PATH=C:\PlatSDK\Bin\Win64\x86\AMD64;C:\PlatSDK\Bin;C:\PlatSDK\Bin\WinNT;C:\Perl64\site\bin;C:\Perl64\bin;C:\cygwin\bin;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\Program Files (x86)\Perforce;C:\mysql\bin Start 2011-04-15T22:37:15 ActivePerl-1003 CPAN-1.9402 LIB=C:\PlatSDK\Lib\AMD64;C:\PlatSDK\Lib\AMD64\atlmfc INCLUDE=C:\PlatSDK\Include;C:\PlatSDK\Include\crt;C:\PlatSDK\Include\crt\sys;C:\PlatSDK\Include\mfc;C:\PlatSDK\Include\atl PATH=C:/cpanfly/var/libs/bin;C:\PlatSDK\Bin\Win64\x86\AMD64;C:\PlatSDK\Bin;C:\PlatSDK\Bin\WinNT;C:\Perl64\site\bin;C:\Perl64\bin;C:\cygwin\bin;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~1\v1.0;C:\PROGRA~2\Perforce;C:\mysql\bin Going to read 'C:\cpanfly\var\cpan\Metadata' Database was generated on Fri, 15 Apr 2011 22:29:42 GMT Running make for C/CJ/CJFIELDS/BioPerl-1.6.900.tar.gz Fetching with LWP: http://cpan.nas.activestate.com/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.900.tar.gz Fetching with LWP: http://cpan.nas.activestate.com/authors/id/C/CJ/CJFIELDS/CHECKSUMS Checksum for C:\cpanfly\var\cpan\sources\authors\id\C\CJ\CJFIELDS\BioPerl-1.6.900.tar.gz ok Will not use Archive::Tar, need 1.00 BioPerl-1.6.900 BioPerl-1.6.900/Build.PL BioPerl-1.6.900/AUTHORS BioPerl-1.6.900/META.json BioPerl-1.6.900/DEPENDENCIES BioPerl-1.6.900/INSTALL.SKIP BioPerl-1.6.900/INSTALL BioPerl-1.6.900/LICENSE BioPerl-1.6.900/README BioPerl-1.6.900/Changes BioPerl-1.6.900/DEPRECATED BioPerl-1.6.900/BioPerl.pm BioPerl-1.6.900/BUGS BioPerl-1.6.900/INSTALL.WIN BioPerl-1.6.900/MANIFEST BioPerl-1.6.900/META.yml BioPerl-1.6.900/maintenance BioPerl-1.6.900/maintenance/check_NAME.pl BioPerl-1.6.900/maintenance/deprecated.pl BioPerl-1.6.900/maintenance/version.pl BioPerl-1.6.900/maintenance/modules.pl BioPerl-1.6.900/maintenance/perltidy.conf BioPerl-1.6.900/maintenance/pod.pl BioPerl-1.6.900/maintenance/README BioPerl-1.6.900/maintenance/module_usage.pl BioPerl-1.6.900/maintenance/ncbi_blast_switches.pl BioPerl-1.6.900/maintenance/dependencies.pl BioPerl-1.6.900/maintenance/authors.pl BioPerl-1.6.900/maintenance/symlink_script.pl BioPerl-1.6.900/maintenance/check_URLs.pl BioPerl-1.6.900/maintenance/cvs2cl_by_file.pl BioPerl-1.6.900/maintenance/find_mod_deps.pl BioPerl-1.6.900/maintenance/big_split BioPerl-1.6.900/maintenance/big_split/file_classification.csv BioPerl-1.6.900/maintenance/big_split/rbuels_notes.txt BioPerl-1.6.900/Bio BioPerl-1.6.900/Bio/AnalysisResultI.pm BioPerl-1.6.900/Bio/IdCollectionI.pm BioPerl-1.6.900/Bio/AnalysisParserI.pm BioPerl-1.6.900/Bio/Seq.pm BioPerl-1.6.900/Bio/AnnotationI.pm BioPerl-1.6.900/Bio/LocationI.pm BioPerl-1.6.900/Bio/PrimarySeq.pm BioPerl-1.6.900/Bio/FeatureHolderI.pm BioPerl-1.6.900/Bio/SearchDist.pm BioPerl-1.6.900/Bio/PhyloNetwork.pm BioPerl-1.6.900/Bio/IdentifiableI.pm BioPerl-1.6.900/Bio/DasI.pm BioPerl-1.6.900/Bio/SimpleAlign.pm BioPerl-1.6.900/Bio/UpdateableSeqI.pm BioPerl-1.6.900/Bio/PullParserI.pm BioPerl-1.6.900/Bio/AnnotationCollectionI.pm BioPerl-1.6.900/Bio/AlignIO.pm BioPerl-1.6.900/Bio/SeqIO.pm BioPerl-1.6.900/Bio/FeatureIO.pm BioPerl-1.6.900/Bio/SeqFeatureI.pm BioPerl-1.6.900/Bio/NexmlIO.pm BioPerl-1.6.900/Bio/Taxonomy.pm BioPerl-1.6.900/Bio/SeqI.pm BioPerl-1.6.900/Bio/PrimarySeqI.pm BioPerl-1.6.900/Bio/Taxon.pm BioPerl-1.6.900/Bio/Range.pm BioPerl-1.6.900/Bio/HandlerBaseI.pm BioPerl-1.6.900/Bio/WebAgent.pm BioPerl-1.6.900/Bio/SeqUtils.pm BioPerl-1.6.900/Bio/DescribableI.pm BioPerl-1.6.900/Bio/Perl.pm BioPerl-1.6.900/Bio/TreeIO.pm BioPerl-1.6.900/Bio/AnalysisI.pm BioPerl-1.6.900/Bio/ClusterI.pm BioPerl-1.6.900/Bio/Biblio.pm BioPerl-1.6.900/Bio/ParameterBaseI.pm BioPerl-1.6.900/Bio/RangeI.pm BioPerl-1.6.900/Bio/DBLinkContainerI.pm BioPerl-1.6.900/Bio/AnnotatableI.pm BioPerl-1.6.900/Bio/OntologyIO.pm BioPerl-1.6.900/Bio/Species.pm BioPerl-1.6.900/Bio/SimpleAnalysisI.pm BioPerl-1.6.900/Bio/SearchIO.pm BioPerl-1.6.900/Bio/MapIO.pm BioPerl-1.6.900/Bio/ClusterIO.pm BioPerl-1.6.900/Bio/SeqAnalysisParserI.pm BioPerl-1.6.900/Bio/LocatableSeq.pm BioPerl-1.6.900/Bio/SeqEvolution BioPerl-1.6.900/Bio/SeqEvolution/EvolutionI.pm BioPerl-1.6.900/Bio/SeqEvolution/Factory.pm BioPerl-1.6.900/Bio/SeqEvolution/DNAPoint.pm BioPerl-1.6.900/Bio/Align BioPerl-1.6.900/Bio/Align/DNAStatistics.pm BioPerl-1.6.900/Bio/Align/StatisticsI.pm BioPerl-1.6.900/Bio/Align/PairwiseStatistics.pm BioPerl-1.6.900/Bio/Align/Utilities.pm BioPerl-1.6.900/Bio/Align/Graphics.pm BioPerl-1.6.900/Bio/Align/AlignI.pm BioPerl-1.6.900/Bio/Align/ProteinStatistics.pm BioPerl-1.6.900/Bio/Factory BioPerl-1.6.900/Bio/Factory/TreeFactoryI.pm BioPerl-1.6.900/Bio/Factory/SequenceStreamI.pm BioPerl-1.6.900/Bio/Factory/ObjectFactory.pm BioPerl-1.6.900/Bio/Factory/FTLocationFactory.pm BioPerl-1.6.900/Bio/Factory/ApplicationFactoryI.pm BioPerl-1.6.900/Bio/Factory/ObjectBuilderI.pm BioPerl-1.6.900/Bio/Factory/SequenceFactoryI.pm BioPerl-1.6.900/Bio/Factory/SeqAnalysisParserFactoryI.pm BioPerl-1.6.900/Bio/Factory/AnalysisI.pm BioPerl-1.6.900/Bio/Factory/SequenceProcessorI.pm BioPerl-1.6.900/Bio/Factory/LocationFactoryI.pm BioPerl-1.6.900/Bio/Factory/MapFactoryI.pm BioPerl-1.6.900/Bio/Factory/SeqAnalysisParserFactory.pm BioPerl-1.6.900/Bio/Factory/DriverFactory.pm BioPerl-1.6.900/Bio/Factory/ObjectFactoryI.pm BioPerl-1.6.900/Bio/Matrix BioPerl-1.6.900/Bio/Matrix/Mlagan.pm BioPerl-1.6.900/Bio/Matrix/MatrixI.pm BioPerl-1.6.900/Bio/Matrix/Generic.pm BioPerl-1.6.900/Bio/Matrix/IO.pm BioPerl-1.6.900/Bio/Matrix/PhylipDist.pm BioPerl-1.6.900/Bio/Matrix/Scoring.pm BioPerl-1.6.900/Bio/Matrix/IO BioPerl-1.6.900/Bio/Matrix/IO/mlagan.pm BioPerl-1.6.900/Bio/Matrix/IO/phylip.pm BioPerl-1.6.900/Bio/Matrix/IO/scoring.pm BioPerl-1.6.900/Bio/Matrix/PSM BioPerl-1.6.900/Bio/Matrix/PSM/PsmHeaderI.pm BioPerl-1.6.900/Bio/Matrix/PSM/SiteMatrix.pm BioPerl-1.6.900/Bio/Matrix/PSM/InstanceSiteI.pm BioPerl-1.6.900/Bio/Matrix/PSM/PsmHeader.pm BioPerl-1.6.900/Bio/Matrix/PSM/SiteMatrixI.pm BioPerl-1.6.900/Bio/Matrix/PSM/PsmI.pm BioPerl-1.6.900/Bio/Matrix/PSM/ProtMatrix.pm BioPerl-1.6.900/Bio/Matrix/PSM/Psm.pm BioPerl-1.6.900/Bio/Matrix/PSM/IO.pm BioPerl-1.6.900/Bio/Matrix/PSM/ProtPsm.pm BioPerl-1.6.900/Bio/Matrix/PSM/InstanceSite.pm BioPerl-1.6.900/Bio/Matrix/PSM/IO BioPerl-1.6.900/Bio/Matrix/PSM/IO/meme.pm BioPerl-1.6.900/Bio/Matrix/PSM/IO/psiblast.pm BioPerl-1.6.900/Bio/Matrix/PSM/IO/masta.pm BioPerl-1.6.900/Bio/Matrix/PSM/IO/mast.pm BioPerl-1.6.900/Bio/Matrix/PSM/IO/transfac.pm BioPerl-1.6.900/Bio/Location BioPerl-1.6.900/Bio/Location/FuzzyLocationI.pm BioPerl-1.6.900/Bio/Location/Split.pm BioPerl-1.6.900/Bio/Location/SplitLocationI.pm BioPerl-1.6.900/Bio/Location/CoordinatePolicyI.pm BioPerl-1.6.900/Bio/Location/Simple.pm BioPerl-1.6.900/Bio/Location/Atomic.pm BioPerl-1.6.900/Bio/Location/Fuzzy.pm BioPerl-1.6.900/Bio/Location/WidestCoordPolicy.pm BioPerl-1.6.900/Bio/Location/AvWithinCoordPolicy.pm BioPerl-1.6.900/Bio/Location/NarrowestCoordPolicy.pm BioPerl-1.6.900/Bio/Annotation BioPerl-1.6.900/Bio/Annotation/Reference.pm BioPerl-1.6.900/Bio/Annotation/Relation.pm BioPerl-1.6.900/Bio/Annotation/SimpleValue.pm BioPerl-1.6.900/Bio/Annotation/Collection.pm BioPerl-1.6.900/Bio/Annotation/Tree.pm BioPerl-1.6.900/Bio/Annotation/DBLink.pm BioPerl-1.6.900/Bio/Annotation/Comment.pm BioPerl-1.6.900/Bio/Annotation/TagTree.pm BioPerl-1.6.900/Bio/Annotation/OntologyTerm.pm BioPerl-1.6.900/Bio/Annotation/StructuredValue.pm BioPerl-1.6.900/Bio/Annotation/TypeManager.pm BioPerl-1.6.900/Bio/Annotation/Target.pm BioPerl-1.6.900/Bio/Annotation/AnnotationFactory.pm BioPerl-1.6.900/Bio/Tools BioPerl-1.6.900/Bio/Tools/SeqPattern.pm BioPerl-1.6.900/Bio/Tools/ipcress.pm BioPerl-1.6.900/Bio/Tools/RandomDistFunctions.pm BioPerl-1.6.900/Bio/Tools/IUPAC.pm BioPerl-1.6.900/Bio/Tools/Blat.pm BioPerl-1.6.900/Bio/Tools/Genewise.pm BioPerl-1.6.900/Bio/Tools/EUtilities.pm BioPerl-1.6.900/Bio/Tools/AlignFactory.pm BioPerl-1.6.900/Bio/Tools/FootPrinter.pm BioPerl-1.6.900/Bio/Tools/Fgenesh.pm BioPerl-1.6.900/Bio/Tools/Coil.pm BioPerl-1.6.900/Bio/Tools/QRNA.pm BioPerl-1.6.900/Bio/Tools/Est2Genome.pm BioPerl-1.6.900/Bio/Tools/tRNAscanSE.pm BioPerl-1.6.900/Bio/Tools/Prints.pm BioPerl-1.6.900/Bio/Tools/Genemark.pm BioPerl-1.6.900/Bio/Tools/GuessSeqFormat.pm BioPerl-1.6.900/Bio/Tools/Lucy.pm BioPerl-1.6.900/Bio/Tools/dpAlign.pm BioPerl-1.6.900/Bio/Tools/Hmmpfam.pm BioPerl-1.6.900/Bio/Tools/Sigcleave.pm BioPerl-1.6.900/Bio/Tools/MZEF.pm BioPerl-1.6.900/Bio/Tools/ERPIN.pm BioPerl-1.6.900/Bio/Tools/AnalysisResult.pm BioPerl-1.6.900/Bio/Tools/ESTScan.pm BioPerl-1.6.900/Bio/Tools/Primer3.pm BioPerl-1.6.900/Bio/Tools/ECnumber.pm BioPerl-1.6.900/Bio/Tools/RNAMotif.pm BioPerl-1.6.900/Bio/Tools/Protparam.pm BioPerl-1.6.900/Bio/Tools/pICalculator.pm BioPerl-1.6.900/Bio/Tools/Eponine.pm BioPerl-1.6.900/Bio/Tools/EPCR.pm BioPerl-1.6.900/Bio/Tools/Profile.pm BioPerl-1.6.900/Bio/Tools/Glimmer.pm BioPerl-1.6.900/Bio/Tools/Grail.pm BioPerl-1.6.900/Bio/Tools/Genomewise.pm BioPerl-1.6.900/Bio/Tools/Geneid.pm BioPerl-1.6.900/Bio/Tools/Seg.pm BioPerl-1.6.900/Bio/Tools/TandemRepeatsFinder.pm BioPerl-1.6.900/Bio/Tools/Genscan.pm BioPerl-1.6.900/Bio/Tools/OddCodes.pm BioPerl-1.6.900/Bio/Tools/isPcr.pm BioPerl-1.6.900/Bio/Tools/SiRNA.pm BioPerl-1.6.900/Bio/Tools/Match.pm BioPerl-1.6.900/Bio/Tools/Infernal.pm BioPerl-1.6.900/Bio/Tools/SeqWords.pm BioPerl-1.6.900/Bio/Tools/RepeatMasker.pm BioPerl-1.6.900/Bio/Tools/pSW.pm BioPerl-1.6.900/Bio/Tools/Signalp.pm BioPerl-1.6.900/Bio/Tools/Promoterwise.pm BioPerl-1.6.900/Bio/Tools/PrositeScan.pm BioPerl-1.6.900/Bio/Tools/CodonTable.pm BioPerl-1.6.900/Bio/Tools/Tmhmm.pm BioPerl-1.6.900/Bio/Tools/TargetP.pm BioPerl-1.6.900/Bio/Tools/SeqStats.pm BioPerl-1.6.900/Bio/Tools/Pseudowise.pm BioPerl-1.6.900/Bio/Tools/GFF.pm BioPerl-1.6.900/Bio/Tools/Gel.pm BioPerl-1.6.900/Bio/Tools/Primer BioPerl-1.6.900/Bio/Tools/Primer/Pair.pm BioPerl-1.6.900/Bio/Tools/Primer/AssessorI.pm BioPerl-1.6.900/Bio/Tools/Primer/Feature.pm BioPerl-1.6.900/Bio/Tools/Primer/Assessor BioPerl-1.6.900/Bio/Tools/Primer/Assessor/Base.pm BioPerl-1.6.900/Bio/Tools/Signalp BioPerl-1.6.900/Bio/Tools/Signalp/ExtendedSignalp.pm BioPerl-1.6.900/Bio/Tools/SiRNA BioPerl-1.6.900/Bio/Tools/SiRNA/Ruleset BioPerl-1.6.900/Bio/Tools/SiRNA/Ruleset/tuschl.pm BioPerl-1.6.900/Bio/Tools/SiRNA/Ruleset/saigo.pm BioPerl-1.6.900/Bio/Tools/Prediction BioPerl-1.6.900/Bio/Tools/Prediction/Exon.pm BioPerl-1.6.900/Bio/Tools/Prediction/Gene.pm BioPerl-1.6.900/Bio/Tools/Run BioPerl-1.6.900/Bio/Tools/Run/RemoteBlast.pm BioPerl-1.6.900/Bio/Tools/Run/StandAloneBlast.pm BioPerl-1.6.900/Bio/Tools/Run/hmmer3.pm BioPerl-1.6.900/Bio/Tools/Run/StandAloneNCBIBlast.pm BioPerl-1.6.900/Bio/Tools/Run/WrapperBase.pm BioPerl-1.6.900/Bio/Tools/Run/GenericParameters.pm BioPerl-1.6.900/Bio/Tools/Run/README BioPerl-1.6.900/Bio/Tools/Run/ParametersI.pm BioPerl-1.6.900/Bio/Tools/Run/StandAloneWUBlast.pm BioPerl-1.6.900/Bio/Tools/Run/WrapperBase BioPerl-1.6.900/Bio/Tools/Run/WrapperBase/CommandExts.pm BioPerl-1.6.900/Bio/Tools/Analysis BioPerl-1.6.900/Bio/Tools/Analysis/SimpleAnalysisBase.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein BioPerl-1.6.900/Bio/Tools/Analysis/Protein/Sopma.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/NetPhos.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/GOR4.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/HNN.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/Scansite.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/Mitoprot.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/Domcut.pm BioPerl-1.6.900/Bio/Tools/Analysis/Protein/ELM.pm BioPerl-1.6.900/Bio/Tools/Analysis/DNA BioPerl-1.6.900/Bio/Tools/Analysis/DNA/ESEfinder.pm BioPerl-1.6.900/Bio/Tools/Sim4 BioPerl-1.6.900/Bio/Tools/Sim4/Results.pm BioPerl-1.6.900/Bio/Tools/Sim4/Exon.pm BioPerl-1.6.900/Bio/Tools/HMMER BioPerl-1.6.900/Bio/Tools/HMMER/Results.pm BioPerl-1.6.900/Bio/Tools/HMMER/Set.pm BioPerl-1.6.900/Bio/Tools/HMMER/Domain.pm BioPerl-1.6.900/Bio/Tools/SeqPattern BioPerl-1.6.900/Bio/Tools/SeqPattern/Backtranslate.pm BioPerl-1.6.900/Bio/Tools/Alignment BioPerl-1.6.900/Bio/Tools/Alignment/Consed.pm BioPerl-1.6.900/Bio/Tools/Alignment/Trim.pm BioPerl-1.6.900/Bio/Tools/EMBOSS BioPerl-1.6.900/Bio/Tools/EMBOSS/Palindrome.pm BioPerl-1.6.900/Bio/Tools/EUtilities BioPerl-1.6.900/Bio/Tools/EUtilities/EUtilParameters.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Summary.pm BioPerl-1.6.900/Bio/Tools/EUtilities/HistoryI.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Info.pm BioPerl-1.6.900/Bio/Tools/EUtilities/History.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Link.pm BioPerl-1.6.900/Bio/Tools/EUtilities/EUtilDataI.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Query.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Query BioPerl-1.6.900/Bio/Tools/EUtilities/Query/GlobalQuery.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Summary BioPerl-1.6.900/Bio/Tools/EUtilities/Summary/ItemContainerI.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Summary/DocSum.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Summary/Item.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Link BioPerl-1.6.900/Bio/Tools/EUtilities/Link/UrlLink.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Link/LinkSet.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Info BioPerl-1.6.900/Bio/Tools/EUtilities/Info/FieldInfo.pm BioPerl-1.6.900/Bio/Tools/EUtilities/Info/LinkInfo.pm BioPerl-1.6.900/Bio/Tools/Spidey BioPerl-1.6.900/Bio/Tools/Spidey/Results.pm BioPerl-1.6.900/Bio/Tools/Spidey/Exon.pm BioPerl-1.6.900/Bio/Tools/Phylo BioPerl-1.6.900/Bio/Tools/Phylo/Gumby.pm BioPerl-1.6.900/Bio/Tools/Phylo/Molphy.pm BioPerl-1.6.900/Bio/Tools/Phylo/Gerp.pm BioPerl-1.6.900/Bio/Tools/Phylo/PAML.pm BioPerl-1.6.900/Bio/Tools/Phylo/Molphy BioPerl-1.6.900/Bio/Tools/Phylo/Molphy/Result.pm BioPerl-1.6.900/Bio/Tools/Phylo/Phylip BioPerl-1.6.900/Bio/Tools/Phylo/Phylip/ProtDist.pm BioPerl-1.6.900/Bio/Tools/Phylo/PAML BioPerl-1.6.900/Bio/Tools/Phylo/PAML/Codeml.pm BioPerl-1.6.900/Bio/Tools/Phylo/PAML/Result.pm BioPerl-1.6.900/Bio/Tools/Phylo/PAML/ModelResult.pm BioPerl-1.6.900/Bio/Cluster BioPerl-1.6.900/Bio/Cluster/ClusterFactory.pm BioPerl-1.6.900/Bio/Cluster/FamilyI.pm BioPerl-1.6.900/Bio/Cluster/SequenceFamily.pm BioPerl-1.6.900/Bio/Cluster/UniGene.pm BioPerl-1.6.900/Bio/Cluster/UniGeneI.pm BioPerl-1.6.900/Bio/Seq BioPerl-1.6.900/Bio/Seq/Quality.pm BioPerl-1.6.900/Bio/Seq/RichSeqI.pm BioPerl-1.6.900/Bio/Seq/SeqFactory.pm BioPerl-1.6.900/Bio/Seq/MetaI.pm BioPerl-1.6.900/Bio/Seq/QualI.pm BioPerl-1.6.900/Bio/Seq/EncodedSeq.pm BioPerl-1.6.900/Bio/Seq/Meta.pm BioPerl-1.6.900/Bio/Seq/RichSeq.pm BioPerl-1.6.900/Bio/Seq/LargePrimarySeq.pm BioPerl-1.6.900/Bio/Seq/SeqBuilder.pm BioPerl-1.6.900/Bio/Seq/LargeLocatableSeq.pm BioPerl-1.6.900/Bio/Seq/BaseSeqProcessor.pm BioPerl-1.6.900/Bio/Seq/SeqWithQuality.pm BioPerl-1.6.900/Bio/Seq/PrimedSeq.pm BioPerl-1.6.900/Bio/Seq/TraceI.pm BioPerl-1.6.900/Bio/Seq/PrimaryQual.pm BioPerl-1.6.900/Bio/Seq/LargeSeq.pm BioPerl-1.6.900/Bio/Seq/LargeSeqI.pm BioPerl-1.6.900/Bio/Seq/SeqFastaSpeedFactory.pm BioPerl-1.6.900/Bio/Seq/SequenceTrace.pm BioPerl-1.6.900/Bio/Seq/Meta BioPerl-1.6.900/Bio/Seq/Meta/Array.pm BioPerl-1.6.900/Bio/Index BioPerl-1.6.900/Bio/Index/SwissPfam.pm BioPerl-1.6.900/Bio/Index/Hmmer.pm BioPerl-1.6.900/Bio/Index/GenBank.pm BioPerl-1.6.900/Bio/Index/Blast.pm BioPerl-1.6.900/Bio/Index/AbstractSeq.pm BioPerl-1.6.900/Bio/Index/Fasta.pm BioPerl-1.6.900/Bio/Index/Qual.pm BioPerl-1.6.900/Bio/Index/Abstract.pm BioPerl-1.6.900/Bio/Index/Fastq.pm BioPerl-1.6.900/Bio/Index/EMBL.pm BioPerl-1.6.900/Bio/Index/Stockholm.pm BioPerl-1.6.900/Bio/Index/Swissprot.pm BioPerl-1.6.900/Bio/Index/BlastTable.pm BioPerl-1.6.900/Bio/CodonUsage BioPerl-1.6.900/Bio/CodonUsage/Table.pm BioPerl-1.6.900/Bio/CodonUsage/IO.pm BioPerl-1.6.900/Bio/Phenotype BioPerl-1.6.900/Bio/Phenotype/Correlate.pm BioPerl-1.6.900/Bio/Phenotype/Phenotype.pm BioPerl-1.6.900/Bio/Phenotype/PhenotypeI.pm BioPerl-1.6.900/Bio/Phenotype/Measure.pm BioPerl-1.6.900/Bio/Phenotype/MeSH BioPerl-1.6.900/Bio/Phenotype/MeSH/Term.pm BioPerl-1.6.900/Bio/Phenotype/MeSH/Twig.pm BioPerl-1.6.900/Bio/Phenotype/OMIM BioPerl-1.6.900/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm BioPerl-1.6.900/Bio/Phenotype/OMIM/OMIMparser.pm BioPerl-1.6.900/Bio/Phenotype/OMIM/MiniMIMentry.pm BioPerl-1.6.900/Bio/Phenotype/OMIM/OMIMentry.pm BioPerl-1.6.900/Bio/Root BioPerl-1.6.900/Bio/Root/Build.pm BioPerl-1.6.900/Bio/Root/Version.pm BioPerl-1.6.900/Bio/Root/RootI.pm BioPerl-1.6.900/Bio/Root/Utilities.pm BioPerl-1.6.900/Bio/Root/Exception.pm BioPerl-1.6.900/Bio/Root/Test.pm BioPerl-1.6.900/Bio/Root/Root.pm BioPerl-1.6.900/Bio/Root/IO.pm BioPerl-1.6.900/Bio/Root/HTTPget.pm BioPerl-1.6.900/Bio/Root/Storable.pm BioPerl-1.6.900/Bio/Root/Test BioPerl-1.6.900/Bio/Root/Test/Warn.pm BioPerl-1.6.900/Bio/DB BioPerl-1.6.900/Bio/DB/CUTG.pm BioPerl-1.6.900/Bio/DB/DBFetch.pm BioPerl-1.6.900/Bio/DB/LocationI.pm BioPerl-1.6.900/Bio/DB/EUtilities.pm BioPerl-1.6.900/Bio/DB/FileCache.pm BioPerl-1.6.900/Bio/DB/GenBank.pm BioPerl-1.6.900/Bio/DB/SwissProt.pm BioPerl-1.6.900/Bio/DB/Flat.pm BioPerl-1.6.900/Bio/DB/UpdateableSeqI.pm BioPerl-1.6.900/Bio/DB/InMemoryCache.pm BioPerl-1.6.900/Bio/DB/HIV.pm BioPerl-1.6.900/Bio/DB/BioFetch.pm BioPerl-1.6.900/Bio/DB/BiblioI.pm BioPerl-1.6.900/Bio/DB/Expression.pm BioPerl-1.6.900/Bio/DB/NCBIHelper.pm BioPerl-1.6.900/Bio/DB/GenericWebAgent.pm BioPerl-1.6.900/Bio/DB/WebDBSeqI.pm BioPerl-1.6.900/Bio/DB/SeqFeature.pm BioPerl-1.6.900/Bio/DB/Taxonomy.pm BioPerl-1.6.900/Bio/DB/SeqI.pm BioPerl-1.6.900/Bio/DB/GenPept.pm BioPerl-1.6.900/Bio/DB/Fasta.pm BioPerl-1.6.900/Bio/DB/SeqVersion.pm BioPerl-1.6.900/Bio/DB/Qual.pm BioPerl-1.6.900/Bio/DB/RandomAccessI.pm BioPerl-1.6.900/Bio/DB/MeSH.pm BioPerl-1.6.900/Bio/DB/TFBS.pm BioPerl-1.6.900/Bio/DB/EMBL.pm BioPerl-1.6.900/Bio/DB/Failover.pm BioPerl-1.6.900/Bio/DB/Universal.pm BioPerl-1.6.900/Bio/DB/EntrezGene.pm BioPerl-1.6.900/Bio/DB/SeqHound.pm BioPerl-1.6.900/Bio/DB/QueryI.pm BioPerl-1.6.900/Bio/DB/RefSeq.pm BioPerl-1.6.900/Bio/DB/Registry.pm BioPerl-1.6.900/Bio/DB/Ace.pm BioPerl-1.6.900/Bio/DB/GFF.pm BioPerl-1.6.900/Bio/DB/ReferenceI.pm BioPerl-1.6.900/Bio/DB/Flat BioPerl-1.6.900/Bio/DB/Flat/BDB.pm BioPerl-1.6.900/Bio/DB/Flat/BinarySearch.pm BioPerl-1.6.900/Bio/DB/Flat/BDB BioPerl-1.6.900/Bio/DB/Flat/BDB/embl.pm BioPerl-1.6.900/Bio/DB/Flat/BDB/genbank.pm BioPerl-1.6.900/Bio/DB/Flat/BDB/swiss.pm BioPerl-1.6.900/Bio/DB/Flat/BDB/fasta.pm BioPerl-1.6.900/Bio/DB/HIV BioPerl-1.6.900/Bio/DB/HIV/lanl-schema.xml BioPerl-1.6.900/Bio/DB/HIV/HIVQueryHelper.pm BioPerl-1.6.900/Bio/DB/HIV/HIVAnnotProcessor.pm BioPerl-1.6.900/Bio/DB/Query BioPerl-1.6.900/Bio/DB/Query/GenBank.pm BioPerl-1.6.900/Bio/DB/Query/WebQuery.pm BioPerl-1.6.900/Bio/DB/Query/HIVQuery.pm BioPerl-1.6.900/Bio/DB/Expression BioPerl-1.6.900/Bio/DB/Expression/geo.pm BioPerl-1.6.900/Bio/DB/GFF BioPerl-1.6.900/Bio/DB/GFF/Aggregator.pm BioPerl-1.6.900/Bio/DB/GFF/Featname.pm BioPerl-1.6.900/Bio/DB/GFF/Segment.pm BioPerl-1.6.900/Bio/DB/GFF/Typename.pm BioPerl-1.6.900/Bio/DB/GFF/RelSegment.pm BioPerl-1.6.900/Bio/DB/GFF/Homol.pm BioPerl-1.6.900/Bio/DB/GFF/Feature.pm BioPerl-1.6.900/Bio/DB/GFF/Util BioPerl-1.6.900/Bio/DB/GFF/Util/Binning.pm BioPerl-1.6.900/Bio/DB/GFF/Util/Rearrange.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator BioPerl-1.6.900/Bio/DB/GFF/Aggregator/coding.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/gene.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_acembly.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_refgene.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/match.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/processed_transcript.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_genscan.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/clone.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/none.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/alignment.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_softberry.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_unigene.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/orf.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/so_transcript.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/transcript.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm BioPerl-1.6.900/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor BioPerl-1.6.900/Bio/DB/GFF/Adaptor/berkeleydb.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/ace.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/biofetch_oracle.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/memory.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/biofetch.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/berkeleydb BioPerl-1.6.900/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/memory BioPerl-1.6.900/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/memory/iterator.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/oracleace.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/oracle.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/iterator.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/pg.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/mysql.pm BioPerl-1.6.900/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm BioPerl-1.6.900/Bio/DB/SeqFeature BioPerl-1.6.900/Bio/DB/SeqFeature/NormalizedFeature.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Segment.pm BioPerl-1.6.900/Bio/DB/SeqFeature/NormalizedFeatureI.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store.pm BioPerl-1.6.900/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store BioPerl-1.6.900/Bio/DB/SeqFeature/Store/berkeleydb.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/GFF3Loader.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/GFF2Loader.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/LoadHelper.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/berkeleydb3.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/Loader.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/bdb.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/memory.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/DBI BioPerl-1.6.900/Bio/DB/SeqFeature/Store/DBI/Pg.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/DBI/Iterator.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/DBI/SQLite.pm BioPerl-1.6.900/Bio/DB/SeqFeature/Store/DBI/mysql.pm BioPerl-1.6.900/Bio/DB/TFBS BioPerl-1.6.900/Bio/DB/TFBS/transfac_pro.pm BioPerl-1.6.900/Bio/DB/Taxonomy BioPerl-1.6.900/Bio/DB/Taxonomy/entrez.pm BioPerl-1.6.900/Bio/DB/Taxonomy/list.pm BioPerl-1.6.900/Bio/DB/Taxonomy/flatfile.pm BioPerl-1.6.900/Bio/DB/Biblio BioPerl-1.6.900/Bio/DB/Biblio/soap.pm BioPerl-1.6.900/Bio/DB/Biblio/eutils.pm BioPerl-1.6.900/Bio/DB/Biblio/biofetch.pm BioPerl-1.6.900/Bio/DB/SeqVersion BioPerl-1.6.900/Bio/DB/SeqVersion/gi.pm BioPerl-1.6.900/Bio/PopGen BioPerl-1.6.900/Bio/PopGen/Utilities.pm BioPerl-1.6.900/Bio/PopGen/Genotype.pm BioPerl-1.6.900/Bio/PopGen/PopStats.pm BioPerl-1.6.900/Bio/PopGen/PopulationI.pm BioPerl-1.6.900/Bio/PopGen/IndividualI.pm BioPerl-1.6.900/Bio/PopGen/Population.pm BioPerl-1.6.900/Bio/PopGen/MarkerI.pm BioPerl-1.6.900/Bio/PopGen/TagHaplotype.pm BioPerl-1.6.900/Bio/PopGen/HtSNP.pm BioPerl-1.6.900/Bio/PopGen/Statistics.pm BioPerl-1.6.900/Bio/PopGen/IO.pm BioPerl-1.6.900/Bio/PopGen/GenotypeI.pm BioPerl-1.6.900/Bio/PopGen/Marker.pm BioPerl-1.6.900/Bio/PopGen/Individual.pm BioPerl-1.6.900/Bio/PopGen/IO BioPerl-1.6.900/Bio/PopGen/IO/hapmap.pm BioPerl-1.6.900/Bio/PopGen/IO/prettybase.pm BioPerl-1.6.900/Bio/PopGen/IO/phase.pm BioPerl-1.6.900/Bio/PopGen/IO/csv.pm BioPerl-1.6.900/Bio/PopGen/Simulation BioPerl-1.6.900/Bio/PopGen/Simulation/GeneticDrift.pm BioPerl-1.6.900/Bio/PopGen/Simulation/Coalescent.pm BioPerl-1.6.900/Bio/LiveSeq BioPerl-1.6.900/Bio/LiveSeq/Chain.pm BioPerl-1.6.900/Bio/LiveSeq/Repeat_Unit.pm BioPerl-1.6.900/Bio/LiveSeq/ChainI.pm BioPerl-1.6.900/Bio/LiveSeq/Prim_Transcript.pm BioPerl-1.6.900/Bio/LiveSeq/SeqI.pm BioPerl-1.6.900/Bio/LiveSeq/Range.pm BioPerl-1.6.900/Bio/LiveSeq/Translation.pm BioPerl-1.6.900/Bio/LiveSeq/Mutation.pm BioPerl-1.6.900/Bio/LiveSeq/Repeat_Region.pm BioPerl-1.6.900/Bio/LiveSeq/Intron.pm BioPerl-1.6.900/Bio/LiveSeq/AARange.pm BioPerl-1.6.900/Bio/LiveSeq/DNA.pm BioPerl-1.6.900/Bio/LiveSeq/Exon.pm BioPerl-1.6.900/Bio/LiveSeq/Transcript.pm BioPerl-1.6.900/Bio/LiveSeq/Gene.pm BioPerl-1.6.900/Bio/LiveSeq/Mutator.pm BioPerl-1.6.900/Bio/LiveSeq/IO BioPerl-1.6.900/Bio/LiveSeq/IO/README BioPerl-1.6.900/Bio/LiveSeq/IO/Loader.pm BioPerl-1.6.900/Bio/LiveSeq/IO/BioPerl.pm BioPerl-1.6.900/Bio/SearchIO BioPerl-1.6.900/Bio/SearchIO/EventHandlerI.pm BioPerl-1.6.900/Bio/SearchIO/SearchWriterI.pm BioPerl-1.6.900/Bio/SearchIO/infernal.pm BioPerl-1.6.900/Bio/SearchIO/megablast.pm BioPerl-1.6.900/Bio/SearchIO/hmmer3.pm BioPerl-1.6.900/Bio/SearchIO/SearchResultEventBuilder.pm BioPerl-1.6.900/Bio/SearchIO/hmmer.pm BioPerl-1.6.900/Bio/SearchIO/axt.pm BioPerl-1.6.900/Bio/SearchIO/erpin.pm BioPerl-1.6.900/Bio/SearchIO/waba.pm BioPerl-1.6.900/Bio/SearchIO/rnamotif.pm BioPerl-1.6.900/Bio/SearchIO/exonerate.pm BioPerl-1.6.900/Bio/SearchIO/sim4.pm BioPerl-1.6.900/Bio/SearchIO/blasttable.pm BioPerl-1.6.900/Bio/SearchIO/psl.pm BioPerl-1.6.900/Bio/SearchIO/gmap_f9.pm BioPerl-1.6.900/Bio/SearchIO/FastHitEventBuilder.pm BioPerl-1.6.900/Bio/SearchIO/cross_match.pm BioPerl-1.6.900/Bio/SearchIO/blast.pm BioPerl-1.6.900/Bio/SearchIO/hmmer2.pm BioPerl-1.6.900/Bio/SearchIO/blastxml.pm BioPerl-1.6.900/Bio/SearchIO/hmmer_pull.pm BioPerl-1.6.900/Bio/SearchIO/IteratedSearchResultEventBuilder.pm BioPerl-1.6.900/Bio/SearchIO/fasta.pm BioPerl-1.6.900/Bio/SearchIO/wise.pm BioPerl-1.6.900/Bio/SearchIO/blast_pull.pm BioPerl-1.6.900/Bio/SearchIO/Writer BioPerl-1.6.900/Bio/SearchIO/Writer/GbrowseGFF.pm BioPerl-1.6.900/Bio/SearchIO/Writer/ResultTableWriter.pm BioPerl-1.6.900/Bio/SearchIO/Writer/HitTableWriter.pm BioPerl-1.6.900/Bio/SearchIO/Writer/TextResultWriter.pm BioPerl-1.6.900/Bio/SearchIO/Writer/HTMLResultWriter.pm BioPerl-1.6.900/Bio/SearchIO/Writer/BSMLResultWriter.pm BioPerl-1.6.900/Bio/SearchIO/Writer/HSPTableWriter.pm BioPerl-1.6.900/Bio/SearchIO/XML BioPerl-1.6.900/Bio/SearchIO/XML/BlastHandler.pm BioPerl-1.6.900/Bio/SearchIO/XML/PsiBlastHandler.pm BioPerl-1.6.900/Bio/Structure BioPerl-1.6.900/Bio/Structure/Residue.pm BioPerl-1.6.900/Bio/Structure/Chain.pm BioPerl-1.6.900/Bio/Structure/Entry.pm BioPerl-1.6.900/Bio/Structure/Atom.pm BioPerl-1.6.900/Bio/Structure/Model.pm BioPerl-1.6.900/Bio/Structure/IO.pm BioPerl-1.6.900/Bio/Structure/StructureI.pm BioPerl-1.6.900/Bio/Structure/IO BioPerl-1.6.900/Bio/Structure/IO/pdb.pm BioPerl-1.6.900/Bio/Structure/SecStr BioPerl-1.6.900/Bio/Structure/SecStr/STRIDE BioPerl-1.6.900/Bio/Structure/SecStr/STRIDE/Res.pm BioPerl-1.6.900/Bio/Structure/SecStr/DSSP BioPerl-1.6.900/Bio/Structure/SecStr/DSSP/Res.pm BioPerl-1.6.900/Bio/SeqFeature BioPerl-1.6.900/Bio/SeqFeature/Computation.pm BioPerl-1.6.900/Bio/SeqFeature/AnnotationAdaptor.pm BioPerl-1.6.900/Bio/SeqFeature/Annotated.pm BioPerl-1.6.900/Bio/SeqFeature/TypedSeqFeatureI.pm BioPerl-1.6.900/Bio/SeqFeature/Collection.pm BioPerl-1.6.900/Bio/SeqFeature/FeaturePair.pm BioPerl-1.6.900/Bio/SeqFeature/CollectionI.pm BioPerl-1.6.900/Bio/SeqFeature/Generic.pm BioPerl-1.6.900/Bio/SeqFeature/PositionProxy.pm BioPerl-1.6.900/Bio/SeqFeature/Primer.pm BioPerl-1.6.900/Bio/SeqFeature/Lite.pm BioPerl-1.6.900/Bio/SeqFeature/SimilarityPair.pm BioPerl-1.6.900/Bio/SeqFeature/Similarity.pm BioPerl-1.6.900/Bio/SeqFeature/SiRNA BioPerl-1.6.900/Bio/SeqFeature/SiRNA/Pair.pm BioPerl-1.6.900/Bio/SeqFeature/SiRNA/Oligo.pm BioPerl-1.6.900/Bio/SeqFeature/Tools BioPerl-1.6.900/Bio/SeqFeature/Tools/FeatureNamer.pm BioPerl-1.6.900/Bio/SeqFeature/Tools/IDHandler.pm BioPerl-1.6.900/Bio/SeqFeature/Tools/Unflattener.pm BioPerl-1.6.900/Bio/SeqFeature/Tools/TypeMapper.pm BioPerl-1.6.900/Bio/SeqFeature/Gene BioPerl-1.6.900/Bio/SeqFeature/Gene/GeneStructure.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/UTR.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/Poly_A_site.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/Intron.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/Exon.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/Transcript.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/Promoter.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/ExonI.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/NC_Feature.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/GeneStructureI.pm BioPerl-1.6.900/Bio/SeqFeature/Gene/TranscriptI.pm BioPerl-1.6.900/Bio/Event BioPerl-1.6.900/Bio/Event/EventHandlerI.pm BioPerl-1.6.900/Bio/Event/EventGeneratorI.pm BioPerl-1.6.900/Bio/Taxonomy BioPerl-1.6.900/Bio/Taxonomy/Tree.pm BioPerl-1.6.900/Bio/Taxonomy/Taxon.pm BioPerl-1.6.900/Bio/Taxonomy/Node.pm BioPerl-1.6.900/Bio/Taxonomy/FactoryI.pm BioPerl-1.6.900/Bio/Assembly BioPerl-1.6.900/Bio/Assembly/Singlet.pm BioPerl-1.6.900/Bio/Assembly/Scaffold.pm BioPerl-1.6.900/Bio/Assembly/ScaffoldI.pm BioPerl-1.6.900/Bio/Assembly/IO.pm BioPerl-1.6.900/Bio/Assembly/Contig.pm BioPerl-1.6.900/Bio/Assembly/ContigAnalysis.pm BioPerl-1.6.900/Bio/Assembly/IO BioPerl-1.6.900/Bio/Assembly/IO/bowtie.pm BioPerl-1.6.900/Bio/Assembly/IO/tigr.pm BioPerl-1.6.900/Bio/Assembly/IO/maq.pm BioPerl-1.6.900/Bio/Assembly/IO/ace.pm BioPerl-1.6.900/Bio/Assembly/IO/phrap.pm BioPerl-1.6.900/Bio/Assembly/IO/sam.pm BioPerl-1.6.900/Bio/Assembly/Tools BioPerl-1.6.900/Bio/Assembly/Tools/ContigSpectrum.pm BioPerl-1.6.900/Bio/Das BioPerl-1.6.900/Bio/Das/SegmentI.pm BioPerl-1.6.900/Bio/Das/FeatureTypeI.pm BioPerl-1.6.900/Bio/ClusterIO BioPerl-1.6.900/Bio/ClusterIO/dbsnp.pm BioPerl-1.6.900/Bio/ClusterIO/unigene.pm BioPerl-1.6.900/Bio/Tree BioPerl-1.6.900/Bio/Tree/Compatible.pm BioPerl-1.6.900/Bio/Tree/TreeI.pm BioPerl-1.6.900/Bio/Tree/DistanceFactory.pm BioPerl-1.6.900/Bio/Tree/Tree.pm BioPerl-1.6.900/Bio/Tree/NodeI.pm BioPerl-1.6.900/Bio/Tree/TreeFunctionsI.pm BioPerl-1.6.900/Bio/Tree/Statistics.pm BioPerl-1.6.900/Bio/Tree/AnnotatableNode.pm BioPerl-1.6.900/Bio/Tree/NodeNHX.pm BioPerl-1.6.900/Bio/Tree/AlleleNode.pm BioPerl-1.6.900/Bio/Tree/Node.pm BioPerl-1.6.900/Bio/Tree/RandomFactory.pm BioPerl-1.6.900/Bio/Tree/Draw BioPerl-1.6.900/Bio/Tree/Draw/Cladogram.pm BioPerl-1.6.900/Bio/Search BioPerl-1.6.900/Bio/Search/StatisticsI.pm BioPerl-1.6.900/Bio/Search/GenericDatabase.pm BioPerl-1.6.900/Bio/Search/GenericStatistics.pm BioPerl-1.6.900/Bio/Search/SearchUtils.pm BioPerl-1.6.900/Bio/Search/Processor.pm BioPerl-1.6.900/Bio/Search/DatabaseI.pm BioPerl-1.6.900/Bio/Search/BlastStatistics.pm BioPerl-1.6.900/Bio/Search/BlastUtils.pm BioPerl-1.6.900/Bio/Search/Tiling BioPerl-1.6.900/Bio/Search/Tiling/MapTileUtils.pm BioPerl-1.6.900/Bio/Search/Tiling/TilingI.pm BioPerl-1.6.900/Bio/Search/Tiling/MapTiling.pm BioPerl-1.6.900/Bio/Search/Result BioPerl-1.6.900/Bio/Search/Result/CrossMatchResult.pm BioPerl-1.6.900/Bio/Search/Result/BlastPullResult.pm BioPerl-1.6.900/Bio/Search/Result/HmmpfamResult.pm BioPerl-1.6.900/Bio/Search/Result/ResultI.pm BioPerl-1.6.900/Bio/Search/Result/PullResultI.pm BioPerl-1.6.900/Bio/Search/Result/ResultFactory.pm BioPerl-1.6.900/Bio/Search/Result/GenericResult.pm BioPerl-1.6.900/Bio/Search/Result/WABAResult.pm BioPerl-1.6.900/Bio/Search/Result/hmmer3Result.pm BioPerl-1.6.900/Bio/Search/Result/HMMERResult.pm BioPerl-1.6.900/Bio/Search/Result/BlastResult.pm BioPerl-1.6.900/Bio/Search/Hit BioPerl-1.6.900/Bio/Search/Hit/HmmpfamHit.pm BioPerl-1.6.900/Bio/Search/Hit/GenericHit.pm BioPerl-1.6.900/Bio/Search/Hit/HitFactory.pm BioPerl-1.6.900/Bio/Search/Hit/PsiBlastHit.pm BioPerl-1.6.900/Bio/Search/Hit/PullHitI.pm BioPerl-1.6.900/Bio/Search/Hit/HMMERHit.pm BioPerl-1.6.900/Bio/Search/Hit/HitI.pm BioPerl-1.6.900/Bio/Search/Hit/BlastPullHit.pm BioPerl-1.6.900/Bio/Search/Hit/Fasta.pm BioPerl-1.6.900/Bio/Search/Hit/hmmer3Hit.pm BioPerl-1.6.900/Bio/Search/Hit/ModelHit.pm BioPerl-1.6.900/Bio/Search/Hit/BlastHit.pm BioPerl-1.6.900/Bio/Search/Iteration BioPerl-1.6.900/Bio/Search/Iteration/GenericIteration.pm BioPerl-1.6.900/Bio/Search/Iteration/IterationI.pm BioPerl-1.6.900/Bio/Search/HSP BioPerl-1.6.900/Bio/Search/HSP/BlastPullHSP.pm BioPerl-1.6.900/Bio/Search/HSP/PsiBlastHSP.pm BioPerl-1.6.900/Bio/Search/HSP/hmmer3HSP.pm BioPerl-1.6.900/Bio/Search/HSP/ModelHSP.pm BioPerl-1.6.900/Bio/Search/HSP/FastaHSP.pm BioPerl-1.6.900/Bio/Search/HSP/HmmpfamHSP.pm BioPerl-1.6.900/Bio/Search/HSP/PSLHSP.pm BioPerl-1.6.900/Bio/Search/HSP/BlastHSP.pm BioPerl-1.6.900/Bio/Search/HSP/HSPFactory.pm BioPerl-1.6.900/Bio/Search/HSP/GenericHSP.pm BioPerl-1.6.900/Bio/Search/HSP/HSPI.pm BioPerl-1.6.900/Bio/Search/HSP/WABAHSP.pm BioPerl-1.6.900/Bio/Search/HSP/PullHSPI.pm BioPerl-1.6.900/Bio/Search/HSP/HMMERHSP.pm BioPerl-1.6.900/Bio/OntologyIO BioPerl-1.6.900/Bio/OntologyIO/simplehierarchy.pm BioPerl-1.6.900/Bio/OntologyIO/obo.pm BioPerl-1.6.900/Bio/OntologyIO/goflat.pm BioPerl-1.6.900/Bio/OntologyIO/soflat.pm BioPerl-1.6.900/Bio/OntologyIO/InterProParser.pm BioPerl-1.6.900/Bio/OntologyIO/dagflat.pm BioPerl-1.6.900/Bio/OntologyIO/Handlers BioPerl-1.6.900/Bio/OntologyIO/Handlers/BaseSAXHandler.pm BioPerl-1.6.900/Bio/OntologyIO/Handlers/InterProHandler.pm BioPerl-1.6.900/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm BioPerl-1.6.900/Bio/Biblio BioPerl-1.6.900/Bio/Biblio/Patent.pm BioPerl-1.6.900/Bio/Biblio/Ref.pm BioPerl-1.6.900/Bio/Biblio/MedlineJournal.pm BioPerl-1.6.900/Bio/Biblio/PubmedArticle.pm BioPerl-1.6.900/Bio/Biblio/Provider.pm BioPerl-1.6.900/Bio/Biblio/Article.pm BioPerl-1.6.900/Bio/Biblio/BookArticle.pm BioPerl-1.6.900/Bio/Biblio/BiblioBase.pm BioPerl-1.6.900/Bio/Biblio/PubmedJournalArticle.pm BioPerl-1.6.900/Bio/Biblio/Proceeding.pm BioPerl-1.6.900/Bio/Biblio/TechReport.pm BioPerl-1.6.900/Bio/Biblio/MedlineBookArticle.pm BioPerl-1.6.900/Bio/Biblio/WebResource.pm BioPerl-1.6.900/Bio/Biblio/MedlineJournalArticle.pm BioPerl-1.6.900/Bio/Biblio/Book.pm BioPerl-1.6.900/Bio/Biblio/Journal.pm BioPerl-1.6.900/Bio/Biblio/Organisation.pm BioPerl-1.6.900/Bio/Biblio/Service.pm BioPerl-1.6.900/Bio/Biblio/Person.pm BioPerl-1.6.900/Bio/Biblio/JournalArticle.pm BioPerl-1.6.900/Bio/Biblio/Thesis.pm BioPerl-1.6.900/Bio/Biblio/MedlineBook.pm BioPerl-1.6.900/Bio/Biblio/MedlineArticle.pm BioPerl-1.6.900/Bio/Biblio/IO.pm BioPerl-1.6.900/Bio/Biblio/PubmedBookArticle.pm BioPerl-1.6.900/Bio/Biblio/IO BioPerl-1.6.900/Bio/Biblio/IO/medlinexml.pm BioPerl-1.6.900/Bio/Biblio/IO/pubmed2ref.pm BioPerl-1.6.900/Bio/Biblio/IO/pubmedxml.pm BioPerl-1.6.900/Bio/Biblio/IO/medline2ref.pm BioPerl-1.6.900/Bio/Map BioPerl-1.6.900/Bio/Map/PositionHandlerI.pm BioPerl-1.6.900/Bio/Map/Clone.pm BioPerl-1.6.900/Bio/Map/OrderedPosition.pm BioPerl-1.6.900/Bio/Map/Relative.pm BioPerl-1.6.900/Bio/Map/CytoPosition.pm BioPerl-1.6.900/Bio/Map/Mappable.pm BioPerl-1.6.900/Bio/Map/EntityI.pm BioPerl-1.6.900/Bio/Map/OrderedPositionWithDistance.pm BioPerl-1.6.900/Bio/Map/CytoMap.pm BioPerl-1.6.900/Bio/Map/MappableI.pm BioPerl-1.6.900/Bio/Map/Position.pm BioPerl-1.6.900/Bio/Map/LinkagePosition.pm BioPerl-1.6.900/Bio/Map/GeneMap.pm BioPerl-1.6.900/Bio/Map/GeneRelative.pm BioPerl-1.6.900/Bio/Map/FPCMarker.pm BioPerl-1.6.900/Bio/Map/LinkageMap.pm BioPerl-1.6.900/Bio/Map/CytoMarker.pm BioPerl-1.6.900/Bio/Map/Physical.pm BioPerl-1.6.900/Bio/Map/MarkerI.pm BioPerl-1.6.900/Bio/Map/TranscriptionFactor.pm BioPerl-1.6.900/Bio/Map/PositionHandler.pm BioPerl-1.6.900/Bio/Map/Prediction.pm BioPerl-1.6.900/Bio/Map/PositionWithSequence.pm BioPerl-1.6.900/Bio/Map/Microsatellite.pm BioPerl-1.6.900/Bio/Map/PositionI.pm BioPerl-1.6.900/Bio/Map/GenePosition.pm BioPerl-1.6.900/Bio/Map/MapI.pm BioPerl-1.6.900/Bio/Map/Gene.pm BioPerl-1.6.900/Bio/Map/RelativeI.pm BioPerl-1.6.900/Bio/Map/SimpleMap.pm BioPerl-1.6.900/Bio/Map/Contig.pm BioPerl-1.6.900/Bio/Map/Marker.pm BioPerl-1.6.900/Bio/Nexml BioPerl-1.6.900/Bio/Nexml/Factory.pm BioPerl-1.6.900/Bio/Coordinate BioPerl-1.6.900/Bio/Coordinate/GeneMapper.pm BioPerl-1.6.900/Bio/Coordinate/Pair.pm BioPerl-1.6.900/Bio/Coordinate/Chain.pm BioPerl-1.6.900/Bio/Coordinate/ResultI.pm BioPerl-1.6.900/Bio/Coordinate/Collection.pm BioPerl-1.6.900/Bio/Coordinate/Graph.pm BioPerl-1.6.900/Bio/Coordinate/Utils.pm BioPerl-1.6.900/Bio/Coordinate/ExtrapolatingPair.pm BioPerl-1.6.900/Bio/Coordinate/Result.pm BioPerl-1.6.900/Bio/Coordinate/MapperI.pm BioPerl-1.6.900/Bio/Coordinate/Result BioPerl-1.6.900/Bio/Coordinate/Result/Match.pm BioPerl-1.6.900/Bio/Coordinate/Result/Gap.pm BioPerl-1.6.900/Bio/Symbol BioPerl-1.6.900/Bio/Symbol/Symbol.pm BioPerl-1.6.900/Bio/Symbol/README.Symbol BioPerl-1.6.900/Bio/Symbol/SymbolI.pm BioPerl-1.6.900/Bio/Symbol/Alphabet.pm BioPerl-1.6.900/Bio/Symbol/DNAAlphabet.pm BioPerl-1.6.900/Bio/Symbol/AlphabetI.pm BioPerl-1.6.900/Bio/Symbol/ProteinAlphabet.pm BioPerl-1.6.900/Bio/MolEvol BioPerl-1.6.900/Bio/MolEvol/CodonModel.pm BioPerl-1.6.900/Bio/Ontology BioPerl-1.6.900/Bio/Ontology/Path.pm BioPerl-1.6.900/Bio/Ontology/GOterm.pm BioPerl-1.6.900/Bio/Ontology/TermFactory.pm BioPerl-1.6.900/Bio/Ontology/DocumentRegistry.pm BioPerl-1.6.900/Bio/Ontology/RelationshipI.pm BioPerl-1.6.900/Bio/Ontology/OntologyStore.pm BioPerl-1.6.900/Bio/Ontology/RelationshipFactory.pm BioPerl-1.6.900/Bio/Ontology/InterProTerm.pm BioPerl-1.6.900/Bio/Ontology/OntologyI.pm BioPerl-1.6.900/Bio/Ontology/TermI.pm BioPerl-1.6.900/Bio/Ontology/Relationship.pm BioPerl-1.6.900/Bio/Ontology/PathI.pm BioPerl-1.6.900/Bio/Ontology/OntologyEngineI.pm BioPerl-1.6.900/Bio/Ontology/Term.pm BioPerl-1.6.900/Bio/Ontology/RelationshipType.pm BioPerl-1.6.900/Bio/Ontology/SimpleOntologyEngine.pm BioPerl-1.6.900/Bio/Ontology/OBOterm.pm BioPerl-1.6.900/Bio/Ontology/Ontology.pm BioPerl-1.6.900/Bio/Ontology/OBOEngine.pm BioPerl-1.6.900/Bio/Ontology/SimpleGOEngine BioPerl-1.6.900/Bio/Ontology/SimpleGOEngine/GraphAdaptor02.pm BioPerl-1.6.900/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm BioPerl-1.6.900/Bio/PhyloNetwork BioPerl-1.6.900/Bio/PhyloNetwork/TreeFactoryMulti.pm BioPerl-1.6.900/Bio/PhyloNetwork/FactoryX.pm BioPerl-1.6.900/Bio/PhyloNetwork/TreeFactoryX.pm BioPerl-1.6.900/Bio/PhyloNetwork/Factory.pm BioPerl-1.6.900/Bio/PhyloNetwork/GraphViz.pm BioPerl-1.6.900/Bio/PhyloNetwork/muVector.pm BioPerl-1.6.900/Bio/PhyloNetwork/RandomFactory.pm BioPerl-1.6.900/Bio/PhyloNetwork/TreeFactory.pm BioPerl-1.6.900/Bio/AlignIO BioPerl-1.6.900/Bio/AlignIO/msf.pm BioPerl-1.6.900/Bio/AlignIO/largemultifasta.pm BioPerl-1.6.900/Bio/AlignIO/meme.pm BioPerl-1.6.900/Bio/AlignIO/stockholm.pm BioPerl-1.6.900/Bio/AlignIO/arp.pm BioPerl-1.6.900/Bio/AlignIO/mase.pm BioPerl-1.6.900/Bio/AlignIO/bl2seq.pm BioPerl-1.6.900/Bio/AlignIO/emboss.pm BioPerl-1.6.900/Bio/AlignIO/psi.pm BioPerl-1.6.900/Bio/AlignIO/xmfa.pm BioPerl-1.6.900/Bio/AlignIO/nexus.pm BioPerl-1.6.900/Bio/AlignIO/clustalw.pm BioPerl-1.6.900/Bio/AlignIO/mega.pm BioPerl-1.6.900/Bio/AlignIO/po.pm BioPerl-1.6.900/Bio/AlignIO/pfam.pm BioPerl-1.6.900/Bio/AlignIO/maf.pm BioPerl-1.6.900/Bio/AlignIO/prodom.pm BioPerl-1.6.900/Bio/AlignIO/nexml.pm BioPerl-1.6.900/Bio/AlignIO/proda.pm BioPerl-1.6.900/Bio/AlignIO/selex.pm BioPerl-1.6.900/Bio/AlignIO/phylip.pm BioPerl-1.6.900/Bio/AlignIO/fasta.pm BioPerl-1.6.900/Bio/AlignIO/metafasta.pm BioPerl-1.6.900/Bio/AlignIO/Handler BioPerl-1.6.900/Bio/AlignIO/Handler/GenericAlignHandler.pm BioPerl-1.6.900/Bio/FeatureIO BioPerl-1.6.900/Bio/FeatureIO/ptt.pm BioPerl-1.6.900/Bio/FeatureIO/gff.pm BioPerl-1.6.900/Bio/FeatureIO/bed.pm BioPerl-1.6.900/Bio/FeatureIO/gtf.pm BioPerl-1.6.900/Bio/FeatureIO/interpro.pm BioPerl-1.6.900/Bio/FeatureIO/vecscreen_simple.pm BioPerl-1.6.900/Bio/Restriction BioPerl-1.6.900/Bio/Restriction/Analysis.pm BioPerl-1.6.900/Bio/Restriction/EnzymeI.pm BioPerl-1.6.900/Bio/Restriction/Enzyme.pm BioPerl-1.6.900/Bio/Restriction/IO.pm BioPerl-1.6.900/Bio/Restriction/EnzymeCollection.pm BioPerl-1.6.900/Bio/Restriction/IO BioPerl-1.6.900/Bio/Restriction/IO/itype2.pm BioPerl-1.6.900/Bio/Restriction/IO/bairoch.pm BioPerl-1.6.900/Bio/Restriction/IO/prototype.pm BioPerl-1.6.900/Bio/Restriction/IO/withrefm.pm BioPerl-1.6.900/Bio/Restriction/IO/base.pm BioPerl-1.6.900/Bio/Restriction/Enzyme BioPerl-1.6.900/Bio/Restriction/Enzyme/MultiCut.pm BioPerl-1.6.900/Bio/Restriction/Enzyme/MultiSite.pm BioPerl-1.6.900/Bio/MapIO BioPerl-1.6.900/Bio/MapIO/mapmaker.pm BioPerl-1.6.900/Bio/MapIO/fpc.pm BioPerl-1.6.900/Bio/Draw BioPerl-1.6.900/Bio/Draw/Pictogram.pm BioPerl-1.6.900/Bio/Variation BioPerl-1.6.900/Bio/Variation/RNAChange.pm BioPerl-1.6.900/Bio/Variation/SNP.pm BioPerl-1.6.900/Bio/Variation/README BioPerl-1.6.900/Bio/Variation/VariantI.pm BioPerl-1.6.900/Bio/Variation/AAChange.pm BioPerl-1.6.900/Bio/Variation/AAReverseMutate.pm BioPerl-1.6.900/Bio/Variation/IO.pm BioPerl-1.6.900/Bio/Variation/SeqDiff.pm BioPerl-1.6.900/Bio/Variation/Allele.pm BioPerl-1.6.900/Bio/Variation/DNAMutation.pm BioPerl-1.6.900/Bio/Variation/IO BioPerl-1.6.900/Bio/Variation/IO/flat.pm BioPerl-1.6.900/Bio/Variation/IO/xml.pm BioPerl-1.6.900/Bio/TreeIO BioPerl-1.6.900/Bio/TreeIO/TreeEventBuilder.pm BioPerl-1.6.900/Bio/TreeIO/cluster.pm BioPerl-1.6.900/Bio/TreeIO/lintree.pm BioPerl-1.6.900/Bio/TreeIO/pag.pm BioPerl-1.6.900/Bio/TreeIO/nexus.pm BioPerl-1.6.900/Bio/TreeIO/NewickParser.pm BioPerl-1.6.900/Bio/TreeIO/nexml.pm BioPerl-1.6.900/Bio/TreeIO/phyloxml.pm BioPerl-1.6.900/Bio/TreeIO/svggraph.pm BioPerl-1.6.900/Bio/TreeIO/nhx.pm BioPerl-1.6.900/Bio/TreeIO/tabtree.pm BioPerl-1.6.900/Bio/TreeIO/newick.pm BioPerl-1.6.900/Bio/SeqIO BioPerl-1.6.900/Bio/SeqIO/seqxml.pm BioPerl-1.6.900/Bio/SeqIO/table.pm BioPerl-1.6.900/Bio/SeqIO/phd.pm BioPerl-1.6.900/Bio/SeqIO/gbxml.pm BioPerl-1.6.900/Bio/SeqIO/locuslink.pm BioPerl-1.6.900/Bio/SeqIO/chadoxml.pm BioPerl-1.6.900/Bio/SeqIO/lasergene.pm BioPerl-1.6.900/Bio/SeqIO/ztr.pm BioPerl-1.6.900/Bio/SeqIO/embl.pm BioPerl-1.6.900/Bio/SeqIO/tigrxml.pm BioPerl-1.6.900/Bio/SeqIO/pln.pm BioPerl-1.6.900/Bio/SeqIO/swissdriver.pm BioPerl-1.6.900/Bio/SeqIO/chaosxml.pm BioPerl-1.6.900/Bio/SeqIO/chaos.pm BioPerl-1.6.900/Bio/SeqIO/flybase_chadoxml.pm BioPerl-1.6.900/Bio/SeqIO/tigr.pm BioPerl-1.6.900/Bio/SeqIO/bsml.pm BioPerl-1.6.900/Bio/SeqIO/genbank.pm BioPerl-1.6.900/Bio/SeqIO/embldriver.pm BioPerl-1.6.900/Bio/SeqIO/entrezgene.pm BioPerl-1.6.900/Bio/SeqIO/ace.pm BioPerl-1.6.900/Bio/SeqIO/asciitree.pm BioPerl-1.6.900/Bio/SeqIO/bsml_sax.pm BioPerl-1.6.900/Bio/SeqIO/excel.pm BioPerl-1.6.900/Bio/SeqIO/raw.pm BioPerl-1.6.900/Bio/SeqIO/gcg.pm BioPerl-1.6.900/Bio/SeqIO/qual.pm BioPerl-1.6.900/Bio/SeqIO/kegg.pm BioPerl-1.6.900/Bio/SeqIO/nexml.pm BioPerl-1.6.900/Bio/SeqIO/mbsout.pm BioPerl-1.6.900/Bio/SeqIO/gbdriver.pm BioPerl-1.6.900/Bio/SeqIO/msout.pm BioPerl-1.6.900/Bio/SeqIO/strider.pm BioPerl-1.6.900/Bio/SeqIO/largefasta.pm BioPerl-1.6.900/Bio/SeqIO/FTHelper.pm BioPerl-1.6.900/Bio/SeqIO/game.pm BioPerl-1.6.900/Bio/SeqIO/swiss.pm BioPerl-1.6.900/Bio/SeqIO/ctf.pm BioPerl-1.6.900/Bio/SeqIO/interpro.pm BioPerl-1.6.900/Bio/SeqIO/MultiFile.pm BioPerl-1.6.900/Bio/SeqIO/fastq.pm BioPerl-1.6.900/Bio/SeqIO/pir.pm BioPerl-1.6.900/Bio/SeqIO/exp.pm BioPerl-1.6.900/Bio/SeqIO/tinyseq.pm BioPerl-1.6.900/Bio/SeqIO/alf.pm BioPerl-1.6.900/Bio/SeqIO/abi.pm BioPerl-1.6.900/Bio/SeqIO/scf.pm BioPerl-1.6.900/Bio/SeqIO/fasta.pm BioPerl-1.6.900/Bio/SeqIO/metafasta.pm BioPerl-1.6.900/Bio/SeqIO/agave.pm BioPerl-1.6.900/Bio/SeqIO/tab.pm BioPerl-1.6.900/Bio/SeqIO/game BioPerl-1.6.900/Bio/SeqIO/game/gameHandler.pm BioPerl-1.6.900/Bio/SeqIO/game/gameSubs.pm BioPerl-1.6.900/Bio/SeqIO/game/featHandler.pm BioPerl-1.6.900/Bio/SeqIO/game/gameWriter.pm BioPerl-1.6.900/Bio/SeqIO/game/seqHandler.pm BioPerl-1.6.900/Bio/SeqIO/tinyseq BioPerl-1.6.900/Bio/SeqIO/tinyseq/tinyseqHandler.pm BioPerl-1.6.900/Bio/SeqIO/Handler BioPerl-1.6.900/Bio/SeqIO/Handler/GenericRichSeqHandler.pm BioPerl-1.6.900/examples BioPerl-1.6.900/examples/longorf.pl BioPerl-1.6.900/examples/subsequence.cgi BioPerl-1.6.900/examples/generate_random_seq.pl BioPerl-1.6.900/examples/bioperl.pl BioPerl-1.6.900/examples/revcom_dir.pl BioPerl-1.6.900/examples/rev_and_trans.pl BioPerl-1.6.900/examples/make_primers.pl BioPerl-1.6.900/examples/db BioPerl-1.6.900/examples/db/dbfetch BioPerl-1.6.900/examples/db/getGenBank.pl BioPerl-1.6.900/examples/db/get_seqs.pl BioPerl-1.6.900/examples/db/est_tissue_query.pl BioPerl-1.6.900/examples/db/gb2features.pl BioPerl-1.6.900/examples/db/use_registry.pl BioPerl-1.6.900/examples/db/rfetch.pl BioPerl-1.6.900/examples/Bio-DB-GFF BioPerl-1.6.900/examples/Bio-DB-GFF/load_ucsc.pl BioPerl-1.6.900/examples/quality BioPerl-1.6.900/examples/quality/svgtrace.pl BioPerl-1.6.900/examples/searchio BioPerl-1.6.900/examples/searchio/hspwriter.pl BioPerl-1.6.900/examples/searchio/custom_writer.pl BioPerl-1.6.900/examples/searchio/waba2gff3.pl BioPerl-1.6.900/examples/searchio/waba2gff.pl BioPerl-1.6.900/examples/searchio/rawwriter.pl BioPerl-1.6.900/examples/searchio/hitwriter.pl BioPerl-1.6.900/examples/searchio/psiblast_features.pl BioPerl-1.6.900/examples/searchio/psiblast_iterations.pl BioPerl-1.6.900/examples/searchio/blast_example.pl BioPerl-1.6.900/examples/searchio/resultwriter.pl BioPerl-1.6.900/examples/searchio/htmlwriter.pl BioPerl-1.6.900/examples/tk BioPerl-1.6.900/examples/tk/hitdisplay.pl BioPerl-1.6.900/examples/tk/gsequence.pl BioPerl-1.6.900/examples/align BioPerl-1.6.900/examples/align/simplealign.pl BioPerl-1.6.900/examples/align/align_on_codons.pl BioPerl-1.6.900/examples/align/clustalw.pl BioPerl-1.6.900/examples/align/aligntutorial.pl BioPerl-1.6.900/examples/tools BioPerl-1.6.900/examples/tools/run_genscan.pl BioPerl-1.6.900/examples/tools/gb_to_gff.pl BioPerl-1.6.900/examples/tools/seq_pattern.pl BioPerl-1.6.900/examples/tools/run_primer3.pl BioPerl-1.6.900/examples/tools/gff2ps.pl BioPerl-1.6.900/examples/tools/reverse-translate.pl BioPerl-1.6.900/examples/tools/extract_genes.pl BioPerl-1.6.900/examples/tools/psw.pl BioPerl-1.6.900/examples/tools/standaloneblast.pl BioPerl-1.6.900/examples/tools/parse_codeml.pl BioPerl-1.6.900/examples/popgen BioPerl-1.6.900/examples/popgen/parse_calc_stats.pl BioPerl-1.6.900/examples/liveseq BioPerl-1.6.900/examples/liveseq/change_gene.pl BioPerl-1.6.900/examples/contributed BioPerl-1.6.900/examples/contributed/prosite2perl.pl BioPerl-1.6.900/examples/contributed/nmrpdb_parse.pl BioPerl-1.6.900/examples/contributed/rebase2list.pl BioPerl-1.6.900/examples/root BioPerl-1.6.900/examples/root/README BioPerl-1.6.900/examples/root/exceptions2.pl BioPerl-1.6.900/examples/root/exceptions3.pl BioPerl-1.6.900/examples/root/exceptions4.pl BioPerl-1.6.900/examples/root/exceptions1.pl BioPerl-1.6.900/examples/root/lib BioPerl-1.6.900/examples/root/lib/TestObject.pm BioPerl-1.6.900/examples/root/lib/TestInterface.pm BioPerl-1.6.900/examples/biblio BioPerl-1.6.900/examples/biblio/biblio_soap.pl BioPerl-1.6.900/examples/biblio/biblio-eutils-example.pl BioPerl-1.6.900/examples/biblio/biblio-soap-example.pl BioPerl-1.6.900/examples/structure BioPerl-1.6.900/examples/structure/structure-io.pl BioPerl-1.6.900/examples/tree BioPerl-1.6.900/examples/tree/paup2phylip.pl BioPerl-1.6.900/examples/cluster BioPerl-1.6.900/examples/cluster/dbsnp.pl BioPerl-1.6.900/examples/sirna BioPerl-1.6.900/examples/sirna/TAG BioPerl-1.6.900/examples/sirna/rnai_finder.cgi BioPerl-1.6.900/ide BioPerl-1.6.900/ide/bioperl.komodo BioPerl-1.6.900/ide/bioperl-mode BioPerl-1.6.900/ide/bioperl-mode/README BioPerl-1.6.900/ide/bioperl-mode/etc BioPerl-1.6.900/ide/bioperl-mode/etc/images BioPerl-1.6.900/ide/bioperl-mode/etc/images/bpmode-tool.xpm BioPerl-1.6.900/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm BioPerl-1.6.900/ide/bioperl-mode/site-lisp BioPerl-1.6.900/ide/bioperl-mode/site-lisp/bioperl-init.el BioPerl-1.6.900/ide/bioperl-mode/site-lisp/bioperl-skel.el BioPerl-1.6.900/ide/bioperl-mode/site-lisp/pod.el BioPerl-1.6.900/ide/bioperl-mode/site-lisp/bioperl-mode.el BioPerl-1.6.900/ide/bioperl-mode/dist BioPerl-1.6.900/ide/bioperl-mode/dist/SKIP BioPerl-1.6.900/ide/bioperl-mode/dist/bioperl-mode.tar BioPerl-1.6.900/ide/bioperl-mode/dist/bioperl-mode.tar.md5 BioPerl-1.6.900/ide/bioperl-mode/dist/package-me BioPerl-1.6.900/ide/bioperl-mode/dist/Changes BioPerl-1.6.900/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5 BioPerl-1.6.900/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar BioPerl-1.6.900/t BioPerl-1.6.900/t/TaxonTree.t BioPerl-1.6.900/t/Perl.t BioPerl-1.6.900/t/SeqEvolution.t BioPerl-1.6.900/t/PodSyntax.t BioPerl-1.6.900/t/nexml.t BioPerl-1.6.900/t/Species.t BioPerl-1.6.900/t/Alphabet.t BioPerl-1.6.900/t/SearchDist.t BioPerl-1.6.900/t/Symbol.t BioPerl-1.6.900/t/Align BioPerl-1.6.900/t/Align/TreeBuild.t BioPerl-1.6.900/t/Align/AlignUtil.t BioPerl-1.6.900/t/Align/Graphics.t BioPerl-1.6.900/t/Align/SimpleAlign.t BioPerl-1.6.900/t/Align/Utilities.t BioPerl-1.6.900/t/Align/AlignStats.t BioPerl-1.6.900/t/Matrix BioPerl-1.6.900/t/Matrix/SiteMatrix.t BioPerl-1.6.900/t/Matrix/ProtPsm.t BioPerl-1.6.900/t/Matrix/ProtMatrix.t BioPerl-1.6.900/t/Matrix/Matrix.t BioPerl-1.6.900/t/Matrix/InstanceSite.t BioPerl-1.6.900/t/Matrix/IO BioPerl-1.6.900/t/Matrix/IO/masta.t BioPerl-1.6.900/t/Matrix/IO/psm.t BioPerl-1.6.900/t/Annotation BioPerl-1.6.900/t/Annotation/AnnotationAdaptor.t BioPerl-1.6.900/t/Annotation/Annotation.t BioPerl-1.6.900/t/LocalDB BioPerl-1.6.900/t/LocalDB/DBFasta.t BioPerl-1.6.900/t/LocalDB/SeqFeature.t BioPerl-1.6.900/t/LocalDB/DBQual.t BioPerl-1.6.900/t/LocalDB/transfac_pro.t BioPerl-1.6.900/t/LocalDB/Flat.t BioPerl-1.6.900/t/LocalDB/BioDBGFF.t BioPerl-1.6.900/t/LocalDB/Registry.t BioPerl-1.6.900/t/LocalDB/Index BioPerl-1.6.900/t/LocalDB/Index/BlastTable.t BioPerl-1.6.900/t/LocalDB/Index/Index.t BioPerl-1.6.900/t/LocalDB/Index/Blast.t BioPerl-1.6.900/t/Tools BioPerl-1.6.900/t/Tools/Genpred.t BioPerl-1.6.900/t/Tools/Tmhmm.t BioPerl-1.6.900/t/Tools/tRNAscanSE.t BioPerl-1.6.900/t/Tools/IUPAC.t BioPerl-1.6.900/t/Tools/RepeatMasker.t BioPerl-1.6.900/t/Tools/ePCR.t BioPerl-1.6.900/t/Tools/QRNA.t BioPerl-1.6.900/t/Tools/Genewise.t BioPerl-1.6.900/t/Tools/RandDistFunctions.t BioPerl-1.6.900/t/Tools/GFF.t BioPerl-1.6.900/t/Tools/GuessSeqFormat.t BioPerl-1.6.900/t/Tools/Lucy.t BioPerl-1.6.900/t/Tools/Sigcleave.t BioPerl-1.6.900/t/Tools/FootPrinter.t BioPerl-1.6.900/t/Tools/SiRNA.t BioPerl-1.6.900/t/Tools/Genomewise.t BioPerl-1.6.900/t/Tools/Seg.t BioPerl-1.6.900/t/Tools/Match.t BioPerl-1.6.900/t/Tools/pICalculator.t BioPerl-1.6.900/t/Tools/Sim4.t BioPerl-1.6.900/t/Tools/Est2Genome.t BioPerl-1.6.900/t/Tools/TandemRepeatsFinder.t BioPerl-1.6.900/t/Tools/Signalp.t BioPerl-1.6.900/t/Tools/rnamotif.t BioPerl-1.6.900/t/Tools/Promoterwise.t BioPerl-1.6.900/t/Tools/Hmmer.t BioPerl-1.6.900/t/Tools/Primer3.t BioPerl-1.6.900/t/Tools/TargetP.t BioPerl-1.6.900/t/Tools/Pseudowise.t BioPerl-1.6.900/t/Tools/Geneid.t BioPerl-1.6.900/t/Tools/Signalp BioPerl-1.6.900/t/Tools/Signalp/ExtendedSignalp.t BioPerl-1.6.900/t/Tools/Run BioPerl-1.6.900/t/Tools/Run/WBCommandExts.t BioPerl-1.6.900/t/Tools/Run/StandAloneBlast.t BioPerl-1.6.900/t/Tools/Run/RemoteBlast_rpsblast.t BioPerl-1.6.900/t/Tools/Run/Dummy.pm BioPerl-1.6.900/t/Tools/Run/WrapperBase.t BioPerl-1.6.900/t/Tools/Run/RemoteBlast.t BioPerl-1.6.900/t/Tools/Run/Dummy BioPerl-1.6.900/t/Tools/Run/Dummy/Config.pm BioPerl-1.6.900/t/Tools/Analysis BioPerl-1.6.900/t/Tools/Analysis/Protein BioPerl-1.6.900/t/Tools/Analysis/Protein/NetPhos.t BioPerl-1.6.900/t/Tools/Analysis/Protein/Domcut.t BioPerl-1.6.900/t/Tools/Analysis/Protein/ELM.t BioPerl-1.6.900/t/Tools/Analysis/Protein/GOR4.t BioPerl-1.6.900/t/Tools/Analysis/Protein/HNN.t BioPerl-1.6.900/t/Tools/Analysis/Protein/Mitoprot.t BioPerl-1.6.900/t/Tools/Analysis/Protein/Sopma.t BioPerl-1.6.900/t/Tools/Analysis/Protein/Scansite.t BioPerl-1.6.900/t/Tools/Analysis/DNA BioPerl-1.6.900/t/Tools/Analysis/DNA/ESEfinder.t BioPerl-1.6.900/t/Tools/Alignment BioPerl-1.6.900/t/Tools/Alignment/Consed.t BioPerl-1.6.900/t/Tools/EMBOSS BioPerl-1.6.900/t/Tools/EMBOSS/Palindrome.t BioPerl-1.6.900/t/Tools/EUtilities BioPerl-1.6.900/t/Tools/EUtilities/epost.t BioPerl-1.6.900/t/Tools/EUtilities/elink_neighbor.t BioPerl-1.6.900/t/Tools/EUtilities/egquery.t BioPerl-1.6.900/t/Tools/EUtilities/elink_neighbor_history.t BioPerl-1.6.900/t/Tools/EUtilities/elink_acheck.t BioPerl-1.6.900/t/Tools/EUtilities/einfo.t BioPerl-1.6.900/t/Tools/EUtilities/elink_lcheck.t BioPerl-1.6.900/t/Tools/EUtilities/esearch.t BioPerl-1.6.900/t/Tools/EUtilities/elink_llinks.t BioPerl-1.6.900/t/Tools/EUtilities/elink_scores.t BioPerl-1.6.900/t/Tools/EUtilities/elink_ncheck.t BioPerl-1.6.900/t/Tools/EUtilities/esummary.t BioPerl-1.6.900/t/Tools/EUtilities/EUtilParameters.t BioPerl-1.6.900/t/Tools/EUtilities/espell.t BioPerl-1.6.900/t/Tools/Spidey BioPerl-1.6.900/t/Tools/Spidey/Spidey.t BioPerl-1.6.900/t/Tools/Phylo BioPerl-1.6.900/t/Tools/Phylo/Molphy.t BioPerl-1.6.900/t/Tools/Phylo/PAML.t BioPerl-1.6.900/t/Tools/Phylo/Gerp.t BioPerl-1.6.900/t/Tools/Phylo/Phylip BioPerl-1.6.900/t/Tools/Phylo/Phylip/ProtDist.t BioPerl-1.6.900/t/Seq BioPerl-1.6.900/t/Seq/EncodedSeq.t BioPerl-1.6.900/t/Seq/LargeLocatableSeq.t BioPerl-1.6.900/t/Seq/PrimarySeq.t BioPerl-1.6.900/t/Seq/PrimaryQual.t BioPerl-1.6.900/t/Seq/WithQuality.t BioPerl-1.6.900/t/Seq/MetaSeq.t BioPerl-1.6.900/t/Seq/Quality.t BioPerl-1.6.900/t/Seq/Seq.t BioPerl-1.6.900/t/Seq/LargePSeq.t BioPerl-1.6.900/t/Seq/LocatableSeq.t BioPerl-1.6.900/t/Seq/DBLink.t BioPerl-1.6.900/t/Seq/PrimedSeq.t BioPerl-1.6.900/t/lib BioPerl-1.6.900/t/lib/Error.pm BioPerl-1.6.900/t/lib/Test BioPerl-1.6.900/t/lib/Test/Simple.pm BioPerl-1.6.900/t/lib/Test/Exception.pm BioPerl-1.6.900/t/lib/Test/Tutorial.pod BioPerl-1.6.900/t/lib/Test/More.pm BioPerl-1.6.900/t/lib/Test/Builder.pm BioPerl-1.6.900/t/lib/Test/Harness.pm BioPerl-1.6.900/t/lib/Test/Warn.pm BioPerl-1.6.900/t/lib/Test/Builder BioPerl-1.6.900/t/lib/Test/Builder/Module.pm BioPerl-1.6.900/t/lib/Test/Builder/Tester.pm BioPerl-1.6.900/t/lib/Test/Builder/Tester BioPerl-1.6.900/t/lib/Test/Builder/Tester/Color.pm BioPerl-1.6.900/t/lib/Test/Harness BioPerl-1.6.900/t/lib/Test/Harness/Results.pm BioPerl-1.6.900/t/lib/Test/Harness/Point.pm BioPerl-1.6.900/t/lib/Test/Harness/Iterator.pm BioPerl-1.6.900/t/lib/Test/Harness/TAP.pod BioPerl-1.6.900/t/lib/Test/Harness/Assert.pm BioPerl-1.6.900/t/lib/Test/Harness/Util.pm BioPerl-1.6.900/t/lib/Test/Harness/Straps.pm BioPerl-1.6.900/t/lib/Array BioPerl-1.6.900/t/lib/Array/Compare.pm BioPerl-1.6.900/t/lib/Sub BioPerl-1.6.900/t/lib/Sub/Uplevel.pm BioPerl-1.6.900/t/lib/Tree BioPerl-1.6.900/t/lib/Tree/DAG_Node.pm BioPerl-1.6.900/t/Phenotype BioPerl-1.6.900/t/Phenotype/Measure.t BioPerl-1.6.900/t/Phenotype/OMIMentryAllelicVariant.t BioPerl-1.6.900/t/Phenotype/MeSH.t BioPerl-1.6.900/t/Phenotype/Phenotype.t BioPerl-1.6.900/t/Phenotype/OMIMentry.t BioPerl-1.6.900/t/Phenotype/OMIMparser.t BioPerl-1.6.900/t/Phenotype/Correlate.t BioPerl-1.6.900/t/Phenotype/MiniMIMentry.t BioPerl-1.6.900/t/Root BioPerl-1.6.900/t/Root/RootI.t BioPerl-1.6.900/t/Root/Exception.t BioPerl-1.6.900/t/Root/RootIO.t BioPerl-1.6.900/t/Root/Tempfile.t BioPerl-1.6.900/t/Root/Utilities.t BioPerl-1.6.900/t/Root/Storable.t BioPerl-1.6.900/t/Root/HTTPget.t BioPerl-1.6.900/t/PopGen BioPerl-1.6.900/t/PopGen/PopGen.t BioPerl-1.6.900/t/PopGen/PopGenSims.t BioPerl-1.6.900/t/PopGen/Coalescent.t BioPerl-1.6.900/t/PopGen/HtSNP.t BioPerl-1.6.900/t/PopGen/TagHaplotype.t BioPerl-1.6.900/t/PopGen/MK.t BioPerl-1.6.900/t/LiveSeq BioPerl-1.6.900/t/LiveSeq/Chain.t BioPerl-1.6.900/t/LiveSeq/LiveSeq.t BioPerl-1.6.900/t/LiveSeq/Mutator.t BioPerl-1.6.900/t/LiveSeq/Mutation.t BioPerl-1.6.900/t/SearchIO BioPerl-1.6.900/t/SearchIO/blastxml.t BioPerl-1.6.900/t/SearchIO/blasttable.t BioPerl-1.6.900/t/SearchIO/Tiling.t BioPerl-1.6.900/t/SearchIO/exonerate.t BioPerl-1.6.900/t/SearchIO/hmmer.t BioPerl-1.6.900/t/SearchIO/hmmer_pull.t BioPerl-1.6.900/t/SearchIO/wise.t BioPerl-1.6.900/t/SearchIO/infernal.t BioPerl-1.6.900/t/SearchIO/blast_pull.t BioPerl-1.6.900/t/SearchIO/blast.t BioPerl-1.6.900/t/SearchIO/SimilarityPair.t BioPerl-1.6.900/t/SearchIO/sim4.t BioPerl-1.6.900/t/SearchIO/rnamotif.t BioPerl-1.6.900/t/SearchIO/cross_match.t BioPerl-1.6.900/t/SearchIO/fasta.t BioPerl-1.6.900/t/SearchIO/waba.t BioPerl-1.6.900/t/SearchIO/axt.t BioPerl-1.6.900/t/SearchIO/CigarString.t BioPerl-1.6.900/t/SearchIO/erpin.t BioPerl-1.6.900/t/SearchIO/SearchIO.t BioPerl-1.6.900/t/SearchIO/psl.t BioPerl-1.6.900/t/SearchIO/gmap_f9.t BioPerl-1.6.900/t/SearchIO/megablast.t BioPerl-1.6.900/t/SearchIO/Writer BioPerl-1.6.900/t/SearchIO/Writer/TextWriter.t BioPerl-1.6.900/t/SearchIO/Writer/GbrowseGFF.t BioPerl-1.6.900/t/SearchIO/Writer/HitTableWriter.t BioPerl-1.6.900/t/SearchIO/Writer/HSPTableWriter.t BioPerl-1.6.900/t/SearchIO/Writer/HTMLWriter.t BioPerl-1.6.900/t/Structure BioPerl-1.6.900/t/Structure/Structure.t BioPerl-1.6.900/t/Structure/IO.t BioPerl-1.6.900/t/SeqFeature BioPerl-1.6.900/t/SeqFeature/LocationFactory.t BioPerl-1.6.900/t/SeqFeature/Unflattener.t BioPerl-1.6.900/t/SeqFeature/SeqAnalysisParser.t BioPerl-1.6.900/t/SeqFeature/SeqFeature.t BioPerl-1.6.900/t/SeqFeature/FeatureIO.t BioPerl-1.6.900/t/SeqFeature/RangeI.t BioPerl-1.6.900/t/SeqFeature/SeqFeaturePrimer.t BioPerl-1.6.900/t/SeqFeature/Location.t BioPerl-1.6.900/t/SeqFeature/Range.t BioPerl-1.6.900/t/SeqFeature/Unflattener2.t BioPerl-1.6.900/t/SeqFeature/Primer.t BioPerl-1.6.900/t/SeqFeature/SeqFeatCollection.t BioPerl-1.6.900/t/SeqFeature/Clone.t BioPerl-1.6.900/t/SeqFeature/SeqFeatAnnotated.t BioPerl-1.6.900/t/SeqTools BioPerl-1.6.900/t/SeqTools/OddCodes.t BioPerl-1.6.900/t/SeqTools/GuessSeqFormat.t BioPerl-1.6.900/t/SeqTools/SeqStats.t BioPerl-1.6.900/t/SeqTools/SeqUtils.t BioPerl-1.6.900/t/SeqTools/CodonTable.t BioPerl-1.6.900/t/SeqTools/ECnumber.t BioPerl-1.6.900/t/SeqTools/Backtranslate.t BioPerl-1.6.900/t/SeqTools/SeqPattern.t BioPerl-1.6.900/t/SeqTools/SeqWords.t BioPerl-1.6.900/t/Assembly BioPerl-1.6.900/t/Assembly/core.t BioPerl-1.6.900/t/Assembly/ContigSpectrum.t BioPerl-1.6.900/t/Assembly/IO BioPerl-1.6.900/t/Assembly/IO/bowtie.t BioPerl-1.6.900/t/Assembly/IO/sam.t BioPerl-1.6.900/t/ClusterIO BioPerl-1.6.900/t/ClusterIO/ClusterIO.t BioPerl-1.6.900/t/ClusterIO/unigene.t BioPerl-1.6.900/t/ClusterIO/SequenceFamily.t BioPerl-1.6.900/t/Tree BioPerl-1.6.900/t/Tree/Compatible.t BioPerl-1.6.900/t/Tree/RandomTreeFactory.t BioPerl-1.6.900/t/Tree/Node.t BioPerl-1.6.900/t/Tree/TreeStatistics.t BioPerl-1.6.900/t/Tree/Tree.t BioPerl-1.6.900/t/Tree/TreeIO.t BioPerl-1.6.900/t/Tree/PhyloNetwork BioPerl-1.6.900/t/Tree/PhyloNetwork/Factory.t BioPerl-1.6.900/t/Tree/PhyloNetwork/GraphViz.t BioPerl-1.6.900/t/Tree/PhyloNetwork/RandomFactory.t BioPerl-1.6.900/t/Tree/PhyloNetwork/TreeFactory.t BioPerl-1.6.900/t/Tree/PhyloNetwork/PhyloNetwork.t BioPerl-1.6.900/t/Tree/PhyloNetwork/MuVector.t BioPerl-1.6.900/t/Tree/TreeIO BioPerl-1.6.900/t/Tree/TreeIO/nexus.t BioPerl-1.6.900/t/Tree/TreeIO/nexml.t BioPerl-1.6.900/t/Tree/TreeIO/phyloxml.t BioPerl-1.6.900/t/Tree/TreeIO/newick.t BioPerl-1.6.900/t/Tree/TreeIO/nhx.t BioPerl-1.6.900/t/Tree/TreeIO/tabtree.t BioPerl-1.6.900/t/Tree/TreeIO/svggraph.t BioPerl-1.6.900/t/Tree/TreeIO/lintree.t BioPerl-1.6.900/t/Biblio BioPerl-1.6.900/t/Biblio/Biblio.t BioPerl-1.6.900/t/Biblio/eutils.t BioPerl-1.6.900/t/Biblio/biofetch.t BioPerl-1.6.900/t/Biblio/References.t BioPerl-1.6.900/t/Map BioPerl-1.6.900/t/Map/Map.t BioPerl-1.6.900/t/Map/Cyto.t BioPerl-1.6.900/t/Map/Physical.t BioPerl-1.6.900/t/Map/Linkage.t BioPerl-1.6.900/t/Map/MapIO.t BioPerl-1.6.900/t/Map/MicrosatelliteMarker.t BioPerl-1.6.900/t/Coordinate BioPerl-1.6.900/t/Coordinate/CoordinateMapper.t BioPerl-1.6.900/t/Coordinate/GeneCoordinateMapper.t BioPerl-1.6.900/t/Coordinate/CoordinateGraph.t BioPerl-1.6.900/t/RemoteDB BioPerl-1.6.900/t/RemoteDB/Taxonomy.t BioPerl-1.6.900/t/RemoteDB/RefSeq.t BioPerl-1.6.900/t/RemoteDB/EUtilities.t BioPerl-1.6.900/t/RemoteDB/MeSH.t BioPerl-1.6.900/t/RemoteDB/EMBL.t BioPerl-1.6.900/t/RemoteDB/SeqRead_fail.t BioPerl-1.6.900/t/RemoteDB/EntrezGene.t BioPerl-1.6.900/t/RemoteDB/GenPept.t BioPerl-1.6.900/t/RemoteDB/SeqVersion.t BioPerl-1.6.900/t/RemoteDB/SeqHound.t BioPerl-1.6.900/t/RemoteDB/BioFetch.t BioPerl-1.6.900/t/RemoteDB/GenBank.t BioPerl-1.6.900/t/RemoteDB/CUTG.t BioPerl-1.6.900/t/RemoteDB/SwissProt.t BioPerl-1.6.900/t/RemoteDB/HIV BioPerl-1.6.900/t/RemoteDB/HIV/HIVQuery.t BioPerl-1.6.900/t/RemoteDB/HIV/HIVAnnotProcessor.t BioPerl-1.6.900/t/RemoteDB/HIV/HIVQueryHelper.t BioPerl-1.6.900/t/RemoteDB/HIV/HIV.t BioPerl-1.6.900/t/RemoteDB/Query BioPerl-1.6.900/t/RemoteDB/Query/GenBank.t BioPerl-1.6.900/t/Ontology BioPerl-1.6.900/t/Ontology/Term.t BioPerl-1.6.900/t/Ontology/GraphAdaptor.t BioPerl-1.6.900/t/Ontology/GOterm.t BioPerl-1.6.900/t/Ontology/OntologyEngine.t BioPerl-1.6.900/t/Ontology/Ontology.t BioPerl-1.6.900/t/Ontology/RelationshipType.t BioPerl-1.6.900/t/Ontology/Relationship.t BioPerl-1.6.900/t/Ontology/OntologyStore.t BioPerl-1.6.900/t/Ontology/IO BioPerl-1.6.900/t/Ontology/IO/go.t BioPerl-1.6.900/t/Ontology/IO/obo.t BioPerl-1.6.900/t/Ontology/IO/interpro.t BioPerl-1.6.900/t/AlignIO BioPerl-1.6.900/t/AlignIO/clustalw.t BioPerl-1.6.900/t/AlignIO/psi.t BioPerl-1.6.900/t/AlignIO/msf.t BioPerl-1.6.900/t/AlignIO/xmfa.t BioPerl-1.6.900/t/AlignIO/mase.t BioPerl-1.6.900/t/AlignIO/po.t BioPerl-1.6.900/t/AlignIO/phylip.t BioPerl-1.6.900/t/AlignIO/selex.t BioPerl-1.6.900/t/AlignIO/bl2seq.t BioPerl-1.6.900/t/AlignIO/nexus.t BioPerl-1.6.900/t/AlignIO/nexml.t BioPerl-1.6.900/t/AlignIO/stockholm.t BioPerl-1.6.900/t/AlignIO/largemultifasta.t BioPerl-1.6.900/t/AlignIO/mega.t BioPerl-1.6.900/t/AlignIO/prodom.t BioPerl-1.6.900/t/AlignIO/metafasta.t BioPerl-1.6.900/t/AlignIO/pfam.t BioPerl-1.6.900/t/AlignIO/emboss.t BioPerl-1.6.900/t/AlignIO/maf.t BioPerl-1.6.900/t/AlignIO/fasta.t BioPerl-1.6.900/t/AlignIO/meme.t BioPerl-1.6.900/t/AlignIO/arp.t BioPerl-1.6.900/t/AlignIO/AlignIO.t BioPerl-1.6.900/t/data BioPerl-1.6.900/t/data/HUMBETGLOA.grailexp BioPerl-1.6.900/t/data/HUMBETGLOA.mzef BioPerl-1.6.900/t/data/intrablock-comment.nex BioPerl-1.6.900/t/data/lysozyme6.simple.protml BioPerl-1.6.900/t/data/targetp.out BioPerl-1.6.900/t/data/popgen_saureus.multidat BioPerl-1.6.900/t/data/testfuzzy.genbank BioPerl-1.6.900/t/data/bug3086.embl BioPerl-1.6.900/t/data/characters.nexml.old.xml BioPerl-1.6.900/t/data/polymorphism.xml BioPerl-1.6.900/t/data/glimmer3-fragment.predict BioPerl-1.6.900/t/data/seqfile.pir BioPerl-1.6.900/t/data/megablast_output.paracel_btk BioPerl-1.6.900/t/data/test.gcg BioPerl-1.6.900/t/data/Primate_mtDNA.nex BioPerl-1.6.900/t/data/tricky.wublast BioPerl-1.6.900/t/data/reference_ace.ace BioPerl-1.6.900/t/data/sim4.rev BioPerl-1.6.900/t/data/AHCYL1.kegg BioPerl-1.6.900/t/data/seqdatabase.ini BioPerl-1.6.900/t/data/HUMBETGLOA.gff BioPerl-1.6.900/t/data/headerless.psl BioPerl-1.6.900/t/data/03_bootstraps.xml BioPerl-1.6.900/t/data/multi_2.fa BioPerl-1.6.900/t/data/codeml315.mlc BioPerl-1.6.900/t/data/tandem_repeats_finder.dat BioPerl-1.6.900/t/data/LOAD_Ccd1.dnd BioPerl-1.6.900/t/data/genomic-seq.epcr BioPerl-1.6.900/t/data/BAB68554.gb BioPerl-1.6.900/t/data/MmCT BioPerl-1.6.900/t/data/tree_nonewline.nexus BioPerl-1.6.900/t/data/tandem_repeats_finder_no_desc.dat BioPerl-1.6.900/t/data/EG352462.gbxml BioPerl-1.6.900/t/data/bug2399.tblastn BioPerl-1.6.900/t/data/testaln.msf BioPerl-1.6.900/t/data/longnames.aln BioPerl-1.6.900/t/data/cds-266.fas BioPerl-1.6.900/t/data/glimmer3-fragment.detail BioPerl-1.6.900/t/data/traittree.nexus BioPerl-1.6.900/t/data/codeml_nssites.mlc BioPerl-1.6.900/t/data/short.blx BioPerl-1.6.900/t/data/U71225.gb BioPerl-1.6.900/t/data/pfam_tests.stk BioPerl-1.6.900/t/data/testaln.fasta BioPerl-1.6.900/t/data/hmmsearch.out BioPerl-1.6.900/t/data/HUMBETGLOA.FASTA BioPerl-1.6.900/t/data/hybrid2.gff3 BioPerl-1.6.900/t/data/LittleChrY.dbsnp.xml BioPerl-1.6.900/t/data/aaml_pairwise.mlc BioPerl-1.6.900/t/data/rebase.itype2 BioPerl-1.6.900/t/data/U71225.gb.win BioPerl-1.6.900/t/data/01_basic.xml BioPerl-1.6.900/t/data/pictogram.fa BioPerl-1.6.900/t/data/c200-vs-yeast.BLASTN.m8 BioPerl-1.6.900/t/data/test.ztr BioPerl-1.6.900/t/data/repeatmasker.fa.out BioPerl-1.6.900/t/data/ecoli_domains.rps.xml BioPerl-1.6.900/t/data/rfam_tests.stk BioPerl-1.6.900/t/data/hybrid1.gff3 BioPerl-1.6.900/t/data/Glimmer2.out BioPerl-1.6.900/t/data/sv40_small.xml BioPerl-1.6.900/t/data/signalp.short BioPerl-1.6.900/t/data/multiline-intrablock-comment.nex BioPerl-1.6.900/t/data/no_hsps.blastp BioPerl-1.6.900/t/data/1.bed BioPerl-1.6.900/t/data/test.ref.fas BioPerl-1.6.900/t/data/SPAN_Family8a.nex BioPerl-1.6.900/t/data/503384.MEGABLAST.2 BioPerl-1.6.900/t/data/sofa.ontology BioPerl-1.6.900/t/data/bl2seq.blastn.rev BioPerl-1.6.900/t/data/mpath.ontology.test BioPerl-1.6.900/t/data/pre_rel9.swiss BioPerl-1.6.900/t/data/Mcjanrna_rdbII.gbk BioPerl-1.6.900/t/data/exonerate.whitespace_before_query.works BioPerl-1.6.900/t/data/footprinter.out BioPerl-1.6.900/t/data/testaln.mase BioPerl-1.6.900/t/data/test.pir BioPerl-1.6.900/t/data/ecoli_domains.rpsblast BioPerl-1.6.900/t/data/genemark.out BioPerl-1.6.900/t/data/gf-s71.needle BioPerl-1.6.900/t/data/27-contig_Newbler.ace BioPerl-1.6.900/t/data/ar.embl BioPerl-1.6.900/t/data/503384.MEGABLAST.0 BioPerl-1.6.900/t/data/char-matrix-spaces.nex BioPerl-1.6.900/t/data/branchSite.mlc BioPerl-1.6.900/t/data/cysprot.fa BioPerl-1.6.900/t/data/bug2942.blastx BioPerl-1.6.900/t/data/meme.dat BioPerl-1.6.900/t/data/little.largemultifasta BioPerl-1.6.900/t/data/hs_owlmonkey.fas BioPerl-1.6.900/t/data/AF165282.gb BioPerl-1.6.900/t/data/unigene.data BioPerl-1.6.900/t/data/primer3_infile.txt BioPerl-1.6.900/t/data/ecoli-trna-qrna.out BioPerl-1.6.900/t/data/GO.defs.test BioPerl-1.6.900/t/data/AE003528_ecoli.bls BioPerl-1.6.900/t/data/test.mase BioPerl-1.6.900/t/data/mutations.xml BioPerl-1.6.900/t/data/worm_fam_2785.cdna BioPerl-1.6.900/t/data/NC_001284.gbk BioPerl-1.6.900/t/data/trna.strict.rnamotif BioPerl-1.6.900/t/data/ATF14F8.gbk BioPerl-1.6.900/t/data/dnaEbsub_ecoli.wutblastx BioPerl-1.6.900/t/data/expected.blast.out BioPerl-1.6.900/t/data/sparsealn.needle BioPerl-1.6.900/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.900/t/data/genomic-seq.mzef BioPerl-1.6.900/t/data/HUMBETGLOA.tblastx BioPerl-1.6.900/t/data/radical-whitespace_02.nex BioPerl-1.6.900/t/data/dna2.fa BioPerl-1.6.900/t/data/NT_021877.gbk BioPerl-1.6.900/t/data/AE003644_Adh-genomic.gb BioPerl-1.6.900/t/data/stress_test_pubmed.xml BioPerl-1.6.900/t/data/U83300.bsml BioPerl-1.6.900/t/data/testdata.crossmatch BioPerl-1.6.900/t/data/bug2391.megablast BioPerl-1.6.900/t/data/nucmatrix.txt BioPerl-1.6.900/t/data/baseml.pairwise BioPerl-1.6.900/t/data/plague_yeast.bls.xml BioPerl-1.6.900/t/data/L77119.hmmer BioPerl-1.6.900/t/data/brassica_ATH.WUBLASTN BioPerl-1.6.900/t/data/signalp.hmm.short BioPerl-1.6.900/t/data/codeml_nan.mlc BioPerl-1.6.900/t/data/test.genbank BioPerl-1.6.900/t/data/signalp.negative.out BioPerl-1.6.900/t/data/interpro_sample.xml BioPerl-1.6.900/t/data/signalp.nn.short BioPerl-1.6.900/t/data/testaln2.fasta BioPerl-1.6.900/t/data/testaln2.arp BioPerl-1.6.900/t/data/seg.out BioPerl-1.6.900/t/data/swiss.dat BioPerl-1.6.900/t/data/quoted-strings1.nex BioPerl-1.6.900/t/data/AY763288.gb BioPerl-1.6.900/t/data/P33897 BioPerl-1.6.900/t/data/GO.defs.test2 BioPerl-1.6.900/t/data/PX1CG.gb BioPerl-1.6.900/t/data/multiseq.bls BioPerl-1.6.900/t/data/codeml43_nssites.mlc BioPerl-1.6.900/t/data/Rab1.chaos-xml BioPerl-1.6.900/t/data/blast_plus.blastp BioPerl-1.6.900/t/data/atp1.matrix BioPerl-1.6.900/t/data/hsinsulin.blastcl3.blastn BioPerl-1.6.900/t/data/roa1.swiss BioPerl-1.6.900/t/data/exonerate.output.dontwork BioPerl-1.6.900/t/data/tblastn.out BioPerl-1.6.900/t/data/long-names.nex BioPerl-1.6.900/t/data/crab.njb BioPerl-1.6.900/t/data/SwissProt.dat BioPerl-1.6.900/t/data/cysprot1.FASTA BioPerl-1.6.900/t/data/humts1.pal BioPerl-1.6.900/t/data/CG2865.fasaln BioPerl-1.6.900/t/data/ZABJ4EA7014.CH878695.1.blast.txt BioPerl-1.6.900/t/data/codeml43.mlc BioPerl-1.6.900/t/data/mini-align.aln BioPerl-1.6.900/t/data/char-interleave.nex BioPerl-1.6.900/t/data/testaln.fastq BioPerl-1.6.900/t/data/test.tseq BioPerl-1.6.900/t/data/interpro.xml BioPerl-1.6.900/t/data/ay149291.gb BioPerl-1.6.900/t/data/mutations.old.dat BioPerl-1.6.900/t/data/tmhmm.out BioPerl-1.6.900/t/data/hg16_chroms.gff BioPerl-1.6.900/t/data/protpars.phy BioPerl-1.6.900/t/data/spidey.test1 BioPerl-1.6.900/t/data/AF305198.gb BioPerl-1.6.900/t/data/1A3I.pdb BioPerl-1.6.900/t/data/radical-whitespace.nex BioPerl-1.6.900/t/data/Genscan.FastA BioPerl-1.6.900/t/data/GlimmerM.out BioPerl-1.6.900/t/data/02_dogfish_no_taxrefs.xml BioPerl-1.6.900/t/data/BC000007.gbk BioPerl-1.6.900/t/data/psiblast.xml BioPerl-1.6.900/t/data/psi_xml.dat BioPerl-1.6.900/t/data/tmp.fst BioPerl-1.6.900/t/data/Q8GBD3.swiss BioPerl-1.6.900/t/data/nhx-bacteria.nhx BioPerl-1.6.900/t/data/test1.blasttab3 BioPerl-1.6.900/t/data/test.gcgfasta BioPerl-1.6.900/t/data/ecolitst.fa BioPerl-1.6.900/t/data/ssp160.embl.1 BioPerl-1.6.900/t/data/barns-combined.nex BioPerl-1.6.900/t/data/lucy.qual BioPerl-1.6.900/t/data/test.pfam BioPerl-1.6.900/t/data/blast_no_hit_desc.txt BioPerl-1.6.900/t/data/hs_fugu.newick BioPerl-1.6.900/t/data/AAC12660.fa BioPerl-1.6.900/t/data/spaces.nex BioPerl-1.6.900/t/data/entrezgene.dat BioPerl-1.6.900/t/data/phipsi.out BioPerl-1.6.900/t/data/cysprot1a.msf BioPerl-1.6.900/t/data/hmmpfam_fake.out BioPerl-1.6.900/t/data/bl2seq.tblastx.out BioPerl-1.6.900/t/data/pseudowise.out BioPerl-1.6.900/t/data/SPAN_Family7n.nex BioPerl-1.6.900/t/data/ctgdemo.fpc BioPerl-1.6.900/t/data/c200-vs-yeast.BLASTN BioPerl-1.6.900/t/data/sbay_c127.fas BioPerl-1.6.900/t/data/no_cds_example.gb BioPerl-1.6.900/t/data/cysprot.needle BioPerl-1.6.900/t/data/polymorphism.dat BioPerl-1.6.900/t/data/testaln.prodom BioPerl-1.6.900/t/data/lysozyme6.protml BioPerl-1.6.900/t/data/testaln.phylip BioPerl-1.6.900/t/data/test.swiss BioPerl-1.6.900/t/data/frac_problems2.blast BioPerl-1.6.900/t/data/test.fasta BioPerl-1.6.900/t/data/singlet_w_CT.ace BioPerl-1.6.900/t/data/hs_est.est2genome BioPerl-1.6.900/t/data/test2.infernal BioPerl-1.6.900/t/data/test.embl BioPerl-1.6.900/t/data/cysprot.tblastn BioPerl-1.6.900/t/data/test.phd BioPerl-1.6.900/t/data/test.lasergene BioPerl-1.6.900/t/data/test.abi BioPerl-1.6.900/t/data/lucy.stderr BioPerl-1.6.900/t/data/frac_problems3.blast BioPerl-1.6.900/t/data/rebase.withrefm BioPerl-1.6.900/t/data/test.interpro BioPerl-1.6.900/t/data/example.phase BioPerl-1.6.900/t/data/bug2982.embl BioPerl-1.6.900/t/data/trees.nexml.xml BioPerl-1.6.900/t/data/myco_sites.gff BioPerl-1.6.900/t/data/ECAPAH02.embl BioPerl-1.6.900/t/data/rel9.swiss BioPerl-1.6.900/t/data/test.metafasta BioPerl-1.6.900/t/data/test.bam BioPerl-1.6.900/t/data/signalp.hmm.summary BioPerl-1.6.900/t/data/cysprot1.fa BioPerl-1.6.900/t/data/tol-2010-02-18.nhx BioPerl-1.6.900/t/data/dnaEbsub_ecoli.wublastx BioPerl-1.6.900/t/data/contigspectrumtest.tigr BioPerl-1.6.900/t/data/testfile.erpin BioPerl-1.6.900/t/data/acefile.singlets BioPerl-1.6.900/t/data/biorecipe.nhx BioPerl-1.6.900/t/data/04_labeled_ancestors.xml BioPerl-1.6.900/t/data/seqs.fas BioPerl-1.6.900/t/data/testdbaccnums.out BioPerl-1.6.900/t/data/02_mackerel_no_taxrefs.xml BioPerl-1.6.900/t/data/interpro_relationship.xml BioPerl-1.6.900/t/data/genemark-fragment.out BioPerl-1.6.900/t/data/no_semicolon.newick BioPerl-1.6.900/t/data/adh.mb_tree.nexus BioPerl-1.6.900/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.900/t/data/5X_1895.FASTXY BioPerl-1.6.900/t/data/frac_problems.blast BioPerl-1.6.900/t/data/in.fasta BioPerl-1.6.900/t/data/cysprot1a.fa BioPerl-1.6.900/t/data/tab1part.mif BioPerl-1.6.900/t/data/qualfile.qual BioPerl-1.6.900/t/data/test_badlf.gcg BioPerl-1.6.900/t/data/seqxml.xml BioPerl-1.6.900/t/data/singleNSsite.mlc BioPerl-1.6.900/t/data/lucy.seq BioPerl-1.6.900/t/data/sequencefamily.dat BioPerl-1.6.900/t/data/test.waba BioPerl-1.6.900/t/data/1A11.pdb BioPerl-1.6.900/t/data/genewise.out BioPerl-1.6.900/t/data/2008.blasttable BioPerl-1.6.900/t/data/no-genes.genscan BioPerl-1.6.900/t/data/multifa.seq BioPerl-1.6.900/t/data/PAM250 BioPerl-1.6.900/t/data/match.output BioPerl-1.6.900/t/data/BN000066-tpa.embl BioPerl-1.6.900/t/data/popgen_saureus.dat BioPerl-1.6.900/t/data/phylipdist.out BioPerl-1.6.900/t/data/example.vcf BioPerl-1.6.900/t/data/BK000016-tpa.gbk BioPerl-1.6.900/t/data/ribosome-slippage.gb BioPerl-1.6.900/t/data/dmel_2Lchunk.gb BioPerl-1.6.900/t/data/genomic-seq.fasta BioPerl-1.6.900/t/data/sim4.for.rev BioPerl-1.6.900/t/data/traits.tab BioPerl-1.6.900/t/data/blat.psLayout3 BioPerl-1.6.900/t/data/bl2seq.bug940.out BioPerl-1.6.900/t/data/dcr1_sp.WUBLASTP BioPerl-1.6.900/t/data/testaln.aln BioPerl-1.6.900/t/data/test.locuslink BioPerl-1.6.900/t/data/longnames.dnd BioPerl-1.6.900/t/data/bug1986.blastp BioPerl-1.6.900/t/data/test.raw BioPerl-1.6.900/t/data/multi.blast.m8 BioPerl-1.6.900/t/data/regulation_test.obo BioPerl-1.6.900/t/data/blast.report BioPerl-1.6.900/t/data/chad100.scf BioPerl-1.6.900/t/data/contig-by-hand.wublastp BioPerl-1.6.900/t/data/sample_dataset.tigr BioPerl-1.6.900/t/data/bug2862.pmr BioPerl-1.6.900/t/data/ecolitst.wublastp BioPerl-1.6.900/t/data/humor.maf BioPerl-1.6.900/t/data/crypto.sim4-3 BioPerl-1.6.900/t/data/cys1_dicdi.water BioPerl-1.6.900/t/data/test.game BioPerl-1.6.900/t/data/mini-AE001405.gb BioPerl-1.6.900/t/data/testaln.nexus BioPerl-1.6.900/t/data/cysprot1b.fa BioPerl-1.6.900/t/data/crypto.sim4-4 BioPerl-1.6.900/t/data/factor7.embl BioPerl-1.6.900/t/data/omim_genemap_test_nolinebreak BioPerl-1.6.900/t/data/Glimmer3.predict BioPerl-1.6.900/t/data/testaln.arp BioPerl-1.6.900/t/data/test.cns.fastq BioPerl-1.6.900/t/data/test.gcgblast BioPerl-1.6.900/t/data/blosum62.bla BioPerl-1.6.900/t/data/mus.bls.xml BioPerl-1.6.900/t/data/tandem_repeats_finder.noresults BioPerl-1.6.900/t/data/calm.swiss BioPerl-1.6.900/t/data/mixedmast.dat BioPerl-1.6.900/t/data/HUMBETGLOA.fa BioPerl-1.6.900/t/data/bl2seq.blastn BioPerl-1.6.900/t/data/MSGEFTUA.gb BioPerl-1.6.900/t/data/blastp2215.blast BioPerl-1.6.900/t/data/codeml4.mlc BioPerl-1.6.900/t/data/dnaE-bsub.fa BioPerl-1.6.900/t/data/NC_006511-short.gbk BioPerl-1.6.900/t/data/BEL16-LTR_AG.embl BioPerl-1.6.900/t/data/characters+trees.nexml.xml BioPerl-1.6.900/t/data/mutations.old.xml BioPerl-1.6.900/t/data/sbay_c545-yeast.BLASTZ.PSL BioPerl-1.6.900/t/data/test.meme2 BioPerl-1.6.900/t/data/bug2937.fasta BioPerl-1.6.900/t/data/P39765.gb BioPerl-1.6.900/t/data/trees.nexml.old.xml BioPerl-1.6.900/t/data/test.nhx BioPerl-1.6.900/t/data/phylipdist-36.out BioPerl-1.6.900/t/data/newblast.xml BioPerl-1.6.900/t/data/mutations.dat BioPerl-1.6.900/t/data/noninterleaved.phy BioPerl-1.6.900/t/data/protpars_longid.phy BioPerl-1.6.900/t/data/test.bowtie BioPerl-1.6.900/t/data/test.nh BioPerl-1.6.900/t/data/8HVP.pdb BioPerl-1.6.900/t/data/phyloxml_examples.xml BioPerl-1.6.900/t/data/test.infernal BioPerl-1.6.900/t/data/neighbor.dist BioPerl-1.6.900/t/data/test.txt BioPerl-1.6.900/t/data/signalp.summary BioPerl-1.6.900/t/data/ENr111.mfa.example.elems BioPerl-1.6.900/t/data/omim_genemap_test BioPerl-1.6.900/t/data/primedseq.fa BioPerl-1.6.900/t/data/ay007676.gb BioPerl-1.6.900/t/data/AB077698.gb BioPerl-1.6.900/t/data/new_blastn.txt BioPerl-1.6.900/t/data/revcomp_mrna.gb BioPerl-1.6.900/t/data/popstats.prettybase BioPerl-1.6.900/t/data/ay116458.gb BioPerl-1.6.900/t/data/AF032047.gbk BioPerl-1.6.900/t/data/bug2982.gb BioPerl-1.6.900/t/data/puzzle.tre BioPerl-1.6.900/t/data/tab3part.mif BioPerl-1.6.900/t/data/P35527.gb BioPerl-1.6.900/t/data/D10483.gbk BioPerl-1.6.900/t/data/codeml.mlc BioPerl-1.6.900/t/data/promoterwise.out BioPerl-1.6.900/t/data/test_singlets.maq BioPerl-1.6.900/t/data/biofpc.cor BioPerl-1.6.900/t/data/urease.tre.nexus BioPerl-1.6.900/t/data/BOSS_DROME.FASTP_v35_04 BioPerl-1.6.900/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.900/t/data/qrna-relloc.out BioPerl-1.6.900/t/data/test_clear_range.fastq BioPerl-1.6.900/t/data/cysprot.msf BioPerl-1.6.900/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.900/t/data/basic-bush.nex BioPerl-1.6.900/t/data/transfac.dat BioPerl-1.6.900/t/data/testaln.xmfa BioPerl-1.6.900/t/data/X98338_Adh-mRNA.gb BioPerl-1.6.900/t/data/amino.fa BioPerl-1.6.900/t/data/bl2seq.blastx.out BioPerl-1.6.900/t/data/basic-ladder.nex BioPerl-1.6.900/t/data/a_thaliana.blastn BioPerl-1.6.900/t/data/vecscreen_simple.test_output BioPerl-1.6.900/t/data/cysprot_vs_gadfly.FASTA BioPerl-1.6.900/t/data/purine_v081.infernal BioPerl-1.6.900/t/data/bug2901.fa BioPerl-1.6.900/t/data/05_ancestral_states.xml BioPerl-1.6.900/t/data/DQ018368.gb BioPerl-1.6.900/t/data/exsignalp.out BioPerl-1.6.900/t/data/multi.phd BioPerl-1.6.900/t/data/empty.bl2seq BioPerl-1.6.900/t/data/bug2246.blast BioPerl-1.6.900/t/data/cysprot1b.newick BioPerl-1.6.900/t/data/M0.mlc BioPerl-1.6.900/t/data/1BPT.pdb BioPerl-1.6.900/t/data/gmap_f9.txt BioPerl-1.6.900/t/data/example.hap BioPerl-1.6.900/t/data/test.interpro-go.xml BioPerl-1.6.900/t/data/aaml.mlc BioPerl-1.6.900/t/data/test 2.txt BioPerl-1.6.900/t/data/bug2869.tree BioPerl-1.6.900/t/data/mapmaker.out BioPerl-1.6.900/t/data/crab.dat.cn BioPerl-1.6.900/t/data/Treebase-chlamy-dna.nex BioPerl-1.6.900/t/data/psiblastreport.out BioPerl-1.6.900/t/data/ex1.nucl.nhx BioPerl-1.6.900/t/data/dnaE-bsub-prot.fa BioPerl-1.6.900/t/data/test.tab BioPerl-1.6.900/t/data/alnfile.fasta BioPerl-1.6.900/t/data/hmmscan_sec_struct.out BioPerl-1.6.900/t/data/hs_owlmonkey.fasta BioPerl-1.6.900/t/data/test.exp BioPerl-1.6.900/t/data/test.tigrxml BioPerl-1.6.900/t/data/Fang_2003.xml BioPerl-1.6.900/t/data/directives.gff3 BioPerl-1.6.900/t/data/hs_owlmonkey.aln BioPerl-1.6.900/t/data/bug1986.blast2 BioPerl-1.6.900/t/data/bug3021.gmap BioPerl-1.6.900/t/data/geneid_1.0.out BioPerl-1.6.900/t/data/CG11099.fasaln BioPerl-1.6.900/t/data/omim_text_test BioPerl-1.6.900/t/data/1ZZ19XR301R-Alignment.tblastn BioPerl-1.6.900/t/data/test.fastq BioPerl-1.6.900/t/data/testaln.psi BioPerl-1.6.900/t/data/O_sat.wgs BioPerl-1.6.900/t/data/cysprot.water BioPerl-1.6.900/t/data/multifa.seq.qual BioPerl-1.6.900/t/data/pep-266.aln BioPerl-1.6.900/t/data/rpsblast.bls BioPerl-1.6.900/t/data/test_data.axt BioPerl-1.6.900/t/data/roa1.genbank BioPerl-1.6.900/t/data/yn00.mlc BioPerl-1.6.900/t/data/wellcome_tol.nhx BioPerl-1.6.900/t/data/compLD_missingtest.prettybase BioPerl-1.6.900/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.900/t/data/compLD_test.prettybase BioPerl-1.6.900/t/data/test1.wublastp BioPerl-1.6.900/t/data/primer3_output.txt BioPerl-1.6.900/t/data/exonerate.output.works BioPerl-1.6.900/t/data/03_bootstraps_in_tag.xml BioPerl-1.6.900/t/data/yeast.tRNAscanSE BioPerl-1.6.900/t/data/cysprot1b.msf BioPerl-1.6.900/t/data/fgenesh.out BioPerl-1.6.900/t/data/bootstrap.tre BioPerl-1.6.900/t/data/roa1_v2.dat BioPerl-1.6.900/t/data/knownGene.gff3 BioPerl-1.6.900/t/data/crypto.sim4-0 BioPerl-1.6.900/t/data/T7.aln BioPerl-1.6.900/t/data/AnnIX-v003.gbk BioPerl-1.6.900/t/data/Kingdoms_DNA.nex BioPerl-1.6.900/t/data/tab2part.mif BioPerl-1.6.900/t/data/swisspfam.data BioPerl-1.6.900/t/data/bug2120.phd BioPerl-1.6.900/t/data/NC_006346.gb BioPerl-1.6.900/t/data/polymorphism.old.xml BioPerl-1.6.900/t/data/bug2473.fasta BioPerl-1.6.900/t/data/Glimmer3.detail BioPerl-1.6.900/t/data/D12555.gbk BioPerl-1.6.900/t/data/sprintf.rnamotif BioPerl-1.6.900/t/data/U58726.gb BioPerl-1.6.900/t/data/interpro_short.xml BioPerl-1.6.900/t/data/test.embl2sq BioPerl-1.6.900/t/data/biofpc.fpc BioPerl-1.6.900/t/data/testaln.metafasta BioPerl-1.6.900/t/data/test.genbank.noseq BioPerl-1.6.900/t/data/hemoglobinA.meg BioPerl-1.6.900/t/data/echofilter.wublastn BioPerl-1.6.900/t/data/dnaEbsub_ecoli.wutblastn BioPerl-1.6.900/t/data/dna1.fa BioPerl-1.6.900/t/data/NM_002254.gb BioPerl-1.6.900/t/data/roa1.dat BioPerl-1.6.900/t/data/interpro_ebi.xml BioPerl-1.6.900/t/data/roa1.gbxml BioPerl-1.6.900/t/data/characters.nexml.xml BioPerl-1.6.900/t/data/gmap_f9-reverse-strand.txt BioPerl-1.6.900/t/data/test.ctf BioPerl-1.6.900/t/data/test.tsv BioPerl-1.6.900/t/data/multi_blast.bls BioPerl-1.6.900/t/data/BLOSUM50 BioPerl-1.6.900/t/data/AY095303S1.gbk BioPerl-1.6.900/t/data/acefile.ace.1 BioPerl-1.6.900/t/data/masta.dat BioPerl-1.6.900/t/data/genomewise.out BioPerl-1.6.900/t/data/GlimmerHMM.out BioPerl-1.6.900/t/data/SPAN_Family4nl.nex BioPerl-1.6.900/t/data/ecolitst.noseqs.wublastp BioPerl-1.6.900/t/data/hmmscan.out BioPerl-1.6.900/t/data/U71225.gb.unix BioPerl-1.6.900/t/data/alleles.fas BioPerl-1.6.900/t/data/genewise_output.paracel_btk BioPerl-1.6.900/t/data/insulin.water BioPerl-1.6.900/t/data/mast.dat BioPerl-1.6.900/t/data/test.ace BioPerl-1.6.900/t/data/test.xls BioPerl-1.6.900/t/data/Bird_Ovomucoids.nex BioPerl-1.6.900/t/data/hmmsearch3.out BioPerl-1.6.900/t/data/UnaSmithHIV-both.nex BioPerl-1.6.900/t/data/semicolon.newick BioPerl-1.6.900/t/data/lucy.info BioPerl-1.6.900/t/data/primer3_outfile.txt BioPerl-1.6.900/t/data/multi_1.fa BioPerl-1.6.900/t/data/multi.blast.m9 BioPerl-1.6.900/t/data/hmmpfam.out BioPerl-1.6.900/t/data/test.meme BioPerl-1.6.900/t/data/version3.scf BioPerl-1.6.900/t/data/bug2453.maf BioPerl-1.6.900/t/data/NC_008536.gb BioPerl-1.6.900/t/data/testaln.pfam BioPerl-1.6.900/t/data/sim4.for.for BioPerl-1.6.900/t/data/component.ontology.test2 BioPerl-1.6.900/t/data/so.obo BioPerl-1.6.900/t/data/multiseq_tags.phd BioPerl-1.6.900/t/data/test2.raw BioPerl-1.6.900/t/data/component.ontology.test BioPerl-1.6.900/t/data/signalp.positive.out BioPerl-1.6.900/t/data/no_FH.embl BioPerl-1.6.900/t/data/spidey.noalignment BioPerl-1.6.900/t/data/quoted-strings2.nex BioPerl-1.6.900/t/data/testaln.stockholm BioPerl-1.6.900/t/data/hmmscan_multi_domain.out BioPerl-1.6.900/t/data/bl2seq.out BioPerl-1.6.900/t/data/hmmpfam_cs.out BioPerl-1.6.900/t/data/cysprot1b.hmmsearch BioPerl-1.6.900/t/data/sp_subset.obo BioPerl-1.6.900/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.900/t/data/ecolitst.bls BioPerl-1.6.900/t/data/gmap_f9-multiple_results.txt BioPerl-1.6.900/t/data/stress_test_medline.xml BioPerl-1.6.900/t/data/testdat.exonerate BioPerl-1.6.900/t/data/HUMBETGLOA.grail BioPerl-1.6.900/t/data/prints.out BioPerl-1.6.900/t/data/M12730.gb BioPerl-1.6.900/t/data/dq519393.gb BioPerl-1.6.900/t/data/assembly_with_singlets.ace BioPerl-1.6.900/t/data/genomic-seq.genscan BioPerl-1.6.900/t/data/mapmaker.txt BioPerl-1.6.900/t/data/13-pilE-F.scf BioPerl-1.6.900/t/data/withrefm.906 BioPerl-1.6.900/t/data/test.pln BioPerl-1.6.900/t/data/baseml.usertree BioPerl-1.6.900/t/data/signalp.nn.summary BioPerl-1.6.900/t/data/crab.nj BioPerl-1.6.900/t/data/nei_gojobori_test.aln BioPerl-1.6.900/t/data/version2.scf BioPerl-1.6.900/t/data/test_singlets.cns.fastq BioPerl-1.6.900/t/data/test.ptt BioPerl-1.6.900/t/data/test.maq BioPerl-1.6.900/t/data/phi.out BioPerl-1.6.900/t/data/catalase-webblast.BLASTP BioPerl-1.6.900/t/data/cds_sample.embl BioPerl-1.6.900/t/data/testaln.list BioPerl-1.6.900/t/data/testaln.po BioPerl-1.6.900/t/data/testaln.selex BioPerl-1.6.900/t/data/map_hem BioPerl-1.6.900/t/data/map_hem/HEM13.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM1.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM1-HEM12.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM13-HEM14.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM1-HEM14.fa BioPerl-1.6.900/t/data/map_hem/HEM15.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM1-HEM3.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM2-HEM13.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM3.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM3-HEM12.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM12-HEM13.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM4-HEM14.fa BioPerl-1.6.900/t/data/map_hem/HEM4-HEM12.fa BioPerl-1.6.900/t/data/map_hem/HEM2-HEM4.fa BioPerl-1.6.900/t/data/map_hem/HEM1-HEM4.fa BioPerl-1.6.900/t/data/map_hem/HEM3-HEM12.fa BioPerl-1.6.900/t/data/map_hem/HEM1-HEM4.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM1-HEM14.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM3-HEM14.fa BioPerl-1.6.900/t/data/map_hem/HEM1.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM2-HEM12.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM4-HEM12.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM13-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM4-HEM14.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM1-HEM12.fa BioPerl-1.6.900/t/data/map_hem/HEM3-HEM4.fa BioPerl-1.6.900/t/data/map_hem/HEM14-HEM15.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM4-HEM13.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM2-HEM14.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM3-HEM15.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM1-HEM12.fa.revcom BioPerl-1.6.900/t/data/map_hem/HEM2-HEM3.fa BioPerl-1.6.900/t/data/map_hem/yeast.nc.1.freq BioPerl-1.6.900/t/data/map_hem/HEM2.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM1-HEM3.fa BioPerl-1.6.900/t/data/map_hem/HEM3-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM1-HEM2.fa BioPerl-1.6.900/t/data/map_hem/HEM1-HEM15.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM3-HEM13.fa BioPerl-1.6.900/t/data/map_hem/HEM4.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM2-HEM14.fa BioPerl-1.6.900/t/data/map_hem/HEM2-HEM12.fa BioPerl-1.6.900/t/data/map_hem/HEM4-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM2-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM4-HEM13.fa BioPerl-1.6.900/t/data/map_hem/HEM1-HEM2.fa.revcom BioPerl-1.6.900/t/data/map_hem/HEM2-HEM13.fa BioPerl-1.6.900/t/data/map_hem/HEM2-HEM15.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM12-HEM15.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM12-HEM13.fa BioPerl-1.6.900/t/data/map_hem/HEM3-HEM4.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM1-HEM2.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM13-HEM14.fa BioPerl-1.6.900/t/data/map_hem/HEM2-HEM3.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM14.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM13.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM1-HEM13.fa BioPerl-1.6.900/t/data/map_hem/HEM2-HEM4.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM14-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM12-HEM14.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM12.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM12.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM3-HEM14.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM4.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM15.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM12-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM1-HEM13.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM3.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM3-HEM13.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM1-HEM15.fa BioPerl-1.6.900/t/data/map_hem/HEM12-HEM14.fa BioPerl-1.6.900/t/data/map_hem/HEM2.ups.fa_.revcom BioPerl-1.6.900/t/data/map_hem/HEM4-HEM15.meme.txt BioPerl-1.6.900/t/data/map_hem/HEM14.ups.fa_ BioPerl-1.6.900/t/data/map_hem/HEM13-HEM15.meme.txt BioPerl-1.6.900/t/data/eutils BioPerl-1.6.900/t/data/eutils/elink_neighbor_corr.xml BioPerl-1.6.900/t/data/eutils/egquery.xml BioPerl-1.6.900/t/data/eutils/elink_llinks.xml BioPerl-1.6.900/t/data/eutils/epost.xml BioPerl-1.6.900/t/data/eutils/elink_ncheck_corr.xml BioPerl-1.6.900/t/data/eutils/elink_ncheck.xml BioPerl-1.6.900/t/data/eutils/elink_nhist_corr.xml BioPerl-1.6.900/t/data/eutils/elink_nhist.xml BioPerl-1.6.900/t/data/eutils/espell.xml BioPerl-1.6.900/t/data/eutils/esummary1.xml BioPerl-1.6.900/t/data/eutils/elink_neighbor.xml BioPerl-1.6.900/t/data/eutils/esearch1.xml BioPerl-1.6.900/t/data/eutils/elink_scores.xml BioPerl-1.6.900/t/data/eutils/einfo_dbs.xml BioPerl-1.6.900/t/data/eutils/elink_acheck.xml BioPerl-1.6.900/t/data/eutils/elink_multidb.xml BioPerl-1.6.900/t/data/eutils/elink_lcheck_corr.xml BioPerl-1.6.900/t/data/eutils/elink_multidb_corr.xml BioPerl-1.6.900/t/data/eutils/esearch2.xml BioPerl-1.6.900/t/data/eutils/esummary2.xml BioPerl-1.6.900/t/data/eutils/elink_llinks_corr.xml BioPerl-1.6.900/t/data/eutils/elink_acheck_corr.xml BioPerl-1.6.900/t/data/eutils/elink_lcheck.xml BioPerl-1.6.900/t/data/eutils/elink_dball.xml BioPerl-1.6.900/t/data/eutils/einfo.xml BioPerl-1.6.900/t/data/seqfeaturedb BioPerl-1.6.900/t/data/seqfeaturedb/test.gff3 BioPerl-1.6.900/t/data/consed_project BioPerl-1.6.900/t/data/consed_project/phd_dir BioPerl-1.6.900/t/data/consed_project/phd_dir/ML4922R.phd.1 BioPerl-1.6.900/t/data/consed_project/phd_dir/ML4947F.phd.1 BioPerl-1.6.900/t/data/consed_project/phd_dir/ML4924R.phd.1 BioPerl-1.6.900/t/data/consed_project/phd_dir/ML4924F.phd.1 BioPerl-1.6.900/t/data/consed_project/edit_dir BioPerl-1.6.900/t/data/consed_project/edit_dir/test_projectNewChromats.fof BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.qual BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.log BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.phrap.out BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1 BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.problems BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.newtags BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2 BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.screen.out BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project_to_alu.cross BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.log BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.view BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.fasta.screen BioPerl-1.6.900/t/data/consed_project/edit_dir/test_project.contigs BioPerl-1.6.900/t/data/bad_dbfa BioPerl-1.6.900/t/data/bad_dbfa/bug3172.fa BioPerl-1.6.900/t/data/fastq BioPerl-1.6.900/t/data/fastq/test2_solexa.fastq BioPerl-1.6.900/t/data/fastq/error_short_qual.fastq BioPerl-1.6.900/t/data/fastq/error_qual_del.fastq BioPerl-1.6.900/t/data/fastq/bug2335.fastq BioPerl-1.6.900/t/data/fastq/solexa_faked.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_at_qual.fastq BioPerl-1.6.900/t/data/fastq/example.fasta BioPerl-1.6.900/t/data/fastq/error_spaces.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_in_qual.fastq BioPerl-1.6.900/t/data/fastq/error_tabs.fastq BioPerl-1.6.900/t/data/fastq/illumina_faked.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_at_seq.fastq BioPerl-1.6.900/t/data/fastq/example.qual BioPerl-1.6.900/t/data/fastq/error_qual_tab.fastq BioPerl-1.6.900/t/data/fastq/wrapping_issues.fastq BioPerl-1.6.900/t/data/fastq/error_double_seq.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_in_plus.fastq BioPerl-1.6.900/t/data/fastq/tricky.fastq BioPerl-1.6.900/t/data/fastq/error_double_qual.fastq BioPerl-1.6.900/t/data/fastq/sanger_faked.fastq BioPerl-1.6.900/t/data/fastq/error_diff_ids.fastq BioPerl-1.6.900/t/data/fastq/sanger_93.fastq BioPerl-1.6.900/t/data/fastq/error_long_qual.fastq BioPerl-1.6.900/t/data/fastq/error_qual_space.fastq BioPerl-1.6.900/t/data/fastq/solexa_example.fastq BioPerl-1.6.900/t/data/fastq/error_qual_escape.fastq BioPerl-1.6.900/t/data/fastq/example.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_at_plus.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_in_title.fastq BioPerl-1.6.900/t/data/fastq/test1_sanger.fastq BioPerl-1.6.900/t/data/fastq/evil_wrapping.fastq BioPerl-1.6.900/t/data/fastq/error_qual_null.fastq BioPerl-1.6.900/t/data/fastq/error_no_qual.fastq BioPerl-1.6.900/t/data/fastq/test3_illumina.fastq BioPerl-1.6.900/t/data/fastq/error_qual_unit_sep.fastq BioPerl-1.6.900/t/data/fastq/error_trunc_in_seq.fastq BioPerl-1.6.900/t/data/fastq/error_qual_vtab.fastq BioPerl-1.6.900/t/data/transfac_pro BioPerl-1.6.900/t/data/transfac_pro/readme.txt BioPerl-1.6.900/t/data/transfac_pro/matrix.dat BioPerl-1.6.900/t/data/transfac_pro/gene.dat BioPerl-1.6.900/t/data/transfac_pro/reference.dat BioPerl-1.6.900/t/data/transfac_pro/site.dat BioPerl-1.6.900/t/data/transfac_pro/factor.dat BioPerl-1.6.900/t/data/transfac_pro/fragment.dat BioPerl-1.6.900/t/data/dbfa BioPerl-1.6.900/t/data/dbfa/2.fa BioPerl-1.6.900/t/data/dbfa/5.fa BioPerl-1.6.900/t/data/dbfa/4.fa BioPerl-1.6.900/t/data/dbfa/7.fa BioPerl-1.6.900/t/data/dbfa/6.fa BioPerl-1.6.900/t/data/dbfa/1.fa BioPerl-1.6.900/t/data/dbfa/3.fa BioPerl-1.6.900/t/data/biodbgff BioPerl-1.6.900/t/data/biodbgff/test.gff BioPerl-1.6.900/t/data/biodbgff/test.gff3 BioPerl-1.6.900/t/data/msout BioPerl-1.6.900/t/data/msout/msout_infile4 BioPerl-1.6.900/t/data/msout/msout_infile1 BioPerl-1.6.900/t/data/msout/msout_infile3 BioPerl-1.6.900/t/data/msout/msout_infile2 BioPerl-1.6.900/t/data/codeml_lysozyme BioPerl-1.6.900/t/data/codeml_lysozyme/4fold.nuc BioPerl-1.6.900/t/data/codeml_lysozyme/mlc BioPerl-1.6.900/t/data/codeml_lysozyme/lnf BioPerl-1.6.900/t/data/codeml_lysozyme/2NG.tt BioPerl-1.6.900/t/data/codeml_lysozyme/2NG.dN BioPerl-1.6.900/t/data/codeml_lysozyme/lysozymeSmall.txt BioPerl-1.6.900/t/data/codeml_lysozyme/rst1 BioPerl-1.6.900/t/data/codeml_lysozyme/rst BioPerl-1.6.900/t/data/codeml_lysozyme/lysozymeSmall.ctl BioPerl-1.6.900/t/data/codeml_lysozyme/rub BioPerl-1.6.900/t/data/codeml_lysozyme/lysozymeSmall.trees BioPerl-1.6.900/t/data/codeml_lysozyme/2NG.dS BioPerl-1.6.900/t/data/dbqual BioPerl-1.6.900/t/data/dbqual/2.qual BioPerl-1.6.900/t/data/dbqual/1.qual BioPerl-1.6.900/t/data/dbqual/3.qual BioPerl-1.6.900/t/data/mbsout BioPerl-1.6.900/t/data/mbsout/mbsout_infile3 BioPerl-1.6.900/t/data/mbsout/mbsout_infile2 BioPerl-1.6.900/t/data/mbsout/mbsout_infile1 BioPerl-1.6.900/t/data/taxdump BioPerl-1.6.900/t/data/taxdump/nodes.dmp BioPerl-1.6.900/t/data/taxdump/names.dmp BioPerl-1.6.900/t/data/registry BioPerl-1.6.900/t/data/registry/flat BioPerl-1.6.900/t/data/registry/flat/seqdatabase.ini BioPerl-1.6.900/t/data/registry/bdb BioPerl-1.6.900/t/data/registry/bdb/seqdatabase.ini BioPerl-1.6.900/t/Restriction BioPerl-1.6.900/t/Restriction/Analysis.t BioPerl-1.6.900/t/Restriction/Analysis-refac.t BioPerl-1.6.900/t/Restriction/Gel.t BioPerl-1.6.900/t/Restriction/IO.t BioPerl-1.6.900/t/Draw BioPerl-1.6.900/t/Draw/Pictogram.t BioPerl-1.6.900/t/Variation BioPerl-1.6.900/t/Variation/DNAMutation.t BioPerl-1.6.900/t/Variation/Variation_IO.t BioPerl-1.6.900/t/Variation/AAReverseMutate.t BioPerl-1.6.900/t/Variation/RNAChange.t BioPerl-1.6.900/t/Variation/SeqDiff.t BioPerl-1.6.900/t/Variation/SNP.t BioPerl-1.6.900/t/Variation/AAChange.t BioPerl-1.6.900/t/Variation/Allele.t BioPerl-1.6.900/t/SeqIO BioPerl-1.6.900/t/SeqIO/table.t BioPerl-1.6.900/t/SeqIO/gbxml.t BioPerl-1.6.900/t/SeqIO/Handler.t BioPerl-1.6.900/t/SeqIO/pln.t BioPerl-1.6.900/t/SeqIO/chadoxml.t BioPerl-1.6.900/t/SeqIO/mbsout.t BioPerl-1.6.900/t/SeqIO/qual.t BioPerl-1.6.900/t/SeqIO/raw.t BioPerl-1.6.900/t/SeqIO/largefasta.t BioPerl-1.6.900/t/SeqIO/bsml_sax.t BioPerl-1.6.900/t/SeqIO/ctf.t BioPerl-1.6.900/t/SeqIO/genbank.t BioPerl-1.6.900/t/SeqIO/phd.t BioPerl-1.6.900/t/SeqIO/nexml.t BioPerl-1.6.900/t/SeqIO/Multiple_fasta.t BioPerl-1.6.900/t/SeqIO/asciitree.t BioPerl-1.6.900/t/SeqIO/Splicedseq.t BioPerl-1.6.900/t/SeqIO/strider.t BioPerl-1.6.900/t/SeqIO/fastq.t BioPerl-1.6.900/t/SeqIO/game.t BioPerl-1.6.900/t/SeqIO/SeqIO.t BioPerl-1.6.900/t/SeqIO/scf.t BioPerl-1.6.900/t/SeqIO/lasergene.t BioPerl-1.6.900/t/SeqIO/flybase_chadoxml.t BioPerl-1.6.900/t/SeqIO/entrezgene.t BioPerl-1.6.900/t/SeqIO/metafasta.t BioPerl-1.6.900/t/SeqIO/ace.t BioPerl-1.6.900/t/SeqIO/alf.t BioPerl-1.6.900/t/SeqIO/MultiFile.t BioPerl-1.6.900/t/SeqIO/ztr.t BioPerl-1.6.900/t/SeqIO/exp.t BioPerl-1.6.900/t/SeqIO/pir.t BioPerl-1.6.900/t/SeqIO/agave.t BioPerl-1.6.900/t/SeqIO/locuslink.t BioPerl-1.6.900/t/SeqIO/seqxml.t BioPerl-1.6.900/t/SeqIO/embl.t BioPerl-1.6.900/t/SeqIO/chaos.t BioPerl-1.6.900/t/SeqIO/msout.t BioPerl-1.6.900/t/SeqIO/kegg.t BioPerl-1.6.900/t/SeqIO/chaosxml.t BioPerl-1.6.900/t/SeqIO/fasta.t BioPerl-1.6.900/t/SeqIO/interpro.t BioPerl-1.6.900/t/SeqIO/tab.t BioPerl-1.6.900/t/SeqIO/abi.t BioPerl-1.6.900/t/SeqIO/swiss.t BioPerl-1.6.900/t/SeqIO/SeqBuilder.t BioPerl-1.6.900/t/SeqIO/tinyseq.t BioPerl-1.6.900/t/SeqIO/bsml.t BioPerl-1.6.900/t/SeqIO/excel.t BioPerl-1.6.900/t/SeqIO/tigr.t BioPerl-1.6.900/t/SeqIO/tigrxml.t BioPerl-1.6.900/t/SeqIO/gcg.t BioPerl-1.6.900/scripts BioPerl-1.6.900/scripts/README BioPerl-1.6.900/scripts/DB-HIV BioPerl-1.6.900/scripts/DB-HIV/hivq.PLS BioPerl-1.6.900/scripts/taxa BioPerl-1.6.900/scripts/taxa/taxonomy2tree.PLS BioPerl-1.6.900/scripts/taxa/TAG BioPerl-1.6.900/scripts/taxa/local_taxonomydb_query.PLS BioPerl-1.6.900/scripts/taxa/classify_hits_kingdom.PLS BioPerl-1.6.900/scripts/taxa/query_entrez_taxa.PLS BioPerl-1.6.900/scripts/taxa/taxid4species.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF BioPerl-1.6.900/scripts/Bio-DB-GFF/meta_gff.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/process_sgd.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/genbank2gff.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/bulk_load_gff.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/process_gadfly.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/README BioPerl-1.6.900/scripts/Bio-DB-GFF/genbank2gff3.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/process_wormbase.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/generate_histogram.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/fast_load_gff.PLS BioPerl-1.6.900/scripts/Bio-DB-GFF/load_gff.PLS BioPerl-1.6.900/scripts/searchio BioPerl-1.6.900/scripts/searchio/TAG BioPerl-1.6.900/scripts/searchio/README BioPerl-1.6.900/scripts/searchio/hmmer_to_table.PLS BioPerl-1.6.900/scripts/searchio/parse_hmmsearch.PLS BioPerl-1.6.900/scripts/searchio/fastam9_to_table.PLS BioPerl-1.6.900/scripts/searchio/filter_search.PLS BioPerl-1.6.900/scripts/searchio/search2table.PLS BioPerl-1.6.900/scripts/das BioPerl-1.6.900/scripts/das/TAG BioPerl-1.6.900/scripts/das/README BioPerl-1.6.900/scripts/das/das_server.pl BioPerl-1.6.900/scripts/Bio-DB-EUtilities BioPerl-1.6.900/scripts/Bio-DB-EUtilities/einfo.PLS BioPerl-1.6.900/scripts/DB BioPerl-1.6.900/scripts/DB/biofetch_genbank_proxy.PLS BioPerl-1.6.900/scripts/DB/TAG BioPerl-1.6.900/scripts/DB/bioflat_index.PLS BioPerl-1.6.900/scripts/DB/flanks.PLS BioPerl-1.6.900/scripts/DB/biogetseq.PLS BioPerl-1.6.900/scripts/utilities BioPerl-1.6.900/scripts/utilities/search2BSML.PLS BioPerl-1.6.900/scripts/utilities/TAG BioPerl-1.6.900/scripts/utilities/search2alnblocks.PLS BioPerl-1.6.900/scripts/utilities/search2gff.PLS BioPerl-1.6.900/scripts/utilities/bp_mrtrans.PLS BioPerl-1.6.900/scripts/utilities/mutate.PLS BioPerl-1.6.900/scripts/utilities/mask_by_search.PLS BioPerl-1.6.900/scripts/utilities/bp_nrdb.PLS BioPerl-1.6.900/scripts/utilities/pairwise_kaks.PLS BioPerl-1.6.900/scripts/utilities/README BioPerl-1.6.900/scripts/utilities/bp_sreformat.PLS BioPerl-1.6.900/scripts/utilities/download_query_genbank.PLS BioPerl-1.6.900/scripts/utilities/bp_netinstall.PLS BioPerl-1.6.900/scripts/utilities/remote_blast.PLS BioPerl-1.6.900/scripts/utilities/dbsplit.PLS BioPerl-1.6.900/scripts/utilities/search2tribe.PLS BioPerl-1.6.900/scripts/utilities/revtrans-motif.PLS BioPerl-1.6.900/scripts/utilities/seq_length.PLS BioPerl-1.6.900/scripts/seqstats BioPerl-1.6.900/scripts/seqstats/TAG BioPerl-1.6.900/scripts/seqstats/chaos_plot.PLS BioPerl-1.6.900/scripts/seqstats/aacomp.PLS BioPerl-1.6.900/scripts/seqstats/oligo_count.PLS BioPerl-1.6.900/scripts/seqstats/gccalc.PLS BioPerl-1.6.900/scripts/index BioPerl-1.6.900/scripts/index/TAG BioPerl-1.6.900/scripts/index/bp_index.PLS BioPerl-1.6.900/scripts/index/bp_seqret.PLS BioPerl-1.6.900/scripts/index/bp_fetch.PLS BioPerl-1.6.900/scripts/popgen BioPerl-1.6.900/scripts/popgen/heterogeneity_test.PLS BioPerl-1.6.900/scripts/popgen/composite_LD.PLS BioPerl-1.6.900/scripts/seq BioPerl-1.6.900/scripts/seq/extract_feature_seq.PLS BioPerl-1.6.900/scripts/seq/make_mrna_protein.PLS BioPerl-1.6.900/scripts/seq/TAG BioPerl-1.6.900/scripts/seq/unflatten_seq.PLS BioPerl-1.6.900/scripts/seq/split_seq.PLS BioPerl-1.6.900/scripts/seq/seqretsplit.PLS BioPerl-1.6.900/scripts/seq/translate_seq.PLS BioPerl-1.6.900/scripts/seq/seqconvert.PLS BioPerl-1.6.900/scripts/biblio BioPerl-1.6.900/scripts/biblio/TAG BioPerl-1.6.900/scripts/biblio/biblio.PLS BioPerl-1.6.900/scripts/Bio-DB-SeqFeature-Store BioPerl-1.6.900/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.PLS BioPerl-1.6.900/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.PLS BioPerl-1.6.900/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.PLS BioPerl-1.6.900/scripts/tree BioPerl-1.6.900/scripts/tree/blast2tree.PLS BioPerl-1.6.900/scripts/tree/TAG BioPerl-1.6.900/scripts/tree/tree2pag.PLS BioPerl-1.6.900/scripts/tree/nexus2nh.PLS BioPerl-1.6.900/models BioPerl-1.6.900/models/bio_map.dia BioPerl-1.6.900/models/population_proposal.txt BioPerl-1.6.900/models/popgen.dia BioPerl-1.6.900/models/coordinatemapper.dia BioPerl-1.6.900/models/README BioPerl-1.6.900/models/bioperl.dia BioPerl-1.6.900/models/map_proposal.txt BioPerl-1.6.900/models/biblio.dia BioPerl-1.6.900/models/maps_and_markers.dia BioPerl-1.6.900/models/bio_liveseq_variation.dia BioPerl-1.6.900/models/bio_restriction.dia BioPerl-1.6.900/doc BioPerl-1.6.900/doc/makedoc.PL BioPerl-1.6.900/doc/README BioPerl-1.6.900/doc/Deobfuscator BioPerl-1.6.900/doc/Deobfuscator/Build.PL BioPerl-1.6.900/doc/Deobfuscator/LICENSE BioPerl-1.6.900/doc/Deobfuscator/README BioPerl-1.6.900/doc/Deobfuscator/Changes BioPerl-1.6.900/doc/Deobfuscator/excluded_modules.txt BioPerl-1.6.900/doc/Deobfuscator/Makefile.PL BioPerl-1.6.900/doc/Deobfuscator/MANIFEST BioPerl-1.6.900/doc/Deobfuscator/META.yml BioPerl-1.6.900/doc/Deobfuscator/lib BioPerl-1.6.900/doc/Deobfuscator/lib/Deobfuscator.pm BioPerl-1.6.900/doc/Deobfuscator/t BioPerl-1.6.900/doc/Deobfuscator/t/pod.t BioPerl-1.6.900/doc/Deobfuscator/t/00.load.t BioPerl-1.6.900/doc/Deobfuscator/cgi-bin BioPerl-1.6.900/doc/Deobfuscator/cgi-bin/deob_detail.cgi BioPerl-1.6.900/doc/Deobfuscator/cgi-bin/deob_flowchart.png BioPerl-1.6.900/doc/Deobfuscator/cgi-bin/deob_help.html BioPerl-1.6.900/doc/Deobfuscator/cgi-bin/deob_interface.cgi BioPerl-1.6.900/doc/Deobfuscator/bin BioPerl-1.6.900/doc/Deobfuscator/bin/deob_index.pl ---- Unsatisfied dependencies detected during ---- ---- CJFIELDS/BioPerl-1.6.900.tar.gz ---- Module::Build [build_requires] Running make test Make had some problems, won't test Delayed until after prerequisites Running test for module 'Module::Build' Running make for D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz Checksum for C:\cpanfly\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Module-Build-0.3800.tar.gz ok Will not use Archive::Tar, need 1.00 Module-Build-0.3800 Module-Build-0.3800/Changes Module-Build-0.3800/MANIFEST Module-Build-0.3800/META.json Module-Build-0.3800/README Module-Build-0.3800/LICENSE Module-Build-0.3800/Build.PL Module-Build-0.3800/META.yml Module-Build-0.3800/INSTALL Module-Build-0.3800/Makefile.PL Module-Build-0.3800/t Module-Build-0.3800/t/perl_mb_opt.t Module-Build-0.3800/t/write_default_maniskip.t Module-Build-0.3800/t/help.t Module-Build-0.3800/t/tilde.t Module-Build-0.3800/t/sample.t Module-Build-0.3800/t/versions.t Module-Build-0.3800/t/compat.t Module-Build-0.3800/t/parents.t Module-Build-0.3800/t/pod_parser.t Module-Build-0.3800/t/install_extra_target.t Module-Build-0.3800/t/manifypods.t Module-Build-0.3800/t/metadata.t Module-Build-0.3800/t/PL_files.t Module-Build-0.3800/t/files.t Module-Build-0.3800/t/destinations.t Module-Build-0.3800/t/ppm.t Module-Build-0.3800/t/par.t Module-Build-0.3800/t/test_file_exts.t Module-Build-0.3800/t/resume.t Module-Build-0.3800/t/xs.t Module-Build-0.3800/t/install.t Module-Build-0.3800/t/script_dist.t Module-Build-0.3800/t/00-compile.t Module-Build-0.3800/t/notes.t Module-Build-0.3800/t/runthrough.t Module-Build-0.3800/t/mymeta.t Module-Build-0.3800/t/use_tap_harness.t Module-Build-0.3800/t/test_type.t Module-Build-0.3800/t/test_types.t Module-Build-0.3800/t/basic.t Module-Build-0.3800/t/new_from_context.t Module-Build-0.3800/t/ext.t Module-Build-0.3800/t/bundle_inc.t Module-Build-0.3800/t/README.pod Module-Build-0.3800/t/add_property.t Module-Build-0.3800/t/debug.t Module-Build-0.3800/t/metadata2.t Module-Build-0.3800/t/signature.t Module-Build-0.3800/t/extend.t Module-Build-0.3800/t/properties Module-Build-0.3800/t/properties/module_name.t Module-Build-0.3800/t/properties/share_dir.t Module-Build-0.3800/t/properties/dist_suffix.t Module-Build-0.3800/t/properties/needs_compiler.t Module-Build-0.3800/t/properties/requires.t Module-Build-0.3800/t/properties/license.t Module-Build-0.3800/t/properties/release_status.t Module-Build-0.3800/t/lib Module-Build-0.3800/t/lib/DistGen.pm Module-Build-0.3800/t/lib/MBTest.pm Module-Build-0.3800/t/lib/Module Module-Build-0.3800/t/lib/Module/Signature.pm Module-Build-0.3800/t/lib/Software Module-Build-0.3800/t/lib/Software/License Module-Build-0.3800/t/lib/Software/License/VaporWare.pm Module-Build-0.3800/t/bundled Module-Build-0.3800/t/bundled/Tie Module-Build-0.3800/t/bundled/Tie/CPHash.pm Module-Build-0.3800/t/bundled/Software Module-Build-0.3800/t/bundled/Software/License.pm Module-Build-0.3800/t/compat Module-Build-0.3800/t/compat/exit.t Module-Build-0.3800/t/actions Module-Build-0.3800/t/actions/installdeps.t Module-Build-0.3800/t/actions/manifest_skip.t Module-Build-0.3800/lib Module-Build-0.3800/lib/Module Module-Build-0.3800/lib/Module/Build.pm Module-Build-0.3800/lib/Module/Build Module-Build-0.3800/lib/Module/Build/PodParser.pm Module-Build-0.3800/lib/Module/Build/Bundling.pod Module-Build-0.3800/lib/Module/Build/Base.pm Module-Build-0.3800/lib/Module/Build/YAML.pm Module-Build-0.3800/lib/Module/Build/API.pod Module-Build-0.3800/lib/Module/Build/Version.pm Module-Build-0.3800/lib/Module/Build/Compat.pm Module-Build-0.3800/lib/Module/Build/ModuleInfo.pm Module-Build-0.3800/lib/Module/Build/Cookbook.pm Module-Build-0.3800/lib/Module/Build/Config.pm Module-Build-0.3800/lib/Module/Build/PPMMaker.pm Module-Build-0.3800/lib/Module/Build/Notes.pm Module-Build-0.3800/lib/Module/Build/Dumper.pm Module-Build-0.3800/lib/Module/Build/Authoring.pod Module-Build-0.3800/lib/Module/Build/Platform Module-Build-0.3800/lib/Module/Build/Platform/darwin.pm Module-Build-0.3800/lib/Module/Build/Platform/Unix.pm Module-Build-0.3800/lib/Module/Build/Platform/EBCDIC.pm Module-Build-0.3800/lib/Module/Build/Platform/aix.pm Module-Build-0.3800/lib/Module/Build/Platform/MPEiX.pm Module-Build-0.3800/lib/Module/Build/Platform/Default.pm Module-Build-0.3800/lib/Module/Build/Platform/MacOS.pm Module-Build-0.3800/lib/Module/Build/Platform/Windows.pm Module-Build-0.3800/lib/Module/Build/Platform/Amiga.pm Module-Build-0.3800/lib/Module/Build/Platform/cygwin.pm Module-Build-0.3800/lib/Module/Build/Platform/VMS.pm Module-Build-0.3800/lib/Module/Build/Platform/RiscOS.pm Module-Build-0.3800/lib/Module/Build/Platform/VOS.pm Module-Build-0.3800/lib/Module/Build/Platform/os2.pm Module-Build-0.3800/lib/inc Module-Build-0.3800/lib/inc/latest.pm Module-Build-0.3800/lib/inc/latest Module-Build-0.3800/lib/inc/latest/private.pm Module-Build-0.3800/inc Module-Build-0.3800/inc/MBVersion.pm Module-Build-0.3800/inc/bootstrap.pl Module-Build-0.3800/inc/Perl Module-Build-0.3800/inc/Perl/OSType.pm Module-Build-0.3800/inc/Module Module-Build-0.3800/inc/Module/Metadata.pm Module-Build-0.3800/bin Module-Build-0.3800/bin/config_data Module-Build-0.3800/contrib Module-Build-0.3800/contrib/bash_completion.module-build CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Subroutine os_type redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 90. Subroutine is_os_type redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 96. Subroutine os_family redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 103. Subroutine is_os_family redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 110. *** BOOTSTRAPPING Perl::OSType *** *** BOOTSTRAPPING version *** *** BOOTSTRAPPING Module::Metadata *** # running Build.PL Subroutine os_type redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 90. Subroutine is_os_type redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 96. Subroutine os_family redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 103. Subroutine is_os_family redefined at C:/cpanfly/var/megalib/Perl/OSType.pm line 110. *** BOOTSTRAPPING Perl::OSType *** *** BOOTSTRAPPING version *** *** BOOTSTRAPPING Module::Metadata *** Checking prerequisites... requires: ! CPAN::Meta (2.101670) is installed, but we need version >= 2.110420 ! Module::Metadata (1.000001) is installed, but we need version >= 1.000002 ! Perl::OSType (0.005) is installed, but we need version >= 1 build_requires: ! Parse::CPAN::Meta (1.40) is installed, but we need version >= 1.4401 Checking optional features... inc_bundling_support....disabled requires: ! ExtUtils::Install (1.52) is installed, but we need version >= 1.54 ! ExtUtils::Installed (1.43) is installed, but we need version >= 1.999 ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions of the modules indicated above before proceeding with this installation Could not create MYMETA files Copied META.yml to MYMETA.yml for bootstrapping These additional prerequisites must be installed: requires: ! Perl::OSType (we need version 1.00) ! version (we need version 0.87) ! Module::Metadata (we need version 1.000002) Creating new 'Build' script for 'Module-Build' version '0.3800' These additional prerequisites must be installed: requires: ! Perl::OSType (we need version 1.00) ! version (we need version 0.87) ! Module::Metadata (we need version 1.000002) ---- Unsatisfied dependencies detected during ---- ---- DAGOLDEN/Module-Build-0.3800.tar.gz ---- Module::Metadata [requires] CPAN::Meta [requires] Perl::OSType [requires] Parse::CPAN::Meta [build_requires] version [requires] Running make test Delayed until after prerequisites Running test for module 'Module::Metadata' Running make for D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz Checksum for C:\cpanfly\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Module-Metadata-1.000004.tar.gz ok Will not use Archive::Tar, need 1.00 Module-Metadata-1.000004/ Module-Metadata-1.000004/maint/ Module-Metadata-1.000004/maint/Makefile.PL.include Module-Metadata-1.000004/maint/Makefile.include Module-Metadata-1.000004/maint/bump-version Module-Metadata-1.000004/t/ Module-Metadata-1.000004/t/lib/ Module-Metadata-1.000004/t/lib/Tie/ Module-Metadata-1.000004/t/lib/Tie/CPHash.pm Module-Metadata-1.000004/t/lib/MBTest.pm Module-Metadata-1.000004/t/lib/DistGen.pm Module-Metadata-1.000004/t/metadata.t Module-Metadata-1.000004/Changes Module-Metadata-1.000004/MANIFEST Module-Metadata-1.000004/lib/ Module-Metadata-1.000004/lib/Module/ Module-Metadata-1.000004/lib/Module/Metadata.pm Module-Metadata-1.000004/xt/ Module-Metadata-1.000004/xt/pod.t Module-Metadata-1.000004/Makefile.PL Module-Metadata-1.000004/META.yml CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Warning: prerequisite version 0.87 not found. We have 0.82. Checking if your kit is complete... Looks good Writing Makefile for Module::Metadata ---- Unsatisfied dependencies detected during ---- ---- DAGOLDEN/Module-Metadata-1.000004.tar.gz ---- version [requires] Running make test Delayed until after prerequisites Running test for module 'version' Running make for J/JP/JPEACOCK/version-0.88.tar.gz Checksum for C:\cpanfly\var\cpan\sources\authors\id\J\JP\JPEACOCK\version-0.88.tar.gz ok Will not use Archive::Tar, need 1.00 version-0.88/ version-0.88/t/ version-0.88/t/02derived.t version-0.88/t/04strict_lax.t version-0.88/t/coretests.pm version-0.88/t/03require.t version-0.88/t/survey_locales version-0.88/t/01base.t version-0.88/vutil/ version-0.88/vutil/vutil.h version-0.88/vutil/vxs.xs version-0.88/vutil/lib/ version-0.88/vutil/lib/version/ version-0.88/vutil/lib/version/vxs.pm version-0.88/vutil/vutil.c version-0.88/vutil/ppport.h version-0.88/vperl/ version-0.88/vperl/vpp.pm version-0.88/MANIFEST.SKIP version-0.88/META.yml version-0.88/Changes version-0.88/Makefile.PL version-0.88/README version-0.88/lib/ version-0.88/lib/version.pod version-0.88/lib/version.pm version-0.88/lib/version/ version-0.88/lib/version/typemap version-0.88/lib/version/Internals.pod version-0.88/MANIFEST CPAN.pm: Going to build J/JP/JPEACOCK/version-0.88.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Testing if you have a C compiler compilet-349306880.c Creating library C:\cpanfly\var\tmp\compilet.lib and object C:\cpanfly\var\tmp\compilet.exp Generating code Finished generating code Checking if your kit is complete... Looks good Writing Makefile for version::vxs Writing Makefile for version >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/version/Internals.pod blib\lib/version/Internals.pod cp lib/version.pm blib\lib/version.pm cp lib/version.pod blib\lib/version.pod nmake -f Makefile all -nologo cp lib/version/vxs.pm ..\blib\lib\version\vxs.pm cl -c -nologo -GF -W3 -MD -Zi -DNDEBUG -Ox -GL -Wp64 -fp:precise -DWIN32 -D_CONSOLE -DNO_STRICT -DHAVE_DES_FCRYPT -DWIN64 -DCONSERVATIVE -DUSE_SITECUSTOMIZE -DPRIVLIB_LAST_IN_INC -DPERL_IMPLICIT_CONTEXT -DPERL_IMPLICIT_SYS -DUSE_PERLIO -DPERL_MSVCRT_READFIX -MD -Zi -DNDEBUG -Ox -GL -Wp64 -fp:precise -DVERSION=\"0.88\" -DXS_VERSION=\"0.88\" "-IC:\Perl64\lib\CORE" vutil.c vutil.c c:\cpanfly\var\cpan\build\version-0.88-LpSB1J\vutil\vutil.h(43) : warning C4101: 'args' : unreferenced local variable vutil.c(469) : warning C4244: 'initializing' : conversion from 'IV' to 'const I32', possible loss of data vutil.c(483) : warning C4244: 'initializing' : conversion from 'IV' to 'const I32', possible loss of data vutil.c(495) : warning C4267: 'function' : conversion from 'size_t' to 'I32', possible loss of data vutil.c(552) : warning C4267: 'function' : conversion from 'size_t' to 'I32', possible loss of data vutil.c(695) : warning C4244: '=' : conversion from 'IV' to 'int', possible loss of data vutil.c(711) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(715) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(728) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(778) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(781) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(788) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(887) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data vutil.c(888) : warning C4244: '=' : conversion from 'IV' to 'I32', possible loss of data C:\Perl64\bin\perl.exe C:\cpanfly\var\megalib\ExtUtils\xsubpp -typemap C:\Perl64\lib\ExtUtils\typemap -typemap ../lib/version/typemap vxs.xs > vxs.xsc && C:\Perl64\bin\perl.exe -MExtUtils::Command -e "mv" -- vxs.xsc vxs.c cl -c -nologo -GF -W3 -MD -Zi -DNDEBUG -Ox -GL -Wp64 -fp:precise -DWIN32 -D_CONSOLE -DNO_STRICT -DHAVE_DES_FCRYPT -DWIN64 -DCONSERVATIVE -DUSE_SITECUSTOMIZE -DPRIVLIB_LAST_IN_INC -DPERL_IMPLICIT_CONTEXT -DPERL_IMPLICIT_SYS -DUSE_PERLIO -DPERL_MSVCRT_READFIX -MD -Zi -DNDEBUG -Ox -GL -Wp64 -fp:precise -DVERSION=\"0.88\" -DXS_VERSION=\"0.88\" "-IC:\Perl64\lib\CORE" vxs.c vxs.c c:\cpanfly\var\cpan\build\version-0.88-LpSB1J\vutil\vutil.h(43) : warning C4101: 'args' : unreferenced local variable Running Mkbootstrap for version::vxs () C:\Perl64\bin\perl.exe -MExtUtils::Command -e "chmod" -- 644 vxs.bs C:\Perl64\bin\perl.exe -MExtUtils::Mksymlists -e "Mksymlists('NAME'=>\"version::vxs\", 'DLBASE' => 'vxs', 'DL_FUNCS' => { }, 'FUNCLIST' => [], 'IMPORTS' => { }, 'DL_VARS' => []);" link -out:..\blib\arch\auto\version\vxs\vxs.dll -dll -nologo -nodefaultlib -debug -opt:ref,icf -ltcg -libpath:"C:\Perl64\lib\CORE" -machine:AMD64 vutil.obj vxs.obj C:\Perl64\lib\CORE\perl510.lib oldnames.lib kernel32.lib user32.lib gdi32.lib winspool.lib comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib netapi32.lib uuid.lib ws2_32.lib mpr.lib winmm.lib version.lib odbc32.lib odbccp32.lib bufferoverflowU.lib msvcrt.lib -def:vxs.def Creating library ..\blib\arch\auto\version\vxs\vxs.lib and object ..\blib\arch\auto\version\vxs\vxs.exp Generating code Finished generating code if exist ..\blib\arch\auto\version\vxs\vxs.dll.manifest mt -nologo -manifest ..\blib\arch\auto\version\vxs\vxs.dll.manifest -outputresource:..\blib\arch\auto\version\vxs\vxs.dll;2 if exist ..\blib\arch\auto\version\vxs\vxs.dll.manifest del ..\blib\arch\auto\version\vxs\vxs.dll.manifest C:\Perl64\bin\perl.exe -MExtUtils::Command -e "chmod" -- 755 ..\blib\arch\auto\version\vxs\vxs.dll C:\Perl64\bin\perl.exe -MExtUtils::Command -e "cp" -- vxs.bs ..\blib\arch\auto\version\vxs\vxs.bs C:\Perl64\bin\perl.exe -MExtUtils::Command -e "chmod" -- 644 ..\blib\arch\auto\version\vxs\vxs.bs cd .. JPEACOCK/version-0.88.tar.gz nmake -- OK Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. nmake -f Makefile all -nologo cd .. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/01base.t ........ ok 1 - use version; ok 2 - 5.005_03 eq 5.00503 ok 3 - 1.23 eq "1.23" ok 4 - "5.005_03" eq "5.005_03" ok 5 - "v1.23" eq "v1.23" ok 6 - 5.005 eq "5.005" ok 7 - 5.006.001 eq v5.6.1 ok 8 - No leading v ok 9 - alpha version 1.2.3_4 eq v1.2.3_4 ok 10 - Invalid version format (multiple underscores) ok 11 - Invalid version format (underscores before decimal) ok 12 - Invalid version format (alpha without decimal) ok 13 - Invalid version format (non-numeric data) ok 14 - Invalid version format (non-numeric data) ok 15 - Invalid version format (non-numeric data) ok 16 - boolean ok 17 - The object isa version ok 18 - $version <=> $version == 0 ok 19 - $version == $version ok 20 - $version == $version ok 21 - $version < $new_version ok 22 - $new_version > $version ok 23 - $version != $new_version ok 24 - $version < $new_version ok 25 - $new_version > $version ok 26 - $version != $new_version ok 27 - $version->numify() == 5.006001 ok 28 - $version->numify() <= 5.006001 ok 29 - $version->numify() < 5.008 ok 30 - $version == "1.2.3" ok 31 - $version->numify == 1.002003 ok 32 - $version == 2002.9.30.1 ok 33 - $version->numify == 2002.009030001 ok 34 - $version < $new_version ok 35 - $new_version > $version ok 36 - $version != $new_version ok 37 - $version > $new_version ok 38 - $new_version < $version ok 39 - $version != $new_version ok 40 - $version < $new_version ok 41 - $new_version > $version ok 42 - $version != $new_version ok 43 - !$version->is_alpha ok 44 - $new_version->is_alpha ok 45 - $version > $new_version ok 46 - $new_version < $version ok 47 - $version != $new_version ok 48 - $version > $new_version ok 49 - $new_version < $version ok 50 - $version != $new_version ok 51 - $version == $new_version ok 52 - $version == $new_version ok 53 - $version < $new_version ok 54 - $version < $new_version ok 55 - $version > $new_version ok 56 - noop ++ ok 57 - noop -- ok 58 - noop / ok 59 - noop * ok 60 - noop abs ok 61 - qv("1.2") == "1.2.0" ok 62 - qv(1.2) == "1.2.0" ok 63 - The object isa version ok 64 - new from existing object ok 65 - class->new(v1.2) identical ok 66 - The object isa version ok 67 - version->new() doesn't clone ok 68 - $version->$method("1.2.3") works too ok 69 - qw$Revision: 1.2$ == 1.2.0 ok 70 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 71 - CPAN-style alpha version ok 72 - 1.23_01 > 1.23 ok 73 - 1.23_01 < 1.24 ok 74 - Replacement eval works with exact version ok 75 - Called as class method ok 76 - Don't freak if the module doesn't even exist ok 77 - Replacement eval works with incremented version ok 78 - Replacement eval works with single digit ok 79 - Replacement eval works with incremented digit ok 80 - Replacement handles modules without package or VERSION ok 81 - Replacement handles modules without package or VERSION ok 82 - Called as class method ok 83 - Replacement handles modules without VERSION ok 84 - Replacement handles modules without VERSION ok 85 - Replacement handles modules without VERSION ok 86 - Replacement handles modules without VERSION ok 87 - "$version" eq 1.2.3 ok 88 - $version == $new_version ok 89 - v-string initialized $qv_declare() ok 90 - "$version" eq "v1.2.3_4" ok 91 - "$version" eq "v1.2.3_4" (from eval) ok 92 - trailing zeros preserved ok 93 - trailing zeros preserved ok 94 - trailing zeros preserved ok 95 - trailing zeros preserved ok 96 - leading zero inferred ok 97 - leading space ignored ok 98 - Undef version comparison \#1 ok 99 - Undef version comparison \#2 ok 100 - Version string 'undef' ok 101 - Version string 'undef' ok 102 - Undef version comparison \#3 ok 103 - Undef version comparison \#4 ok 104 - No initializer at all ok 105 - Undef version comparison \#5 ok 106 - Undef version comparison \#6 ok 107 - Very small version objects ok 108 - Make sure very small versions don't freak ok 109 - Comparing vs. version with no decimal ok 110 - Comparing vs. version with decimal only ok 111 - Make sure very small versions don't freak ok 112 - Succeed - required == VERSION ok 113 - No undef warnings ok 114 - make sure we cleared qv() properly ok 115 - make sure we exported qv() properly ok 116 - The object isa tU6M3_3p ok 117 - User typed numeric so we error with numeric ok 118 - User typed extended so we error with extended ok 119 # skip Cannot test locale handling without a comma locale ok 120 # skip Cannot test locale handling without a comma locale ok 121 # skip Cannot test locale handling without a comma locale ok 122 # skip Cannot test locale handling without a comma locale ok 123 - Invalid version format 1._1 ok 124 - Too large version ok 125 - Too large version ok 126 - Don't fall for Data::Dumper's tricks ok 127 - Deal with badly serialized versions from YAML ok 128 - Deal with badly serialized versions from YAML ok 129 - Correctly guesses this is not a v-string ok 130 - Correctly guess that this is a v-string ok 131 - Compare 3 and 4 digit v-strings ok 132 - Compare 3 and 4 digit v-strings, leaving v ok 133 - Compare 3 and 4 digit v-strings, quoted ok 134 - Compare 3 and 4 digit v-strings, quoted leading v ok 135 - 5.005_03 eq 5.00503 ok 136 - 1.23 eq "1.23" ok 137 - "5.005_03" eq "5.005_03" ok 138 - "v1.23" eq "v1.23" ok 139 - 5.005 eq "5.005" ok 140 - 5.006.001 eq v5.6.1 ok 141 - No leading v ok 142 - alpha version 1.2.3_4 eq v1.2.3_4 ok 143 - Invalid version format (multiple underscores) ok 144 - Invalid version format (underscores before decimal) ok 145 - Invalid version format (alpha without decimal) ok 146 - Invalid version format (non-numeric data) ok 147 - Invalid version format (non-numeric data) ok 148 - Invalid version format (non-numeric data) ok 149 - boolean ok 150 - The object isa version ok 151 - $version <=> $version == 0 ok 152 - $version == $version ok 153 - $version == $version ok 154 - $version < $new_version ok 155 - $new_version > $version ok 156 - $version != $new_version ok 157 - $version < $new_version ok 158 - $new_version > $version ok 159 - $version != $new_version ok 160 - $version->numify() == 5.006001 ok 161 - $version->numify() <= 5.006001 ok 162 - $version->numify() < 5.008 ok 163 - $version == "1.2.3" ok 164 - $version->numify == 1.002003 ok 165 - $version == 2002.9.30.1 ok 166 - $version->numify == 2002.009030001 ok 167 - $version < $new_version ok 168 - $new_version > $version ok 169 - $version != $new_version ok 170 - $version > $new_version ok 171 - $new_version < $version ok 172 - $version != $new_version ok 173 - $version < $new_version ok 174 - $new_version > $version ok 175 - $version != $new_version ok 176 - !$version->is_alpha ok 177 - $new_version->is_alpha ok 178 - $version > $new_version ok 179 - $new_version < $version ok 180 - $version != $new_version ok 181 - $version > $new_version ok 182 - $new_version < $version ok 183 - $version != $new_version ok 184 - $version == $new_version ok 185 - $version == $new_version ok 186 - $version < $new_version ok 187 - $version < $new_version ok 188 - $version > $new_version ok 189 - noop ++ ok 190 - noop -- ok 191 - noop / ok 192 - noop * ok 193 - noop abs ok 194 - declare("1.2") == "1.2.0" ok 195 - declare(1.2) == "1.2.0" ok 196 - The object isa version ok 197 - new from existing object ok 198 - class->new(v1.2) identical ok 199 - The object isa version ok 200 - version->new() doesn't clone ok 201 - $version->$method("1.2.3") works too ok 202 - qw$Revision: 1.2$ == 1.2.0 ok 203 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 204 - CPAN-style alpha version ok 205 - 1.23_01 > 1.23 ok 206 - 1.23_01 < 1.24 ok 207 - Replacement eval works with exact version ok 208 - Called as class method ok 209 - Don't freak if the module doesn't even exist ok 210 - Replacement eval works with incremented version ok 211 - Replacement eval works with single digit ok 212 - Replacement eval works with incremented digit ok 213 - Replacement handles modules without package or VERSION ok 214 - Replacement handles modules without package or VERSION ok 215 - Called as class method ok 216 - Replacement handles modules without VERSION ok 217 - Replacement handles modules without VERSION ok 218 - Replacement handles modules without VERSION ok 219 - Replacement handles modules without VERSION ok 220 - "$version" eq 1.2.3 ok 221 - $version == $new_version ok 222 - v-string initialized $qv_declare() ok 223 - "$version" eq "v1.2.3_4" ok 224 - "$version" eq "v1.2.3_4" (from eval) ok 225 - trailing zeros preserved ok 226 - trailing zeros preserved ok 227 - trailing zeros preserved ok 228 - trailing zeros preserved ok 229 - leading zero inferred ok 230 - leading space ignored ok 231 - Undef version comparison \#1 ok 232 - Undef version comparison \#2 ok 233 - Version string 'undef' ok 234 - Version string 'undef' ok 235 - Undef version comparison \#3 ok 236 - Undef version comparison \#4 ok 237 - No initializer at all ok 238 - Undef version comparison \#5 ok 239 - Undef version comparison \#6 ok 240 - Very small version objects ok 241 - Make sure very small versions don't freak ok 242 - Comparing vs. version with no decimal ok 243 - Comparing vs. version with decimal only ok 244 - Make sure very small versions don't freak ok 245 - Succeed - required == VERSION ok 246 - No undef warnings ok 247 - make sure we cleared declare() properly ok 248 - make sure we exported declare() properly ok 249 - The object isa te0cq7N0 ok 250 - User typed numeric so we error with numeric ok 251 - User typed extended so we error with extended ok 252 # skip Cannot test locale handling without a comma locale ok 253 # skip Cannot test locale handling without a comma locale ok 254 # skip Cannot test locale handling without a comma locale ok 255 # skip Cannot test locale handling without a comma locale ok 256 - Invalid version format 1._1 ok 257 - Too large version ok 258 - Too large version ok 259 - Don't fall for Data::Dumper's tricks ok 260 - Deal with badly serialized versions from YAML ok 261 - Deal with badly serialized versions from YAML ok 262 - Correctly guesses this is not a v-string ok 263 - Correctly guess that this is a v-string ok 264 - Compare 3 and 4 digit v-strings ok 265 - Compare 3 and 4 digit v-strings, leaving v ok 266 - Compare 3 and 4 digit v-strings, quoted ok 267 - Compare 3 and 4 digit v-strings, quoted leading v ok 268 - 5.005_03 eq 5.00503 ok 269 - 1.23 eq "1.23" ok 270 - "5.005_03" eq "5.005_03" ok 271 - "v1.23" eq "v1.23" ok 272 - 5.005 eq "5.005" ok 273 - 5.006.001 eq v5.6.1 ok 274 - No leading v ok 275 - alpha version 1.2.3_4 eq v1.2.3_4 ok 276 - Invalid version format (multiple underscores) ok 277 - Invalid version format (underscores before decimal) ok 278 - Invalid version format (alpha without decimal) ok 279 - Invalid version format (non-numeric data) ok 280 - Invalid version format (non-numeric data) ok 281 - Invalid version format (non-numeric data) ok 282 - boolean ok 283 - The object isa version ok 284 - $version <=> $version == 0 ok 285 - $version == $version ok 286 - $version == $version ok 287 - $version < $new_version ok 288 - $new_version > $version ok 289 - $version != $new_version ok 290 - $version < $new_version ok 291 - $new_version > $version ok 292 - $version != $new_version ok 293 - $version->numify() == 5.006001 ok 294 - $version->numify() <= 5.006001 ok 295 - $version->numify() < 5.008 ok 296 - $version == "1.2.3" ok 297 - $version->numify == 1.002003 ok 298 - $version == 2002.9.30.1 ok 299 - $version->numify == 2002.009030001 ok 300 - $version < $new_version ok 301 - $new_version > $version ok 302 - $version != $new_version ok 303 - $version > $new_version ok 304 - $new_version < $version ok 305 - $version != $new_version ok 306 - $version < $new_version ok 307 - $new_version > $version ok 308 - $version != $new_version ok 309 - !$version->is_alpha ok 310 - $new_version->is_alpha ok 311 - $version > $new_version ok 312 - $new_version < $version ok 313 - $version != $new_version ok 314 - $version > $new_version ok 315 - $new_version < $version ok 316 - $version != $new_version ok 317 - $version == $new_version ok 318 - $version == $new_version ok 319 - $version < $new_version ok 320 - $version < $new_version ok 321 - $version > $new_version ok 322 - noop ++ ok 323 - noop -- ok 324 - noop / ok 325 - noop * ok 326 - noop abs ok 327 - qv("1.2") == "1.2.0" ok 328 - qv(1.2) == "1.2.0" ok 329 - The object isa version ok 330 - new from existing object ok 331 - class->parse(v1.2) identical ok 332 - The object isa version ok 333 - version->parse() doesn't clone ok 334 - $version->$method("1.2.3") works too ok 335 - qw$Revision: 1.2$ == 1.2.0 ok 336 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 337 - CPAN-style alpha version ok 338 - 1.23_01 > 1.23 ok 339 - 1.23_01 < 1.24 ok 340 - Replacement eval works with exact version ok 341 - Called as class method ok 342 - Don't freak if the module doesn't even exist ok 343 - Replacement eval works with incremented version ok 344 - Replacement eval works with single digit ok 345 - Replacement eval works with incremented digit ok 346 - Replacement handles modules without package or VERSION ok 347 - Replacement handles modules without package or VERSION ok 348 - Called as class method ok 349 - Replacement handles modules without VERSION ok 350 - Replacement handles modules without VERSION ok 351 - Replacement handles modules without VERSION ok 352 - Replacement handles modules without VERSION ok 353 - "$version" eq 1.2.3 ok 354 - $version == $new_version ok 355 - v-string initialized $qv_declare() ok 356 - "$version" eq "v1.2.3_4" ok 357 - "$version" eq "v1.2.3_4" (from eval) ok 358 - trailing zeros preserved ok 359 - trailing zeros preserved ok 360 - trailing zeros preserved ok 361 - trailing zeros preserved ok 362 - leading zero inferred ok 363 - leading space ignored ok 364 - Undef version comparison \#1 ok 365 - Undef version comparison \#2 ok 366 - Version string 'undef' ok 367 - Version string 'undef' ok 368 - Undef version comparison \#3 ok 369 - Undef version comparison \#4 ok 370 - No initializer at all ok 371 - Undef version comparison \#5 ok 372 - Undef version comparison \#6 ok 373 - Very small version objects ok 374 - Make sure very small versions don't freak ok 375 - Comparing vs. version with no decimal ok 376 - Comparing vs. version with decimal only ok 377 - Make sure very small versions don't freak ok 378 - Succeed - required == VERSION ok 379 - No undef warnings ok 380 - make sure we cleared qv() properly ok 381 - make sure we exported qv() properly ok 382 - The object isa ttOZW4a7 ok 383 - User typed numeric so we error with numeric ok 384 - User typed extended so we error with extended ok 385 # skip Cannot test locale handling without a comma locale ok 386 # skip Cannot test locale handling without a comma locale ok 387 # skip Cannot test locale handling without a comma locale ok 388 # skip Cannot test locale handling without a comma locale ok 389 - Invalid version format 1._1 ok 390 - Too large version ok 391 - Too large version ok 392 - Don't fall for Data::Dumper's tricks ok 393 - Deal with badly serialized versions from YAML ok 394 - Deal with badly serialized versions from YAML ok 395 - Correctly guesses this is not a v-string ok 396 - Correctly guess that this is a v-string ok 397 - Compare 3 and 4 digit v-strings ok 398 - Compare 3 and 4 digit v-strings, leaving v ok 399 - Compare 3 and 4 digit v-strings, quoted ok 400 - Compare 3 and 4 digit v-strings, quoted leading v ok 401 - 5.005_03 eq 5.00503 ok 402 - 1.23 eq "1.23" ok 403 - "5.005_03" eq "5.005_03" ok 404 - "v1.23" eq "v1.23" ok 405 - 5.005 eq "5.005" ok 406 - 5.006.001 eq v5.6.1 ok 407 - No leading v ok 408 - alpha version 1.2.3_4 eq v1.2.3_4 ok 409 - Invalid version format (multiple underscores) ok 410 - Invalid version format (underscores before decimal) ok 411 - Invalid version format (alpha without decimal) ok 412 - Invalid version format (non-numeric data) ok 413 - Invalid version format (non-numeric data) ok 414 - Invalid version format (non-numeric data) ok 415 - boolean ok 416 - The object isa version ok 417 - $version <=> $version == 0 ok 418 - $version == $version ok 419 - $version == $version ok 420 - $version < $new_version ok 421 - $new_version > $version ok 422 - $version != $new_version ok 423 - $version < $new_version ok 424 - $new_version > $version ok 425 - $version != $new_version ok 426 - $version->numify() == 5.006001 ok 427 - $version->numify() <= 5.006001 ok 428 - $version->numify() < 5.008 ok 429 - $version == "1.2.3" ok 430 - $version->numify == 1.002003 ok 431 - $version == 2002.9.30.1 ok 432 - $version->numify == 2002.009030001 ok 433 - $version < $new_version ok 434 - $new_version > $version ok 435 - $version != $new_version ok 436 - $version > $new_version ok 437 - $new_version < $version ok 438 - $version != $new_version ok 439 - $version < $new_version ok 440 - $new_version > $version ok 441 - $version != $new_version ok 442 - !$version->is_alpha ok 443 - $new_version->is_alpha ok 444 - $version > $new_version ok 445 - $new_version < $version ok 446 - $version != $new_version ok 447 - $version > $new_version ok 448 - $new_version < $version ok 449 - $version != $new_version ok 450 - $version == $new_version ok 451 - $version == $new_version ok 452 - $version < $new_version ok 453 - $version < $new_version ok 454 - $version > $new_version ok 455 - noop ++ ok 456 - noop -- ok 457 - noop / ok 458 - noop * ok 459 - noop abs ok 460 - declare("1.2") == "1.2.0" ok 461 - declare(1.2) == "1.2.0" ok 462 - The object isa version ok 463 - new from existing object ok 464 - class->parse(v1.2) identical ok 465 - The object isa version ok 466 - version->parse() doesn't clone ok 467 - $version->$method("1.2.3") works too ok 468 - qw$Revision: 1.2$ == 1.2.0 ok 469 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 470 - CPAN-style alpha version ok 471 - 1.23_01 > 1.23 ok 472 - 1.23_01 < 1.24 ok 473 - Replacement eval works with exact version ok 474 - Called as class method ok 475 - Don't freak if the module doesn't even exist ok 476 - Replacement eval works with incremented version ok 477 - Replacement eval works with single digit ok 478 - Replacement eval works with incremented digit ok 479 - Replacement handles modules without package or VERSION ok 480 - Replacement handles modules without package or VERSION ok 481 - Called as class method ok 482 - Replacement handles modules without VERSION ok 483 - Replacement handles modules without VERSION ok 484 - Replacement handles modules without VERSION ok 485 - Replacement handles modules without VERSION ok 486 - "$version" eq 1.2.3 ok 487 - $version == $new_version ok 488 - v-string initialized $qv_declare() ok 489 - "$version" eq "v1.2.3_4" ok 490 - "$version" eq "v1.2.3_4" (from eval) ok 491 - trailing zeros preserved ok 492 - trailing zeros preserved ok 493 - trailing zeros preserved ok 494 - trailing zeros preserved ok 495 - leading zero inferred ok 496 - leading space ignored ok 497 - Undef version comparison \#1 ok 498 - Undef version comparison \#2 ok 499 - Version string 'undef' ok 500 - Version string 'undef' ok 501 - Undef version comparison \#3 ok 502 - Undef version comparison \#4 ok 503 - No initializer at all ok 504 - Undef version comparison \#5 ok 505 - Undef version comparison \#6 ok 506 - Very small version objects ok 507 - Make sure very small versions don't freak ok 508 - Comparing vs. version with no decimal ok 509 - Comparing vs. version with decimal only ok 510 - Make sure very small versions don't freak ok 511 - Succeed - required == VERSION ok 512 - No undef warnings ok 513 - make sure we cleared declare() properly ok 514 - make sure we exported declare() properly ok 515 - The object isa tghU7HIO ok 516 - User typed numeric so we error with numeric ok 517 - User typed extended so we error with extended ok 518 # skip Cannot test locale handling without a comma locale ok 519 # skip Cannot test locale handling without a comma locale ok 520 # skip Cannot test locale handling without a comma locale ok 521 # skip Cannot test locale handling without a comma locale ok 522 - Invalid version format 1._1 ok 523 - Too large version ok 524 - Too large version ok 525 - Don't fall for Data::Dumper's tricks ok 526 - Deal with badly serialized versions from YAML ok 527 - Deal with badly serialized versions from YAML ok 528 - Correctly guesses this is not a v-string ok 529 - Correctly guess that this is a v-string ok 530 - Compare 3 and 4 digit v-strings ok 531 - Compare 3 and 4 digit v-strings, leaving v ok 532 - Compare 3 and 4 digit v-strings, quoted ok 533 - Compare 3 and 4 digit v-strings, quoted leading v ok 534 - Only export declare once per package (to prevent redefined warnings). ok 535 - Fix for RT \#47980 1..535 ok t/02derived.t ..... ok 1 - use version; ok 2 - use tLrKLJeR; ok 3 - The object isa tLrKLJeR ok 4 - Numified correctly ok 5 - Stringified correctly ok 6 - Normalified correctly ok 7 - Comparison vs parent class ok 8 - 5.005_03 eq 5.00503 ok 9 - 1.23 eq "1.23" ok 10 - "5.005_03" eq "5.005_03" ok 11 - "v1.23" eq "v1.23" ok 12 - 5.005 eq "5.005" ok 13 - 5.006.001 eq v5.6.1 ok 14 - No leading v ok 15 - alpha version 1.2.3_4 eq v1.2.3_4 ok 16 - Invalid version format (multiple underscores) ok 17 - Invalid version format (underscores before decimal) ok 18 - Invalid version format (alpha without decimal) ok 19 - Invalid version format (non-numeric data) ok 20 - Invalid version format (non-numeric data) ok 21 - Invalid version format (non-numeric data) ok 22 - boolean ok 23 - The object isa tLrKLJeR ok 24 - $version <=> $version == 0 ok 25 - $version == $version ok 26 - $version == $version ok 27 - $version < $new_version ok 28 - $new_version > $version ok 29 - $version != $new_version ok 30 - $version < $new_version ok 31 - $new_version > $version ok 32 - $version != $new_version ok 33 - $version->numify() == 5.006001 ok 34 - $version->numify() <= 5.006001 ok 35 - $version->numify() < 5.008 ok 36 - $version == "1.2.3" ok 37 - $version->numify == 1.002003 ok 38 - $version == 2002.9.30.1 ok 39 - $version->numify == 2002.009030001 ok 40 - $version < $new_version ok 41 - $new_version > $version ok 42 - $version != $new_version ok 43 - $version > $new_version ok 44 - $new_version < $version ok 45 - $version != $new_version ok 46 - $version < $new_version ok 47 - $new_version > $version ok 48 - $version != $new_version ok 49 - !$version->is_alpha ok 50 - $new_version->is_alpha ok 51 - $version > $new_version ok 52 - $new_version < $version ok 53 - $version != $new_version ok 54 - $version > $new_version ok 55 - $new_version < $version ok 56 - $version != $new_version ok 57 - $version == $new_version ok 58 - $version == $new_version ok 59 - $version < $new_version ok 60 - $version < $new_version ok 61 - $version > $new_version ok 62 - noop ++ ok 63 - noop -- ok 64 - noop / ok 65 - noop * ok 66 - noop abs ok 67 - qv("1.2") == "1.2.0" ok 68 - qv(1.2) == "1.2.0" ok 69 - The object isa tLrKLJeR ok 70 - new from existing object ok 71 - class->new(v1.2) identical ok 72 - The object isa tLrKLJeR ok 73 - version->new() doesn't clone ok 74 - $version->$method("1.2.3") works too ok 75 - qw$Revision: 1.2$ == 1.2.0 ok 76 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 77 - CPAN-style alpha version ok 78 - 1.23_01 > 1.23 ok 79 - 1.23_01 < 1.24 ok 80 - Replacement eval works with exact version ok 81 - Called as class method ok 82 - Don't freak if the module doesn't even exist ok 83 - Replacement eval works with incremented version ok 84 - Replacement eval works with single digit ok 85 - Replacement eval works with incremented digit ok 86 - Replacement handles modules without package or VERSION ok 87 - Replacement handles modules without package or VERSION ok 88 - Called as class method ok 89 - Replacement handles modules without VERSION ok 90 - Replacement handles modules without VERSION ok 91 - Replacement handles modules without VERSION ok 92 - Replacement handles modules without VERSION ok 93 - "$version" eq 1.2.3 ok 94 - $version == $new_version ok 95 - v-string initialized $qv_declare() ok 96 - "$version" eq "v1.2.3_4" ok 97 - "$version" eq "v1.2.3_4" (from eval) ok 98 - trailing zeros preserved ok 99 - trailing zeros preserved ok 100 - trailing zeros preserved ok 101 - trailing zeros preserved ok 102 - leading zero inferred ok 103 - leading space ignored ok 104 - Undef version comparison \#1 ok 105 - Undef version comparison \#2 ok 106 - Version string 'undef' ok 107 - Version string 'undef' ok 108 - Undef version comparison \#3 ok 109 - Undef version comparison \#4 ok 110 - No initializer at all ok 111 - Undef version comparison \#5 ok 112 - Undef version comparison \#6 ok 113 - Very small version objects ok 114 - Make sure very small versions don't freak ok 115 - Comparing vs. version with no decimal ok 116 - Comparing vs. version with decimal only ok 117 - Make sure very small versions don't freak ok 118 - Succeed - required == VERSION ok 119 - No undef warnings ok 120 - make sure we cleared qv() properly ok 121 - make sure we exported qv() properly ok 122 - The object isa t5mVvCR4 ok 123 - User typed numeric so we error with numeric ok 124 - User typed extended so we error with extended ok 125 # skip Cannot test locale handling without a comma locale ok 126 # skip Cannot test locale handling without a comma locale ok 127 # skip Cannot test locale handling without a comma locale ok 128 # skip Cannot test locale handling without a comma locale ok 129 - Invalid version format 1._1 ok 130 - Too large version ok 131 - Too large version ok 132 - Don't fall for Data::Dumper's tricks ok 133 - Deal with badly serialized versions from YAML ok 134 - Deal with badly serialized versions from YAML ok 135 - Correctly guesses this is not a v-string ok 136 - Correctly guess that this is a v-string ok 137 - Compare 3 and 4 digit v-strings ok 138 - Compare 3 and 4 digit v-strings, leaving v ok 139 - Compare 3 and 4 digit v-strings, quoted ok 140 - Compare 3 and 4 digit v-strings, quoted leading v ok 141 - use tLrKLJeR; ok 142 - 5.005_03 eq 5.00503 ok 143 - 1.23 eq "1.23" ok 144 - "5.005_03" eq "5.005_03" ok 145 - "v1.23" eq "v1.23" ok 146 - 5.005 eq "5.005" ok 147 - 5.006.001 eq v5.6.1 ok 148 - No leading v ok 149 - alpha version 1.2.3_4 eq v1.2.3_4 ok 150 - Invalid version format (multiple underscores) ok 151 - Invalid version format (underscores before decimal) ok 152 - Invalid version format (alpha without decimal) ok 153 - Invalid version format (non-numeric data) ok 154 - Invalid version format (non-numeric data) ok 155 - Invalid version format (non-numeric data) ok 156 - boolean ok 157 - The object isa tLrKLJeR ok 158 - $version <=> $version == 0 ok 159 - $version == $version ok 160 - $version == $version ok 161 - $version < $new_version ok 162 - $new_version > $version ok 163 - $version != $new_version ok 164 - $version < $new_version ok 165 - $new_version > $version ok 166 - $version != $new_version ok 167 - $version->numify() == 5.006001 ok 168 - $version->numify() <= 5.006001 ok 169 - $version->numify() < 5.008 ok 170 - $version == "1.2.3" ok 171 - $version->numify == 1.002003 ok 172 - $version == 2002.9.30.1 ok 173 - $version->numify == 2002.009030001 ok 174 - $version < $new_version ok 175 - $new_version > $version ok 176 - $version != $new_version ok 177 - $version > $new_version ok 178 - $new_version < $version ok 179 - $version != $new_version ok 180 - $version < $new_version ok 181 - $new_version > $version ok 182 - $version != $new_version ok 183 - !$version->is_alpha ok 184 - $new_version->is_alpha ok 185 - $version > $new_version ok 186 - $new_version < $version ok 187 - $version != $new_version ok 188 - $version > $new_version ok 189 - $new_version < $version ok 190 - $version != $new_version ok 191 - $version == $new_version ok 192 - $version == $new_version ok 193 - $version < $new_version ok 194 - $version < $new_version ok 195 - $version > $new_version ok 196 - noop ++ ok 197 - noop -- ok 198 - noop / ok 199 - noop * ok 200 - noop abs ok 201 - declare("1.2") == "1.2.0" ok 202 - declare(1.2) == "1.2.0" ok 203 - The object isa tLrKLJeR ok 204 - new from existing object ok 205 - class->new(v1.2) identical ok 206 - The object isa tLrKLJeR ok 207 - version->new() doesn't clone ok 208 - $version->$method("1.2.3") works too ok 209 - qw$Revision: 1.2$ == 1.2.0 ok 210 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 211 - CPAN-style alpha version ok 212 - 1.23_01 > 1.23 ok 213 - 1.23_01 < 1.24 ok 214 - Replacement eval works with exact version ok 215 - Called as class method ok 216 - Don't freak if the module doesn't even exist ok 217 - Replacement eval works with incremented version ok 218 - Replacement eval works with single digit ok 219 - Replacement eval works with incremented digit ok 220 - Replacement handles modules without package or VERSION ok 221 - Replacement handles modules without package or VERSION ok 222 - Called as class method ok 223 - Replacement handles modules without VERSION ok 224 - Replacement handles modules without VERSION ok 225 - Replacement handles modules without VERSION ok 226 - Replacement handles modules without VERSION ok 227 - "$version" eq 1.2.3 ok 228 - $version == $new_version ok 229 - v-string initialized $qv_declare() ok 230 - "$version" eq "v1.2.3_4" ok 231 - "$version" eq "v1.2.3_4" (from eval) ok 232 - trailing zeros preserved ok 233 - trailing zeros preserved ok 234 - trailing zeros preserved ok 235 - trailing zeros preserved ok 236 - leading zero inferred ok 237 - leading space ignored ok 238 - Undef version comparison \#1 ok 239 - Undef version comparison \#2 ok 240 - Version string 'undef' ok 241 - Version string 'undef' ok 242 - Undef version comparison \#3 ok 243 - Undef version comparison \#4 ok 244 - No initializer at all ok 245 - Undef version comparison \#5 ok 246 - Undef version comparison \#6 ok 247 - Very small version objects ok 248 - Make sure very small versions don't freak ok 249 - Comparing vs. version with no decimal ok 250 - Comparing vs. version with decimal only ok 251 - Make sure very small versions don't freak ok 252 - Succeed - required == VERSION ok 253 - No undef warnings ok 254 - make sure we cleared declare() properly ok 255 - make sure we exported declare() properly ok 256 - The object isa tjFUKplc ok 257 - User typed numeric so we error with numeric ok 258 - User typed extended so we error with extended ok 259 # skip Cannot test locale handling without a comma locale ok 260 # skip Cannot test locale handling without a comma locale ok 261 # skip Cannot test locale handling without a comma locale ok 262 # skip Cannot test locale handling without a comma locale ok 263 - Invalid version format 1._1 ok 264 - Too large version ok 265 - Too large version ok 266 - Don't fall for Data::Dumper's tricks ok 267 - Deal with badly serialized versions from YAML ok 268 - Deal with badly serialized versions from YAML ok 269 - Correctly guesses this is not a v-string ok 270 - Correctly guess that this is a v-string ok 271 - Compare 3 and 4 digit v-strings ok 272 - Compare 3 and 4 digit v-strings, leaving v ok 273 - Compare 3 and 4 digit v-strings, quoted ok 274 - Compare 3 and 4 digit v-strings, quoted leading v ok 275 - use tLrKLJeR; ok 276 - 5.005_03 eq 5.00503 ok 277 - 1.23 eq "1.23" ok 278 - "5.005_03" eq "5.005_03" ok 279 - "v1.23" eq "v1.23" ok 280 - 5.005 eq "5.005" ok 281 - 5.006.001 eq v5.6.1 ok 282 - No leading v ok 283 - alpha version 1.2.3_4 eq v1.2.3_4 ok 284 - Invalid version format (multiple underscores) ok 285 - Invalid version format (underscores before decimal) ok 286 - Invalid version format (alpha without decimal) ok 287 - Invalid version format (non-numeric data) ok 288 - Invalid version format (non-numeric data) ok 289 - Invalid version format (non-numeric data) ok 290 - boolean ok 291 - The object isa tLrKLJeR ok 292 - $version <=> $version == 0 ok 293 - $version == $version ok 294 - $version == $version ok 295 - $version < $new_version ok 296 - $new_version > $version ok 297 - $version != $new_version ok 298 - $version < $new_version ok 299 - $new_version > $version ok 300 - $version != $new_version ok 301 - $version->numify() == 5.006001 ok 302 - $version->numify() <= 5.006001 ok 303 - $version->numify() < 5.008 ok 304 - $version == "1.2.3" ok 305 - $version->numify == 1.002003 ok 306 - $version == 2002.9.30.1 ok 307 - $version->numify == 2002.009030001 ok 308 - $version < $new_version ok 309 - $new_version > $version ok 310 - $version != $new_version ok 311 - $version > $new_version ok 312 - $new_version < $version ok 313 - $version != $new_version ok 314 - $version < $new_version ok 315 - $new_version > $version ok 316 - $version != $new_version ok 317 - !$version->is_alpha ok 318 - $new_version->is_alpha ok 319 - $version > $new_version ok 320 - $new_version < $version ok 321 - $version != $new_version ok 322 - $version > $new_version ok 323 - $new_version < $version ok 324 - $version != $new_version ok 325 - $version == $new_version ok 326 - $version == $new_version ok 327 - $version < $new_version ok 328 - $version < $new_version ok 329 - $version > $new_version ok 330 - noop ++ ok 331 - noop -- ok 332 - noop / ok 333 - noop * ok 334 - noop abs ok 335 - qv("1.2") == "1.2.0" ok 336 - qv(1.2) == "1.2.0" ok 337 - The object isa tLrKLJeR ok 338 - new from existing object ok 339 - class->parse(v1.2) identical ok 340 - The object isa tLrKLJeR ok 341 - version->parse() doesn't clone ok 342 - $version->$method("1.2.3") works too ok 343 - qw$Revision: 1.2$ == 1.2.0 ok 344 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 345 - CPAN-style alpha version ok 346 - 1.23_01 > 1.23 ok 347 - 1.23_01 < 1.24 ok 348 - Replacement eval works with exact version ok 349 - Called as class method ok 350 - Don't freak if the module doesn't even exist ok 351 - Replacement eval works with incremented version ok 352 - Replacement eval works with single digit ok 353 - Replacement eval works with incremented digit ok 354 - Replacement handles modules without package or VERSION ok 355 - Replacement handles modules without package or VERSION ok 356 - Called as class method ok 357 - Replacement handles modules without VERSION ok 358 - Replacement handles modules without VERSION ok 359 - Replacement handles modules without VERSION ok 360 - Replacement handles modules without VERSION ok 361 - "$version" eq 1.2.3 ok 362 - $version == $new_version ok 363 - v-string initialized $qv_declare() ok 364 - "$version" eq "v1.2.3_4" ok 365 - "$version" eq "v1.2.3_4" (from eval) ok 366 - trailing zeros preserved ok 367 - trailing zeros preserved ok 368 - trailing zeros preserved ok 369 - trailing zeros preserved ok 370 - leading zero inferred ok 371 - leading space ignored ok 372 - Undef version comparison \#1 ok 373 - Undef version comparison \#2 ok 374 - Version string 'undef' ok 375 - Version string 'undef' ok 376 - Undef version comparison \#3 ok 377 - Undef version comparison \#4 ok 378 - No initializer at all ok 379 - Undef version comparison \#5 ok 380 - Undef version comparison \#6 ok 381 - Very small version objects ok 382 - Make sure very small versions don't freak ok 383 - Comparing vs. version with no decimal ok 384 - Comparing vs. version with decimal only ok 385 - Make sure very small versions don't freak ok 386 - Succeed - required == VERSION ok 387 - No undef warnings ok 388 - make sure we cleared qv() properly ok 389 - make sure we exported qv() properly ok 390 - The object isa t1zGU7dk ok 391 - User typed numeric so we error with numeric ok 392 - User typed extended so we error with extended ok 393 # skip Cannot test locale handling without a comma locale ok 394 # skip Cannot test locale handling without a comma locale ok 395 # skip Cannot test locale handling without a comma locale ok 396 # skip Cannot test locale handling without a comma locale ok 397 - Invalid version format 1._1 ok 398 - Too large version ok 399 - Too large version ok 400 - Don't fall for Data::Dumper's tricks ok 401 - Deal with badly serialized versions from YAML ok 402 - Deal with badly serialized versions from YAML ok 403 - Correctly guesses this is not a v-string ok 404 - Correctly guess that this is a v-string ok 405 - Compare 3 and 4 digit v-strings ok 406 - Compare 3 and 4 digit v-strings, leaving v ok 407 - Compare 3 and 4 digit v-strings, quoted ok 408 - Compare 3 and 4 digit v-strings, quoted leading v ok 409 - use tLrKLJeR; ok 410 - 5.005_03 eq 5.00503 ok 411 - 1.23 eq "1.23" ok 412 - "5.005_03" eq "5.005_03" ok 413 - "v1.23" eq "v1.23" ok 414 - 5.005 eq "5.005" ok 415 - 5.006.001 eq v5.6.1 ok 416 - No leading v ok 417 - alpha version 1.2.3_4 eq v1.2.3_4 ok 418 - Invalid version format (multiple underscores) ok 419 - Invalid version format (underscores before decimal) ok 420 - Invalid version format (alpha without decimal) ok 421 - Invalid version format (non-numeric data) ok 422 - Invalid version format (non-numeric data) ok 423 - Invalid version format (non-numeric data) ok 424 - boolean ok 425 - The object isa tLrKLJeR ok 426 - $version <=> $version == 0 ok 427 - $version == $version ok 428 - $version == $version ok 429 - $version < $new_version ok 430 - $new_version > $version ok 431 - $version != $new_version ok 432 - $version < $new_version ok 433 - $new_version > $version ok 434 - $version != $new_version ok 435 - $version->numify() == 5.006001 ok 436 - $version->numify() <= 5.006001 ok 437 - $version->numify() < 5.008 ok 438 - $version == "1.2.3" ok 439 - $version->numify == 1.002003 ok 440 - $version == 2002.9.30.1 ok 441 - $version->numify == 2002.009030001 ok 442 - $version < $new_version ok 443 - $new_version > $version ok 444 - $version != $new_version ok 445 - $version > $new_version ok 446 - $new_version < $version ok 447 - $version != $new_version ok 448 - $version < $new_version ok 449 - $new_version > $version ok 450 - $version != $new_version ok 451 - !$version->is_alpha ok 452 - $new_version->is_alpha ok 453 - $version > $new_version ok 454 - $new_version < $version ok 455 - $version != $new_version ok 456 - $version > $new_version ok 457 - $new_version < $version ok 458 - $version != $new_version ok 459 - $version == $new_version ok 460 - $version == $new_version ok 461 - $version < $new_version ok 462 - $version < $new_version ok 463 - $version > $new_version ok 464 - noop ++ ok 465 - noop -- ok 466 - noop / ok 467 - noop * ok 468 - noop abs ok 469 - declare("1.2") == "1.2.0" ok 470 - declare(1.2) == "1.2.0" ok 471 - The object isa tLrKLJeR ok 472 - new from existing object ok 473 - class->parse(v1.2) identical ok 474 - The object isa tLrKLJeR ok 475 - version->parse() doesn't clone ok 476 - $version->$method("1.2.3") works too ok 477 - qw$Revision: 1.2$ == 1.2.0 ok 478 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 479 - CPAN-style alpha version ok 480 - 1.23_01 > 1.23 ok 481 - 1.23_01 < 1.24 ok 482 - Replacement eval works with exact version ok 483 - Called as class method ok 484 - Don't freak if the module doesn't even exist ok 485 - Replacement eval works with incremented version ok 486 - Replacement eval works with single digit ok 487 - Replacement eval works with incremented digit ok 488 - Replacement handles modules without package or VERSION ok 489 - Replacement handles modules without package or VERSION ok 490 - Called as class method ok 491 - Replacement handles modules without VERSION ok 492 - Replacement handles modules without VERSION ok 493 - Replacement handles modules without VERSION ok 494 - Replacement handles modules without VERSION ok 495 - "$version" eq 1.2.3 ok 496 - $version == $new_version ok 497 - v-string initialized $qv_declare() ok 498 - "$version" eq "v1.2.3_4" ok 499 - "$version" eq "v1.2.3_4" (from eval) ok 500 - trailing zeros preserved ok 501 - trailing zeros preserved ok 502 - trailing zeros preserved ok 503 - trailing zeros preserved ok 504 - leading zero inferred ok 505 - leading space ignored ok 506 - Undef version comparison \#1 ok 507 - Undef version comparison \#2 ok 508 - Version string 'undef' ok 509 - Version string 'undef' ok 510 - Undef version comparison \#3 ok 511 - Undef version comparison \#4 ok 512 - No initializer at all ok 513 - Undef version comparison \#5 ok 514 - Undef version comparison \#6 ok 515 - Very small version objects ok 516 - Make sure very small versions don't freak ok 517 - Comparing vs. version with no decimal ok 518 - Comparing vs. version with decimal only ok 519 - Make sure very small versions don't freak ok 520 - Succeed - required == VERSION ok 521 - No undef warnings ok 522 - make sure we cleared declare() properly ok 523 - make sure we exported declare() properly ok 524 - The object isa t1JDUBaR ok 525 - User typed numeric so we error with numeric ok 526 - User typed extended so we error with extended ok 527 # skip Cannot test locale handling without a comma locale ok 528 # skip Cannot test locale handling without a comma locale ok 529 # skip Cannot test locale handling without a comma locale ok 530 # skip Cannot test locale handling without a comma locale ok 531 - Invalid version format 1._1 ok 532 - Too large version ok 533 - Too large version ok 534 - Don't fall for Data::Dumper's tricks ok 535 - Deal with badly serialized versions from YAML ok 536 - Deal with badly serialized versions from YAML ok 537 - Correctly guesses this is not a v-string ok 538 - Correctly guess that this is a v-string ok 539 - Compare 3 and 4 digit v-strings ok 540 - Compare 3 and 4 digit v-strings, leaving v ok 541 - Compare 3 and 4 digit v-strings, quoted ok 542 - Compare 3 and 4 digit v-strings, quoted leading v ok 543 - The object isa version::Bad ok 544 - Bad subclass numify ok 545 - Bad subclass normal ok 546 - Bad subclass stringify ok 547 - Bad subclass vcmp 1..547 ok t/03require.t ..... ok 1 - require version; ok 2 - Make sure we have the correct class ok 3 - We don't have the imported qv() ok 4 - We don't have the imported declare() ok 5 - 5.005_03 eq 5.00503 ok 6 - 1.23 eq "1.23" ok 7 - "5.005_03" eq "5.005_03" ok 8 - "v1.23" eq "v1.23" ok 9 - 5.005 eq "5.005" ok 10 - 5.006.001 eq v5.6.1 ok 11 - No leading v ok 12 - alpha version 1.2.3_4 eq v1.2.3_4 ok 13 - Invalid version format (multiple underscores) ok 14 - Invalid version format (underscores before decimal) ok 15 - Invalid version format (alpha without decimal) ok 16 - Invalid version format (non-numeric data) ok 17 - Invalid version format (non-numeric data) ok 18 - Invalid version format (non-numeric data) ok 19 - boolean ok 20 - The object isa version ok 21 - $version <=> $version == 0 ok 22 - $version == $version ok 23 - $version == $version ok 24 - $version < $new_version ok 25 - $new_version > $version ok 26 - $version != $new_version ok 27 - $version < $new_version ok 28 - $new_version > $version ok 29 - $version != $new_version ok 30 - $version->numify() == 5.006001 ok 31 - $version->numify() <= 5.006001 ok 32 - $version->numify() < 5.008 ok 33 - $version == "1.2.3" ok 34 - $version->numify == 1.002003 ok 35 - $version == 2002.9.30.1 ok 36 - $version->numify == 2002.009030001 ok 37 - $version < $new_version ok 38 - $new_version > $version ok 39 - $version != $new_version ok 40 - $version > $new_version ok 41 - $new_version < $version ok 42 - $version != $new_version ok 43 - $version < $new_version ok 44 - $new_version > $version ok 45 - $version != $new_version ok 46 - !$version->is_alpha ok 47 - $new_version->is_alpha ok 48 - $version > $new_version ok 49 - $new_version < $version ok 50 - $version != $new_version ok 51 - $version > $new_version ok 52 - $new_version < $version ok 53 - $version != $new_version ok 54 - $version == $new_version ok 55 - $version == $new_version ok 56 - $version < $new_version ok 57 - $version < $new_version ok 58 - $version > $new_version ok 59 - noop ++ ok 60 - noop -- ok 61 - noop / ok 62 - noop * ok 63 - noop abs ok 64 # skip version require'd instead of use'd, cannot test ok 65 # skip version require'd instead of use'd, cannot test ok 66 # skip version require'd instead of use'd, cannot test ok 67 - new from existing object ok 68 - class->new(v1.2.3) identical ok 69 - The object isa version ok 70 - version->new() doesn't clone ok 71 - $version->$method("1.2.3") works too ok 72 - qw$Revision: 1.2$ == 1.2.0 ok 73 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 74 - CPAN-style alpha version ok 75 - 1.23_01 > 1.23 ok 76 - 1.23_01 < 1.24 ok 77 - Replacement eval works with exact version ok 78 - Called as class method ok 79 - Don't freak if the module doesn't even exist ok 80 - Replacement eval works with incremented version ok 81 - Replacement eval works with single digit ok 82 - Replacement eval works with incremented digit ok 83 - Replacement handles modules without package or VERSION ok 84 - Replacement handles modules without package or VERSION ok 85 - Called as class method ok 86 - Replacement handles modules without VERSION ok 87 - Replacement handles modules without VERSION ok 88 - Replacement handles modules without VERSION ok 89 - Replacement handles modules without VERSION ok 90 - "$version" eq 1.2.3 ok 91 - $version == $new_version ok 92 # skip version require'd instead of use'd, cannot test declare ok 93 - "$version" eq "v1.2.3_4" ok 94 - "$version" eq "v1.2.3_4" (from eval) ok 95 - trailing zeros preserved ok 96 - trailing zeros preserved ok 97 - trailing zeros preserved ok 98 - trailing zeros preserved ok 99 - leading zero inferred ok 100 - leading space ignored ok 101 - Undef version comparison \#1 ok 102 - Undef version comparison \#2 ok 103 - Version string 'undef' ok 104 - Version string 'undef' ok 105 - Undef version comparison \#3 ok 106 - Undef version comparison \#4 ok 107 - No initializer at all ok 108 - Undef version comparison \#5 ok 109 - Undef version comparison \#6 ok 110 - Very small version objects ok 111 - Make sure very small versions don't freak ok 112 - Comparing vs. version with no decimal ok 113 - Comparing vs. version with decimal only ok 114 - Make sure very small versions don't freak ok 115 - Succeed - required == VERSION ok 116 - No undef warnings ok 117 # skip Cannot test "use base qw(version)" when require is used ok 118 # skip Cannot test "use base qw(version)" when require is used ok 119 # skip Cannot test "use base qw(version)" when require is used ok 120 - User typed numeric so we error with numeric ok 121 - User typed extended so we error with extended ok 122 # skip Cannot test locale handling without a comma locale ok 123 # skip Cannot test locale handling without a comma locale ok 124 # skip Cannot test locale handling without a comma locale ok 125 # skip Cannot test locale handling without a comma locale ok 126 - Invalid version format 1._1 ok 127 - Too large version ok 128 - Too large version ok 129 - Don't fall for Data::Dumper's tricks ok 130 - Deal with badly serialized versions from YAML ok 131 - Deal with badly serialized versions from YAML ok 132 - Correctly guesses this is not a v-string ok 133 - Correctly guess that this is a v-string ok 134 - Compare 3 and 4 digit v-strings ok 135 - Compare 3 and 4 digit v-strings, leaving v ok 136 - Compare 3 and 4 digit v-strings, quoted ok 137 - Compare 3 and 4 digit v-strings, quoted leading v ok 138 - 5.005_03 eq 5.00503 ok 139 - 1.23 eq "1.23" ok 140 - "5.005_03" eq "5.005_03" ok 141 - "v1.23" eq "v1.23" ok 142 - 5.005 eq "5.005" ok 143 - 5.006.001 eq v5.6.1 ok 144 - No leading v ok 145 - alpha version 1.2.3_4 eq v1.2.3_4 ok 146 - Invalid version format (multiple underscores) ok 147 - Invalid version format (underscores before decimal) ok 148 - Invalid version format (alpha without decimal) ok 149 - Invalid version format (non-numeric data) ok 150 - Invalid version format (non-numeric data) ok 151 - Invalid version format (non-numeric data) ok 152 - boolean ok 153 - The object isa version ok 154 - $version <=> $version == 0 ok 155 - $version == $version ok 156 - $version == $version ok 157 - $version < $new_version ok 158 - $new_version > $version ok 159 - $version != $new_version ok 160 - $version < $new_version ok 161 - $new_version > $version ok 162 - $version != $new_version ok 163 - $version->numify() == 5.006001 ok 164 - $version->numify() <= 5.006001 ok 165 - $version->numify() < 5.008 ok 166 - $version == "1.2.3" ok 167 - $version->numify == 1.002003 ok 168 - $version == 2002.9.30.1 ok 169 - $version->numify == 2002.009030001 ok 170 - $version < $new_version ok 171 - $new_version > $version ok 172 - $version != $new_version ok 173 - $version > $new_version ok 174 - $new_version < $version ok 175 - $version != $new_version ok 176 - $version < $new_version ok 177 - $new_version > $version ok 178 - $version != $new_version ok 179 - !$version->is_alpha ok 180 - $new_version->is_alpha ok 181 - $version > $new_version ok 182 - $new_version < $version ok 183 - $version != $new_version ok 184 - $version > $new_version ok 185 - $new_version < $version ok 186 - $version != $new_version ok 187 - $version == $new_version ok 188 - $version == $new_version ok 189 - $version < $new_version ok 190 - $version < $new_version ok 191 - $version > $new_version ok 192 - noop ++ ok 193 - noop -- ok 194 - noop / ok 195 - noop * ok 196 - noop abs ok 197 # skip version require'd instead of use'd, cannot test ok 198 # skip version require'd instead of use'd, cannot test ok 199 # skip version require'd instead of use'd, cannot test ok 200 - new from existing object ok 201 - class->parse(v1.2.3) identical ok 202 - The object isa version ok 203 - version->parse() doesn't clone ok 204 - $version->$method("1.2.3") works too ok 205 - qw$Revision: 1.2$ == 1.2.0 ok 206 - qw$Revision: 1.2.3.4$ == 1.2.3.4 ok 207 - CPAN-style alpha version ok 208 - 1.23_01 > 1.23 ok 209 - 1.23_01 < 1.24 ok 210 - Replacement eval works with exact version ok 211 - Called as class method ok 212 - Don't freak if the module doesn't even exist ok 213 - Replacement eval works with incremented version ok 214 - Replacement eval works with single digit ok 215 - Replacement eval works with incremented digit ok 216 - Replacement handles modules without package or VERSION ok 217 - Replacement handles modules without package or VERSION ok 218 - Called as class method ok 219 - Replacement handles modules without VERSION ok 220 - Replacement handles modules without VERSION ok 221 - Replacement handles modules without VERSION ok 222 - Replacement handles modules without VERSION ok 223 - "$version" eq 1.2.3 ok 224 - $version == $new_version ok 225 # skip version require'd instead of use'd, cannot test declare ok 226 - "$version" eq "v1.2.3_4" ok 227 - "$version" eq "v1.2.3_4" (from eval) ok 228 - trailing zeros preserved ok 229 - trailing zeros preserved ok 230 - trailing zeros preserved ok 231 - trailing zeros preserved ok 232 - leading zero inferred ok 233 - leading space ignored ok 234 - Undef version comparison \#1 ok 235 - Undef version comparison \#2 ok 236 - Version string 'undef' ok 237 - Version string 'undef' ok 238 - Undef version comparison \#3 ok 239 - Undef version comparison \#4 ok 240 - No initializer at all ok 241 - Undef version comparison \#5 ok 242 - Undef version comparison \#6 ok 243 - Very small version objects ok 244 - Make sure very small versions don't freak ok 245 - Comparing vs. version with no decimal ok 246 - Comparing vs. version with decimal only ok 247 - Make sure very small versions don't freak ok 248 - Succeed - required == VERSION ok 249 - No undef warnings ok 250 # skip Cannot test "use base qw(version)" when require is used ok 251 # skip Cannot test "use base qw(version)" when require is used ok 252 # skip Cannot test "use base qw(version)" when require is used ok 253 - User typed numeric so we error with numeric ok 254 - User typed extended so we error with extended ok 255 # skip Cannot test locale handling without a comma locale ok 256 # skip Cannot test locale handling without a comma locale ok 257 # skip Cannot test locale handling without a comma locale ok 258 # skip Cannot test locale handling without a comma locale ok 259 - Invalid version format 1._1 ok 260 - Too large version ok 261 - Too large version ok 262 - Don't fall for Data::Dumper's tricks ok 263 - Deal with badly serialized versions from YAML ok 264 - Deal with badly serialized versions from YAML ok 265 - Correctly guesses this is not a v-string ok 266 - Correctly guess that this is a v-string ok 267 - Compare 3 and 4 digit v-strings ok 268 - Compare 3 and 4 digit v-strings, leaving v ok 269 - Compare 3 and 4 digit v-strings, quoted ok 270 - Compare 3 and 4 digit v-strings, quoted leading v 1..270 ok t/04strict_lax.t .. ok 1 - is_strict(1.00) [pass] ok 2 - version::is_strict(1.00) [pass] ok 3 - is_lax(1.00) [pass] ok 4 - version::is_lax(1.00) [pass] ok 5 - is_strict(1.00001) [pass] ok 6 - version::is_strict(1.00001) [pass] ok 7 - is_lax(1.00001) [pass] ok 8 - version::is_lax(1.00001) [pass] ok 9 - is_strict(0.123) [pass] ok 10 - version::is_strict(0.123) [pass] ok 11 - is_lax(0.123) [pass] ok 12 - version::is_lax(0.123) [pass] ok 13 - is_strict(12.345) [pass] ok 14 - version::is_strict(12.345) [pass] ok 15 - is_lax(12.345) [pass] ok 16 - version::is_lax(12.345) [pass] ok 17 - is_strict(42) [pass] ok 18 - version::is_strict(42) [pass] ok 19 - is_lax(42) [pass] ok 20 - version::is_lax(42) [pass] ok 21 - is_strict(0) [pass] ok 22 - version::is_strict(0) [pass] ok 23 - is_lax(0) [pass] ok 24 - version::is_lax(0) [pass] ok 25 - is_strict(0.0) [pass] ok 26 - version::is_strict(0.0) [pass] ok 27 - is_lax(0.0) [pass] ok 28 - version::is_lax(0.0) [pass] ok 29 - is_strict(v1.2.3) [pass] ok 30 - version::is_strict(v1.2.3) [pass] ok 31 - is_lax(v1.2.3) [pass] ok 32 - version::is_lax(v1.2.3) [pass] ok 33 - is_strict(v1.2.3.4) [pass] ok 34 - version::is_strict(v1.2.3.4) [pass] ok 35 - is_lax(v1.2.3.4) [pass] ok 36 - version::is_lax(v1.2.3.4) [pass] ok 37 - is_strict(v0.1.2) [pass] ok 38 - version::is_strict(v0.1.2) [pass] ok 39 - is_lax(v0.1.2) [pass] ok 40 - version::is_lax(v0.1.2) [pass] ok 41 - is_strict(v0.0.0) [pass] ok 42 - version::is_strict(v0.0.0) [pass] ok 43 - is_lax(v0.0.0) [pass] ok 44 - version::is_lax(v0.0.0) [pass] ok 45 - is_strict(01) [fail] ok 46 - version::is_strict(01) [fail] ok 47 - is_lax(01) [pass] ok 48 - version::is_lax(01) [pass] ok 49 - is_strict(01.0203) [fail] ok 50 - version::is_strict(01.0203) [fail] ok 51 - is_lax(01.0203) [pass] ok 52 - version::is_lax(01.0203) [pass] ok 53 - is_strict(v01) [fail] ok 54 - version::is_strict(v01) [fail] ok 55 - is_lax(v01) [pass] ok 56 - version::is_lax(v01) [pass] ok 57 - is_strict(v01.02.03) [fail] ok 58 - version::is_strict(v01.02.03) [fail] ok 59 - is_lax(v01.02.03) [pass] ok 60 - version::is_lax(v01.02.03) [pass] ok 61 - is_strict(.1) [fail] ok 62 - version::is_strict(.1) [fail] ok 63 - is_lax(.1) [pass] ok 64 - version::is_lax(.1) [pass] ok 65 - is_strict(.1.2) [fail] ok 66 - version::is_strict(.1.2) [fail] ok 67 - is_lax(.1.2) [pass] ok 68 - version::is_lax(.1.2) [pass] ok 69 - is_strict(1.) [fail] ok 70 - version::is_strict(1.) [fail] ok 71 - is_lax(1.) [pass] ok 72 - version::is_lax(1.) [pass] ok 73 - is_strict(1.a) [fail] ok 74 - version::is_strict(1.a) [fail] ok 75 - is_lax(1.a) [fail] ok 76 - version::is_lax(1.a) [fail] ok 77 - is_strict(1._) [fail] ok 78 - version::is_strict(1._) [fail] ok 79 - is_lax(1._) [fail] ok 80 - version::is_lax(1._) [fail] ok 81 - is_strict(1.02_03) [fail] ok 82 - version::is_strict(1.02_03) [fail] ok 83 - is_lax(1.02_03) [pass] ok 84 - version::is_lax(1.02_03) [pass] ok 85 - is_strict(v1.2_3) [fail] ok 86 - version::is_strict(v1.2_3) [fail] ok 87 - is_lax(v1.2_3) [pass] ok 88 - version::is_lax(v1.2_3) [pass] ok 89 - is_strict(v1.02_03) [fail] ok 90 - version::is_strict(v1.02_03) [fail] ok 91 - is_lax(v1.02_03) [pass] ok 92 - version::is_lax(v1.02_03) [pass] ok 93 - is_strict(v1.2_3_4) [fail] ok 94 - version::is_strict(v1.2_3_4) [fail] ok 95 - is_lax(v1.2_3_4) [fail] ok 96 - version::is_lax(v1.2_3_4) [fail] ok 97 - is_strict(v1.2_3.4) [fail] ok 98 - version::is_strict(v1.2_3.4) [fail] ok 99 - is_lax(v1.2_3.4) [fail] ok 100 - version::is_lax(v1.2_3.4) [fail] ok 101 - is_strict(1.2_3.4) [fail] ok 102 - version::is_strict(1.2_3.4) [fail] ok 103 - is_lax(1.2_3.4) [fail] ok 104 - version::is_lax(1.2_3.4) [fail] ok 105 - is_strict(0_) [fail] ok 106 - version::is_strict(0_) [fail] ok 107 - is_lax(0_) [fail] ok 108 - version::is_lax(0_) [fail] ok 109 - is_strict(1_) [fail] ok 110 - version::is_strict(1_) [fail] ok 111 - is_lax(1_) [fail] ok 112 - version::is_lax(1_) [fail] ok 113 - is_strict(1_.) [fail] ok 114 - version::is_strict(1_.) [fail] ok 115 - is_lax(1_.) [fail] ok 116 - version::is_lax(1_.) [fail] ok 117 - is_strict(1.1_) [fail] ok 118 - version::is_strict(1.1_) [fail] ok 119 - is_lax(1.1_) [fail] ok 120 - version::is_lax(1.1_) [fail] ok 121 - is_strict(1.02_03_04) [fail] ok 122 - version::is_strict(1.02_03_04) [fail] ok 123 - is_lax(1.02_03_04) [fail] ok 124 - version::is_lax(1.02_03_04) [fail] ok 125 - is_strict(1.2.3) [fail] ok 126 - version::is_strict(1.2.3) [fail] ok 127 - is_lax(1.2.3) [pass] ok 128 - version::is_lax(1.2.3) [pass] ok 129 - is_strict(v1.2) [fail] ok 130 - version::is_strict(v1.2) [fail] ok 131 - is_lax(v1.2) [pass] ok 132 - version::is_lax(v1.2) [pass] ok 133 - is_strict(v0) [fail] ok 134 - version::is_strict(v0) [fail] ok 135 - is_lax(v0) [pass] ok 136 - version::is_lax(v0) [pass] ok 137 - is_strict(v1) [fail] ok 138 - version::is_strict(v1) [fail] ok 139 - is_lax(v1) [pass] ok 140 - version::is_lax(v1) [pass] ok 141 - is_strict(v.1.2.3) [fail] ok 142 - version::is_strict(v.1.2.3) [fail] ok 143 - is_lax(v.1.2.3) [fail] ok 144 - version::is_lax(v.1.2.3) [fail] ok 145 - is_strict(v) [fail] ok 146 - version::is_strict(v) [fail] ok 147 - is_lax(v) [fail] ok 148 - version::is_lax(v) [fail] ok 149 - is_strict(v1.2345.6) [fail] ok 150 - version::is_strict(v1.2345.6) [fail] ok 151 - is_lax(v1.2345.6) [pass] ok 152 - version::is_lax(v1.2345.6) [pass] ok 153 - is_strict(undef) [fail] ok 154 - version::is_strict(undef) [fail] ok 155 - is_lax(undef) [pass] ok 156 - version::is_lax(undef) [pass] ok 157 - is_strict(1a) [fail] ok 158 - version::is_strict(1a) [fail] ok 159 - is_lax(1a) [fail] ok 160 - version::is_lax(1a) [fail] ok 161 - is_strict(1.2a3) [fail] ok 162 - version::is_strict(1.2a3) [fail] ok 163 - is_lax(1.2a3) [fail] ok 164 - version::is_lax(1.2a3) [fail] ok 165 - is_strict(bar) [fail] ok 166 - version::is_strict(bar) [fail] ok 167 - is_lax(bar) [fail] ok 168 - version::is_lax(bar) [fail] ok 169 - is_strict(_) [fail] ok 170 - version::is_strict(_) [fail] ok 171 - is_lax(_) [fail] ok 172 - version::is_lax(_) [fail] 1..172 ok All tests successful. Files=4, Tests=1524, 1 wallclock secs ( 0.20 usr + 0.02 sys = 0.22 CPU) Result: PASS nmake test -nologo 'No tests defined for version::vxs extension.' cd .. JPEACOCK/version-0.88.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for version-0.88 already made Running make for D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz Prepending C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi Prepending C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/Module/Metadata.pm blib\lib\Module\Metadata.pm DAGOLDEN/Module-Metadata-1.000004.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/metadata.t .. 1..99 ok 1 - require Module::Metadata; ok 2 - find_module_by_name() succeeds ok 3 - fail if can't find module by module name ok 4 - fail if can't find module by file name ok 5 - new_from_file() succeeds ok 6 - new_from_module() succeeds ok 7 - correct module version (expected '1.23') ok 8 - no warnings from parsing ok 9 # skip No package NAME VERSION support until perl 5.11.1 ok 10 # skip No package NAME VERSION support until perl 5.11.1 ok 11 # skip No package NAME VERSION support until perl 5.11.1 ok 12 # skip No package NAME VERSION support until perl 5.11.1 ok 13 # skip No package NAME VERSION support until perl 5.11.1 ok 14 # skip No package NAME VERSION support until perl 5.11.1 ok 15 # skip No package NAME VERSION support until perl 5.11.1 ok 16 # skip No package NAME VERSION support until perl 5.11.1 ok 17 - correct module version (expected '1.23') ok 18 - no warnings from parsing ok 19 - correct module version (expected '1.23') ok 20 - no warnings from parsing ok 21 - correct module version (expected '1.234') ok 22 - no warnings from parsing ok 23 - correct module version (expected '0') ok 24 - no warnings from parsing ok 25 - correct module version (expected '1.23') ok 26 - no warnings from parsing ok 27 - correct module version (expected '1.23') ok 28 - no warnings from parsing ok 29 - correct module version (expected '1.23') ok 30 - no warnings from parsing ok 31 - correct module version (expected '1.23') ok 32 - no warnings from parsing ok 33 - correct module version (expected '1.23') ok 34 - no warnings from parsing ok 35 - correct module version (expected '1.23') ok 36 - no warnings from parsing ok 37 - correct module version (expected '1.23') ok 38 - no warnings from parsing ok 39 - correct module version (expected '1.23') ok 40 - no warnings from parsing ok 41 - correct module version (expected '1.23') ok 42 - no warnings from parsing ok 43 - correct module version (expected '1.23') ok 44 - no warnings from parsing ok 45 - correct module version (expected '1.23') ok 46 - no warnings from parsing ok 47 - correct module version (expected '1.23') ok 48 - no warnings from parsing ok 49 - correct module version (expected '1.23') ok 50 - no warnings from parsing ok 51 - correct module version (expected '1.23') ok 52 - no warnings from parsing ok 53 - correct module version (expected '1.23') ok 54 - no warnings from parsing ok 55 - correct module version (expected '1.23') ok 56 - no warnings from parsing ok 57 - correct module version (expected '1.23') ok 58 - no warnings from parsing ok 59 - correct module version (expected '1.23') ok 60 - no warnings from parsing ok 61 - correct module version (expected '1.23') ok 62 - no warnings from parsing ok 63 - correct module version (expected '1.23') ok 64 - no warnings from parsing ok 65 - correct module version (expected '1.23') ok 66 - no warnings from parsing ok 67 - correct module version (expected '1.23') ok 68 - no warnings from parsing ok 69 - record only one occurence of each package ok 70 - no default package ok 71 - no version w/o default package ok 72 - alpha version reported ok 73 - alpha version greater than non ok 74 - correct script version (1 of 8) ok 75 - correct script version (2 of 8) ok 76 - correct script version (3 of 8) ok 77 - correct script version (4 of 8) ok 78 - correct script version (5 of 8) ok 79 - correct script version (6 of 8) ok 80 - correct script version (7 of 8) ok 81 - correct script version (8 of 8) ok 82 - found default package ok 83 - version for default package ok 84 - version for secondary package ok 85 - filename() returns valid path to module file ok 86 - found correct number of packages ok 87 - packages stored in order found ok 88 - contains_pod() succeeds ok 89 - found all pod sections ok 90 - return undef() if pod section not present ok 91 - return undef() if pod section not collected ok 92 - collected pod section ok 93 - found default package ok 94 - version for default package ok 95 - packages inside ok 96 - found default package ok 97 - version for default package ok 98 - packages inside ok 99 - version for embedded package ok All tests successful. Files=1, Tests=99, 0 wallclock secs ( 0.02 usr + 0.00 sys = 0.02 CPU) Result: PASS DAGOLDEN/Module-Metadata-1.000004.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for Module-Metadata-1.000004 already made Running test for module 'CPAN::Meta' Running make for D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Checksum for C:\cpanfly\var\cpan\sources\authors\id\D\DA\DAGOLDEN\CPAN-Meta-2.110930.tar.gz ok Will not use Archive::Tar, need 1.00 CPAN-Meta-2.110930 CPAN-Meta-2.110930/Todo CPAN-Meta-2.110930/README CPAN-Meta-2.110930/Changes CPAN-Meta-2.110930/LICENSE CPAN-Meta-2.110930/dist.ini CPAN-Meta-2.110930/META.yml CPAN-Meta-2.110930/MANIFEST CPAN-Meta-2.110930/META.json CPAN-Meta-2.110930/t CPAN-Meta-2.110930/t/prereqs.t CPAN-Meta-2.110930/Makefile.PL CPAN-Meta-2.110930/t/no-index.t CPAN-Meta-2.110930/t/load-bad.t CPAN-Meta-2.110930/t/meta-obj.t CPAN-Meta-2.110930/t/save-load.t CPAN-Meta-2.110930/t/validator.t CPAN-Meta-2.110930/t/converter.t CPAN-Meta-2.110930/t/repository.t CPAN-Meta-2.110930/lib/CPAN CPAN-Meta-2.110930/lib/CPAN/Meta.pm CPAN-Meta-2.110930/t/converter-bad.t CPAN-Meta-2.110930/t/prereqs-merge.t CPAN-Meta-2.110930/t/converter-fail.t CPAN-Meta-2.110930/t/data CPAN-Meta-2.110930/t/data/gpl-1_4.yml CPAN-Meta-2.110930/t/data/META-2.json CPAN-Meta-2.110930/t/data/META-1_1.yml CPAN-Meta-2.110930/t/data/META-1_0.yml CPAN-Meta-2.110930/t/data/META-1_4.yml CPAN-Meta-2.110930/t/data/META-1_2.yml CPAN-Meta-2.110930/t/data/META-1_3.yml CPAN-Meta-2.110930/t/prereqs-finalize.t CPAN-Meta-2.110930/t/data/resources.yml CPAN-Meta-2.110930/lib/CPAN/Meta CPAN-Meta-2.110930/lib/CPAN/Meta/Spec.pm CPAN-Meta-2.110930/t/data-bad CPAN-Meta-2.110930/t/data-bad/META-2.json CPAN-Meta-2.110930/t/data-bad/META-1_1.yml CPAN-Meta-2.110930/t/data-bad/META-1_0.yml CPAN-Meta-2.110930/t/data-bad/META-1_4.yml CPAN-Meta-2.110930/t/data-bad/META-1_2.yml CPAN-Meta-2.110930/t/data-bad/META-1_3.yml CPAN-Meta-2.110930/t/data-fail CPAN-Meta-2.110930/t/data-fail/META-2.json CPAN-Meta-2.110930/xt/release CPAN-Meta-2.110930/xt/release/pod-syntax.t CPAN-Meta-2.110930/lib/CPAN/Meta/Feature.pm CPAN-Meta-2.110930/lib/CPAN/Meta/History.pm CPAN-Meta-2.110930/lib/CPAN/Meta/Prereqs.pm CPAN-Meta-2.110930/t/data/restricted-2.json CPAN-Meta-2.110930/t/data-fail/META-1_1.yml CPAN-Meta-2.110930/t/data-fail/META-1_0.yml CPAN-Meta-2.110930/t/data-fail/META-1_4.yml CPAN-Meta-2.110930/t/data-fail/META-1_2.yml CPAN-Meta-2.110930/t/data-fail/META-1_3.yml CPAN-Meta-2.110930/history CPAN-Meta-2.110930/history/META-spec-1_3.pod CPAN-Meta-2.110930/history/META-spec-1_4.pod CPAN-Meta-2.110930/history/META-spec-1_2.pod CPAN-Meta-2.110930/history/META-spec-1_0.html CPAN-Meta-2.110930/history/META-spec-1_1.html CPAN-Meta-2.110930/lib/CPAN/Meta/Validator.pm CPAN-Meta-2.110930/lib/CPAN/Meta/Converter.pm CPAN-Meta-2.110930/t/data/restrictive-1_4.yml CPAN-Meta-2.110930/t/data-bad/35478989-META.yml CPAN-Meta-2.110930/t/data-bad/98042513-META.yml CPAN-Meta-2.110930/t/data-bad/284247103-META.yml CPAN-Meta-2.110930/t/data-bad/restrictive-2.json CPAN-Meta-2.110930/t/data-bad/107650337-META.yml CPAN-Meta-2.110930/t/data-bad/476602558-META.yml CPAN-Meta-2.110930/t/data-bad/344981821-META.yml CPAN-Meta-2.110930/t/data-bad/1985684504-META.yml CPAN-Meta-2.110930/t/data-bad/2031017050-META.yml CPAN-Meta-2.110930/t/data-bad/1927486199-META.yml CPAN-Meta-2.110930/t/data-bad/1598804075-META.yml CPAN-Meta-2.110930/t/data-bad/1206545041-META.yml CPAN-Meta-2.110930/t/data-bad/1985980974-META.yml CPAN-Meta-2.110930/t/data-bad/1122575719-META.yml Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Warning: prerequisite CPAN::Meta::YAML 0.002 not found. Warning: prerequisite JSON::PP 2.27103 not found. We have 2.27003. Warning: prerequisite Parse::CPAN::Meta 1.4400 not found. We have 1.40. Warning: prerequisite Test::More 0.96 not found. We have 0.94. Checking if your kit is complete... Looks good Writing Makefile for CPAN::Meta ---- Unsatisfied dependencies detected during ---- ---- DAGOLDEN/CPAN-Meta-2.110930.tar.gz ---- Parse::CPAN::Meta [requires] CPAN::Meta::YAML [requires] Test::More [build_requires] JSON::PP [requires] Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test Delayed until after prerequisites Running test for module 'Parse::CPAN::Meta' Running make for D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Checksum for C:\cpanfly\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Parse-CPAN-Meta-1.4401.tar.gz ok Will not use Archive::Tar, need 1.00 Parse-CPAN-Meta-1.4401/ Parse-CPAN-Meta-1.4401/t/ Parse-CPAN-Meta-1.4401/t/data/ Parse-CPAN-Meta-1.4401/t/data/VR-META.yml Parse-CPAN-Meta-1.4401/t/data/VR-META.json Parse-CPAN-Meta-1.4401/t/01_compile.t Parse-CPAN-Meta-1.4401/t/04_export.t Parse-CPAN-Meta-1.4401/t/lib/ Parse-CPAN-Meta-1.4401/t/lib/Parse/ Parse-CPAN-Meta-1.4401/t/lib/Parse/CPAN/ Parse-CPAN-Meta-1.4401/t/lib/Parse/CPAN/Meta/ Parse-CPAN-Meta-1.4401/t/lib/Parse/CPAN/Meta/Test.pm Parse-CPAN-Meta-1.4401/t/05_errors.t Parse-CPAN-Meta-1.4401/t/03_functions.t Parse-CPAN-Meta-1.4401/t/02_api.t Parse-CPAN-Meta-1.4401/lib/ Parse-CPAN-Meta-1.4401/lib/Parse/ Parse-CPAN-Meta-1.4401/lib/Parse/CPAN/ Parse-CPAN-Meta-1.4401/lib/Parse/CPAN/Meta.pm Parse-CPAN-Meta-1.4401/Changes Parse-CPAN-Meta-1.4401/MANIFEST Parse-CPAN-Meta-1.4401/Makefile.PL Parse-CPAN-Meta-1.4401/META.yml Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Warning: prerequisite CPAN::Meta::YAML 0.002 not found. Warning: prerequisite JSON::PP 2.27103 not found. We have 2.27003. Checking if your kit is complete... Looks good Writing Makefile for Parse::CPAN::Meta ---- Unsatisfied dependencies detected during ---- ---- DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz ---- CPAN::Meta::YAML [requires] JSON::PP [requires] Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test Delayed until after prerequisites Running test for module 'CPAN::Meta::YAML' Running make for D/DA/DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Checksum for C:\cpanfly\var\cpan\sources\authors\id\D\DA\DAGOLDEN\CPAN-Meta-YAML-0.003.tar.gz ok Will not use Archive::Tar, need 1.00 CPAN-Meta-YAML-0.003 CPAN-Meta-YAML-0.003/README CPAN-Meta-YAML-0.003/Changes CPAN-Meta-YAML-0.003/LICENSE CPAN-Meta-YAML-0.003/META.yml CPAN-Meta-YAML-0.003/MANIFEST CPAN-Meta-YAML-0.003/META.json CPAN-Meta-YAML-0.003/t CPAN-Meta-YAML-0.003/t/18_tap.t CPAN-Meta-YAML-0.003/t/21_bom.t CPAN-Meta-YAML-0.003/Makefile.PL CPAN-Meta-YAML-0.003/t/02_basic.t CPAN-Meta-YAML-0.003/t/05_export.t CPAN-Meta-YAML-0.003/t/04_scalar.t CPAN-Meta-YAML-0.003/t/19_errors.t CPAN-Meta-YAML-0.003/t/lib CPAN-Meta-YAML-0.003/t/lib/Test.pm CPAN-Meta-YAML-0.003/MANIFEST.SKIP CPAN-Meta-YAML-0.003/t/12_plagger.t CPAN-Meta-YAML-0.003/t/17_toolbar.t CPAN-Meta-YAML-0.003/t/01_compile.t CPAN-Meta-YAML-0.003/t/data CPAN-Meta-YAML-0.003/t/data/one.yml CPAN-Meta-YAML-0.003/t/data/two.yml CPAN-Meta-YAML-0.003/t/16_nullrefs.t CPAN-Meta-YAML-0.003/t/14_yaml_org.t CPAN-Meta-YAML-0.003/t/22_comments.t CPAN-Meta-YAML-0.003/t/20_subclass.t CPAN-Meta-YAML-0.003/t/11_meta_yml.t CPAN-Meta-YAML-0.003/t/15_multibyte.t CPAN-Meta-YAML-0.003/t/13_perl_smith.t CPAN-Meta-YAML-0.003/t/03_regression.t CPAN-Meta-YAML-0.003/t/data/sample.yml CPAN-Meta-YAML-0.003/t/data/vanilla.yml CPAN-Meta-YAML-0.003/t/data/toolbar.yml CPAN-Meta-YAML-0.003/t/data/multibyte.yml CPAN-Meta-YAML-0.003/lib/CPAN/Meta CPAN-Meta-YAML-0.003/lib/CPAN/Meta/YAML.pm CPAN-Meta-YAML-0.003/xt/release CPAN-Meta-YAML-0.003/xt/release/distmeta.t CPAN-Meta-YAML-0.003/t/data/HTML-WebDAO.yml CPAN-Meta-YAML-0.003/xt/release/pod-syntax.t CPAN-Meta-YAML-0.003/t/data/utf_16_le_bom.yml CPAN-Meta-YAML-0.003/t/data/Spreadsheet-Read.yml CPAN-Meta-YAML-0.003/t/data/Template-Provider-Unicode-Japanese.yml Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Checking if your kit is complete... Looks good Writing Makefile for CPAN::Meta::YAML >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/CPAN/Meta/YAML.pm blib\lib\CPAN\Meta\YAML.pm DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/01_compile.t ..... 1..3 ok 1 - Your perl is new enough ok 2 - use CPAN::Meta::YAML; ok 3 - use t::lib::Test; ok t/02_basic.t ....... 1..1140 ok 1 - empty: YAML.pm saves without error ok 2 - empty: YAML.pm serializes correctly ok 3 - empty: YAML.pm round-trips without error ok 4 - empty: YAML.pm round-trips correctly ok 5 - empty: YAML.pm loads without error ok 6 - empty: YAML.pm does not modify the input string ok 7 - empty: YAML.pm parses correctly ok 8 # skip Skipping YAML::Syck for unsupported feature ok 9 # skip Skipping YAML::Syck for unsupported feature ok 10 # skip Skipping YAML::Syck for unsupported feature ok 11 # skip Skipping YAML::Syck for unsupported feature ok 12 # skip Skipping YAML::Syck for unsupported feature ok 13 # skip Skipping YAML::Syck for unsupported feature ok 14 # skip Skipping YAML::Syck for unsupported feature ok 15 - empty: YAML::XS saves without error ok 16 - empty: YAML::XS serializes correctly ok 17 - empty: YAML::XS round-trips without error ok 18 - empty: YAML::XS round-trips correctly ok 19 - empty: YAML::XS loads without error ok 20 - empty: YAML::XS does not modify the input string ok 21 - empty: YAML::XS parses correctly ok 22 - empty: YAML::Perl saves without error ok 23 - empty: YAML::Perl serializes correctly ok 24 - empty: YAML::Perl round-trips without error ok 25 - empty: YAML::Perl round-trips correctly ok 26 - empty: YAML::Perl loads without error ok 27 - empty: YAML::Perl does not modify the input string ok 28 - empty: YAML::Perl parses correctly ok 29 - empty: CPAN::Meta::YAML parses without error ok 30 - empty: CPAN::Meta::YAML does not modify the input string ok 31 - The object isa CPAN::Meta::YAML ok 32 - empty: CPAN::Meta::YAML parses correctly ok 33 - empty: CPAN::Meta::YAML serializes without error ok 34 - empty: CPAN::Meta::YAML serializes correctly ok 35 - empty: CPAN::Meta::YAML round-trips without error ok 36 - The object isa CPAN::Meta::YAML ok 37 - empty: CPAN::Meta::YAML round-trips correctly ok 38 # skip Shortcutting perfect serialization tests ok 39 - only_newlines: YAML.pm saves without error ok 40 - only_newlines: YAML.pm serializes correctly ok 41 - only_newlines: YAML.pm round-trips without error ok 42 - only_newlines: YAML.pm round-trips correctly ok 43 - only_newlines: YAML.pm loads without error ok 44 - only_newlines: YAML.pm does not modify the input string ok 45 - only_newlines: YAML.pm parses correctly ok 46 # skip Skipping YAML::Syck for unsupported feature ok 47 # skip Skipping YAML::Syck for unsupported feature ok 48 # skip Skipping YAML::Syck for unsupported feature ok 49 # skip Skipping YAML::Syck for unsupported feature ok 50 # skip Skipping YAML::Syck for unsupported feature ok 51 # skip Skipping YAML::Syck for unsupported feature ok 52 # skip Skipping YAML::Syck for unsupported feature ok 53 - only_newlines: YAML::XS saves without error ok 54 - only_newlines: YAML::XS serializes correctly ok 55 - only_newlines: YAML::XS round-trips without error ok 56 - only_newlines: YAML::XS round-trips correctly ok 57 - only_newlines: YAML::XS loads without error ok 58 - only_newlines: YAML::XS does not modify the input string ok 59 - only_newlines: YAML::XS parses correctly ok 60 - only_newlines: YAML::Perl saves without error ok 61 - only_newlines: YAML::Perl serializes correctly ok 62 - only_newlines: YAML::Perl round-trips without error ok 63 - only_newlines: YAML::Perl round-trips correctly ok 64 - only_newlines: YAML::Perl loads without error ok 65 - only_newlines: YAML::Perl does not modify the input string ok 66 - only_newlines: YAML::Perl parses correctly ok 67 - only_newlines: CPAN::Meta::YAML parses without error ok 68 - only_newlines: CPAN::Meta::YAML does not modify the input string ok 69 - The object isa CPAN::Meta::YAML ok 70 - only_newlines: CPAN::Meta::YAML parses correctly ok 71 - only_newlines: CPAN::Meta::YAML serializes without error ok 72 - only_newlines: CPAN::Meta::YAML serializes correctly ok 73 - only_newlines: CPAN::Meta::YAML round-trips without error ok 74 - The object isa CPAN::Meta::YAML ok 75 - only_newlines: CPAN::Meta::YAML round-trips correctly ok 76 # skip Shortcutting perfect serialization tests ok 77 - only_comment: YAML.pm saves without error ok 78 - only_comment: YAML.pm serializes correctly ok 79 - only_comment: YAML.pm round-trips without error ok 80 - only_comment: YAML.pm round-trips correctly ok 81 - only_comment: YAML.pm loads without error ok 82 - only_comment: YAML.pm does not modify the input string ok 83 - only_comment: YAML.pm parses correctly ok 84 # skip Skipping YAML::Syck for unsupported feature ok 85 # skip Skipping YAML::Syck for unsupported feature ok 86 # skip Skipping YAML::Syck for unsupported feature ok 87 # skip Skipping YAML::Syck for unsupported feature ok 88 # skip Skipping YAML::Syck for unsupported feature ok 89 # skip Skipping YAML::Syck for unsupported feature ok 90 # skip Skipping YAML::Syck for unsupported feature ok 91 - only_comment: YAML::XS saves without error ok 92 - only_comment: YAML::XS serializes correctly ok 93 - only_comment: YAML::XS round-trips without error ok 94 - only_comment: YAML::XS round-trips correctly ok 95 - only_comment: YAML::XS loads without error ok 96 - only_comment: YAML::XS does not modify the input string ok 97 - only_comment: YAML::XS parses correctly ok 98 - only_comment: YAML::Perl saves without error ok 99 - only_comment: YAML::Perl serializes correctly ok 100 - only_comment: YAML::Perl round-trips without error ok 101 - only_comment: YAML::Perl round-trips correctly ok 102 - only_comment: YAML::Perl loads without error ok 103 - only_comment: YAML::Perl does not modify the input string ok 104 - only_comment: YAML::Perl parses correctly ok 105 - only_comment: CPAN::Meta::YAML parses without error ok 106 - only_comment: CPAN::Meta::YAML does not modify the input string ok 107 - The object isa CPAN::Meta::YAML ok 108 - only_comment: CPAN::Meta::YAML parses correctly ok 109 - only_comment: CPAN::Meta::YAML serializes without error ok 110 - only_comment: CPAN::Meta::YAML serializes correctly ok 111 - only_comment: CPAN::Meta::YAML round-trips without error ok 112 - The object isa CPAN::Meta::YAML ok 113 - only_comment: CPAN::Meta::YAML round-trips correctly ok 114 # skip Shortcutting perfect serialization tests ok 115 - only_header: YAML.pm saves without error ok 116 - only_header: YAML.pm serializes correctly ok 117 - only_header: YAML.pm round-trips without error ok 118 - only_header: YAML.pm round-trips correctly ok 119 - only_header: YAML.pm loads without error ok 120 - only_header: YAML.pm does not modify the input string ok 121 - only_header: YAML.pm parses correctly ok 122 - only_header: YAML::Syck saves without error ok 123 - only_header: YAML::Syck serializes correctly ok 124 - only_header: YAML::Syck round-trips without error ok 125 - only_header: YAML::Syck round-trips correctly ok 126 - only_header: YAML::Syck loads without error ok 127 - only_header: YAML::Syck does not modify the input string ok 128 - only_header: YAML::Syck parses correctly ok 129 - only_header: YAML::XS saves without error ok 130 - only_header: YAML::XS serializes correctly ok 131 - only_header: YAML::XS round-trips without error ok 132 - only_header: YAML::XS round-trips correctly ok 133 - only_header: YAML::XS loads without error ok 134 - only_header: YAML::XS does not modify the input string ok 135 - only_header: YAML::XS parses correctly ok 136 # skip Skipping YAML::Perl for known-broken feature ok 137 # skip Skipping YAML::Perl for known-broken feature ok 138 # skip Skipping YAML::Perl for known-broken feature ok 139 # skip Skipping YAML::Perl for known-broken feature ok 140 # skip Skipping YAML::Perl for known-broken feature ok 141 # skip Skipping YAML::Perl for known-broken feature ok 142 # skip Skipping YAML::Perl for known-broken feature ok 143 - only_header: CPAN::Meta::YAML parses without error ok 144 - only_header: CPAN::Meta::YAML does not modify the input string ok 145 - The object isa CPAN::Meta::YAML ok 146 - only_header: CPAN::Meta::YAML parses correctly ok 147 - only_header: CPAN::Meta::YAML serializes without error ok 148 - only_header: CPAN::Meta::YAML serializes correctly ok 149 - only_header: CPAN::Meta::YAML round-trips without error ok 150 - The object isa CPAN::Meta::YAML ok 151 - only_header: CPAN::Meta::YAML round-trips correctly ok 152 # skip Shortcutting perfect serialization tests ok 153 - two_header: YAML.pm saves without error ok 154 - two_header: YAML.pm serializes correctly ok 155 - two_header: YAML.pm round-trips without error ok 156 - two_header: YAML.pm round-trips correctly ok 157 - two_header: YAML.pm loads without error ok 158 - two_header: YAML.pm does not modify the input string ok 159 - two_header: YAML.pm parses correctly ok 160 # skip Skipping YAML::Syck for unsupported feature ok 161 # skip Skipping YAML::Syck for unsupported feature ok 162 # skip Skipping YAML::Syck for unsupported feature ok 163 # skip Skipping YAML::Syck for unsupported feature ok 164 # skip Skipping YAML::Syck for unsupported feature ok 165 # skip Skipping YAML::Syck for unsupported feature ok 166 # skip Skipping YAML::Syck for unsupported feature ok 167 - two_header: YAML::XS saves without error ok 168 - two_header: YAML::XS serializes correctly ok 169 - two_header: YAML::XS round-trips without error ok 170 - two_header: YAML::XS round-trips correctly ok 171 - two_header: YAML::XS loads without error ok 172 - two_header: YAML::XS does not modify the input string ok 173 - two_header: YAML::XS parses correctly ok 174 # skip Skipping YAML::Perl for known-broken feature ok 175 # skip Skipping YAML::Perl for known-broken feature ok 176 # skip Skipping YAML::Perl for known-broken feature ok 177 # skip Skipping YAML::Perl for known-broken feature ok 178 # skip Skipping YAML::Perl for known-broken feature ok 179 # skip Skipping YAML::Perl for known-broken feature ok 180 # skip Skipping YAML::Perl for known-broken feature ok 181 - two_header: CPAN::Meta::YAML parses without error ok 182 - two_header: CPAN::Meta::YAML does not modify the input string ok 183 - The object isa CPAN::Meta::YAML ok 184 - two_header: CPAN::Meta::YAML parses correctly ok 185 - two_header: CPAN::Meta::YAML serializes without error ok 186 - two_header: CPAN::Meta::YAML serializes correctly ok 187 - two_header: CPAN::Meta::YAML round-trips without error ok 188 - The object isa CPAN::Meta::YAML ok 189 - two_header: CPAN::Meta::YAML round-trips correctly ok 190 # skip Shortcutting perfect serialization tests ok 191 - one_undef: YAML.pm saves without error ok 192 - one_undef: YAML.pm serializes correctly ok 193 - one_undef: YAML.pm round-trips without error ok 194 - one_undef: YAML.pm round-trips correctly ok 195 - one_undef: YAML.pm loads without error ok 196 - one_undef: YAML.pm does not modify the input string ok 197 - one_undef: YAML.pm parses correctly ok 198 - one_undef: YAML::Syck saves without error ok 199 - one_undef: YAML::Syck serializes correctly ok 200 - one_undef: YAML::Syck round-trips without error ok 201 - one_undef: YAML::Syck round-trips correctly ok 202 - one_undef: YAML::Syck loads without error ok 203 - one_undef: YAML::Syck does not modify the input string ok 204 - one_undef: YAML::Syck parses correctly ok 205 - one_undef: YAML::XS saves without error ok 206 - one_undef: YAML::XS serializes correctly ok 207 - one_undef: YAML::XS round-trips without error ok 208 - one_undef: YAML::XS round-trips correctly ok 209 - one_undef: YAML::XS loads without error ok 210 - one_undef: YAML::XS does not modify the input string ok 211 - one_undef: YAML::XS parses correctly ok 212 # skip Skipping YAML::Perl for known-broken feature ok 213 # skip Skipping YAML::Perl for known-broken feature ok 214 # skip Skipping YAML::Perl for known-broken feature ok 215 # skip Skipping YAML::Perl for known-broken feature ok 216 # skip Skipping YAML::Perl for known-broken feature ok 217 # skip Skipping YAML::Perl for known-broken feature ok 218 # skip Skipping YAML::Perl for known-broken feature ok 219 - one_undef: CPAN::Meta::YAML parses without error ok 220 - one_undef: CPAN::Meta::YAML does not modify the input string ok 221 - The object isa CPAN::Meta::YAML ok 222 - one_undef: CPAN::Meta::YAML parses correctly ok 223 - one_undef: CPAN::Meta::YAML serializes without error ok 224 - one_undef: CPAN::Meta::YAML serializes correctly ok 225 - one_undef: CPAN::Meta::YAML round-trips without error ok 226 - The object isa CPAN::Meta::YAML ok 227 - one_undef: CPAN::Meta::YAML round-trips correctly ok 228 # skip Shortcutting perfect serialization tests ok 229 - one_undef2: YAML.pm saves without error ok 230 - one_undef2: YAML.pm serializes correctly ok 231 - one_undef2: YAML.pm round-trips without error ok 232 - one_undef2: YAML.pm round-trips correctly ok 233 - one_undef2: YAML.pm loads without error ok 234 - one_undef2: YAML.pm does not modify the input string ok 235 - one_undef2: YAML.pm parses correctly ok 236 - one_undef2: YAML::Syck saves without error ok 237 - one_undef2: YAML::Syck serializes correctly ok 238 - one_undef2: YAML::Syck round-trips without error ok 239 - one_undef2: YAML::Syck round-trips correctly ok 240 - one_undef2: YAML::Syck loads without error ok 241 - one_undef2: YAML::Syck does not modify the input string ok 242 - one_undef2: YAML::Syck parses correctly ok 243 - one_undef2: YAML::XS saves without error ok 244 - one_undef2: YAML::XS serializes correctly ok 245 - one_undef2: YAML::XS round-trips without error ok 246 - one_undef2: YAML::XS round-trips correctly ok 247 - one_undef2: YAML::XS loads without error ok 248 - one_undef2: YAML::XS does not modify the input string ok 249 - one_undef2: YAML::XS parses correctly ok 250 # skip Skipping YAML::Perl for known-broken feature ok 251 # skip Skipping YAML::Perl for known-broken feature ok 252 # skip Skipping YAML::Perl for known-broken feature ok 253 # skip Skipping YAML::Perl for known-broken feature ok 254 # skip Skipping YAML::Perl for known-broken feature ok 255 # skip Skipping YAML::Perl for known-broken feature ok 256 # skip Skipping YAML::Perl for known-broken feature ok 257 - one_undef2: CPAN::Meta::YAML parses without error ok 258 - one_undef2: CPAN::Meta::YAML does not modify the input string ok 259 - The object isa CPAN::Meta::YAML ok 260 - one_undef2: CPAN::Meta::YAML parses correctly ok 261 - one_undef2: CPAN::Meta::YAML serializes without error ok 262 - one_undef2: CPAN::Meta::YAML serializes correctly ok 263 - one_undef2: CPAN::Meta::YAML round-trips without error ok 264 - The object isa CPAN::Meta::YAML ok 265 - one_undef2: CPAN::Meta::YAML round-trips correctly ok 266 # skip Shortcutting perfect serialization tests ok 267 - two_undef: YAML.pm saves without error ok 268 - two_undef: YAML.pm serializes correctly ok 269 - two_undef: YAML.pm round-trips without error ok 270 - two_undef: YAML.pm round-trips correctly ok 271 - two_undef: YAML.pm loads without error ok 272 - two_undef: YAML.pm does not modify the input string ok 273 - two_undef: YAML.pm parses correctly ok 274 # skip Skipping YAML::Syck for unsupported feature ok 275 # skip Skipping YAML::Syck for unsupported feature ok 276 # skip Skipping YAML::Syck for unsupported feature ok 277 # skip Skipping YAML::Syck for unsupported feature ok 278 # skip Skipping YAML::Syck for unsupported feature ok 279 # skip Skipping YAML::Syck for unsupported feature ok 280 # skip Skipping YAML::Syck for unsupported feature ok 281 - two_undef: YAML::XS saves without error ok 282 - two_undef: YAML::XS serializes correctly ok 283 - two_undef: YAML::XS round-trips without error ok 284 - two_undef: YAML::XS round-trips correctly ok 285 - two_undef: YAML::XS loads without error ok 286 - two_undef: YAML::XS does not modify the input string ok 287 - two_undef: YAML::XS parses correctly ok 288 # skip Skipping YAML::Perl for known-broken feature ok 289 # skip Skipping YAML::Perl for known-broken feature ok 290 # skip Skipping YAML::Perl for known-broken feature ok 291 # skip Skipping YAML::Perl for known-broken feature ok 292 # skip Skipping YAML::Perl for known-broken feature ok 293 # skip Skipping YAML::Perl for known-broken feature ok 294 # skip Skipping YAML::Perl for known-broken feature ok 295 - two_undef: CPAN::Meta::YAML parses without error ok 296 - two_undef: CPAN::Meta::YAML does not modify the input string ok 297 - The object isa CPAN::Meta::YAML ok 298 - two_undef: CPAN::Meta::YAML parses correctly ok 299 - two_undef: CPAN::Meta::YAML serializes without error ok 300 - two_undef: CPAN::Meta::YAML serializes correctly ok 301 - two_undef: CPAN::Meta::YAML round-trips without error ok 302 - The object isa CPAN::Meta::YAML ok 303 - two_undef: CPAN::Meta::YAML round-trips correctly ok 304 # skip Shortcutting perfect serialization tests ok 305 - one_scalar: YAML.pm saves without error ok 306 - one_scalar: YAML.pm serializes correctly ok 307 - one_scalar: YAML.pm round-trips without error ok 308 - one_scalar: YAML.pm round-trips correctly ok 309 - one_scalar: YAML.pm loads without error ok 310 - one_scalar: YAML.pm does not modify the input string ok 311 - one_scalar: YAML.pm parses correctly ok 312 - one_scalar: YAML::Syck saves without error ok 313 - one_scalar: YAML::Syck serializes correctly ok 314 - one_scalar: YAML::Syck round-trips without error ok 315 - one_scalar: YAML::Syck round-trips correctly ok 316 - one_scalar: YAML::Syck loads without error ok 317 - one_scalar: YAML::Syck does not modify the input string ok 318 - one_scalar: YAML::Syck parses correctly ok 319 - one_scalar: YAML::XS saves without error ok 320 - one_scalar: YAML::XS serializes correctly ok 321 - one_scalar: YAML::XS round-trips without error ok 322 - one_scalar: YAML::XS round-trips correctly ok 323 - one_scalar: YAML::XS loads without error ok 324 - one_scalar: YAML::XS does not modify the input string ok 325 - one_scalar: YAML::XS parses correctly ok 326 - one_scalar: YAML::Perl saves without error ok 327 - one_scalar: YAML::Perl serializes correctly ok 328 - one_scalar: YAML::Perl round-trips without error ok 329 - one_scalar: YAML::Perl round-trips correctly ok 330 - one_scalar: YAML::Perl loads without error ok 331 - one_scalar: YAML::Perl does not modify the input string ok 332 - one_scalar: YAML::Perl parses correctly ok 333 - one_scalar: CPAN::Meta::YAML parses without error ok 334 - one_scalar: CPAN::Meta::YAML does not modify the input string ok 335 - The object isa CPAN::Meta::YAML ok 336 - one_scalar: CPAN::Meta::YAML parses correctly ok 337 - one_scalar: CPAN::Meta::YAML serializes without error ok 338 - one_scalar: CPAN::Meta::YAML serializes correctly ok 339 - one_scalar: CPAN::Meta::YAML round-trips without error ok 340 - The object isa CPAN::Meta::YAML ok 341 - one_scalar: CPAN::Meta::YAML round-trips correctly ok 342 # skip Shortcutting perfect serialization tests ok 343 - one_scalar2: YAML.pm saves without error ok 344 - one_scalar2: YAML.pm serializes correctly ok 345 - one_scalar2: YAML.pm round-trips without error ok 346 - one_scalar2: YAML.pm round-trips correctly ok 347 - one_scalar2: YAML.pm loads without error ok 348 - one_scalar2: YAML.pm does not modify the input string ok 349 - one_scalar2: YAML.pm parses correctly ok 350 - one_scalar2: YAML::Syck saves without error ok 351 - one_scalar2: YAML::Syck serializes correctly ok 352 - one_scalar2: YAML::Syck round-trips without error ok 353 - one_scalar2: YAML::Syck round-trips correctly ok 354 - one_scalar2: YAML::Syck loads without error ok 355 - one_scalar2: YAML::Syck does not modify the input string ok 356 - one_scalar2: YAML::Syck parses correctly ok 357 - one_scalar2: YAML::XS saves without error ok 358 - one_scalar2: YAML::XS serializes correctly ok 359 - one_scalar2: YAML::XS round-trips without error ok 360 - one_scalar2: YAML::XS round-trips correctly ok 361 - one_scalar2: YAML::XS loads without error ok 362 - one_scalar2: YAML::XS does not modify the input string ok 363 - one_scalar2: YAML::XS parses correctly ok 364 - one_scalar2: YAML::Perl saves without error ok 365 - one_scalar2: YAML::Perl serializes correctly ok 366 - one_scalar2: YAML::Perl round-trips without error ok 367 - one_scalar2: YAML::Perl round-trips correctly ok 368 - one_scalar2: YAML::Perl loads without error ok 369 - one_scalar2: YAML::Perl does not modify the input string ok 370 - one_scalar2: YAML::Perl parses correctly ok 371 - one_scalar2: CPAN::Meta::YAML parses without error ok 372 - one_scalar2: CPAN::Meta::YAML does not modify the input string ok 373 - The object isa CPAN::Meta::YAML ok 374 - one_scalar2: CPAN::Meta::YAML parses correctly ok 375 - one_scalar2: CPAN::Meta::YAML serializes without error ok 376 - one_scalar2: CPAN::Meta::YAML serializes correctly ok 377 - one_scalar2: CPAN::Meta::YAML round-trips without error ok 378 - The object isa CPAN::Meta::YAML ok 379 - one_scalar2: CPAN::Meta::YAML round-trips correctly ok 380 # skip Shortcutting perfect serialization tests ok 381 - two_scalar: YAML.pm saves without error ok 382 - two_scalar: YAML.pm serializes correctly ok 383 - two_scalar: YAML.pm round-trips without error ok 384 - two_scalar: YAML.pm round-trips correctly ok 385 - two_scalar: YAML.pm loads without error ok 386 - two_scalar: YAML.pm does not modify the input string ok 387 - two_scalar: YAML.pm parses correctly ok 388 # skip Skipping YAML::Syck for unsupported feature ok 389 # skip Skipping YAML::Syck for unsupported feature ok 390 # skip Skipping YAML::Syck for unsupported feature ok 391 # skip Skipping YAML::Syck for unsupported feature ok 392 # skip Skipping YAML::Syck for unsupported feature ok 393 # skip Skipping YAML::Syck for unsupported feature ok 394 # skip Skipping YAML::Syck for unsupported feature ok 395 - two_scalar: YAML::XS saves without error ok 396 - two_scalar: YAML::XS serializes correctly ok 397 - two_scalar: YAML::XS round-trips without error ok 398 - two_scalar: YAML::XS round-trips correctly ok 399 - two_scalar: YAML::XS loads without error ok 400 - two_scalar: YAML::XS does not modify the input string ok 401 - two_scalar: YAML::XS parses correctly ok 402 # skip Skipping YAML::Perl for known-broken feature ok 403 # skip Skipping YAML::Perl for known-broken feature ok 404 # skip Skipping YAML::Perl for known-broken feature ok 405 # skip Skipping YAML::Perl for known-broken feature ok 406 # skip Skipping YAML::Perl for known-broken feature ok 407 # skip Skipping YAML::Perl for known-broken feature ok 408 # skip Skipping YAML::Perl for known-broken feature ok 409 - two_scalar: CPAN::Meta::YAML parses without error ok 410 - two_scalar: CPAN::Meta::YAML does not modify the input string ok 411 - The object isa CPAN::Meta::YAML ok 412 - two_scalar: CPAN::Meta::YAML parses correctly ok 413 - two_scalar: CPAN::Meta::YAML serializes without error ok 414 - two_scalar: CPAN::Meta::YAML serializes correctly ok 415 - two_scalar: CPAN::Meta::YAML round-trips without error ok 416 - The object isa CPAN::Meta::YAML ok 417 - two_scalar: CPAN::Meta::YAML round-trips correctly ok 418 # skip Shortcutting perfect serialization tests ok 419 - one_list1: YAML.pm saves without error ok 420 - one_list1: YAML.pm serializes correctly ok 421 - one_list1: YAML.pm round-trips without error ok 422 - one_list1: YAML.pm round-trips correctly ok 423 - one_list1: YAML.pm loads without error ok 424 - one_list1: YAML.pm does not modify the input string ok 425 - one_list1: YAML.pm parses correctly ok 426 - one_list1: YAML::Syck saves without error ok 427 - one_list1: YAML::Syck serializes correctly ok 428 - one_list1: YAML::Syck round-trips without error ok 429 - one_list1: YAML::Syck round-trips correctly ok 430 - one_list1: YAML::Syck loads without error ok 431 - one_list1: YAML::Syck does not modify the input string ok 432 - one_list1: YAML::Syck parses correctly ok 433 - one_list1: YAML::XS saves without error ok 434 - one_list1: YAML::XS serializes correctly ok 435 - one_list1: YAML::XS round-trips without error ok 436 - one_list1: YAML::XS round-trips correctly ok 437 - one_list1: YAML::XS loads without error ok 438 - one_list1: YAML::XS does not modify the input string ok 439 - one_list1: YAML::XS parses correctly ok 440 - one_list1: YAML::Perl saves without error ok 441 - one_list1: YAML::Perl serializes correctly ok 442 - one_list1: YAML::Perl round-trips without error ok 443 - one_list1: YAML::Perl round-trips correctly ok 444 - one_list1: YAML::Perl loads without error ok 445 - one_list1: YAML::Perl does not modify the input string ok 446 - one_list1: YAML::Perl parses correctly ok 447 - one_list1: CPAN::Meta::YAML parses without error ok 448 - one_list1: CPAN::Meta::YAML does not modify the input string ok 449 - The object isa CPAN::Meta::YAML ok 450 - one_list1: CPAN::Meta::YAML parses correctly ok 451 - one_list1: CPAN::Meta::YAML serializes without error ok 452 - one_list1: CPAN::Meta::YAML serializes correctly ok 453 - one_list1: CPAN::Meta::YAML round-trips without error ok 454 - The object isa CPAN::Meta::YAML ok 455 - one_list1: CPAN::Meta::YAML round-trips correctly ok 456 # skip Shortcutting perfect serialization tests ok 457 - one_list2: YAML.pm saves without error ok 458 - one_list2: YAML.pm serializes correctly ok 459 - one_list2: YAML.pm round-trips without error ok 460 - one_list2: YAML.pm round-trips correctly ok 461 - one_list2: YAML.pm loads without error ok 462 - one_list2: YAML.pm does not modify the input string ok 463 - one_list2: YAML.pm parses correctly ok 464 - one_list2: YAML::Syck saves without error ok 465 - one_list2: YAML::Syck serializes correctly ok 466 - one_list2: YAML::Syck round-trips without error ok 467 - one_list2: YAML::Syck round-trips correctly ok 468 - one_list2: YAML::Syck loads without error ok 469 - one_list2: YAML::Syck does not modify the input string ok 470 - one_list2: YAML::Syck parses correctly ok 471 - one_list2: YAML::XS saves without error ok 472 - one_list2: YAML::XS serializes correctly ok 473 - one_list2: YAML::XS round-trips without error ok 474 - one_list2: YAML::XS round-trips correctly ok 475 - one_list2: YAML::XS loads without error ok 476 - one_list2: YAML::XS does not modify the input string ok 477 - one_list2: YAML::XS parses correctly ok 478 - one_list2: YAML::Perl saves without error ok 479 - one_list2: YAML::Perl serializes correctly ok 480 - one_list2: YAML::Perl round-trips without error ok 481 - one_list2: YAML::Perl round-trips correctly ok 482 - one_list2: YAML::Perl loads without error ok 483 - one_list2: YAML::Perl does not modify the input string ok 484 - one_list2: YAML::Perl parses correctly ok 485 - one_list2: CPAN::Meta::YAML parses without error ok 486 - one_list2: CPAN::Meta::YAML does not modify the input string ok 487 - The object isa CPAN::Meta::YAML ok 488 - one_list2: CPAN::Meta::YAML parses correctly ok 489 - one_list2: CPAN::Meta::YAML serializes without error ok 490 - one_list2: CPAN::Meta::YAML serializes correctly ok 491 - one_list2: CPAN::Meta::YAML round-trips without error ok 492 - The object isa CPAN::Meta::YAML ok 493 - one_list2: CPAN::Meta::YAML round-trips correctly ok 494 # skip Shortcutting perfect serialization tests ok 495 - one_listundef: YAML.pm saves without error ok 496 - one_listundef: YAML.pm serializes correctly ok 497 - one_listundef: YAML.pm round-trips without error ok 498 - one_listundef: YAML.pm round-trips correctly ok 499 - one_listundef: YAML.pm loads without error ok 500 - one_listundef: YAML.pm does not modify the input string ok 501 - one_listundef: YAML.pm parses correctly ok 502 - one_listundef: YAML::Syck saves without error ok 503 - one_listundef: YAML::Syck serializes correctly ok 504 - one_listundef: YAML::Syck round-trips without error ok 505 - one_listundef: YAML::Syck round-trips correctly ok 506 - one_listundef: YAML::Syck loads without error ok 507 - one_listundef: YAML::Syck does not modify the input string ok 508 - one_listundef: YAML::Syck parses correctly ok 509 - one_listundef: YAML::XS saves without error ok 510 - one_listundef: YAML::XS serializes correctly ok 511 - one_listundef: YAML::XS round-trips without error ok 512 - one_listundef: YAML::XS round-trips correctly ok 513 - one_listundef: YAML::XS loads without error ok 514 - one_listundef: YAML::XS does not modify the input string ok 515 - one_listundef: YAML::XS parses correctly ok 516 # skip Skipping YAML::Perl for known-broken feature ok 517 # skip Skipping YAML::Perl for known-broken feature ok 518 # skip Skipping YAML::Perl for known-broken feature ok 519 # skip Skipping YAML::Perl for known-broken feature ok 520 # skip Skipping YAML::Perl for known-broken feature ok 521 # skip Skipping YAML::Perl for known-broken feature ok 522 # skip Skipping YAML::Perl for known-broken feature ok 523 - one_listundef: CPAN::Meta::YAML parses without error ok 524 - one_listundef: CPAN::Meta::YAML does not modify the input string ok 525 - The object isa CPAN::Meta::YAML ok 526 - one_listundef: CPAN::Meta::YAML parses correctly ok 527 - one_listundef: CPAN::Meta::YAML serializes without error ok 528 - one_listundef: CPAN::Meta::YAML serializes correctly ok 529 - one_listundef: CPAN::Meta::YAML round-trips without error ok 530 - The object isa CPAN::Meta::YAML ok 531 - one_listundef: CPAN::Meta::YAML round-trips correctly ok 532 # skip Shortcutting perfect serialization tests ok 533 - one_hash1: YAML.pm saves without error ok 534 - one_hash1: YAML.pm serializes correctly ok 535 - one_hash1: YAML.pm round-trips without error ok 536 - one_hash1: YAML.pm round-trips correctly ok 537 - one_hash1: YAML.pm loads without error ok 538 - one_hash1: YAML.pm does not modify the input string ok 539 - one_hash1: YAML.pm parses correctly ok 540 - one_hash1: YAML::Syck saves without error ok 541 - one_hash1: YAML::Syck serializes correctly ok 542 - one_hash1: YAML::Syck round-trips without error ok 543 - one_hash1: YAML::Syck round-trips correctly ok 544 - one_hash1: YAML::Syck loads without error ok 545 - one_hash1: YAML::Syck does not modify the input string ok 546 - one_hash1: YAML::Syck parses correctly ok 547 - one_hash1: YAML::XS saves without error ok 548 - one_hash1: YAML::XS serializes correctly ok 549 - one_hash1: YAML::XS round-trips without error ok 550 - one_hash1: YAML::XS round-trips correctly ok 551 - one_hash1: YAML::XS loads without error ok 552 - one_hash1: YAML::XS does not modify the input string ok 553 - one_hash1: YAML::XS parses correctly ok 554 - one_hash1: YAML::Perl saves without error ok 555 - one_hash1: YAML::Perl serializes correctly ok 556 - one_hash1: YAML::Perl round-trips without error ok 557 - one_hash1: YAML::Perl round-trips correctly ok 558 - one_hash1: YAML::Perl loads without error ok 559 - one_hash1: YAML::Perl does not modify the input string ok 560 - one_hash1: YAML::Perl parses correctly ok 561 - one_hash1: CPAN::Meta::YAML parses without error ok 562 - one_hash1: CPAN::Meta::YAML does not modify the input string ok 563 - The object isa CPAN::Meta::YAML ok 564 - one_hash1: CPAN::Meta::YAML parses correctly ok 565 - one_hash1: CPAN::Meta::YAML serializes without error ok 566 - one_hash1: CPAN::Meta::YAML serializes correctly ok 567 - one_hash1: CPAN::Meta::YAML round-trips without error ok 568 - The object isa CPAN::Meta::YAML ok 569 - one_hash1: CPAN::Meta::YAML round-trips correctly ok 570 # skip Shortcutting perfect serialization tests ok 571 - one_hash2: YAML.pm saves without error ok 572 - one_hash2: YAML.pm serializes correctly ok 573 - one_hash2: YAML.pm round-trips without error ok 574 - one_hash2: YAML.pm round-trips correctly ok 575 - one_hash2: YAML.pm loads without error ok 576 - one_hash2: YAML.pm does not modify the input string ok 577 - one_hash2: YAML.pm parses correctly ok 578 - one_hash2: YAML::Syck saves without error ok 579 - one_hash2: YAML::Syck serializes correctly ok 580 - one_hash2: YAML::Syck round-trips without error ok 581 - one_hash2: YAML::Syck round-trips correctly ok 582 - one_hash2: YAML::Syck loads without error ok 583 - one_hash2: YAML::Syck does not modify the input string ok 584 - one_hash2: YAML::Syck parses correctly ok 585 - one_hash2: YAML::XS saves without error ok 586 - one_hash2: YAML::XS serializes correctly ok 587 - one_hash2: YAML::XS round-trips without error ok 588 - one_hash2: YAML::XS round-trips correctly ok 589 - one_hash2: YAML::XS loads without error ok 590 - one_hash2: YAML::XS does not modify the input string ok 591 - one_hash2: YAML::XS parses correctly ok 592 # skip Skipping YAML::Perl for known-broken feature ok 593 # skip Skipping YAML::Perl for known-broken feature ok 594 # skip Skipping YAML::Perl for known-broken feature ok 595 # skip Skipping YAML::Perl for known-broken feature ok 596 # skip Skipping YAML::Perl for known-broken feature ok 597 # skip Skipping YAML::Perl for known-broken feature ok 598 # skip Skipping YAML::Perl for known-broken feature ok 599 - one_hash2: CPAN::Meta::YAML parses without error ok 600 - one_hash2: CPAN::Meta::YAML does not modify the input string ok 601 - The object isa CPAN::Meta::YAML ok 602 - one_hash2: CPAN::Meta::YAML parses correctly ok 603 - one_hash2: CPAN::Meta::YAML serializes without error ok 604 - one_hash2: CPAN::Meta::YAML serializes correctly ok 605 - one_hash2: CPAN::Meta::YAML round-trips without error ok 606 - The object isa CPAN::Meta::YAML ok 607 - one_hash2: CPAN::Meta::YAML round-trips correctly ok 608 # skip Shortcutting perfect serialization tests ok 609 - array_in_hash: YAML.pm saves without error ok 610 - array_in_hash: YAML.pm serializes correctly ok 611 - array_in_hash: YAML.pm round-trips without error ok 612 - array_in_hash: YAML.pm round-trips correctly ok 613 - array_in_hash: YAML.pm loads without error ok 614 - array_in_hash: YAML.pm does not modify the input string ok 615 - array_in_hash: YAML.pm parses correctly ok 616 - array_in_hash: YAML::Syck saves without error ok 617 - array_in_hash: YAML::Syck serializes correctly ok 618 - array_in_hash: YAML::Syck round-trips without error ok 619 - array_in_hash: YAML::Syck round-trips correctly ok 620 - array_in_hash: YAML::Syck loads without error ok 621 - array_in_hash: YAML::Syck does not modify the input string ok 622 - array_in_hash: YAML::Syck parses correctly ok 623 - array_in_hash: YAML::XS saves without error ok 624 - array_in_hash: YAML::XS serializes correctly ok 625 - array_in_hash: YAML::XS round-trips without error ok 626 - array_in_hash: YAML::XS round-trips correctly ok 627 - array_in_hash: YAML::XS loads without error ok 628 - array_in_hash: YAML::XS does not modify the input string ok 629 - array_in_hash: YAML::XS parses correctly ok 630 # skip Skipping YAML::Perl for known-broken feature ok 631 # skip Skipping YAML::Perl for known-broken feature ok 632 # skip Skipping YAML::Perl for known-broken feature ok 633 # skip Skipping YAML::Perl for known-broken feature ok 634 # skip Skipping YAML::Perl for known-broken feature ok 635 # skip Skipping YAML::Perl for known-broken feature ok 636 # skip Skipping YAML::Perl for known-broken feature ok 637 - array_in_hash: CPAN::Meta::YAML parses without error ok 638 - array_in_hash: CPAN::Meta::YAML does not modify the input string ok 639 - The object isa CPAN::Meta::YAML ok 640 - array_in_hash: CPAN::Meta::YAML parses correctly ok 641 - array_in_hash: CPAN::Meta::YAML serializes without error ok 642 - array_in_hash: CPAN::Meta::YAML serializes correctly ok 643 - array_in_hash: CPAN::Meta::YAML round-trips without error ok 644 - The object isa CPAN::Meta::YAML ok 645 - array_in_hash: CPAN::Meta::YAML round-trips correctly ok 646 # skip Shortcutting perfect serialization tests ok 647 - hash_in_hash: YAML.pm saves without error ok 648 - hash_in_hash: YAML.pm serializes correctly ok 649 - hash_in_hash: YAML.pm round-trips without error ok 650 - hash_in_hash: YAML.pm round-trips correctly ok 651 - hash_in_hash: YAML.pm loads without error ok 652 - hash_in_hash: YAML.pm does not modify the input string ok 653 - hash_in_hash: YAML.pm parses correctly ok 654 - hash_in_hash: YAML::Syck saves without error ok 655 - hash_in_hash: YAML::Syck serializes correctly ok 656 - hash_in_hash: YAML::Syck round-trips without error ok 657 - hash_in_hash: YAML::Syck round-trips correctly ok 658 - hash_in_hash: YAML::Syck loads without error ok 659 - hash_in_hash: YAML::Syck does not modify the input string ok 660 - hash_in_hash: YAML::Syck parses correctly ok 661 - hash_in_hash: YAML::XS saves without error ok 662 - hash_in_hash: YAML::XS serializes correctly ok 663 - hash_in_hash: YAML::XS round-trips without error ok 664 - hash_in_hash: YAML::XS round-trips correctly ok 665 - hash_in_hash: YAML::XS loads without error ok 666 - hash_in_hash: YAML::XS does not modify the input string ok 667 - hash_in_hash: YAML::XS parses correctly ok 668 # skip Skipping YAML::Perl for known-broken feature ok 669 # skip Skipping YAML::Perl for known-broken feature ok 670 # skip Skipping YAML::Perl for known-broken feature ok 671 # skip Skipping YAML::Perl for known-broken feature ok 672 # skip Skipping YAML::Perl for known-broken feature ok 673 # skip Skipping YAML::Perl for known-broken feature ok 674 # skip Skipping YAML::Perl for known-broken feature ok 675 - hash_in_hash: CPAN::Meta::YAML parses without error ok 676 - hash_in_hash: CPAN::Meta::YAML does not modify the input string ok 677 - The object isa CPAN::Meta::YAML ok 678 - hash_in_hash: CPAN::Meta::YAML parses correctly ok 679 - hash_in_hash: CPAN::Meta::YAML serializes without error ok 680 - hash_in_hash: CPAN::Meta::YAML serializes correctly ok 681 - hash_in_hash: CPAN::Meta::YAML round-trips without error ok 682 - The object isa CPAN::Meta::YAML ok 683 - hash_in_hash: CPAN::Meta::YAML round-trips correctly ok 684 # skip Shortcutting perfect serialization tests ok 685 - hash_in_array: YAML.pm saves without error ok 686 - hash_in_array: YAML.pm serializes correctly ok 687 - hash_in_array: YAML.pm round-trips without error ok 688 - hash_in_array: YAML.pm round-trips correctly ok 689 - hash_in_array: YAML.pm loads without error ok 690 - hash_in_array: YAML.pm does not modify the input string ok 691 - hash_in_array: YAML.pm parses correctly ok 692 - hash_in_array: YAML::Syck saves without error ok 693 - hash_in_array: YAML::Syck serializes correctly ok 694 - hash_in_array: YAML::Syck round-trips without error ok 695 - hash_in_array: YAML::Syck round-trips correctly ok 696 - hash_in_array: YAML::Syck loads without error ok 697 - hash_in_array: YAML::Syck does not modify the input string ok 698 - hash_in_array: YAML::Syck parses correctly ok 699 - hash_in_array: YAML::XS saves without error ok 700 - hash_in_array: YAML::XS serializes correctly ok 701 - hash_in_array: YAML::XS round-trips without error ok 702 - hash_in_array: YAML::XS round-trips correctly ok 703 - hash_in_array: YAML::XS loads without error ok 704 - hash_in_array: YAML::XS does not modify the input string ok 705 - hash_in_array: YAML::XS parses correctly ok 706 # skip Skipping YAML::Perl for known-broken feature ok 707 # skip Skipping YAML::Perl for known-broken feature ok 708 # skip Skipping YAML::Perl for known-broken feature ok 709 # skip Skipping YAML::Perl for known-broken feature ok 710 # skip Skipping YAML::Perl for known-broken feature ok 711 # skip Skipping YAML::Perl for known-broken feature ok 712 # skip Skipping YAML::Perl for known-broken feature ok 713 - hash_in_array: CPAN::Meta::YAML parses without error ok 714 - hash_in_array: CPAN::Meta::YAML does not modify the input string ok 715 - The object isa CPAN::Meta::YAML ok 716 - hash_in_array: CPAN::Meta::YAML parses correctly ok 717 - hash_in_array: CPAN::Meta::YAML serializes without error ok 718 - hash_in_array: CPAN::Meta::YAML serializes correctly ok 719 - hash_in_array: CPAN::Meta::YAML round-trips without error ok 720 - The object isa CPAN::Meta::YAML ok 721 - hash_in_array: CPAN::Meta::YAML round-trips correctly ok 722 # skip Shortcutting perfect serialization tests ok 723 - single_quote1: YAML.pm saves without error ok 724 - single_quote1: YAML.pm serializes correctly ok 725 - single_quote1: YAML.pm round-trips without error ok 726 - single_quote1: YAML.pm round-trips correctly ok 727 - single_quote1: YAML.pm loads without error ok 728 - single_quote1: YAML.pm does not modify the input string ok 729 - single_quote1: YAML.pm parses correctly ok 730 - single_quote1: YAML::Syck saves without error ok 731 - single_quote1: YAML::Syck serializes correctly ok 732 - single_quote1: YAML::Syck round-trips without error ok 733 - single_quote1: YAML::Syck round-trips correctly ok 734 - single_quote1: YAML::Syck loads without error ok 735 - single_quote1: YAML::Syck does not modify the input string ok 736 - single_quote1: YAML::Syck parses correctly ok 737 - single_quote1: YAML::XS saves without error ok 738 - single_quote1: YAML::XS serializes correctly ok 739 - single_quote1: YAML::XS round-trips without error ok 740 - single_quote1: YAML::XS round-trips correctly ok 741 - single_quote1: YAML::XS loads without error ok 742 - single_quote1: YAML::XS does not modify the input string ok 743 - single_quote1: YAML::XS parses correctly ok 744 - single_quote1: YAML::Perl saves without error ok 745 - single_quote1: YAML::Perl serializes correctly ok 746 - single_quote1: YAML::Perl round-trips without error ok 747 - single_quote1: YAML::Perl round-trips correctly ok 748 - single_quote1: YAML::Perl loads without error ok 749 - single_quote1: YAML::Perl does not modify the input string ok 750 - single_quote1: YAML::Perl parses correctly ok 751 - single_quote1: CPAN::Meta::YAML parses without error ok 752 - single_quote1: CPAN::Meta::YAML does not modify the input string ok 753 - The object isa CPAN::Meta::YAML ok 754 - single_quote1: CPAN::Meta::YAML parses correctly ok 755 - single_quote1: CPAN::Meta::YAML serializes without error ok 756 - single_quote1: CPAN::Meta::YAML serializes correctly ok 757 - single_quote1: CPAN::Meta::YAML round-trips without error ok 758 - The object isa CPAN::Meta::YAML ok 759 - single_quote1: CPAN::Meta::YAML round-trips correctly ok 760 # skip Shortcutting perfect serialization tests ok 761 - single_spaces: YAML.pm saves without error ok 762 - single_spaces: YAML.pm serializes correctly ok 763 - single_spaces: YAML.pm round-trips without error ok 764 - single_spaces: YAML.pm round-trips correctly ok 765 - single_spaces: YAML.pm loads without error ok 766 - single_spaces: YAML.pm does not modify the input string ok 767 - single_spaces: YAML.pm parses correctly ok 768 - single_spaces: YAML::Syck saves without error ok 769 - single_spaces: YAML::Syck serializes correctly ok 770 - single_spaces: YAML::Syck round-trips without error ok 771 - single_spaces: YAML::Syck round-trips correctly ok 772 - single_spaces: YAML::Syck loads without error ok 773 - single_spaces: YAML::Syck does not modify the input string ok 774 - single_spaces: YAML::Syck parses correctly ok 775 - single_spaces: YAML::XS saves without error ok 776 - single_spaces: YAML::XS serializes correctly ok 777 - single_spaces: YAML::XS round-trips without error ok 778 - single_spaces: YAML::XS round-trips correctly ok 779 - single_spaces: YAML::XS loads without error ok 780 - single_spaces: YAML::XS does not modify the input string ok 781 - single_spaces: YAML::XS parses correctly ok 782 - single_spaces: YAML::Perl saves without error ok 783 - single_spaces: YAML::Perl serializes correctly ok 784 - single_spaces: YAML::Perl round-trips without error ok 785 - single_spaces: YAML::Perl round-trips correctly ok 786 - single_spaces: YAML::Perl loads without error ok 787 - single_spaces: YAML::Perl does not modify the input string ok 788 - single_spaces: YAML::Perl parses correctly ok 789 - single_spaces: CPAN::Meta::YAML parses without error ok 790 - single_spaces: CPAN::Meta::YAML does not modify the input string ok 791 - The object isa CPAN::Meta::YAML ok 792 - single_spaces: CPAN::Meta::YAML parses correctly ok 793 - single_spaces: CPAN::Meta::YAML serializes without error ok 794 - single_spaces: CPAN::Meta::YAML serializes correctly ok 795 - single_spaces: CPAN::Meta::YAML round-trips without error ok 796 - The object isa CPAN::Meta::YAML ok 797 - single_spaces: CPAN::Meta::YAML round-trips correctly ok 798 # skip Shortcutting perfect serialization tests ok 799 - single_null: YAML.pm saves without error ok 800 - single_null: YAML.pm serializes correctly ok 801 - single_null: YAML.pm round-trips without error ok 802 - single_null: YAML.pm round-trips correctly ok 803 - single_null: YAML.pm loads without error ok 804 - single_null: YAML.pm does not modify the input string ok 805 - single_null: YAML.pm parses correctly ok 806 - single_null: YAML::Syck saves without error ok 807 - single_null: YAML::Syck serializes correctly ok 808 - single_null: YAML::Syck round-trips without error ok 809 - single_null: YAML::Syck round-trips correctly ok 810 - single_null: YAML::Syck loads without error ok 811 - single_null: YAML::Syck does not modify the input string ok 812 - single_null: YAML::Syck parses correctly ok 813 - single_null: YAML::XS saves without error ok 814 - single_null: YAML::XS serializes correctly ok 815 - single_null: YAML::XS round-trips without error ok 816 - single_null: YAML::XS round-trips correctly ok 817 - single_null: YAML::XS loads without error ok 818 - single_null: YAML::XS does not modify the input string ok 819 - single_null: YAML::XS parses correctly ok 820 - single_null: YAML::Perl saves without error ok 821 - single_null: YAML::Perl serializes correctly ok 822 - single_null: YAML::Perl round-trips without error ok 823 - single_null: YAML::Perl round-trips correctly ok 824 - single_null: YAML::Perl loads without error ok 825 - single_null: YAML::Perl does not modify the input string ok 826 - single_null: YAML::Perl parses correctly ok 827 - single_null: CPAN::Meta::YAML parses without error ok 828 - single_null: CPAN::Meta::YAML does not modify the input string ok 829 - The object isa CPAN::Meta::YAML ok 830 - single_null: CPAN::Meta::YAML parses correctly ok 831 - single_null: CPAN::Meta::YAML serializes without error ok 832 - single_null: CPAN::Meta::YAML serializes correctly ok 833 - single_null: CPAN::Meta::YAML round-trips without error ok 834 - The object isa CPAN::Meta::YAML ok 835 - single_null: CPAN::Meta::YAML round-trips correctly ok 836 # skip Shortcutting perfect serialization tests ok 837 # skip Skipping YAML.pm for known-broken feature ok 838 # skip Skipping YAML.pm for known-broken feature ok 839 # skip Skipping YAML.pm for known-broken feature ok 840 # skip Skipping YAML.pm for known-broken feature ok 841 # skip Skipping YAML.pm for known-broken feature ok 842 # skip Skipping YAML.pm for known-broken feature ok 843 # skip Skipping YAML.pm for known-broken feature ok 844 - only_spaces: YAML::Syck saves without error ok 845 - only_spaces: YAML::Syck serializes correctly ok 846 - only_spaces: YAML::Syck round-trips without error ok 847 - only_spaces: YAML::Syck round-trips correctly ok 848 - only_spaces: YAML::Syck loads without error ok 849 - only_spaces: YAML::Syck does not modify the input string ok 850 - only_spaces: YAML::Syck parses correctly ok 851 - only_spaces: YAML::XS saves without error ok 852 - only_spaces: YAML::XS serializes correctly ok 853 - only_spaces: YAML::XS round-trips without error ok 854 - only_spaces: YAML::XS round-trips correctly ok 855 - only_spaces: YAML::XS loads without error ok 856 - only_spaces: YAML::XS does not modify the input string ok 857 - only_spaces: YAML::XS parses correctly ok 858 # skip Skipping YAML::Perl for known-broken feature ok 859 # skip Skipping YAML::Perl for known-broken feature ok 860 # skip Skipping YAML::Perl for known-broken feature ok 861 # skip Skipping YAML::Perl for known-broken feature ok 862 # skip Skipping YAML::Perl for known-broken feature ok 863 # skip Skipping YAML::Perl for known-broken feature ok 864 # skip Skipping YAML::Perl for known-broken feature ok 865 - only_spaces: CPAN::Meta::YAML parses without error ok 866 - only_spaces: CPAN::Meta::YAML does not modify the input string ok 867 - The object isa CPAN::Meta::YAML ok 868 - only_spaces: CPAN::Meta::YAML parses correctly ok 869 - only_spaces: CPAN::Meta::YAML serializes without error ok 870 - only_spaces: CPAN::Meta::YAML serializes correctly ok 871 - only_spaces: CPAN::Meta::YAML round-trips without error ok 872 - The object isa CPAN::Meta::YAML ok 873 - only_spaces: CPAN::Meta::YAML round-trips correctly ok 874 # skip Shortcutting perfect serialization tests ok 875 # skip Skipping YAML.pm for known-broken feature ok 876 # skip Skipping YAML.pm for known-broken feature ok 877 # skip Skipping YAML.pm for known-broken feature ok 878 # skip Skipping YAML.pm for known-broken feature ok 879 # skip Skipping YAML.pm for known-broken feature ok 880 # skip Skipping YAML.pm for known-broken feature ok 881 # skip Skipping YAML.pm for known-broken feature ok 882 # skip Skipping YAML::Syck for unsupported feature ok 883 # skip Skipping YAML::Syck for unsupported feature ok 884 # skip Skipping YAML::Syck for unsupported feature ok 885 # skip Skipping YAML::Syck for unsupported feature ok 886 # skip Skipping YAML::Syck for unsupported feature ok 887 # skip Skipping YAML::Syck for unsupported feature ok 888 # skip Skipping YAML::Syck for unsupported feature ok 889 - leading_trailing_spaces: YAML::XS saves without error ok 890 - leading_trailing_spaces: YAML::XS serializes correctly ok 891 - leading_trailing_spaces: YAML::XS round-trips without error ok 892 - leading_trailing_spaces: YAML::XS round-trips correctly ok 893 - leading_trailing_spaces: YAML::XS loads without error ok 894 - leading_trailing_spaces: YAML::XS does not modify the input string ok 895 - leading_trailing_spaces: YAML::XS parses correctly ok 896 # skip Skipping YAML::Perl for known-broken feature ok 897 # skip Skipping YAML::Perl for known-broken feature ok 898 # skip Skipping YAML::Perl for known-broken feature ok 899 # skip Skipping YAML::Perl for known-broken feature ok 900 # skip Skipping YAML::Perl for known-broken feature ok 901 # skip Skipping YAML::Perl for known-broken feature ok 902 # skip Skipping YAML::Perl for known-broken feature ok 903 - leading_trailing_spaces: CPAN::Meta::YAML parses without error ok 904 - leading_trailing_spaces: CPAN::Meta::YAML does not modify the input string ok 905 - The object isa CPAN::Meta::YAML ok 906 - leading_trailing_spaces: CPAN::Meta::YAML parses correctly ok 907 - leading_trailing_spaces: CPAN::Meta::YAML serializes without error ok 908 - leading_trailing_spaces: CPAN::Meta::YAML serializes correctly ok 909 - leading_trailing_spaces: CPAN::Meta::YAML round-trips without error ok 910 - The object isa CPAN::Meta::YAML ok 911 - leading_trailing_spaces: CPAN::Meta::YAML round-trips correctly ok 912 # skip Shortcutting perfect serialization tests ok 913 - implicit_hash: YAML.pm saves without error ok 914 - implicit_hash: YAML.pm serializes correctly ok 915 - implicit_hash: YAML.pm round-trips without error ok 916 - implicit_hash: YAML.pm round-trips correctly ok 917 - implicit_hash: YAML.pm loads without error ok 918 - implicit_hash: YAML.pm does not modify the input string ok 919 - implicit_hash: YAML.pm parses correctly ok 920 - implicit_hash: YAML::Syck saves without error ok 921 - implicit_hash: YAML::Syck serializes correctly ok 922 - implicit_hash: YAML::Syck round-trips without error ok 923 - implicit_hash: YAML::Syck round-trips correctly ok 924 - implicit_hash: YAML::Syck loads without error ok 925 - implicit_hash: YAML::Syck does not modify the input string ok 926 - implicit_hash: YAML::Syck parses correctly ok 927 - implicit_hash: YAML::XS saves without error ok 928 - implicit_hash: YAML::XS serializes correctly ok 929 - implicit_hash: YAML::XS round-trips without error ok 930 - implicit_hash: YAML::XS round-trips correctly ok 931 - implicit_hash: YAML::XS loads without error ok 932 - implicit_hash: YAML::XS does not modify the input string ok 933 - implicit_hash: YAML::XS parses correctly ok 934 - implicit_hash: YAML::Perl saves without error ok 935 - implicit_hash: YAML::Perl serializes correctly ok 936 - implicit_hash: YAML::Perl round-trips without error ok 937 - implicit_hash: YAML::Perl round-trips correctly ok 938 - implicit_hash: YAML::Perl loads without error ok 939 - implicit_hash: YAML::Perl does not modify the input string ok 940 - implicit_hash: YAML::Perl parses correctly ok 941 - implicit_hash: CPAN::Meta::YAML parses without error ok 942 - implicit_hash: CPAN::Meta::YAML does not modify the input string ok 943 - The object isa CPAN::Meta::YAML ok 944 - implicit_hash: CPAN::Meta::YAML parses correctly ok 945 - implicit_hash: CPAN::Meta::YAML serializes without error ok 946 - implicit_hash: CPAN::Meta::YAML serializes correctly ok 947 - implicit_hash: CPAN::Meta::YAML round-trips without error ok 948 - The object isa CPAN::Meta::YAML ok 949 - implicit_hash: CPAN::Meta::YAML round-trips correctly ok 950 # skip Shortcutting perfect serialization tests ok 951 - implicit_array: YAML.pm saves without error ok 952 - implicit_array: YAML.pm serializes correctly ok 953 - implicit_array: YAML.pm round-trips without error ok 954 - implicit_array: YAML.pm round-trips correctly ok 955 - implicit_array: YAML.pm loads without error ok 956 - implicit_array: YAML.pm does not modify the input string ok 957 - implicit_array: YAML.pm parses correctly ok 958 - implicit_array: YAML::Syck saves without error ok 959 - implicit_array: YAML::Syck serializes correctly ok 960 - implicit_array: YAML::Syck round-trips without error ok 961 - implicit_array: YAML::Syck round-trips correctly ok 962 - implicit_array: YAML::Syck loads without error ok 963 - implicit_array: YAML::Syck does not modify the input string ok 964 - implicit_array: YAML::Syck parses correctly ok 965 - implicit_array: YAML::XS saves without error ok 966 - implicit_array: YAML::XS serializes correctly ok 967 - implicit_array: YAML::XS round-trips without error ok 968 - implicit_array: YAML::XS round-trips correctly ok 969 - implicit_array: YAML::XS loads without error ok 970 - implicit_array: YAML::XS does not modify the input string ok 971 - implicit_array: YAML::XS parses correctly ok 972 - implicit_array: YAML::Perl saves without error ok 973 - implicit_array: YAML::Perl serializes correctly ok 974 - implicit_array: YAML::Perl round-trips without error ok 975 - implicit_array: YAML::Perl round-trips correctly ok 976 - implicit_array: YAML::Perl loads without error ok 977 - implicit_array: YAML::Perl does not modify the input string ok 978 - implicit_array: YAML::Perl parses correctly ok 979 - implicit_array: CPAN::Meta::YAML parses without error ok 980 - implicit_array: CPAN::Meta::YAML does not modify the input string ok 981 - The object isa CPAN::Meta::YAML ok 982 - implicit_array: CPAN::Meta::YAML parses correctly ok 983 - implicit_array: CPAN::Meta::YAML serializes without error ok 984 - implicit_array: CPAN::Meta::YAML serializes correctly ok 985 - implicit_array: CPAN::Meta::YAML round-trips without error ok 986 - The object isa CPAN::Meta::YAML ok 987 - implicit_array: CPAN::Meta::YAML round-trips correctly ok 988 # skip Shortcutting perfect serialization tests ok 989 - inline_nested_hash: YAML.pm saves without error ok 990 - inline_nested_hash: YAML.pm serializes correctly ok 991 - inline_nested_hash: YAML.pm round-trips without error ok 992 - inline_nested_hash: YAML.pm round-trips correctly ok 993 - inline_nested_hash: YAML.pm loads without error ok 994 - inline_nested_hash: YAML.pm does not modify the input string ok 995 - inline_nested_hash: YAML.pm parses correctly ok 996 - inline_nested_hash: YAML::Syck saves without error ok 997 - inline_nested_hash: YAML::Syck serializes correctly ok 998 - inline_nested_hash: YAML::Syck round-trips without error ok 999 - inline_nested_hash: YAML::Syck round-trips correctly ok 1000 - inline_nested_hash: YAML::Syck loads without error ok 1001 - inline_nested_hash: YAML::Syck does not modify the input string ok 1002 - inline_nested_hash: YAML::Syck parses correctly ok 1003 - inline_nested_hash: YAML::XS saves without error ok 1004 - inline_nested_hash: YAML::XS serializes correctly ok 1005 - inline_nested_hash: YAML::XS round-trips without error ok 1006 - inline_nested_hash: YAML::XS round-trips correctly ok 1007 - inline_nested_hash: YAML::XS loads without error ok 1008 - inline_nested_hash: YAML::XS does not modify the input string ok 1009 - inline_nested_hash: YAML::XS parses correctly ok 1010 # skip Skipping YAML::Perl for known-broken feature ok 1011 # skip Skipping YAML::Perl for known-broken feature ok 1012 # skip Skipping YAML::Perl for known-broken feature ok 1013 # skip Skipping YAML::Perl for known-broken feature ok 1014 # skip Skipping YAML::Perl for known-broken feature ok 1015 # skip Skipping YAML::Perl for known-broken feature ok 1016 # skip Skipping YAML::Perl for known-broken feature ok 1017 - inline_nested_hash: CPAN::Meta::YAML parses without error ok 1018 - inline_nested_hash: CPAN::Meta::YAML does not modify the input string ok 1019 - The object isa CPAN::Meta::YAML ok 1020 - inline_nested_hash: CPAN::Meta::YAML parses correctly ok 1021 - inline_nested_hash: CPAN::Meta::YAML serializes without error ok 1022 - inline_nested_hash: CPAN::Meta::YAML serializes correctly ok 1023 - inline_nested_hash: CPAN::Meta::YAML round-trips without error ok 1024 - The object isa CPAN::Meta::YAML ok 1025 - inline_nested_hash: CPAN::Meta::YAML round-trips correctly ok 1026 # skip Shortcutting perfect serialization tests ok 1027 - empty_comment_in_list: YAML.pm saves without error ok 1028 - empty_comment_in_list: YAML.pm serializes correctly ok 1029 - empty_comment_in_list: YAML.pm round-trips without error ok 1030 - empty_comment_in_list: YAML.pm round-trips correctly ok 1031 - empty_comment_in_list: YAML.pm loads without error ok 1032 - empty_comment_in_list: YAML.pm does not modify the input string ok 1033 - empty_comment_in_list: YAML.pm parses correctly ok 1034 - empty_comment_in_list: YAML::Syck saves without error ok 1035 - empty_comment_in_list: YAML::Syck serializes correctly ok 1036 - empty_comment_in_list: YAML::Syck round-trips without error ok 1037 - empty_comment_in_list: YAML::Syck round-trips correctly ok 1038 - empty_comment_in_list: YAML::Syck loads without error ok 1039 - empty_comment_in_list: YAML::Syck does not modify the input string ok 1040 - empty_comment_in_list: YAML::Syck parses correctly ok 1041 - empty_comment_in_list: YAML::XS saves without error ok 1042 - empty_comment_in_list: YAML::XS serializes correctly ok 1043 - empty_comment_in_list: YAML::XS round-trips without error ok 1044 - empty_comment_in_list: YAML::XS round-trips correctly ok 1045 - empty_comment_in_list: YAML::XS loads without error ok 1046 - empty_comment_in_list: YAML::XS does not modify the input string ok 1047 - empty_comment_in_list: YAML::XS parses correctly ok 1048 - empty_comment_in_list: YAML::Perl saves without error ok 1049 - empty_comment_in_list: YAML::Perl serializes correctly ok 1050 - empty_comment_in_list: YAML::Perl round-trips without error ok 1051 - empty_comment_in_list: YAML::Perl round-trips correctly ok 1052 - empty_comment_in_list: YAML::Perl loads without error ok 1053 - empty_comment_in_list: YAML::Perl does not modify the input string ok 1054 - empty_comment_in_list: YAML::Perl parses correctly ok 1055 - empty_comment_in_list: CPAN::Meta::YAML parses without error ok 1056 - empty_comment_in_list: CPAN::Meta::YAML does not modify the input string ok 1057 - The object isa CPAN::Meta::YAML ok 1058 - empty_comment_in_list: CPAN::Meta::YAML parses correctly ok 1059 - empty_comment_in_list: CPAN::Meta::YAML serializes without error ok 1060 - empty_comment_in_list: CPAN::Meta::YAML serializes correctly ok 1061 - empty_comment_in_list: CPAN::Meta::YAML round-trips without error ok 1062 - The object isa CPAN::Meta::YAML ok 1063 - empty_comment_in_list: CPAN::Meta::YAML round-trips correctly ok 1064 # skip Shortcutting perfect serialization tests ok 1065 - empty_comment_in_hash: YAML.pm saves without error ok 1066 - empty_comment_in_hash: YAML.pm serializes correctly ok 1067 - empty_comment_in_hash: YAML.pm round-trips without error ok 1068 - empty_comment_in_hash: YAML.pm round-trips correctly ok 1069 - empty_comment_in_hash: YAML.pm loads without error ok 1070 - empty_comment_in_hash: YAML.pm does not modify the input string ok 1071 - empty_comment_in_hash: YAML.pm parses correctly ok 1072 - empty_comment_in_hash: YAML::Syck saves without error ok 1073 - empty_comment_in_hash: YAML::Syck serializes correctly ok 1074 - empty_comment_in_hash: YAML::Syck round-trips without error ok 1075 - empty_comment_in_hash: YAML::Syck round-trips correctly ok 1076 - empty_comment_in_hash: YAML::Syck loads without error ok 1077 - empty_comment_in_hash: YAML::Syck does not modify the input string ok 1078 - empty_comment_in_hash: YAML::Syck parses correctly ok 1079 - empty_comment_in_hash: YAML::XS saves without error ok 1080 - empty_comment_in_hash: YAML::XS serializes correctly ok 1081 - empty_comment_in_hash: YAML::XS round-trips without error ok 1082 - empty_comment_in_hash: YAML::XS round-trips correctly ok 1083 - empty_comment_in_hash: YAML::XS loads without error ok 1084 - empty_comment_in_hash: YAML::XS does not modify the input string ok 1085 - empty_comment_in_hash: YAML::XS parses correctly ok 1086 - empty_comment_in_hash: YAML::Perl saves without error ok 1087 - empty_comment_in_hash: YAML::Perl serializes correctly ok 1088 - empty_comment_in_hash: YAML::Perl round-trips without error ok 1089 - empty_comment_in_hash: YAML::Perl round-trips correctly ok 1090 - empty_comment_in_hash: YAML::Perl loads without error ok 1091 - empty_comment_in_hash: YAML::Perl does not modify the input string ok 1092 - empty_comment_in_hash: YAML::Perl parses correctly ok 1093 - empty_comment_in_hash: CPAN::Meta::YAML parses without error ok 1094 - empty_comment_in_hash: CPAN::Meta::YAML does not modify the input string ok 1095 - The object isa CPAN::Meta::YAML ok 1096 - empty_comment_in_hash: CPAN::Meta::YAML parses correctly ok 1097 - empty_comment_in_hash: CPAN::Meta::YAML serializes without error ok 1098 - empty_comment_in_hash: CPAN::Meta::YAML serializes correctly ok 1099 - empty_comment_in_hash: CPAN::Meta::YAML round-trips without error ok 1100 - The object isa CPAN::Meta::YAML ok 1101 - empty_comment_in_hash: CPAN::Meta::YAML round-trips correctly ok 1102 # skip Shortcutting perfect serialization tests ok 1103 - key_with_whitespace: YAML.pm saves without error ok 1104 - key_with_whitespace: YAML.pm serializes correctly ok 1105 - key_with_whitespace: YAML.pm round-trips without error ok 1106 - key_with_whitespace: YAML.pm round-trips correctly ok 1107 - key_with_whitespace: YAML.pm loads without error ok 1108 - key_with_whitespace: YAML.pm does not modify the input string ok 1109 - key_with_whitespace: YAML.pm parses correctly ok 1110 - key_with_whitespace: YAML::Syck saves without error ok 1111 - key_with_whitespace: YAML::Syck serializes correctly ok 1112 - key_with_whitespace: YAML::Syck round-trips without error ok 1113 - key_with_whitespace: YAML::Syck round-trips correctly ok 1114 - key_with_whitespace: YAML::Syck loads without error ok 1115 - key_with_whitespace: YAML::Syck does not modify the input string ok 1116 - key_with_whitespace: YAML::Syck parses correctly ok 1117 - key_with_whitespace: YAML::XS saves without error ok 1118 - key_with_whitespace: YAML::XS serializes correctly ok 1119 - key_with_whitespace: YAML::XS round-trips without error ok 1120 - key_with_whitespace: YAML::XS round-trips correctly ok 1121 - key_with_whitespace: YAML::XS loads without error ok 1122 - key_with_whitespace: YAML::XS does not modify the input string ok 1123 - key_with_whitespace: YAML::XS parses correctly ok 1124 - key_with_whitespace: YAML::Perl saves without error ok 1125 - key_with_whitespace: YAML::Perl serializes correctly ok 1126 - key_with_whitespace: YAML::Perl round-trips without error ok 1127 - key_with_whitespace: YAML::Perl round-trips correctly ok 1128 - key_with_whitespace: YAML::Perl loads without error ok 1129 - key_with_whitespace: YAML::Perl does not modify the input string ok 1130 - key_with_whitespace: YAML::Perl parses correctly ok 1131 - key_with_whitespace: CPAN::Meta::YAML parses without error ok 1132 - key_with_whitespace: CPAN::Meta::YAML does not modify the input string ok 1133 - The object isa CPAN::Meta::YAML ok 1134 - key_with_whitespace: CPAN::Meta::YAML parses correctly ok 1135 - key_with_whitespace: CPAN::Meta::YAML serializes without error ok 1136 - key_with_whitespace: CPAN::Meta::YAML serializes correctly ok 1137 - key_with_whitespace: CPAN::Meta::YAML round-trips without error ok 1138 - The object isa CPAN::Meta::YAML ok 1139 - key_with_whitespace: CPAN::Meta::YAML round-trips correctly ok 1140 # skip Shortcutting perfect serialization tests ok t/03_regression.t .. 1..1418 ok 1 - Found exported Load function ok 2 - Found exported Dump function ok 3 - Found exported LoadFile function ok 4 - Found exported DumpFile function ok 5 - Found exported freeze function ok 6 - Found exported thaw functiona ok 7 - module_hash_key: YAML.pm saves without error ok 8 - module_hash_key: YAML.pm serializes correctly ok 9 - module_hash_key: YAML.pm round-trips without error ok 10 - module_hash_key: YAML.pm round-trips correctly ok 11 - module_hash_key: YAML.pm loads without error ok 12 - module_hash_key: YAML.pm does not modify the input string ok 13 - module_hash_key: YAML.pm parses correctly ok 14 - module_hash_key: YAML::Syck saves without error ok 15 - module_hash_key: YAML::Syck serializes correctly ok 16 - module_hash_key: YAML::Syck round-trips without error ok 17 - module_hash_key: YAML::Syck round-trips correctly ok 18 - module_hash_key: YAML::Syck loads without error ok 19 - module_hash_key: YAML::Syck does not modify the input string ok 20 - module_hash_key: YAML::Syck parses correctly ok 21 - module_hash_key: YAML::XS saves without error ok 22 - module_hash_key: YAML::XS serializes correctly ok 23 - module_hash_key: YAML::XS round-trips without error ok 24 - module_hash_key: YAML::XS round-trips correctly ok 25 - module_hash_key: YAML::XS loads without error ok 26 - module_hash_key: YAML::XS does not modify the input string ok 27 - module_hash_key: YAML::XS parses correctly ok 28 - module_hash_key: YAML::Perl saves without error ok 29 - module_hash_key: YAML::Perl serializes correctly ok 30 - module_hash_key: YAML::Perl round-trips without error ok 31 - module_hash_key: YAML::Perl round-trips correctly ok 32 - module_hash_key: YAML::Perl loads without error ok 33 - module_hash_key: YAML::Perl does not modify the input string ok 34 - module_hash_key: YAML::Perl parses correctly ok 35 - module_hash_key: CPAN::Meta::YAML parses without error ok 36 - module_hash_key: CPAN::Meta::YAML does not modify the input string ok 37 - The object isa CPAN::Meta::YAML ok 38 - module_hash_key: CPAN::Meta::YAML parses correctly ok 39 - module_hash_key: CPAN::Meta::YAML serializes without error ok 40 - module_hash_key: CPAN::Meta::YAML serializes correctly ok 41 - module_hash_key: CPAN::Meta::YAML round-trips without error ok 42 - The object isa CPAN::Meta::YAML ok 43 - module_hash_key: CPAN::Meta::YAML round-trips correctly ok 44 # skip Shortcutting perfect serialization tests ok 45 - hash_indented: YAML.pm saves without error ok 46 - hash_indented: YAML.pm serializes correctly ok 47 - hash_indented: YAML.pm round-trips without error ok 48 - hash_indented: YAML.pm round-trips correctly ok 49 - hash_indented: YAML.pm loads without error ok 50 - hash_indented: YAML.pm does not modify the input string ok 51 - hash_indented: YAML.pm parses correctly ok 52 - hash_indented: YAML::Syck saves without error ok 53 - hash_indented: YAML::Syck serializes correctly ok 54 - hash_indented: YAML::Syck round-trips without error ok 55 - hash_indented: YAML::Syck round-trips correctly ok 56 - hash_indented: YAML::Syck loads without error ok 57 - hash_indented: YAML::Syck does not modify the input string ok 58 - hash_indented: YAML::Syck parses correctly ok 59 - hash_indented: YAML::XS saves without error ok 60 - hash_indented: YAML::XS serializes correctly ok 61 - hash_indented: YAML::XS round-trips without error ok 62 - hash_indented: YAML::XS round-trips correctly ok 63 - hash_indented: YAML::XS loads without error ok 64 - hash_indented: YAML::XS does not modify the input string ok 65 - hash_indented: YAML::XS parses correctly ok 66 - hash_indented: YAML::Perl saves without error ok 67 - hash_indented: YAML::Perl serializes correctly ok 68 - hash_indented: YAML::Perl round-trips without error ok 69 - hash_indented: YAML::Perl round-trips correctly ok 70 - hash_indented: YAML::Perl loads without error ok 71 - hash_indented: YAML::Perl does not modify the input string ok 72 - hash_indented: YAML::Perl parses correctly ok 73 - hash_indented: CPAN::Meta::YAML parses without error ok 74 - hash_indented: CPAN::Meta::YAML does not modify the input string ok 75 - The object isa CPAN::Meta::YAML ok 76 - hash_indented: CPAN::Meta::YAML parses correctly ok 77 - hash_indented: CPAN::Meta::YAML serializes without error ok 78 - hash_indented: CPAN::Meta::YAML serializes correctly ok 79 - hash_indented: CPAN::Meta::YAML round-trips without error ok 80 - The object isa CPAN::Meta::YAML ok 81 - hash_indented: CPAN::Meta::YAML round-trips correctly ok 82 # skip Shortcutting perfect serialization tests ok 83 - simple_multiline: YAML.pm saves without error ok 84 - simple_multiline: YAML.pm serializes correctly ok 85 - simple_multiline: YAML.pm round-trips without error ok 86 - simple_multiline: YAML.pm round-trips correctly ok 87 - simple_multiline: YAML.pm loads without error ok 88 - simple_multiline: YAML.pm does not modify the input string ok 89 - simple_multiline: YAML.pm parses correctly ok 90 - simple_multiline: YAML::Syck saves without error ok 91 - simple_multiline: YAML::Syck serializes correctly ok 92 - simple_multiline: YAML::Syck round-trips without error ok 93 - simple_multiline: YAML::Syck round-trips correctly ok 94 - simple_multiline: YAML::Syck loads without error ok 95 - simple_multiline: YAML::Syck does not modify the input string ok 96 - simple_multiline: YAML::Syck parses correctly ok 97 - simple_multiline: YAML::XS saves without error ok 98 - simple_multiline: YAML::XS serializes correctly ok 99 - simple_multiline: YAML::XS round-trips without error ok 100 - simple_multiline: YAML::XS round-trips correctly ok 101 - simple_multiline: YAML::XS loads without error ok 102 - simple_multiline: YAML::XS does not modify the input string ok 103 - simple_multiline: YAML::XS parses correctly ok 104 - simple_multiline: YAML::Perl saves without error ok 105 - simple_multiline: YAML::Perl serializes correctly ok 106 - simple_multiline: YAML::Perl round-trips without error ok 107 - simple_multiline: YAML::Perl round-trips correctly ok 108 - simple_multiline: YAML::Perl loads without error ok 109 - simple_multiline: YAML::Perl does not modify the input string ok 110 - simple_multiline: YAML::Perl parses correctly ok 111 - simple_multiline: CPAN::Meta::YAML parses without error ok 112 - simple_multiline: CPAN::Meta::YAML does not modify the input string ok 113 - The object isa CPAN::Meta::YAML ok 114 - simple_multiline: CPAN::Meta::YAML parses correctly ok 115 - simple_multiline: CPAN::Meta::YAML serializes without error ok 116 - simple_multiline: CPAN::Meta::YAML serializes correctly ok 117 - simple_multiline: CPAN::Meta::YAML round-trips without error ok 118 - The object isa CPAN::Meta::YAML ok 119 - simple_multiline: CPAN::Meta::YAML round-trips correctly ok 120 # skip Shortcutting perfect serialization tests ok 121 - indented: YAML.pm saves without error ok 122 - indented: YAML.pm serializes correctly ok 123 - indented: YAML.pm round-trips without error ok 124 - indented: YAML.pm round-trips correctly ok 125 - indented: YAML.pm loads without error ok 126 - indented: YAML.pm does not modify the input string ok 127 - indented: YAML.pm parses correctly ok 128 - indented: YAML::Syck saves without error ok 129 - indented: YAML::Syck serializes correctly ok 130 - indented: YAML::Syck round-trips without error ok 131 - indented: YAML::Syck round-trips correctly ok 132 - indented: YAML::Syck loads without error ok 133 - indented: YAML::Syck does not modify the input string ok 134 - indented: YAML::Syck parses correctly ok 135 - indented: YAML::XS saves without error ok 136 - indented: YAML::XS serializes correctly ok 137 - indented: YAML::XS round-trips without error ok 138 - indented: YAML::XS round-trips correctly ok 139 - indented: YAML::XS loads without error ok 140 - indented: YAML::XS does not modify the input string ok 141 - indented: YAML::XS parses correctly ok 142 - indented: YAML::Perl saves without error ok 143 - indented: YAML::Perl serializes correctly ok 144 - indented: YAML::Perl round-trips without error ok 145 - indented: YAML::Perl round-trips correctly ok 146 - indented: YAML::Perl loads without error ok 147 - indented: YAML::Perl does not modify the input string ok 148 - indented: YAML::Perl parses correctly ok 149 - indented: CPAN::Meta::YAML parses without error ok 150 - indented: CPAN::Meta::YAML does not modify the input string ok 151 - The object isa CPAN::Meta::YAML ok 152 - indented: CPAN::Meta::YAML parses correctly ok 153 - indented: CPAN::Meta::YAML serializes without error ok 154 - indented: CPAN::Meta::YAML serializes correctly ok 155 - indented: CPAN::Meta::YAML round-trips without error ok 156 - The object isa CPAN::Meta::YAML ok 157 - indented: CPAN::Meta::YAML round-trips correctly ok 158 # skip Shortcutting perfect serialization tests ok 159 - indented: YAML.pm saves without error ok 160 - indented: YAML.pm serializes correctly ok 161 - indented: YAML.pm round-trips without error ok 162 - indented: YAML.pm round-trips correctly ok 163 - indented: YAML.pm loads without error ok 164 - indented: YAML.pm does not modify the input string ok 165 - indented: YAML.pm parses correctly ok 166 - indented: YAML::Syck saves without error ok 167 - indented: YAML::Syck serializes correctly ok 168 - indented: YAML::Syck round-trips without error ok 169 - indented: YAML::Syck round-trips correctly ok 170 - indented: YAML::Syck loads without error ok 171 - indented: YAML::Syck does not modify the input string ok 172 - indented: YAML::Syck parses correctly ok 173 - indented: YAML::XS saves without error ok 174 - indented: YAML::XS serializes correctly ok 175 - indented: YAML::XS round-trips without error ok 176 - indented: YAML::XS round-trips correctly ok 177 - indented: YAML::XS loads without error ok 178 - indented: YAML::XS does not modify the input string ok 179 - indented: YAML::XS parses correctly ok 180 - indented: YAML::Perl saves without error ok 181 - indented: YAML::Perl serializes correctly ok 182 - indented: YAML::Perl round-trips without error ok 183 - indented: YAML::Perl round-trips correctly ok 184 - indented: YAML::Perl loads without error ok 185 - indented: YAML::Perl does not modify the input string ok 186 - indented: YAML::Perl parses correctly ok 187 - indented: CPAN::Meta::YAML parses without error ok 188 - indented: CPAN::Meta::YAML does not modify the input string ok 189 - The object isa CPAN::Meta::YAML ok 190 - indented: CPAN::Meta::YAML parses correctly ok 191 - indented: CPAN::Meta::YAML serializes without error ok 192 - indented: CPAN::Meta::YAML serializes correctly ok 193 - indented: CPAN::Meta::YAML round-trips without error ok 194 - The object isa CPAN::Meta::YAML ok 195 - indented: CPAN::Meta::YAML round-trips correctly ok 196 # skip Shortcutting perfect serialization tests ok 197 - simple_doctype_comment: YAML.pm saves without error ok 198 - simple_doctype_comment: YAML.pm serializes correctly ok 199 - simple_doctype_comment: YAML.pm round-trips without error ok 200 - simple_doctype_comment: YAML.pm round-trips correctly ok 201 - simple_doctype_comment: YAML.pm loads without error ok 202 - simple_doctype_comment: YAML.pm does not modify the input string ok 203 - simple_doctype_comment: YAML.pm parses correctly ok 204 # skip Skipping YAML::Syck for known-broken feature ok 205 # skip Skipping YAML::Syck for known-broken feature ok 206 # skip Skipping YAML::Syck for known-broken feature ok 207 # skip Skipping YAML::Syck for known-broken feature ok 208 # skip Skipping YAML::Syck for known-broken feature ok 209 # skip Skipping YAML::Syck for known-broken feature ok 210 # skip Skipping YAML::Syck for known-broken feature ok 211 - simple_doctype_comment: YAML::XS saves without error ok 212 - simple_doctype_comment: YAML::XS serializes correctly ok 213 - simple_doctype_comment: YAML::XS round-trips without error ok 214 - simple_doctype_comment: YAML::XS round-trips correctly ok 215 - simple_doctype_comment: YAML::XS loads without error ok 216 - simple_doctype_comment: YAML::XS does not modify the input string ok 217 - simple_doctype_comment: YAML::XS parses correctly ok 218 - simple_doctype_comment: YAML::Perl saves without error ok 219 - simple_doctype_comment: YAML::Perl serializes correctly ok 220 - simple_doctype_comment: YAML::Perl round-trips without error ok 221 - simple_doctype_comment: YAML::Perl round-trips correctly ok 222 - simple_doctype_comment: YAML::Perl loads without error ok 223 - simple_doctype_comment: YAML::Perl does not modify the input string ok 224 - simple_doctype_comment: YAML::Perl parses correctly ok 225 - simple_doctype_comment: CPAN::Meta::YAML parses without error ok 226 - simple_doctype_comment: CPAN::Meta::YAML does not modify the input string ok 227 - The object isa CPAN::Meta::YAML ok 228 - simple_doctype_comment: CPAN::Meta::YAML parses correctly ok 229 - simple_doctype_comment: CPAN::Meta::YAML serializes without error ok 230 - simple_doctype_comment: CPAN::Meta::YAML serializes correctly ok 231 - simple_doctype_comment: CPAN::Meta::YAML round-trips without error ok 232 - The object isa CPAN::Meta::YAML ok 233 - simple_doctype_comment: CPAN::Meta::YAML round-trips correctly ok 234 # skip Shortcutting perfect serialization tests ok 235 # skip Skipping YAML.pm for known-broken feature ok 236 # skip Skipping YAML.pm for known-broken feature ok 237 # skip Skipping YAML.pm for known-broken feature ok 238 # skip Skipping YAML.pm for known-broken feature ok 239 # skip Skipping YAML.pm for known-broken feature ok 240 # skip Skipping YAML.pm for known-broken feature ok 241 # skip Skipping YAML.pm for known-broken feature ok 242 - simple_doctype_percent: YAML::Syck saves without error ok 243 - simple_doctype_percent: YAML::Syck serializes correctly ok 244 - simple_doctype_percent: YAML::Syck round-trips without error ok 245 - simple_doctype_percent: YAML::Syck round-trips correctly ok 246 - simple_doctype_percent: YAML::Syck loads without error ok 247 - simple_doctype_percent: YAML::Syck does not modify the input string ok 248 - simple_doctype_percent: YAML::Syck parses correctly ok 249 # skip Skipping YAML::XS for known-broken feature ok 250 # skip Skipping YAML::XS for known-broken feature ok 251 # skip Skipping YAML::XS for known-broken feature ok 252 # skip Skipping YAML::XS for known-broken feature ok 253 # skip Skipping YAML::XS for known-broken feature ok 254 # skip Skipping YAML::XS for known-broken feature ok 255 # skip Skipping YAML::XS for known-broken feature ok 256 # skip Skipping YAML::Perl for known-broken feature ok 257 # skip Skipping YAML::Perl for known-broken feature ok 258 # skip Skipping YAML::Perl for known-broken feature ok 259 # skip Skipping YAML::Perl for known-broken feature ok 260 # skip Skipping YAML::Perl for known-broken feature ok 261 # skip Skipping YAML::Perl for known-broken feature ok 262 # skip Skipping YAML::Perl for known-broken feature ok 263 - simple_doctype_percent: CPAN::Meta::YAML parses without error ok 264 - simple_doctype_percent: CPAN::Meta::YAML does not modify the input string ok 265 - The object isa CPAN::Meta::YAML ok 266 - simple_doctype_percent: CPAN::Meta::YAML parses correctly ok 267 - simple_doctype_percent: CPAN::Meta::YAML serializes without error ok 268 - simple_doctype_percent: CPAN::Meta::YAML serializes correctly ok 269 - simple_doctype_percent: CPAN::Meta::YAML round-trips without error ok 270 - The object isa CPAN::Meta::YAML ok 271 - simple_doctype_percent: CPAN::Meta::YAML round-trips correctly ok 272 # skip Shortcutting perfect serialization tests ok 273 # skip Skipping YAML.pm for known-broken feature ok 274 # skip Skipping YAML.pm for known-broken feature ok 275 # skip Skipping YAML.pm for known-broken feature ok 276 # skip Skipping YAML.pm for known-broken feature ok 277 # skip Skipping YAML.pm for known-broken feature ok 278 # skip Skipping YAML.pm for known-broken feature ok 279 # skip Skipping YAML.pm for known-broken feature ok 280 # skip Skipping YAML::Syck for known-broken feature ok 281 # skip Skipping YAML::Syck for known-broken feature ok 282 # skip Skipping YAML::Syck for known-broken feature ok 283 # skip Skipping YAML::Syck for known-broken feature ok 284 # skip Skipping YAML::Syck for known-broken feature ok 285 # skip Skipping YAML::Syck for known-broken feature ok 286 # skip Skipping YAML::Syck for known-broken feature ok 287 # skip Skipping YAML::XS for known-broken feature ok 288 # skip Skipping YAML::XS for known-broken feature ok 289 # skip Skipping YAML::XS for known-broken feature ok 290 # skip Skipping YAML::XS for known-broken feature ok 291 # skip Skipping YAML::XS for known-broken feature ok 292 # skip Skipping YAML::XS for known-broken feature ok 293 # skip Skipping YAML::XS for known-broken feature ok 294 # skip Skipping YAML::Perl for known-broken feature ok 295 # skip Skipping YAML::Perl for known-broken feature ok 296 # skip Skipping YAML::Perl for known-broken feature ok 297 # skip Skipping YAML::Perl for known-broken feature ok 298 # skip Skipping YAML::Perl for known-broken feature ok 299 # skip Skipping YAML::Perl for known-broken feature ok 300 # skip Skipping YAML::Perl for known-broken feature ok 301 - predocument_1_0: CPAN::Meta::YAML parses without error ok 302 - predocument_1_0: CPAN::Meta::YAML does not modify the input string ok 303 - The object isa CPAN::Meta::YAML ok 304 - predocument_1_0: CPAN::Meta::YAML parses correctly ok 305 - predocument_1_0: CPAN::Meta::YAML serializes without error ok 306 - predocument_1_0: CPAN::Meta::YAML serializes correctly ok 307 - predocument_1_0: CPAN::Meta::YAML round-trips without error ok 308 - The object isa CPAN::Meta::YAML ok 309 - predocument_1_0: CPAN::Meta::YAML round-trips correctly ok 310 # skip Shortcutting perfect serialization tests ok 311 # skip Skipping YAML.pm for known-broken feature ok 312 # skip Skipping YAML.pm for known-broken feature ok 313 # skip Skipping YAML.pm for known-broken feature ok 314 # skip Skipping YAML.pm for known-broken feature ok 315 # skip Skipping YAML.pm for known-broken feature ok 316 # skip Skipping YAML.pm for known-broken feature ok 317 # skip Skipping YAML.pm for known-broken feature ok 318 # skip Skipping YAML::Syck for known-broken feature ok 319 # skip Skipping YAML::Syck for known-broken feature ok 320 # skip Skipping YAML::Syck for known-broken feature ok 321 # skip Skipping YAML::Syck for known-broken feature ok 322 # skip Skipping YAML::Syck for known-broken feature ok 323 # skip Skipping YAML::Syck for known-broken feature ok 324 # skip Skipping YAML::Syck for known-broken feature ok 325 - predocument_1_1: YAML::XS saves without error ok 326 - predocument_1_1: YAML::XS serializes correctly ok 327 - predocument_1_1: YAML::XS round-trips without error ok 328 - predocument_1_1: YAML::XS round-trips correctly ok 329 - predocument_1_1: YAML::XS loads without error ok 330 - predocument_1_1: YAML::XS does not modify the input string ok 331 - predocument_1_1: YAML::XS parses correctly ok 332 # skip Skipping YAML::Perl for known-broken feature ok 333 # skip Skipping YAML::Perl for known-broken feature ok 334 # skip Skipping YAML::Perl for known-broken feature ok 335 # skip Skipping YAML::Perl for known-broken feature ok 336 # skip Skipping YAML::Perl for known-broken feature ok 337 # skip Skipping YAML::Perl for known-broken feature ok 338 # skip Skipping YAML::Perl for known-broken feature ok 339 - predocument_1_1: CPAN::Meta::YAML parses without error ok 340 - predocument_1_1: CPAN::Meta::YAML does not modify the input string ok 341 - The object isa CPAN::Meta::YAML ok 342 - predocument_1_1: CPAN::Meta::YAML parses correctly ok 343 - predocument_1_1: CPAN::Meta::YAML serializes without error ok 344 - predocument_1_1: CPAN::Meta::YAML serializes correctly ok 345 - predocument_1_1: CPAN::Meta::YAML round-trips without error ok 346 - The object isa CPAN::Meta::YAML ok 347 - predocument_1_1: CPAN::Meta::YAML round-trips correctly ok 348 # skip Shortcutting perfect serialization tests ok 349 - multi_doctype_comment: YAML.pm saves without error ok 350 - multi_doctype_comment: YAML.pm serializes correctly ok 351 - multi_doctype_comment: YAML.pm round-trips without error ok 352 - multi_doctype_comment: YAML.pm round-trips correctly ok 353 - multi_doctype_comment: YAML.pm loads without error ok 354 - multi_doctype_comment: YAML.pm does not modify the input string ok 355 - multi_doctype_comment: YAML.pm parses correctly ok 356 # skip Skipping YAML::Syck for unsupported feature ok 357 # skip Skipping YAML::Syck for unsupported feature ok 358 # skip Skipping YAML::Syck for unsupported feature ok 359 # skip Skipping YAML::Syck for unsupported feature ok 360 # skip Skipping YAML::Syck for unsupported feature ok 361 # skip Skipping YAML::Syck for unsupported feature ok 362 # skip Skipping YAML::Syck for unsupported feature ok 363 - multi_doctype_comment: YAML::XS saves without error ok 364 - multi_doctype_comment: YAML::XS serializes correctly ok 365 - multi_doctype_comment: YAML::XS round-trips without error ok 366 - multi_doctype_comment: YAML::XS round-trips correctly ok 367 - multi_doctype_comment: YAML::XS loads without error ok 368 - multi_doctype_comment: YAML::XS does not modify the input string ok 369 - multi_doctype_comment: YAML::XS parses correctly ok 370 - multi_doctype_comment: YAML::Perl saves without error ok 371 - multi_doctype_comment: YAML::Perl serializes correctly ok 372 - multi_doctype_comment: YAML::Perl round-trips without error ok 373 - multi_doctype_comment: YAML::Perl round-trips correctly ok 374 - multi_doctype_comment: YAML::Perl loads without error ok 375 - multi_doctype_comment: YAML::Perl does not modify the input string ok 376 - multi_doctype_comment: YAML::Perl parses correctly ok 377 - multi_doctype_comment: CPAN::Meta::YAML parses without error ok 378 - multi_doctype_comment: CPAN::Meta::YAML does not modify the input string ok 379 - The object isa CPAN::Meta::YAML ok 380 - multi_doctype_comment: CPAN::Meta::YAML parses correctly ok 381 - multi_doctype_comment: CPAN::Meta::YAML serializes without error ok 382 - multi_doctype_comment: CPAN::Meta::YAML serializes correctly ok 383 - multi_doctype_comment: CPAN::Meta::YAML round-trips without error ok 384 - The object isa CPAN::Meta::YAML ok 385 - multi_doctype_comment: CPAN::Meta::YAML round-trips correctly ok 386 # skip Shortcutting perfect serialization tests ok 387 # skip Skipping YAML.pm for known-broken feature ok 388 # skip Skipping YAML.pm for known-broken feature ok 389 # skip Skipping YAML.pm for known-broken feature ok 390 # skip Skipping YAML.pm for known-broken feature ok 391 # skip Skipping YAML.pm for known-broken feature ok 392 # skip Skipping YAML.pm for known-broken feature ok 393 # skip Skipping YAML.pm for known-broken feature ok 394 # skip Skipping YAML::Syck for known-broken feature ok 395 # skip Skipping YAML::Syck for known-broken feature ok 396 # skip Skipping YAML::Syck for known-broken feature ok 397 # skip Skipping YAML::Syck for known-broken feature ok 398 # skip Skipping YAML::Syck for known-broken feature ok 399 # skip Skipping YAML::Syck for known-broken feature ok 400 # skip Skipping YAML::Syck for known-broken feature ok 401 - predocument_percent: YAML::XS saves without error ok 402 - predocument_percent: YAML::XS serializes correctly ok 403 - predocument_percent: YAML::XS round-trips without error ok 404 - predocument_percent: YAML::XS round-trips correctly ok 405 - predocument_percent: YAML::XS loads without error ok 406 - predocument_percent: YAML::XS does not modify the input string ok 407 - predocument_percent: YAML::XS parses correctly ok 408 # skip Skipping YAML::Perl for known-broken feature ok 409 # skip Skipping YAML::Perl for known-broken feature ok 410 # skip Skipping YAML::Perl for known-broken feature ok 411 # skip Skipping YAML::Perl for known-broken feature ok 412 # skip Skipping YAML::Perl for known-broken feature ok 413 # skip Skipping YAML::Perl for known-broken feature ok 414 # skip Skipping YAML::Perl for known-broken feature ok 415 - predocument_percent: CPAN::Meta::YAML parses without error ok 416 - predocument_percent: CPAN::Meta::YAML does not modify the input string ok 417 - The object isa CPAN::Meta::YAML ok 418 - predocument_percent: CPAN::Meta::YAML parses correctly ok 419 - predocument_percent: CPAN::Meta::YAML serializes without error ok 420 - predocument_percent: CPAN::Meta::YAML serializes correctly ok 421 - predocument_percent: CPAN::Meta::YAML round-trips without error ok 422 - The object isa CPAN::Meta::YAML ok 423 - predocument_percent: CPAN::Meta::YAML round-trips correctly ok 424 # skip Shortcutting perfect serialization tests ok 425 - predocument_comment: YAML.pm saves without error ok 426 - predocument_comment: YAML.pm serializes correctly ok 427 - predocument_comment: YAML.pm round-trips without error ok 428 - predocument_comment: YAML.pm round-trips correctly ok 429 - predocument_comment: YAML.pm loads without error ok 430 - predocument_comment: YAML.pm does not modify the input string ok 431 - predocument_comment: YAML.pm parses correctly ok 432 - predocument_comment: YAML::Syck saves without error ok 433 - predocument_comment: YAML::Syck serializes correctly ok 434 - predocument_comment: YAML::Syck round-trips without error ok 435 - predocument_comment: YAML::Syck round-trips correctly ok 436 - predocument_comment: YAML::Syck loads without error ok 437 - predocument_comment: YAML::Syck does not modify the input string ok 438 - predocument_comment: YAML::Syck parses correctly ok 439 - predocument_comment: YAML::XS saves without error ok 440 - predocument_comment: YAML::XS serializes correctly ok 441 - predocument_comment: YAML::XS round-trips without error ok 442 - predocument_comment: YAML::XS round-trips correctly ok 443 - predocument_comment: YAML::XS loads without error ok 444 - predocument_comment: YAML::XS does not modify the input string ok 445 - predocument_comment: YAML::XS parses correctly ok 446 - predocument_comment: YAML::Perl saves without error ok 447 - predocument_comment: YAML::Perl serializes correctly ok 448 - predocument_comment: YAML::Perl round-trips without error ok 449 - predocument_comment: YAML::Perl round-trips correctly ok 450 - predocument_comment: YAML::Perl loads without error ok 451 - predocument_comment: YAML::Perl does not modify the input string ok 452 - predocument_comment: YAML::Perl parses correctly ok 453 - predocument_comment: CPAN::Meta::YAML parses without error ok 454 - predocument_comment: CPAN::Meta::YAML does not modify the input string ok 455 - The object isa CPAN::Meta::YAML ok 456 - predocument_comment: CPAN::Meta::YAML parses correctly ok 457 - predocument_comment: CPAN::Meta::YAML serializes without error ok 458 - predocument_comment: CPAN::Meta::YAML serializes correctly ok 459 - predocument_comment: CPAN::Meta::YAML round-trips without error ok 460 - The object isa CPAN::Meta::YAML ok 461 - predocument_comment: CPAN::Meta::YAML round-trips correctly ok 462 # skip Shortcutting perfect serialization tests ok 463 - hitchhiker scalar: YAML.pm saves without error ok 464 - hitchhiker scalar: YAML.pm serializes correctly ok 465 - hitchhiker scalar: YAML.pm round-trips without error ok 466 - hitchhiker scalar: YAML.pm round-trips correctly ok 467 - hitchhiker scalar: YAML.pm loads without error ok 468 - hitchhiker scalar: YAML.pm does not modify the input string ok 469 - hitchhiker scalar: YAML.pm parses correctly ok 470 - hitchhiker scalar: YAML::Syck saves without error ok 471 - hitchhiker scalar: YAML::Syck serializes correctly ok 472 - hitchhiker scalar: YAML::Syck round-trips without error ok 473 - hitchhiker scalar: YAML::Syck round-trips correctly ok 474 - hitchhiker scalar: YAML::Syck loads without error ok 475 - hitchhiker scalar: YAML::Syck does not modify the input string ok 476 - hitchhiker scalar: YAML::Syck parses correctly ok 477 - hitchhiker scalar: YAML::XS saves without error ok 478 - hitchhiker scalar: YAML::XS serializes correctly ok 479 - hitchhiker scalar: YAML::XS round-trips without error ok 480 - hitchhiker scalar: YAML::XS round-trips correctly ok 481 - hitchhiker scalar: YAML::XS loads without error ok 482 - hitchhiker scalar: YAML::XS does not modify the input string ok 483 - hitchhiker scalar: YAML::XS parses correctly ok 484 - hitchhiker scalar: YAML::Perl saves without error ok 485 - hitchhiker scalar: YAML::Perl serializes correctly ok 486 - hitchhiker scalar: YAML::Perl round-trips without error ok 487 - hitchhiker scalar: YAML::Perl round-trips correctly ok 488 - hitchhiker scalar: YAML::Perl loads without error ok 489 - hitchhiker scalar: YAML::Perl does not modify the input string ok 490 - hitchhiker scalar: YAML::Perl parses correctly ok 491 - hitchhiker scalar: CPAN::Meta::YAML parses without error ok 492 - hitchhiker scalar: CPAN::Meta::YAML does not modify the input string ok 493 - The object isa CPAN::Meta::YAML ok 494 - hitchhiker scalar: CPAN::Meta::YAML parses correctly ok 495 - hitchhiker scalar: CPAN::Meta::YAML serializes without error ok 496 - hitchhiker scalar: CPAN::Meta::YAML serializes correctly ok 497 - hitchhiker scalar: CPAN::Meta::YAML round-trips without error ok 498 - The object isa CPAN::Meta::YAML ok 499 - hitchhiker scalar: CPAN::Meta::YAML round-trips correctly ok 500 - Serializes ok ok 501 - null hash in array: YAML.pm saves without error ok 502 - null hash in array: YAML.pm serializes correctly ok 503 - null hash in array: YAML.pm round-trips without error ok 504 - null hash in array: YAML.pm round-trips correctly ok 505 - null hash in array: YAML.pm loads without error ok 506 - null hash in array: YAML.pm does not modify the input string ok 507 - null hash in array: YAML.pm parses correctly ok 508 - null hash in array: YAML::Syck saves without error ok 509 - null hash in array: YAML::Syck serializes correctly ok 510 - null hash in array: YAML::Syck round-trips without error ok 511 - null hash in array: YAML::Syck round-trips correctly ok 512 - null hash in array: YAML::Syck loads without error ok 513 - null hash in array: YAML::Syck does not modify the input string ok 514 - null hash in array: YAML::Syck parses correctly ok 515 - null hash in array: YAML::XS saves without error ok 516 - null hash in array: YAML::XS serializes correctly ok 517 - null hash in array: YAML::XS round-trips without error ok 518 - null hash in array: YAML::XS round-trips correctly ok 519 - null hash in array: YAML::XS loads without error ok 520 - null hash in array: YAML::XS does not modify the input string ok 521 - null hash in array: YAML::XS parses correctly ok 522 - null hash in array: YAML::Perl saves without error ok 523 - null hash in array: YAML::Perl serializes correctly ok 524 - null hash in array: YAML::Perl round-trips without error ok 525 - null hash in array: YAML::Perl round-trips correctly ok 526 - null hash in array: YAML::Perl loads without error ok 527 - null hash in array: YAML::Perl does not modify the input string ok 528 - null hash in array: YAML::Perl parses correctly ok 529 - null hash in array: CPAN::Meta::YAML parses without error ok 530 - null hash in array: CPAN::Meta::YAML does not modify the input string ok 531 - The object isa CPAN::Meta::YAML ok 532 - null hash in array: CPAN::Meta::YAML parses correctly ok 533 - null hash in array: CPAN::Meta::YAML serializes without error ok 534 - null hash in array: CPAN::Meta::YAML serializes correctly ok 535 - null hash in array: CPAN::Meta::YAML round-trips without error ok 536 - The object isa CPAN::Meta::YAML ok 537 - null hash in array: CPAN::Meta::YAML round-trips correctly ok 538 # skip Shortcutting perfect serialization tests ok 539 - null array in array: YAML.pm saves without error ok 540 - null array in array: YAML.pm serializes correctly ok 541 - null array in array: YAML.pm round-trips without error ok 542 - null array in array: YAML.pm round-trips correctly ok 543 - null array in array: YAML.pm loads without error ok 544 - null array in array: YAML.pm does not modify the input string ok 545 - null array in array: YAML.pm parses correctly ok 546 - null array in array: YAML::Syck saves without error ok 547 - null array in array: YAML::Syck serializes correctly ok 548 - null array in array: YAML::Syck round-trips without error ok 549 - null array in array: YAML::Syck round-trips correctly ok 550 - null array in array: YAML::Syck loads without error ok 551 - null array in array: YAML::Syck does not modify the input string ok 552 - null array in array: YAML::Syck parses correctly ok 553 - null array in array: YAML::XS saves without error ok 554 - null array in array: YAML::XS serializes correctly ok 555 - null array in array: YAML::XS round-trips without error ok 556 - null array in array: YAML::XS round-trips correctly ok 557 - null array in array: YAML::XS loads without error ok 558 - null array in array: YAML::XS does not modify the input string ok 559 - null array in array: YAML::XS parses correctly ok 560 - null array in array: YAML::Perl saves without error ok 561 - null array in array: YAML::Perl serializes correctly ok 562 - null array in array: YAML::Perl round-trips without error ok 563 - null array in array: YAML::Perl round-trips correctly ok 564 - null array in array: YAML::Perl loads without error ok 565 - null array in array: YAML::Perl does not modify the input string ok 566 - null array in array: YAML::Perl parses correctly ok 567 - null array in array: CPAN::Meta::YAML parses without error ok 568 - null array in array: CPAN::Meta::YAML does not modify the input string ok 569 - The object isa CPAN::Meta::YAML ok 570 - null array in array: CPAN::Meta::YAML parses correctly ok 571 - null array in array: CPAN::Meta::YAML serializes without error ok 572 - null array in array: CPAN::Meta::YAML serializes correctly ok 573 - null array in array: CPAN::Meta::YAML round-trips without error ok 574 - The object isa CPAN::Meta::YAML ok 575 - null array in array: CPAN::Meta::YAML round-trips correctly ok 576 # skip Shortcutting perfect serialization tests ok 577 - null hash in hash: YAML.pm saves without error ok 578 - null hash in hash: YAML.pm serializes correctly ok 579 - null hash in hash: YAML.pm round-trips without error ok 580 - null hash in hash: YAML.pm round-trips correctly ok 581 - null hash in hash: YAML.pm loads without error ok 582 - null hash in hash: YAML.pm does not modify the input string ok 583 - null hash in hash: YAML.pm parses correctly ok 584 - null hash in hash: YAML::Syck saves without error ok 585 - null hash in hash: YAML::Syck serializes correctly ok 586 - null hash in hash: YAML::Syck round-trips without error ok 587 - null hash in hash: YAML::Syck round-trips correctly ok 588 - null hash in hash: YAML::Syck loads without error ok 589 - null hash in hash: YAML::Syck does not modify the input string ok 590 - null hash in hash: YAML::Syck parses correctly ok 591 - null hash in hash: YAML::XS saves without error ok 592 - null hash in hash: YAML::XS serializes correctly ok 593 - null hash in hash: YAML::XS round-trips without error ok 594 - null hash in hash: YAML::XS round-trips correctly ok 595 - null hash in hash: YAML::XS loads without error ok 596 - null hash in hash: YAML::XS does not modify the input string ok 597 - null hash in hash: YAML::XS parses correctly ok 598 - null hash in hash: YAML::Perl saves without error ok 599 - null hash in hash: YAML::Perl serializes correctly ok 600 - null hash in hash: YAML::Perl round-trips without error ok 601 - null hash in hash: YAML::Perl round-trips correctly ok 602 - null hash in hash: YAML::Perl loads without error ok 603 - null hash in hash: YAML::Perl does not modify the input string ok 604 - null hash in hash: YAML::Perl parses correctly ok 605 - null hash in hash: CPAN::Meta::YAML parses without error ok 606 - null hash in hash: CPAN::Meta::YAML does not modify the input string ok 607 - The object isa CPAN::Meta::YAML ok 608 - null hash in hash: CPAN::Meta::YAML parses correctly ok 609 - null hash in hash: CPAN::Meta::YAML serializes without error ok 610 - null hash in hash: CPAN::Meta::YAML serializes correctly ok 611 - null hash in hash: CPAN::Meta::YAML round-trips without error ok 612 - The object isa CPAN::Meta::YAML ok 613 - null hash in hash: CPAN::Meta::YAML round-trips correctly ok 614 # skip Shortcutting perfect serialization tests ok 615 - null array in hash: YAML.pm saves without error ok 616 - null array in hash: YAML.pm serializes correctly ok 617 - null array in hash: YAML.pm round-trips without error ok 618 - null array in hash: YAML.pm round-trips correctly ok 619 - null array in hash: YAML.pm loads without error ok 620 - null array in hash: YAML.pm does not modify the input string ok 621 - null array in hash: YAML.pm parses correctly ok 622 - null array in hash: YAML::Syck saves without error ok 623 - null array in hash: YAML::Syck serializes correctly ok 624 - null array in hash: YAML::Syck round-trips without error ok 625 - null array in hash: YAML::Syck round-trips correctly ok 626 - null array in hash: YAML::Syck loads without error ok 627 - null array in hash: YAML::Syck does not modify the input string ok 628 - null array in hash: YAML::Syck parses correctly ok 629 - null array in hash: YAML::XS saves without error ok 630 - null array in hash: YAML::XS serializes correctly ok 631 - null array in hash: YAML::XS round-trips without error ok 632 - null array in hash: YAML::XS round-trips correctly ok 633 - null array in hash: YAML::XS loads without error ok 634 - null array in hash: YAML::XS does not modify the input string ok 635 - null array in hash: YAML::XS parses correctly ok 636 - null array in hash: YAML::Perl saves without error ok 637 - null array in hash: YAML::Perl serializes correctly ok 638 - null array in hash: YAML::Perl round-trips without error ok 639 - null array in hash: YAML::Perl round-trips correctly ok 640 - null array in hash: YAML::Perl loads without error ok 641 - null array in hash: YAML::Perl does not modify the input string ok 642 - null array in hash: YAML::Perl parses correctly ok 643 - null array in hash: CPAN::Meta::YAML parses without error ok 644 - null array in hash: CPAN::Meta::YAML does not modify the input string ok 645 - The object isa CPAN::Meta::YAML ok 646 - null array in hash: CPAN::Meta::YAML parses correctly ok 647 - null array in hash: CPAN::Meta::YAML serializes without error ok 648 - null array in hash: CPAN::Meta::YAML serializes correctly ok 649 - null array in hash: CPAN::Meta::YAML round-trips without error ok 650 - The object isa CPAN::Meta::YAML ok 651 - null array in hash: CPAN::Meta::YAML round-trips correctly ok 652 # skip Shortcutting perfect serialization tests ok 653 - trailing whitespace: YAML.pm saves without error ok 654 - trailing whitespace: YAML.pm serializes correctly ok 655 - trailing whitespace: YAML.pm round-trips without error ok 656 - trailing whitespace: YAML.pm round-trips correctly ok 657 - trailing whitespace: YAML.pm loads without error ok 658 - trailing whitespace: YAML.pm does not modify the input string ok 659 - trailing whitespace: YAML.pm parses correctly ok 660 - trailing whitespace: YAML::Syck saves without error ok 661 - trailing whitespace: YAML::Syck serializes correctly ok 662 - trailing whitespace: YAML::Syck round-trips without error ok 663 - trailing whitespace: YAML::Syck round-trips correctly ok 664 - trailing whitespace: YAML::Syck loads without error ok 665 - trailing whitespace: YAML::Syck does not modify the input string ok 666 - trailing whitespace: YAML::Syck parses correctly ok 667 - trailing whitespace: YAML::XS saves without error ok 668 - trailing whitespace: YAML::XS serializes correctly ok 669 - trailing whitespace: YAML::XS round-trips without error ok 670 - trailing whitespace: YAML::XS round-trips correctly ok 671 - trailing whitespace: YAML::XS loads without error ok 672 - trailing whitespace: YAML::XS does not modify the input string ok 673 - trailing whitespace: YAML::XS parses correctly ok 674 # skip Skipping YAML::Perl for known-broken feature ok 675 # skip Skipping YAML::Perl for known-broken feature ok 676 # skip Skipping YAML::Perl for known-broken feature ok 677 # skip Skipping YAML::Perl for known-broken feature ok 678 # skip Skipping YAML::Perl for known-broken feature ok 679 # skip Skipping YAML::Perl for known-broken feature ok 680 # skip Skipping YAML::Perl for known-broken feature ok 681 - trailing whitespace: CPAN::Meta::YAML parses without error ok 682 - trailing whitespace: CPAN::Meta::YAML does not modify the input string ok 683 - The object isa CPAN::Meta::YAML ok 684 - trailing whitespace: CPAN::Meta::YAML parses correctly ok 685 - trailing whitespace: CPAN::Meta::YAML serializes without error ok 686 - trailing whitespace: CPAN::Meta::YAML serializes correctly ok 687 - trailing whitespace: CPAN::Meta::YAML round-trips without error ok 688 - The object isa CPAN::Meta::YAML ok 689 - trailing whitespace: CPAN::Meta::YAML round-trips correctly ok 690 # skip Shortcutting perfect serialization tests ok 691 - hash-like quote: YAML.pm saves without error ok 692 - hash-like quote: YAML.pm serializes correctly ok 693 - hash-like quote: YAML.pm round-trips without error ok 694 - hash-like quote: YAML.pm round-trips correctly ok 695 - hash-like quote: YAML.pm loads without error ok 696 - hash-like quote: YAML.pm does not modify the input string ok 697 - hash-like quote: YAML.pm parses correctly ok 698 - hash-like quote: YAML::Syck saves without error ok 699 - hash-like quote: YAML::Syck serializes correctly ok 700 - hash-like quote: YAML::Syck round-trips without error ok 701 - hash-like quote: YAML::Syck round-trips correctly ok 702 - hash-like quote: YAML::Syck loads without error ok 703 - hash-like quote: YAML::Syck does not modify the input string ok 704 - hash-like quote: YAML::Syck parses correctly ok 705 - hash-like quote: YAML::XS saves without error ok 706 - hash-like quote: YAML::XS serializes correctly ok 707 - hash-like quote: YAML::XS round-trips without error ok 708 - hash-like quote: YAML::XS round-trips correctly ok 709 - hash-like quote: YAML::XS loads without error ok 710 - hash-like quote: YAML::XS does not modify the input string ok 711 - hash-like quote: YAML::XS parses correctly ok 712 - hash-like quote: YAML::Perl saves without error ok 713 - hash-like quote: YAML::Perl serializes correctly ok 714 - hash-like quote: YAML::Perl round-trips without error ok 715 - hash-like quote: YAML::Perl round-trips correctly ok 716 - hash-like quote: YAML::Perl loads without error ok 717 - hash-like quote: YAML::Perl does not modify the input string ok 718 - hash-like quote: YAML::Perl parses correctly ok 719 - hash-like quote: CPAN::Meta::YAML parses without error ok 720 - hash-like quote: CPAN::Meta::YAML does not modify the input string ok 721 - The object isa CPAN::Meta::YAML ok 722 - hash-like quote: CPAN::Meta::YAML parses correctly ok 723 - hash-like quote: CPAN::Meta::YAML serializes without error ok 724 - hash-like quote: CPAN::Meta::YAML serializes correctly ok 725 - hash-like quote: CPAN::Meta::YAML round-trips without error ok 726 - The object isa CPAN::Meta::YAML ok 727 - hash-like quote: CPAN::Meta::YAML round-trips correctly ok 728 # skip Shortcutting perfect serialization tests ok 729 - single quote subtleties: YAML.pm saves without error ok 730 - single quote subtleties: YAML.pm serializes correctly ok 731 - single quote subtleties: YAML.pm round-trips without error ok 732 - single quote subtleties: YAML.pm round-trips correctly ok 733 - single quote subtleties: YAML.pm loads without error ok 734 - single quote subtleties: YAML.pm does not modify the input string ok 735 - single quote subtleties: YAML.pm parses correctly ok 736 - single quote subtleties: YAML::Syck saves without error ok 737 - single quote subtleties: YAML::Syck serializes correctly ok 738 - single quote subtleties: YAML::Syck round-trips without error ok 739 - single quote subtleties: YAML::Syck round-trips correctly ok 740 - single quote subtleties: YAML::Syck loads without error ok 741 - single quote subtleties: YAML::Syck does not modify the input string ok 742 - single quote subtleties: YAML::Syck parses correctly ok 743 - single quote subtleties: YAML::XS saves without error ok 744 - single quote subtleties: YAML::XS serializes correctly ok 745 - single quote subtleties: YAML::XS round-trips without error ok 746 - single quote subtleties: YAML::XS round-trips correctly ok 747 - single quote subtleties: YAML::XS loads without error ok 748 - single quote subtleties: YAML::XS does not modify the input string ok 749 - single quote subtleties: YAML::XS parses correctly ok 750 - single quote subtleties: YAML::Perl saves without error ok 751 - single quote subtleties: YAML::Perl serializes correctly ok 752 - single quote subtleties: YAML::Perl round-trips without error ok 753 - single quote subtleties: YAML::Perl round-trips correctly ok 754 - single quote subtleties: YAML::Perl loads without error ok 755 - single quote subtleties: YAML::Perl does not modify the input string ok 756 - single quote subtleties: YAML::Perl parses correctly ok 757 - single quote subtleties: CPAN::Meta::YAML parses without error ok 758 - single quote subtleties: CPAN::Meta::YAML does not modify the input string ok 759 - The object isa CPAN::Meta::YAML ok 760 - single quote subtleties: CPAN::Meta::YAML parses correctly ok 761 - single quote subtleties: CPAN::Meta::YAML serializes without error ok 762 - single quote subtleties: CPAN::Meta::YAML serializes correctly ok 763 - single quote subtleties: CPAN::Meta::YAML round-trips without error ok 764 - The object isa CPAN::Meta::YAML ok 765 - single quote subtleties: CPAN::Meta::YAML round-trips correctly ok 766 # skip Shortcutting perfect serialization tests ok 767 - single quote subtleties: YAML.pm saves without error ok 768 - single quote subtleties: YAML.pm serializes correctly ok 769 - single quote subtleties: YAML.pm round-trips without error ok 770 - single quote subtleties: YAML.pm round-trips correctly ok 771 - single quote subtleties: YAML.pm loads without error ok 772 - single quote subtleties: YAML.pm does not modify the input string ok 773 - single quote subtleties: YAML.pm parses correctly ok 774 - single quote subtleties: YAML::Syck saves without error ok 775 - single quote subtleties: YAML::Syck serializes correctly ok 776 - single quote subtleties: YAML::Syck round-trips without error ok 777 - single quote subtleties: YAML::Syck round-trips correctly ok 778 - single quote subtleties: YAML::Syck loads without error ok 779 - single quote subtleties: YAML::Syck does not modify the input string ok 780 - single quote subtleties: YAML::Syck parses correctly ok 781 - single quote subtleties: YAML::XS saves without error ok 782 - single quote subtleties: YAML::XS serializes correctly ok 783 - single quote subtleties: YAML::XS round-trips without error ok 784 - single quote subtleties: YAML::XS round-trips correctly ok 785 - single quote subtleties: YAML::XS loads without error ok 786 - single quote subtleties: YAML::XS does not modify the input string ok 787 - single quote subtleties: YAML::XS parses correctly ok 788 - single quote subtleties: YAML::Perl saves without error ok 789 - single quote subtleties: YAML::Perl serializes correctly ok 790 - single quote subtleties: YAML::Perl round-trips without error ok 791 - single quote subtleties: YAML::Perl round-trips correctly ok 792 - single quote subtleties: YAML::Perl loads without error ok 793 - single quote subtleties: YAML::Perl does not modify the input string ok 794 - single quote subtleties: YAML::Perl parses correctly ok 795 - single quote subtleties: CPAN::Meta::YAML parses without error ok 796 - single quote subtleties: CPAN::Meta::YAML does not modify the input string ok 797 - The object isa CPAN::Meta::YAML ok 798 - single quote subtleties: CPAN::Meta::YAML parses correctly ok 799 - single quote subtleties: CPAN::Meta::YAML serializes without error ok 800 - single quote subtleties: CPAN::Meta::YAML serializes correctly ok 801 - single quote subtleties: CPAN::Meta::YAML round-trips without error ok 802 - The object isa CPAN::Meta::YAML ok 803 - single quote subtleties: CPAN::Meta::YAML round-trips correctly ok 804 # skip Shortcutting perfect serialization tests ok 805 # skip Skipping YAML.pm for known-broken feature ok 806 # skip Skipping YAML.pm for known-broken feature ok 807 # skip Skipping YAML.pm for known-broken feature ok 808 # skip Skipping YAML.pm for known-broken feature ok 809 # skip Skipping YAML.pm for known-broken feature ok 810 # skip Skipping YAML.pm for known-broken feature ok 811 # skip Skipping YAML.pm for known-broken feature ok 812 - empty hash keys: YAML::Syck saves without error ok 813 - empty hash keys: YAML::Syck serializes correctly ok 814 - empty hash keys: YAML::Syck round-trips without error ok 815 - empty hash keys: YAML::Syck round-trips correctly ok 816 - empty hash keys: YAML::Syck loads without error ok 817 - empty hash keys: YAML::Syck does not modify the input string ok 818 - empty hash keys: YAML::Syck parses correctly ok 819 - empty hash keys: YAML::XS saves without error ok 820 - empty hash keys: YAML::XS serializes correctly ok 821 - empty hash keys: YAML::XS round-trips without error ok 822 - empty hash keys: YAML::XS round-trips correctly ok 823 - empty hash keys: YAML::XS loads without error ok 824 - empty hash keys: YAML::XS does not modify the input string ok 825 - empty hash keys: YAML::XS parses correctly ok 826 # skip Skipping YAML::Perl for known-broken feature ok 827 # skip Skipping YAML::Perl for known-broken feature ok 828 # skip Skipping YAML::Perl for known-broken feature ok 829 # skip Skipping YAML::Perl for known-broken feature ok 830 # skip Skipping YAML::Perl for known-broken feature ok 831 # skip Skipping YAML::Perl for known-broken feature ok 832 # skip Skipping YAML::Perl for known-broken feature ok 833 - empty hash keys: CPAN::Meta::YAML parses without error ok 834 - empty hash keys: CPAN::Meta::YAML does not modify the input string ok 835 - The object isa CPAN::Meta::YAML ok 836 - empty hash keys: CPAN::Meta::YAML parses correctly ok 837 - empty hash keys: CPAN::Meta::YAML serializes without error ok 838 - empty hash keys: CPAN::Meta::YAML serializes correctly ok 839 - empty hash keys: CPAN::Meta::YAML round-trips without error ok 840 - The object isa CPAN::Meta::YAML ok 841 - empty hash keys: CPAN::Meta::YAML round-trips correctly ok 842 # skip Shortcutting perfect serialization tests ok 843 # skip Skipping YAML.pm for known-broken feature ok 844 # skip Skipping YAML.pm for known-broken feature ok 845 # skip Skipping YAML.pm for known-broken feature ok 846 # skip Skipping YAML.pm for known-broken feature ok 847 # skip Skipping YAML.pm for known-broken feature ok 848 # skip Skipping YAML.pm for known-broken feature ok 849 # skip Skipping YAML.pm for known-broken feature ok 850 - empty array keys: YAML::Syck saves without error ok 851 - empty array keys: YAML::Syck serializes correctly ok 852 - empty array keys: YAML::Syck round-trips without error ok 853 - empty array keys: YAML::Syck round-trips correctly ok 854 - empty array keys: YAML::Syck loads without error ok 855 - empty array keys: YAML::Syck does not modify the input string ok 856 - empty array keys: YAML::Syck parses correctly ok 857 - empty array keys: YAML::XS saves without error ok 858 - empty array keys: YAML::XS serializes correctly ok 859 - empty array keys: YAML::XS round-trips without error ok 860 - empty array keys: YAML::XS round-trips correctly ok 861 - empty array keys: YAML::XS loads without error ok 862 - empty array keys: YAML::XS does not modify the input string ok 863 - empty array keys: YAML::XS parses correctly ok 864 # skip Skipping YAML::Perl for known-broken feature ok 865 # skip Skipping YAML::Perl for known-broken feature ok 866 # skip Skipping YAML::Perl for known-broken feature ok 867 # skip Skipping YAML::Perl for known-broken feature ok 868 # skip Skipping YAML::Perl for known-broken feature ok 869 # skip Skipping YAML::Perl for known-broken feature ok 870 # skip Skipping YAML::Perl for known-broken feature ok 871 - empty array keys: CPAN::Meta::YAML parses without error ok 872 - empty array keys: CPAN::Meta::YAML does not modify the input string ok 873 - The object isa CPAN::Meta::YAML ok 874 - empty array keys: CPAN::Meta::YAML parses correctly ok 875 - empty array keys: CPAN::Meta::YAML serializes without error ok 876 - empty array keys: CPAN::Meta::YAML serializes correctly ok 877 - empty array keys: CPAN::Meta::YAML round-trips without error ok 878 - The object isa CPAN::Meta::YAML ok 879 - empty array keys: CPAN::Meta::YAML round-trips correctly ok 880 # skip Shortcutting perfect serialization tests ok 881 # skip Skipping YAML.pm for known-broken feature ok 882 # skip Skipping YAML.pm for known-broken feature ok 883 # skip Skipping YAML.pm for known-broken feature ok 884 # skip Skipping YAML.pm for known-broken feature ok 885 # skip Skipping YAML.pm for known-broken feature ok 886 # skip Skipping YAML.pm for known-broken feature ok 887 # skip Skipping YAML.pm for known-broken feature ok 888 - comment header: YAML::Syck saves without error ok 889 - comment header: YAML::Syck serializes correctly ok 890 - comment header: YAML::Syck round-trips without error ok 891 - comment header: YAML::Syck round-trips correctly ok 892 - comment header: YAML::Syck loads without error ok 893 - comment header: YAML::Syck does not modify the input string ok 894 - comment header: YAML::Syck parses correctly ok 895 - comment header: YAML::XS saves without error ok 896 - comment header: YAML::XS serializes correctly ok 897 - comment header: YAML::XS round-trips without error ok 898 - comment header: YAML::XS round-trips correctly ok 899 - comment header: YAML::XS loads without error ok 900 - comment header: YAML::XS does not modify the input string ok 901 - comment header: YAML::XS parses correctly ok 902 # skip Skipping YAML::Perl for known-broken feature ok 903 # skip Skipping YAML::Perl for known-broken feature ok 904 # skip Skipping YAML::Perl for known-broken feature ok 905 # skip Skipping YAML::Perl for known-broken feature ok 906 # skip Skipping YAML::Perl for known-broken feature ok 907 # skip Skipping YAML::Perl for known-broken feature ok 908 # skip Skipping YAML::Perl for known-broken feature ok 909 - comment header: CPAN::Meta::YAML parses without error ok 910 - comment header: CPAN::Meta::YAML does not modify the input string ok 911 - The object isa CPAN::Meta::YAML ok 912 - comment header: CPAN::Meta::YAML parses correctly ok 913 - comment header: CPAN::Meta::YAML serializes without error ok 914 - comment header: CPAN::Meta::YAML serializes correctly ok 915 - comment header: CPAN::Meta::YAML round-trips without error ok 916 - The object isa CPAN::Meta::YAML ok 917 - comment header: CPAN::Meta::YAML round-trips correctly ok 918 # skip Shortcutting perfect serialization tests ok 919 - special characters: YAML.pm saves without error ok 920 - special characters: YAML.pm serializes correctly ok 921 - special characters: YAML.pm round-trips without error ok 922 - special characters: YAML.pm round-trips correctly ok 923 - special characters: YAML.pm loads without error ok 924 - special characters: YAML.pm does not modify the input string ok 925 - special characters: YAML.pm parses correctly ok 926 - special characters: YAML::Syck saves without error ok 927 - special characters: YAML::Syck serializes correctly ok 928 - special characters: YAML::Syck round-trips without error ok 929 - special characters: YAML::Syck round-trips correctly ok 930 - special characters: YAML::Syck loads without error ok 931 - special characters: YAML::Syck does not modify the input string ok 932 - special characters: YAML::Syck parses correctly ok 933 - special characters: YAML::XS saves without error ok 934 - special characters: YAML::XS serializes correctly ok 935 - special characters: YAML::XS round-trips without error ok 936 - special characters: YAML::XS round-trips correctly ok 937 - special characters: YAML::XS loads without error ok 938 - special characters: YAML::XS does not modify the input string ok 939 - special characters: YAML::XS parses correctly ok 940 - special characters: YAML::Perl saves without error ok 941 - special characters: YAML::Perl serializes correctly ok 942 - special characters: YAML::Perl round-trips without error ok 943 - special characters: YAML::Perl round-trips correctly ok 944 - special characters: YAML::Perl loads without error ok 945 - special characters: YAML::Perl does not modify the input string ok 946 - special characters: YAML::Perl parses correctly ok 947 - special characters: CPAN::Meta::YAML parses without error ok 948 - special characters: CPAN::Meta::YAML does not modify the input string ok 949 - The object isa CPAN::Meta::YAML ok 950 - special characters: CPAN::Meta::YAML parses correctly ok 951 - special characters: CPAN::Meta::YAML serializes without error ok 952 - special characters: CPAN::Meta::YAML serializes correctly ok 953 - special characters: CPAN::Meta::YAML round-trips without error ok 954 - The object isa CPAN::Meta::YAML ok 955 - special characters: CPAN::Meta::YAML round-trips correctly ok 956 # skip Shortcutting perfect serialization tests ok 957 - The object isa CPAN::Meta::YAML ok 958 - ->write_string does not return a value ok 959 - Error string is defined ok 960 - Got the expected error message ok 961 - synopsis: YAML.pm saves without error ok 962 - synopsis: YAML.pm serializes correctly ok 963 - synopsis: YAML.pm round-trips without error ok 964 - synopsis: YAML.pm round-trips correctly ok 965 - synopsis: YAML.pm loads without error ok 966 - synopsis: YAML.pm does not modify the input string ok 967 - synopsis: YAML.pm parses correctly ok 968 - synopsis: YAML::Syck saves without error ok 969 - synopsis: YAML::Syck serializes correctly ok 970 - synopsis: YAML::Syck round-trips without error ok 971 - synopsis: YAML::Syck round-trips correctly ok 972 - synopsis: YAML::Syck loads without error ok 973 - synopsis: YAML::Syck does not modify the input string ok 974 - synopsis: YAML::Syck parses correctly ok 975 - synopsis: YAML::XS saves without error ok 976 - synopsis: YAML::XS serializes correctly ok 977 - synopsis: YAML::XS round-trips without error ok 978 - synopsis: YAML::XS round-trips correctly ok 979 - synopsis: YAML::XS loads without error ok 980 - synopsis: YAML::XS does not modify the input string ok 981 - synopsis: YAML::XS parses correctly ok 982 # skip Skipping YAML::Perl for known-broken feature ok 983 # skip Skipping YAML::Perl for known-broken feature ok 984 # skip Skipping YAML::Perl for known-broken feature ok 985 # skip Skipping YAML::Perl for known-broken feature ok 986 # skip Skipping YAML::Perl for known-broken feature ok 987 # skip Skipping YAML::Perl for known-broken feature ok 988 # skip Skipping YAML::Perl for known-broken feature ok 989 - synopsis: CPAN::Meta::YAML parses without error ok 990 - synopsis: CPAN::Meta::YAML does not modify the input string ok 991 - The object isa CPAN::Meta::YAML ok 992 - synopsis: CPAN::Meta::YAML parses correctly ok 993 - synopsis: CPAN::Meta::YAML serializes without error ok 994 - synopsis: CPAN::Meta::YAML serializes correctly ok 995 - synopsis: CPAN::Meta::YAML round-trips without error ok 996 - The object isa CPAN::Meta::YAML ok 997 - synopsis: CPAN::Meta::YAML round-trips correctly ok 998 # skip Shortcutting perfect serialization tests ok 999 - unprintable: YAML.pm saves without error ok 1000 - unprintable: YAML.pm serializes correctly ok 1001 - unprintable: YAML.pm round-trips without error ok 1002 - unprintable: YAML.pm round-trips correctly ok 1003 - unprintable: YAML.pm loads without error ok 1004 - unprintable: YAML.pm does not modify the input string ok 1005 - unprintable: YAML.pm parses correctly ok 1006 - unprintable: YAML::Syck saves without error ok 1007 - unprintable: YAML::Syck serializes correctly ok 1008 - unprintable: YAML::Syck round-trips without error ok 1009 - unprintable: YAML::Syck round-trips correctly ok 1010 - unprintable: YAML::Syck loads without error ok 1011 - unprintable: YAML::Syck does not modify the input string ok 1012 - unprintable: YAML::Syck parses correctly ok 1013 - unprintable: YAML::XS saves without error ok 1014 - unprintable: YAML::XS serializes correctly ok 1015 - unprintable: YAML::XS round-trips without error ok 1016 - unprintable: YAML::XS round-trips correctly ok 1017 - unprintable: YAML::XS loads without error ok 1018 - unprintable: YAML::XS does not modify the input string ok 1019 - unprintable: YAML::XS parses correctly ok 1020 - unprintable: YAML::Perl saves without error ok 1021 - unprintable: YAML::Perl serializes correctly ok 1022 - unprintable: YAML::Perl round-trips without error ok 1023 - unprintable: YAML::Perl round-trips correctly ok 1024 - unprintable: YAML::Perl loads without error ok 1025 - unprintable: YAML::Perl does not modify the input string ok 1026 - unprintable: YAML::Perl parses correctly ok 1027 - unprintable: CPAN::Meta::YAML parses without error ok 1028 - unprintable: CPAN::Meta::YAML does not modify the input string ok 1029 - The object isa CPAN::Meta::YAML ok 1030 - unprintable: CPAN::Meta::YAML parses correctly ok 1031 - unprintable: CPAN::Meta::YAML serializes without error ok 1032 - unprintable: CPAN::Meta::YAML serializes correctly ok 1033 - unprintable: CPAN::Meta::YAML round-trips without error ok 1034 - The object isa CPAN::Meta::YAML ok 1035 - unprintable: CPAN::Meta::YAML round-trips correctly ok 1036 # skip Shortcutting perfect serialization tests ok 1037 - unnamed: YAML.pm saves without error ok 1038 - unnamed: YAML.pm serializes correctly ok 1039 - unnamed: YAML.pm round-trips without error ok 1040 - unnamed: YAML.pm round-trips correctly ok 1041 - unnamed: YAML.pm loads without error ok 1042 - unnamed: YAML.pm does not modify the input string ok 1043 - unnamed: YAML.pm parses correctly ok 1044 - unnamed: YAML::Syck saves without error ok 1045 - unnamed: YAML::Syck serializes correctly ok 1046 - unnamed: YAML::Syck round-trips without error ok 1047 - unnamed: YAML::Syck round-trips correctly ok 1048 - unnamed: YAML::Syck loads without error ok 1049 - unnamed: YAML::Syck does not modify the input string ok 1050 - unnamed: YAML::Syck parses correctly ok 1051 - unnamed: YAML::XS saves without error ok 1052 - unnamed: YAML::XS serializes correctly ok 1053 - unnamed: YAML::XS round-trips without error ok 1054 - unnamed: YAML::XS round-trips correctly ok 1055 - unnamed: YAML::XS loads without error ok 1056 - unnamed: YAML::XS does not modify the input string ok 1057 - unnamed: YAML::XS parses correctly ok 1058 - unnamed: YAML::Perl saves without error ok 1059 - unnamed: YAML::Perl serializes correctly ok 1060 - unnamed: YAML::Perl round-trips without error ok 1061 - unnamed: YAML::Perl round-trips correctly ok 1062 - unnamed: YAML::Perl loads without error ok 1063 - unnamed: YAML::Perl does not modify the input string ok 1064 - unnamed: YAML::Perl parses correctly ok 1065 - unnamed: CPAN::Meta::YAML parses without error ok 1066 - unnamed: CPAN::Meta::YAML does not modify the input string ok 1067 - The object isa CPAN::Meta::YAML ok 1068 - unnamed: CPAN::Meta::YAML parses correctly ok 1069 - unnamed: CPAN::Meta::YAML serializes without error ok 1070 - unnamed: CPAN::Meta::YAML serializes correctly ok 1071 - unnamed: CPAN::Meta::YAML round-trips without error ok 1072 - The object isa CPAN::Meta::YAML ok 1073 - unnamed: CPAN::Meta::YAML round-trips correctly ok 1074 # skip Shortcutting perfect serialization tests ok 1075 - Indentation after empty hash value: YAML.pm saves without error ok 1076 - Indentation after empty hash value: YAML.pm serializes correctly ok 1077 - Indentation after empty hash value: YAML.pm round-trips without error ok 1078 - Indentation after empty hash value: YAML.pm round-trips correctly ok 1079 - Indentation after empty hash value: YAML.pm loads without error ok 1080 - Indentation after empty hash value: YAML.pm does not modify the input string ok 1081 - Indentation after empty hash value: YAML.pm parses correctly ok 1082 - Indentation after empty hash value: YAML::Syck saves without error ok 1083 - Indentation after empty hash value: YAML::Syck serializes correctly ok 1084 - Indentation after empty hash value: YAML::Syck round-trips without error ok 1085 - Indentation after empty hash value: YAML::Syck round-trips correctly ok 1086 - Indentation after empty hash value: YAML::Syck loads without error ok 1087 - Indentation after empty hash value: YAML::Syck does not modify the input string ok 1088 - Indentation after empty hash value: YAML::Syck parses correctly ok 1089 - Indentation after empty hash value: YAML::XS saves without error ok 1090 - Indentation after empty hash value: YAML::XS serializes correctly ok 1091 - Indentation after empty hash value: YAML::XS round-trips without error ok 1092 - Indentation after empty hash value: YAML::XS round-trips correctly ok 1093 - Indentation after empty hash value: YAML::XS loads without error ok 1094 - Indentation after empty hash value: YAML::XS does not modify the input string ok 1095 - Indentation after empty hash value: YAML::XS parses correctly ok 1096 # skip Skipping YAML::Perl for known-broken feature ok 1097 # skip Skipping YAML::Perl for known-broken feature ok 1098 # skip Skipping YAML::Perl for known-broken feature ok 1099 # skip Skipping YAML::Perl for known-broken feature ok 1100 # skip Skipping YAML::Perl for known-broken feature ok 1101 # skip Skipping YAML::Perl for known-broken feature ok 1102 # skip Skipping YAML::Perl for known-broken feature ok 1103 - Indentation after empty hash value: CPAN::Meta::YAML parses without error ok 1104 - Indentation after empty hash value: CPAN::Meta::YAML does not modify the input string ok 1105 - The object isa CPAN::Meta::YAML ok 1106 - Indentation after empty hash value: CPAN::Meta::YAML parses correctly ok 1107 - Indentation after empty hash value: CPAN::Meta::YAML serializes without error ok 1108 - Indentation after empty hash value: CPAN::Meta::YAML serializes correctly ok 1109 - Indentation after empty hash value: CPAN::Meta::YAML round-trips without error ok 1110 - The object isa CPAN::Meta::YAML ok 1111 - Indentation after empty hash value: CPAN::Meta::YAML round-trips correctly ok 1112 # skip Shortcutting perfect serialization tests ok 1113 - unnamed: YAML.pm saves without error ok 1114 - unnamed: YAML.pm serializes correctly ok 1115 - unnamed: YAML.pm round-trips without error ok 1116 - unnamed: YAML.pm round-trips correctly ok 1117 - unnamed: YAML.pm loads without error ok 1118 - unnamed: YAML.pm does not modify the input string ok 1119 - unnamed: YAML.pm parses correctly ok 1120 - unnamed: YAML::Syck saves without error ok 1121 - unnamed: YAML::Syck serializes correctly ok 1122 - unnamed: YAML::Syck round-trips without error ok 1123 - unnamed: YAML::Syck round-trips correctly ok 1124 - unnamed: YAML::Syck loads without error ok 1125 - unnamed: YAML::Syck does not modify the input string ok 1126 - unnamed: YAML::Syck parses correctly ok 1127 - unnamed: YAML::XS saves without error ok 1128 - unnamed: YAML::XS serializes correctly ok 1129 - unnamed: YAML::XS round-trips without error ok 1130 - unnamed: YAML::XS round-trips correctly ok 1131 - unnamed: YAML::XS loads without error ok 1132 - unnamed: YAML::XS does not modify the input string ok 1133 - unnamed: YAML::XS parses correctly ok 1134 - unnamed: YAML::Perl saves without error ok 1135 - unnamed: YAML::Perl serializes correctly ok 1136 - unnamed: YAML::Perl round-trips without error ok 1137 - unnamed: YAML::Perl round-trips correctly ok 1138 - unnamed: YAML::Perl loads without error ok 1139 - unnamed: YAML::Perl does not modify the input string ok 1140 - unnamed: YAML::Perl parses correctly ok 1141 - unnamed: CPAN::Meta::YAML parses without error ok 1142 - unnamed: CPAN::Meta::YAML does not modify the input string ok 1143 - The object isa CPAN::Meta::YAML ok 1144 - unnamed: CPAN::Meta::YAML parses correctly ok 1145 - unnamed: CPAN::Meta::YAML serializes without error ok 1146 - unnamed: CPAN::Meta::YAML serializes correctly ok 1147 - unnamed: CPAN::Meta::YAML round-trips without error ok 1148 - The object isa CPAN::Meta::YAML ok 1149 - unnamed: CPAN::Meta::YAML round-trips correctly ok 1150 # skip Shortcutting perfect serialization tests ok 1151 - Pathological >< case: YAML.pm saves without error ok 1152 - Pathological >< case: YAML.pm serializes correctly ok 1153 - Pathological >< case: YAML.pm round-trips without error ok 1154 - Pathological >< case: YAML.pm round-trips correctly ok 1155 - Pathological >< case: YAML.pm loads without error ok 1156 - Pathological >< case: YAML.pm does not modify the input string ok 1157 - Pathological >< case: YAML.pm parses correctly ok 1158 - Pathological >< case: YAML::Syck saves without error ok 1159 - Pathological >< case: YAML::Syck serializes correctly ok 1160 - Pathological >< case: YAML::Syck round-trips without error ok 1161 - Pathological >< case: YAML::Syck round-trips correctly ok 1162 - Pathological >< case: YAML::Syck loads without error ok 1163 - Pathological >< case: YAML::Syck does not modify the input string ok 1164 - Pathological >< case: YAML::Syck parses correctly ok 1165 - Pathological >< case: YAML::XS saves without error ok 1166 - Pathological >< case: YAML::XS serializes correctly ok 1167 - Pathological >< case: YAML::XS round-trips without error ok 1168 - Pathological >< case: YAML::XS round-trips correctly ok 1169 - Pathological >< case: YAML::XS loads without error ok 1170 - Pathological >< case: YAML::XS does not modify the input string ok 1171 - Pathological >< case: YAML::XS parses correctly ok 1172 - Pathological >< case: YAML::Perl saves without error ok 1173 - Pathological >< case: YAML::Perl serializes correctly ok 1174 - Pathological >< case: YAML::Perl round-trips without error ok 1175 - Pathological >< case: YAML::Perl round-trips correctly ok 1176 - Pathological >< case: YAML::Perl loads without error ok 1177 - Pathological >< case: YAML::Perl does not modify the input string ok 1178 - Pathological >< case: YAML::Perl parses correctly ok 1179 - Pathological >< case: CPAN::Meta::YAML parses without error ok 1180 - Pathological >< case: CPAN::Meta::YAML does not modify the input string ok 1181 - The object isa CPAN::Meta::YAML ok 1182 - Pathological >< case: CPAN::Meta::YAML parses correctly ok 1183 - Pathological >< case: CPAN::Meta::YAML serializes without error ok 1184 - Pathological >< case: CPAN::Meta::YAML serializes correctly ok 1185 - Pathological >< case: CPAN::Meta::YAML round-trips without error ok 1186 - The object isa CPAN::Meta::YAML ok 1187 - Pathological >< case: CPAN::Meta::YAML round-trips correctly ok 1188 # skip Shortcutting perfect serialization tests ok 1189 # skip Skipping YAML.pm for known-broken feature ok 1190 # skip Skipping YAML.pm for known-broken feature ok 1191 # skip Skipping YAML.pm for known-broken feature ok 1192 # skip Skipping YAML.pm for known-broken feature ok 1193 # skip Skipping YAML.pm for known-broken feature ok 1194 # skip Skipping YAML.pm for known-broken feature ok 1195 # skip Skipping YAML.pm for known-broken feature ok 1196 - Non-indenting sub-list: YAML::Syck saves without error ok 1197 - Non-indenting sub-list: YAML::Syck serializes correctly ok 1198 - Non-indenting sub-list: YAML::Syck round-trips without error ok 1199 - Non-indenting sub-list: YAML::Syck round-trips correctly ok 1200 - Non-indenting sub-list: YAML::Syck loads without error ok 1201 - Non-indenting sub-list: YAML::Syck does not modify the input string ok 1202 - Non-indenting sub-list: YAML::Syck parses correctly ok 1203 - Non-indenting sub-list: YAML::XS saves without error ok 1204 - Non-indenting sub-list: YAML::XS serializes correctly ok 1205 - Non-indenting sub-list: YAML::XS round-trips without error ok 1206 - Non-indenting sub-list: YAML::XS round-trips correctly ok 1207 - Non-indenting sub-list: YAML::XS loads without error ok 1208 - Non-indenting sub-list: YAML::XS does not modify the input string ok 1209 - Non-indenting sub-list: YAML::XS parses correctly ok 1210 # skip Skipping YAML::Perl for known-broken feature ok 1211 # skip Skipping YAML::Perl for known-broken feature ok 1212 # skip Skipping YAML::Perl for known-broken feature ok 1213 # skip Skipping YAML::Perl for known-broken feature ok 1214 # skip Skipping YAML::Perl for known-broken feature ok 1215 # skip Skipping YAML::Perl for known-broken feature ok 1216 # skip Skipping YAML::Perl for known-broken feature ok 1217 - Non-indenting sub-list: CPAN::Meta::YAML parses without error ok 1218 - Non-indenting sub-list: CPAN::Meta::YAML does not modify the input string ok 1219 - The object isa CPAN::Meta::YAML ok 1220 - Non-indenting sub-list: CPAN::Meta::YAML parses correctly ok 1221 - Non-indenting sub-list: CPAN::Meta::YAML serializes without error ok 1222 - Non-indenting sub-list: CPAN::Meta::YAML serializes correctly ok 1223 - Non-indenting sub-list: CPAN::Meta::YAML round-trips without error ok 1224 - The object isa CPAN::Meta::YAML ok 1225 - Non-indenting sub-list: CPAN::Meta::YAML round-trips correctly ok 1226 # skip Shortcutting perfect serialization tests ok 1227 - Multiple escaping of quote ok: YAML.pm saves without error ok 1228 - Multiple escaping of quote ok: YAML.pm serializes correctly ok 1229 - Multiple escaping of quote ok: YAML.pm round-trips without error ok 1230 - Multiple escaping of quote ok: YAML.pm round-trips correctly ok 1231 - Multiple escaping of quote ok: YAML.pm loads without error ok 1232 - Multiple escaping of quote ok: YAML.pm does not modify the input string ok 1233 - Multiple escaping of quote ok: YAML.pm parses correctly ok 1234 - Multiple escaping of quote ok: YAML::Syck saves without error ok 1235 - Multiple escaping of quote ok: YAML::Syck serializes correctly ok 1236 - Multiple escaping of quote ok: YAML::Syck round-trips without error ok 1237 - Multiple escaping of quote ok: YAML::Syck round-trips correctly ok 1238 - Multiple escaping of quote ok: YAML::Syck loads without error ok 1239 - Multiple escaping of quote ok: YAML::Syck does not modify the input string ok 1240 - Multiple escaping of quote ok: YAML::Syck parses correctly ok 1241 - Multiple escaping of quote ok: YAML::XS saves without error ok 1242 - Multiple escaping of quote ok: YAML::XS serializes correctly ok 1243 - Multiple escaping of quote ok: YAML::XS round-trips without error ok 1244 - Multiple escaping of quote ok: YAML::XS round-trips correctly ok 1245 - Multiple escaping of quote ok: YAML::XS loads without error ok 1246 - Multiple escaping of quote ok: YAML::XS does not modify the input string ok 1247 - Multiple escaping of quote ok: YAML::XS parses correctly ok 1248 - Multiple escaping of quote ok: YAML::Perl saves without error ok 1249 - Multiple escaping of quote ok: YAML::Perl serializes correctly ok 1250 - Multiple escaping of quote ok: YAML::Perl round-trips without error ok 1251 - Multiple escaping of quote ok: YAML::Perl round-trips correctly ok 1252 - Multiple escaping of quote ok: YAML::Perl loads without error ok 1253 - Multiple escaping of quote ok: YAML::Perl does not modify the input string ok 1254 - Multiple escaping of quote ok: YAML::Perl parses correctly ok 1255 - Multiple escaping of quote ok: CPAN::Meta::YAML parses without error ok 1256 - Multiple escaping of quote ok: CPAN::Meta::YAML does not modify the input string ok 1257 - The object isa CPAN::Meta::YAML ok 1258 - Multiple escaping of quote ok: CPAN::Meta::YAML parses correctly ok 1259 - Multiple escaping of quote ok: CPAN::Meta::YAML serializes without error ok 1260 - Multiple escaping of quote ok: CPAN::Meta::YAML serializes correctly ok 1261 - Multiple escaping of quote ok: CPAN::Meta::YAML round-trips without error ok 1262 - The object isa CPAN::Meta::YAML ok 1263 - Multiple escaping of quote ok: CPAN::Meta::YAML round-trips correctly ok 1264 # skip Shortcutting perfect serialization tests ok 1265 - Multiple escaping of escape ok: YAML.pm saves without error ok 1266 - Multiple escaping of escape ok: YAML.pm serializes correctly ok 1267 - Multiple escaping of escape ok: YAML.pm round-trips without error ok 1268 - Multiple escaping of escape ok: YAML.pm round-trips correctly ok 1269 - Multiple escaping of escape ok: YAML.pm loads without error ok 1270 - Multiple escaping of escape ok: YAML.pm does not modify the input string ok 1271 - Multiple escaping of escape ok: YAML.pm parses correctly ok 1272 - Multiple escaping of escape ok: YAML::Syck saves without error ok 1273 - Multiple escaping of escape ok: YAML::Syck serializes correctly ok 1274 - Multiple escaping of escape ok: YAML::Syck round-trips without error ok 1275 - Multiple escaping of escape ok: YAML::Syck round-trips correctly ok 1276 - Multiple escaping of escape ok: YAML::Syck loads without error ok 1277 - Multiple escaping of escape ok: YAML::Syck does not modify the input string ok 1278 - Multiple escaping of escape ok: YAML::Syck parses correctly ok 1279 - Multiple escaping of escape ok: YAML::XS saves without error ok 1280 - Multiple escaping of escape ok: YAML::XS serializes correctly ok 1281 - Multiple escaping of escape ok: YAML::XS round-trips without error ok 1282 - Multiple escaping of escape ok: YAML::XS round-trips correctly ok 1283 - Multiple escaping of escape ok: YAML::XS loads without error ok 1284 - Multiple escaping of escape ok: YAML::XS does not modify the input string ok 1285 - Multiple escaping of escape ok: YAML::XS parses correctly ok 1286 - Multiple escaping of escape ok: YAML::Perl saves without error ok 1287 - Multiple escaping of escape ok: YAML::Perl serializes correctly ok 1288 - Multiple escaping of escape ok: YAML::Perl round-trips without error ok 1289 - Multiple escaping of escape ok: YAML::Perl round-trips correctly ok 1290 - Multiple escaping of escape ok: YAML::Perl loads without error ok 1291 - Multiple escaping of escape ok: YAML::Perl does not modify the input string ok 1292 - Multiple escaping of escape ok: YAML::Perl parses correctly ok 1293 - Multiple escaping of escape ok: CPAN::Meta::YAML parses without error ok 1294 - Multiple escaping of escape ok: CPAN::Meta::YAML does not modify the input string ok 1295 - The object isa CPAN::Meta::YAML ok 1296 - Multiple escaping of escape ok: CPAN::Meta::YAML parses correctly ok 1297 - Multiple escaping of escape ok: CPAN::Meta::YAML serializes without error ok 1298 - Multiple escaping of escape ok: CPAN::Meta::YAML serializes correctly ok 1299 - Multiple escaping of escape ok: CPAN::Meta::YAML round-trips without error ok 1300 - The object isa CPAN::Meta::YAML ok 1301 - Multiple escaping of escape ok: CPAN::Meta::YAML round-trips correctly ok 1302 # skip Shortcutting perfect serialization tests ok 1303 - Multiple escaping of escape with whitespace ok: YAML.pm saves without error ok 1304 - Multiple escaping of escape with whitespace ok: YAML.pm serializes correctly ok 1305 - Multiple escaping of escape with whitespace ok: YAML.pm round-trips without error ok 1306 - Multiple escaping of escape with whitespace ok: YAML.pm round-trips correctly ok 1307 - Multiple escaping of escape with whitespace ok: YAML.pm loads without error ok 1308 - Multiple escaping of escape with whitespace ok: YAML.pm does not modify the input string ok 1309 - Multiple escaping of escape with whitespace ok: YAML.pm parses correctly ok 1310 - Multiple escaping of escape with whitespace ok: YAML::Syck saves without error ok 1311 - Multiple escaping of escape with whitespace ok: YAML::Syck serializes correctly ok 1312 - Multiple escaping of escape with whitespace ok: YAML::Syck round-trips without error ok 1313 - Multiple escaping of escape with whitespace ok: YAML::Syck round-trips correctly ok 1314 - Multiple escaping of escape with whitespace ok: YAML::Syck loads without error ok 1315 - Multiple escaping of escape with whitespace ok: YAML::Syck does not modify the input string ok 1316 - Multiple escaping of escape with whitespace ok: YAML::Syck parses correctly ok 1317 - Multiple escaping of escape with whitespace ok: YAML::XS saves without error ok 1318 - Multiple escaping of escape with whitespace ok: YAML::XS serializes correctly ok 1319 - Multiple escaping of escape with whitespace ok: YAML::XS round-trips without error ok 1320 - Multiple escaping of escape with whitespace ok: YAML::XS round-trips correctly ok 1321 - Multiple escaping of escape with whitespace ok: YAML::XS loads without error ok 1322 - Multiple escaping of escape with whitespace ok: YAML::XS does not modify the input string ok 1323 - Multiple escaping of escape with whitespace ok: YAML::XS parses correctly ok 1324 - Multiple escaping of escape with whitespace ok: YAML::Perl saves without error ok 1325 - Multiple escaping of escape with whitespace ok: YAML::Perl serializes correctly ok 1326 - Multiple escaping of escape with whitespace ok: YAML::Perl round-trips without error ok 1327 - Multiple escaping of escape with whitespace ok: YAML::Perl round-trips correctly ok 1328 - Multiple escaping of escape with whitespace ok: YAML::Perl loads without error ok 1329 - Multiple escaping of escape with whitespace ok: YAML::Perl does not modify the input string ok 1330 - Multiple escaping of escape with whitespace ok: YAML::Perl parses correctly ok 1331 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML parses without error ok 1332 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML does not modify the input string ok 1333 - The object isa CPAN::Meta::YAML ok 1334 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML parses correctly ok 1335 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML serializes without error ok 1336 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML serializes correctly ok 1337 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML round-trips without error ok 1338 - The object isa CPAN::Meta::YAML ok 1339 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML round-trips correctly ok 1340 # skip Shortcutting perfect serialization tests ok 1341 - Bang in a quote: YAML.pm saves without error ok 1342 - Bang in a quote: YAML.pm serializes correctly ok 1343 - Bang in a quote: YAML.pm round-trips without error ok 1344 - Bang in a quote: YAML.pm round-trips correctly ok 1345 - Bang in a quote: YAML.pm loads without error ok 1346 - Bang in a quote: YAML.pm does not modify the input string ok 1347 - Bang in a quote: YAML.pm parses correctly ok 1348 - Bang in a quote: YAML::Syck saves without error ok 1349 - Bang in a quote: YAML::Syck serializes correctly ok 1350 - Bang in a quote: YAML::Syck round-trips without error ok 1351 - Bang in a quote: YAML::Syck round-trips correctly ok 1352 - Bang in a quote: YAML::Syck loads without error ok 1353 - Bang in a quote: YAML::Syck does not modify the input string ok 1354 - Bang in a quote: YAML::Syck parses correctly ok 1355 - Bang in a quote: YAML::XS saves without error ok 1356 - Bang in a quote: YAML::XS serializes correctly ok 1357 - Bang in a quote: YAML::XS round-trips without error ok 1358 - Bang in a quote: YAML::XS round-trips correctly ok 1359 - Bang in a quote: YAML::XS loads without error ok 1360 - Bang in a quote: YAML::XS does not modify the input string ok 1361 - Bang in a quote: YAML::XS parses correctly ok 1362 - Bang in a quote: YAML::Perl saves without error ok 1363 - Bang in a quote: YAML::Perl serializes correctly ok 1364 - Bang in a quote: YAML::Perl round-trips without error ok 1365 - Bang in a quote: YAML::Perl round-trips correctly ok 1366 - Bang in a quote: YAML::Perl loads without error ok 1367 - Bang in a quote: YAML::Perl does not modify the input string ok 1368 - Bang in a quote: YAML::Perl parses correctly ok 1369 - Bang in a quote: CPAN::Meta::YAML parses without error ok 1370 - Bang in a quote: CPAN::Meta::YAML does not modify the input string ok 1371 - The object isa CPAN::Meta::YAML ok 1372 - Bang in a quote: CPAN::Meta::YAML parses correctly ok 1373 - Bang in a quote: CPAN::Meta::YAML serializes without error ok 1374 - Bang in a quote: CPAN::Meta::YAML serializes correctly ok 1375 - Bang in a quote: CPAN::Meta::YAML round-trips without error ok 1376 - The object isa CPAN::Meta::YAML ok 1377 - Bang in a quote: CPAN::Meta::YAML round-trips correctly ok 1378 # skip Shortcutting perfect serialization tests ok 1379 - Ampersand in a quote: YAML.pm saves without error ok 1380 - Ampersand in a quote: YAML.pm serializes correctly ok 1381 - Ampersand in a quote: YAML.pm round-trips without error ok 1382 - Ampersand in a quote: YAML.pm round-trips correctly ok 1383 - Ampersand in a quote: YAML.pm loads without error ok 1384 - Ampersand in a quote: YAML.pm does not modify the input string ok 1385 - Ampersand in a quote: YAML.pm parses correctly ok 1386 - Ampersand in a quote: YAML::Syck saves without error ok 1387 - Ampersand in a quote: YAML::Syck serializes correctly ok 1388 - Ampersand in a quote: YAML::Syck round-trips without error ok 1389 - Ampersand in a quote: YAML::Syck round-trips correctly ok 1390 - Ampersand in a quote: YAML::Syck loads without error ok 1391 - Ampersand in a quote: YAML::Syck does not modify the input string ok 1392 - Ampersand in a quote: YAML::Syck parses correctly ok 1393 - Ampersand in a quote: YAML::XS saves without error ok 1394 - Ampersand in a quote: YAML::XS serializes correctly ok 1395 - Ampersand in a quote: YAML::XS round-trips without error ok 1396 - Ampersand in a quote: YAML::XS round-trips correctly ok 1397 - Ampersand in a quote: YAML::XS loads without error ok 1398 - Ampersand in a quote: YAML::XS does not modify the input string ok 1399 - Ampersand in a quote: YAML::XS parses correctly ok 1400 - Ampersand in a quote: YAML::Perl saves without error ok 1401 - Ampersand in a quote: YAML::Perl serializes correctly ok 1402 - Ampersand in a quote: YAML::Perl round-trips without error ok 1403 - Ampersand in a quote: YAML::Perl round-trips correctly ok 1404 - Ampersand in a quote: YAML::Perl loads without error ok 1405 - Ampersand in a quote: YAML::Perl does not modify the input string ok 1406 - Ampersand in a quote: YAML::Perl parses correctly ok 1407 - Ampersand in a quote: CPAN::Meta::YAML parses without error ok 1408 - Ampersand in a quote: CPAN::Meta::YAML does not modify the input string ok 1409 - The object isa CPAN::Meta::YAML ok 1410 - Ampersand in a quote: CPAN::Meta::YAML parses correctly ok 1411 - Ampersand in a quote: CPAN::Meta::YAML serializes without error ok 1412 - Ampersand in a quote: CPAN::Meta::YAML serializes correctly ok 1413 - Ampersand in a quote: CPAN::Meta::YAML round-trips without error ok 1414 - The object isa CPAN::Meta::YAML ok 1415 - Ampersand in a quote: CPAN::Meta::YAML round-trips correctly ok 1416 # skip Shortcutting perfect serialization tests ok 1417 - Idiomatic trivial boolean string is escaped ok 1418 ok t/04_scalar.t ...... 1..18 ok 1 - one: Parsed correctly ok 2 - one: List context matches ok 3 - two: Parsed correctly ok 4 - two: List context matches ok 5 - one: Parsed correctly ok 6 - one: Scalar context matches ok 7 - two: Parsed correctly ok 8 - two: Scalar context matches ok 9 - Found t\data\one.yml ok 10 - Found t\data\two.yml ok 11 - one: Parsed correctly ok 12 - one: List context matches ok 13 - two: Parsed correctly ok 14 - two: List context matches ok 15 - one: Parsed correctly ok 16 - one: Scalar context matches ok 17 - two: Parsed correctly ok 18 - two: Scalar context matches ok t/05_export.t ...... 1..6 ok 1 - Load is exported ok 2 - Dump is exported ok 3 - Load is exported ok 4 - Dump is exported ok 5 - Load is CPAN::Meta::YAML ok 6 - Dump is CPAN::Meta::YAML ok t/11_meta_yml.t .... 1..316 ok 1 - CPAN::Meta::YAML: YAML.pm saves without error ok 2 - CPAN::Meta::YAML: YAML.pm serializes correctly ok 3 - CPAN::Meta::YAML: YAML.pm round-trips without error ok 4 - CPAN::Meta::YAML: YAML.pm round-trips correctly ok 5 - CPAN::Meta::YAML: YAML.pm loads without error ok 6 - CPAN::Meta::YAML: YAML.pm does not modify the input string ok 7 - CPAN::Meta::YAML: YAML.pm parses correctly ok 8 - CPAN::Meta::YAML: YAML::Syck saves without error ok 9 - CPAN::Meta::YAML: YAML::Syck serializes correctly ok 10 - CPAN::Meta::YAML: YAML::Syck round-trips without error ok 11 - CPAN::Meta::YAML: YAML::Syck round-trips correctly ok 12 - CPAN::Meta::YAML: YAML::Syck loads without error ok 13 - CPAN::Meta::YAML: YAML::Syck does not modify the input string ok 14 - CPAN::Meta::YAML: YAML::Syck parses correctly ok 15 - CPAN::Meta::YAML: YAML::XS saves without error ok 16 - CPAN::Meta::YAML: YAML::XS serializes correctly ok 17 - CPAN::Meta::YAML: YAML::XS round-trips without error ok 18 - CPAN::Meta::YAML: YAML::XS round-trips correctly ok 19 - CPAN::Meta::YAML: YAML::XS loads without error ok 20 - CPAN::Meta::YAML: YAML::XS does not modify the input string ok 21 - CPAN::Meta::YAML: YAML::XS parses correctly ok 22 - CPAN::Meta::YAML: YAML::Perl saves without error ok 23 - CPAN::Meta::YAML: YAML::Perl serializes correctly ok 24 - CPAN::Meta::YAML: YAML::Perl round-trips without error ok 25 - CPAN::Meta::YAML: YAML::Perl round-trips correctly ok 26 - CPAN::Meta::YAML: YAML::Perl loads without error ok 27 - CPAN::Meta::YAML: YAML::Perl does not modify the input string ok 28 - CPAN::Meta::YAML: YAML::Perl parses correctly ok 29 - CPAN::Meta::YAML: CPAN::Meta::YAML parses without error ok 30 - CPAN::Meta::YAML: CPAN::Meta::YAML does not modify the input string ok 31 - The object isa CPAN::Meta::YAML ok 32 - CPAN::Meta::YAML: CPAN::Meta::YAML parses correctly ok 33 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes without error ok 34 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes correctly ok 35 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips without error ok 36 - The object isa CPAN::Meta::YAML ok 37 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips correctly ok 38 # skip Shortcutting perfect serialization tests ok 39 - CPAN::Meta::YAML: YAML.pm saves without error ok 40 - CPAN::Meta::YAML: YAML.pm serializes correctly ok 41 - CPAN::Meta::YAML: YAML.pm round-trips without error ok 42 - CPAN::Meta::YAML: YAML.pm round-trips correctly ok 43 - CPAN::Meta::YAML: YAML.pm loads without error ok 44 - CPAN::Meta::YAML: YAML.pm does not modify the input string ok 45 - CPAN::Meta::YAML: YAML.pm parses correctly ok 46 - CPAN::Meta::YAML: YAML::Syck saves without error ok 47 - CPAN::Meta::YAML: YAML::Syck serializes correctly ok 48 - CPAN::Meta::YAML: YAML::Syck round-trips without error ok 49 - CPAN::Meta::YAML: YAML::Syck round-trips correctly ok 50 - CPAN::Meta::YAML: YAML::Syck loads without error ok 51 - CPAN::Meta::YAML: YAML::Syck does not modify the input string ok 52 - CPAN::Meta::YAML: YAML::Syck parses correctly ok 53 - CPAN::Meta::YAML: YAML::XS saves without error ok 54 - CPAN::Meta::YAML: YAML::XS serializes correctly ok 55 - CPAN::Meta::YAML: YAML::XS round-trips without error ok 56 - CPAN::Meta::YAML: YAML::XS round-trips correctly ok 57 - CPAN::Meta::YAML: YAML::XS loads without error ok 58 - CPAN::Meta::YAML: YAML::XS does not modify the input string ok 59 - CPAN::Meta::YAML: YAML::XS parses correctly ok 60 - CPAN::Meta::YAML: YAML::Perl saves without error ok 61 - CPAN::Meta::YAML: YAML::Perl serializes correctly ok 62 - CPAN::Meta::YAML: YAML::Perl round-trips without error ok 63 - CPAN::Meta::YAML: YAML::Perl round-trips correctly ok 64 - CPAN::Meta::YAML: YAML::Perl loads without error ok 65 - CPAN::Meta::YAML: YAML::Perl does not modify the input string ok 66 - CPAN::Meta::YAML: YAML::Perl parses correctly ok 67 - CPAN::Meta::YAML: CPAN::Meta::YAML parses without error ok 68 - CPAN::Meta::YAML: CPAN::Meta::YAML does not modify the input string ok 69 - The object isa CPAN::Meta::YAML ok 70 - CPAN::Meta::YAML: CPAN::Meta::YAML parses correctly ok 71 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes without error ok 72 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes correctly ok 73 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips without error ok 74 - The object isa CPAN::Meta::YAML ok 75 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips correctly ok 76 # skip Shortcutting perfect serialization tests ok 77 - Games-Nintendo-Wii-Mii: YAML.pm saves without error ok 78 - Games-Nintendo-Wii-Mii: YAML.pm serializes correctly ok 79 - Games-Nintendo-Wii-Mii: YAML.pm round-trips without error ok 80 - Games-Nintendo-Wii-Mii: YAML.pm round-trips correctly ok 81 - Games-Nintendo-Wii-Mii: YAML.pm loads without error ok 82 - Games-Nintendo-Wii-Mii: YAML.pm does not modify the input string ok 83 - Games-Nintendo-Wii-Mii: YAML.pm parses correctly ok 84 - Games-Nintendo-Wii-Mii: YAML::Syck saves without error ok 85 - Games-Nintendo-Wii-Mii: YAML::Syck serializes correctly ok 86 - Games-Nintendo-Wii-Mii: YAML::Syck round-trips without error ok 87 - Games-Nintendo-Wii-Mii: YAML::Syck round-trips correctly ok 88 - Games-Nintendo-Wii-Mii: YAML::Syck loads without error ok 89 - Games-Nintendo-Wii-Mii: YAML::Syck does not modify the input string ok 90 - Games-Nintendo-Wii-Mii: YAML::Syck parses correctly ok 91 - Games-Nintendo-Wii-Mii: YAML::XS saves without error ok 92 - Games-Nintendo-Wii-Mii: YAML::XS serializes correctly ok 93 - Games-Nintendo-Wii-Mii: YAML::XS round-trips without error ok 94 - Games-Nintendo-Wii-Mii: YAML::XS round-trips correctly ok 95 - Games-Nintendo-Wii-Mii: YAML::XS loads without error ok 96 - Games-Nintendo-Wii-Mii: YAML::XS does not modify the input string ok 97 - Games-Nintendo-Wii-Mii: YAML::XS parses correctly ok 98 - Games-Nintendo-Wii-Mii: YAML::Perl saves without error ok 99 - Games-Nintendo-Wii-Mii: YAML::Perl serializes correctly ok 100 - Games-Nintendo-Wii-Mii: YAML::Perl round-trips without error ok 101 - Games-Nintendo-Wii-Mii: YAML::Perl round-trips correctly ok 102 - Games-Nintendo-Wii-Mii: YAML::Perl loads without error ok 103 - Games-Nintendo-Wii-Mii: YAML::Perl does not modify the input string ok 104 - Games-Nintendo-Wii-Mii: YAML::Perl parses correctly ok 105 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML parses without error ok 106 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML does not modify the input string ok 107 - The object isa CPAN::Meta::YAML ok 108 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML parses correctly ok 109 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML serializes without error ok 110 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML serializes correctly ok 111 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML round-trips without error ok 112 - The object isa CPAN::Meta::YAML ok 113 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML round-trips correctly ok 114 # skip Shortcutting perfect serialization tests ok 115 - Acme-Time-Baby: YAML.pm saves without error ok 116 - Acme-Time-Baby: YAML.pm serializes correctly ok 117 - Acme-Time-Baby: YAML.pm round-trips without error ok 118 - Acme-Time-Baby: YAML.pm round-trips correctly ok 119 - Acme-Time-Baby: YAML.pm loads without error ok 120 - Acme-Time-Baby: YAML.pm does not modify the input string ok 121 - Acme-Time-Baby: YAML.pm parses correctly ok 122 - Acme-Time-Baby: YAML::Syck saves without error ok 123 - Acme-Time-Baby: YAML::Syck serializes correctly ok 124 - Acme-Time-Baby: YAML::Syck round-trips without error ok 125 - Acme-Time-Baby: YAML::Syck round-trips correctly ok 126 - Acme-Time-Baby: YAML::Syck loads without error ok 127 - Acme-Time-Baby: YAML::Syck does not modify the input string ok 128 - Acme-Time-Baby: YAML::Syck parses correctly ok 129 - Acme-Time-Baby: YAML::XS saves without error ok 130 - Acme-Time-Baby: YAML::XS serializes correctly ok 131 - Acme-Time-Baby: YAML::XS round-trips without error ok 132 - Acme-Time-Baby: YAML::XS round-trips correctly ok 133 - Acme-Time-Baby: YAML::XS loads without error ok 134 - Acme-Time-Baby: YAML::XS does not modify the input string ok 135 - Acme-Time-Baby: YAML::XS parses correctly ok 136 # skip Skipping YAML::Perl for known-broken feature ok 137 # skip Skipping YAML::Perl for known-broken feature ok 138 # skip Skipping YAML::Perl for known-broken feature ok 139 # skip Skipping YAML::Perl for known-broken feature ok 140 # skip Skipping YAML::Perl for known-broken feature ok 141 # skip Skipping YAML::Perl for known-broken feature ok 142 # skip Skipping YAML::Perl for known-broken feature ok 143 - Acme-Time-Baby: CPAN::Meta::YAML parses without error ok 144 - Acme-Time-Baby: CPAN::Meta::YAML does not modify the input string ok 145 - The object isa CPAN::Meta::YAML ok 146 - Acme-Time-Baby: CPAN::Meta::YAML parses correctly ok 147 - Acme-Time-Baby: CPAN::Meta::YAML serializes without error ok 148 - Acme-Time-Baby: CPAN::Meta::YAML serializes correctly ok 149 - Acme-Time-Baby: CPAN::Meta::YAML round-trips without error ok 150 - The object isa CPAN::Meta::YAML ok 151 - Acme-Time-Baby: CPAN::Meta::YAML round-trips correctly ok 152 # skip Shortcutting perfect serialization tests ok 153 - Data-Swap: YAML.pm saves without error ok 154 - Data-Swap: YAML.pm serializes correctly ok 155 - Data-Swap: YAML.pm round-trips without error ok 156 - Data-Swap: YAML.pm round-trips correctly ok 157 - Data-Swap: YAML.pm loads without error ok 158 - Data-Swap: YAML.pm does not modify the input string ok 159 - Data-Swap: YAML.pm parses correctly ok 160 # skip Skipping YAML::Syck for known-broken feature ok 161 # skip Skipping YAML::Syck for known-broken feature ok 162 # skip Skipping YAML::Syck for known-broken feature ok 163 # skip Skipping YAML::Syck for known-broken feature ok 164 # skip Skipping YAML::Syck for known-broken feature ok 165 # skip Skipping YAML::Syck for known-broken feature ok 166 # skip Skipping YAML::Syck for known-broken feature ok 167 - Data-Swap: YAML::XS saves without error ok 168 - Data-Swap: YAML::XS serializes correctly ok 169 - Data-Swap: YAML::XS round-trips without error ok 170 - Data-Swap: YAML::XS round-trips correctly ok 171 - Data-Swap: YAML::XS loads without error ok 172 - Data-Swap: YAML::XS does not modify the input string ok 173 - Data-Swap: YAML::XS parses correctly ok 174 - Data-Swap: YAML::Perl saves without error ok 175 - Data-Swap: YAML::Perl serializes correctly ok 176 - Data-Swap: YAML::Perl round-trips without error ok 177 - Data-Swap: YAML::Perl round-trips correctly ok 178 - Data-Swap: YAML::Perl loads without error ok 179 - Data-Swap: YAML::Perl does not modify the input string ok 180 - Data-Swap: YAML::Perl parses correctly ok 181 - Data-Swap: CPAN::Meta::YAML parses without error ok 182 - Data-Swap: CPAN::Meta::YAML does not modify the input string ok 183 - The object isa CPAN::Meta::YAML ok 184 - Data-Swap: CPAN::Meta::YAML parses correctly ok 185 - Data-Swap: CPAN::Meta::YAML serializes without error ok 186 - Data-Swap: CPAN::Meta::YAML serializes correctly ok 187 - Data-Swap: CPAN::Meta::YAML round-trips without error ok 188 - The object isa CPAN::Meta::YAML ok 189 - Data-Swap: CPAN::Meta::YAML round-trips correctly ok 190 # skip Shortcutting perfect serialization tests ok 191 - Found Template-Provider-Unicode-Japanese.yml ok 192 - Can read Template-Provider-Unicode-Japanese.yml ok 193 - Loaded Template-Provider-Unicode-Japanese.yml ok 194 - Content of Template-Provider-Unicode-Japanese.yml larger than 100 bytes ok 195 - Template-Provider-Unicode-Japanese: YAML.pm saves without error ok 196 - Template-Provider-Unicode-Japanese: YAML.pm serializes correctly ok 197 - Template-Provider-Unicode-Japanese: YAML.pm round-trips without error ok 198 - Template-Provider-Unicode-Japanese: YAML.pm round-trips correctly ok 199 - Template-Provider-Unicode-Japanese: YAML.pm loads without error ok 200 - Template-Provider-Unicode-Japanese: YAML.pm does not modify the input string ok 201 - Template-Provider-Unicode-Japanese: YAML.pm parses correctly ok 202 - Template-Provider-Unicode-Japanese: YAML::Syck saves without error ok 203 - Template-Provider-Unicode-Japanese: YAML::Syck serializes correctly ok 204 - Template-Provider-Unicode-Japanese: YAML::Syck round-trips without error ok 205 - Template-Provider-Unicode-Japanese: YAML::Syck round-trips correctly ok 206 - Template-Provider-Unicode-Japanese: YAML::Syck loads without error ok 207 - Template-Provider-Unicode-Japanese: YAML::Syck does not modify the input string ok 208 - Template-Provider-Unicode-Japanese: YAML::Syck parses correctly ok 209 - Template-Provider-Unicode-Japanese: YAML::XS saves without error ok 210 - Template-Provider-Unicode-Japanese: YAML::XS serializes correctly ok 211 - Template-Provider-Unicode-Japanese: YAML::XS round-trips without error ok 212 - Template-Provider-Unicode-Japanese: YAML::XS round-trips correctly ok 213 - Template-Provider-Unicode-Japanese: YAML::XS loads without error ok 214 - Template-Provider-Unicode-Japanese: YAML::XS does not modify the input string ok 215 - Template-Provider-Unicode-Japanese: YAML::XS parses correctly ok 216 # skip Skipping YAML::Perl for known-broken feature ok 217 # skip Skipping YAML::Perl for known-broken feature ok 218 # skip Skipping YAML::Perl for known-broken feature ok 219 # skip Skipping YAML::Perl for known-broken feature ok 220 # skip Skipping YAML::Perl for known-broken feature ok 221 # skip Skipping YAML::Perl for known-broken feature ok 222 # skip Skipping YAML::Perl for known-broken feature ok 223 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML parses without error ok 224 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML does not modify the input string ok 225 - The object isa CPAN::Meta::YAML ok 226 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML parses correctly ok 227 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML serializes without error ok 228 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML serializes correctly ok 229 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML round-trips without error ok 230 - The object isa CPAN::Meta::YAML ok 231 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML round-trips correctly ok 232 # skip Shortcutting perfect serialization tests ok 233 - Found HTML-WebDAO.yml ok 234 - Can read HTML-WebDAO.yml ok 235 - Loaded HTML-WebDAO.yml ok 236 - Content of HTML-WebDAO.yml larger than 100 bytes ok 237 - HTML-WebDAO: YAML.pm saves without error ok 238 - HTML-WebDAO: YAML.pm serializes correctly ok 239 - HTML-WebDAO: YAML.pm round-trips without error ok 240 - HTML-WebDAO: YAML.pm round-trips correctly ok 241 - HTML-WebDAO: YAML.pm loads without error ok 242 - HTML-WebDAO: YAML.pm does not modify the input string ok 243 - HTML-WebDAO: YAML.pm parses correctly ok 244 # skip Skipping YAML::Syck for known-broken feature ok 245 # skip Skipping YAML::Syck for known-broken feature ok 246 # skip Skipping YAML::Syck for known-broken feature ok 247 # skip Skipping YAML::Syck for known-broken feature ok 248 # skip Skipping YAML::Syck for known-broken feature ok 249 # skip Skipping YAML::Syck for known-broken feature ok 250 # skip Skipping YAML::Syck for known-broken feature ok 251 - HTML-WebDAO: YAML::XS saves without error ok 252 - HTML-WebDAO: YAML::XS serializes correctly ok 253 - HTML-WebDAO: YAML::XS round-trips without error ok 254 - HTML-WebDAO: YAML::XS round-trips correctly ok 255 - HTML-WebDAO: YAML::XS loads without error ok 256 - HTML-WebDAO: YAML::XS does not modify the input string ok 257 - HTML-WebDAO: YAML::XS parses correctly ok 258 - HTML-WebDAO: YAML::Perl saves without error ok 259 - HTML-WebDAO: YAML::Perl serializes correctly ok 260 - HTML-WebDAO: YAML::Perl round-trips without error ok 261 - HTML-WebDAO: YAML::Perl round-trips correctly ok 262 - HTML-WebDAO: YAML::Perl loads without error ok 263 - HTML-WebDAO: YAML::Perl does not modify the input string ok 264 - HTML-WebDAO: YAML::Perl parses correctly ok 265 - HTML-WebDAO: CPAN::Meta::YAML parses without error ok 266 - HTML-WebDAO: CPAN::Meta::YAML does not modify the input string ok 267 - The object isa CPAN::Meta::YAML ok 268 - HTML-WebDAO: CPAN::Meta::YAML parses correctly ok 269 - HTML-WebDAO: CPAN::Meta::YAML serializes without error ok 270 - HTML-WebDAO: CPAN::Meta::YAML serializes correctly ok 271 - HTML-WebDAO: CPAN::Meta::YAML round-trips without error ok 272 - The object isa CPAN::Meta::YAML ok 273 - HTML-WebDAO: CPAN::Meta::YAML round-trips correctly ok 274 # skip Shortcutting perfect serialization tests ok 275 - Found Spreadsheet-Read.yml ok 276 - Can read Spreadsheet-Read.yml ok 277 - Loaded Spreadsheet-Read.yml ok 278 - Content of Spreadsheet-Read.yml larger than 100 bytes ok 279 # skip Skipping YAML.pm for known-broken feature ok 280 # skip Skipping YAML.pm for known-broken feature ok 281 # skip Skipping YAML.pm for known-broken feature ok 282 # skip Skipping YAML.pm for known-broken feature ok 283 # skip Skipping YAML.pm for known-broken feature ok 284 # skip Skipping YAML.pm for known-broken feature ok 285 # skip Skipping YAML.pm for known-broken feature ok 286 - Spreadsheet-Read: YAML::Syck saves without error ok 287 - Spreadsheet-Read: YAML::Syck serializes correctly ok 288 - Spreadsheet-Read: YAML::Syck round-trips without error ok 289 - Spreadsheet-Read: YAML::Syck round-trips correctly ok 290 - Spreadsheet-Read: YAML::Syck loads without error ok 291 - Spreadsheet-Read: YAML::Syck does not modify the input string ok 292 - Spreadsheet-Read: YAML::Syck parses correctly ok 293 - Spreadsheet-Read: YAML::XS saves without error ok 294 - Spreadsheet-Read: YAML::XS serializes correctly ok 295 - Spreadsheet-Read: YAML::XS round-trips without error ok 296 - Spreadsheet-Read: YAML::XS round-trips correctly ok 297 - Spreadsheet-Read: YAML::XS loads without error ok 298 - Spreadsheet-Read: YAML::XS does not modify the input string ok 299 - Spreadsheet-Read: YAML::XS parses correctly ok 300 # skip Skipping YAML::Perl for known-broken feature ok 301 # skip Skipping YAML::Perl for known-broken feature ok 302 # skip Skipping YAML::Perl for known-broken feature ok 303 # skip Skipping YAML::Perl for known-broken feature ok 304 # skip Skipping YAML::Perl for known-broken feature ok 305 # skip Skipping YAML::Perl for known-broken feature ok 306 # skip Skipping YAML::Perl for known-broken feature ok 307 - Spreadsheet-Read: CPAN::Meta::YAML parses without error ok 308 - Spreadsheet-Read: CPAN::Meta::YAML does not modify the input string ok 309 - The object isa CPAN::Meta::YAML ok 310 - Spreadsheet-Read: CPAN::Meta::YAML parses correctly ok 311 - Spreadsheet-Read: CPAN::Meta::YAML serializes without error ok 312 - Spreadsheet-Read: CPAN::Meta::YAML serializes correctly ok 313 - Spreadsheet-Read: CPAN::Meta::YAML round-trips without error ok 314 - The object isa CPAN::Meta::YAML ok 315 - Spreadsheet-Read: CPAN::Meta::YAML round-trips correctly ok 316 # skip Shortcutting perfect serialization tests ok t/12_plagger.t ..... 1..76 ok 1 - Plagger: YAML.pm saves without error ok 2 - Plagger: YAML.pm serializes correctly ok 3 - Plagger: YAML.pm round-trips without error ok 4 - Plagger: YAML.pm round-trips correctly ok 5 - Plagger: YAML.pm loads without error ok 6 - Plagger: YAML.pm does not modify the input string ok 7 - Plagger: YAML.pm parses correctly ok 8 - Plagger: YAML::Syck saves without error ok 9 - Plagger: YAML::Syck serializes correctly ok 10 - Plagger: YAML::Syck round-trips without error ok 11 - Plagger: YAML::Syck round-trips correctly ok 12 - Plagger: YAML::Syck loads without error ok 13 - Plagger: YAML::Syck does not modify the input string ok 14 - Plagger: YAML::Syck parses correctly ok 15 - Plagger: YAML::XS saves without error ok 16 - Plagger: YAML::XS serializes correctly ok 17 - Plagger: YAML::XS round-trips without error ok 18 - Plagger: YAML::XS round-trips correctly ok 19 - Plagger: YAML::XS loads without error ok 20 - Plagger: YAML::XS does not modify the input string ok 21 - Plagger: YAML::XS parses correctly ok 22 - Plagger: YAML::Perl saves without error ok 23 - Plagger: YAML::Perl serializes correctly ok 24 - Plagger: YAML::Perl round-trips without error ok 25 - Plagger: YAML::Perl round-trips correctly ok 26 - Plagger: YAML::Perl loads without error ok 27 - Plagger: YAML::Perl does not modify the input string ok 28 - Plagger: YAML::Perl parses correctly ok 29 - Plagger: CPAN::Meta::YAML parses without error ok 30 - Plagger: CPAN::Meta::YAML does not modify the input string ok 31 - The object isa CPAN::Meta::YAML ok 32 - Plagger: CPAN::Meta::YAML parses correctly ok 33 - Plagger: CPAN::Meta::YAML serializes without error ok 34 - Plagger: CPAN::Meta::YAML serializes correctly ok 35 - Plagger: CPAN::Meta::YAML round-trips without error ok 36 - The object isa CPAN::Meta::YAML ok 37 - Plagger: CPAN::Meta::YAML round-trips correctly ok 38 # skip Shortcutting perfect serialization tests ok 39 - plagger2: YAML.pm saves without error ok 40 - plagger2: YAML.pm serializes correctly ok 41 - plagger2: YAML.pm round-trips without error ok 42 - plagger2: YAML.pm round-trips correctly ok 43 - plagger2: YAML.pm loads without error ok 44 - plagger2: YAML.pm does not modify the input string ok 45 - plagger2: YAML.pm parses correctly ok 46 - plagger2: YAML::Syck saves without error ok 47 - plagger2: YAML::Syck serializes correctly ok 48 - plagger2: YAML::Syck round-trips without error ok 49 - plagger2: YAML::Syck round-trips correctly ok 50 - plagger2: YAML::Syck loads without error ok 51 - plagger2: YAML::Syck does not modify the input string ok 52 - plagger2: YAML::Syck parses correctly ok 53 - plagger2: YAML::XS saves without error ok 54 - plagger2: YAML::XS serializes correctly ok 55 - plagger2: YAML::XS round-trips without error ok 56 - plagger2: YAML::XS round-trips correctly ok 57 - plagger2: YAML::XS loads without error ok 58 - plagger2: YAML::XS does not modify the input string ok 59 - plagger2: YAML::XS parses correctly ok 60 - plagger2: YAML::Perl saves without error ok 61 - plagger2: YAML::Perl serializes correctly ok 62 - plagger2: YAML::Perl round-trips without error ok 63 - plagger2: YAML::Perl round-trips correctly ok 64 - plagger2: YAML::Perl loads without error ok 65 - plagger2: YAML::Perl does not modify the input string ok 66 - plagger2: YAML::Perl parses correctly ok 67 - plagger2: CPAN::Meta::YAML parses without error ok 68 - plagger2: CPAN::Meta::YAML does not modify the input string ok 69 - The object isa CPAN::Meta::YAML ok 70 - plagger2: CPAN::Meta::YAML parses correctly ok 71 - plagger2: CPAN::Meta::YAML serializes without error ok 72 - plagger2: CPAN::Meta::YAML serializes correctly ok 73 - plagger2: CPAN::Meta::YAML round-trips without error ok 74 - The object isa CPAN::Meta::YAML ok 75 - plagger2: CPAN::Meta::YAML round-trips correctly ok 76 # skip Shortcutting perfect serialization tests ok t/13_perl_smith.t .. 1..42 ok 1 - Found yanilla.yml ok 2 - Can read yanilla.yml ok 3 - Loaded yanilla.yml ok 4 - Content of yanilla.yml larger than 1000 bytes ok 5 - vanilla.yml: YAML.pm saves without error ok 6 - vanilla.yml: YAML.pm serializes correctly ok 7 - vanilla.yml: YAML.pm round-trips without error ok 8 - vanilla.yml: YAML.pm round-trips correctly ok 9 - vanilla.yml: YAML.pm loads without error ok 10 - vanilla.yml: YAML.pm does not modify the input string ok 11 - vanilla.yml: YAML.pm parses correctly ok 12 # skip Skipping YAML::Syck for known-broken feature ok 13 # skip Skipping YAML::Syck for known-broken feature ok 14 # skip Skipping YAML::Syck for known-broken feature ok 15 # skip Skipping YAML::Syck for known-broken feature ok 16 # skip Skipping YAML::Syck for known-broken feature ok 17 # skip Skipping YAML::Syck for known-broken feature ok 18 # skip Skipping YAML::Syck for known-broken feature ok 19 - vanilla.yml: YAML::XS saves without error ok 20 - vanilla.yml: YAML::XS serializes correctly ok 21 - vanilla.yml: YAML::XS round-trips without error ok 22 - vanilla.yml: YAML::XS round-trips correctly ok 23 - vanilla.yml: YAML::XS loads without error ok 24 - vanilla.yml: YAML::XS does not modify the input string ok 25 - vanilla.yml: YAML::XS parses correctly ok 26 # skip Skipping YAML::Perl for known-broken feature ok 27 # skip Skipping YAML::Perl for known-broken feature ok 28 # skip Skipping YAML::Perl for known-broken feature ok 29 # skip Skipping YAML::Perl for known-broken feature ok 30 # skip Skipping YAML::Perl for known-broken feature ok 31 # skip Skipping YAML::Perl for known-broken feature ok 32 # skip Skipping YAML::Perl for known-broken feature ok 33 - vanilla.yml: CPAN::Meta::YAML parses without error ok 34 - vanilla.yml: CPAN::Meta::YAML does not modify the input string ok 35 - The object isa CPAN::Meta::YAML ok 36 - vanilla.yml: CPAN::Meta::YAML parses correctly ok 37 - vanilla.yml: CPAN::Meta::YAML serializes without error ok 38 - vanilla.yml: CPAN::Meta::YAML serializes correctly ok 39 - vanilla.yml: CPAN::Meta::YAML round-trips without error ok 40 - The object isa CPAN::Meta::YAML ok 41 - vanilla.yml: CPAN::Meta::YAML round-trips correctly ok 42 # skip Shortcutting perfect serialization tests ok t/14_yaml_org.t .... 1..42 ok 1 - Found sample.yml ok 2 - Can read sample.yml ok 3 - Loaded sample.yml ok 4 - Content of sample.yml larger than 500 bytes ok 5 - sample.yml: YAML.pm saves without error ok 6 - sample.yml: YAML.pm serializes correctly ok 7 - sample.yml: YAML.pm round-trips without error ok 8 - sample.yml: YAML.pm round-trips correctly ok 9 - sample.yml: YAML.pm loads without error ok 10 - sample.yml: YAML.pm does not modify the input string ok 11 - sample.yml: YAML.pm parses correctly ok 12 - sample.yml: YAML::Syck saves without error ok 13 - sample.yml: YAML::Syck serializes correctly ok 14 - sample.yml: YAML::Syck round-trips without error ok 15 - sample.yml: YAML::Syck round-trips correctly ok 16 - sample.yml: YAML::Syck loads without error ok 17 - sample.yml: YAML::Syck does not modify the input string ok 18 - sample.yml: YAML::Syck parses correctly ok 19 - sample.yml: YAML::XS saves without error ok 20 - sample.yml: YAML::XS serializes correctly ok 21 - sample.yml: YAML::XS round-trips without error ok 22 - sample.yml: YAML::XS round-trips correctly ok 23 - sample.yml: YAML::XS loads without error ok 24 - sample.yml: YAML::XS does not modify the input string ok 25 - sample.yml: YAML::XS parses correctly ok 26 - sample.yml: YAML::Perl saves without error ok 27 - sample.yml: YAML::Perl serializes correctly ok 28 - sample.yml: YAML::Perl round-trips without error ok 29 - sample.yml: YAML::Perl round-trips correctly ok 30 - sample.yml: YAML::Perl loads without error ok 31 - sample.yml: YAML::Perl does not modify the input string ok 32 - sample.yml: YAML::Perl parses correctly ok 33 - sample.yml: CPAN::Meta::YAML parses without error ok 34 - sample.yml: CPAN::Meta::YAML does not modify the input string ok 35 - The object isa CPAN::Meta::YAML ok 36 - sample.yml: CPAN::Meta::YAML parses correctly ok 37 - sample.yml: CPAN::Meta::YAML serializes without error ok 38 - sample.yml: CPAN::Meta::YAML serializes correctly ok 39 - sample.yml: CPAN::Meta::YAML round-trips without error ok 40 - The object isa CPAN::Meta::YAML ok 41 - sample.yml: CPAN::Meta::YAML round-trips correctly ok 42 # skip Shortcutting perfect serialization tests ok t/15_multibyte.t ... 1..9 ok 1 - Found multibyte.yml ok 2 - Can read multibyte.yml ok 3 - Loaded multibyte.yml ok 4 - Content of multibyte.yml larger than 450 bytes ok 5 - multibyte: CPAN::Meta::YAML parses without error ok 6 - multibyte: CPAN::Meta::YAML does not modify the input string ok 7 - The object isa CPAN::Meta::YAML ok 8 - build_requires ok ok 9 - utf8 decoded ok t/16_nullrefs.t .... 1..38 ok 1 - Empty references: YAML.pm saves without error ok 2 - Empty references: YAML.pm serializes correctly ok 3 - Empty references: YAML.pm round-trips without error ok 4 - Empty references: YAML.pm round-trips correctly ok 5 - Empty references: YAML.pm loads without error ok 6 - Empty references: YAML.pm does not modify the input string ok 7 - Empty references: YAML.pm parses correctly ok 8 # skip Skipping YAML::Syck for unsupported feature ok 9 # skip Skipping YAML::Syck for unsupported feature ok 10 # skip Skipping YAML::Syck for unsupported feature ok 11 # skip Skipping YAML::Syck for unsupported feature ok 12 # skip Skipping YAML::Syck for unsupported feature ok 13 # skip Skipping YAML::Syck for unsupported feature ok 14 # skip Skipping YAML::Syck for unsupported feature ok 15 - Empty references: YAML::XS saves without error ok 16 - Empty references: YAML::XS serializes correctly ok 17 - Empty references: YAML::XS round-trips without error ok 18 - Empty references: YAML::XS round-trips correctly ok 19 - Empty references: YAML::XS loads without error ok 20 - Empty references: YAML::XS does not modify the input string ok 21 - Empty references: YAML::XS parses correctly ok 22 - Empty references: YAML::Perl saves without error ok 23 - Empty references: YAML::Perl serializes correctly ok 24 - Empty references: YAML::Perl round-trips without error ok 25 - Empty references: YAML::Perl round-trips correctly ok 26 - Empty references: YAML::Perl loads without error ok 27 - Empty references: YAML::Perl does not modify the input string ok 28 - Empty references: YAML::Perl parses correctly ok 29 - Empty references: CPAN::Meta::YAML parses without error ok 30 - Empty references: CPAN::Meta::YAML does not modify the input string ok 31 - The object isa CPAN::Meta::YAML ok 32 - Empty references: CPAN::Meta::YAML parses correctly ok 33 - Empty references: CPAN::Meta::YAML serializes without error ok 34 - Empty references: CPAN::Meta::YAML serializes correctly ok 35 - Empty references: CPAN::Meta::YAML round-trips without error ok 36 - The object isa CPAN::Meta::YAML ok 37 - Empty references: CPAN::Meta::YAML round-trips correctly ok 38 # skip Shortcutting perfect serialization tests ok t/17_toolbar.t ..... 1..42 ok 1 - Found toolbar.yml ok 2 - Can read toolbar.yml ok 3 - Loaded toolbar.yml ok 4 - Content of toolbar.yml larger than 100 bytes ok 5 - toolbar.yml: YAML.pm saves without error ok 6 - toolbar.yml: YAML.pm serializes correctly ok 7 - toolbar.yml: YAML.pm round-trips without error ok 8 - toolbar.yml: YAML.pm round-trips correctly ok 9 - toolbar.yml: YAML.pm loads without error ok 10 - toolbar.yml: YAML.pm does not modify the input string ok 11 - toolbar.yml: YAML.pm parses correctly ok 12 - toolbar.yml: YAML::Syck saves without error ok 13 - toolbar.yml: YAML::Syck serializes correctly ok 14 - toolbar.yml: YAML::Syck round-trips without error ok 15 - toolbar.yml: YAML::Syck round-trips correctly ok 16 - toolbar.yml: YAML::Syck loads without error ok 17 - toolbar.yml: YAML::Syck does not modify the input string ok 18 - toolbar.yml: YAML::Syck parses correctly ok 19 - toolbar.yml: YAML::XS saves without error ok 20 - toolbar.yml: YAML::XS serializes correctly ok 21 - toolbar.yml: YAML::XS round-trips without error ok 22 - toolbar.yml: YAML::XS round-trips correctly ok 23 - toolbar.yml: YAML::XS loads without error ok 24 - toolbar.yml: YAML::XS does not modify the input string ok 25 - toolbar.yml: YAML::XS parses correctly ok 26 # skip Skipping YAML::Perl for known-broken feature ok 27 # skip Skipping YAML::Perl for known-broken feature ok 28 # skip Skipping YAML::Perl for known-broken feature ok 29 # skip Skipping YAML::Perl for known-broken feature ok 30 # skip Skipping YAML::Perl for known-broken feature ok 31 # skip Skipping YAML::Perl for known-broken feature ok 32 # skip Skipping YAML::Perl for known-broken feature ok 33 - toolbar.yml: CPAN::Meta::YAML parses without error ok 34 - toolbar.yml: CPAN::Meta::YAML does not modify the input string ok 35 - The object isa CPAN::Meta::YAML ok 36 - toolbar.yml: CPAN::Meta::YAML parses correctly ok 37 - toolbar.yml: CPAN::Meta::YAML serializes without error ok 38 - toolbar.yml: CPAN::Meta::YAML serializes correctly ok 39 - toolbar.yml: CPAN::Meta::YAML round-trips without error ok 40 - The object isa CPAN::Meta::YAML ok 41 - toolbar.yml: CPAN::Meta::YAML round-trips correctly ok 42 # skip Shortcutting perfect serialization tests ok t/18_tap.t ......... 1..190 ok 1 - x-foo key: YAML.pm saves without error ok 2 - x-foo key: YAML.pm serializes correctly ok 3 - x-foo key: YAML.pm round-trips without error ok 4 - x-foo key: YAML.pm round-trips correctly ok 5 - x-foo key: YAML.pm loads without error ok 6 - x-foo key: YAML.pm does not modify the input string ok 7 - x-foo key: YAML.pm parses correctly ok 8 - x-foo key: YAML::Syck saves without error ok 9 - x-foo key: YAML::Syck serializes correctly ok 10 - x-foo key: YAML::Syck round-trips without error ok 11 - x-foo key: YAML::Syck round-trips correctly ok 12 - x-foo key: YAML::Syck loads without error ok 13 - x-foo key: YAML::Syck does not modify the input string ok 14 - x-foo key: YAML::Syck parses correctly ok 15 - x-foo key: YAML::XS saves without error ok 16 - x-foo key: YAML::XS serializes correctly ok 17 - x-foo key: YAML::XS round-trips without error ok 18 - x-foo key: YAML::XS round-trips correctly ok 19 - x-foo key: YAML::XS loads without error ok 20 - x-foo key: YAML::XS does not modify the input string ok 21 - x-foo key: YAML::XS parses correctly ok 22 - x-foo key: YAML::Perl saves without error ok 23 - x-foo key: YAML::Perl serializes correctly ok 24 - x-foo key: YAML::Perl round-trips without error ok 25 - x-foo key: YAML::Perl round-trips correctly ok 26 - x-foo key: YAML::Perl loads without error ok 27 - x-foo key: YAML::Perl does not modify the input string ok 28 - x-foo key: YAML::Perl parses correctly ok 29 - x-foo key: CPAN::Meta::YAML parses without error ok 30 - x-foo key: CPAN::Meta::YAML does not modify the input string ok 31 - The object isa CPAN::Meta::YAML ok 32 - x-foo key: CPAN::Meta::YAML parses correctly ok 33 - x-foo key: CPAN::Meta::YAML serializes without error ok 34 - x-foo key: CPAN::Meta::YAML serializes correctly ok 35 - x-foo key: CPAN::Meta::YAML round-trips without error ok 36 - The object isa CPAN::Meta::YAML ok 37 - x-foo key: CPAN::Meta::YAML round-trips correctly ok 38 # skip Shortcutting perfect serialization tests ok 39 # skip Skipping YAML.pm for known-broken feature ok 40 # skip Skipping YAML.pm for known-broken feature ok 41 # skip Skipping YAML.pm for known-broken feature ok 42 # skip Skipping YAML.pm for known-broken feature ok 43 # skip Skipping YAML.pm for known-broken feature ok 44 # skip Skipping YAML.pm for known-broken feature ok 45 # skip Skipping YAML.pm for known-broken feature ok 46 # skip Skipping YAML::Syck for known-broken feature ok 47 # skip Skipping YAML::Syck for known-broken feature ok 48 # skip Skipping YAML::Syck for known-broken feature ok 49 # skip Skipping YAML::Syck for known-broken feature ok 50 # skip Skipping YAML::Syck for known-broken feature ok 51 # skip Skipping YAML::Syck for known-broken feature ok 52 # skip Skipping YAML::Syck for known-broken feature ok 53 - document_end_hash: YAML::XS saves without error ok 54 - document_end_hash: YAML::XS serializes correctly ok 55 - document_end_hash: YAML::XS round-trips without error ok 56 - document_end_hash: YAML::XS round-trips correctly ok 57 - document_end_hash: YAML::XS loads without error ok 58 - document_end_hash: YAML::XS does not modify the input string ok 59 - document_end_hash: YAML::XS parses correctly ok 60 # skip Skipping YAML::Perl for known-broken feature ok 61 # skip Skipping YAML::Perl for known-broken feature ok 62 # skip Skipping YAML::Perl for known-broken feature ok 63 # skip Skipping YAML::Perl for known-broken feature ok 64 # skip Skipping YAML::Perl for known-broken feature ok 65 # skip Skipping YAML::Perl for known-broken feature ok 66 # skip Skipping YAML::Perl for known-broken feature ok 67 - document_end_hash: CPAN::Meta::YAML parses without error ok 68 - document_end_hash: CPAN::Meta::YAML does not modify the input string ok 69 - The object isa CPAN::Meta::YAML ok 70 - document_end_hash: CPAN::Meta::YAML parses correctly ok 71 - document_end_hash: CPAN::Meta::YAML serializes without error ok 72 - document_end_hash: CPAN::Meta::YAML serializes correctly ok 73 - document_end_hash: CPAN::Meta::YAML round-trips without error ok 74 - The object isa CPAN::Meta::YAML ok 75 - document_end_hash: CPAN::Meta::YAML round-trips correctly ok 76 # skip Shortcutting perfect serialization tests ok 77 # skip Skipping YAML.pm for known-broken feature ok 78 # skip Skipping YAML.pm for known-broken feature ok 79 # skip Skipping YAML.pm for known-broken feature ok 80 # skip Skipping YAML.pm for known-broken feature ok 81 # skip Skipping YAML.pm for known-broken feature ok 82 # skip Skipping YAML.pm for known-broken feature ok 83 # skip Skipping YAML.pm for known-broken feature ok 84 - document_end_array: YAML::Syck saves without error ok 85 - document_end_array: YAML::Syck serializes correctly ok 86 - document_end_array: YAML::Syck round-trips without error ok 87 - document_end_array: YAML::Syck round-trips correctly ok 88 - document_end_array: YAML::Syck loads without error ok 89 - document_end_array: YAML::Syck does not modify the input string ok 90 - document_end_array: YAML::Syck parses correctly ok 91 - document_end_array: YAML::XS saves without error ok 92 - document_end_array: YAML::XS serializes correctly ok 93 - document_end_array: YAML::XS round-trips without error ok 94 - document_end_array: YAML::XS round-trips correctly ok 95 - document_end_array: YAML::XS loads without error ok 96 - document_end_array: YAML::XS does not modify the input string ok 97 - document_end_array: YAML::XS parses correctly ok 98 # skip Skipping YAML::Perl for known-broken feature ok 99 # skip Skipping YAML::Perl for known-broken feature ok 100 # skip Skipping YAML::Perl for known-broken feature ok 101 # skip Skipping YAML::Perl for known-broken feature ok 102 # skip Skipping YAML::Perl for known-broken feature ok 103 # skip Skipping YAML::Perl for known-broken feature ok 104 # skip Skipping YAML::Perl for known-broken feature ok 105 - document_end_array: CPAN::Meta::YAML parses without error ok 106 - document_end_array: CPAN::Meta::YAML does not modify the input string ok 107 - The object isa CPAN::Meta::YAML ok 108 - document_end_array: CPAN::Meta::YAML parses correctly ok 109 - document_end_array: CPAN::Meta::YAML serializes without error ok 110 - document_end_array: CPAN::Meta::YAML serializes correctly ok 111 - document_end_array: CPAN::Meta::YAML round-trips without error ok 112 - The object isa CPAN::Meta::YAML ok 113 - document_end_array: CPAN::Meta::YAML round-trips correctly ok 114 # skip Shortcutting perfect serialization tests ok 115 # skip Skipping YAML.pm for known-broken feature ok 116 # skip Skipping YAML.pm for known-broken feature ok 117 # skip Skipping YAML.pm for known-broken feature ok 118 # skip Skipping YAML.pm for known-broken feature ok 119 # skip Skipping YAML.pm for known-broken feature ok 120 # skip Skipping YAML.pm for known-broken feature ok 121 # skip Skipping YAML.pm for known-broken feature ok 122 # skip Skipping YAML::Syck for unsupported feature ok 123 # skip Skipping YAML::Syck for unsupported feature ok 124 # skip Skipping YAML::Syck for unsupported feature ok 125 # skip Skipping YAML::Syck for unsupported feature ok 126 # skip Skipping YAML::Syck for unsupported feature ok 127 # skip Skipping YAML::Syck for unsupported feature ok 128 # skip Skipping YAML::Syck for unsupported feature ok 129 - multi_document_simple: YAML::XS saves without error ok 130 - multi_document_simple: YAML::XS serializes correctly ok 131 - multi_document_simple: YAML::XS round-trips without error ok 132 - multi_document_simple: YAML::XS round-trips correctly ok 133 - multi_document_simple: YAML::XS loads without error ok 134 - multi_document_simple: YAML::XS does not modify the input string ok 135 - multi_document_simple: YAML::XS parses correctly ok 136 # skip Skipping YAML::Perl for known-broken feature ok 137 # skip Skipping YAML::Perl for known-broken feature ok 138 # skip Skipping YAML::Perl for known-broken feature ok 139 # skip Skipping YAML::Perl for known-broken feature ok 140 # skip Skipping YAML::Perl for known-broken feature ok 141 # skip Skipping YAML::Perl for known-broken feature ok 142 # skip Skipping YAML::Perl for known-broken feature ok 143 - multi_document_simple: CPAN::Meta::YAML parses without error ok 144 - multi_document_simple: CPAN::Meta::YAML does not modify the input string ok 145 - The object isa CPAN::Meta::YAML ok 146 - multi_document_simple: CPAN::Meta::YAML parses correctly ok 147 - multi_document_simple: CPAN::Meta::YAML serializes without error ok 148 - multi_document_simple: CPAN::Meta::YAML serializes correctly ok 149 - multi_document_simple: CPAN::Meta::YAML round-trips without error ok 150 - The object isa CPAN::Meta::YAML ok 151 - multi_document_simple: CPAN::Meta::YAML round-trips correctly ok 152 # skip Shortcutting perfect serialization tests ok 153 # skip Skipping YAML.pm for known-broken feature ok 154 # skip Skipping YAML.pm for known-broken feature ok 155 # skip Skipping YAML.pm for known-broken feature ok 156 # skip Skipping YAML.pm for known-broken feature ok 157 # skip Skipping YAML.pm for known-broken feature ok 158 # skip Skipping YAML.pm for known-broken feature ok 159 # skip Skipping YAML.pm for known-broken feature ok 160 # skip Skipping YAML::Syck for unsupported feature ok 161 # skip Skipping YAML::Syck for unsupported feature ok 162 # skip Skipping YAML::Syck for unsupported feature ok 163 # skip Skipping YAML::Syck for unsupported feature ok 164 # skip Skipping YAML::Syck for unsupported feature ok 165 # skip Skipping YAML::Syck for unsupported feature ok 166 # skip Skipping YAML::Syck for unsupported feature ok 167 - multi_document_space: YAML::XS saves without error ok 168 - multi_document_space: YAML::XS serializes correctly ok 169 - multi_document_space: YAML::XS round-trips without error ok 170 - multi_document_space: YAML::XS round-trips correctly ok 171 - multi_document_space: YAML::XS loads without error ok 172 - multi_document_space: YAML::XS does not modify the input string ok 173 - multi_document_space: YAML::XS parses correctly ok 174 # skip Skipping YAML::Perl for known-broken feature ok 175 # skip Skipping YAML::Perl for known-broken feature ok 176 # skip Skipping YAML::Perl for known-broken feature ok 177 # skip Skipping YAML::Perl for known-broken feature ok 178 # skip Skipping YAML::Perl for known-broken feature ok 179 # skip Skipping YAML::Perl for known-broken feature ok 180 # skip Skipping YAML::Perl for known-broken feature ok 181 - multi_document_space: CPAN::Meta::YAML parses without error ok 182 - multi_document_space: CPAN::Meta::YAML does not modify the input string ok 183 - The object isa CPAN::Meta::YAML ok 184 - multi_document_space: CPAN::Meta::YAML parses correctly ok 185 - multi_document_space: CPAN::Meta::YAML serializes without error ok 186 - multi_document_space: CPAN::Meta::YAML serializes correctly ok 187 - multi_document_space: CPAN::Meta::YAML round-trips without error ok 188 - The object isa CPAN::Meta::YAML ok 189 - multi_document_space: CPAN::Meta::YAML round-trips correctly ok 190 # skip Shortcutting perfect serialization tests ok t/19_errors.t ...... 1..20 ok 1 - ->read_string returns undef ok 2 - Got expected error ok 3 - ->read_string returns undef ok 4 - Got expected error ok 5 - ->read_string returns undef ok 6 - Got expected error ok 7 - ->read_string returns undef ok 8 - Got expected error ok 9 - ->read_string returns undef ok 10 - Got expected error ok 11 - ->read_string returns undef ok 12 - Got expected error ok 13 - ->read_string returns undef ok 14 - Got expected error ok 15 - ->read_string returns undef ok 16 - Got expected error ok 17 - ->read_string returns undef ok 18 - Got expected error ok 19 - ->read_string returns undef ok 20 - Got expected error ok t/20_subclass.t .... 1..1 ok 1 - Subclassing works ok t/21_bom.t ......... 1..8 ok 1 - Found utf_16_le_bom.yml ok 2 - Can read utf_16_le_bom.yml ok 3 - Loaded utf_16_le_bom.yml ok 4 - Content of utf_16_le_bom.yml larger than 3 bytes ok 5 - utf-16: CPAN::Meta::YAML parses without error ok 6 - utf-16: CPAN::Meta::YAML does not modify the input string ok 7 - file not parsed ok 8 - correct error ok t/22_comments.t .... 1..76 ok 1 # skip Skipping YAML.pm for known-broken feature ok 2 # skip Skipping YAML.pm for known-broken feature ok 3 # skip Skipping YAML.pm for known-broken feature ok 4 # skip Skipping YAML.pm for known-broken feature ok 5 # skip Skipping YAML.pm for known-broken feature ok 6 # skip Skipping YAML.pm for known-broken feature ok 7 # skip Skipping YAML.pm for known-broken feature ok 8 - Properly ignore comments: YAML::Syck saves without error ok 9 - Properly ignore comments: YAML::Syck serializes correctly ok 10 - Properly ignore comments: YAML::Syck round-trips without error ok 11 - Properly ignore comments: YAML::Syck round-trips correctly ok 12 - Properly ignore comments: YAML::Syck loads without error ok 13 - Properly ignore comments: YAML::Syck does not modify the input string ok 14 - Properly ignore comments: YAML::Syck parses correctly ok 15 - Properly ignore comments: YAML::XS saves without error ok 16 - Properly ignore comments: YAML::XS serializes correctly ok 17 - Properly ignore comments: YAML::XS round-trips without error ok 18 - Properly ignore comments: YAML::XS round-trips correctly ok 19 - Properly ignore comments: YAML::XS loads without error ok 20 - Properly ignore comments: YAML::XS does not modify the input string ok 21 - Properly ignore comments: YAML::XS parses correctly ok 22 - Properly ignore comments: YAML::Perl saves without error ok 23 - Properly ignore comments: YAML::Perl serializes correctly ok 24 - Properly ignore comments: YAML::Perl round-trips without error ok 25 - Properly ignore comments: YAML::Perl round-trips correctly ok 26 - Properly ignore comments: YAML::Perl loads without error ok 27 - Properly ignore comments: YAML::Perl does not modify the input string ok 28 - Properly ignore comments: YAML::Perl parses correctly ok 29 - Properly ignore comments: CPAN::Meta::YAML parses without error ok 30 - Properly ignore comments: CPAN::Meta::YAML does not modify the input string ok 31 - The object isa CPAN::Meta::YAML ok 32 - Properly ignore comments: CPAN::Meta::YAML parses correctly ok 33 - Properly ignore comments: CPAN::Meta::YAML serializes without error ok 34 - Properly ignore comments: CPAN::Meta::YAML serializes correctly ok 35 - Properly ignore comments: CPAN::Meta::YAML round-trips without error ok 36 - The object isa CPAN::Meta::YAML ok 37 - Properly ignore comments: CPAN::Meta::YAML round-trips correctly ok 38 # skip Shortcutting perfect serialization tests ok 39 # skip Skipping YAML.pm for known-broken feature ok 40 # skip Skipping YAML.pm for known-broken feature ok 41 # skip Skipping YAML.pm for known-broken feature ok 42 # skip Skipping YAML.pm for known-broken feature ok 43 # skip Skipping YAML.pm for known-broken feature ok 44 # skip Skipping YAML.pm for known-broken feature ok 45 # skip Skipping YAML.pm for known-broken feature ok 46 - Properly ignore comments (with otherwise illegal characters): YAML::Syck saves without error ok 47 - Properly ignore comments (with otherwise illegal characters): YAML::Syck serializes correctly ok 48 - Properly ignore comments (with otherwise illegal characters): YAML::Syck round-trips without error ok 49 - Properly ignore comments (with otherwise illegal characters): YAML::Syck round-trips correctly ok 50 - Properly ignore comments (with otherwise illegal characters): YAML::Syck loads without error ok 51 - Properly ignore comments (with otherwise illegal characters): YAML::Syck does not modify the input string ok 52 - Properly ignore comments (with otherwise illegal characters): YAML::Syck parses correctly ok 53 - Properly ignore comments (with otherwise illegal characters): YAML::XS saves without error ok 54 - Properly ignore comments (with otherwise illegal characters): YAML::XS serializes correctly ok 55 - Properly ignore comments (with otherwise illegal characters): YAML::XS round-trips without error ok 56 - Properly ignore comments (with otherwise illegal characters): YAML::XS round-trips correctly ok 57 - Properly ignore comments (with otherwise illegal characters): YAML::XS loads without error ok 58 - Properly ignore comments (with otherwise illegal characters): YAML::XS does not modify the input string ok 59 - Properly ignore comments (with otherwise illegal characters): YAML::XS parses correctly ok 60 - Properly ignore comments (with otherwise illegal characters): YAML::Perl saves without error ok 61 - Properly ignore comments (with otherwise illegal characters): YAML::Perl serializes correctly ok 62 - Properly ignore comments (with otherwise illegal characters): YAML::Perl round-trips without error ok 63 - Properly ignore comments (with otherwise illegal characters): YAML::Perl round-trips correctly ok 64 - Properly ignore comments (with otherwise illegal characters): YAML::Perl loads without error ok 65 - Properly ignore comments (with otherwise illegal characters): YAML::Perl does not modify the input string ok 66 - Properly ignore comments (with otherwise illegal characters): YAML::Perl parses correctly ok 67 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML parses without error ok 68 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML does not modify the input string ok 69 - The object isa CPAN::Meta::YAML ok 70 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML parses correctly ok 71 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML serializes without error ok 72 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML serializes correctly ok 73 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML round-trips without error ok 74 - The object isa CPAN::Meta::YAML ok 75 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML round-trips correctly ok 76 # skip Shortcutting perfect serialization tests ok All tests successful. Files=17, Tests=3445, 5 wallclock secs ( 0.53 usr + 0.06 sys = 0.59 CPU) Result: PASS DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for CPAN-Meta-YAML-0.003 already made Running test for module 'JSON::PP' Running make for M/MA/MAKAMAKA/JSON-PP-2.27105.tar.gz Prepending C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Checksum for C:\cpanfly\var\cpan\sources\authors\id\M\MA\MAKAMAKA\JSON-PP-2.27105.tar.gz ok Will not use Archive::Tar, need 1.00 JSON-PP-2.27105/ JSON-PP-2.27105/lib/ JSON-PP-2.27105/lib/JSON/ JSON-PP-2.27105/lib/JSON/PP/ JSON-PP-2.27105/lib/JSON/PP/Boolean.pm JSON-PP-2.27105/lib/JSON/PP.pm JSON-PP-2.27105/Makefile.PL JSON-PP-2.27105/README JSON-PP-2.27105/t/ JSON-PP-2.27105/t/012_blessed.t JSON-PP-2.27105/t/014_latin1.t JSON-PP-2.27105/t/108_decode.t JSON-PP-2.27105/t/008_pc_base.t JSON-PP-2.27105/t/107_allow_singlequote.t JSON-PP-2.27105/t/009_pc_extra_number.t JSON-PP-2.27105/t/011_pc_expo.t JSON-PP-2.27105/t/113_overloaded_eq.t JSON-PP-2.27105/t/021_evans_bugrep.t JSON-PP-2.27105/t/114_decode_prefix.t JSON-PP-2.27105/t/003_types.t JSON-PP-2.27105/t/015_prefix.t JSON-PP-2.27105/t/007_pc_esc.t JSON-PP-2.27105/t/016_tied.t JSON-PP-2.27105/t/106_allow_barekey.t JSON-PP-2.27105/t/010_pc_keysort.t JSON-PP-2.27105/t/022_comment_at_eof.t JSON-PP-2.27105/t/110_bignum.t JSON-PP-2.27105/t/001_utf8.t JSON-PP-2.27105/t/013_limit.t JSON-PP-2.27105/t/006_pc_pretty.t JSON-PP-2.27105/t/000_load.t JSON-PP-2.27105/t/_unicode_handling.pm JSON-PP-2.27105/t/109_encode.t JSON-PP-2.27105/t/104_sortby.t JSON-PP-2.27105/t/112_upgrade.t JSON-PP-2.27105/t/020_unknown.t JSON-PP-2.27105/t/019_incr.t JSON-PP-2.27105/t/018_json_checker.t JSON-PP-2.27105/t/017_relaxed.t JSON-PP-2.27105/t/105_esc_slash.t JSON-PP-2.27105/t/115_tie_ixhash.t JSON-PP-2.27105/t/002_error.t JSON-PP-2.27105/t/099_binary.t JSON-PP-2.27105/MANIFEST JSON-PP-2.27105/META.yml JSON-PP-2.27105/bin/ JSON-PP-2.27105/bin/json_pp JSON-PP-2.27105/Changes Prepending C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build M/MA/MAKAMAKA/JSON-PP-2.27105.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Checking if your kit is complete... Looks good Writing Makefile for JSON::PP >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/JSON/PP.pm blib\lib\JSON\PP.pm cp lib/JSON/PP/Boolean.pm blib\lib\JSON\PP\Boolean.pm C:\Perl64\bin\perl.exe -MExtUtils::Command -e "cp" -- bin/json_pp blib\script\json_pp pl2bat.bat blib\script\json_pp MAKAMAKA/JSON-PP-2.27105.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/000_load.t ............... 1..1 ok 1 ok t/001_utf8.t ............... 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/002_error.t .............. 1..31 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/003_types.t .............. 1..76 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok t/006_pc_pretty.t .......... 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 - nospace ok 7 - after ok 8 - both ok 9 - before ok t/007_pc_esc.t ............. 1..17 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - {"id":"abc\ndef"} ok 16 - {"id":"abc\\ndef"} ok 17 - {"id":"abc\\\ndef"} ok t/008_pc_base.t ............ 1..20 ok 1 - {} ok 2 - [] ok 3 ok 4 - {"foo":"bar"} ok 5 - {"foo":""} ok 6 - {"foo":" "} ok 7 - {"foo":"0"} - autoencode (default) ok 8 - {"foo":"0 0"} ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - invalid value (coderef) ok 20 - invalid value (ref) ok t/009_pc_extra_number.t .... 1..6 ok 1 - normal 0 ok 2 - normal 0.1 ok 3 - normal 10 ok 4 - normal -10 ok 5 - normal 0 ok 6 - normal 0.1 ok t/010_pc_keysort.t ......... 1..1 ok 1 ok t/011_pc_expo.t ............ 1..8 ok 1 - digit -12.34 ok 2 - digit -12.34 ok 3 - digit -1.234e5 ok 4 - digit -1.234e5 ok 5 - digit 1.23E-4 ok 6 - digit 1.23E-4 ok 7 - digit 1.01e+67 ok 8 - digit 1.01e+67 ok t/012_blessed.t ............ 1..16 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/013_limit.t .............. 1..11 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/014_latin1.t ............. 1..4 ok 1 ok 2 ok 3 ok 4 ok t/015_prefix.t ............. 1..4 ok 1 ok 2 ok 3 ok 4 ok t/016_tied.t ............... 1..2 ok 1 ok 2 ok t/017_relaxed.t ............ 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/018_json_checker.t ....... 1..39 ok 1 - fail1.json # (JSON text must be an object or array (but found number, string, true, false or null, use allow_nonref to allow this) at t/018_json_checker.t line 28 # ) ok 2 - fail10.json # (garbage after JSON object, at character offset 35 (before "misplaced quoted val...") at t/018_json_checker.t line 28 # ) ok 3 - fail11.json # (, or } expected while parsing object/hash, at character offset 25 (before "+ 2}") at t/018_json_checker.t line 28 # ) ok 4 - fail12.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 23 (before "alert()}") at t/018_json_checker.t line 28 # ) ok 5 - fail13.json # (malformed number (leading zero must not be followed by another digit), at character offset 40 (before "13}") at t/018_json_checker.t line 28 # ) ok 6 - fail14.json # (malformed number (leading zero must not be followed by another digit), at character offset 27 (before "x14}") at t/018_json_checker.t line 28 # ) ok 7 - fail15.json # (illegal backslash escape sequence in string, at character offset 28 (before "\\x15"]") at t/018_json_checker.t line 28 # ) ok 8 - fail16.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 1 (before "\\naked]") at t/018_json_checker.t line 28 # ) ok 9 - fail17.json # (illegal backslash escape sequence in string, at character offset 28 (before "\\017"]") at t/018_json_checker.t line 28 # ) ok 10 - fail18.json # (json text or perl structure exceeds maximum nesting level (max_depth set too low?), at character offset 33 (before ""Too deep"]]]]]]]]]]...") at t/018_json_checker.t line 28 # ) ok 11 - fail19.json # (':' expected, at character offset 17 (before "null}") at t/018_json_checker.t line 28 # ) ok 12 - fail2.json # (, or ] expected while parsing array, at character offset 17 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 13 - fail20.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 16 (before ": null}") at t/018_json_checker.t line 28 # ) ok 14 - fail21.json # (':' expected, at character offset 25 (before ", null}") at t/018_json_checker.t line 28 # ) ok 15 - fail22.json # (, or ] expected while parsing array, at character offset 26 (before " false]") at t/018_json_checker.t line 28 # ) ok 16 - fail23.json # ('true' expected, at character offset 14 (before "truth]") at t/018_json_checker.t line 28 # ) ok 17 - fail24.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 1 (before "'single quote']") at t/018_json_checker.t line 28 # ) ok 18 - fail25.json # (invalid character encountered while parsing JSON string, at character offset 2 (before "\ttab\tcharacter\tin...") at t/018_json_checker.t line 28 # ) ok 19 - fail26.json # (illegal backslash escape sequence in string, at character offset 5 (before "\\ character\\ i...") at t/018_json_checker.t line 28 # ) ok 20 - fail27.json # (invalid character encountered while parsing JSON string, at character offset 6 (before "\nbreak"]") at t/018_json_checker.t line 28 # ) ok 21 - fail28.json # (illegal backslash escape sequence in string, at character offset 6 (before "\\\nbreak"]") at t/018_json_checker.t line 28 # ) ok 22 - fail29.json # (malformed number (no digits after exp sign), at character offset 4 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 23 - fail3.json # (unexpected end of string while parsing JSON string, at character offset 2 (before "nquoted_key: "keys m...") at t/018_json_checker.t line 28 # ) ok 24 - fail30.json # (malformed number (no digits after exp sign), at character offset 5 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 25 - fail31.json # (malformed number (no digits after exp sign), at character offset 5 (before "1]") at t/018_json_checker.t line 28 # ) ok 26 - fail32.json # (, or } expected while parsing object/hash, at character offset 39 (before ",") at t/018_json_checker.t line 28 # ) ok 27 - fail33.json # (, or ] expected while parsing array, at character offset 12 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 28 - fail4.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 15 (before "]") at t/018_json_checker.t line 28 # ) ok 29 - fail5.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 22 (before ",]") at t/018_json_checker.t line 28 # ) ok 30 - fail6.json # (malformed JSON string, neither array, object, number, string or atom, at character offset 4 (before ", "<-- missing value...") at t/018_json_checker.t line 28 # ) ok 31 - fail7.json # (garbage after JSON object, at character offset 26 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 32 - fail8.json # (garbage after JSON object, at character offset 16 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 33 - fail9.json # (unexpected end of string while parsing JSON string, at character offset 22 (before "(end of string)") at t/018_json_checker.t line 28 # ) ok 34 - pass1.json # ok 35 ok 36 - pass2.json # ok 37 ok 38 - pass3.json # ok 39 ok t/019_incr.t ............... 1..697 ok 1 ok 2 - data ok 3 - tailws ok 4 ok 5 - data ok 6 - tailws ok 7 ok 8 - data ok 9 - tailws ok 10 ok 11 - data ok 12 - tailws ok 13 ok 14 - data ok 15 - tailws ok 16 ok 17 - data ok 18 - tailws ok 19 ok 20 - data ok 21 - tailws ok 22 ok 23 - data ok 24 - tailws ok 25 ok 26 - data ok 27 - tailws ok 28 ok 29 - data ok 30 - tailws ok 31 ok 32 - data ok 33 - tailws ok 34 ok 35 - data ok 36 - tailws ok 37 ok 38 - data ok 39 - tailws ok 40 ok 41 - data ok 42 - tailws ok 43 ok 44 - data ok 45 - tailws ok 46 ok 47 - data ok 48 - tailws ok 49 ok 50 - data ok 51 - tailws ok 52 ok 53 - data ok 54 - tailws ok 55 ok 56 - data ok 57 - tailws ok 58 ok 59 - data ok 60 - tailws ok 61 ok 62 - data ok 63 - tailws ok 64 ok 65 - data ok 66 - tailws ok 67 ok 68 - data ok 69 - tailws ok 70 ok 71 - data ok 72 - tailws ok 73 ok 74 - data ok 75 - tailws ok 76 ok 77 - data ok 78 - tailws ok 79 ok 80 - data ok 81 - tailws ok 82 ok 83 - data ok 84 - tailws ok 85 ok 86 - data ok 87 - tailws ok 88 ok 89 - data ok 90 - tailws ok 91 ok 92 - data ok 93 - tailws ok 94 ok 95 - data ok 96 - tailws ok 97 ok 98 - data ok 99 - tailws ok 100 ok 101 - data ok 102 - tailws ok 103 ok 104 - data ok 105 - tailws ok 106 ok 107 - data ok 108 - tailws ok 109 ok 110 - data ok 111 - tailws ok 112 ok 113 - data ok 114 - tailws ok 115 ok 116 - data ok 117 - tailws ok 118 ok 119 - data ok 120 - tailws ok 121 ok 122 - data ok 123 - tailws ok 124 ok 125 - data ok 126 - tailws ok 127 ok 128 - data ok 129 - tailws ok 130 ok 131 - data ok 132 - tailws ok 133 ok 134 - data ok 135 - tailws ok 136 ok 137 - data ok 138 - tailws ok 139 ok 140 - data ok 141 - tailws ok 142 ok 143 - data ok 144 - tailws ok 145 ok 146 - data ok 147 - tailws ok 148 ok 149 - data ok 150 - tailws ok 151 ok 152 - data ok 153 - tailws ok 154 ok 155 - data ok 156 - tailws ok 157 ok 158 - data ok 159 - tailws ok 160 ok 161 - data ok 162 - tailws ok 163 ok 164 - data ok 165 - tailws ok 166 ok 167 - data ok 168 - tailws ok 169 ok 170 - data ok 171 - tailws ok 172 ok 173 - data ok 174 - tailws ok 175 ok 176 - data ok 177 - tailws ok 178 ok 179 - data ok 180 - tailws ok 181 ok 182 - data ok 183 - tailws ok 184 ok 185 - data ok 186 - tailws ok 187 ok 188 - data ok 189 - tailws ok 190 ok 191 - data ok 192 - tailws ok 193 ok 194 - data ok 195 - tailws ok 196 ok 197 - data ok 198 - tailws ok 199 ok 200 - data ok 201 - tailws ok 202 ok 203 - data ok 204 - tailws ok 205 ok 206 - data ok 207 - tailws ok 208 ok 209 - data ok 210 - tailws ok 211 ok 212 - data ok 213 - tailws ok 214 ok 215 - data ok 216 - tailws ok 217 ok 218 - data ok 219 - tailws ok 220 ok 221 - data ok 222 - tailws ok 223 ok 224 - data ok 225 - tailws ok 226 ok 227 - data ok 228 - tailws ok 229 ok 230 - data ok 231 - tailws ok 232 ok 233 - data ok 234 - tailws ok 235 ok 236 - data ok 237 - tailws ok 238 ok 239 - data ok 240 - tailws ok 241 ok 242 - data ok 243 - tailws ok 244 ok 245 - data ok 246 - tailws ok 247 ok 248 - data ok 249 - tailws ok 250 ok 251 - data ok 252 - tailws ok 253 ok 254 - data ok 255 - tailws ok 256 ok 257 - data ok 258 - tailws ok 259 ok 260 - data ok 261 - tailws ok 262 ok 263 - data ok 264 - tailws ok 265 ok 266 - data ok 267 - tailws ok 268 ok 269 - data ok 270 - tailws ok 271 ok 272 - data ok 273 - tailws ok 274 ok 275 - data ok 276 - tailws ok 277 ok 278 - data ok 279 - tailws ok 280 ok 281 - data ok 282 - tailws ok 283 ok 284 - data ok 285 - tailws ok 286 ok 287 - data ok 288 - tailws ok 289 ok 290 - data ok 291 - tailws ok 292 ok 293 - data ok 294 - tailws ok 295 ok 296 - data ok 297 - tailws ok 298 ok 299 - data ok 300 - tailws ok 301 ok 302 - data ok 303 - tailws ok 304 ok 305 - data ok 306 - tailws ok 307 ok 308 - data ok 309 - tailws ok 310 ok 311 - data ok 312 - tailws ok 313 ok 314 - data ok 315 - tailws ok 316 ok 317 - data ok 318 - tailws ok 319 ok 320 - data ok 321 - tailws ok 322 ok 323 - data ok 324 - tailws ok 325 ok 326 - data ok 327 - tailws ok 328 ok 329 - data ok 330 - tailws ok 331 ok 332 - data ok 333 - tailws ok 334 ok 335 - data ok 336 - tailws ok 337 - cskip1 ok 338 - cskip2 ok 339 - cskip3 ok 340 - cskip4 ok 341 - cskip5 ok 342 - cjson1 ok 343 - cjson2 ok 344 - cjson3 ok 345 - cjson4 ok 346 - cjson5 ok 347 - cskip1 ok 348 - cskip2 ok 349 - cskip3 ok 350 - cskip4 ok 351 - cskip5 ok 352 - cjson1 ok 353 - cjson2 ok 354 - cjson3 ok 355 - cjson4 ok 356 - cjson5 ok 357 - cskip1 ok 358 - cskip2 ok 359 - cskip3 ok 360 - cskip4 ok 361 - cskip5 ok 362 - cjson1 ok 363 - cjson2 ok 364 - cjson3 ok 365 - cjson4 ok 366 - cjson5 ok 367 - cskip1 ok 368 - cskip2 ok 369 - cskip3 ok 370 - cskip4 ok 371 - cskip5 ok 372 - cjson1 ok 373 - cjson2 ok 374 - cjson3 ok 375 - cjson4 ok 376 - cjson5 ok 377 - cskip1 ok 378 - cskip2 ok 379 - cskip3 ok 380 - cskip4 ok 381 - cskip5 ok 382 - cjson1 ok 383 - cjson2 ok 384 - cjson3 ok 385 - cjson4 ok 386 - cjson5 ok 387 - cskip1 ok 388 - cskip2 ok 389 - cskip3 ok 390 - cskip4 ok 391 - cskip5 ok 392 - cjson1 ok 393 - cjson2 ok 394 - cjson3 ok 395 - cjson4 ok 396 - cjson5 ok 397 - cskip1 ok 398 - cskip2 ok 399 - cskip3 ok 400 - cskip4 ok 401 - cskip5 ok 402 - cjson1 ok 403 - cjson2 ok 404 - cjson3 ok 405 - cjson4 ok 406 - cjson5 ok 407 - cskip1 ok 408 - cskip2 ok 409 - cskip3 ok 410 - cskip4 ok 411 - cskip5 ok 412 - cjson1 ok 413 - cjson2 ok 414 - cjson3 ok 415 - cjson4 ok 416 - cjson5 ok 417 - cskip1 ok 418 - cskip2 ok 419 - cskip3 ok 420 - cskip4 ok 421 - cskip5 ok 422 - cjson1 ok 423 - cjson2 ok 424 - cjson3 ok 425 - cjson4 ok 426 - cjson5 ok 427 - cskip1 ok 428 - cskip2 ok 429 - cskip3 ok 430 - cskip4 ok 431 - cskip5 ok 432 - cjson1 ok 433 - cjson2 ok 434 - cjson3 ok 435 - cjson4 ok 436 - cjson5 ok 437 - cskip1 ok 438 - cskip2 ok 439 - cskip3 ok 440 - cskip4 ok 441 - cskip5 ok 442 - cjson1 ok 443 - cjson2 ok 444 - cjson3 ok 445 - cjson4 ok 446 - cjson5 ok 447 - cskip1 ok 448 - cskip2 ok 449 - cskip3 ok 450 - cskip4 ok 451 - cskip5 ok 452 - cjson1 ok 453 - cjson2 ok 454 - cjson3 ok 455 - cjson4 ok 456 - cjson5 ok 457 - cskip1 ok 458 - cskip2 ok 459 - cskip3 ok 460 - cskip4 ok 461 - cskip5 ok 462 - cjson1 ok 463 - cjson2 ok 464 - cjson3 ok 465 - cjson4 ok 466 - cjson5 ok 467 - cskip1 ok 468 - cskip2 ok 469 - cskip3 ok 470 - cskip4 ok 471 - cskip5 ok 472 - cjson1 ok 473 - cjson2 ok 474 - cjson3 ok 475 - cjson4 ok 476 - cjson5 ok 477 - cskip1 ok 478 - cskip2 ok 479 - cskip3 ok 480 - cskip4 ok 481 - cskip5 ok 482 - cjson1 ok 483 - cjson2 ok 484 - cjson3 ok 485 - cjson4 ok 486 - cjson5 ok 487 - cskip1 ok 488 - cskip2 ok 489 - cskip3 ok 490 - cskip4 ok 491 - cskip5 ok 492 - cjson1 ok 493 - cjson2 ok 494 - cjson3 ok 495 - cjson4 ok 496 - cjson5 ok 497 - cskip1 ok 498 - cskip2 ok 499 - cskip3 ok 500 - cskip4 ok 501 - cskip5 ok 502 - cjson1 ok 503 - cjson2 ok 504 - cjson3 ok 505 - cjson4 ok 506 - cjson5 ok 507 - cskip1 ok 508 - cskip2 ok 509 - cskip3 ok 510 - cskip4 ok 511 - cskip5 ok 512 - cjson1 ok 513 - cjson2 ok 514 - cjson3 ok 515 - cjson4 ok 516 - cjson5 ok 517 - cskip1 ok 518 - cskip2 ok 519 - cskip3 ok 520 - cskip4 ok 521 - cskip5 ok 522 - cjson1 ok 523 - cjson2 ok 524 - cjson3 ok 525 - cjson4 ok 526 - cjson5 ok 527 - cskip1 ok 528 - cskip2 ok 529 - cskip3 ok 530 - cskip4 ok 531 - cskip5 ok 532 - cjson1 ok 533 - cjson2 ok 534 - cjson3 ok 535 - cjson4 ok 536 - cjson5 ok 537 - cskip1 ok 538 - cskip2 ok 539 - cskip3 ok 540 - cskip4 ok 541 - cskip5 ok 542 - cjson1 ok 543 - cjson2 ok 544 - cjson3 ok 545 - cjson4 ok 546 - cjson5 ok 547 - cskip1 ok 548 - cskip2 ok 549 - cskip3 ok 550 - cskip4 ok 551 - cskip5 ok 552 - cjson1 ok 553 - cjson2 ok 554 - cjson3 ok 555 - cjson4 ok 556 - cjson5 ok 557 - cskip1 ok 558 - cskip2 ok 559 - cskip3 ok 560 - cskip4 ok 561 - cskip5 ok 562 - cjson1 ok 563 - cjson2 ok 564 - cjson3 ok 565 - cjson4 ok 566 - cjson5 ok 567 - cskip1 ok 568 - cskip2 ok 569 - cskip3 ok 570 - cskip4 ok 571 - cskip5 ok 572 - cjson1 ok 573 - cjson2 ok 574 - cjson3 ok 575 - cjson4 ok 576 - cjson5 ok 577 - cskip1 ok 578 - cskip2 ok 579 - cskip3 ok 580 - cskip4 ok 581 - cskip5 ok 582 - cjson1 ok 583 - cjson2 ok 584 - cjson3 ok 585 - cjson4 ok 586 - cjson5 ok 587 - cskip1 ok 588 - cskip2 ok 589 - cskip3 ok 590 - cskip4 ok 591 - cskip5 ok 592 - cjson1 ok 593 - cjson2 ok 594 - cjson3 ok 595 - cjson4 ok 596 - cjson5 ok 597 - cskip1 ok 598 - cskip2 ok 599 - cskip3 ok 600 - cskip4 ok 601 - cskip5 ok 602 - cjson1 ok 603 - cjson2 ok 604 - cjson3 ok 605 - cjson4 ok 606 - cjson5 ok 607 - cskip1 ok 608 - cskip2 ok 609 - cskip3 ok 610 - cskip4 ok 611 - cskip5 ok 612 - cjson1 ok 613 - cjson2 ok 614 - cjson3 ok 615 - cjson4 ok 616 - cjson5 ok 617 - cskip1 ok 618 - cskip2 ok 619 - cskip3 ok 620 - cskip4 ok 621 - cskip5 ok 622 - cjson1 ok 623 - cjson2 ok 624 - cjson3 ok 625 - cjson4 ok 626 - cjson5 ok 627 - cskip1 ok 628 - cskip2 ok 629 - cskip3 ok 630 - cskip4 ok 631 - cskip5 ok 632 - cjson1 ok 633 - cjson2 ok 634 - cjson3 ok 635 - cjson4 ok 636 - cjson5 ok 637 - cskip1 ok 638 - cskip2 ok 639 - cskip3 ok 640 - cskip4 ok 641 - cskip5 ok 642 - cjson1 ok 643 - cjson2 ok 644 - cjson3 ok 645 - cjson4 ok 646 - cjson5 ok 647 - cskip1 ok 648 - cskip2 ok 649 - cskip3 ok 650 - cskip4 ok 651 - cskip5 ok 652 - cjson1 ok 653 - cjson2 ok 654 - cjson3 ok 655 - cjson4 ok 656 - cjson5 ok 657 - cskip1 ok 658 - cskip2 ok 659 - cskip3 ok 660 - cskip4 ok 661 - cskip5 ok 662 - cjson1 ok 663 - cjson2 ok 664 - cjson3 ok 665 - cjson4 ok 666 - cjson5 ok 667 - cskip1 ok 668 - cskip2 ok 669 - cskip3 ok 670 - cskip4 ok 671 - cskip5 ok 672 - cjson1 ok 673 - cjson2 ok 674 - cjson3 ok 675 - cjson4 ok 676 - cjson5 ok 677 - cskip1 ok 678 - cskip2 ok 679 - cskip3 ok 680 - cskip4 ok 681 - cskip5 ok 682 - cjson1 ok 683 - cjson2 ok 684 - cjson3 ok 685 - cjson4 ok 686 - cjson5 ok 687 - sparse1 ok 688 - sparse2 ok 689 - sparse3 ok 690 - incsize1 ok 691 - incsize2 attempted decode of JSON text of 6 bytes size, but max_size is set to 5 at (eval 46) line 1 # ok 692 - incdepth1 ok 693 - incdepth2 json text or perl structure exceeds maximum nesting level (max_depth set too low?) at (eval 47) line 1 # ok 694 - unbalanced bracket ok 695 - got error ok 696 - malformed json string error ok 697 - valid data after incr_skip ok t/020_unknown.t ............ 1..10 ok 1 - encountered CODE(0x2cd7828), but JSON can only represent references to arrays or hashes at (eval 45) line 1 # ok 2 - cannot encode reference to scalar at (eval 46) line 1 # ok 3 - cannot encode reference to scalar at (eval 47) line 1 # ok 4 - cannot encode reference to scalar at (eval 48) line 1 # ok 5 ok 6 ok 7 ok 8 ok 9 - encountered GLOB(0x2cd76a8), but JSON can only represent references to arrays or hashes at (eval 53) line 1 # ok 10 ok t/021_evans_bugrep.t ....... 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok t/022_comment_at_eof.t ..... 1..13 ok 1 - array baseline ok 2 - space ignored before array ok 3 - newline ignored before array ok 4 - comment ignored before array ok 5 - comment ignored before array ok 6 - comment ignored before array ok 7 - comment ignored inside array ok 8 - eof baseline ok 9 - space ignored before eof ok 10 - newline ignored before eof ok 11 - comment ignored before eof ok 12 - comment ignored before eof ok 13 - array and string in multiple lines ok t/099_binary.t ............. 1..2432 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 ok 598 ok 599 ok 600 ok 601 ok 602 ok 603 ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 ok 979 ok 980 ok 981 ok 982 ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 ok 1007 ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 ok 1055 ok 1056 ok 1057 ok 1058 ok 1059 ok 1060 ok 1061 ok 1062 ok 1063 ok 1064 ok 1065 ok 1066 ok 1067 ok 1068 ok 1069 ok 1070 ok 1071 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 ok 1084 ok 1085 ok 1086 ok 1087 ok 1088 ok 1089 ok 1090 ok 1091 ok 1092 ok 1093 ok 1094 ok 1095 ok 1096 ok 1097 ok 1098 ok 1099 ok 1100 ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 ok 1117 ok 1118 ok 1119 ok 1120 ok 1121 ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok 1146 ok 1147 ok 1148 ok 1149 ok 1150 ok 1151 ok 1152 ok 1153 ok 1154 ok 1155 ok 1156 ok 1157 ok 1158 ok 1159 ok 1160 ok 1161 ok 1162 ok 1163 ok 1164 ok 1165 ok 1166 ok 1167 ok 1168 ok 1169 ok 1170 ok 1171 ok 1172 ok 1173 ok 1174 ok 1175 ok 1176 ok 1177 ok 1178 ok 1179 ok 1180 ok 1181 ok 1182 ok 1183 ok 1184 ok 1185 ok 1186 ok 1187 ok 1188 ok 1189 ok 1190 ok 1191 ok 1192 ok 1193 ok 1194 ok 1195 ok 1196 ok 1197 ok 1198 ok 1199 ok 1200 ok 1201 ok 1202 ok 1203 ok 1204 ok 1205 ok 1206 ok 1207 ok 1208 ok 1209 ok 1210 ok 1211 ok 1212 ok 1213 ok 1214 ok 1215 ok 1216 ok 1217 ok 1218 ok 1219 ok 1220 ok 1221 ok 1222 ok 1223 ok 1224 ok 1225 ok 1226 ok 1227 ok 1228 ok 1229 ok 1230 ok 1231 ok 1232 ok 1233 ok 1234 ok 1235 ok 1236 ok 1237 ok 1238 ok 1239 ok 1240 ok 1241 ok 1242 ok 1243 ok 1244 ok 1245 ok 1246 ok 1247 ok 1248 ok 1249 ok 1250 ok 1251 ok 1252 ok 1253 ok 1254 ok 1255 ok 1256 ok 1257 ok 1258 ok 1259 ok 1260 ok 1261 ok 1262 ok 1263 ok 1264 ok 1265 ok 1266 ok 1267 ok 1268 ok 1269 ok 1270 ok 1271 ok 1272 ok 1273 ok 1274 ok 1275 ok 1276 ok 1277 ok 1278 ok 1279 ok 1280 ok 1281 ok 1282 ok 1283 ok 1284 ok 1285 ok 1286 ok 1287 ok 1288 ok 1289 ok 1290 ok 1291 ok 1292 ok 1293 ok 1294 ok 1295 ok 1296 ok 1297 ok 1298 ok 1299 ok 1300 ok 1301 ok 1302 ok 1303 ok 1304 ok 1305 ok 1306 ok 1307 ok 1308 ok 1309 ok 1310 ok 1311 ok 1312 ok 1313 ok 1314 ok 1315 ok 1316 ok 1317 ok 1318 ok 1319 ok 1320 ok 1321 ok 1322 ok 1323 ok 1324 ok 1325 ok 1326 ok 1327 ok 1328 ok 1329 ok 1330 ok 1331 ok 1332 ok 1333 ok 1334 ok 1335 ok 1336 ok 1337 ok 1338 ok 1339 ok 1340 ok 1341 ok 1342 ok 1343 ok 1344 ok 1345 ok 1346 ok 1347 ok 1348 ok 1349 ok 1350 ok 1351 ok 1352 ok 1353 ok 1354 ok 1355 ok 1356 ok 1357 ok 1358 ok 1359 ok 1360 ok 1361 ok 1362 ok 1363 ok 1364 ok 1365 ok 1366 ok 1367 ok 1368 ok 1369 ok 1370 ok 1371 ok 1372 ok 1373 ok 1374 ok 1375 ok 1376 ok 1377 ok 1378 ok 1379 ok 1380 ok 1381 ok 1382 ok 1383 ok 1384 ok 1385 ok 1386 ok 1387 ok 1388 ok 1389 ok 1390 ok 1391 ok 1392 ok 1393 ok 1394 ok 1395 ok 1396 ok 1397 ok 1398 ok 1399 ok 1400 ok 1401 ok 1402 ok 1403 ok 1404 ok 1405 ok 1406 ok 1407 ok 1408 ok 1409 ok 1410 ok 1411 ok 1412 ok 1413 ok 1414 ok 1415 ok 1416 ok 1417 ok 1418 ok 1419 ok 1420 ok 1421 ok 1422 ok 1423 ok 1424 ok 1425 ok 1426 ok 1427 ok 1428 ok 1429 ok 1430 ok 1431 ok 1432 ok 1433 ok 1434 ok 1435 ok 1436 ok 1437 ok 1438 ok 1439 ok 1440 ok 1441 ok 1442 ok 1443 ok 1444 ok 1445 ok 1446 ok 1447 ok 1448 ok 1449 ok 1450 ok 1451 ok 1452 ok 1453 ok 1454 ok 1455 ok 1456 ok 1457 ok 1458 ok 1459 ok 1460 ok 1461 ok 1462 ok 1463 ok 1464 ok 1465 ok 1466 ok 1467 ok 1468 ok 1469 ok 1470 ok 1471 ok 1472 ok 1473 ok 1474 ok 1475 ok 1476 ok 1477 ok 1478 ok 1479 ok 1480 ok 1481 ok 1482 ok 1483 ok 1484 ok 1485 ok 1486 ok 1487 ok 1488 ok 1489 ok 1490 ok 1491 ok 1492 ok 1493 ok 1494 ok 1495 ok 1496 ok 1497 ok 1498 ok 1499 ok 1500 ok 1501 ok 1502 ok 1503 ok 1504 ok 1505 ok 1506 ok 1507 ok 1508 ok 1509 ok 1510 ok 1511 ok 1512 ok 1513 ok 1514 ok 1515 ok 1516 ok 1517 ok 1518 ok 1519 ok 1520 ok 1521 ok 1522 ok 1523 ok 1524 ok 1525 ok 1526 ok 1527 ok 1528 ok 1529 ok 1530 ok 1531 ok 1532 ok 1533 ok 1534 ok 1535 ok 1536 ok 1537 ok 1538 ok 1539 ok 1540 ok 1541 ok 1542 ok 1543 ok 1544 ok 1545 ok 1546 ok 1547 ok 1548 ok 1549 ok 1550 ok 1551 ok 1552 ok 1553 ok 1554 ok 1555 ok 1556 ok 1557 ok 1558 ok 1559 ok 1560 ok 1561 ok 1562 ok 1563 ok 1564 ok 1565 ok 1566 ok 1567 ok 1568 ok 1569 ok 1570 ok 1571 ok 1572 ok 1573 ok 1574 ok 1575 ok 1576 ok 1577 ok 1578 ok 1579 ok 1580 ok 1581 ok 1582 ok 1583 ok 1584 ok 1585 ok 1586 ok 1587 ok 1588 ok 1589 ok 1590 ok 1591 ok 1592 ok 1593 ok 1594 ok 1595 ok 1596 ok 1597 ok 1598 ok 1599 ok 1600 ok 1601 ok 1602 ok 1603 ok 1604 ok 1605 ok 1606 ok 1607 ok 1608 ok 1609 ok 1610 ok 1611 ok 1612 ok 1613 ok 1614 ok 1615 ok 1616 ok 1617 ok 1618 ok 1619 ok 1620 ok 1621 ok 1622 ok 1623 ok 1624 ok 1625 ok 1626 ok 1627 ok 1628 ok 1629 ok 1630 ok 1631 ok 1632 ok 1633 ok 1634 ok 1635 ok 1636 ok 1637 ok 1638 ok 1639 ok 1640 ok 1641 ok 1642 ok 1643 ok 1644 ok 1645 ok 1646 ok 1647 ok 1648 ok 1649 ok 1650 ok 1651 ok 1652 ok 1653 ok 1654 ok 1655 ok 1656 ok 1657 ok 1658 ok 1659 ok 1660 ok 1661 ok 1662 ok 1663 ok 1664 ok 1665 ok 1666 ok 1667 ok 1668 ok 1669 ok 1670 ok 1671 ok 1672 ok 1673 ok 1674 ok 1675 ok 1676 ok 1677 ok 1678 ok 1679 ok 1680 ok 1681 ok 1682 ok 1683 ok 1684 ok 1685 ok 1686 ok 1687 ok 1688 ok 1689 ok 1690 ok 1691 ok 1692 ok 1693 ok 1694 ok 1695 ok 1696 ok 1697 ok 1698 ok 1699 ok 1700 ok 1701 ok 1702 ok 1703 ok 1704 ok 1705 ok 1706 ok 1707 ok 1708 ok 1709 ok 1710 ok 1711 ok 1712 ok 1713 ok 1714 ok 1715 ok 1716 ok 1717 ok 1718 ok 1719 ok 1720 ok 1721 ok 1722 ok 1723 ok 1724 ok 1725 ok 1726 ok 1727 ok 1728 ok 1729 ok 1730 ok 1731 ok 1732 ok 1733 ok 1734 ok 1735 ok 1736 ok 1737 ok 1738 ok 1739 ok 1740 ok 1741 ok 1742 ok 1743 ok 1744 ok 1745 ok 1746 ok 1747 ok 1748 ok 1749 ok 1750 ok 1751 ok 1752 ok 1753 ok 1754 ok 1755 ok 1756 ok 1757 ok 1758 ok 1759 ok 1760 ok 1761 ok 1762 ok 1763 ok 1764 ok 1765 ok 1766 ok 1767 ok 1768 ok 1769 ok 1770 ok 1771 ok 1772 ok 1773 ok 1774 ok 1775 ok 1776 ok 1777 ok 1778 ok 1779 ok 1780 ok 1781 ok 1782 ok 1783 ok 1784 ok 1785 ok 1786 ok 1787 ok 1788 ok 1789 ok 1790 ok 1791 ok 1792 ok 1793 ok 1794 ok 1795 ok 1796 ok 1797 ok 1798 ok 1799 ok 1800 ok 1801 ok 1802 ok 1803 ok 1804 ok 1805 ok 1806 ok 1807 ok 1808 ok 1809 ok 1810 ok 1811 ok 1812 ok 1813 ok 1814 ok 1815 ok 1816 ok 1817 ok 1818 ok 1819 ok 1820 ok 1821 ok 1822 ok 1823 ok 1824 ok 1825 ok 1826 ok 1827 ok 1828 ok 1829 ok 1830 ok 1831 ok 1832 ok 1833 ok 1834 ok 1835 ok 1836 ok 1837 ok 1838 ok 1839 ok 1840 ok 1841 ok 1842 ok 1843 ok 1844 ok 1845 ok 1846 ok 1847 ok 1848 ok 1849 ok 1850 ok 1851 ok 1852 ok 1853 ok 1854 ok 1855 ok 1856 ok 1857 ok 1858 ok 1859 ok 1860 ok 1861 ok 1862 ok 1863 ok 1864 ok 1865 ok 1866 ok 1867 ok 1868 ok 1869 ok 1870 ok 1871 ok 1872 ok 1873 ok 1874 ok 1875 ok 1876 ok 1877 ok 1878 ok 1879 ok 1880 ok 1881 ok 1882 ok 1883 ok 1884 ok 1885 ok 1886 ok 1887 ok 1888 ok 1889 ok 1890 ok 1891 ok 1892 ok 1893 ok 1894 ok 1895 ok 1896 ok 1897 ok 1898 ok 1899 ok 1900 ok 1901 ok 1902 ok 1903 ok 1904 ok 1905 ok 1906 ok 1907 ok 1908 ok 1909 ok 1910 ok 1911 ok 1912 ok 1913 ok 1914 ok 1915 ok 1916 ok 1917 ok 1918 ok 1919 ok 1920 ok 1921 ok 1922 ok 1923 ok 1924 ok 1925 ok 1926 ok 1927 ok 1928 ok 1929 ok 1930 ok 1931 ok 1932 ok 1933 ok 1934 ok 1935 ok 1936 ok 1937 ok 1938 ok 1939 ok 1940 ok 1941 ok 1942 ok 1943 ok 1944 ok 1945 ok 1946 ok 1947 ok 1948 ok 1949 ok 1950 ok 1951 ok 1952 ok 1953 ok 1954 ok 1955 ok 1956 ok 1957 ok 1958 ok 1959 ok 1960 ok 1961 ok 1962 ok 1963 ok 1964 ok 1965 ok 1966 ok 1967 ok 1968 ok 1969 ok 1970 ok 1971 ok 1972 ok 1973 ok 1974 ok 1975 ok 1976 ok 1977 ok 1978 ok 1979 ok 1980 ok 1981 ok 1982 ok 1983 ok 1984 ok 1985 ok 1986 ok 1987 ok 1988 ok 1989 ok 1990 ok 1991 ok 1992 ok 1993 ok 1994 ok 1995 ok 1996 ok 1997 ok 1998 ok 1999 ok 2000 ok 2001 ok 2002 ok 2003 ok 2004 ok 2005 ok 2006 ok 2007 ok 2008 ok 2009 ok 2010 ok 2011 ok 2012 ok 2013 ok 2014 ok 2015 ok 2016 ok 2017 ok 2018 ok 2019 ok 2020 ok 2021 ok 2022 ok 2023 ok 2024 ok 2025 ok 2026 ok 2027 ok 2028 ok 2029 ok 2030 ok 2031 ok 2032 ok 2033 ok 2034 ok 2035 ok 2036 ok 2037 ok 2038 ok 2039 ok 2040 ok 2041 ok 2042 ok 2043 ok 2044 ok 2045 ok 2046 ok 2047 ok 2048 ok 2049 ok 2050 ok 2051 ok 2052 ok 2053 ok 2054 ok 2055 ok 2056 ok 2057 ok 2058 ok 2059 ok 2060 ok 2061 ok 2062 ok 2063 ok 2064 ok 2065 ok 2066 ok 2067 ok 2068 ok 2069 ok 2070 ok 2071 ok 2072 ok 2073 ok 2074 ok 2075 ok 2076 ok 2077 ok 2078 ok 2079 ok 2080 ok 2081 ok 2082 ok 2083 ok 2084 ok 2085 ok 2086 ok 2087 ok 2088 ok 2089 ok 2090 ok 2091 ok 2092 ok 2093 ok 2094 ok 2095 ok 2096 ok 2097 ok 2098 ok 2099 ok 2100 ok 2101 ok 2102 ok 2103 ok 2104 ok 2105 ok 2106 ok 2107 ok 2108 ok 2109 ok 2110 ok 2111 ok 2112 ok 2113 ok 2114 ok 2115 ok 2116 ok 2117 ok 2118 ok 2119 ok 2120 ok 2121 ok 2122 ok 2123 ok 2124 ok 2125 ok 2126 ok 2127 ok 2128 ok 2129 ok 2130 ok 2131 ok 2132 ok 2133 ok 2134 ok 2135 ok 2136 ok 2137 ok 2138 ok 2139 ok 2140 ok 2141 ok 2142 ok 2143 ok 2144 ok 2145 ok 2146 ok 2147 ok 2148 ok 2149 ok 2150 ok 2151 ok 2152 ok 2153 ok 2154 ok 2155 ok 2156 ok 2157 ok 2158 ok 2159 ok 2160 ok 2161 ok 2162 ok 2163 ok 2164 ok 2165 ok 2166 ok 2167 ok 2168 ok 2169 ok 2170 ok 2171 ok 2172 ok 2173 ok 2174 ok 2175 ok 2176 ok 2177 ok 2178 ok 2179 ok 2180 ok 2181 ok 2182 ok 2183 ok 2184 ok 2185 ok 2186 ok 2187 ok 2188 ok 2189 ok 2190 ok 2191 ok 2192 ok 2193 ok 2194 ok 2195 ok 2196 ok 2197 ok 2198 ok 2199 ok 2200 ok 2201 ok 2202 ok 2203 ok 2204 ok 2205 ok 2206 ok 2207 ok 2208 ok 2209 ok 2210 ok 2211 ok 2212 ok 2213 ok 2214 ok 2215 ok 2216 ok 2217 ok 2218 ok 2219 ok 2220 ok 2221 ok 2222 ok 2223 ok 2224 ok 2225 ok 2226 ok 2227 ok 2228 ok 2229 ok 2230 ok 2231 ok 2232 ok 2233 ok 2234 ok 2235 ok 2236 ok 2237 ok 2238 ok 2239 ok 2240 ok 2241 ok 2242 ok 2243 ok 2244 ok 2245 ok 2246 ok 2247 ok 2248 ok 2249 ok 2250 ok 2251 ok 2252 ok 2253 ok 2254 ok 2255 ok 2256 ok 2257 ok 2258 ok 2259 ok 2260 ok 2261 ok 2262 ok 2263 ok 2264 ok 2265 ok 2266 ok 2267 ok 2268 ok 2269 ok 2270 ok 2271 ok 2272 ok 2273 ok 2274 ok 2275 ok 2276 ok 2277 ok 2278 ok 2279 ok 2280 ok 2281 ok 2282 ok 2283 ok 2284 ok 2285 ok 2286 ok 2287 ok 2288 ok 2289 ok 2290 ok 2291 ok 2292 ok 2293 ok 2294 ok 2295 ok 2296 ok 2297 ok 2298 ok 2299 ok 2300 ok 2301 ok 2302 ok 2303 ok 2304 ok 2305 ok 2306 ok 2307 ok 2308 ok 2309 ok 2310 ok 2311 ok 2312 ok 2313 ok 2314 ok 2315 ok 2316 ok 2317 ok 2318 ok 2319 ok 2320 ok 2321 ok 2322 ok 2323 ok 2324 ok 2325 ok 2326 ok 2327 ok 2328 ok 2329 ok 2330 ok 2331 ok 2332 ok 2333 ok 2334 ok 2335 ok 2336 ok 2337 ok 2338 ok 2339 ok 2340 ok 2341 ok 2342 ok 2343 ok 2344 ok 2345 ok 2346 ok 2347 ok 2348 ok 2349 ok 2350 ok 2351 ok 2352 ok 2353 ok 2354 ok 2355 ok 2356 ok 2357 ok 2358 ok 2359 ok 2360 ok 2361 ok 2362 ok 2363 ok 2364 ok 2365 ok 2366 ok 2367 ok 2368 ok 2369 ok 2370 ok 2371 ok 2372 ok 2373 ok 2374 ok 2375 ok 2376 ok 2377 ok 2378 ok 2379 ok 2380 ok 2381 ok 2382 ok 2383 ok 2384 ok 2385 ok 2386 ok 2387 ok 2388 ok 2389 ok 2390 ok 2391 ok 2392 ok 2393 ok 2394 ok 2395 ok 2396 ok 2397 ok 2398 ok 2399 ok 2400 ok 2401 ok 2402 ok 2403 ok 2404 ok 2405 ok 2406 ok 2407 ok 2408 ok 2409 ok 2410 ok 2411 ok 2412 ok 2413 ok 2414 ok 2415 ok 2416 ok 2417 ok 2418 ok 2419 ok 2420 ok 2421 ok 2422 ok 2423 ok 2424 ok 2425 ok 2426 ok 2427 ok 2428 ok 2429 ok 2430 ok 2431 ok 2432 ok t/104_sortby.t ............. 1..3 ok 1 ok 2 ok 3 ok t/105_esc_slash.t .......... 1..2 ok 1 ok 2 ok t/106_allow_barekey.t ...... 1..2 ok 1 ok 2 ok t/107_allow_singlequote.t .. 1..4 ok 1 ok 2 ok 3 ok 4 ok t/108_decode.t ............. 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok t/109_encode.t ............. 1..7 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok t/110_bignum.t ............. 1..6 ok 1 - The object isa Math::BigInt ok 2 ok 3 ok 4 - The object isa Math::BigFloat ok 5 ok 6 ok t/112_upgrade.t ............ 1..3 ok 1 ok 2 ok 3 ok t/113_overloaded_eq.t ...... 1..4 ok 1 ok 2 ok 3 ok 4 ok t/114_decode_prefix.t ...... 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/115_tie_ixhash.t ......... 1..2 ok 1 ok 2 ok All tests successful. Files=33, Tests=3467, 5 wallclock secs ( 0.44 usr + 0.03 sys = 0.47 CPU) Result: PASS MAKAMAKA/JSON-PP-2.27105.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for JSON-PP-2.27105 already made Running make for D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz Prepending C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob Prepending C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/Parse/CPAN/Meta.pm blib\lib\Parse\CPAN\Meta.pm DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/01_compile.t .... 1..3 ok 1 - Your perl is new enough ok 2 - use Parse::CPAN::Meta; ok 3 - use Parse::CPAN::Meta::Test; ok t/02_api.t ........ ok 1 - yaml_backend() ok 2 - load from YAML file results in expected data ok 3 - Found VR-META.yml ok 4 - Can read VR-META.yml ok 5 - Loaded VR-META.yml ok 6 - Content of VR-META.yml larger than 100 bytes ok 7 - load from YAML str results in expected data ok 8 - yaml_backend() ok 9 - Found VR-META.yml ok 10 - Can read VR-META.yml ok 11 - Loaded VR-META.yml ok 12 - Content of VR-META.yml larger than 100 bytes ok 13 - load_yaml_string using PERL_YAML_BACKEND ok 14 - json_backend() ok 15 - load from JSON file results in expected data ok 16 - Found VR-META.json ok 17 - Can read VR-META.json ok 18 - Loaded VR-META.json ok 19 - Content of VR-META.json larger than 100 bytes ok 20 - load from JSON str results in expected data ok 21 - Found VR-META.json ok 22 - Can read VR-META.json ok 23 - Loaded VR-META.json ok 24 - Content of VR-META.json larger than 100 bytes ok 25 - load_json_string with PERL_JSON_BACKEND = 0 ok 26 - Found VR-META.json ok 27 - Can read VR-META.json ok 28 - Loaded VR-META.json ok 29 - Content of VR-META.json larger than 100 bytes ok 30 - load_json_string with PERL_JSON_BACKEND = 'JSON::PP' ok 31 # skip JSON module version 2.5 not installed ok 32 # skip JSON module version 2.5 not installed 1..32 ok t/03_functions.t .. 1..2 ok 1 - one: Parsed correctly ok 2 - two: Parsed correctly ok t/04_export.t ..... 1..4 ok 1 - Load is not exported ok 2 - Dump is not exported ok 3 - LoadFile is not exported ok 4 - DumpFile is not exported ok t/05_errors.t ..... 1..1 ok 1 - error causes exception ok All tests successful. Files=5, Tests=42, 0 wallclock secs ( 0.05 usr + 0.01 sys = 0.06 CPU) Result: PASS DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for Parse-CPAN-Meta-1.4401 already made Running test for module 'CPAN::Meta::YAML' Running make for D/DA/DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz Prepending C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5 Prepending C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' Has already been made Prepending C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test Has already been tested successfully Running test for module 'Test::More' Running make for M/MS/MSCHWERN/Test-Simple-0.98.tar.gz Prepending C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'get' Checksum for C:\cpanfly\var\cpan\sources\authors\id\M\MS\MSCHWERN\Test-Simple-0.98.tar.gz ok Will not use Archive::Tar, need 1.00 Test-Simple-0.98/ Test-Simple-0.98/.perlcriticrc Test-Simple-0.98/.perltidyrc Test-Simple-0.98/Changes Test-Simple-0.98/examples/ Test-Simple-0.98/examples/indent.pl Test-Simple-0.98/examples/subtest.t Test-Simple-0.98/lib/ Test-Simple-0.98/lib/Test/ Test-Simple-0.98/lib/Test/Builder/ Test-Simple-0.98/lib/Test/Builder/IO/ Test-Simple-0.98/lib/Test/Builder/IO/Scalar.pm Test-Simple-0.98/lib/Test/Builder/Module.pm Test-Simple-0.98/lib/Test/Builder/Tester/ Test-Simple-0.98/lib/Test/Builder/Tester/Color.pm Test-Simple-0.98/lib/Test/Builder/Tester.pm Test-Simple-0.98/lib/Test/Builder.pm Test-Simple-0.98/lib/Test/More.pm Test-Simple-0.98/lib/Test/Simple.pm Test-Simple-0.98/lib/Test/Tutorial.pod Test-Simple-0.98/Makefile.PL Test-Simple-0.98/MANIFEST Test-Simple-0.98/MANIFEST.SKIP Test-Simple-0.98/META.yml Test-Simple-0.98/README Test-Simple-0.98/t/ Test-Simple-0.98/t/00compile.t Test-Simple-0.98/t/00test_harness_check.t Test-Simple-0.98/t/bad_plan.t Test-Simple-0.98/t/bail_out.t Test-Simple-0.98/t/BEGIN_require_ok.t Test-Simple-0.98/t/BEGIN_use_ok.t Test-Simple-0.98/t/buffer.t Test-Simple-0.98/t/Builder/ Test-Simple-0.98/t/Builder/Builder.t Test-Simple-0.98/t/Builder/carp.t Test-Simple-0.98/t/Builder/create.t Test-Simple-0.98/t/Builder/current_test.t Test-Simple-0.98/t/Builder/current_test_without_plan.t Test-Simple-0.98/t/Builder/details.t Test-Simple-0.98/t/Builder/done_testing.t Test-Simple-0.98/t/Builder/done_testing_double.t Test-Simple-0.98/t/Builder/done_testing_plan_mismatch.t Test-Simple-0.98/t/Builder/done_testing_with_no_plan.t Test-Simple-0.98/t/Builder/done_testing_with_number.t Test-Simple-0.98/t/Builder/done_testing_with_plan.t Test-Simple-0.98/t/Builder/fork_with_new_stdout.t Test-Simple-0.98/t/Builder/has_plan.t Test-Simple-0.98/t/Builder/has_plan2.t Test-Simple-0.98/t/Builder/is_fh.t Test-Simple-0.98/t/Builder/is_passing.t Test-Simple-0.98/t/Builder/maybe_regex.t Test-Simple-0.98/t/Builder/no_diag.t Test-Simple-0.98/t/Builder/no_ending.t Test-Simple-0.98/t/Builder/no_header.t Test-Simple-0.98/t/Builder/no_plan_at_all.t Test-Simple-0.98/t/Builder/ok_obj.t Test-Simple-0.98/t/Builder/output.t Test-Simple-0.98/t/Builder/reset.t Test-Simple-0.98/t/Builder/reset_outputs.t Test-Simple-0.98/t/Builder/try.t Test-Simple-0.98/t/c_flag.t Test-Simple-0.98/t/circular_data.t Test-Simple-0.98/t/cmp_ok.t Test-Simple-0.98/t/dependents.t Test-Simple-0.98/t/diag.t Test-Simple-0.98/t/died.t Test-Simple-0.98/t/dont_overwrite_die_handler.t Test-Simple-0.98/t/eq_set.t Test-Simple-0.98/t/exit.t Test-Simple-0.98/t/explain.t Test-Simple-0.98/t/extra.t Test-Simple-0.98/t/extra_one.t Test-Simple-0.98/t/fail-like.t Test-Simple-0.98/t/fail-more.t Test-Simple-0.98/t/fail.t Test-Simple-0.98/t/fail_one.t Test-Simple-0.98/t/filehandles.t Test-Simple-0.98/t/fork.t Test-Simple-0.98/t/harness_active.t Test-Simple-0.98/t/import.t Test-Simple-0.98/t/is_deeply_dne_bug.t Test-Simple-0.98/t/is_deeply_fail.t Test-Simple-0.98/t/is_deeply_with_threads.t Test-Simple-0.98/t/lib/ Test-Simple-0.98/t/lib/Dev/ Test-Simple-0.98/t/lib/Dev/Null.pm Test-Simple-0.98/t/lib/Dummy.pm Test-Simple-0.98/t/lib/MyOverload.pm Test-Simple-0.98/t/lib/NoExporter.pm Test-Simple-0.98/t/lib/SigDie.pm Test-Simple-0.98/t/lib/Test/ Test-Simple-0.98/t/lib/Test/Builder/ Test-Simple-0.98/t/lib/Test/Builder/NoOutput.pm Test-Simple-0.98/t/lib/Test/Simple/ Test-Simple-0.98/t/lib/Test/Simple/Catch.pm Test-Simple-0.98/t/lib/Test/Simple/sample_tests/ Test-Simple-0.98/t/lib/Test/Simple/sample_tests/death.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/death_in_eval.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/death_with_handler.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/exit.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/extras.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/five_fail.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/last_minute_death.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/one_fail.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/pre_plan_death.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/require.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/success.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/too_few.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/too_few_fail.plx Test-Simple-0.98/t/lib/Test/Simple/sample_tests/two_fail.plx Test-Simple-0.98/t/lib/TieOut.pm Test-Simple-0.98/t/missing.t Test-Simple-0.98/t/More.t Test-Simple-0.98/t/new_ok.t Test-Simple-0.98/t/no_plan.t Test-Simple-0.98/t/no_tests.t Test-Simple-0.98/t/note.t Test-Simple-0.98/t/overload.t Test-Simple-0.98/t/overload_threads.t Test-Simple-0.98/t/plan.t Test-Simple-0.98/t/plan_bad.t Test-Simple-0.98/t/plan_is_noplan.t Test-Simple-0.98/t/plan_no_plan.t Test-Simple-0.98/t/plan_shouldnt_import.t Test-Simple-0.98/t/plan_skip_all.t Test-Simple-0.98/t/pod-coverage.t Test-Simple-0.98/t/pod.t Test-Simple-0.98/t/require_ok.t Test-Simple-0.98/t/Simple/ Test-Simple-0.98/t/Simple/load.t Test-Simple-0.98/t/simple.t Test-Simple-0.98/t/skip.t Test-Simple-0.98/t/skipall.t Test-Simple-0.98/t/subtest/ Test-Simple-0.98/t/subtest/args.t Test-Simple-0.98/t/subtest/basic.t Test-Simple-0.98/t/subtest/die.t Test-Simple-0.98/t/subtest/do.t Test-Simple-0.98/t/subtest/exceptions.t Test-Simple-0.98/t/subtest/for_do_t.test Test-Simple-0.98/t/subtest/fork.t Test-Simple-0.98/t/subtest/implicit_done.t Test-Simple-0.98/t/subtest/line_numbers.t Test-Simple-0.98/t/subtest/plan.t Test-Simple-0.98/t/subtest/predicate.t Test-Simple-0.98/t/subtest/singleton.t Test-Simple-0.98/t/subtest/todo.t Test-Simple-0.98/t/subtest/wstat.t Test-Simple-0.98/t/tbm_doesnt_set_exported_to.t Test-Simple-0.98/t/Tester/ Test-Simple-0.98/t/Tester/tbt_01basic.t Test-Simple-0.98/t/Tester/tbt_02fhrestore.t Test-Simple-0.98/t/Tester/tbt_03die.t Test-Simple-0.98/t/Tester/tbt_04line_num.t Test-Simple-0.98/t/Tester/tbt_05faildiag.t Test-Simple-0.98/t/Tester/tbt_06errormess.t Test-Simple-0.98/t/Tester/tbt_07args.t Test-Simple-0.98/t/thread_taint.t Test-Simple-0.98/t/threads.t Test-Simple-0.98/t/todo.t Test-Simple-0.98/t/undef.t Test-Simple-0.98/t/use_ok.t Test-Simple-0.98/t/useing.t Test-Simple-0.98/t/utf8.t Test-Simple-0.98/t/versions.t Test-Simple-0.98/TODO Prepending C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'make' CPAN.pm: Going to build M/MS/MSCHWERN/Test-Simple-0.98.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Checking if your kit is complete... Looks good Writing Makefile for Test::Simple >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/Test/Builder/Tester/Color.pm blib\lib\Test\Builder\Tester\Color.pm cp lib/Test/Builder.pm blib\lib\Test\Builder.pm cp lib/Test/Simple.pm blib\lib\Test\Simple.pm cp lib/Test/Builder/IO/Scalar.pm blib\lib\Test\Builder\IO\Scalar.pm cp lib/Test/More.pm blib\lib\Test\More.pm cp lib/Test/Builder/Module.pm blib\lib\Test\Builder\Module.pm cp lib/Test/Builder/Tester.pm blib\lib\Test\Builder\Tester.pm cp lib/Test/Tutorial.pod blib\lib\Test\Tutorial.pod MSCHWERN/Test-Simple-0.98.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/*/*.t t/00compile.t ........................... 1..14 ok 1 ok 2 - POD test for Test/Builder.pm ok 3 ok 4 - POD test for Test/Builder/IO/Scalar.pm ok 5 ok 6 - POD test for Test/Builder/Module.pm ok 7 ok 8 - POD test for Test/Builder/Tester.pm ok 9 ok 10 - POD test for Test/Builder/Tester/Color.pm ok 11 ok 12 - POD test for Test/More.pm ok 13 ok 14 - POD test for Test/Simple.pm ok t/00test_harness_check.t ................ 1..1 ok 1 - T::H version ok t/bad_plan.t ............................ 1..2 ok 1 - bad plan() ok 2 - bad plan() ok t/bail_out.t ............................ 1..3 ok 1 ok 2 ok 3 - Backwards compat ok t/BEGIN_require_ok.t .................... ok 1 - require strict; ok 2 - require_ok ran 1..2 ok t/BEGIN_use_ok.t ........................ ok 1 - use strict; ok 2 - use_ok() ran 1..2 ok t/buffer.t .............................. 1..20 ok 1 - I'm ok ok 2 - You're ok ok 3 - I'm ok ok 4 - You're ok ok 5 - I'm ok ok 6 - You're ok ok 7 - I'm ok ok 8 - You're ok ok 9 - I'm ok ok 10 - You're ok ok 11 - I'm ok ok 12 - You're ok ok 13 - I'm ok ok 14 - You're ok ok 15 - I'm ok ok 16 - You're ok ok 17 - I'm ok ok 18 - You're ok ok 19 - I'm ok ok 20 - You're ok ok t/Builder/Builder.t ..................... 1..7 ok 1 - compiled and new() ok 2 - level() ok 3 - is_eq ok 4 - is_num ok 5 - current_test() get ok 6 - current_test() set ok 7 - counter still good ok t/Builder/carp.t ........................ 1..3 ok 1 ok 2 ok 3 ok t/Builder/create.t ...................... 1..7 ok 1 - The object isa Test::Builder ok 2 - create does not interfere with ->builder ok 3 - does not interfere with ->new ok 4 - The object isa Test::Builder ok 5 - Test::Builder->create makes a new object ok 6 ok 7 - Changing output() of new TB doesn't interfere with singleton ok t/Builder/current_test.t ................ 1..2 ok 1 ok 2 ok t/Builder/current_test_without_plan.t ... ok 1 ok 2 ok 3 - Third test 1..3 ok t/Builder/details.t ..................... 1..9 ok 1 - no tests yet, no summary ok 2 ok 3 ok 4 ok 5 - summary ok 6 - current_test incremented ok 7 - details() should return a list of all test details ok 8 ok 9 ok t/Builder/done_testing.t ................ ok 1 - testing done_testing() with no arguments ok 2 - another test so we're not testing just one 1..2 ok t/Builder/done_testing_double.t ......... 1..1 ok 1 - multiple done_testing ok t/Builder/done_testing_plan_mismatch.t .. 1..1 ok 1 ok t/Builder/done_testing_with_no_plan.t ... ok 1 ok 2 1..2 ok t/Builder/done_testing_with_number.t .... ok 1 - testing done_testing() with no arguments ok 2 - another test so we're not testing just one 1..2 ok t/Builder/done_testing_with_plan.t ...... 1..2 ok 1 ok 2 ok t/Builder/fork_with_new_stdout.t ........ 1..2 ok 1 ok 2 ok t/Builder/has_plan.t .................... 1..2 ok 1 - no plan yet defined ok 2 - has fixed plan ok t/Builder/has_plan2.t ................... ok 1 - has no_plan 1..1 ok t/Builder/is_fh.t ....................... 1..11 ok 1 - string is not a filehandle ok 2 - empty string ok 3 - undef ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/Builder/is_passing.t .................. ok 1 - a fresh TB object is passing ok 2 - still passing after a test ok 3 - not passing after a failing test ok 4 - a passing test doesn't resurrect it ok 5 - a successful plan doesn't help either ok 6 - Passing with a plan ok 7 - passing test, but it overran the plan ok 8 - Passing with no_plan ok 9 - still passing after a test ok 10 - and another test ok 11 - and after the ending ok 12 - Passing with skip_all ok 13 - All tests passed but done_testing() does not match ok 14 - No tests run with done_testing() ok 15 - All tests passed with done_testing() 1..15 ok t/Builder/maybe_regex.t ................. 1..16 ok 1 - qr// detected ok 2 - qr// good match ok 3 - qr// bad match ok 4 - blessed regex detected ok 5 - blessed qr/foo/ good match ok 6 - blessed qr/foo/ bad math ok 7 - "//" detected ok 8 - "//" good match ok 9 - "//" bad match ok 10 - non-regex detected ok 11 - non-regex detected ok 12 - "//" good match ok 13 - "//" bad match ok 14 - m,, detected ok 15 - "//" good match ok 16 - "//" bad match ok t/Builder/no_diag.t ..................... 1..2 ok 1 - foo ok 2 ok t/Builder/no_ending.t ................... 1..3 ok 1 ok 2 ok 3 ok t/Builder/no_header.t ................... 1..1 ok 1 ok t/Builder/no_plan_at_all.t .............. 1..1 ok 1 - proper behavior when no plan is seen ok t/Builder/ok_obj.t ...................... 1..4 ok 1 - created Foo object ok 2 - created Foo object ok 3 - created Foo object ok 4 - DESTROY called 3 times ok t/Builder/output.t ...................... 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 - One scalar, two filehandles ok 6 ok t/Builder/reset.t ....................... ok 1 - exported_to ok 2 - expected_tests ok 3 - level ok 4 - use_numbers ok 5 - no_header ok 6 - no_ending ok 7 - current_test ok 8 - summary ok 9 - details ok 10 - output ok 11 - failure_output ok 12 - todo_output ok 13 - final test to make sure output was reset 1..13 ok t/Builder/reset_outputs.t ............... ok 1 ok 2 ok 3 ok 4 - reset_outputs() resets output ok 5 - reset_outputs() resets failure_output ok 6 - reset_outputs() resets todo_output 1..6 ok t/Builder/try.t ......................... ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 1..8 ok t/c_flag.t .............................. 1..1 ok 1 ok t/circular_data.t ....................... 1..11 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/cmp_ok.t .............................. 1..20 ok 1 - right return ok 2 - passed without diagnostic ok 3 - right return ok 4 - failed without diagnostic ok 5 - right return ok 6 - failed without diagnostic ok 7 - right return ok 8 - passed without diagnostic ok 9 - right return ok 10 - passed without diagnostic ok 11 - right return ok 12 - failed without diagnostic ok 13 - right return ok 14 - passed without diagnostic ok 15 - right return ok 16 - passed without diagnostic ok 17 - right return ok 18 - expected error ok 19 - right return ok 20 - expected error ok t/dependents.t .......................... skipped: Dependents only tested when releasing t/diag.t ................................ 1..7 ok 1 - diag() with todo_output set ok 2 - multi line ok 3 - diag returns false ok 4 - diag() adds \# even if there's one already ok 5 - blank lines get escaped ok 6 - even at the end ok 7 ok t/died.t ................................ 1..3 ok 1 ok 2 ok 3 - exit code ok t/dont_overwrite_die_handler.t .......... 1..2 ok 1 ok 2 - existing DIE handler not overridden ok t/eq_set.t .............................. 1..4 ok 1 ok 2 ok 3 not ok 4 # TODO eq_set() doesn't really handle references # Failed (TODO) test at t/eq_set.t line 32. ok t/exit.t ................................ # Building up a map of exit codes. May take a while. ok 1 - exit map test for 0 ok 2 - exit map test for 1 ok 3 - exit map test for 2 ok 4 - exit map test for 3 ok 5 - exit map test for 4 ok 6 - exit map test for 5 ok 7 - exit map test for 6 ok 8 - exit map test for 7 ok 9 - exit map test for 8 ok 10 - exit map test for 9 ok 11 - exit map test for 10 ok 12 - exit map test for 11 ok 13 - exit map test for 12 ok 14 - exit map test for 13 ok 15 - exit map test for 14 ok 16 - exit map test for 15 ok 17 - exit map test for 16 ok 18 - exit map test for 17 ok 19 - exit map test for 18 ok 20 - exit map test for 19 ok 21 - exit map test for 20 ok 22 - exit map test for 21 ok 23 - exit map test for 22 ok 24 - exit map test for 23 ok 25 - exit map test for 24 ok 26 - exit map test for 25 ok 27 - exit map test for 26 ok 28 - exit map test for 27 ok 29 - exit map test for 28 ok 30 - exit map test for 29 ok 31 - exit map test for 30 ok 32 - exit map test for 31 ok 33 - exit map test for 32 ok 34 - exit map test for 33 ok 35 - exit map test for 34 ok 36 - exit map test for 35 ok 37 - exit map test for 36 ok 38 - exit map test for 37 ok 39 - exit map test for 38 ok 40 - exit map test for 39 ok 41 - exit map test for 40 ok 42 - exit map test for 41 ok 43 - exit map test for 42 ok 44 - exit map test for 43 ok 45 - exit map test for 44 ok 46 - exit map test for 45 ok 47 - exit map test for 46 ok 48 - exit map test for 47 ok 49 - exit map test for 48 ok 50 - exit map test for 49 ok 51 - exit map test for 50 ok 52 - exit map test for 51 ok 53 - exit map test for 52 ok 54 - exit map test for 53 ok 55 - exit map test for 54 ok 56 - exit map test for 55 ok 57 - exit map test for 56 ok 58 - exit map test for 57 ok 59 - exit map test for 58 ok 60 - exit map test for 59 ok 61 - exit map test for 60 ok 62 - exit map test for 61 ok 63 - exit map test for 62 ok 64 - exit map test for 63 ok 65 - exit map test for 64 ok 66 - exit map test for 65 ok 67 - exit map test for 66 ok 68 - exit map test for 67 ok 69 - exit map test for 68 ok 70 - exit map test for 69 ok 71 - exit map test for 70 ok 72 - exit map test for 71 ok 73 - exit map test for 72 ok 74 - exit map test for 73 ok 75 - exit map test for 74 ok 76 - exit map test for 75 ok 77 - exit map test for 76 ok 78 - exit map test for 77 ok 79 - exit map test for 78 ok 80 - exit map test for 79 ok 81 - exit map test for 80 ok 82 - exit map test for 81 ok 83 - exit map test for 82 ok 84 - exit map test for 83 ok 85 - exit map test for 84 ok 86 - exit map test for 85 ok 87 - exit map test for 86 ok 88 - exit map test for 87 ok 89 - exit map test for 88 ok 90 - exit map test for 89 ok 91 - exit map test for 90 ok 92 - exit map test for 91 ok 93 - exit map test for 92 ok 94 - exit map test for 93 ok 95 - exit map test for 94 ok 96 - exit map test for 95 ok 97 - exit map test for 96 ok 98 - exit map test for 97 ok 99 - exit map test for 98 ok 100 - exit map test for 99 ok 101 - exit map test for 100 ok 102 - exit map test for 101 ok 103 - exit map test for 102 ok 104 - exit map test for 103 ok 105 - exit map test for 104 ok 106 - exit map test for 105 ok 107 - exit map test for 106 ok 108 - exit map test for 107 ok 109 - exit map test for 108 ok 110 - exit map test for 109 ok 111 - exit map test for 110 ok 112 - exit map test for 111 ok 113 - exit map test for 112 ok 114 - exit map test for 113 ok 115 - exit map test for 114 ok 116 - exit map test for 115 ok 117 - exit map test for 116 ok 118 - exit map test for 117 ok 119 - exit map test for 118 ok 120 - exit map test for 119 ok 121 - exit map test for 120 ok 122 - exit map test for 121 ok 123 - exit map test for 122 ok 124 - exit map test for 123 ok 125 - exit map test for 124 ok 126 - exit map test for 125 ok 127 - exit map test for 126 ok 128 - exit map test for 127 ok 129 - exit map test for 128 ok 130 - exit map test for 129 ok 131 - exit map test for 130 ok 132 - exit map test for 131 ok 133 - exit map test for 132 ok 134 - exit map test for 133 ok 135 - exit map test for 134 ok 136 - exit map test for 135 ok 137 - exit map test for 136 ok 138 - exit map test for 137 ok 139 - exit map test for 138 ok 140 - exit map test for 139 ok 141 - exit map test for 140 ok 142 - exit map test for 141 ok 143 - exit map test for 142 ok 144 - exit map test for 143 ok 145 - exit map test for 144 ok 146 - exit map test for 145 ok 147 - exit map test for 146 ok 148 - exit map test for 147 ok 149 - exit map test for 148 ok 150 - exit map test for 149 ok 151 - exit map test for 150 ok 152 - exit map test for 151 ok 153 - exit map test for 152 ok 154 - exit map test for 153 ok 155 - exit map test for 154 ok 156 - exit map test for 155 ok 157 - exit map test for 156 ok 158 - exit map test for 157 ok 159 - exit map test for 158 ok 160 - exit map test for 159 ok 161 - exit map test for 160 ok 162 - exit map test for 161 ok 163 - exit map test for 162 ok 164 - exit map test for 163 ok 165 - exit map test for 164 ok 166 - exit map test for 165 ok 167 - exit map test for 166 ok 168 - exit map test for 167 ok 169 - exit map test for 168 ok 170 - exit map test for 169 ok 171 - exit map test for 170 ok 172 - exit map test for 171 ok 173 - exit map test for 172 ok 174 - exit map test for 173 ok 175 - exit map test for 174 ok 176 - exit map test for 175 ok 177 - exit map test for 176 ok 178 - exit map test for 177 ok 179 - exit map test for 178 ok 180 - exit map test for 179 ok 181 - exit map test for 180 ok 182 - exit map test for 181 ok 183 - exit map test for 182 ok 184 - exit map test for 183 ok 185 - exit map test for 184 ok 186 - exit map test for 185 ok 187 - exit map test for 186 ok 188 - exit map test for 187 ok 189 - exit map test for 188 ok 190 - exit map test for 189 ok 191 - exit map test for 190 ok 192 - exit map test for 191 ok 193 - exit map test for 192 ok 194 - exit map test for 193 ok 195 - exit map test for 194 ok 196 - exit map test for 195 ok 197 - exit map test for 196 ok 198 - exit map test for 197 ok 199 - exit map test for 198 ok 200 - exit map test for 199 ok 201 - exit map test for 200 ok 202 - exit map test for 201 ok 203 - exit map test for 202 ok 204 - exit map test for 203 ok 205 - exit map test for 204 ok 206 - exit map test for 205 ok 207 - exit map test for 206 ok 208 - exit map test for 207 ok 209 - exit map test for 208 ok 210 - exit map test for 209 ok 211 - exit map test for 210 ok 212 - exit map test for 211 ok 213 - exit map test for 212 ok 214 - exit map test for 213 ok 215 - exit map test for 214 ok 216 - exit map test for 215 ok 217 - exit map test for 216 ok 218 - exit map test for 217 ok 219 - exit map test for 218 ok 220 - exit map test for 219 ok 221 - exit map test for 220 ok 222 - exit map test for 221 ok 223 - exit map test for 222 ok 224 - exit map test for 223 ok 225 - exit map test for 224 ok 226 - exit map test for 225 ok 227 - exit map test for 226 ok 228 - exit map test for 227 ok 229 - exit map test for 228 ok 230 - exit map test for 229 ok 231 - exit map test for 230 ok 232 - exit map test for 231 ok 233 - exit map test for 232 ok 234 - exit map test for 233 ok 235 - exit map test for 234 ok 236 - exit map test for 235 ok 237 - exit map test for 236 ok 238 - exit map test for 237 ok 239 - exit map test for 238 ok 240 - exit map test for 239 ok 241 - exit map test for 240 ok 242 - exit map test for 241 ok 243 - exit map test for 242 ok 244 - exit map test for 243 ok 245 - exit map test for 244 ok 246 - exit map test for 245 ok 247 - exit map test for 246 ok 248 - exit map test for 247 ok 249 - exit map test for 248 ok 250 - exit map test for 249 ok 251 - exit map test for 250 ok 252 - exit map test for 251 ok 253 - exit map test for 252 ok 254 - exit map test for 253 ok 255 - exit map test for 254 ok 256 - exit map test for 255 # Done. ok 257 - death.plx exited with 255 (expected 255) ok 258 - too_few.plx exited with 255 (expected 255) ok 259 - require.plx exited with 0 (expected 0) ok 260 - too_few_fail.plx exited with 2 (expected 2) ok 261 - five_fail.plx exited with 5 (expected 5) ok 262 - pre_plan_death.plx exited with 9 (expected non-zero) ok 263 - death_with_handler.plx exited with 255 (expected 255) ok 264 - extras.plx exited with 2 (expected 2) ok 265 - success.plx exited with 0 (expected 0) ok 266 - two_fail.plx exited with 2 (expected 2) ok 267 - death_in_eval.plx exited with 0 (expected 0) ok 268 - last_minute_death.plx exited with 255 (expected 255) ok 269 - one_fail.plx exited with 1 (expected 1) ok 270 - exit.plx exited with 1 (expected 1) 1..270 ok t/explain.t ............................. 1..5 ok 1 - main->can('explain') ok 2 ok 3 ok 4 ok 5 ok t/extra.t ............................... ok 1 ok 2 ok 3 ok 4 ok 5 1..5 ok t/extra_one.t ........................... 1..2 ok 1 ok 2 ok t/fail-like.t ........................... 1..4 ok 1 - failing output ok 2 - failing errors ok 3 ok 4 ok t/fail-more.t ........................... 1..80 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 not ok 69 # TODO cmp_ok() gives the wrong "expected" for undef # Failed (TODO) test at t/fail-more.t line 446. # got: '# Failed test 'undef ne empty string' # # at t/fail-more.t line 437. # # got: undef # # expected: anything else # ' # expected: '# Failed test 'undef ne empty string' # # at t/fail-more.t line 437. # # got: undef # # expected: '' # ' ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok t/fail.t ................................ ok 1 ok 2 1..2 ok t/fail_one.t ............................ ok 1 ok 2 1..2 ok t/filehandles.t ......................... 1..1 ok 1 - STDOUT can be mucked with ok t/fork.t ................................ 1..1 ok 1 - Only the parent should process the ending, not the child ok t/harness_active.t ...................... 1..4 ok 1 ok 2 ok 3 ok 4 ok t/import.t .............................. 1..2 ok 1 - main->can(...) ok 2 - fail() not exported ok t/is_deeply_dne_bug.t ................... 1..2 ok 1 ok 2 ok t/is_deeply_fail.t ...................... 1..100 ok 1 ok 2 - plain strings ok 3 - right diagnostic ok 4 ok 5 - different types ok 6 - right diagnostic ok 7 ok 8 - hashes with different values ok 9 - right diagnostic ok 10 ok 11 - hashes with different keys ok 12 - right diagnostic ok 13 ok 14 - arrays of different length ok 15 - right diagnostic ok 16 ok 17 - arrays of undefs ok 18 - right diagnostic ok 19 ok 20 - hashes of undefs ok 21 - right diagnostic ok 22 ok 23 - scalar refs ok 24 - right diagnostic ok 25 ok 26 - mixed scalar and array refs ok 27 - right diagnostic ok 28 ok 29 - deep scalar refs ok 30 - right diagnostic ok 31 ok 32 - @Data_Stack not holding onto things ok 33 - deep structures ok 34 - right diagnostic ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - undef != "" ok 42 - @Data_Stack not holding onto things ok 43 - don't compare refs like strings ok 44 - even deep inside ok 45 - [] could match non-existent values ok 46 ok 47 ok 48 - scalar refs in an array ok 49 - right diagnostic ok 50 ok 51 - scalar vs ref ok 52 - right diagnostic ok 53 ok 54 - ref vs scalar ok 55 - right diagnostic ok 56 ok 57 - is_deeply and undef [RT 9441] ok 58 - right diagnostic ok 59 ok 60 - is_deeply and different reference types ok 61 - right diagnostic ok 62 ok 63 - nested different ref types ok 64 - right diagnostic ok 65 ok 66 - string overloaded refs respected in diag ok 67 - right diagnostic ok 68 - function refs ok 69 ok 70 - right diagnostic ok 71 - typeglobs ok 72 ok 73 - right diagnostic ok 74 ok 75 ok 76 - right diagnostic ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok t/is_deeply_with_threads.t .............. skipped: many perls have broken threads. Enable with AUTHOR_TESTING. t/missing.t ............................. 1..2 ok 1 ok 2 ok t/More.t ................................ 1..54 ok 1 - use Dummy; ok 2 - use_ok() loads a module ok 3 - require Test::More; ok 4 - two is two is two is two ok 5 - foo is foo ok 6 - foo isnt bar ok 7 - foo isn't bar ok 8 - foo is like fooble ok 9 - foo is like FooBle ok 10 - regexes with slashes in like ok 11 - unlike bar ok 12 - foo is unlike FooBle ok 13 - regexes with slashes in unlike ok 14 ok 15 - Test::More->can(...) ok 16 - Test::More->can(...) ok 17 - The object isa Foo ok 18 - The reference isa ARRAY ok 19 - The reference isa SCALAR ok 20 - The class isa Bar ok 21 ok 22 ok 23 - Foo->can('blah') ok 24 - The object isa blah ok 25 - pass() passed ok 26 - eq_array with simple arrays ok 27 - @Data_Stack not holding onto things ok 28 - eq_hash with simple hashes ok 29 ok 30 - eq_set with simple sets ok 31 ok 32 - is_deeply with arrays ok 33 - eq_array with complicated arrays ok 34 - eq_set with complicated arrays ok 35 - eq_array with slightly different complicated arrays ok 36 ok 37 - eq_set with slightly different complicated arrays ok 38 ok 39 - is_deeply with complicated hashes ok 40 - eq_hash with complicated hashes ok 41 - eq_hash with slightly different complicated hashes ok 42 ok 43 - builder() ok 44 - cmp_ok == ok 45 - eq ok 46 - < ok 47 - || ok 48 - The object isa Wibblemeister ok 49 - the same function ref ok 50 - the same glob ok 51 ok 52 - same regex ok 53 - $@ untouched ok 54 - $! untouched ok t/new_ok.t .............................. 1..13 ok 1 - The object isa Foo ok 2 ok 3 - The object isa Foo ok 4 - The object isa Bar ok 5 ok 6 - The object isa Bar ok 7 - The object isa Foo ok 8 ok 9 - The object isa Foo ok 10 - Foo isa Foo ok 11 ok 12 - The object isa Foo ok 13 ok t/no_plan.t ............................. 1..7 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok t/no_tests.t ............................ 1..3 ok 1 ok 2 ok 3 - exit code ok t/note.t ................................ 1..2 ok 1 ok 2 ok t/overload.t ............................ 1..19 ok 1 - The object isa Overloaded ok 2 - cmp_ok() eq ok 3 - does not stringify ok 4 - is() with string overloading ok 5 - cmp_ok() with number overloading ok 6 - does not numify ok 7 - is_deeply with string overloading ok 8 - eq_array ... ok 9 - eq_hash ... ok 10 - is_deeply with string overloading at the top ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - The object isa Overloaded ok 17 - cmp_ok() eq ok 18 - does not stringify ok 19 - is() with string overloading ok t/overload_threads.t .................... 1..5 ok 1 - foo ok 2 ok 3 not ok 4 - Just checking todo as an overloaded value # TODO not really todo, testing overloaded reason # Failed (TODO) test 'Just checking todo as an overloaded value' # at t/overload_threads.t line 53. ok 5 # skip not really skipped, testing overloaded reason ok t/plan.t ................................ 1..4 ok 1 - disallow double plan ok 2 - disallow changing plan ok 3 - Just testing plan() ok 4 - Testing it some more ok t/plan_bad.t ............................ 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok t/plan_is_noplan.t ...................... 1..1 ok 1 ok t/plan_no_plan.t ........................ ok 1 - Just testing ok 2 - Testing again ok 3 # skip Just testing skip with no_plan ok 4 - skip with no "how_many" ok with no_plan not ok 5 # TODO & SKIP Just testing todo_skip ok 6 - skip with no "how_many" ok with no_plan 1..6 ok t/plan_shouldnt_import.t ................ 1..1 ok 1 - plan should not export ok t/plan_skip_all.t ....................... skipped: Just testing plan & skip_all t/pod-coverage.t ........................ 1..7 ok 1 - Pod coverage on Test::Builder ok 2 - Pod coverage on Test::More ok 3 - Pod coverage on Test::Simple ok 4 - Pod coverage on Test::Builder::Module ok 5 - Pod coverage on Test::Builder::Tester ok 6 - Pod coverage on Test::Builder::IO::Scalar ok 7 - Pod coverage on Test::Builder::Tester::Color ok t/pod.t ................................. 1..8 ok 1 - POD test for blib\lib\Test\Builder.pm ok 2 - POD test for blib\lib\Test\More.pm ok 3 - POD test for blib\lib\Test\Simple.pm ok 4 - POD test for blib\lib\Test\Tutorial.pod ok 5 - POD test for blib\lib\Test\Builder\Module.pm ok 6 - POD test for blib\lib\Test\Builder\Tester.pm ok 7 - POD test for blib\lib\Test\Builder\IO\Scalar.pm ok 8 - POD test for blib\lib\Test\Builder\Tester\Color.pm ok t/require_ok.t .......................... 1..8 ok 1 - require Symbol; ok 2 - require_ok MODULE ok 3 - require 'Class/Struct.pm'; ok 4 - require_ok FILE ok 5 ok 6 ok 7 ok 8 ok t/simple.t .............................. 1..3 ok 1 - compile ok 2 ok 3 - foo ok t/Simple/load.t ......................... 1..1 ok 1 - use Test::Simple with no arguments ok t/skip.t ................................ 1..17 ok 1 # skip Just testing the skip interface. ok 2 # skip Just testing the skip interface. ok 3 - Inside skip block ok 4 - Another inside ok 5 - calling package not interfered with ok 6 - or file ok 7 - or line ok 8 # skip Just testing the skip interface. ok 9 # skip Just testing the skip interface. ok 10 # skip Just testing the skip interface. ok 11 - skip without $how_many warning ok 12 - This is supposed to run ok 13 # skip Just testing the skip interface. ok 14 # skip Just testing the skip interface. ok 15 - This is supposed to run, too ok 16 # skip 1 ok 17 ok t/skipall.t ............................. 1..2 ok 1 ok 2 ok t/subtest/args.t ........................ ok 1 ok 2 ok 3 ok 4 1..4 ok t/subtest/basic.t ....................... 1..19 ok 1 - Output should nest properly ok 2 - We should allow arbitrary nesting ok 3 - Previous child failures should not force subsequent failures ok 4 - The child should copy the (Out_FH) filehandle ok 5 - The child should copy the (Todo_FH) filehandle ok 6 - The child should copy the (Fail_FH) filehandle ok 7 - Test::Builder::NoOutput->can('parent') ok 8 - ... and it should return the parent of the child ok 9 - ... but top level builders should not have parents ok 10 - Test::Builder::NoOutput->can('name') ok 11 - The top level name should be $0 ok 12 - ... but child names should be whatever we set them to ok 13 - ... or at least have a sensible default ok 14 - A child which does a "skip_all" should throw an exception ok 15 - ... and the exception it throws isa Test::Builder::Exception 1..0 # SKIP subtest with skip_all ok 16 # skip subtest with skip_all ok 17 - Subtests which "skip_all" are reported as skipped tests ok 18 - TODO tests should not make the parent test fail ok 19 - Not running subtests should make the parent test fail ok t/subtest/die.t ......................... ok 1 ok 2 ok 3 - the parent object is restored after a die 1..3 ok t/subtest/do.t .......................... ok 1 - First ok 2 - subtest test file exists ok 1 - First ok 2 - Second ok 3 - Third 1..3 ok 3 - t/subtest/for_do_t.test ok 4 - Last 1..4 ok t/subtest/exceptions.t .................. 1..7 ok 1 - Trying to create a child with another one active should fail ok 2 - Trying to create nested children should succeed ok 3 - ... but trying to finalize() a child with open children should fail ok 4 - Failing to call finalize should issue an appropriate diagnostic ok 5 - ... and should cause the test suite to fail ok 6 - Running a test with active children should fail ok 7 - ... and should cause the test suite to fail ok t/subtest/fork.t ........................ 1..1 1..2 ok 1 - child exit status ok 2 - child output ok 1 - fork within subtest ok t/subtest/implicit_done.t ............... ok 1 - Before ok 1 - Inside sub test 1..1 ok 2 - basic ok 1 - This has done_testing 1..1 ok 3 - with done 1..1 ok 1 - I have a plan, Batman! ok 4 - with plan 1..0 # SKIP Skipping ok 5 # skip Skipping ok 6 - After 1..6 ok t/subtest/line_numbers.t ................ 1..5 ok 1 - un-named inner tests ok 2 - named inner tests ok 3 - subtest() called from a sub ok 4 - lineno in 'No tests run' diagnostic ok 5 - diag indent for is() in subtest ok t/subtest/plan.t ........................ 1..6 ok 1 - subtest() should be exported to our namespace ok 2 - ... has no prototype 1..2 ok 1 - planned subtests should work ok 2 - ... and support more than one test ok 3 - subtest with plan ok 1 - no_plan subtests should work ok 2 - ... and support more than one test ok 3 - ... no matter how many tests are run 1..3 ok 4 - subtest without plan ok 1 - subtests with an implicit done testing should work ok 2 - ... and support more than one test ok 3 - ... no matter how many tests are run 1..3 ok 5 - subtest with implicit done_testing() ok 1 - subtests with an explicit done testing should work ok 2 - ... and support more than one test ok 3 - ... no matter how many tests are run 1..3 ok 6 - subtest with explicit done_testing() ok t/subtest/predicate.t ................... 1..4 ok 1 - foobar_ok failing line numbers ok 2 - foobar_ok_2 failing line numbers ok 3 - barfoo_ok failing line numbers ok 4 - barfoo_ok_2 failing line numbers ok t/subtest/singleton.t ................... 1..3 ok 1 - TB top level 1..4 ok 1 - first test in subtest ok 2 - this should not fail ok 3 - second test in subtest ok 4 - this should not fail ok 2 - doing a subtest ok 3 - left subtest ok t/subtest/todo.t ........................ 1..96 ok 1 - plan, no tests run (1), todo [Reason] set via $TODO ok 2 - plan, no tests run (1), todo [Reason] set via todo_start ok 3 - plan, no tests run (1), todo [] set via todo_start ok 4 - plan, no tests run (1), todo [0] set via todo_start ok 5 - plan, no tests run (2), todo [Reason] set via $TODO ok 6 - plan, no tests run (2), todo [Reason] set via todo_start ok 7 - plan, no tests run (2), todo [] set via todo_start ok 8 - plan, no tests run (2), todo [0] set via todo_start ok 9 - plan, no tests run (3), todo [Reason] set via $TODO ok 10 - plan, no tests run (3), todo [Reason] set via todo_start ok 11 - plan, no tests run (3), todo [] set via todo_start ok 12 - plan, no tests run (3), todo [0] set via todo_start ok 13 - noplan, no tests run (1), todo [Reason] set via $TODO ok 14 - noplan, no tests run (1), todo [Reason] set via todo_start ok 15 - noplan, no tests run (1), todo [] set via todo_start ok 16 - noplan, no tests run (1), todo [0] set via todo_start ok 17 - noplan, no tests run (2), todo [Reason] set via $TODO ok 18 - noplan, no tests run (2), todo [Reason] set via todo_start ok 19 - noplan, no tests run (2), todo [] set via todo_start ok 20 - noplan, no tests run (2), todo [0] set via todo_start ok 21 - noplan, no tests run (3), todo [Reason] set via $TODO ok 22 - noplan, no tests run (3), todo [Reason] set via todo_start ok 23 - noplan, no tests run (3), todo [] set via todo_start ok 24 - noplan, no tests run (3), todo [0] set via todo_start ok 25 - missingplan, no tests run (1), todo [Reason] set via $TODO ok 26 - missingplan, no tests run (1), todo [Reason] set via todo_start ok 27 - missingplan, no tests run (1), todo [] set via todo_start ok 28 - missingplan, no tests run (1), todo [0] set via todo_start ok 29 - missingplan, no tests run (2), todo [Reason] set via $TODO ok 30 - missingplan, no tests run (2), todo [Reason] set via todo_start ok 31 - missingplan, no tests run (2), todo [] set via todo_start ok 32 - missingplan, no tests run (2), todo [0] set via todo_start ok 33 - missingplan, no tests run (3), todo [Reason] set via $TODO ok 34 - missingplan, no tests run (3), todo [Reason] set via todo_start ok 35 - missingplan, no tests run (3), todo [] set via todo_start ok 36 - missingplan, no tests run (3), todo [0] set via todo_start ok 37 - donetesting, no tests run (1), todo [Reason] set via $TODO ok 38 - donetesting, no tests run (1), todo [Reason] set via todo_start ok 39 - donetesting, no tests run (1), todo [] set via todo_start ok 40 - donetesting, no tests run (1), todo [0] set via todo_start ok 41 - donetesting, no tests run (2), todo [Reason] set via $TODO ok 42 - donetesting, no tests run (2), todo [Reason] set via todo_start ok 43 - donetesting, no tests run (2), todo [] set via todo_start ok 44 - donetesting, no tests run (2), todo [0] set via todo_start ok 45 - donetesting, no tests run (3), todo [Reason] set via $TODO ok 46 - donetesting, no tests run (3), todo [Reason] set via todo_start ok 47 - donetesting, no tests run (3), todo [] set via todo_start ok 48 - donetesting, no tests run (3), todo [0] set via todo_start ok 49 - 1 failed test (1), todo [Reason] set via $TODO ok 50 - 1 failed test (1), todo [Reason] set via todo_start ok 51 - 1 failed test (1), todo [] set via todo_start ok 52 - 1 failed test (1), todo [0] set via todo_start ok 53 - 1 failed test (2), todo [Reason] set via $TODO ok 54 - 1 failed test (2), todo [Reason] set via todo_start ok 55 - 1 failed test (2), todo [] set via todo_start ok 56 - 1 failed test (2), todo [0] set via todo_start ok 57 - 1 failed test (3), todo [Reason] set via $TODO ok 58 - 1 failed test (3), todo [Reason] set via todo_start ok 59 - 1 failed test (3), todo [] set via todo_start ok 60 - 1 failed test (3), todo [0] set via todo_start ok 61 - 1fail, wrongplan (1), todo [Reason] set via $TODO ok 62 - 1fail, wrongplan (1), todo [Reason] set via todo_start ok 63 - 1fail, wrongplan (1), todo [] set via todo_start ok 64 - 1fail, wrongplan (1), todo [0] set via todo_start ok 65 - 1fail, wrongplan (2), todo [Reason] set via $TODO ok 66 - 1fail, wrongplan (2), todo [Reason] set via todo_start ok 67 - 1fail, wrongplan (2), todo [] set via todo_start ok 68 - 1fail, wrongplan (2), todo [0] set via todo_start ok 69 - 1fail, wrongplan (3), todo [Reason] set via $TODO ok 70 - 1fail, wrongplan (3), todo [Reason] set via todo_start ok 71 - 1fail, wrongplan (3), todo [] set via todo_start ok 72 - 1fail, wrongplan (3), todo [0] set via todo_start ok 73 - 1fail, 1pass (1), todo [Reason] set via $TODO ok 74 - 1fail, 1pass (1), todo [Reason] set via todo_start ok 75 - 1fail, 1pass (1), todo [] set via todo_start ok 76 - 1fail, 1pass (1), todo [0] set via todo_start ok 77 - 1fail, 1pass (2), todo [Reason] set via $TODO ok 78 - 1fail, 1pass (2), todo [Reason] set via todo_start ok 79 - 1fail, 1pass (2), todo [] set via todo_start ok 80 - 1fail, 1pass (2), todo [0] set via todo_start ok 81 - 1fail, 1pass (3), todo [Reason] set via $TODO ok 82 - 1fail, 1pass (3), todo [Reason] set via todo_start ok 83 - 1fail, 1pass (3), todo [] set via todo_start ok 84 - 1fail, 1pass (3), todo [0] set via todo_start ok 85 - todo tests in the subtest (1), todo [Reason] set via $TODO ok 86 - todo tests in the subtest (1), todo [Reason] set via todo_start ok 87 - todo tests in the subtest (1), todo [] set via todo_start ok 88 - todo tests in the subtest (1), todo [0] set via todo_start ok 89 - todo tests in the subtest (2), todo [Reason] set via $TODO ok 90 - todo tests in the subtest (2), todo [Reason] set via todo_start ok 91 - todo tests in the subtest (2), todo [] set via todo_start ok 92 - todo tests in the subtest (2), todo [0] set via todo_start ok 93 - todo tests in the subtest (3), todo [Reason] set via $TODO ok 94 - todo tests in the subtest (3), todo [Reason] set via todo_start ok 95 - todo tests in the subtest (3), todo [] set via todo_start ok 96 - todo tests in the subtest (3), todo [0] set via todo_start ok t/subtest/wstat.t ....................... 1..1 ok 1 - bar ok 1 - foo ok 2 - exit code keeps on from a subtest 1..1 ok 1 - bar2 ok 3 - foo2 ok 4 - exit code keeps on from a subtest 1..4 ok t/tbm_doesnt_set_exported_to.t .......... 1..1 ok 1 - using Test::Builder::Module does not set exported_to() ok t/Tester/tbt_01basic.t .................. 1..9 ok 1 - This is a basic test ok 2 - captured okay on basic ok 3 - captured okay again without changing number ok 4 - test unrelated to Test::Builder::Tester ok 5 - multiple tests ok 6 - testing failing ok 7 - testing failing on the same line with no name ok 8 - testing failing on the same line with the same name ok 9 - testing failing with todo ok t/Tester/tbt_02fhrestore.t .............. 1..4 ok 1 - standard test okay ok 2 - output file reconnected ok 3 - todo output file reconnected ok 4 - failure output file reconnected ok t/Tester/tbt_03die.t .................... 1..1 ok 1 - dies correctly on error ok t/Tester/tbt_04line_num.t ............... 1..3 ok 1 - normal line num ok 2 - line number minus one ok 3 - line number plus two ok t/Tester/tbt_05faildiag.t ............... 1..5 ok 1 - test fail ok 2 - test_fail first ok 3 - test diag ok 4 - test diag multi line ok 5 - test diag multiple ok t/Tester/tbt_06errormess.t .............. 1..8 ok 1 - STDOUT basic meta meta test ok 2 - STDERR basic meta meta test ok 3 - STDOUT basic meta meta test 2 ok 4 - STDERR basic meta meta test 2 ok 5 - STDOUT meta meta test with tbt ok 6 - STDERR meta meta test with tbt ok 7 - STDOUT meta meta test with tbt2 ok 8 - STDERR meta meta test with tbt2 ok t/Tester/tbt_07args.t ................... 1..18 ok 1 - STDOUT basic meta meta test ok 2 - STDERR basic meta meta test ok 3 - STDOUT basic meta meta test 2 ok 4 - STDERR basic meta meta test 2 ok 5 - STDOUT meta meta test with tbt ok 6 - STDERR meta meta test with tbt ok 7 - STDOUT meta meta test with tbt2 ok 8 - STDERR meta meta test with tbt2 ok 9 - STDOUT meta test name ok 10 - STDERR meta test name ok 11 - STDOUT meta test title ok 12 - STDERR meta test title ok 13 - STDOUT meta test title ok 14 - STDERR meta test title ok 15 - STDOUT meta test skip_out ok 16 - STDERR meta test skip_out ok 17 - STDOUT meta test skip_err ok 18 - STDERR meta test skip_err ok t/thread_taint.t ........................ 1..1 ok 1 - Loading Test::More does not load threads.pm ok t/threads.t ............................. 1..6 ok 1 - Each of these should app the test number ok 2 - Each of these should app the test number ok 3 - Each of these should app the test number ok 4 - Each of these should app the test number ok 5 - Each of these should app the test number ok 6 - Should be five ok t/todo.t ................................ 1..36 not ok 1 - Expected failure # TODO Just testing the todo interface. # Failed (TODO) test 'Expected failure' # at t/todo.t line 21. not ok 2 - Another expected failure # TODO Just testing the todo interface. # Failed (TODO) test 'Another expected failure' # at t/todo.t line 22. ok 3 - This is not todo ok 4 - TB->todo not ok 5 - Yet another failure # TODO Just testing the todo interface. # Failed (TODO) test 'Yet another failure' # at t/todo.t line 34. ok 6 - This is still not todo not ok 7 - ok # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'ok' # at t/todo.t line 43. not ok 8 - like # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'like' # at t/todo.t line 45. # 'this' # doesn't match '(?-xism:that)' not ok 9 - is # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'is' # at t/todo.t line 46. # got: 'this' # expected: 'that' not ok 10 - isnt # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'isnt' # at t/todo.t line 47. # got: 'this' # expected: anything else not ok 11 - Fooble->can('yarble') # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'Fooble->can('yarble')' # at t/todo.t line 49. # Fooble->can('yarble') failed not ok 12 - The class isa yarble # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'The class isa yarble' # at t/todo.t line 50. # The class isn't a 'yarble' it's a '' not ok 13 - use Fooble; # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'use Fooble;' # at t/todo.t line 51. # Tried to use 'Fooble'. # Error: Can't locate Fooble.pm in @INC (@INC contains: C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib .) at (eval 7) line 2. # BEGIN failed--compilation aborted at (eval 7) line 2. not ok 14 - require Fooble; # TODO testing that error messages don't leak out of todo # Failed (TODO) test 'require Fooble;' # at t/todo.t line 52. # Tried to require 'Fooble'. # Error: Can't locate Fooble.pm in @INC (@INC contains: C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib .) at (eval 8) line 2. not ok 15 # TODO & SKIP Just testing todo_skip not ok 16 # TODO & SKIP Just testing todo_skip not ok 17 # TODO & SKIP Just testing todo_skip ok 18 - todo_skip without $how_many warning not ok 19 - Just testing todo # TODO testing $TODO with an incorrect exported_to() # Failed (TODO) test 'Just testing todo' # at t/todo.t line 89. not ok 20 - Testing todo_start() # TODO Expected failures # Failed (TODO) test 'Testing todo_start()' # at t/todo.t line 95. not ok 21 - Testing todo_start() with more than one failure # TODO Expected failures # Failed (TODO) test 'Testing todo_start() with more than one failure' # at t/todo.t line 96. ok 22 - todo_start should have the correct TODO message ok 23 - todo_end() should not leak TODO behavior not ok 24 - fail 1 # TODO Nesting TODO # Failed (TODO) test 'fail 1' # at t/todo.t line 107. not ok 25 - fail 2 # TODO failure level 1 # Failed (TODO) test 'fail 2' # at t/todo.t line 110. not ok 26 - fail 3 # TODO failure_level 2 # Failed (TODO) test 'fail 3' # at t/todo.t line 114. not ok 27 - fail 4 # TODO failure level 1 # Failed (TODO) test 'fail 4' # at t/todo.t line 118. not ok 28 - fail 4 # TODO Nesting TODO # Failed (TODO) test 'fail 4' # at t/todo.t line 123. ok 29 - Nested TODO message should be correct ok 30 - ... and original TODO message should be correct not ok 31 - testing todo_start() with no message # TODO # Failed (TODO) test 'testing todo_start() with no message' # at t/todo.t line 132. ok 32 - todo() reports no reason ok 33 - but we're in_todo() ok 34 ok 35 ok 36 - $TODO = "" is not considered TODO ok t/undef.t ............................... 1..21 ok 1 - undef is undef ok 2 - no warnings ok 3 - undef isnt foo ok 4 - no warnings ok 5 - undef isnt an empty string ok 6 - undef isnt zero ok 7 - is_num() ok 8 - isnt_num() ok 9 - undef is like anything ok 10 ok 11 - no warnings ok 12 - no warnings ok 13 - no warnings ok 14 - no warnings ok 15 - undef <= 2 ok 16 ok 17 ok 18 - no warnings ok 19 - no warnings ok 20 ok 21 - no warnings ok t/use_ok.t .............................. 1..15 ok 1 - use Symbol; ok 2 - use_ok() no args exports defaults ok 3 - use Symbol; ok 4 - one arg, defaults overridden ok 5 - right function exported ok 6 - use Symbol; ok 7 - multiple args ok 8 - use constant; ok 9 - constant ok 10 - no warning ok 11 - use Symbol; ok 12 - use NoExporter; ok 13 - use Test::More; ok 14 - use SigDie; ok 15 - SIG{__DIE__} preserved ok t/useing.t .............................. 1..5 ok 1 - require Test::Builder; ok 2 - require Test::More; ok 3 - require Test::Simple; ok 4 - Foo->can(...) ok 5 - import working properly ok t/utf8.t ................................ 1..5 ok 1 - layers copied to todo_output ok 2 - layers copied to failure_output ok 3 - layers copied to output ok 4 - Testing Äž ok 5 ok t/versions.t ............................ ok 1 ok 2 - Test::Simple ok 3 - Test::Builder ok 4 - Test::Builder::Module 1..4 ok All tests successful. Files=107, Tests=1183, 8 wallclock secs ( 0.39 usr + 0.16 sys = 0.55 CPU) Result: PASS MSCHWERN/Test-Simple-0.98.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for Test-Simple-0.98 already made Running test for module 'JSON::PP' Running make for M/MA/MAKAMAKA/JSON-PP-2.27105.tar.gz Prepending C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK Prepending C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' Has already been made Prepending C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running make test Has already been tested successfully Running make for D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz Prepending C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f Prepending C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/CPAN/Meta.pm blib\lib\CPAN\Meta.pm cp lib/CPAN/Meta/Prereqs.pm blib\lib\CPAN\Meta\Prereqs.pm cp lib/CPAN/Meta/History.pm blib\lib\CPAN\Meta\History.pm cp lib/CPAN/Meta/Converter.pm blib\lib\CPAN\Meta\Converter.pm cp lib/CPAN/Meta/Validator.pm blib\lib\CPAN\Meta\Validator.pm cp lib/CPAN/Meta/Feature.pm blib\lib\CPAN\Meta\Feature.pm cp lib/CPAN/Meta/Spec.pm blib\lib\CPAN\Meta\Spec.pm DAGOLDEN/CPAN-Meta-2.110930.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/converter-bad.t ..... ok 1 - loaded restrictive-2.json ok 2 - down converted spec version 2 to spec version 1.2 ok 3 - down converted META is valid ok 4 - down converted spec version 2 to spec version 1.0 ok 5 - down converted META is valid ok 6 - loaded META-2.json ok 7 - down converted spec version 2 to spec version 1.2 ok 8 - down converted META is valid ok 9 - down converted spec version 2 to spec version 1.0 ok 10 - down converted META is valid ok 11 - loaded META-1_4.yml ok 12 - up converted spec version 1.4 to spec version 2 ok 13 - up converted META is valid ok 14 - down converted spec version 1.4 to spec version 1.2 ok 15 - down converted META is valid ok 16 - down converted spec version 1.4 to spec version 1.0 ok 17 - down converted META is valid ok 18 - loaded META-1_3.yml ok 19 - up converted spec version 1.3 to spec version 2 ok 20 - up converted META is valid ok 21 - up converted spec version 1.3 to spec version 1.4 ok 22 - up converted META is valid ok 23 - down converted spec version 1.3 to spec version 1.2 ok 24 - down converted META is valid ok 25 - down converted spec version 1.3 to spec version 1.0 ok 26 - down converted META is valid ok 27 - loaded META-1_2.yml ok 28 - up converted spec version 1.2 to spec version 2 ok 29 - up converted META is valid ok 30 - up converted spec version 1.2 to spec version 1.4 ok 31 - up converted META is valid ok 32 - down converted spec version 1.2 to spec version 1.0 ok 33 - down converted META is valid ok 34 - loaded META-1_1.yml ok 35 - up converted spec version 1.1 to spec version 2 ok 36 - up converted META is valid ok 37 - up converted spec version 1.1 to spec version 1.4 ok 38 - up converted META is valid ok 39 - down converted spec version 1.1 to spec version 1.0 ok 40 - down converted META is valid ok 41 - loaded META-1_0.yml ok 42 - up converted spec version 1.0 to spec version 2 ok 43 - up converted META is valid ok 44 - up converted spec version 1.0 to spec version 1.4 ok 45 - up converted META is valid ok 46 - loaded 98042513-META.yml ok 47 - up converted spec version 1.0 to spec version 2 ok 48 - up converted META is valid ok 49 - up converted spec version 1.0 to spec version 1.4 ok 50 - up converted META is valid ok 51 - loaded 476602558-META.yml ok 52 - up converted spec version 1.4 to spec version 2 ok 53 - up converted META is valid ok 54 - down converted spec version 1.4 to spec version 1.2 ok 55 - down converted META is valid ok 56 - down converted spec version 1.4 to spec version 1.0 ok 57 - down converted META is valid ok 58 - loaded 35478989-META.yml ok 59 - up converted spec version 1.3 to spec version 2 ok 60 - up converted META is valid ok 61 - up converted spec version 1.3 to spec version 1.4 ok 62 - up converted META is valid ok 63 - down converted spec version 1.3 to spec version 1.2 ok 64 - down converted META is valid ok 65 - down converted spec version 1.3 to spec version 1.0 ok 66 - down converted META is valid ok 67 - loaded 344981821-META.yml ok 68 - up converted spec version 1.3 to spec version 2 ok 69 - up converted META is valid ok 70 - up converted spec version 1.3 to spec version 1.4 ok 71 - up converted META is valid ok 72 - down converted spec version 1.3 to spec version 1.2 ok 73 - down converted META is valid ok 74 - down converted spec version 1.3 to spec version 1.0 ok 75 - down converted META is valid ok 76 - loaded 284247103-META.yml ok 77 - up converted spec version 1.2 to spec version 2 ok 78 - up converted META is valid ok 79 - up converted spec version 1.2 to spec version 1.4 ok 80 - up converted META is valid ok 81 - down converted spec version 1.2 to spec version 1.0 ok 82 - down converted META is valid ok 83 - loaded 2031017050-META.yml ok 84 - up converted spec version 1.4 to spec version 2 ok 85 - up converted META is valid ok 86 - down converted spec version 1.4 to spec version 1.2 ok 87 - down converted META is valid ok 88 - down converted spec version 1.4 to spec version 1.0 ok 89 - down converted META is valid ok 90 - loaded 1985980974-META.yml ok 91 - up converted spec version 1.4 to spec version 2 ok 92 - up converted META is valid ok 93 - down converted spec version 1.4 to spec version 1.2 ok 94 - down converted META is valid ok 95 - down converted spec version 1.4 to spec version 1.0 ok 96 - down converted META is valid ok 97 - loaded 1985684504-META.yml ok 98 - up converted spec version 1.2 to spec version 2 ok 99 - up converted META is valid ok 100 - up converted spec version 1.2 to spec version 1.4 ok 101 - up converted META is valid ok 102 - down converted spec version 1.2 to spec version 1.0 ok 103 - down converted META is valid ok 104 - loaded 1927486199-META.yml ok 105 - up converted spec version 1.0 to spec version 2 ok 106 - up converted META is valid ok 107 - up converted spec version 1.0 to spec version 1.4 ok 108 - up converted META is valid ok 109 - loaded 1598804075-META.yml ok 110 - up converted spec version 1.0 to spec version 2 ok 111 - up converted META is valid ok 112 - up converted spec version 1.0 to spec version 1.4 ok 113 - up converted META is valid ok 114 - loaded 1206545041-META.yml ok 115 - up converted spec version 1.0 to spec version 2 ok 116 - up converted META is valid ok 117 - up converted spec version 1.0 to spec version 1.4 ok 118 - up converted META is valid ok 119 - loaded 1122575719-META.yml ok 120 - up converted spec version 1.4 to spec version 2 ok 121 - up converted META is valid ok 122 - down converted spec version 1.4 to spec version 1.2 ok 123 - down converted META is valid ok 124 - down converted spec version 1.4 to spec version 1.0 ok 125 - down converted META is valid ok 126 - loaded 107650337-META.yml ok 127 - up converted spec version 1.2 to spec version 2 ok 128 - up converted META is valid ok 129 - up converted spec version 1.2 to spec version 1.4 ok 130 - up converted META is valid ok 131 - down converted spec version 1.2 to spec version 1.0 ok 132 - down converted META is valid 1..132 ok t/converter-fail.t .... ok 1 - loaded invalid META-2.json ok 2 - error thrown down converting ok 3 - loaded invalid META-1_4.yml ok 4 - error thrown up converting ok 5 - error thrown down converting ok 6 - loaded invalid META-1_3.yml ok 7 - error thrown up converting ok 8 - error thrown down converting ok 9 - loaded invalid META-1_2.yml ok 10 - error thrown up converting ok 11 - error thrown down converting ok 12 - loaded invalid META-1_1.yml ok 13 - error thrown up converting ok 14 - error thrown down converting ok 15 - loaded invalid META-1_0.yml ok 16 - error thrown up converting 1..16 ok t/converter.t ......... ok 1 - loaded restrictive-1_4.yml ok 2 - up converted spec version 1.4 to spec version 2 ok 3 - up converted META is valid ok 4 - up converted spec version 1.4 to spec version 1.4 ok 5 - up converted META is valid ok 6 - down converted spec version 1.4 to spec version 1.2 ok 7 - down converted META is valid ok 8 - down converted spec version 1.4 to spec version 1.0 ok 9 - down converted META is valid ok 10 - added converter mark to generated_by ok 11 - loaded restricted-2.json ok 12 - up converted spec version 2 to spec version 2 ok 13 - up converted META is valid ok 14 - down converted spec version 2 to spec version 1.2 ok 15 - down converted META is valid ok 16 - downconversion from 2 merge test and build requirements ok 17 - down converted spec version 2 to spec version 1.0 ok 18 - down converted META is valid ok 19 - added converter mark to generated_by ok 20 - loaded resources.yml ok 21 - up converted spec version 1.4 to spec version 2 ok 22 - up converted META is valid ok 23 - up converted spec version 1.4 to spec version 1.4 ok 24 - up converted META is valid ok 25 - down converted spec version 1.4 to spec version 1.2 ok 26 - down converted META is valid ok 27 - down converted spec version 1.4 to spec version 1.0 ok 28 - down converted META is valid ok 29 - added converter mark to generated_by ok 30 - loaded gpl-1_4.yml ok 31 - up converted spec version 1.4 to spec version 2 ok 32 - up converted META is valid ok 33 - up converted spec version 1.4 to spec version 1.4 ok 34 - up converted META is valid ok 35 - down converted spec version 1.4 to spec version 1.2 ok 36 - down converted META is valid ok 37 - down converted spec version 1.4 to spec version 1.0 ok 38 - down converted META is valid ok 39 - added converter mark to generated_by ok 40 - loaded META-2.json ok 41 - up converted spec version 2 to spec version 2 ok 42 - up converted META is valid ok 43 - down converted spec version 2 to spec version 1.2 ok 44 - down converted META is valid ok 45 - downconversion from 2 merge test and build requirements ok 46 - down converted spec version 2 to spec version 1.0 ok 47 - down converted META is valid ok 48 - added converter mark to generated_by ok 49 - loaded META-1_4.yml ok 50 - up converted spec version 1.4 to spec version 2 ok 51 - up converted META is valid ok 52 - up converted spec version 1.4 to spec version 1.4 ok 53 - up converted META is valid ok 54 - down converted spec version 1.4 to spec version 1.2 ok 55 - down converted META is valid ok 56 - down converted spec version 1.4 to spec version 1.0 ok 57 - down converted META is valid ok 58 - added converter mark to generated_by ok 59 - loaded META-1_3.yml ok 60 - up converted spec version 1.3 to spec version 2 ok 61 - up converted META is valid ok 62 - up converted spec version 1.3 to spec version 1.4 ok 63 - up converted META is valid ok 64 - down converted spec version 1.3 to spec version 1.2 ok 65 - down converted META is valid ok 66 - down converted spec version 1.3 to spec version 1.0 ok 67 - down converted META is valid ok 68 - added converter mark to generated_by ok 69 - loaded META-1_2.yml ok 70 - up converted spec version 1.2 to spec version 2 ok 71 - up converted META is valid ok 72 - up converted spec version 1.2 to spec version 1.4 ok 73 - up converted META is valid ok 74 - down converted spec version 1.2 to spec version 1.2 ok 75 - down converted META is valid ok 76 - down converted spec version 1.2 to spec version 1.0 ok 77 - down converted META is valid ok 78 - added converter mark to generated_by ok 79 - loaded META-1_1.yml ok 80 - up converted spec version 1.1 to spec version 2 ok 81 - up converted META is valid ok 82 - up converted spec version 1.1 to spec version 1.4 ok 83 - up converted META is valid ok 84 - down converted spec version 1.1 to spec version 1.0 ok 85 - down converted META is valid ok 86 - added converter mark to generated_by ok 87 - loaded META-1_0.yml ok 88 - up converted spec version 1.0 to spec version 2 ok 89 - up converted META is valid ok 90 - up converted spec version 1.0 to spec version 1.4 ok 91 - up converted META is valid ok 92 - down converted spec version 1.0 to spec version 1.0 ok 93 - down converted META is valid ok 94 - loaded META-1_4.yml ok 95 - up converted 'x-' to 'x_' ok 96 - up converted 'x_' as 'x_' ok 97 - up converted 'XFoo' to 'x_Foo' ok 98 - loaded META-2.json ok 99 - down converted 'x_' as 'x_' ok 100 - loaded gpl-1_4.yml ok 101 - up converted 'gpl' to 'open_source' ok 102 - loaded resources.yml ok 103 - upconversion of resources 1..103 ok t/load-bad.t .......... ok 1 - load_file('107650337-META.yml') ok 2 - load_yaml_string(slurp('107650337-META.yml')) ok 3 - load_file('1122575719-META.yml') ok 4 - load_yaml_string(slurp('1122575719-META.yml')) ok 5 - load_file('1206545041-META.yml') ok 6 - load_yaml_string(slurp('1206545041-META.yml')) ok 7 - load_file('1598804075-META.yml') ok 8 - load_yaml_string(slurp('1598804075-META.yml')) ok 9 - load_file('1927486199-META.yml') ok 10 - load_yaml_string(slurp('1927486199-META.yml')) ok 11 - load_file('1985684504-META.yml') ok 12 - load_yaml_string(slurp('1985684504-META.yml')) ok 13 - load_file('1985980974-META.yml') ok 14 - load_yaml_string(slurp('1985980974-META.yml')) ok 15 - load_file('2031017050-META.yml') ok 16 - load_yaml_string(slurp('2031017050-META.yml')) ok 17 - load_file('284247103-META.yml') ok 18 - load_yaml_string(slurp('284247103-META.yml')) ok 19 - load_file('344981821-META.yml') ok 20 - load_yaml_string(slurp('344981821-META.yml')) ok 21 - load_file('35478989-META.yml') ok 22 - load_yaml_string(slurp('35478989-META.yml')) ok 23 - load_file('476602558-META.yml') ok 24 - load_yaml_string(slurp('476602558-META.yml')) ok 25 - load_file('98042513-META.yml') ok 26 - load_yaml_string(slurp('98042513-META.yml')) ok 27 - load_file('META-1_0.yml') ok 28 - load_yaml_string(slurp('META-1_0.yml')) ok 29 - load_file('META-1_1.yml') ok 30 - load_yaml_string(slurp('META-1_1.yml')) ok 31 - load_file('META-1_2.yml') ok 32 - load_yaml_string(slurp('META-1_2.yml')) ok 33 - load_file('META-1_3.yml') ok 34 - load_yaml_string(slurp('META-1_3.yml')) ok 35 - load_file('META-1_4.yml') ok 36 - load_yaml_string(slurp('META-1_4.yml')) ok 37 - load_file('META-2.json') ok 38 - load_json_string(slurp('META-2.json')) ok 39 - load_file('restrictive-2.json') ok 40 - load_json_string(slurp('restrictive-2.json')) 1..40 ok t/meta-obj.t .......... ok 1 - the result of ->as_struct is unblessed ok 2 - ->as_struct (deep comparison) ok 3 - ->as_struct (is a deep clone) ok 4 - ->as_struct (downconversion) ok 5 - ->resource (map values are deep cloned) ok 6 - ->name ok 7 - ->abstract ok 8 - ->description ok 9 - ->version ok 10 - ->dynamic_config ok 11 - ->author ok 12 - ->authors ok 13 - ->license ok 14 - ->licenses ok 15 - ->keywords ok 16 - ->resources ok 17 - ->meta_spec ok 18 - ->meta_spec_version ok 19 - ->generated_by ok 20 - ->effective_prereqs() ok 21 - ->custom_keys ok 22 - ->custom(X) ok 23 - ->custom(X) [is_deeply] ok 24 - ->custom(x) [is a deep clone] ok 25 - ->effective_prereqs([ qw(domination) ]) ok 26 - we got one feature ok 27 - The object isa CPAN::Meta::Feature ok 28 - $feature->identifier ok 29 - $feature->description ok 30 - $feature->prereqs ok 31 - The object isa CPAN::Meta::Feature ok 32 - $feature->identifier ok 33 - $feature->description ok 34 - $feature->prereqs 1..34 ok t/no-index.t .......... ok 1 - we index any old package, without a no_index rule ok 2 - we index any old file, without a no_index rule ok 3 - exclude a specific package ok 4 - namespace X does not exclude package X ok 5 - exclude something under a namespace ok 6 - exclude a specific file ok 7 - do not exclude a file with a name like an excluded dir ok 8 - exclude something under a directory 1..8 ok t/prereqs-finalize.t .. ok 1 - The object isa CPAN::Meta::Prereqs ok 2 - cloned obj is not finalized ok 3 - ...and still round-trip ok 4 - ...we can add a minimum if it has no effect ok 5 - ...but we die if it would alter a finalized prereqs ok 6 - ...we can get a V:R object for a previously unconfigured phase ok 7 - ...but we die if we try to put anything in it ok 8 - cloned prereqs obj isa CPAN::Meta::Prereqs ok 9 - cloned obj is not finalized ok 10 - ...it still round-trips ok 11 - ...we can add minimum if it has no effect ok 12 - ...or if it has an effect ok 13 - ...we can get a V:R object for a previously unconfigured phase ok 14 - ...and we can add stuff to it 1..14 ok t/prereqs-merge.t ..... ok 1 - first prereq isa CPAN::Meta::Prereqs ok 2 - ...and it round trips ok 3 - second prereq isa CPAN::Meta::Prereqs ok 4 - ...and it round trips ok 5 - we get the right result of merging two prereqs ok 6 - ...and the merge works the same in reverse 1..6 ok t/prereqs.t ........... ok 1 - The object isa CPAN::Meta::Prereqs ok 2 - round-trip okay ok 3 - we got the runtime requirements ok 4 - ...but not the runtime recommendations ok 5 - ...nor the build requirements ok 6 - we got the runtime requirements ok 7 - ...and the runtime recommendations ok 8 - ...but not the build requirements ok 9 - empty set of runtime/suggests requirements ok 10 - empty set of develop/suggests requirements ok 11 - we can accumulate new requirements on a prereq object 1..11 ok t/repository.t ........ ok 1 - (version 1.4) old repository winds up in 'url' ok 2 - (version 2 ) http in web passed through unchanged ok 3 - (version 2 ) http in url passed through unchanged ok 4 - (version 2 ) svn in url adds svn type ok 5 - (version 2 ) git in url adds svn type ok 6 - (version 2 ) pre-existing type preserved 1..6 ok t/save-load.t ......... ok 1 - save returns true ok 2 - save meta to file ok 3 - load saved file ok 4 - name correct ok 5 - load META-1.4 ok 6 - name correct ok 7 - save meta to META.yml with conversion ok 8 - load saved file ok 9 - name correct ok 10 - prereq correct 1..10 ok t/validator.t ......... ok 1 - META-1_0.yml validates ok 2 - META-1_1.yml validates ok 3 - META-1_2.yml validates ok 4 - META-1_3.yml validates ok 5 - META-1_4.yml validates ok 6 - META-2.json validates ok 7 - gpl-1_4.yml validates ok 8 - resources.yml validates ok 9 - restricted-2.json validates ok 10 - restrictive-1_4.yml validates ok 11 - invalid META-1_0.yml doesn't validate ok 12 - invalid META-1_1.yml doesn't validate ok 13 - invalid META-1_2.yml doesn't validate ok 14 - invalid META-1_3.yml doesn't validate ok 15 - invalid META-1_4.yml doesn't validate ok 16 - invalid META-2.json doesn't validate 1..16 ok All tests successful. Files=12, Tests=396, 2 wallclock secs ( 0.09 usr + 0.03 sys = 0.13 CPU) Result: PASS DAGOLDEN/CPAN-Meta-2.110930.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for CPAN-Meta-2.110930 already made Running test for module 'Perl::OSType' Running make for D/DA/DAGOLDEN/Perl-OSType-1.002.tar.gz Prepending C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Checksum for C:\cpanfly\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Perl-OSType-1.002.tar.gz ok Will not use Archive::Tar, need 1.00 Perl-OSType-1.002 Perl-OSType-1.002/README Perl-OSType-1.002/Changes Perl-OSType-1.002/LICENSE Perl-OSType-1.002/dist.ini Perl-OSType-1.002/META.yml Perl-OSType-1.002/MANIFEST Perl-OSType-1.002/META.json Perl-OSType-1.002/t Perl-OSType-1.002/t/OSType.t Perl-OSType-1.002/Makefile.PL Perl-OSType-1.002/t/00-compile.t Perl-OSType-1.002/lib/Perl Perl-OSType-1.002/lib/Perl/OSType.pm Perl-OSType-1.002/xt/release Perl-OSType-1.002/xt/release/distmeta.t Perl-OSType-1.002/xt/release/pod-syntax.t Perl-OSType-1.002/xt/release/portability.t Perl-OSType-1.002/xt/release/pod-coverage.t Prepending C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/Perl-OSType-1.002.tar.gz >>> C:\Perl64\bin\perl.exe Makefile.PL Checking if your kit is complete... Looks good Writing Makefile for Perl::OSType >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp lib/Perl/OSType.pm blib\lib\Perl\OSType.pm DAGOLDEN/Perl-OSType-1.002.tar.gz nmake -- OK Prepending C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t t/00-compile.t .. 1..1 ok 1 - Perl::OSType loaded ok ok t/OSType.t ...... ok 1 - require Perl::OSType; ok 2 - Perl::OSType->can('os_type') ok 3 - importing os_type() ok 4 - main->can('os_type') ok 5 - importing is_os_type() ok 6 - main->can('is_os_type') ok 7 - Testing 'use Perl::OSType qw/:all/' ok 8 - testpackage2800->can(...) ok 9 - os_type(): without arguments ok 10 - ... matches os_type(MSWin32) ok 11 - os_type(): unknown OS returns empty string ok 12 - os_type(): empty string returns empty string ok 13 - os_type(): explicit undef uses linux ok 14 - is_os_type(): non-existent type is false ok 15 - is_os_type(): empty string type is false ok 16 - is_os_type(): non-existent OS is false ok 17 - is_os_type(): false ok 18 - is_os_type(): true ok 19 - is_os_type(): false if no type provided 1..19 ok All tests successful. Files=2, Tests=20, 0 wallclock secs ( 0.08 usr + 0.00 sys = 0.08 CPU) Result: PASS DAGOLDEN/Perl-OSType-1.002.tar.gz nmake test TEST_VERBOSE=1 -- OK PPD for Perl-OSType-1.002 already made Running test for module 'Parse::CPAN::Meta' Running make for D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' Has already been made Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running make test Has already been tested successfully Running test for module 'version' Running make for J/JP/JPEACOCK/version-0.88.tar.gz Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\version-0.88-LpSB1J Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' Has already been made Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running make test Has already been tested successfully Running make for D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\Module-Build-0.3800-Q1illD Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl64\bin\perl.exe Build --makefile_env_macros 1 version version 0.87 required--this is only version 0.82 at lib/Module/Build/Version.pm line 6. BEGIN failed--compilation aborted at lib/Module/Build/Version.pm line 6. Compilation failed in require at lib/Module/Build/Base.pm line 26. BEGIN failed--compilation aborted at lib/Module/Build/Base.pm line 26. Compilation failed in require at lib/Module/Build.pm line 15. BEGIN failed--compilation aborted at lib/Module/Build.pm line 15. Compilation failed in require at Build line 43. BEGIN failed--compilation aborted at Build line 43. NMAKE : fatal error U1077: 'C:\Perl64\bin\perl.exe' : return code '0x9' Stop. DAGOLDEN/Module-Build-0.3800.tar.gz nmake -- NOT OK Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running make test Can't test without successful make Running make for C/CJ/CJFIELDS/BioPerl-1.6.900.tar.gz Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Warning: Prerequisite 'Module::Build => 0.38' for 'CJFIELDS/BioPerl-1.6.900.tar.gz' failed when processing 'DAGOLDEN/Module-Build-0.3800.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited. Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.900.tar.gz >>> C:\Perl64\bin\perl.exe Build.PL could not find ParserDetails.ini in C:/cpanfly/var/megalib/XML/SAX - ERROR: DB_File is not installed * Optional prerequisite GraphViz is not installed ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions of the modules indicated above before proceeding with this installation - DB_File is not installed - DBD::Pg is not installed - Bio::ASN1::EntrezGene is not installed ############################# WARNING ############################# Bio::ASN1::EntrezGene not found. This is an *optional* module; however, because it has a circular dependency with BioPerl we do not include it on our list of recommended modules. If you require EntrezGene functionality, you can install Bio::ASN1::EntrezGene after BioPerl has finished installing. ############################# WARNING ############################# Checking whether your kit is complete... Looks good Checking prerequisites... Checking features: SQLite Tests..........enabled MySQL Tests...........enabled DB_File Tests.........disabled Bio::DB::GFF Tests....enabled Network Tests.........enabled Pg Tests..............disabled EntrezGene............disabled Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts Do you want to run tests that require connection to servers across the internet (likely to cause some failures)? y/n [n] - will not run internet-requiring tests Creating new 'Build' script for 'BioPerl' version '1.006900' ---- Unsatisfied dependencies detected during ---- ---- CJFIELDS/BioPerl-1.6.900.tar.gz ---- DB_File [requires] Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running Build test Delayed until after prerequisites Running test for module 'DB_File' ______________________ D i s t r o P r e f s ______________________ DB_File.yml[0] Running make for P/PM/PMQS/DB_File-1.822.tar.gz Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Disabled via prefs file 'C:\cpanfly\etc\distroprefs\DB_File.yml' doc 0 PMQS/DB_File-1.822.tar.gz [disabled] -- NA Disabled via prefs file 'C:\cpanfly\etc\distroprefs\DB_File.yml' doc 0 Running Build for C/CJ/CJFIELDS/BioPerl-1.6.900.tar.gz Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'get' Has already been unwrapped into directory C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'make' CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.900.tar.gz Warning: Prerequisite 'DB_File => 0' for 'CJFIELDS/BioPerl-1.6.900.tar.gz' failed when processing 'PMQS/DB_File-1.822.tar.gz' with 'unwrapped => NO Disabled via prefs file 'C:\cpanfly\etc\distroprefs\DB_File.yml' doc 0'. Continuing, but chances to succeed are limited. >>> C:\Perl64\bin\perl.exe ./Build Copying Bio\DB\CUTG.pm -> blib\lib\Bio\DB\CUTG.pm Copying Bio\Restriction\IO\itype2.pm -> blib\lib\Bio\Restriction\IO\itype2.pm Copying Bio\DB\GFF\Aggregator\none.pm -> blib\lib\Bio\DB\GFF\Aggregator\none.pm Copying Bio\Tools\Analysis\Protein\GOR4.pm -> blib\lib\Bio\Tools\Analysis\Protein\GOR4.pm Copying Bio\AlignIO\prodom.pm -> blib\lib\Bio\AlignIO\prodom.pm Copying Bio\SeqFeature\Gene\UTR.pm -> blib\lib\Bio\SeqFeature\Gene\UTR.pm Copying Bio\AlignIO.pm -> blib\lib\Bio\AlignIO.pm Copying Bio\SearchIO\hmmer.pm -> blib\lib\Bio\SearchIO\hmmer.pm Copying Bio\PopGen\Statistics.pm -> blib\lib\Bio\PopGen\Statistics.pm Copying Bio\OntologyIO\Handlers\BaseSAXHandler.pm -> blib\lib\Bio\OntologyIO\Handlers\BaseSAXHandler.pm Copying Bio\Tools\pICalculator.pm -> blib\lib\Bio\Tools\pICalculator.pm Copying Bio\Ontology\Path.pm -> blib\lib\Bio\Ontology\Path.pm Copying Bio\Matrix\PSM\InstanceSite.pm -> blib\lib\Bio\Matrix\PSM\InstanceSite.pm Copying Bio\Tools\SiRNA.pm -> blib\lib\Bio\Tools\SiRNA.pm Copying Bio\Tools\GFF.pm -> blib\lib\Bio\Tools\GFF.pm Copying Bio\Search\Hit\ModelHit.pm -> blib\lib\Bio\Search\Hit\ModelHit.pm Copying Bio\Search\Tiling\TilingI.pm -> blib\lib\Bio\Search\Tiling\TilingI.pm Copying Bio\PopGen\TagHaplotype.pm -> blib\lib\Bio\PopGen\TagHaplotype.pm Copying Bio\SeqIO\tigrxml.pm -> blib\lib\Bio\SeqIO\tigrxml.pm Copying Bio\Search\GenericDatabase.pm -> blib\lib\Bio\Search\GenericDatabase.pm Copying Bio\SeqFeature\Gene\NC_Feature.pm -> blib\lib\Bio\SeqFeature\Gene\NC_Feature.pm Copying Bio\Matrix\PSM\Psm.pm -> blib\lib\Bio\Matrix\PSM\Psm.pm Copying Bio\DB\GFF\Adaptor\dbi\mysqlace.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlace.pm Copying Bio\Biblio\JournalArticle.pm -> blib\lib\Bio\Biblio\JournalArticle.pm Copying Bio\DB\Fasta.pm -> blib\lib\Bio\DB\Fasta.pm Copying Bio\DB\Failover.pm -> blib\lib\Bio\DB\Failover.pm Copying Bio\Matrix\PSM\SiteMatrix.pm -> blib\lib\Bio\Matrix\PSM\SiteMatrix.pm Copying Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm Copying Bio\Search\Hit\BlastPullHit.pm -> blib\lib\Bio\Search\Hit\BlastPullHit.pm Copying Bio\Tools\SeqWords.pm -> blib\lib\Bio\Tools\SeqWords.pm Copying Bio\Tools\EUtilities\Query.pm -> blib\lib\Bio\Tools\EUtilities\Query.pm Copying Bio\SeqFeature\Tools\TypeMapper.pm -> blib\lib\Bio\SeqFeature\Tools\TypeMapper.pm Copying Bio\Biblio\Person.pm -> blib\lib\Bio\Biblio\Person.pm Copying Bio\SeqIO\fastq.pm -> blib\lib\Bio\SeqIO\fastq.pm Copying Bio\SearchIO\Writer\HTMLResultWriter.pm -> blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm Copying Bio\Structure\IO.pm -> blib\lib\Bio\Structure\IO.pm Copying Bio\OntologyIO\InterProParser.pm -> blib\lib\Bio\OntologyIO\InterProParser.pm Copying Bio\Tools\Promoterwise.pm -> blib\lib\Bio\Tools\Promoterwise.pm Copying Bio\Coordinate\Result\Gap.pm -> blib\lib\Bio\Coordinate\Result\Gap.pm Copying Bio\Index\Hmmer.pm -> blib\lib\Bio\Index\Hmmer.pm Copying Bio\Root\Root.pm -> blib\lib\Bio\Root\Root.pm Copying Bio\Structure\Model.pm -> blib\lib\Bio\Structure\Model.pm Copying Bio\DB\GFF\Adaptor\ace.pm -> blib\lib\Bio\DB\GFF\Adaptor\ace.pm Copying Bio\Search\Iteration\GenericIteration.pm -> blib\lib\Bio\Search\Iteration\GenericIteration.pm Copying Bio\SeqIO\nexml.pm -> blib\lib\Bio\SeqIO\nexml.pm Copying Bio\TreeIO\tabtree.pm -> blib\lib\Bio\TreeIO\tabtree.pm Copying Bio\AlignIO\nexus.pm -> blib\lib\Bio\AlignIO\nexus.pm Copying Bio\Annotation\SimpleValue.pm -> blib\lib\Bio\Annotation\SimpleValue.pm Copying Bio\PullParserI.pm -> blib\lib\Bio\PullParserI.pm Copying Bio\PhyloNetwork\muVector.pm -> blib\lib\Bio\PhyloNetwork\muVector.pm Copying Bio\Biblio\Book.pm -> blib\lib\Bio\Biblio\Book.pm Copying Bio\TreeIO\newick.pm -> blib\lib\Bio\TreeIO\newick.pm Copying Bio\CodonUsage\IO.pm -> blib\lib\Bio\CodonUsage\IO.pm Copying Bio\SeqIO\scf.pm -> blib\lib\Bio\SeqIO\scf.pm Copying Bio\DB\SeqFeature\Store\GFF2Loader.pm -> blib\lib\Bio\DB\SeqFeature\Store\GFF2Loader.pm Copying Bio\Tools\Run\WrapperBase\CommandExts.pm -> blib\lib\Bio\Tools\Run\WrapperBase\CommandExts.pm Copying Bio\Seq\SeqBuilder.pm -> blib\lib\Bio\Seq\SeqBuilder.pm Copying Bio\Search\Hit\HMMERHit.pm -> blib\lib\Bio\Search\Hit\HMMERHit.pm Copying Bio\LiveSeq\Repeat_Region.pm -> blib\lib\Bio\LiveSeq\Repeat_Region.pm Copying Bio\SearchDist.pm -> blib\lib\Bio\SearchDist.pm Copying Bio\SeqEvolution\DNAPoint.pm -> blib\lib\Bio\SeqEvolution\DNAPoint.pm Copying Bio\SeqIO\excel.pm -> blib\lib\Bio\SeqIO\excel.pm Copying Bio\SeqIO\bsml_sax.pm -> blib\lib\Bio\SeqIO\bsml_sax.pm Copying Bio\OntologyIO\Handlers\InterProHandler.pm -> blib\lib\Bio\OntologyIO\Handlers\InterProHandler.pm Copying Bio\Ontology\OntologyStore.pm -> blib\lib\Bio\Ontology\OntologyStore.pm Copying Bio\SeqIO\alf.pm -> blib\lib\Bio\SeqIO\alf.pm Copying Bio\SearchIO\sim4.pm -> blib\lib\Bio\SearchIO\sim4.pm Copying Bio\DB\EUtilities.pm -> blib\lib\Bio\DB\EUtilities.pm Copying Bio\Structure\Chain.pm -> blib\lib\Bio\Structure\Chain.pm Copying Bio\DB\SeqFeature\Store\Loader.pm -> blib\lib\Bio\DB\SeqFeature\Store\Loader.pm Copying Bio\DB\SeqFeature\NormalizedTableFeatureI.pm -> blib\lib\Bio\DB\SeqFeature\NormalizedTableFeatureI.pm Copying Bio\FeatureIO.pm -> blib\lib\Bio\FeatureIO.pm Copying Bio\SeqIO\gbxml.pm -> blib\lib\Bio\SeqIO\gbxml.pm Copying Bio\TreeIO\svggraph.pm -> blib\lib\Bio\TreeIO\svggraph.pm Copying Bio\SearchIO\erpin.pm -> blib\lib\Bio\SearchIO\erpin.pm Copying Bio\Map\LinkageMap.pm -> blib\lib\Bio\Map\LinkageMap.pm Copying Bio\Search\Hit\hmmer3Hit.pm -> blib\lib\Bio\Search\Hit\hmmer3Hit.pm Copying Bio\HandlerBaseI.pm -> blib\lib\Bio\HandlerBaseI.pm Copying Bio\Map\LinkagePosition.pm -> blib\lib\Bio\Map\LinkagePosition.pm Copying Bio\SearchIO\blast.pm -> blib\lib\Bio\SearchIO\blast.pm Copying Bio\Nexml\Factory.pm -> blib\lib\Bio\Nexml\Factory.pm Copying Bio\Coordinate\Collection.pm -> blib\lib\Bio\Coordinate\Collection.pm Copying Bio\Tools\Grail.pm -> blib\lib\Bio\Tools\Grail.pm Copying Bio\SearchIO\gmap_f9.pm -> blib\lib\Bio\SearchIO\gmap_f9.pm Copying Bio\SeqIO\embldriver.pm -> blib\lib\Bio\SeqIO\embldriver.pm Copying Bio\Search\Hit\GenericHit.pm -> blib\lib\Bio\Search\Hit\GenericHit.pm Copying Bio\Matrix\MatrixI.pm -> blib\lib\Bio\Matrix\MatrixI.pm Copying Bio\Search\SearchUtils.pm -> blib\lib\Bio\Search\SearchUtils.pm Copying Bio\DB\SeqVersion.pm -> blib\lib\Bio\DB\SeqVersion.pm Copying Bio\PopGen\IO.pm -> blib\lib\Bio\PopGen\IO.pm Copying Bio\Taxonomy\Node.pm -> blib\lib\Bio\Taxonomy\Node.pm Copying Bio\Coordinate\Result\Match.pm -> blib\lib\Bio\Coordinate\Result\Match.pm Copying Bio\LocatableSeq.pm -> blib\lib\Bio\LocatableSeq.pm Copying Bio\DB\Registry.pm -> blib\lib\Bio\DB\Registry.pm Copying Bio\Map\GeneMap.pm -> blib\lib\Bio\Map\GeneMap.pm Copying Bio\Matrix\PSM\InstanceSiteI.pm -> blib\lib\Bio\Matrix\PSM\InstanceSiteI.pm Copying Bio\Tools\Alignment\Consed.pm -> blib\lib\Bio\Tools\Alignment\Consed.pm Copying Bio\Seq\PrimedSeq.pm -> blib\lib\Bio\Seq\PrimedSeq.pm Copying Bio\Search\HSP\HSPI.pm -> blib\lib\Bio\Search\HSP\HSPI.pm Copying Bio\SeqFeature\Primer.pm -> blib\lib\Bio\SeqFeature\Primer.pm Copying Bio\UpdateableSeqI.pm -> blib\lib\Bio\UpdateableSeqI.pm Copying Bio\Align\AlignI.pm -> blib\lib\Bio\Align\AlignI.pm Copying Bio\DB\GenericWebAgent.pm -> blib\lib\Bio\DB\GenericWebAgent.pm Copying Bio\Tools\Tmhmm.pm -> blib\lib\Bio\Tools\Tmhmm.pm Copying Bio\Tools\Phylo\Gumby.pm -> blib\lib\Bio\Tools\Phylo\Gumby.pm Copying Bio\Tools\EUtilities\Summary\ItemContainerI.pm -> blib\lib\Bio\Tools\EUtilities\Summary\ItemContainerI.pm Copying Bio\Search\Result\CrossMatchResult.pm -> blib\lib\Bio\Search\Result\CrossMatchResult.pm Copying Bio\DB\GFF\Adaptor\berkeleydb\iterator.pm -> blib\lib\Bio\DB\GFF\Adaptor\berkeleydb\iterator.pm Copying Bio\FeatureIO\vecscreen_simple.pm -> blib\lib\Bio\FeatureIO\vecscreen_simple.pm Copying Bio\SearchIO\axt.pm -> blib\lib\Bio\SearchIO\axt.pm Copying Bio\LiveSeq\Mutation.pm -> blib\lib\Bio\LiveSeq\Mutation.pm Copying Bio\SeqIO\Handler\GenericRichSeqHandler.pm -> blib\lib\Bio\SeqIO\Handler\GenericRichSeqHandler.pm Copying Bio\Map\PositionHandler.pm -> blib\lib\Bio\Map\PositionHandler.pm Copying Bio\LiveSeq\Prim_Transcript.pm -> blib\lib\Bio\LiveSeq\Prim_Transcript.pm Copying Bio\DB\RefSeq.pm -> blib\lib\Bio\DB\RefSeq.pm Copying Bio\Map\Marker.pm -> blib\lib\Bio\Map\Marker.pm Copying Bio\Search\Iteration\IterationI.pm -> blib\lib\Bio\Search\Iteration\IterationI.pm Copying Bio\SeqIO\mbsout.pm -> blib\lib\Bio\SeqIO\mbsout.pm Copying Bio\Event\EventGeneratorI.pm -> blib\lib\Bio\Event\EventGeneratorI.pm Copying Bio\Tools\EUtilities\HistoryI.pm -> blib\lib\Bio\Tools\EUtilities\HistoryI.pm Copying Bio\Species.pm -> blib\lib\Bio\Species.pm Copying Bio\Draw\Pictogram.pm -> blib\lib\Bio\Draw\Pictogram.pm Copying Bio\Tools\Run\StandAloneNCBIBlast.pm -> blib\lib\Bio\Tools\Run\StandAloneNCBIBlast.pm Copying Bio\Tools\Phylo\PAML\ModelResult.pm -> blib\lib\Bio\Tools\Phylo\PAML\ModelResult.pm Copying Bio\Tools\EUtilities\Link\UrlLink.pm -> blib\lib\Bio\Tools\EUtilities\Link\UrlLink.pm Copying Bio\Tools\EUtilities\Summary.pm -> blib\lib\Bio\Tools\EUtilities\Summary.pm Copying Bio\Tree\NodeNHX.pm -> blib\lib\Bio\Tree\NodeNHX.pm Copying Bio\Tools\Run\StandAloneBlast.pm -> blib\lib\Bio\Tools\Run\StandAloneBlast.pm Copying Bio\Tools\Run\WrapperBase.pm -> blib\lib\Bio\Tools\Run\WrapperBase.pm Copying Bio\AlignIO\nexml.pm -> blib\lib\Bio\AlignIO\nexml.pm Copying Bio\LiveSeq\Transcript.pm -> blib\lib\Bio\LiveSeq\Transcript.pm Copying Bio\Tree\TreeFunctionsI.pm -> blib\lib\Bio\Tree\TreeFunctionsI.pm Copying Bio\DB\GFF\Aggregator\orf.pm -> blib\lib\Bio\DB\GFF\Aggregator\orf.pm Copying Bio\Seq\LargePrimarySeq.pm -> blib\lib\Bio\Seq\LargePrimarySeq.pm Copying Bio\Search\DatabaseI.pm -> blib\lib\Bio\Search\DatabaseI.pm Copying Bio\Seq\BaseSeqProcessor.pm -> blib\lib\Bio\Seq\BaseSeqProcessor.pm Copying Bio\Tools\TargetP.pm -> blib\lib\Bio\Tools\TargetP.pm Copying Bio\FeatureIO\bed.pm -> blib\lib\Bio\FeatureIO\bed.pm Copying Bio\Tools\Analysis\Protein\ELM.pm -> blib\lib\Bio\Tools\Analysis\Protein\ELM.pm Copying Bio\Coordinate\GeneMapper.pm -> blib\lib\Bio\Coordinate\GeneMapper.pm Copying Bio\AlignIO\stockholm.pm -> blib\lib\Bio\AlignIO\stockholm.pm Copying Bio\DB\Flat\BDB\embl.pm -> blib\lib\Bio\DB\Flat\BDB\embl.pm Copying Bio\Ontology\PathI.pm -> blib\lib\Bio\Ontology\PathI.pm Copying Bio\AlignIO\xmfa.pm -> blib\lib\Bio\AlignIO\xmfa.pm Copying Bio\OntologyIO\goflat.pm -> blib\lib\Bio\OntologyIO\goflat.pm Copying Bio\DB\Taxonomy\flatfile.pm -> blib\lib\Bio\DB\Taxonomy\flatfile.pm Copying Bio\SearchIO\blasttable.pm -> blib\lib\Bio\SearchIO\blasttable.pm Copying Bio\DB\GFF\Aggregator\alignment.pm -> blib\lib\Bio\DB\GFF\Aggregator\alignment.pm Copying Bio\DB\GFF\Aggregator\gene.pm -> blib\lib\Bio\DB\GFF\Aggregator\gene.pm Copying Bio\Perl.pm -> blib\lib\Bio\Perl.pm Copying Bio\SeqFeature\Generic.pm -> blib\lib\Bio\SeqFeature\Generic.pm Copying Bio\Tools\SiRNA\Ruleset\saigo.pm -> blib\lib\Bio\Tools\SiRNA\Ruleset\saigo.pm Copying Bio\RangeI.pm -> blib\lib\Bio\RangeI.pm Copying Bio\CodonUsage\Table.pm -> blib\lib\Bio\CodonUsage\Table.pm Copying Bio\DB\SeqFeature\NormalizedFeature.pm -> blib\lib\Bio\DB\SeqFeature\NormalizedFeature.pm Copying Bio\Tools\Genscan.pm -> blib\lib\Bio\Tools\Genscan.pm Copying Bio\Seq\MetaI.pm -> blib\lib\Bio\Seq\MetaI.pm Copying Bio\DB\Flat\BDB.pm -> blib\lib\Bio\DB\Flat\BDB.pm Copying Bio\Biblio\BookArticle.pm -> blib\lib\Bio\Biblio\BookArticle.pm Copying Bio\Restriction\IO.pm -> blib\lib\Bio\Restriction\IO.pm Copying Bio\PopGen\HtSNP.pm -> blib\lib\Bio\PopGen\HtSNP.pm Copying Bio\Map\GenePosition.pm -> blib\lib\Bio\Map\GenePosition.pm Copying Bio\SeqIO\pln.pm -> blib\lib\Bio\SeqIO\pln.pm Copying Bio\Matrix\IO\scoring.pm -> blib\lib\Bio\Matrix\IO\scoring.pm Copying Bio\DB\MeSH.pm -> blib\lib\Bio\DB\MeSH.pm Copying Bio\Restriction\EnzymeI.pm -> blib\lib\Bio\Restriction\EnzymeI.pm Copying Bio\Index\Swissprot.pm -> blib\lib\Bio\Index\Swissprot.pm Copying Bio\Tools\Signalp\ExtendedSignalp.pm -> blib\lib\Bio\Tools\Signalp\ExtendedSignalp.pm Copying Bio\Tools\HMMER\Domain.pm -> blib\lib\Bio\Tools\HMMER\Domain.pm Copying Bio\SeqIO\MultiFile.pm -> blib\lib\Bio\SeqIO\MultiFile.pm Copying Bio\SeqIO\lasergene.pm -> blib\lib\Bio\SeqIO\lasergene.pm Copying Bio\OntologyIO.pm -> blib\lib\Bio\OntologyIO.pm Copying Bio\Ontology\SimpleGOEngine\GraphAdaptor02.pm -> blib\lib\Bio\Ontology\SimpleGOEngine\GraphAdaptor02.pm Copying Bio\Tree\AnnotatableNode.pm -> blib\lib\Bio\Tree\AnnotatableNode.pm Copying Bio\Seq\Meta.pm -> blib\lib\Bio\Seq\Meta.pm Copying Bio\Tools\Analysis\Protein\HNN.pm -> blib\lib\Bio\Tools\Analysis\Protein\HNN.pm Copying Bio\Variation\AAReverseMutate.pm -> blib\lib\Bio\Variation\AAReverseMutate.pm Copying Bio\Matrix\IO.pm -> blib\lib\Bio\Matrix\IO.pm Copying Bio\DB\EntrezGene.pm -> blib\lib\Bio\DB\EntrezGene.pm Copying Bio\Tools\EMBOSS\Palindrome.pm -> blib\lib\Bio\Tools\EMBOSS\Palindrome.pm Copying Bio\Tools\Phylo\PAML.pm -> blib\lib\Bio\Tools\Phylo\PAML.pm Copying Bio\Location\Fuzzy.pm -> blib\lib\Bio\Location\Fuzzy.pm Copying Bio\LiveSeq\Repeat_Unit.pm -> blib\lib\Bio\LiveSeq\Repeat_Unit.pm Copying Bio\SeqIO\chadoxml.pm -> blib\lib\Bio\SeqIO\chadoxml.pm Copying Bio\AlignIO\pfam.pm -> blib\lib\Bio\AlignIO\pfam.pm Copying Bio\Location\SplitLocationI.pm -> blib\lib\Bio\Location\SplitLocationI.pm Copying Bio\DB\Biblio\soap.pm -> blib\lib\Bio\DB\Biblio\soap.pm Copying Bio\Search\HSP\HSPFactory.pm -> blib\lib\Bio\Search\HSP\HSPFactory.pm Copying Bio\Tools\MZEF.pm -> blib\lib\Bio\Tools\MZEF.pm Copying Bio\DescribableI.pm -> blib\lib\Bio\DescribableI.pm Copying Bio\OntologyIO\dagflat.pm -> blib\lib\Bio\OntologyIO\dagflat.pm Copying Bio\SimpleAlign.pm -> blib\lib\Bio\SimpleAlign.pm Copying Bio\SeqIO\largefasta.pm -> blib\lib\Bio\SeqIO\largefasta.pm Copying Bio\SeqIO\game.pm -> blib\lib\Bio\SeqIO\game.pm Copying Bio\SearchIO\XML\PsiBlastHandler.pm -> blib\lib\Bio\SearchIO\XML\PsiBlastHandler.pm Copying Bio\Restriction\Enzyme.pm -> blib\lib\Bio\Restriction\Enzyme.pm Copying Bio\Phenotype\Phenotype.pm -> blib\lib\Bio\Phenotype\Phenotype.pm Copying Bio\SeqIO\chaosxml.pm -> blib\lib\Bio\SeqIO\chaosxml.pm Copying Bio\SearchIO\Writer\HitTableWriter.pm -> blib\lib\Bio\SearchIO\Writer\HitTableWriter.pm Copying Bio\Biblio\Journal.pm -> blib\lib\Bio\Biblio\Journal.pm Copying Bio\Matrix\Mlagan.pm -> blib\lib\Bio\Matrix\Mlagan.pm Copying Bio\Matrix\PSM\IO\mast.pm -> blib\lib\Bio\Matrix\PSM\IO\mast.pm Copying Bio\Cluster\ClusterFactory.pm -> blib\lib\Bio\Cluster\ClusterFactory.pm Copying Bio\FeatureIO\interpro.pm -> blib\lib\Bio\FeatureIO\interpro.pm Copying Bio\SeqEvolution\Factory.pm -> blib\lib\Bio\SeqEvolution\Factory.pm Copying Bio\PhyloNetwork\Factory.pm -> blib\lib\Bio\PhyloNetwork\Factory.pm Copying Bio\Biblio\IO\pubmedxml.pm -> blib\lib\Bio\Biblio\IO\pubmedxml.pm Copying Bio\DB\SeqFeature\Store.pm -> blib\lib\Bio\DB\SeqFeature\Store.pm Copying Bio\PrimarySeqI.pm -> blib\lib\Bio\PrimarySeqI.pm Copying Bio\DB\Flat.pm -> blib\lib\Bio\DB\Flat.pm Copying Bio\Biblio\Thesis.pm -> blib\lib\Bio\Biblio\Thesis.pm Copying Bio\Factory\TreeFactoryI.pm -> blib\lib\Bio\Factory\TreeFactoryI.pm Copying Bio\Assembly\Contig.pm -> blib\lib\Bio\Assembly\Contig.pm Copying Bio\Biblio\Article.pm -> blib\lib\Bio\Biblio\Article.pm Copying Bio\DB\InMemoryCache.pm -> blib\lib\Bio\DB\InMemoryCache.pm Copying Bio\Tools\HMMER\Results.pm -> blib\lib\Bio\Tools\HMMER\Results.pm Copying Bio\Tools\AnalysisResult.pm -> blib\lib\Bio\Tools\AnalysisResult.pm Copying Bio\DB\GFF\Aggregator\ucsc_refgene.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_refgene.pm Copying Bio\PopGen\PopStats.pm -> blib\lib\Bio\PopGen\PopStats.pm Copying Bio\TreeIO\NewickParser.pm -> blib\lib\Bio\TreeIO\NewickParser.pm Copying Bio\Seq\EncodedSeq.pm -> blib\lib\Bio\Seq\EncodedSeq.pm Copying Bio\Root\IO.pm -> blib\lib\Bio\Root\IO.pm Copying Bio\SeqIO\ztr.pm -> blib\lib\Bio\SeqIO\ztr.pm Copying Bio\Tools\EUtilities\EUtilDataI.pm -> blib\lib\Bio\Tools\EUtilities\EUtilDataI.pm Copying Bio\Tree\Node.pm -> blib\lib\Bio\Tree\Node.pm Copying Bio\Map\Position.pm -> blib\lib\Bio\Map\Position.pm Copying Bio\LiveSeq\ChainI.pm -> blib\lib\Bio\LiveSeq\ChainI.pm Copying Bio\FeatureHolderI.pm -> blib\lib\Bio\FeatureHolderI.pm Copying Bio\Matrix\Scoring.pm -> blib\lib\Bio\Matrix\Scoring.pm Copying Bio\Restriction\IO\withrefm.pm -> blib\lib\Bio\Restriction\IO\withrefm.pm Copying Bio\Location\NarrowestCoordPolicy.pm -> blib\lib\Bio\Location\NarrowestCoordPolicy.pm Copying Bio\DB\GFF\Aggregator\so_transcript.pm -> blib\lib\Bio\DB\GFF\Aggregator\so_transcript.pm Copying Bio\Annotation\TagTree.pm -> blib\lib\Bio\Annotation\TagTree.pm Copying Bio\Factory\ApplicationFactoryI.pm -> blib\lib\Bio\Factory\ApplicationFactoryI.pm Copying Bio\Matrix\PSM\ProtMatrix.pm -> blib\lib\Bio\Matrix\PSM\ProtMatrix.pm Copying Bio\Das\FeatureTypeI.pm -> blib\lib\Bio\Das\FeatureTypeI.pm Copying Bio\Tools\Gel.pm -> blib\lib\Bio\Tools\Gel.pm Copying Bio\DB\GFF\Feature.pm -> blib\lib\Bio\DB\GFF\Feature.pm Copying Bio\Tools\Run\StandAloneWUBlast.pm -> blib\lib\Bio\Tools\Run\StandAloneWUBlast.pm Copying Bio\Structure\SecStr\STRIDE\Res.pm -> blib\lib\Bio\Structure\SecStr\STRIDE\Res.pm Copying Bio\Location\CoordinatePolicyI.pm -> blib\lib\Bio\Location\CoordinatePolicyI.pm Copying Bio\LiveSeq\Chain.pm -> blib\lib\Bio\LiveSeq\Chain.pm Copying Bio\AlignIO\fasta.pm -> blib\lib\Bio\AlignIO\fasta.pm Copying Bio\Tools\Prediction\Gene.pm -> blib\lib\Bio\Tools\Prediction\Gene.pm Copying Bio\WebAgent.pm -> blib\lib\Bio\WebAgent.pm Copying Bio\Biblio\IO.pm -> blib\lib\Bio\Biblio\IO.pm Copying Bio\Tools\Profile.pm -> blib\lib\Bio\Tools\Profile.pm Copying Bio\Tools\EUtilities\Summary\Item.pm -> blib\lib\Bio\Tools\EUtilities\Summary\Item.pm Copying Bio\Structure\Residue.pm -> blib\lib\Bio\Structure\Residue.pm Copying Bio\Tools\SeqStats.pm -> blib\lib\Bio\Tools\SeqStats.pm Copying Bio\Map\TranscriptionFactor.pm -> blib\lib\Bio\Map\TranscriptionFactor.pm Copying Bio\Align\DNAStatistics.pm -> blib\lib\Bio\Align\DNAStatistics.pm Copying Bio\Tools\Protparam.pm -> blib\lib\Bio\Tools\Protparam.pm Copying Bio\DB\SeqI.pm -> blib\lib\Bio\DB\SeqI.pm Copying Bio\Search\Result\PullResultI.pm -> blib\lib\Bio\Search\Result\PullResultI.pm Copying Bio\PopGen\IO\csv.pm -> blib\lib\Bio\PopGen\IO\csv.pm Copying Bio\SeqIO\genbank.pm -> blib\lib\Bio\SeqIO\genbank.pm Copying Bio\DB\SwissProt.pm -> blib\lib\Bio\DB\SwissProt.pm Copying Bio\Location\Atomic.pm -> blib\lib\Bio\Location\Atomic.pm Copying Bio\Ontology\RelationshipI.pm -> blib\lib\Bio\Ontology\RelationshipI.pm Copying Bio\SeqFeature\Gene\Poly_A_site.pm -> blib\lib\Bio\SeqFeature\Gene\Poly_A_site.pm Copying Bio\PhyloNetwork\FactoryX.pm -> blib\lib\Bio\PhyloNetwork\FactoryX.pm Copying Bio\DB\GFF\Aggregator\ucsc_sanger22.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22.pm Copying Bio\PopGen\Genotype.pm -> blib\lib\Bio\PopGen\Genotype.pm Copying Bio\Search\HSP\BlastPullHSP.pm -> blib\lib\Bio\Search\HSP\BlastPullHSP.pm Copying Bio\Tools\Run\hmmer3.pm -> blib\lib\Bio\Tools\Run\hmmer3.pm Copying Bio\Variation\VariantI.pm -> blib\lib\Bio\Variation\VariantI.pm Copying Bio\Annotation\Tree.pm -> blib\lib\Bio\Annotation\Tree.pm Copying Bio\Biblio\Ref.pm -> blib\lib\Bio\Biblio\Ref.pm Copying Bio\SeqIO\tab.pm -> blib\lib\Bio\SeqIO\tab.pm Copying Bio\Biblio\PubmedArticle.pm -> blib\lib\Bio\Biblio\PubmedArticle.pm Copying Bio\Restriction\IO\bairoch.pm -> blib\lib\Bio\Restriction\IO\bairoch.pm Copying Bio\Tools\Run\ParametersI.pm -> blib\lib\Bio\Tools\Run\ParametersI.pm Copying Bio\NexmlIO.pm -> blib\lib\Bio\NexmlIO.pm Copying Bio\Das\SegmentI.pm -> blib\lib\Bio\Das\SegmentI.pm Copying Bio\Map\Physical.pm -> blib\lib\Bio\Map\Physical.pm Copying Bio\Annotation\TypeManager.pm -> blib\lib\Bio\Annotation\TypeManager.pm Copying Bio\DB\SeqFeature\Store\DBI\mysql.pm -> blib\lib\Bio\DB\SeqFeature\Store\DBI\mysql.pm Copying Bio\SeqFeature\Gene\Intron.pm -> blib\lib\Bio\SeqFeature\Gene\Intron.pm Copying Bio\TreeIO\cluster.pm -> blib\lib\Bio\TreeIO\cluster.pm Copying Bio\DB\SeqFeature\Store\bdb.pm -> blib\lib\Bio\DB\SeqFeature\Store\bdb.pm Copying Bio\SeqFeature\SiRNA\Pair.pm -> blib\lib\Bio\SeqFeature\SiRNA\Pair.pm Copying Bio\Factory\DriverFactory.pm -> blib\lib\Bio\Factory\DriverFactory.pm Copying Bio\Tools\ESTScan.pm -> blib\lib\Bio\Tools\ESTScan.pm Copying Bio\SeqIO\tinyseq\tinyseqHandler.pm -> blib\lib\Bio\SeqIO\tinyseq\tinyseqHandler.pm Copying Bio\AnnotationI.pm -> blib\lib\Bio\AnnotationI.pm Copying Bio\Map\PositionWithSequence.pm -> blib\lib\Bio\Map\PositionWithSequence.pm Copying Bio\Tools\Sigcleave.pm -> blib\lib\Bio\Tools\Sigcleave.pm Copying Bio\Tree\Statistics.pm -> blib\lib\Bio\Tree\Statistics.pm Copying Bio\Biblio\TechReport.pm -> blib\lib\Bio\Biblio\TechReport.pm Copying Bio\Tools\Analysis\SimpleAnalysisBase.pm -> blib\lib\Bio\Tools\Analysis\SimpleAnalysisBase.pm Copying Bio\Tools\Geneid.pm -> blib\lib\Bio\Tools\Geneid.pm Copying Bio\Tools\Glimmer.pm -> blib\lib\Bio\Tools\Glimmer.pm Copying Bio\Tools\Est2Genome.pm -> blib\lib\Bio\Tools\Est2Genome.pm Copying Bio\Tools\EUtilities\Query\GlobalQuery.pm -> blib\lib\Bio\Tools\EUtilities\Query\GlobalQuery.pm Copying Bio\Tools\Phylo\Molphy\Result.pm -> blib\lib\Bio\Tools\Phylo\Molphy\Result.pm Copying Bio\DB\Ace.pm -> blib\lib\Bio\DB\Ace.pm Copying Bio\Tools\Phylo\Gerp.pm -> blib\lib\Bio\Tools\Phylo\Gerp.pm Copying Bio\DB\SeqFeature\Store\LoadHelper.pm -> blib\lib\Bio\DB\SeqFeature\Store\LoadHelper.pm Copying Bio\Biblio\PubmedJournalArticle.pm -> blib\lib\Bio\Biblio\PubmedJournalArticle.pm Copying Bio\SeqIO\embl.pm -> blib\lib\Bio\SeqIO\embl.pm Copying Bio\Tools\Coil.pm -> blib\lib\Bio\Tools\Coil.pm Copying Bio\DB\GFF\Aggregator\ucsc_genscan.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_genscan.pm Copying Bio\DB\Flat\BDB\genbank.pm -> blib\lib\Bio\DB\Flat\BDB\genbank.pm Copying Bio\Seq\RichSeqI.pm -> blib\lib\Bio\Seq\RichSeqI.pm Copying Bio\Search\Tiling\MapTiling.pm -> blib\lib\Bio\Search\Tiling\MapTiling.pm Copying Bio\Seq\SeqFastaSpeedFactory.pm -> blib\lib\Bio\Seq\SeqFastaSpeedFactory.pm Copying Bio\Phenotype\OMIM\OMIMparser.pm -> blib\lib\Bio\Phenotype\OMIM\OMIMparser.pm Copying Bio\DB\GFF\Segment.pm -> blib\lib\Bio\DB\GFF\Segment.pm Copying Bio\Map\RelativeI.pm -> blib\lib\Bio\Map\RelativeI.pm Copying Bio\DB\GFF\Aggregator\processed_transcript.pm -> blib\lib\Bio\DB\GFF\Aggregator\processed_transcript.pm Copying Bio\SeqIO\strider.pm -> blib\lib\Bio\SeqIO\strider.pm Copying Bio\Tools\Signalp.pm -> blib\lib\Bio\Tools\Signalp.pm Copying Bio\Tree\NodeI.pm -> blib\lib\Bio\Tree\NodeI.pm Copying Bio\Tree\TreeI.pm -> blib\lib\Bio\Tree\TreeI.pm Copying Bio\SearchIO\megablast.pm -> blib\lib\Bio\SearchIO\megablast.pm Copying Bio\Ontology\InterProTerm.pm -> blib\lib\Bio\Ontology\InterProTerm.pm Copying Bio\DB\Biblio\biofetch.pm -> blib\lib\Bio\DB\Biblio\biofetch.pm Copying Bio\SeqIO\gcg.pm -> blib\lib\Bio\SeqIO\gcg.pm Copying Bio\Tree\AlleleNode.pm -> blib\lib\Bio\Tree\AlleleNode.pm Copying Bio\DB\HIV\HIVAnnotProcessor.pm -> blib\lib\Bio\DB\HIV\HIVAnnotProcessor.pm Copying Bio\Tools\OddCodes.pm -> blib\lib\Bio\Tools\OddCodes.pm Copying Bio\DB\Query\GenBank.pm -> blib\lib\Bio\DB\Query\GenBank.pm Copying Bio\SeqIO\raw.pm -> blib\lib\Bio\SeqIO\raw.pm Copying Bio\TreeIO\TreeEventBuilder.pm -> blib\lib\Bio\TreeIO\TreeEventBuilder.pm Copying Bio\Tools\EUtilities\Link\LinkSet.pm -> blib\lib\Bio\Tools\EUtilities\Link\LinkSet.pm Copying Bio\Tools\RandomDistFunctions.pm -> blib\lib\Bio\Tools\RandomDistFunctions.pm Copying Bio\DB\GFF\Adaptor\biofetch_oracle.pm -> blib\lib\Bio\DB\GFF\Adaptor\biofetch_oracle.pm Copying Bio\SearchIO\hmmer3.pm -> blib\lib\Bio\SearchIO\hmmer3.pm Copying Bio\SeqIO\seqxml.pm -> blib\lib\Bio\SeqIO\seqxml.pm Copying Bio\DB\GFF\Adaptor\memory.pm -> blib\lib\Bio\DB\GFF\Adaptor\memory.pm Copying Bio\DB\Expression\geo.pm -> blib\lib\Bio\DB\Expression\geo.pm Copying Bio\Tools\Primer\AssessorI.pm -> blib\lib\Bio\Tools\Primer\AssessorI.pm Copying Bio\Cluster\UniGeneI.pm -> blib\lib\Bio\Cluster\UniGeneI.pm Copying Bio\Map\PositionHandlerI.pm -> blib\lib\Bio\Map\PositionHandlerI.pm Copying Bio\LocationI.pm -> blib\lib\Bio\LocationI.pm Copying Bio\PhyloNetwork\RandomFactory.pm -> blib\lib\Bio\PhyloNetwork\RandomFactory.pm Copying Bio\DB\GFF\Adaptor\memory\iterator.pm -> blib\lib\Bio\DB\GFF\Adaptor\memory\iterator.pm Copying Bio\Tools\AlignFactory.pm -> blib\lib\Bio\Tools\AlignFactory.pm Copying Bio\Location\FuzzyLocationI.pm -> blib\lib\Bio\Location\FuzzyLocationI.pm Copying Bio\Biblio\MedlineJournal.pm -> blib\lib\Bio\Biblio\MedlineJournal.pm Copying Bio\Map\MapI.pm -> blib\lib\Bio\Map\MapI.pm Copying Bio\Matrix\PSM\SiteMatrixI.pm -> blib\lib\Bio\Matrix\PSM\SiteMatrixI.pm Copying Bio\Annotation\Target.pm -> blib\lib\Bio\Annotation\Target.pm Copying Bio\DB\GFF\Adaptor\dbi\oracleace.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\oracleace.pm Copying Bio\SeqFeature\Gene\Promoter.pm -> blib\lib\Bio\SeqFeature\Gene\Promoter.pm Copying Bio\Annotation\Reference.pm -> blib\lib\Bio\Annotation\Reference.pm Copying Bio\DB\SeqFeature\Store\GFF3Loader.pm -> blib\lib\Bio\DB\SeqFeature\Store\GFF3Loader.pm Copying Bio\LiveSeq\DNA.pm -> blib\lib\Bio\LiveSeq\DNA.pm Copying Bio\SeqIO\chaos.pm -> blib\lib\Bio\SeqIO\chaos.pm Copying Bio\Tools\Primer\Assessor\Base.pm -> blib\lib\Bio\Tools\Primer\Assessor\Base.pm Copying Bio\Index\Fasta.pm -> blib\lib\Bio\Index\Fasta.pm Copying Bio\Tree\Draw\Cladogram.pm -> blib\lib\Bio\Tree\Draw\Cladogram.pm Copying Bio\Search\Result\GenericResult.pm -> blib\lib\Bio\Search\Result\GenericResult.pm Copying Bio\SeqIO\phd.pm -> blib\lib\Bio\SeqIO\phd.pm Copying Bio\Root\Build.pm -> blib\lib\Bio\Root\Build.pm Copying Bio\SeqIO\pir.pm -> blib\lib\Bio\SeqIO\pir.pm Copying Bio\Phenotype\OMIM\OMIMentry.pm -> blib\lib\Bio\Phenotype\OMIM\OMIMentry.pm Copying Bio\Tools\SeqPattern\Backtranslate.pm -> blib\lib\Bio\Tools\SeqPattern\Backtranslate.pm Copying Bio\Map\Gene.pm -> blib\lib\Bio\Map\Gene.pm Copying Bio\Search\Result\WABAResult.pm -> blib\lib\Bio\Search\Result\WABAResult.pm Copying Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm -> blib\lib\Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm Copying Bio\Factory\LocationFactoryI.pm -> blib\lib\Bio\Factory\LocationFactoryI.pm Copying Bio\MapIO\fpc.pm -> blib\lib\Bio\MapIO\fpc.pm Copying Bio\SeqAnalysisParserI.pm -> blib\lib\Bio\SeqAnalysisParserI.pm Copying Bio\OntologyIO\simplehierarchy.pm -> blib\lib\Bio\OntologyIO\simplehierarchy.pm Copying Bio\Variation\DNAMutation.pm -> blib\lib\Bio\Variation\DNAMutation.pm Copying Bio\Tools\HMMER\Set.pm -> blib\lib\Bio\Tools\HMMER\Set.pm Copying Bio\SearchIO\infernal.pm -> blib\lib\Bio\SearchIO\infernal.pm Copying Bio\SeqFeature\CollectionI.pm -> blib\lib\Bio\SeqFeature\CollectionI.pm Copying Bio\AlignIO\mase.pm -> blib\lib\Bio\AlignIO\mase.pm Copying Bio\TreeIO\pag.pm -> blib\lib\Bio\TreeIO\pag.pm Copying Bio\LiveSeq\IO\Loader.pm -> blib\lib\Bio\LiveSeq\IO\Loader.pm Copying Bio\Variation\IO\xml.pm -> blib\lib\Bio\Variation\IO\xml.pm Copying Bio\DB\SeqVersion\gi.pm -> blib\lib\Bio\DB\SeqVersion\gi.pm Copying Bio\PopGen\Marker.pm -> blib\lib\Bio\PopGen\Marker.pm Copying Bio\SeqFeature\Gene\GeneStructureI.pm -> blib\lib\Bio\SeqFeature\Gene\GeneStructureI.pm Copying Bio\AlignIO\mega.pm -> blib\lib\Bio\AlignIO\mega.pm Copying Bio\Matrix\PSM\IO.pm -> blib\lib\Bio\Matrix\PSM\IO.pm Copying Bio\DB\GFF\Adaptor\dbi\pg.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\pg.pm Copying Bio\DB\GFF\Aggregator\ucsc_ensgene.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_ensgene.pm Copying Bio\SeqIO\msout.pm -> blib\lib\Bio\SeqIO\msout.pm Copying Bio\Tools\Primer\Feature.pm -> blib\lib\Bio\Tools\Primer\Feature.pm Copying Bio\DB\SeqFeature\Segment.pm -> blib\lib\Bio\DB\SeqFeature\Segment.pm Copying Bio\Structure\SecStr\DSSP\Res.pm -> blib\lib\Bio\Structure\SecStr\DSSP\Res.pm Copying Bio\PhyloNetwork\GraphViz.pm -> blib\lib\Bio\PhyloNetwork\GraphViz.pm Copying Bio\Assembly\IO\bowtie.pm -> blib\lib\Bio\Assembly\IO\bowtie.pm Copying Bio\DB\EMBL.pm -> blib\lib\Bio\DB\EMBL.pm Copying Bio\SearchIO\fasta.pm -> blib\lib\Bio\SearchIO\fasta.pm Copying Bio\DB\GFF\Aggregator\ucsc_softberry.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_softberry.pm Copying Bio\DB\SeqFeature\Store\memory.pm -> blib\lib\Bio\DB\SeqFeature\Store\memory.pm Copying Bio\DB\HIV.pm -> blib\lib\Bio\DB\HIV.pm Copying Bio\Biblio\BiblioBase.pm -> blib\lib\Bio\Biblio\BiblioBase.pm Copying Bio\Matrix\PhylipDist.pm -> blib\lib\Bio\Matrix\PhylipDist.pm Copying Bio\PhyloNetwork\TreeFactory.pm -> blib\lib\Bio\PhyloNetwork\TreeFactory.pm Copying Bio\Matrix\PSM\IO\transfac.pm -> blib\lib\Bio\Matrix\PSM\IO\transfac.pm Copying Bio\SearchIO\Writer\ResultTableWriter.pm -> blib\lib\Bio\SearchIO\Writer\ResultTableWriter.pm Copying Bio\Search\Result\hmmer3Result.pm -> blib\lib\Bio\Search\Result\hmmer3Result.pm Copying Bio\Coordinate\ExtrapolatingPair.pm -> blib\lib\Bio\Coordinate\ExtrapolatingPair.pm Copying Bio\SearchIO\cross_match.pm -> blib\lib\Bio\SearchIO\cross_match.pm Copying Bio\Index\EMBL.pm -> blib\lib\Bio\Index\EMBL.pm Copying Bio\SearchIO\rnamotif.pm -> blib\lib\Bio\SearchIO\rnamotif.pm Copying Bio\Seq\LargeSeq.pm -> blib\lib\Bio\Seq\LargeSeq.pm Copying Bio\SeqIO\game\gameSubs.pm -> blib\lib\Bio\SeqIO\game\gameSubs.pm Copying Bio\AlignIO\psi.pm -> blib\lib\Bio\AlignIO\psi.pm Copying Bio\DB\GFF\Aggregator\clone.pm -> blib\lib\Bio\DB\GFF\Aggregator\clone.pm Copying Bio\PopGen\IO\phase.pm -> blib\lib\Bio\PopGen\IO\phase.pm Copying Bio\Seq\LargeLocatableSeq.pm -> blib\lib\Bio\Seq\LargeLocatableSeq.pm Copying Bio\Map\Prediction.pm -> blib\lib\Bio\Map\Prediction.pm Copying Bio\Biblio\Service.pm -> blib\lib\Bio\Biblio\Service.pm Copying Bio\DB\RandomAccessI.pm -> blib\lib\Bio\DB\RandomAccessI.pm Copying Bio\Map\CytoMarker.pm -> blib\lib\Bio\Map\CytoMarker.pm Copying Bio\LiveSeq\Range.pm -> blib\lib\Bio\LiveSeq\Range.pm Copying Bio\Search\Result\HMMERResult.pm -> blib\lib\Bio\Search\Result\HMMERResult.pm Copying Bio\Seq\QualI.pm -> blib\lib\Bio\Seq\QualI.pm Copying Bio\Tree\Tree.pm -> blib\lib\Bio\Tree\Tree.pm Copying Bio\DB\GFF\Adaptor\dbi.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi.pm Copying Bio\DB\SeqFeature\Store\FeatureFileLoader.pm -> blib\lib\Bio\DB\SeqFeature\Store\FeatureFileLoader.pm Copying Bio\Assembly\IO\ace.pm -> blib\lib\Bio\Assembly\IO\ace.pm Copying Bio\DB\Qual.pm -> blib\lib\Bio\DB\Qual.pm Copying Bio\PopGen\Population.pm -> blib\lib\Bio\PopGen\Population.pm Copying Bio\SeqIO\game\gameWriter.pm -> blib\lib\Bio\SeqIO\game\gameWriter.pm Copying Bio\Root\RootI.pm -> blib\lib\Bio\Root\RootI.pm Copying Bio\SeqIO\FTHelper.pm -> blib\lib\Bio\SeqIO\FTHelper.pm Copying Bio\Tools\Phylo\Molphy.pm -> blib\lib\Bio\Tools\Phylo\Molphy.pm Copying Bio\Seq\SeqFactory.pm -> blib\lib\Bio\Seq\SeqFactory.pm Copying Bio\SeqIO\fasta.pm -> blib\lib\Bio\SeqIO\fasta.pm Copying Bio\TreeIO\nhx.pm -> blib\lib\Bio\TreeIO\nhx.pm Copying Bio\Ontology\OBOEngine.pm -> blib\lib\Bio\Ontology\OBOEngine.pm Copying Bio\Variation\Allele.pm -> blib\lib\Bio\Variation\Allele.pm Copying Bio\Location\AvWithinCoordPolicy.pm -> blib\lib\Bio\Location\AvWithinCoordPolicy.pm Copying Bio\LiveSeq\AARange.pm -> blib\lib\Bio\LiveSeq\AARange.pm Copying Bio\Tools\RepeatMasker.pm -> blib\lib\Bio\Tools\RepeatMasker.pm Copying Bio\Align\ProteinStatistics.pm -> blib\lib\Bio\Align\ProteinStatistics.pm Copying Bio\Seq\Quality.pm -> blib\lib\Bio\Seq\Quality.pm Copying Bio\TreeIO\nexus.pm -> blib\lib\Bio\TreeIO\nexus.pm Copying Bio\Tools\Genemark.pm -> blib\lib\Bio\Tools\Genemark.pm Copying Bio\SeqFeature\Tools\FeatureNamer.pm -> blib\lib\Bio\SeqFeature\Tools\FeatureNamer.pm Copying Bio\Tools\Hmmpfam.pm -> blib\lib\Bio\Tools\Hmmpfam.pm Copying Bio\Index\Stockholm.pm -> blib\lib\Bio\Index\Stockholm.pm Copying Bio\Ontology\DocumentRegistry.pm -> blib\lib\Bio\Ontology\DocumentRegistry.pm Copying Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm -> blib\lib\Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm Copying Bio\DB\Biblio\eutils.pm -> blib\lib\Bio\DB\Biblio\eutils.pm Copying Bio\Ontology\OntologyI.pm -> blib\lib\Bio\Ontology\OntologyI.pm Copying Bio\DB\SeqFeature\Store\berkeleydb.pm -> blib\lib\Bio\DB\SeqFeature\Store\berkeleydb.pm Copying Bio\Tools\isPcr.pm -> blib\lib\Bio\Tools\isPcr.pm Copying Bio\Tools\QRNA.pm -> blib\lib\Bio\Tools\QRNA.pm Copying Bio\DB\SeqFeature\NormalizedFeatureI.pm -> blib\lib\Bio\DB\SeqFeature\NormalizedFeatureI.pm Copying Bio\Biblio\MedlineBook.pm -> blib\lib\Bio\Biblio\MedlineBook.pm Copying Bio\Tools\RNAMotif.pm -> blib\lib\Bio\Tools\RNAMotif.pm Copying Bio\Tools\Genewise.pm -> blib\lib\Bio\Tools\Genewise.pm Copying Bio\TreeIO\phyloxml.pm -> blib\lib\Bio\TreeIO\phyloxml.pm Copying Bio\SeqIO\flybase_chadoxml.pm -> blib\lib\Bio\SeqIO\flybase_chadoxml.pm Copying Bio\Biblio\IO\medlinexml.pm -> blib\lib\Bio\Biblio\IO\medlinexml.pm Copying Bio\Tools\PrositeScan.pm -> blib\lib\Bio\Tools\PrositeScan.pm Copying Bio\AnnotatableI.pm -> blib\lib\Bio\AnnotatableI.pm Copying Bio\FeatureIO\gtf.pm -> blib\lib\Bio\FeatureIO\gtf.pm Copying Bio\SeqIO\metafasta.pm -> blib\lib\Bio\SeqIO\metafasta.pm Copying Bio\LiveSeq\IO\BioPerl.pm -> blib\lib\Bio\LiveSeq\IO\BioPerl.pm Copying Bio\Range.pm -> blib\lib\Bio\Range.pm Copying Bio\Factory\SeqAnalysisParserFactoryI.pm -> blib\lib\Bio\Factory\SeqAnalysisParserFactoryI.pm Copying Bio\SeqIO\asciitree.pm -> blib\lib\Bio\SeqIO\asciitree.pm Copying Bio\MolEvol\CodonModel.pm -> blib\lib\Bio\MolEvol\CodonModel.pm Copying Bio\Tools\EUtilities\History.pm -> blib\lib\Bio\Tools\EUtilities\History.pm Copying Bio\AlignIO\Handler\GenericAlignHandler.pm -> blib\lib\Bio\AlignIO\Handler\GenericAlignHandler.pm Copying Bio\Tools\ERPIN.pm -> blib\lib\Bio\Tools\ERPIN.pm Copying Bio\PopGen\MarkerI.pm -> blib\lib\Bio\PopGen\MarkerI.pm Copying Bio\Matrix\PSM\PsmI.pm -> blib\lib\Bio\Matrix\PSM\PsmI.pm Copying Bio\SearchIO\XML\BlastHandler.pm -> blib\lib\Bio\SearchIO\XML\BlastHandler.pm Copying Bio\Search\Processor.pm -> blib\lib\Bio\Search\Processor.pm Copying Bio\ClusterIO\unigene.pm -> blib\lib\Bio\ClusterIO\unigene.pm Copying Bio\DB\HIV\HIVQueryHelper.pm -> blib\lib\Bio\DB\HIV\HIVQueryHelper.pm Copying Bio\Tools\Eponine.pm -> blib\lib\Bio\Tools\Eponine.pm Copying Bio\Tools\EUtilities\Link.pm -> blib\lib\Bio\Tools\EUtilities\Link.pm Copying Bio\Tools\Sim4\Results.pm -> blib\lib\Bio\Tools\Sim4\Results.pm Copying Bio\DasI.pm -> blib\lib\Bio\DasI.pm Copying Bio\IdCollectionI.pm -> blib\lib\Bio\IdCollectionI.pm Copying Bio\Tools\dpAlign.pm -> blib\lib\Bio\Tools\dpAlign.pm Copying Bio\SeqIO\swiss.pm -> blib\lib\Bio\SeqIO\swiss.pm Copying Bio\AnnotationCollectionI.pm -> blib\lib\Bio\AnnotationCollectionI.pm Copying Bio\Tools\Primer\Pair.pm -> blib\lib\Bio\Tools\Primer\Pair.pm Copying Bio\Cluster\FamilyI.pm -> blib\lib\Bio\Cluster\FamilyI.pm Copying Bio\Tools\Phylo\PAML\Codeml.pm -> blib\lib\Bio\Tools\Phylo\PAML\Codeml.pm Copying Bio\Factory\SequenceStreamI.pm -> blib\lib\Bio\Factory\SequenceStreamI.pm Copying Bio\Search\HSP\GenericHSP.pm -> blib\lib\Bio\Search\HSP\GenericHSP.pm Copying Bio\Factory\MapFactoryI.pm -> blib\lib\Bio\Factory\MapFactoryI.pm Copying Bio\Tools\EUtilities.pm -> blib\lib\Bio\Tools\EUtilities.pm Copying Bio\Coordinate\Chain.pm -> blib\lib\Bio\Coordinate\Chain.pm Copying Bio\AlignIO\proda.pm -> blib\lib\Bio\AlignIO\proda.pm Copying Bio\AlignIO\emboss.pm -> blib\lib\Bio\AlignIO\emboss.pm Copying Bio\Tools\Run\GenericParameters.pm -> blib\lib\Bio\Tools\Run\GenericParameters.pm Copying Bio\SeqIO\swissdriver.pm -> blib\lib\Bio\SeqIO\swissdriver.pm Copying Bio\Variation\SNP.pm -> blib\lib\Bio\Variation\SNP.pm Copying Bio\Tools\EUtilities\Info\FieldInfo.pm -> blib\lib\Bio\Tools\EUtilities\Info\FieldInfo.pm Copying Bio\DBLinkContainerI.pm -> blib\lib\Bio\DBLinkContainerI.pm Copying Bio\Variation\AAChange.pm -> blib\lib\Bio\Variation\AAChange.pm Copying Bio\SearchIO\hmmer2.pm -> blib\lib\Bio\SearchIO\hmmer2.pm Copying Bio\Root\Test\Warn.pm -> blib\lib\Bio\Root\Test\Warn.pm Copying Bio\DB\Query\HIVQuery.pm -> blib\lib\Bio\DB\Query\HIVQuery.pm Copying Bio\DB\Universal.pm -> blib\lib\Bio\DB\Universal.pm Copying Bio\Ontology\TermI.pm -> blib\lib\Bio\Ontology\TermI.pm Copying Bio\Taxonomy\FactoryI.pm -> blib\lib\Bio\Taxonomy\FactoryI.pm Copying Bio\Map\GeneRelative.pm -> blib\lib\Bio\Map\GeneRelative.pm Copying Bio\DB\SeqFeature\Store\berkeleydb3.pm -> blib\lib\Bio\DB\SeqFeature\Store\berkeleydb3.pm Copying Bio\Root\Test.pm -> blib\lib\Bio\Root\Test.pm Copying Bio\Ontology\TermFactory.pm -> blib\lib\Bio\Ontology\TermFactory.pm Copying Bio\Search\HSP\PSLHSP.pm -> blib\lib\Bio\Search\HSP\PSLHSP.pm Copying Bio\Annotation\DBLink.pm -> blib\lib\Bio\Annotation\DBLink.pm Copying Bio\SeqIO\tinyseq.pm -> blib\lib\Bio\SeqIO\tinyseq.pm Copying Bio\Taxonomy\Taxon.pm -> blib\lib\Bio\Taxonomy\Taxon.pm Copying Bio\PopGen\Utilities.pm -> blib\lib\Bio\PopGen\Utilities.pm Copying Bio\Tools\SeqPattern.pm -> blib\lib\Bio\Tools\SeqPattern.pm Copying Bio\Tree\DistanceFactory.pm -> blib\lib\Bio\Tree\DistanceFactory.pm Copying Bio\Root\Storable.pm -> blib\lib\Bio\Root\Storable.pm Copying Bio\SeqIO\gbdriver.pm -> blib\lib\Bio\SeqIO\gbdriver.pm Copying Bio\AlignIO\selex.pm -> blib\lib\Bio\AlignIO\selex.pm Copying Bio\SearchIO\Writer\BSMLResultWriter.pm -> blib\lib\Bio\SearchIO\Writer\BSMLResultWriter.pm Copying Bio\SeqIO\locuslink.pm -> blib\lib\Bio\SeqIO\locuslink.pm Copying Bio\FeatureIO\gff.pm -> blib\lib\Bio\FeatureIO\gff.pm Copying Bio\DB\GenBank.pm -> blib\lib\Bio\DB\GenBank.pm Copying Bio\Ontology\Term.pm -> blib\lib\Bio\Ontology\Term.pm Copying Bio\Cluster\UniGene.pm -> blib\lib\Bio\Cluster\UniGene.pm Copying Bio\SearchIO\Writer\TextResultWriter.pm -> blib\lib\Bio\SearchIO\Writer\TextResultWriter.pm Copying Bio\Search\Tiling\MapTileUtils.pm -> blib\lib\Bio\Search\Tiling\MapTileUtils.pm Copying Bio\Tools\Spidey\Results.pm -> blib\lib\Bio\Tools\Spidey\Results.pm Copying Bio\DB\QueryI.pm -> blib\lib\Bio\DB\QueryI.pm Copying Bio\Search\BlastUtils.pm -> blib\lib\Bio\Search\BlastUtils.pm Copying Bio\Tools\SiRNA\Ruleset\tuschl.pm -> blib\lib\Bio\Tools\SiRNA\Ruleset\tuschl.pm Copying Bio\Structure\IO\pdb.pm -> blib\lib\Bio\Structure\IO\pdb.pm Copying Bio\Search\Result\HmmpfamResult.pm -> blib\lib\Bio\Search\Result\HmmpfamResult.pm Copying Bio\DB\Query\WebQuery.pm -> blib\lib\Bio\DB\Query\WebQuery.pm Copying Bio\Search\HSP\HmmpfamHSP.pm -> blib\lib\Bio\Search\HSP\HmmpfamHSP.pm Copying Bio\SeqFeature\SimilarityPair.pm -> blib\lib\Bio\SeqFeature\SimilarityPair.pm Copying Bio\Tools\Match.pm -> blib\lib\Bio\Tools\Match.pm Copying Bio\OntologyIO\obo.pm -> blib\lib\Bio\OntologyIO\obo.pm Copying Bio\Coordinate\MapperI.pm -> blib\lib\Bio\Coordinate\MapperI.pm Copying Bio\Annotation\Relation.pm -> blib\lib\Bio\Annotation\Relation.pm Copying Bio\Tools\EUtilities\EUtilParameters.pm -> blib\lib\Bio\Tools\EUtilities\EUtilParameters.pm Copying Bio\Search\Result\ResultI.pm -> blib\lib\Bio\Search\Result\ResultI.pm Copying Bio\SeqIO\kegg.pm -> blib\lib\Bio\SeqIO\kegg.pm Copying Bio\Tools\pSW.pm -> blib\lib\Bio\Tools\pSW.pm Copying Bio\LiveSeq\Mutator.pm -> blib\lib\Bio\LiveSeq\Mutator.pm Copying Bio\SeqIO.pm -> blib\lib\Bio\SeqIO.pm Copying Bio\Phenotype\PhenotypeI.pm -> blib\lib\Bio\Phenotype\PhenotypeI.pm Copying Bio\Restriction\IO\base.pm -> blib\lib\Bio\Restriction\IO\base.pm Copying Bio\Tools\Infernal.pm -> blib\lib\Bio\Tools\Infernal.pm Copying Bio\SimpleAnalysisI.pm -> blib\lib\Bio\SimpleAnalysisI.pm Copying Bio\Tools\Analysis\Protein\Mitoprot.pm -> blib\lib\Bio\Tools\Analysis\Protein\Mitoprot.pm Copying Bio\DB\Flat\BinarySearch.pm -> blib\lib\Bio\DB\Flat\BinarySearch.pm Copying Bio\SeqFeature\Tools\Unflattener.pm -> blib\lib\Bio\SeqFeature\Tools\Unflattener.pm Copying Bio\Tools\Analysis\Protein\Scansite.pm -> blib\lib\Bio\Tools\Analysis\Protein\Scansite.pm Copying Bio\Variation\RNAChange.pm -> blib\lib\Bio\Variation\RNAChange.pm Copying Bio\Symbol\SymbolI.pm -> blib\lib\Bio\Symbol\SymbolI.pm Copying Bio\Tools\Run\RemoteBlast.pm -> blib\lib\Bio\Tools\Run\RemoteBlast.pm Copying Bio\Tools\EUtilities\Info\LinkInfo.pm -> blib\lib\Bio\Tools\EUtilities\Info\LinkInfo.pm Copying Bio\Tools\tRNAscanSE.pm -> blib\lib\Bio\Tools\tRNAscanSE.pm Copying Bio\Tools\Prints.pm -> blib\lib\Bio\Tools\Prints.pm Copying Bio\DB\GFF\Adaptor\biofetch.pm -> blib\lib\Bio\DB\GFF\Adaptor\biofetch.pm Copying Bio\AlignIO\largemultifasta.pm -> blib\lib\Bio\AlignIO\largemultifasta.pm Copying Bio\PrimarySeq.pm -> blib\lib\Bio\PrimarySeq.pm Copying Bio\SearchIO\SearchWriterI.pm -> blib\lib\Bio\SearchIO\SearchWriterI.pm Copying Bio\SeqIO\bsml.pm -> blib\lib\Bio\SeqIO\bsml.pm Copying Bio\Assembly\IO\maq.pm -> blib\lib\Bio\Assembly\IO\maq.pm Copying Bio\Structure\Entry.pm -> blib\lib\Bio\Structure\Entry.pm Copying Bio\Biblio\PubmedBookArticle.pm -> blib\lib\Bio\Biblio\PubmedBookArticle.pm Copying Bio\Root\Exception.pm -> blib\lib\Bio\Root\Exception.pm Copying Bio\SeqIO\ace.pm -> blib\lib\Bio\SeqIO\ace.pm Copying Bio\DB\GFF\Aggregator\match.pm -> blib\lib\Bio\DB\GFF\Aggregator\match.pm Copying Bio\Search\BlastStatistics.pm -> blib\lib\Bio\Search\BlastStatistics.pm Copying Bio\Map\Microsatellite.pm -> blib\lib\Bio\Map\Microsatellite.pm Copying Bio\Restriction\IO\prototype.pm -> blib\lib\Bio\Restriction\IO\prototype.pm Copying Bio\Tools\TandemRepeatsFinder.pm -> blib\lib\Bio\Tools\TandemRepeatsFinder.pm Copying Bio\Coordinate\Graph.pm -> blib\lib\Bio\Coordinate\Graph.pm Copying Bio\Tools\Blat.pm -> blib\lib\Bio\Tools\Blat.pm Copying Bio\Structure\StructureI.pm -> blib\lib\Bio\Structure\StructureI.pm Copying Bio\Index\GenBank.pm -> blib\lib\Bio\Index\GenBank.pm Copying Bio\Search\Result\BlastPullResult.pm -> blib\lib\Bio\Search\Result\BlastPullResult.pm Copying Bio\PopGen\Simulation\Coalescent.pm -> blib\lib\Bio\PopGen\Simulation\Coalescent.pm Copying Bio\Map\OrderedPosition.pm -> blib\lib\Bio\Map\OrderedPosition.pm Copying Bio\Biblio\MedlineArticle.pm -> blib\lib\Bio\Biblio\MedlineArticle.pm Copying Bio\PopGen\IO\prettybase.pm -> blib\lib\Bio\PopGen\IO\prettybase.pm Copying Bio\AlignIO\maf.pm -> blib\lib\Bio\AlignIO\maf.pm Copying Bio\Symbol\Alphabet.pm -> blib\lib\Bio\Symbol\Alphabet.pm Copying Bio\Search\HSP\BlastHSP.pm -> blib\lib\Bio\Search\HSP\BlastHSP.pm Copying Bio\Factory\ObjectFactory.pm -> blib\lib\Bio\Factory\ObjectFactory.pm Copying Bio\DB\GFF\Util\Rearrange.pm -> blib\lib\Bio\DB\GFF\Util\Rearrange.pm Copying Bio\DB\ReferenceI.pm -> blib\lib\Bio\DB\ReferenceI.pm Copying Bio\Tree\Compatible.pm -> blib\lib\Bio\Tree\Compatible.pm Copying Bio\Search\Hit\HitI.pm -> blib\lib\Bio\Search\Hit\HitI.pm Copying Bio\Index\Blast.pm -> blib\lib\Bio\Index\Blast.pm Copying Bio\Biblio\MedlineJournalArticle.pm -> blib\lib\Bio\Biblio\MedlineJournalArticle.pm Copying Bio\Biblio\Organisation.pm -> blib\lib\Bio\Biblio\Organisation.pm Copying Bio\Search\Result\BlastResult.pm -> blib\lib\Bio\Search\Result\BlastResult.pm Copying Bio\Annotation\AnnotationFactory.pm -> blib\lib\Bio\Annotation\AnnotationFactory.pm Copying Bio\Tools\ECnumber.pm -> blib\lib\Bio\Tools\ECnumber.pm Copying Bio\ParameterBaseI.pm -> blib\lib\Bio\ParameterBaseI.pm Copying Bio\Search\Hit\HmmpfamHit.pm -> blib\lib\Bio\Search\Hit\HmmpfamHit.pm Copying Bio\Search\Result\ResultFactory.pm -> blib\lib\Bio\Search\Result\ResultFactory.pm Copying Bio\Index\Qual.pm -> blib\lib\Bio\Index\Qual.pm Copying Bio\Tools\IUPAC.pm -> blib\lib\Bio\Tools\IUPAC.pm Copying Bio\SearchIO\FastHitEventBuilder.pm -> blib\lib\Bio\SearchIO\FastHitEventBuilder.pm Copying Bio\SearchIO\SearchResultEventBuilder.pm -> blib\lib\Bio\SearchIO\SearchResultEventBuilder.pm Copying Bio\SeqIO\tigr.pm -> blib\lib\Bio\SeqIO\tigr.pm Copying Bio\AlignIO\phylip.pm -> blib\lib\Bio\AlignIO\phylip.pm Copying Bio\Restriction\Analysis.pm -> blib\lib\Bio\Restriction\Analysis.pm Copying Bio\Search\HSP\PsiBlastHSP.pm -> blib\lib\Bio\Search\HSP\PsiBlastHSP.pm Copying Bio\Taxonomy.pm -> blib\lib\Bio\Taxonomy.pm Copying Bio\LiveSeq\Translation.pm -> blib\lib\Bio\LiveSeq\Translation.pm Copying Bio\Tools\Alignment\Trim.pm -> blib\lib\Bio\Tools\Alignment\Trim.pm Copying Bio\Tools\Pseudowise.pm -> blib\lib\Bio\Tools\Pseudowise.pm Copying Bio\Ontology\SimpleGOEngine\GraphAdaptor.pm -> blib\lib\Bio\Ontology\SimpleGOEngine\GraphAdaptor.pm Copying Bio\TreeIO.pm -> blib\lib\Bio\TreeIO.pm Copying Bio\DB\Flat\BDB\fasta.pm -> blib\lib\Bio\DB\Flat\BDB\fasta.pm Copying Bio\AlignIO\arp.pm -> blib\lib\Bio\AlignIO\arp.pm Copying Bio\AnalysisResultI.pm -> blib\lib\Bio\AnalysisResultI.pm Copying Bio\Coordinate\Utils.pm -> blib\lib\Bio\Coordinate\Utils.pm Copying Bio\DB\SeqFeature\Store\DBI\SQLite.pm -> blib\lib\Bio\DB\SeqFeature\Store\DBI\SQLite.pm Copying Bio\SeqIO\ctf.pm -> blib\lib\Bio\SeqIO\ctf.pm Copying Bio\SeqIO\abi.pm -> blib\lib\Bio\SeqIO\abi.pm Copying Bio\Ontology\GOterm.pm -> blib\lib\Bio\Ontology\GOterm.pm Copying Bio\Search\HSP\FastaHSP.pm -> blib\lib\Bio\Search\HSP\FastaHSP.pm Copying Bio\AlignIO\meme.pm -> blib\lib\Bio\AlignIO\meme.pm Copying Bio\Tools\Analysis\Protein\Sopma.pm -> blib\lib\Bio\Tools\Analysis\Protein\Sopma.pm Copying Bio\DB\GFF\Adaptor\berkeleydb.pm -> blib\lib\Bio\DB\GFF\Adaptor\berkeleydb.pm Copying Bio\DB\Taxonomy.pm -> blib\lib\Bio\DB\Taxonomy.pm Copying Bio\DB\Expression.pm -> blib\lib\Bio\DB\Expression.pm Copying Bio\Assembly\Scaffold.pm -> blib\lib\Bio\Assembly\Scaffold.pm Copying Bio\AlignIO\metafasta.pm -> blib\lib\Bio\AlignIO\metafasta.pm Copying Bio\Search\Hit\BlastHit.pm -> blib\lib\Bio\Search\Hit\BlastHit.pm Copying Bio\SeqIO\game\gameHandler.pm -> blib\lib\Bio\SeqIO\game\gameHandler.pm Copying Bio\SearchIO\EventHandlerI.pm -> blib\lib\Bio\SearchIO\EventHandlerI.pm Copying Bio\SeqFeature\Gene\Transcript.pm -> blib\lib\Bio\SeqFeature\Gene\Transcript.pm Copying Bio\SearchIO\blastxml.pm -> blib\lib\Bio\SearchIO\blastxml.pm Copying Bio\Biblio\WebResource.pm -> blib\lib\Bio\Biblio\WebResource.pm Copying Bio\Symbol\DNAAlphabet.pm -> blib\lib\Bio\Symbol\DNAAlphabet.pm Copying Bio\Assembly\Tools\ContigSpectrum.pm -> blib\lib\Bio\Assembly\Tools\ContigSpectrum.pm Copying Bio\Search\Hit\Fasta.pm -> blib\lib\Bio\Search\Hit\Fasta.pm Copying Bio\Factory\SeqAnalysisParserFactory.pm -> blib\lib\Bio\Factory\SeqAnalysisParserFactory.pm Copying Bio\SeqFeature\Gene\ExonI.pm -> blib\lib\Bio\SeqFeature\Gene\ExonI.pm Copying Bio\LiveSeq\SeqI.pm -> blib\lib\Bio\LiveSeq\SeqI.pm Copying Bio\AlignIO\bl2seq.pm -> blib\lib\Bio\AlignIO\bl2seq.pm Copying Bio\Annotation\StructuredValue.pm -> blib\lib\Bio\Annotation\StructuredValue.pm Copying Bio\SeqUtils.pm -> blib\lib\Bio\SeqUtils.pm Copying Bio\DB\GFF\Aggregator\ucsc_twinscan.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_twinscan.pm Copying Bio\Tools\EUtilities\Info.pm -> blib\lib\Bio\Tools\EUtilities\Info.pm Copying Bio\PhyloNetwork\TreeFactoryX.pm -> blib\lib\Bio\PhyloNetwork\TreeFactoryX.pm Copying Bio\Search\StatisticsI.pm -> blib\lib\Bio\Search\StatisticsI.pm Copying Bio\Map\Mappable.pm -> blib\lib\Bio\Map\Mappable.pm Copying Bio\ClusterI.pm -> blib\lib\Bio\ClusterI.pm Copying Bio\DB\GFF\Aggregator.pm -> blib\lib\Bio\DB\GFF\Aggregator.pm Copying Bio\LiveSeq\Intron.pm -> blib\lib\Bio\LiveSeq\Intron.pm Copying Bio\Tools\EPCR.pm -> blib\lib\Bio\Tools\EPCR.pm Copying Bio\Phenotype\OMIM\MiniMIMentry.pm -> blib\lib\Bio\Phenotype\OMIM\MiniMIMentry.pm Copying Bio\Location\WidestCoordPolicy.pm -> blib\lib\Bio\Location\WidestCoordPolicy.pm Copying Bio\Tools\CodonTable.pm -> blib\lib\Bio\Tools\CodonTable.pm Copying Bio\Ontology\RelationshipType.pm -> blib\lib\Bio\Ontology\RelationshipType.pm Copying Bio\Tools\Seg.pm -> blib\lib\Bio\Tools\Seg.pm Copying Bio\Search\HSP\HMMERHSP.pm -> blib\lib\Bio\Search\HSP\HMMERHSP.pm Copying Bio\TreeIO\lintree.pm -> blib\lib\Bio\TreeIO\lintree.pm Copying Bio\Ontology\OntologyEngineI.pm -> blib\lib\Bio\Ontology\OntologyEngineI.pm Copying Bio\DB\GFF\Adaptor\dbi\pg_fts.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.pm Copying Bio\DB\DBFetch.pm -> blib\lib\Bio\DB\DBFetch.pm Copying Bio\DB\TFBS\transfac_pro.pm -> blib\lib\Bio\DB\TFBS\transfac_pro.pm Copying Bio\LiveSeq\Gene.pm -> blib\lib\Bio\LiveSeq\Gene.pm Copying Bio\DB\SeqHound.pm -> blib\lib\Bio\DB\SeqHound.pm Copying Bio\Variation\IO.pm -> blib\lib\Bio\Variation\IO.pm Copying Bio\SeqIO\game\featHandler.pm -> blib\lib\Bio\SeqIO\game\featHandler.pm Copying Bio\SeqIO\table.pm -> blib\lib\Bio\SeqIO\table.pm Copying Bio\DB\WebDBSeqI.pm -> blib\lib\Bio\DB\WebDBSeqI.pm Copying Bio\DB\FileCache.pm -> blib\lib\Bio\DB\FileCache.pm Copying Bio\Seq\LargeSeqI.pm -> blib\lib\Bio\Seq\LargeSeqI.pm Copying Bio\Phenotype\MeSH\Twig.pm -> blib\lib\Bio\Phenotype\MeSH\Twig.pm Copying Bio\DB\GFF\Aggregator\ucsc_unigene.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_unigene.pm Copying Bio\Biblio\IO\medline2ref.pm -> blib\lib\Bio\Biblio\IO\medline2ref.pm Copying Bio\SeqFeature\SiRNA\Oligo.pm -> blib\lib\Bio\SeqFeature\SiRNA\Oligo.pm Copying Bio\SeqFeature\Gene\TranscriptI.pm -> blib\lib\Bio\SeqFeature\Gene\TranscriptI.pm Copying Bio\SeqFeatureI.pm -> blib\lib\Bio\SeqFeatureI.pm Copying Bio\Ontology\Relationship.pm -> blib\lib\Bio\Ontology\Relationship.pm Copying Bio\ClusterIO\dbsnp.pm -> blib\lib\Bio\ClusterIO\dbsnp.pm Copying Bio\DB\GFF\Homol.pm -> blib\lib\Bio\DB\GFF\Homol.pm Copying Bio\SeqIO\agave.pm -> blib\lib\Bio\SeqIO\agave.pm Copying Bio\Index\Fastq.pm -> blib\lib\Bio\Index\Fastq.pm Copying Bio\Map\EntityI.pm -> blib\lib\Bio\Map\EntityI.pm Copying Bio\Phenotype\Correlate.pm -> blib\lib\Bio\Phenotype\Correlate.pm Copying Bio\Restriction\Enzyme\MultiSite.pm -> blib\lib\Bio\Restriction\Enzyme\MultiSite.pm Copying Bio\Assembly\Singlet.pm -> blib\lib\Bio\Assembly\Singlet.pm Copying Bio\Map\CytoMap.pm -> blib\lib\Bio\Map\CytoMap.pm Copying Bio\ClusterIO.pm -> blib\lib\Bio\ClusterIO.pm Copying Bio\AlignIO\clustalw.pm -> blib\lib\Bio\AlignIO\clustalw.pm Copying Bio\DB\GFF\Aggregator\ucsc_acembly.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_acembly.pm Copying Bio\FeatureIO\ptt.pm -> blib\lib\Bio\FeatureIO\ptt.pm Copying Bio\DB\GFF\Adaptor\dbi\mysql.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\mysql.pm Copying Bio\Factory\ObjectBuilderI.pm -> blib\lib\Bio\Factory\ObjectBuilderI.pm Copying Bio\Map\FPCMarker.pm -> blib\lib\Bio\Map\FPCMarker.pm Copying Bio\MapIO.pm -> blib\lib\Bio\MapIO.pm Copying Bio\Map\PositionI.pm -> blib\lib\Bio\Map\PositionI.pm Copying Bio\DB\GFF\Adaptor\memory\feature_serializer.pm -> blib\lib\Bio\DB\GFF\Adaptor\memory\feature_serializer.pm Copying Bio\Annotation\Collection.pm -> blib\lib\Bio\Annotation\Collection.pm Copying Bio\Location\Split.pm -> blib\lib\Bio\Location\Split.pm Copying Bio\Search\GenericStatistics.pm -> blib\lib\Bio\Search\GenericStatistics.pm Copying Bio\DB\GFF\Adaptor\dbi\caching_handle.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm Copying Bio\DB\GFF\Aggregator\coding.pm -> blib\lib\Bio\DB\GFF\Aggregator\coding.pm Copying Bio\Search\HSP\hmmer3HSP.pm -> blib\lib\Bio\Search\HSP\hmmer3HSP.pm Copying Bio\Tools\Analysis\Protein\Domcut.pm -> blib\lib\Bio\Tools\Analysis\Protein\Domcut.pm Copying Bio\Tools\GuessSeqFormat.pm -> blib\lib\Bio\Tools\GuessSeqFormat.pm Copying Bio\Search\HSP\ModelHSP.pm -> blib\lib\Bio\Search\HSP\ModelHSP.pm Copying Bio\PhyloNetwork\TreeFactoryMulti.pm -> blib\lib\Bio\PhyloNetwork\TreeFactoryMulti.pm Copying Bio\SeqFeature\Collection.pm -> blib\lib\Bio\SeqFeature\Collection.pm Copying Bio\SearchIO\hmmer_pull.pm -> blib\lib\Bio\SearchIO\hmmer_pull.pm Copying Bio\Tools\Genomewise.pm -> blib\lib\Bio\Tools\Genomewise.pm Copying Bio\Biblio\Provider.pm -> blib\lib\Bio\Biblio\Provider.pm Copying Bio\DB\TFBS.pm -> blib\lib\Bio\DB\TFBS.pm Copying Bio\Biblio\Proceeding.pm -> blib\lib\Bio\Biblio\Proceeding.pm Copying Bio\OntologyIO\soflat.pm -> blib\lib\Bio\OntologyIO\soflat.pm Copying Bio\Assembly\IO\phrap.pm -> blib\lib\Bio\Assembly\IO\phrap.pm Copying Bio\Root\Version.pm -> blib\lib\Bio\Root\Version.pm Copying Bio\SearchIO\waba.pm -> blib\lib\Bio\SearchIO\waba.pm Copying Bio\Coordinate\ResultI.pm -> blib\lib\Bio\Coordinate\ResultI.pm Copying Bio\Seq.pm -> blib\lib\Bio\Seq.pm Copying Bio\Matrix\PSM\IO\masta.pm -> blib\lib\Bio\Matrix\PSM\IO\masta.pm Copying Bio\DB\SeqFeature.pm -> blib\lib\Bio\DB\SeqFeature.pm Copying Bio\SeqIO\qual.pm -> blib\lib\Bio\SeqIO\qual.pm Copying Bio\Root\Utilities.pm -> blib\lib\Bio\Root\Utilities.pm Copying Bio\Align\PairwiseStatistics.pm -> blib\lib\Bio\Align\PairwiseStatistics.pm Copying Bio\Assembly\IO\sam.pm -> blib\lib\Bio\Assembly\IO\sam.pm Copying Bio\Seq\TraceI.pm -> blib\lib\Bio\Seq\TraceI.pm Copying Bio\Biblio\MedlineBookArticle.pm -> blib\lib\Bio\Biblio\MedlineBookArticle.pm Copying Bio\SeqI.pm -> blib\lib\Bio\SeqI.pm Copying Bio\Matrix\IO\phylip.pm -> blib\lib\Bio\Matrix\IO\phylip.pm Copying Bio\Seq\PrimaryQual.pm -> blib\lib\Bio\Seq\PrimaryQual.pm Copying Bio\DB\SeqFeature\Store\DBI\Iterator.pm -> blib\lib\Bio\DB\SeqFeature\Store\DBI\Iterator.pm Copying Bio\Cluster\SequenceFamily.pm -> blib\lib\Bio\Cluster\SequenceFamily.pm Copying Bio\Ontology\RelationshipFactory.pm -> blib\lib\Bio\Ontology\RelationshipFactory.pm Copying Bio\SearchIO\exonerate.pm -> blib\lib\Bio\SearchIO\exonerate.pm Copying Bio\Map\Contig.pm -> blib\lib\Bio\Map\Contig.pm Copying Bio\Index\SwissPfam.pm -> blib\lib\Bio\Index\SwissPfam.pm Copying Bio\Align\Graphics.pm -> blib\lib\Bio\Align\Graphics.pm Copying Bio\Tools\Spidey\Exon.pm -> blib\lib\Bio\Tools\Spidey\Exon.pm Copying Bio\Matrix\Generic.pm -> blib\lib\Bio\Matrix\Generic.pm Copying Bio\DB\UpdateableSeqI.pm -> blib\lib\Bio\DB\UpdateableSeqI.pm Copying Bio\Search\Hit\PsiBlastHit.pm -> blib\lib\Bio\Search\Hit\PsiBlastHit.pm Copying Bio\Tools\Analysis\Protein\NetPhos.pm -> blib\lib\Bio\Tools\Analysis\Protein\NetPhos.pm Copying Bio\PopGen\IO\hapmap.pm -> blib\lib\Bio\PopGen\IO\hapmap.pm Copying Bio\Seq\SeqWithQuality.pm -> blib\lib\Bio\Seq\SeqWithQuality.pm Copying Bio\DB\SeqFeature\Store\DBI\Pg.pm -> blib\lib\Bio\DB\SeqFeature\Store\DBI\Pg.pm Copying Bio\Phenotype\MeSH\Term.pm -> blib\lib\Bio\Phenotype\MeSH\Term.pm Copying Bio\Matrix\IO\mlagan.pm -> blib\lib\Bio\Matrix\IO\mlagan.pm Copying Bio\SeqFeature\Tools\IDHandler.pm -> blib\lib\Bio\SeqFeature\Tools\IDHandler.pm Copying Bio\SeqFeature\Lite.pm -> blib\lib\Bio\SeqFeature\Lite.pm Copying Bio\Biblio\IO\pubmed2ref.pm -> blib\lib\Bio\Biblio\IO\pubmed2ref.pm Copying Bio\Phenotype\Measure.pm -> blib\lib\Bio\Phenotype\Measure.pm Copying Bio\Tools\Analysis\DNA\ESEfinder.pm -> blib\lib\Bio\Tools\Analysis\DNA\ESEfinder.pm Copying Bio\SearchIO\wise.pm -> blib\lib\Bio\SearchIO\wise.pm Copying Bio\SeqFeature\AnnotationAdaptor.pm -> blib\lib\Bio\SeqFeature\AnnotationAdaptor.pm Copying Bio\Matrix\PSM\PsmHeaderI.pm -> blib\lib\Bio\Matrix\PSM\PsmHeaderI.pm Copying Bio\Assembly\IO.pm -> blib\lib\Bio\Assembly\IO.pm Copying Bio\Tools\FootPrinter.pm -> blib\lib\Bio\Tools\FootPrinter.pm Copying Bio\SeqIO\entrezgene.pm -> blib\lib\Bio\SeqIO\entrezgene.pm Copying Bio\Map\MappableI.pm -> blib\lib\Bio\Map\MappableI.pm Copying Bio\Matrix\PSM\IO\psiblast.pm -> blib\lib\Bio\Matrix\PSM\IO\psiblast.pm Copying Bio\SeqFeature\Gene\Exon.pm -> blib\lib\Bio\SeqFeature\Gene\Exon.pm Copying Bio\Tools\Primer3.pm -> blib\lib\Bio\Tools\Primer3.pm Copying Bio\Root\HTTPget.pm -> blib\lib\Bio\Root\HTTPget.pm Copying Bio\Ontology\Ontology.pm -> blib\lib\Bio\Ontology\Ontology.pm Copying Bio\SearchIO\blast_pull.pm -> blib\lib\Bio\SearchIO\blast_pull.pm Copying Bio\SeqFeature\TypedSeqFeatureI.pm -> blib\lib\Bio\SeqFeature\TypedSeqFeatureI.pm Copying Bio\DB\GFF\Typename.pm -> blib\lib\Bio\DB\GFF\Typename.pm Copying Bio\Factory\SequenceProcessorI.pm -> blib\lib\Bio\Factory\SequenceProcessorI.pm Copying Bio\Search\Hit\PullHitI.pm -> blib\lib\Bio\Search\Hit\PullHitI.pm Copying Bio\SearchIO\Writer\HSPTableWriter.pm -> blib\lib\Bio\SearchIO\Writer\HSPTableWriter.pm Copying Bio\Biblio\Patent.pm -> blib\lib\Bio\Biblio\Patent.pm Copying Bio\Structure\Atom.pm -> blib\lib\Bio\Structure\Atom.pm Copying Bio\PopGen\Individual.pm -> blib\lib\Bio\PopGen\Individual.pm Copying Bio\Assembly\ScaffoldI.pm -> blib\lib\Bio\Assembly\ScaffoldI.pm Copying Bio\Tools\Fgenesh.pm -> blib\lib\Bio\Tools\Fgenesh.pm Copying Bio\Align\Utilities.pm -> blib\lib\Bio\Align\Utilities.pm Copying Bio\Assembly\ContigAnalysis.pm -> blib\lib\Bio\Assembly\ContigAnalysis.pm Copying Bio\DB\GFF\Adaptor\dbi\iterator.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\iterator.pm Copying Bio\SeqIO\interpro.pm -> blib\lib\Bio\SeqIO\interpro.pm Copying Bio\LiveSeq\Exon.pm -> blib\lib\Bio\LiveSeq\Exon.pm Copying Bio\Index\AbstractSeq.pm -> blib\lib\Bio\Index\AbstractSeq.pm Copying Bio\Index\Abstract.pm -> blib\lib\Bio\Index\Abstract.pm Copying Bio\Search\HSP\WABAHSP.pm -> blib\lib\Bio\Search\HSP\WABAHSP.pm Copying Bio\PhyloNetwork.pm -> blib\lib\Bio\PhyloNetwork.pm Copying Bio\Restriction\EnzymeCollection.pm -> blib\lib\Bio\Restriction\EnzymeCollection.pm Copying Bio\Annotation\OntologyTerm.pm -> blib\lib\Bio\Annotation\OntologyTerm.pm Copying Bio\Tools\Lucy.pm -> blib\lib\Bio\Tools\Lucy.pm Copying Bio\AlignIO\po.pm -> blib\lib\Bio\AlignIO\po.pm Copying Bio\Matrix\PSM\ProtPsm.pm -> blib\lib\Bio\Matrix\PSM\ProtPsm.pm Copying Bio\Factory\SequenceFactoryI.pm -> blib\lib\Bio\Factory\SequenceFactoryI.pm Copying Bio\Seq\RichSeq.pm -> blib\lib\Bio\Seq\RichSeq.pm Copying Bio\Index\BlastTable.pm -> blib\lib\Bio\Index\BlastTable.pm Copying Bio\Ontology\OBOterm.pm -> blib\lib\Bio\Ontology\OBOterm.pm Copying Bio\DB\Taxonomy\entrez.pm -> blib\lib\Bio\DB\Taxonomy\entrez.pm Copying Bio\SearchIO.pm -> blib\lib\Bio\SearchIO.pm Copying Bio\Symbol\ProteinAlphabet.pm -> blib\lib\Bio\Symbol\ProteinAlphabet.pm Copying Bio\Assembly\IO\tigr.pm -> blib\lib\Bio\Assembly\IO\tigr.pm Copying Bio\SeqFeature\PositionProxy.pm -> blib\lib\Bio\SeqFeature\PositionProxy.pm Copying Bio\Tools\Phylo\Phylip\ProtDist.pm -> blib\lib\Bio\Tools\Phylo\Phylip\ProtDist.pm Copying Bio\AlignIO\msf.pm -> blib\lib\Bio\AlignIO\msf.pm Copying Bio\DB\GFF\Util\Binning.pm -> blib\lib\Bio\DB\GFF\Util\Binning.pm Copying Bio\Event\EventHandlerI.pm -> blib\lib\Bio\Event\EventHandlerI.pm Copying Bio\DB\GenPept.pm -> blib\lib\Bio\DB\GenPept.pm Copying Bio\DB\GFF\RelSegment.pm -> blib\lib\Bio\DB\GFF\RelSegment.pm Copying Bio\Matrix\PSM\PsmHeader.pm -> blib\lib\Bio\Matrix\PSM\PsmHeader.pm Copying Bio\Map\SimpleMap.pm -> blib\lib\Bio\Map\SimpleMap.pm Copying Bio\Coordinate\Result.pm -> blib\lib\Bio\Coordinate\Result.pm Copying Bio\Tools\Prediction\Exon.pm -> blib\lib\Bio\Tools\Prediction\Exon.pm Copying Bio\Annotation\Comment.pm -> blib\lib\Bio\Annotation\Comment.pm Copying Bio\SeqEvolution\EvolutionI.pm -> blib\lib\Bio\SeqEvolution\EvolutionI.pm Copying Bio\SearchIO\Writer\GbrowseGFF.pm -> blib\lib\Bio\SearchIO\Writer\GbrowseGFF.pm Copying Bio\Ontology\SimpleOntologyEngine.pm -> blib\lib\Bio\Ontology\SimpleOntologyEngine.pm Copying Bio\PopGen\GenotypeI.pm -> blib\lib\Bio\PopGen\GenotypeI.pm Copying Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm Copying Bio\Biblio.pm -> blib\lib\Bio\Biblio.pm Copying Bio\Align\StatisticsI.pm -> blib\lib\Bio\Align\StatisticsI.pm Copying Bio\Factory\AnalysisI.pm -> blib\lib\Bio\Factory\AnalysisI.pm Copying Bio\MapIO\mapmaker.pm -> blib\lib\Bio\MapIO\mapmaker.pm Copying Bio\DB\LocationI.pm -> blib\lib\Bio\DB\LocationI.pm Copying Bio\Tools\EUtilities\Summary\DocSum.pm -> blib\lib\Bio\Tools\EUtilities\Summary\DocSum.pm Copying Bio\Coordinate\Pair.pm -> blib\lib\Bio\Coordinate\Pair.pm Copying Bio\AnalysisParserI.pm -> blib\lib\Bio\AnalysisParserI.pm Copying Bio\Factory\FTLocationFactory.pm -> blib\lib\Bio\Factory\FTLocationFactory.pm Copying Bio\DB\GFF\Adaptor\dbi\oracle.pm -> blib\lib\Bio\DB\GFF\Adaptor\dbi\oracle.pm Copying Bio\SearchIO\IteratedSearchResultEventBuilder.pm -> blib\lib\Bio\SearchIO\IteratedSearchResultEventBuilder.pm Copying Bio\SeqFeature\Similarity.pm -> blib\lib\Bio\SeqFeature\Similarity.pm Copying Bio\SeqIO\exp.pm -> blib\lib\Bio\SeqIO\exp.pm Copying Bio\DB\GFF.pm -> blib\lib\Bio\DB\GFF.pm Copying Bio\SeqIO\game\seqHandler.pm -> blib\lib\Bio\SeqIO\game\seqHandler.pm Copying Bio\Search\HSP\PullHSPI.pm -> blib\lib\Bio\Search\HSP\PullHSPI.pm Copying Bio\Variation\IO\flat.pm -> blib\lib\Bio\Variation\IO\flat.pm Copying Bio\Factory\ObjectFactoryI.pm -> blib\lib\Bio\Factory\ObjectFactoryI.pm Copying Bio\Tools\ipcress.pm -> blib\lib\Bio\Tools\ipcress.pm Copying Bio\Symbol\Symbol.pm -> blib\lib\Bio\Symbol\Symbol.pm Copying Bio\Map\Relative.pm -> blib\lib\Bio\Map\Relative.pm Copying Bio\Restriction\Enzyme\MultiCut.pm -> blib\lib\Bio\Restriction\Enzyme\MultiCut.pm Copying Bio\Symbol\AlphabetI.pm -> blib\lib\Bio\Symbol\AlphabetI.pm Copying Bio\SeqFeature\Gene\GeneStructure.pm -> blib\lib\Bio\SeqFeature\Gene\GeneStructure.pm Copying Bio\Seq\Meta\Array.pm -> blib\lib\Bio\Seq\Meta\Array.pm Copying Bio\PopGen\PopulationI.pm -> blib\lib\Bio\PopGen\PopulationI.pm Copying Bio\Tools\Sim4\Exon.pm -> blib\lib\Bio\Tools\Sim4\Exon.pm Copying Bio\Location\Simple.pm -> blib\lib\Bio\Location\Simple.pm Copying Bio\DB\GFF\Aggregator\transcript.pm -> blib\lib\Bio\DB\GFF\Aggregator\transcript.pm Copying Bio\PopGen\IndividualI.pm -> blib\lib\Bio\PopGen\IndividualI.pm Copying Bio\SeqFeature\Annotated.pm -> blib\lib\Bio\SeqFeature\Annotated.pm Copying Bio\DB\BioFetch.pm -> blib\lib\Bio\DB\BioFetch.pm Copying Bio\DB\BiblioI.pm -> blib\lib\Bio\DB\BiblioI.pm Copying Bio\DB\NCBIHelper.pm -> blib\lib\Bio\DB\NCBIHelper.pm Copying Bio\DB\Flat\BDB\swiss.pm -> blib\lib\Bio\DB\Flat\BDB\swiss.pm Copying Bio\SeqFeature\Computation.pm -> blib\lib\Bio\SeqFeature\Computation.pm Copying Bio\Tree\RandomFactory.pm -> blib\lib\Bio\Tree\RandomFactory.pm Copying Bio\Map\OrderedPositionWithDistance.pm -> blib\lib\Bio\Map\OrderedPositionWithDistance.pm Copying Bio\DB\Taxonomy\list.pm -> blib\lib\Bio\DB\Taxonomy\list.pm Copying Bio\Search\Hit\HitFactory.pm -> blib\lib\Bio\Search\Hit\HitFactory.pm Copying Bio\Map\Clone.pm -> blib\lib\Bio\Map\Clone.pm Copying Bio\TreeIO\nexml.pm -> blib\lib\Bio\TreeIO\nexml.pm Copying Bio\Map\CytoPosition.pm -> blib\lib\Bio\Map\CytoPosition.pm Copying Bio\SeqFeature\FeaturePair.pm -> blib\lib\Bio\SeqFeature\FeaturePair.pm Copying Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm -> blib\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm Copying Bio\Tools\Phylo\PAML\Result.pm -> blib\lib\Bio\Tools\Phylo\PAML\Result.pm Copying Bio\AnalysisI.pm -> blib\lib\Bio\AnalysisI.pm Copying Bio\Variation\SeqDiff.pm -> blib\lib\Bio\Variation\SeqDiff.pm Copying Bio\PopGen\Simulation\GeneticDrift.pm -> blib\lib\Bio\PopGen\Simulation\GeneticDrift.pm Copying Bio\Matrix\PSM\IO\meme.pm -> blib\lib\Bio\Matrix\PSM\IO\meme.pm Copying Bio\IdentifiableI.pm -> blib\lib\Bio\IdentifiableI.pm Copying Bio\SearchIO\psl.pm -> blib\lib\Bio\SearchIO\psl.pm Copying Bio\DB\GFF\Featname.pm -> blib\lib\Bio\DB\GFF\Featname.pm Copying Bio\Taxon.pm -> blib\lib\Bio\Taxon.pm Copying Bio\Map\MarkerI.pm -> blib\lib\Bio\Map\MarkerI.pm Copying Bio\Seq\SequenceTrace.pm -> blib\lib\Bio\Seq\SequenceTrace.pm Copying Bio\Taxonomy\Tree.pm -> blib\lib\Bio\Taxonomy\Tree.pm Copying scripts\utilities\search2alnblocks.PLS -> blib\script\search2alnblocks.PLS Deleting blib\script\search2alnblocks.PLS.bak Copying scripts\DB\bioflat_index.PLS -> blib\script\bioflat_index.PLS Deleting blib\script\bioflat_index.PLS.bak Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_gff3.PLS -> blib\script\bp_seqfeature_gff3.PLS Copying scripts\utilities\mask_by_search.PLS -> blib\script\mask_by_search.PLS Deleting blib\script\mask_by_search.PLS.bak Copying scripts\utilities\bp_mrtrans.PLS -> blib\script\bp_mrtrans.PLS Deleting blib\script\bp_mrtrans.PLS.bak Copying scripts\utilities\bp_sreformat.PLS -> blib\script\bp_sreformat.PLS Deleting blib\script\bp_sreformat.PLS.bak Copying scripts\utilities\search2gff.PLS -> blib\script\search2gff.PLS Deleting blib\script\search2gff.PLS.bak Copying scripts\searchio\hmmer_to_table.PLS -> blib\script\hmmer_to_table.PLS Deleting blib\script\hmmer_to_table.PLS.bak Copying scripts\seq\seqconvert.PLS -> blib\script\seqconvert.PLS Deleting blib\script\seqconvert.PLS.bak Copying scripts\DB\flanks.PLS -> blib\script\flanks.PLS Deleting blib\script\flanks.PLS.bak Copying scripts\utilities\seq_length.PLS -> blib\script\seq_length.PLS Deleting blib\script\seq_length.PLS.bak Copying scripts\DB-HIV\hivq.PLS -> blib\script\hivq.PLS Deleting blib\script\hivq.PLS.bak Copying scripts\Bio-DB-GFF\genbank2gff.PLS -> blib\script\genbank2gff.PLS Deleting blib\script\genbank2gff.PLS.bak Copying scripts\Bio-DB-EUtilities\einfo.PLS -> blib\script\einfo.PLS Deleting blib\script\einfo.PLS.bak Copying scripts\Bio-DB-GFF\process_gadfly.PLS -> blib\script\process_gadfly.PLS Deleting blib\script\process_gadfly.PLS.bak Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_delete.PLS -> blib\script\bp_seqfeature_delete.PLS Deleting blib\script\bp_seqfeature_delete.PLS.bak Copying scripts\seq\extract_feature_seq.PLS -> blib\script\extract_feature_seq.PLS Deleting blib\script\extract_feature_seq.PLS.bak Copying scripts\seq\make_mrna_protein.PLS -> blib\script\make_mrna_protein.PLS Deleting blib\script\make_mrna_protein.PLS.bak Copying scripts\DB\biofetch_genbank_proxy.PLS -> blib\script\biofetch_genbank_proxy.PLS Deleting blib\script\biofetch_genbank_proxy.PLS.bak Copying scripts\tree\nexus2nh.PLS -> blib\script\nexus2nh.PLS Deleting blib\script\nexus2nh.PLS.bak Copying scripts\searchio\filter_search.PLS -> blib\script\filter_search.PLS Deleting blib\script\filter_search.PLS.bak Copying scripts\tree\tree2pag.PLS -> blib\script\tree2pag.PLS Deleting blib\script\tree2pag.PLS.bak Copying scripts\taxa\local_taxonomydb_query.PLS -> blib\script\local_taxonomydb_query.PLS Deleting blib\script\local_taxonomydb_query.PLS.bak Copying scripts\utilities\search2BSML.PLS -> blib\script\search2BSML.PLS Deleting blib\script\search2BSML.PLS.bak Copying scripts\Bio-DB-GFF\process_sgd.PLS -> blib\script\process_sgd.PLS Deleting blib\script\process_sgd.PLS.bak Copying scripts\utilities\search2tribe.PLS -> blib\script\search2tribe.PLS Deleting blib\script\search2tribe.PLS.bak Copying scripts\Bio-DB-GFF\generate_histogram.PLS -> blib\script\generate_histogram.PLS Deleting blib\script\generate_histogram.PLS.bak Copying scripts\taxa\query_entrez_taxa.PLS -> blib\script\query_entrez_taxa.PLS Deleting blib\script\query_entrez_taxa.PLS.bak Copying scripts\utilities\dbsplit.PLS -> blib\script\dbsplit.PLS Deleting blib\script\dbsplit.PLS.bak Copying scripts\tree\blast2tree.PLS -> blib\script\blast2tree.PLS Deleting blib\script\blast2tree.PLS.bak Copying scripts\Bio-DB-GFF\load_gff.PLS -> blib\script\load_gff.PLS Deleting blib\script\load_gff.PLS.bak Copying scripts\das\das_server.pl -> blib\script\das_server.pl Deleting blib\script\das_server.pl.bak Copying scripts\utilities\mutate.PLS -> blib\script\mutate.PLS Deleting blib\script\mutate.PLS.bak Copying scripts\seq\unflatten_seq.PLS -> blib\script\unflatten_seq.PLS Deleting blib\script\unflatten_seq.PLS.bak Copying scripts\seqstats\chaos_plot.PLS -> blib\script\chaos_plot.PLS Deleting blib\script\chaos_plot.PLS.bak Copying scripts\Bio-DB-GFF\bulk_load_gff.PLS -> blib\script\bulk_load_gff.PLS Deleting blib\script\bulk_load_gff.PLS.bak Copying scripts\Bio-DB-GFF\fast_load_gff.PLS -> blib\script\fast_load_gff.PLS Deleting blib\script\fast_load_gff.PLS.bak Copying scripts\utilities\revtrans-motif.PLS -> blib\script\revtrans-motif.PLS Deleting blib\script\revtrans-motif.PLS.bak Copying scripts\searchio\search2table.PLS -> blib\script\search2table.PLS Deleting blib\script\search2table.PLS.bak Copying scripts\index\bp_seqret.PLS -> blib\script\bp_seqret.PLS Deleting blib\script\bp_seqret.PLS.bak Copying scripts\popgen\composite_LD.PLS -> blib\script\composite_LD.PLS Deleting blib\script\composite_LD.PLS.bak Copying scripts\biblio\biblio.PLS -> blib\script\biblio.PLS Deleting blib\script\biblio.PLS.bak Copying scripts\seq\split_seq.PLS -> blib\script\split_seq.PLS Deleting blib\script\split_seq.PLS.bak Copying scripts\searchio\parse_hmmsearch.PLS -> blib\script\parse_hmmsearch.PLS Deleting blib\script\parse_hmmsearch.PLS.bak Copying scripts\Bio-DB-GFF\process_wormbase.PLS -> blib\script\process_wormbase.PLS Deleting blib\script\process_wormbase.PLS.bak Copying scripts\utilities\download_query_genbank.PLS -> blib\script\download_query_genbank.PLS Deleting blib\script\download_query_genbank.PLS.bak Copying scripts\seqstats\aacomp.PLS -> blib\script\aacomp.PLS Deleting blib\script\aacomp.PLS.bak Copying scripts\utilities\bp_nrdb.PLS -> blib\script\bp_nrdb.PLS Deleting blib\script\bp_nrdb.PLS.bak Copying scripts\popgen\heterogeneity_test.PLS -> blib\script\heterogeneity_test.PLS Deleting blib\script\heterogeneity_test.PLS.bak Copying scripts\index\bp_fetch.PLS -> blib\script\bp_fetch.PLS Deleting blib\script\bp_fetch.PLS.bak Copying scripts\taxa\taxid4species.PLS -> blib\script\taxid4species.PLS Deleting blib\script\taxid4species.PLS.bak Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_load.PLS -> blib\script\bp_seqfeature_load.PLS Deleting blib\script\bp_seqfeature_load.PLS.bak Copying scripts\taxa\taxonomy2tree.PLS -> blib\script\taxonomy2tree.PLS Deleting blib\script\taxonomy2tree.PLS.bak Copying scripts\Bio-DB-GFF\genbank2gff3.PLS -> blib\script\genbank2gff3.PLS Deleting blib\script\genbank2gff3.PLS.bak Copying scripts\Bio-DB-GFF\meta_gff.PLS -> blib\script\meta_gff.PLS Deleting blib\script\meta_gff.PLS.bak Copying scripts\seqstats\oligo_count.PLS -> blib\script\oligo_count.PLS Deleting blib\script\oligo_count.PLS.bak Copying scripts\seq\seqretsplit.PLS -> blib\script\seqretsplit.PLS Deleting blib\script\seqretsplit.PLS.bak Copying scripts\index\bp_index.PLS -> blib\script\bp_index.PLS Deleting blib\script\bp_index.PLS.bak Copying scripts\utilities\bp_netinstall.PLS -> blib\script\bp_netinstall.PLS Deleting blib\script\bp_netinstall.PLS.bak Copying scripts\seqstats\gccalc.PLS -> blib\script\gccalc.PLS Deleting blib\script\gccalc.PLS.bak Copying scripts\DB\biogetseq.PLS -> blib\script\biogetseq.PLS Deleting blib\script\biogetseq.PLS.bak Copying scripts\seq\translate_seq.PLS -> blib\script\translate_seq.PLS Deleting blib\script\translate_seq.PLS.bak Copying scripts\searchio\fastam9_to_table.PLS -> blib\script\fastam9_to_table.PLS Deleting blib\script\fastam9_to_table.PLS.bak Copying scripts\taxa\classify_hits_kingdom.PLS -> blib\script\classify_hits_kingdom.PLS Deleting blib\script\classify_hits_kingdom.PLS.bak Copying scripts\utilities\remote_blast.PLS -> blib\script\remote_blast.PLS Deleting blib\script\remote_blast.PLS.bak Copying scripts\utilities\pairwise_kaks.PLS -> blib\script\pairwise_kaks.PLS Deleting blib\script\pairwise_kaks.PLS.bak Copying Bio\DB\HIV\lanl-schema.xml -> blib\lib\Bio\DB\HIV\lanl-schema.xml Writing config notes to blib\lib\Bio\ConfigData.pm Manifying blib\script/bp_bulk_load_gff.pl -> blib\bindoc\bp_bulk_load_gff.pl.1 Manifying blib\script/bp_fastam9_to_table.pl -> blib\bindoc\bp_fastam9_to_table.pl.1 Manifying blib\script/bp_meta_gff.pl -> blib\bindoc\bp_meta_gff.pl.1 Manifying blib\script/bp_process_wormbase.pl -> blib\bindoc\bp_process_wormbase.pl.1 Manifying blib\script/bp_make_mrna_protein.pl -> blib\bindoc\bp_make_mrna_protein.pl.1 Manifying blib\script/bp_translate_seq.pl -> blib\bindoc\bp_translate_seq.pl.1 Manifying blib\script/bp_bioflat_index.pl -> blib\bindoc\bp_bioflat_index.pl.1 Manifying blib\script/bp_oligo_count.pl -> blib\bindoc\bp_oligo_count.pl.1 Manifying blib\script/bp_search2alnblocks.pl -> blib\bindoc\bp_search2alnblocks.pl.1 Manifying blib\script/bp_nrdb.pl -> blib\bindoc\bp_nrdb.pl.1 Manifying blib\script/bp_netinstall.pl -> blib\bindoc\bp_netinstall.pl.1 Manifying blib\script/bp_process_sgd.pl -> blib\bindoc\bp_process_sgd.pl.1 Manifying blib\script/bp_extract_feature_seq.pl -> blib\bindoc\bp_extract_feature_seq.pl.1 Manifying blib\script/bp_dbsplit.pl -> blib\bindoc\bp_dbsplit.pl.1 Manifying blib\script/bp_seqfeature_load.pl -> blib\bindoc\bp_seqfeature_load.pl.1 Manifying blib\script/bp_classify_hits_kingdom.pl -> blib\bindoc\bp_classify_hits_kingdom.pl.1 Manifying blib\script/bp_einfo.pl -> blib\bindoc\bp_einfo.pl.1 Manifying blib\script/bp_fetch.pl -> blib\bindoc\bp_fetch.pl.1 Manifying blib\script/bp_load_gff.pl -> blib\bindoc\bp_load_gff.pl.1 Manifying blib\script/bp_aacomp.pl -> blib\bindoc\bp_aacomp.pl.1 Manifying blib\script/bp_fast_load_gff.pl -> blib\bindoc\bp_fast_load_gff.pl.1 Manifying blib\script/bp_heterogeneity_test.pl -> blib\bindoc\bp_heterogeneity_test.pl.1 Manifying blib\script/bp_search2gff.pl -> blib\bindoc\bp_search2gff.pl.1 Manifying blib\script/bp_biblio.pl -> blib\bindoc\bp_biblio.pl.1 Manifying blib\script/bp_tree2pag.pl -> blib\bindoc\bp_tree2pag.pl.1 Manifying blib\script/bp_biogetseq.pl -> blib\bindoc\bp_biogetseq.pl.1 Manifying blib\script/bp_unflatten_seq.pl -> blib\bindoc\bp_unflatten_seq.pl.1 Manifying blib\script/bp_mask_by_search.pl -> blib\bindoc\bp_mask_by_search.pl.1 Manifying blib\script/bp_search2BSML.pl -> blib\bindoc\bp_search2BSML.pl.1 Manifying blib\script/bp_genbank2gff.pl -> blib\bindoc\bp_genbank2gff.pl.1 Manifying blib\script/bp_biofetch_genbank_proxy.pl -> blib\bindoc\bp_biofetch_genbank_proxy.pl.1 Manifying blib\script/bp_query_entrez_taxa.pl -> blib\bindoc\bp_query_entrez_taxa.pl.1 Manifying blib\script/bp_generate_histogram.pl -> blib\bindoc\bp_generate_histogram.pl.1 Manifying blib\script/bp_local_taxonomydb_query.pl -> blib\bindoc\bp_local_taxonomydb_query.pl.1 Manifying blib\script/bp_seq_length.pl -> blib\bindoc\bp_seq_length.pl.1 Manifying blib\script/bp_search2tribe.pl -> blib\bindoc\bp_search2tribe.pl.1 Manifying blib\script/bp_parse_hmmsearch.pl -> blib\bindoc\bp_parse_hmmsearch.pl.1 Manifying blib\script/bp_seqconvert.pl -> blib\bindoc\bp_seqconvert.pl.1 Manifying blib\script/bp_taxid4species.pl -> blib\bindoc\bp_taxid4species.pl.1 Manifying blib\script/bp_index.pl -> blib\bindoc\bp_index.pl.1 Manifying blib\script/bp_filter_search.pl -> blib\bindoc\bp_filter_search.pl.1 Manifying blib\script/bp_blast2tree.pl -> blib\bindoc\bp_blast2tree.pl.1 Manifying blib\script/bp_hivq.pl -> blib\bindoc\bp_hivq.pl.1 Manifying blib\script/bp_sreformat.pl -> blib\bindoc\bp_sreformat.pl.1 Manifying blib\script/bp_process_gadfly.pl -> blib\bindoc\bp_process_gadfly.pl.1 Manifying blib\script/bp_pairwise_kaks.pl -> blib\bindoc\bp_pairwise_kaks.pl.1 Manifying blib\script/bp_gccalc.pl -> blib\bindoc\bp_gccalc.pl.1 Manifying blib\script/bp_mutate.pl -> blib\bindoc\bp_mutate.pl.1 Manifying blib\script/bp_mrtrans.pl -> blib\bindoc\bp_mrtrans.pl.1 Manifying blib\script/bp_search2table.pl -> blib\bindoc\bp_search2table.pl.1 Manifying blib\script/bp_revtrans-motif.pl -> blib\bindoc\bp_revtrans-motif.pl.1 Manifying blib\script/bp_remote_blast.pl -> blib\bindoc\bp_remote_blast.pl.1 Manifying blib\script/bp_nexus2nh.pl -> blib\bindoc\bp_nexus2nh.pl.1 Manifying blib\script/bp_composite_LD.pl -> blib\bindoc\bp_composite_LD.pl.1 Manifying blib\script/bp_hmmer_to_table.pl -> blib\bindoc\bp_hmmer_to_table.pl.1 Manifying blib\script/bp_download_query_genbank.pl -> blib\bindoc\bp_download_query_genbank.pl.1 Manifying blib\script/bp_seqret.pl -> blib\bindoc\bp_seqret.pl.1 Manifying blib\script/bp_flanks.pl -> blib\bindoc\bp_flanks.pl.1 Manifying blib\script/bp_taxonomy2tree.pl -> blib\bindoc\bp_taxonomy2tree.pl.1 Manifying blib\script/bp_split_seq.pl -> blib\bindoc\bp_split_seq.pl.1 Manifying blib\script/bp_seqretsplit.pl -> blib\bindoc\bp_seqretsplit.pl.1 Manifying blib\script/bp_genbank2gff3.pl -> blib\bindoc\bp_genbank2gff3.pl.1 Manifying blib\script/bp_chaos_plot.pl -> blib\bindoc\bp_chaos_plot.pl.1 Manifying blib\lib/Bio/Tools/EUtilities.pm -> blib\libdoc\Bio.Tools.EUtilities.3 Manifying blib\lib/Bio/Search/Hit/HitFactory.pm -> blib\libdoc\Bio.Search.Hit.HitFactory.3 Manifying blib\lib/Bio/Index/Abstract.pm -> blib\libdoc\Bio.Index.Abstract.3 Manifying blib\lib/Bio/Structure/SecStr/DSSP/Res.pm -> blib\libdoc\Bio.Structure.SecStr.DSSP.Res.3 Manifying blib\lib/Bio/SearchIO/Writer/HSPTableWriter.pm -> blib\libdoc\Bio.SearchIO.Writer.HSPTableWriter.3 Manifying blib\lib/Bio/Location/Simple.pm -> blib\libdoc\Bio.Location.Simple.3 Manifying blib\lib/Bio/SearchIO/blastxml.pm -> blib\libdoc\Bio.SearchIO.blastxml.3 Manifying blib\lib/Bio/Search/HSP/BlastHSP.pm -> blib\libdoc\Bio.Search.HSP.BlastHSP.3 Manifying blib\lib/Bio/LiveSeq/AARange.pm -> blib\libdoc\Bio.LiveSeq.AARange.3 Manifying blib\lib/Bio/SeqIO/tinyseq.pm -> blib\libdoc\Bio.SeqIO.tinyseq.3 Manifying blib\lib/Bio/AlignIO/metafasta.pm -> blib\libdoc\Bio.AlignIO.metafasta.3 Manifying blib\lib/Bio/Tools/Run/WrapperBase/CommandExts.pm -> blib\libdoc\Bio.Tools.Run.WrapperBase.CommandExts.3 Manifying blib\lib/Bio/Tools/TargetP.pm -> blib\libdoc\Bio.Tools.TargetP.3 Manifying blib\lib/Bio/Ontology/TermFactory.pm -> blib\libdoc\Bio.Ontology.TermFactory.3 Manifying blib\lib/Bio/Tools/Fgenesh.pm -> blib\libdoc\Bio.Tools.Fgenesh.3 Manifying blib\lib/Bio/Tools/FootPrinter.pm -> blib\libdoc\Bio.Tools.FootPrinter.3 Manifying blib\lib/Bio/TreeIO/TreeEventBuilder.pm -> blib\libdoc\Bio.TreeIO.TreeEventBuilder.3 Manifying blib\lib/Bio/Ontology/DocumentRegistry.pm -> blib\libdoc\Bio.Ontology.DocumentRegistry.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/match.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.match.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/iterator.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.iterator.3 Manifying blib\lib/Bio/HandlerBaseI.pm -> blib\libdoc\Bio.HandlerBaseI.3 Manifying blib\lib/Bio/Event/EventGeneratorI.pm -> blib\libdoc\Bio.Event.EventGeneratorI.3 Manifying blib\lib/Bio/Structure/SecStr/STRIDE/Res.pm -> blib\libdoc\Bio.Structure.SecStr.STRIDE.Res.3 Manifying blib\lib/Bio/SeqIO/exp.pm -> blib\libdoc\Bio.SeqIO.exp.3 Manifying blib\lib/Bio/AlignIO/mega.pm -> blib\libdoc\Bio.AlignIO.mega.3 Manifying blib\lib/Bio/SeqIO/game/gameHandler.pm -> blib\libdoc\Bio.SeqIO.game.gameHandler.3 Manifying blib\lib/Bio/Search/HSP/BlastPullHSP.pm -> blib\libdoc\Bio.Search.HSP.BlastPullHSP.3 Manifying blib\lib/Bio/Ontology/RelationshipI.pm -> blib\libdoc\Bio.Ontology.RelationshipI.3 Manifying blib\lib/Bio/AlignIO/proda.pm -> blib\libdoc\Bio.AlignIO.proda.3 Manifying blib\lib/Bio/SearchIO/hmmer.pm -> blib\libdoc\Bio.SearchIO.hmmer.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_softberry.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_softberry.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/ace.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.ace.3 Manifying blib\lib/Bio/SeqFeature/Gene/ExonI.pm -> blib\libdoc\Bio.SeqFeature.Gene.ExonI.3 Manifying blib\lib/Bio/Seq/EncodedSeq.pm -> blib\libdoc\Bio.Seq.EncodedSeq.3 Manifying blib\lib/Bio/Search/Result/GenericResult.pm -> blib\libdoc\Bio.Search.Result.GenericResult.3 Manifying blib\lib/Bio/SeqFeature/Tools/FeatureNamer.pm -> blib\libdoc\Bio.SeqFeature.Tools.FeatureNamer.3 Manifying blib\lib/Bio/Tools/Genomewise.pm -> blib\libdoc\Bio.Tools.Genomewise.3 Manifying blib\lib/Bio/Restriction/IO/bairoch.pm -> blib\libdoc\Bio.Restriction.IO.bairoch.3 Manifying blib\lib/Bio/Map/PositionI.pm -> blib\libdoc\Bio.Map.PositionI.3 Manifying blib\lib/Bio/SeqIO/tigr.pm -> blib\libdoc\Bio.SeqIO.tigr.3 Manifying blib\lib/Bio/Cluster/UniGene.pm -> blib\libdoc\Bio.Cluster.UniGene.3 Manifying blib\lib/Bio/Tools/HMMER/Domain.pm -> blib\libdoc\Bio.Tools.HMMER.Domain.3 Manifying blib\lib/Bio/Seq/SeqFactory.pm -> blib\libdoc\Bio.Seq.SeqFactory.3 Manifying blib\lib/Bio/Tools/tRNAscanSE.pm -> blib\libdoc\Bio.Tools.tRNAscanSE.3 Manifying blib\lib/Bio/SeqEvolution/EvolutionI.pm -> blib\libdoc\Bio.SeqEvolution.EvolutionI.3 Manifying blib\lib/Bio/Search/Hit/hmmer3Hit.pm -> blib\libdoc\Bio.Search.Hit.hmmer3Hit.3 Manifying blib\lib/Bio/Map/CytoPosition.pm -> blib\libdoc\Bio.Map.CytoPosition.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.mysqlace.3 Manifying blib\lib/Bio/Biblio/WebResource.pm -> blib\libdoc\Bio.Biblio.WebResource.3 Manifying blib\lib/Bio/Map/Marker.pm -> blib\libdoc\Bio.Map.Marker.3 Manifying blib\lib/Bio/PopGen/IO/prettybase.pm -> blib\libdoc\Bio.PopGen.IO.prettybase.3 Manifying blib\lib/Bio/Tree/NodeNHX.pm -> blib\libdoc\Bio.Tree.NodeNHX.3 Manifying blib\lib/Bio/Biblio/Organisation.pm -> blib\libdoc\Bio.Biblio.Organisation.3 Manifying blib\lib/Bio/DescribableI.pm -> blib\libdoc\Bio.DescribableI.3 Manifying blib\lib/Bio/Root/RootI.pm -> blib\libdoc\Bio.Root.RootI.3 Manifying blib\lib/Bio/Tools/HMMER/Set.pm -> blib\libdoc\Bio.Tools.HMMER.Set.3 Manifying blib\lib/Bio/Tools/Genewise.pm -> blib\libdoc\Bio.Tools.Genewise.3 Manifying blib\lib/Bio/Variation/IO.pm -> blib\libdoc\Bio.Variation.IO.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/bdb.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.bdb.3 Manifying blib\lib/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm -> blib\libdoc\Bio.Phenotype.OMIM.OMIMentryAllelicVariant.3 Manifying blib\lib/Bio/SearchIO/psl.pm -> blib\libdoc\Bio.SearchIO.psl.3 Manifying blib\lib/Bio/Align/AlignI.pm -> blib\libdoc\Bio.Align.AlignI.3 Manifying blib\lib/Bio/Tools/Run/StandAloneBlast.pm -> blib\libdoc\Bio.Tools.Run.StandAloneBlast.3 Manifying blib\lib/Bio/SeqIO/tinyseq/tinyseqHandler.pm -> blib\libdoc\Bio.SeqIO.tinyseq.tinyseqHandler.3 Manifying blib\lib/Bio/Seq/PrimedSeq.pm -> blib\libdoc\Bio.Seq.PrimedSeq.3 Manifying blib\lib/Bio/Coordinate/ExtrapolatingPair.pm -> blib\libdoc\Bio.Coordinate.ExtrapolatingPair.3 Manifying blib\lib/Bio/SimpleAnalysisI.pm -> blib\libdoc\Bio.SimpleAnalysisI.3 Manifying blib\lib/Bio/FeatureIO/vecscreen_simple.pm -> blib\libdoc\Bio.FeatureIO.vecscreen_simple.3 Manifying blib\lib/Bio/SeqIO.pm -> blib\libdoc\Bio.SeqIO.3 Manifying blib\lib/Bio/SeqIO/interpro.pm -> blib\libdoc\Bio.SeqIO.interpro.3 Manifying blib\lib/Bio/Cluster/UniGeneI.pm -> blib\libdoc\Bio.Cluster.UniGeneI.3 Manifying blib\lib/Bio/Map/GeneMap.pm -> blib\libdoc\Bio.Map.GeneMap.3 Manifying blib\lib/Bio/Annotation/Comment.pm -> blib\libdoc\Bio.Annotation.Comment.3 Manifying blib\lib/Bio/SeqIO/MultiFile.pm -> blib\libdoc\Bio.SeqIO.MultiFile.3 Manifying blib\lib/Bio/Map/MapI.pm -> blib\libdoc\Bio.Map.MapI.3 Manifying blib\lib/Bio/TreeIO/nexml.pm -> blib\libdoc\Bio.TreeIO.nexml.3 Manifying blib\lib/Bio/AlignIO/phylip.pm -> blib\libdoc\Bio.AlignIO.phylip.3 Manifying blib\lib/Bio/Ontology/OntologyEngineI.pm -> blib\libdoc\Bio.Ontology.OntologyEngineI.3 Manifying blib\lib/Bio/AlignIO/arp.pm -> blib\libdoc\Bio.AlignIO.arp.3 Manifying blib\lib/Bio/TreeIO/nexus.pm -> blib\libdoc\Bio.TreeIO.nexus.3 Manifying blib\lib/Bio/Tools/TandemRepeatsFinder.pm -> blib\libdoc\Bio.Tools.TandemRepeatsFinder.3 Manifying blib\lib/Bio/Index/GenBank.pm -> blib\libdoc\Bio.Index.GenBank.3 Manifying blib\lib/Bio/Tools/Eponine.pm -> blib\libdoc\Bio.Tools.Eponine.3 Manifying blib\lib/Bio/SearchIO/hmmer3.pm -> blib\libdoc\Bio.SearchIO.hmmer3.3 Manifying blib\lib/Bio/DB/Universal.pm -> blib\libdoc\Bio.DB.Universal.3 Manifying blib\lib/Bio/Index/Fasta.pm -> blib\libdoc\Bio.Index.Fasta.3 Manifying blib\lib/Bio/Matrix/PSM/IO/psiblast.pm -> blib\libdoc\Bio.Matrix.PSM.IO.psiblast.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/GOR4.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.GOR4.3 Manifying blib\lib/Bio/Biblio/MedlineBook.pm -> blib\libdoc\Bio.Biblio.MedlineBook.3 Manifying blib\lib/Bio/SeqIO/table.pm -> blib\libdoc\Bio.SeqIO.table.3 Manifying blib\lib/Bio/AlignIO/emboss.pm -> blib\libdoc\Bio.AlignIO.emboss.3 Manifying blib\lib/Bio/Factory/SequenceProcessorI.pm -> blib\libdoc\Bio.Factory.SequenceProcessorI.3 Manifying blib\lib/Bio/AlignIO/nexus.pm -> blib\libdoc\Bio.AlignIO.nexus.3 Manifying blib\lib/Bio/OntologyIO/Handlers/InterProHandler.pm -> blib\libdoc\Bio.OntologyIO.Handlers.InterProHandler.3 Manifying blib\lib/Bio/Matrix/PSM/Psm.pm -> blib\libdoc\Bio.Matrix.PSM.Psm.3 Manifying blib\lib/Bio/Assembly/Singlet.pm -> blib\libdoc\Bio.Assembly.Singlet.3 Manifying blib\lib/Bio/AlignIO/maf.pm -> blib\libdoc\Bio.AlignIO.maf.3 Manifying blib\lib/Bio/SearchIO/Writer/GbrowseGFF.pm -> blib\libdoc\Bio.SearchIO.Writer.GbrowseGFF.3 Manifying blib\lib/Bio/Search/HSP/PSLHSP.pm -> blib\libdoc\Bio.Search.HSP.PSLHSP.3 Manifying blib\lib/Bio/Biblio/MedlineJournalArticle.pm -> blib\libdoc\Bio.Biblio.MedlineJournalArticle.3 Manifying blib\lib/Bio/Variation/AAChange.pm -> blib\libdoc\Bio.Variation.AAChange.3 Manifying blib\lib/Bio/DB/Query/GenBank.pm -> blib\libdoc\Bio.DB.Query.GenBank.3 Manifying blib\lib/Bio/Search/Hit/Fasta.pm -> blib\libdoc\Bio.Search.Hit.Fasta.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/biofetch_oracle.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.biofetch_oracle.3 Manifying blib\lib/Bio/DB/EMBL.pm -> blib\libdoc\Bio.DB.EMBL.3 Manifying blib\lib/Bio/Assembly/IO.pm -> blib\libdoc\Bio.Assembly.IO.3 Manifying blib\lib/Bio/Structure/StructureI.pm -> blib\libdoc\Bio.Structure.StructureI.3 Manifying blib\lib/Bio/LocatableSeq.pm -> blib\libdoc\Bio.LocatableSeq.3 Manifying blib\lib/Bio/Tools/Lucy.pm -> blib\libdoc\Bio.Tools.Lucy.3 Manifying blib\lib/Bio/Tools/Profile.pm -> blib\libdoc\Bio.Tools.Profile.3 Manifying blib\lib/Bio/Restriction/IO/itype2.pm -> blib\libdoc\Bio.Restriction.IO.itype2.3 Manifying blib\lib/Bio/Tools/Coil.pm -> blib\libdoc\Bio.Tools.Coil.3 Manifying blib\lib/Bio/Search/Result/BlastPullResult.pm -> blib\libdoc\Bio.Search.Result.BlastPullResult.3 Manifying blib\lib/Bio/MapIO/fpc.pm -> blib\libdoc\Bio.MapIO.fpc.3 Manifying blib\lib/Bio/SeqFeature/Computation.pm -> blib\libdoc\Bio.SeqFeature.Computation.3 Manifying blib\lib/Bio/SearchIO/SearchWriterI.pm -> blib\libdoc\Bio.SearchIO.SearchWriterI.3 Manifying blib\lib/Bio/PrimarySeq.pm -> blib\libdoc\Bio.PrimarySeq.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/mysql.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.mysql.3 Manifying blib\lib/Bio/Ontology/Ontology.pm -> blib\libdoc\Bio.Ontology.Ontology.3 Manifying blib\lib/Bio/Map/PositionHandlerI.pm -> blib\libdoc\Bio.Map.PositionHandlerI.3 Manifying blib\lib/Bio/Tools/SeqPattern.pm -> blib\libdoc\Bio.Tools.SeqPattern.3 Manifying blib\lib/Bio/Tools/Analysis/DNA/ESEfinder.pm -> blib\libdoc\Bio.Tools.Analysis.DNA.ESEfinder.3 Manifying blib\lib/Bio/SeqIO/metafasta.pm -> blib\libdoc\Bio.SeqIO.metafasta.3 Manifying blib\lib/Bio/Location/Fuzzy.pm -> blib\libdoc\Bio.Location.Fuzzy.3 Manifying blib\lib/Bio/Taxonomy.pm -> blib\libdoc\Bio.Taxonomy.3 Manifying blib\lib/Bio/AlignIO/selex.pm -> blib\libdoc\Bio.AlignIO.selex.3 Manifying blib\lib/Bio/Map/LinkagePosition.pm -> blib\libdoc\Bio.Map.LinkagePosition.3 Manifying blib\lib/Bio/OntologyIO/goflat.pm -> blib\libdoc\Bio.OntologyIO.goflat.3 Manifying blib\lib/Bio/Annotation/Target.pm -> blib\libdoc\Bio.Annotation.Target.3 Manifying blib\lib/Bio/SearchIO/FastHitEventBuilder.pm -> blib\libdoc\Bio.SearchIO.FastHitEventBuilder.3 Manifying blib\lib/Bio/Search/HSP/HMMERHSP.pm -> blib\libdoc\Bio.Search.HSP.HMMERHSP.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/DBI/Pg.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.DBI.Pg.3 Manifying blib\lib/Bio/SeqEvolution/Factory.pm -> blib\libdoc\Bio.SeqEvolution.Factory.3 Manifying blib\lib/Bio/ClusterIO/unigene.pm -> blib\libdoc\Bio.ClusterIO.unigene.3 Manifying blib\lib/Bio/DB/SeqFeature.pm -> blib\libdoc\Bio.DB.SeqFeature.3 Manifying blib\lib/Bio/Tree/TreeFunctionsI.pm -> blib\libdoc\Bio.Tree.TreeFunctionsI.3 Manifying blib\lib/Bio/Restriction/Enzyme.pm -> blib\libdoc\Bio.Restriction.Enzyme.3 Manifying blib\lib/Bio/Map/MappableI.pm -> blib\libdoc\Bio.Map.MappableI.3 Manifying blib\lib/Bio/DB/Biblio/eutils.pm -> blib\libdoc\Bio.DB.Biblio.eutils.3 Manifying blib\lib/Bio/Biblio/Book.pm -> blib\libdoc\Bio.Biblio.Book.3 Manifying blib\lib/Bio/Tree/AnnotatableNode.pm -> blib\libdoc\Bio.Tree.AnnotatableNode.3 Manifying blib\lib/Bio/Tools/Glimmer.pm -> blib\libdoc\Bio.Tools.Glimmer.3 Manifying blib\lib/Bio/Annotation/StructuredValue.pm -> blib\libdoc\Bio.Annotation.StructuredValue.3 Manifying blib\lib/Bio/LiveSeq/Mutation.pm -> blib\libdoc\Bio.LiveSeq.Mutation.3 Manifying blib\lib/Bio/DB/TFBS/transfac_pro.pm -> blib\libdoc\Bio.DB.TFBS.transfac_pro.3 Manifying blib\lib/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm -> blib\libdoc\Bio.DB.SeqFeature.NormalizedTableFeatureI.3 Manifying blib\lib/Bio/SearchIO/infernal.pm -> blib\libdoc\Bio.SearchIO.infernal.3 Manifying blib\lib/Bio/Matrix/PSM/InstanceSiteI.pm -> blib\libdoc\Bio.Matrix.PSM.InstanceSiteI.3 Manifying blib\lib/Bio/SeqFeature/Tools/IDHandler.pm -> blib\libdoc\Bio.SeqFeature.Tools.IDHandler.3 Manifying blib\lib/Bio/Coordinate/Result/Gap.pm -> blib\libdoc\Bio.Coordinate.Result.Gap.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/pg.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.pg.3 Manifying blib\lib/Bio/SeqIO/locuslink.pm -> blib\libdoc\Bio.SeqIO.locuslink.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.pg_fts.3 Manifying blib\lib/Bio/SeqFeature/Gene/Exon.pm -> blib\libdoc\Bio.SeqFeature.Gene.Exon.3 Manifying blib\lib/Bio/LiveSeq/Exon.pm -> blib\libdoc\Bio.LiveSeq.Exon.3 Manifying blib\lib/Bio/DB/GFF/Featname.pm -> blib\libdoc\Bio.DB.GFF.Featname.3 Manifying blib\lib/Bio/Map/EntityI.pm -> blib\libdoc\Bio.Map.EntityI.3 Manifying blib\lib/Bio/Tools/Sim4/Results.pm -> blib\libdoc\Bio.Tools.Sim4.Results.3 Manifying blib\lib/Bio/Tools/GFF.pm -> blib\libdoc\Bio.Tools.GFF.3 Manifying blib\lib/Bio/SearchIO/wise.pm -> blib\libdoc\Bio.SearchIO.wise.3 Manifying blib\lib/Bio/Cluster/FamilyI.pm -> blib\libdoc\Bio.Cluster.FamilyI.3 Manifying blib\lib/Bio/Coordinate/ResultI.pm -> blib\libdoc\Bio.Coordinate.ResultI.3 Manifying blib\lib/Bio/Tools/Tmhmm.pm -> blib\libdoc\Bio.Tools.Tmhmm.3 Manifying blib\lib/Bio/SearchIO/Writer/HTMLResultWriter.pm -> blib\libdoc\Bio.SearchIO.Writer.HTMLResultWriter.3 Manifying blib\lib/Bio/SeqIO/FTHelper.pm -> blib\libdoc\Bio.SeqIO.FTHelper.3 Manifying blib\lib/Bio/Assembly/IO/ace.pm -> blib\libdoc\Bio.Assembly.IO.ace.3 Manifying blib\lib/Bio/Matrix/PSM/InstanceSite.pm -> blib\libdoc\Bio.Matrix.PSM.InstanceSite.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_ensgene.3 Manifying blib\lib/Bio/SeqIO/pir.pm -> blib\libdoc\Bio.SeqIO.pir.3 Manifying blib\lib/Bio/SearchIO/erpin.pm -> blib\libdoc\Bio.SearchIO.erpin.3 Manifying blib\lib/Bio/SeqIO/qual.pm -> blib\libdoc\Bio.SeqIO.qual.3 Manifying blib\lib/Bio/Tools/EUtilities/Link.pm -> blib\libdoc\Bio.Tools.EUtilities.Link.3 Manifying blib\lib/Bio/Biblio/PubmedJournalArticle.pm -> blib\libdoc\Bio.Biblio.PubmedJournalArticle.3 Manifying blib\lib/Bio/Tools/Phylo/Molphy/Result.pm -> blib\libdoc\Bio.Tools.Phylo.Molphy.Result.3 Manifying blib\lib/Bio/Restriction/IO/withrefm.pm -> blib\libdoc\Bio.Restriction.IO.withrefm.3 Manifying blib\lib/Bio/CodonUsage/Table.pm -> blib\libdoc\Bio.CodonUsage.Table.3 Manifying blib\lib/Bio/SearchIO/fasta.pm -> blib\libdoc\Bio.SearchIO.fasta.3 Manifying blib\lib/Bio/PopGen/MarkerI.pm -> blib\libdoc\Bio.PopGen.MarkerI.3 Manifying blib\lib/Bio/PhyloNetwork/GraphViz.pm -> blib\libdoc\Bio.PhyloNetwork.GraphViz.3 Manifying blib\lib/Bio/LiveSeq/IO/BioPerl.pm -> blib\libdoc\Bio.LiveSeq.IO.BioPerl.3 Manifying blib\lib/Bio/SeqFeature/Gene/Intron.pm -> blib\libdoc\Bio.SeqFeature.Gene.Intron.3 Manifying blib\lib/Bio/SeqIO/embldriver.pm -> blib\libdoc\Bio.SeqIO.embldriver.3 Manifying blib\lib/Bio/DB/WebDBSeqI.pm -> blib\libdoc\Bio.DB.WebDBSeqI.3 Manifying blib\lib/Bio/Map/Position.pm -> blib\libdoc\Bio.Map.Position.3 Manifying blib\lib/Bio/SeqIO/mbsout.pm -> blib\libdoc\Bio.SeqIO.mbsout.3 Manifying blib\lib/Bio/Biblio/TechReport.pm -> blib\libdoc\Bio.Biblio.TechReport.3 Manifying blib\lib/Bio/Structure/IO/pdb.pm -> blib\libdoc\Bio.Structure.IO.pdb.3 Manifying blib\lib/Bio/SeqIO/chaos.pm -> blib\libdoc\Bio.SeqIO.chaos.3 Manifying blib\lib/Bio/DB/Failover.pm -> blib\libdoc\Bio.DB.Failover.3 Manifying blib\lib/Bio/NexmlIO.pm -> blib\libdoc\Bio.NexmlIO.3 Manifying blib\lib/Bio/Biblio.pm -> blib\libdoc\Bio.Biblio.3 Manifying blib\lib/Bio/SearchIO/SearchResultEventBuilder.pm -> blib\libdoc\Bio.SearchIO.SearchResultEventBuilder.3 Manifying blib\lib/Bio/Tools/Genscan.pm -> blib\libdoc\Bio.Tools.Genscan.3 Manifying blib\lib/Bio/Tools/EUtilities/Summary/ItemContainerI.pm -> blib\libdoc\Bio.Tools.EUtilities.Summary.ItemContainerI.3 Manifying blib\lib/Bio/SeqIO/largefasta.pm -> blib\libdoc\Bio.SeqIO.largefasta.3 Manifying blib\lib/Bio/Tools/Alignment/Consed.pm -> blib\libdoc\Bio.Tools.Alignment.Consed.3 Manifying blib\lib/Bio/Matrix/Scoring.pm -> blib\libdoc\Bio.Matrix.Scoring.3 Manifying blib\lib/Bio/Tools/HMMER/Results.pm -> blib\libdoc\Bio.Tools.HMMER.Results.3 Manifying blib\lib/Bio/SeqIO/embl.pm -> blib\libdoc\Bio.SeqIO.embl.3 Manifying blib\lib/Bio/Location/Atomic.pm -> blib\libdoc\Bio.Location.Atomic.3 Manifying blib\lib/Bio/SearchIO/XML/BlastHandler.pm -> blib\libdoc\Bio.SearchIO.XML.BlastHandler.3 Manifying blib\lib/Bio/LocationI.pm -> blib\libdoc\Bio.LocationI.3 Manifying blib\lib/Bio/Annotation/Reference.pm -> blib\libdoc\Bio.Annotation.Reference.3 Manifying blib\lib/Bio/Tools/Signalp.pm -> blib\libdoc\Bio.Tools.Signalp.3 Manifying blib\lib/Bio/AlignIO/stockholm.pm -> blib\libdoc\Bio.AlignIO.stockholm.3 Manifying blib\lib/Bio/Seq/LargeSeqI.pm -> blib\libdoc\Bio.Seq.LargeSeqI.3 Manifying blib\lib/Bio/Matrix/PSM/SiteMatrix.pm -> blib\libdoc\Bio.Matrix.PSM.SiteMatrix.3 Manifying blib\lib/Bio/Factory/ObjectBuilderI.pm -> blib\libdoc\Bio.Factory.ObjectBuilderI.3 Manifying blib\lib/Bio/Symbol/Symbol.pm -> blib\libdoc\Bio.Symbol.Symbol.3 Manifying blib\lib/Bio/PopGen/GenotypeI.pm -> blib\libdoc\Bio.PopGen.GenotypeI.3 Manifying blib\lib/Bio/Assembly/IO/tigr.pm -> blib\libdoc\Bio.Assembly.IO.tigr.3 Manifying blib\lib/Bio/Seq/SequenceTrace.pm -> blib\libdoc\Bio.Seq.SequenceTrace.3 Manifying blib\lib/Bio/PopGen/Marker.pm -> blib\libdoc\Bio.PopGen.Marker.3 Manifying blib\lib/Bio/SeqIO/gbdriver.pm -> blib\libdoc\Bio.SeqIO.gbdriver.3 Manifying blib\lib/Bio/SearchIO/hmmer_pull.pm -> blib\libdoc\Bio.SearchIO.hmmer_pull.3 Manifying blib\lib/Bio/Biblio/Person.pm -> blib\libdoc\Bio.Biblio.Person.3 Manifying blib\lib/Bio/Search/HSP/HmmpfamHSP.pm -> blib\libdoc\Bio.Search.HSP.HmmpfamHSP.3 Manifying blib\lib/Bio/DB/SeqFeature/Store.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.3 Manifying blib\lib/Bio/ClusterI.pm -> blib\libdoc\Bio.ClusterI.3 Manifying blib\lib/Bio/SeqIO/strider.pm -> blib\libdoc\Bio.SeqIO.strider.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.mysqlcmap.3 Manifying blib\lib/Bio/ClusterIO.pm -> blib\libdoc\Bio.ClusterIO.3 Manifying blib\lib/Bio/Map/SimpleMap.pm -> blib\libdoc\Bio.Map.SimpleMap.3 Manifying blib\lib/Bio/Factory/AnalysisI.pm -> blib\libdoc\Bio.Factory.AnalysisI.3 Manifying blib\lib/Bio/PopGen/IO.pm -> blib\libdoc\Bio.PopGen.IO.3 Manifying blib\lib/Bio/DB/LocationI.pm -> blib\libdoc\Bio.DB.LocationI.3 Manifying blib\lib/Bio/FeatureIO/gtf.pm -> blib\libdoc\Bio.FeatureIO.gtf.3 Manifying blib\lib/Bio/FeatureIO/bed.pm -> blib\libdoc\Bio.FeatureIO.bed.3 Manifying blib\lib/Bio/Structure/Model.pm -> blib\libdoc\Bio.Structure.Model.3 Manifying blib\lib/Bio/FeatureIO/ptt.pm -> blib\libdoc\Bio.FeatureIO.ptt.3 Manifying blib\lib/Bio/Search/Hit/HMMERHit.pm -> blib\libdoc\Bio.Search.Hit.HMMERHit.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/transcript.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.transcript.3 Manifying blib\lib/Bio/IdCollectionI.pm -> blib\libdoc\Bio.IdCollectionI.3 Manifying blib\lib/Bio/Search/Result/ResultFactory.pm -> blib\libdoc\Bio.Search.Result.ResultFactory.3 Manifying blib\lib/Bio/Map/Clone.pm -> blib\libdoc\Bio.Map.Clone.3 Manifying blib\lib/Bio/Search/Iteration/GenericIteration.pm -> blib\libdoc\Bio.Search.Iteration.GenericIteration.3 Manifying blib\lib/Bio/PopGen/IO/csv.pm -> blib\libdoc\Bio.PopGen.IO.csv.3 Manifying blib\lib/Bio/OntologyIO/simplehierarchy.pm -> blib\libdoc\Bio.OntologyIO.simplehierarchy.3 Manifying blib\lib/Bio/PhyloNetwork/RandomFactory.pm -> blib\libdoc\Bio.PhyloNetwork.RandomFactory.3 Manifying blib\lib/Bio/Align/Utilities.pm -> blib\libdoc\Bio.Align.Utilities.3 Manifying blib\lib/Bio/Phenotype/MeSH/Twig.pm -> blib\libdoc\Bio.Phenotype.MeSH.Twig.3 Manifying blib\lib/Bio/Tools/SeqPattern/Backtranslate.pm -> blib\libdoc\Bio.Tools.SeqPattern.Backtranslate.3 Manifying blib\lib/Bio/Tools/Phylo/PAML/ModelResult.pm -> blib\libdoc\Bio.Tools.Phylo.PAML.ModelResult.3 Manifying blib\lib/Bio/Seq/QualI.pm -> blib\libdoc\Bio.Seq.QualI.3 Manifying blib\lib/Bio/Search/Hit/PullHitI.pm -> blib\libdoc\Bio.Search.Hit.PullHitI.3 Manifying blib\lib/Bio/Coordinate/Chain.pm -> blib\libdoc\Bio.Coordinate.Chain.3 Manifying blib\lib/Bio/SeqFeature/Gene/TranscriptI.pm -> blib\libdoc\Bio.SeqFeature.Gene.TranscriptI.3 Manifying blib\lib/Bio/WebAgent.pm -> blib\libdoc\Bio.WebAgent.3 Manifying blib\lib/Bio/Seq/Quality.pm -> blib\libdoc\Bio.Seq.Quality.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_sanger22.3 Manifying blib\lib/Bio/Tools/EUtilities/Summary.pm -> blib\libdoc\Bio.Tools.EUtilities.Summary.3 Manifying blib\lib/Bio/AnnotationI.pm -> blib\libdoc\Bio.AnnotationI.3 Manifying blib\lib/Bio/Variation/SNP.pm -> blib\libdoc\Bio.Variation.SNP.3 Manifying blib\lib/Bio/TreeIO/phyloxml.pm -> blib\libdoc\Bio.TreeIO.phyloxml.3 Manifying blib\lib/Bio/Search/Tiling/MapTiling.pm -> blib\libdoc\Bio.Search.Tiling.MapTiling.3 Manifying blib\lib/Bio/Map/PositionHandler.pm -> blib\libdoc\Bio.Map.PositionHandler.3 Manifying blib\lib/Bio/Map/OrderedPosition.pm -> blib\libdoc\Bio.Map.OrderedPosition.3 Manifying blib\lib/Bio/SeqIO/fasta.pm -> blib\libdoc\Bio.SeqIO.fasta.3 Manifying blib\lib/Bio/Align/Graphics.pm -> blib\libdoc\Bio.Align.Graphics.3 Manifying blib\lib/Bio/Align/ProteinStatistics.pm -> blib\libdoc\Bio.Align.ProteinStatistics.3 Manifying blib\lib/Bio/DasI.pm -> blib\libdoc\Bio.DasI.3 Manifying blib\lib/Bio/Seq/LargePrimarySeq.pm -> blib\libdoc\Bio.Seq.LargePrimarySeq.3 Manifying blib\lib/Bio/DB/GenericWebAgent.pm -> blib\libdoc\Bio.DB.GenericWebAgent.3 Manifying blib\lib/Bio/LiveSeq/Gene.pm -> blib\libdoc\Bio.LiveSeq.Gene.3 Manifying blib\lib/Bio/Tools/ECnumber.pm -> blib\libdoc\Bio.Tools.ECnumber.3 Manifying blib\lib/Bio/Seq/SeqFastaSpeedFactory.pm -> blib\libdoc\Bio.Seq.SeqFastaSpeedFactory.3 Manifying blib\lib/Bio/Phenotype/OMIM/OMIMparser.pm -> blib\libdoc\Bio.Phenotype.OMIM.OMIMparser.3 Manifying blib\lib/Bio/DB/Flat/BinarySearch.pm -> blib\libdoc\Bio.DB.Flat.BinarySearch.3 Manifying blib\lib/Bio/SeqFeature/Gene/Promoter.pm -> blib\libdoc\Bio.SeqFeature.Gene.Promoter.3 Manifying blib\lib/Bio/Location/SplitLocationI.pm -> blib\libdoc\Bio.Location.SplitLocationI.3 Manifying blib\lib/Bio/SeqFeature/Primer.pm -> blib\libdoc\Bio.SeqFeature.Primer.3 Manifying blib\lib/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm -> blib\libdoc\Bio.Ontology.SimpleGOEngine.GraphAdaptor.3 Manifying blib\lib/Bio/ParameterBaseI.pm -> blib\libdoc\Bio.ParameterBaseI.3 Manifying blib\lib/Bio/DB/Flat.pm -> blib\libdoc\Bio.DB.Flat.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/none.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.none.3 Manifying blib\lib/Bio/OntologyIO/dagflat.pm -> blib\libdoc\Bio.OntologyIO.dagflat.3 Manifying blib\lib/Bio/Tools/Primer/Feature.pm -> blib\libdoc\Bio.Tools.Primer.Feature.3 Manifying blib\lib/Bio/SeqFeature/Collection.pm -> blib\libdoc\Bio.SeqFeature.Collection.3 Manifying blib\lib/Bio/Matrix/PhylipDist.pm -> blib\libdoc\Bio.Matrix.PhylipDist.3 Manifying blib\lib/Bio/Taxonomy/Tree.pm -> blib\libdoc\Bio.Taxonomy.Tree.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/memory.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.memory.3 Manifying blib\lib/Bio/Factory/SeqAnalysisParserFactory.pm -> blib\libdoc\Bio.Factory.SeqAnalysisParserFactory.3 Manifying blib\lib/Bio/DBLinkContainerI.pm -> blib\libdoc\Bio.DBLinkContainerI.3 Manifying blib\lib/Bio/SeqIO/ace.pm -> blib\libdoc\Bio.SeqIO.ace.3 Manifying blib\lib/Bio/Search/Hit/PsiBlastHit.pm -> blib\libdoc\Bio.Search.Hit.PsiBlastHit.3 Manifying blib\lib/Bio/DB/EntrezGene.pm -> blib\libdoc\Bio.DB.EntrezGene.3 Manifying blib\lib/Bio/DB/SeqVersion.pm -> blib\libdoc\Bio.DB.SeqVersion.3 Manifying blib\lib/Bio/AlignIO/prodom.pm -> blib\libdoc\Bio.AlignIO.prodom.3 Manifying blib\lib/Bio/Das/FeatureTypeI.pm -> blib\libdoc\Bio.Das.FeatureTypeI.3 Manifying blib\lib/Bio/SeqFeature/Gene/Poly_A_site.pm -> blib\libdoc\Bio.SeqFeature.Gene.Poly_A_site.3 Manifying blib\lib/Bio/Tools/Primer3.pm -> blib\libdoc\Bio.Tools.Primer3.3 Manifying blib\lib/Bio/SeqIO/game/seqHandler.pm -> blib\libdoc\Bio.SeqIO.game.seqHandler.3 Manifying blib\lib/Bio/SearchIO.pm -> blib\libdoc\Bio.SearchIO.3 Manifying blib\lib/Bio/Tools/Run/GenericParameters.pm -> blib\libdoc\Bio.Tools.Run.GenericParameters.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.caching_handle.3 Manifying blib\lib/Bio/LiveSeq/IO/Loader.pm -> blib\libdoc\Bio.LiveSeq.IO.Loader.3 Manifying blib\lib/Bio/Search/Hit/HmmpfamHit.pm -> blib\libdoc\Bio.Search.Hit.HmmpfamHit.3 Manifying blib\lib/Bio/Tools/Primer/Assessor/Base.pm -> blib\libdoc\Bio.Tools.Primer.Assessor.Base.3 Manifying blib\lib/Bio/Ontology/Term.pm -> blib\libdoc\Bio.Ontology.Term.3 Manifying blib\lib/Bio/LiveSeq/Translation.pm -> blib\libdoc\Bio.LiveSeq.Translation.3 Manifying blib\lib/Bio/SeqFeature/Gene/NC_Feature.pm -> blib\libdoc\Bio.SeqFeature.Gene.NC_Feature.3 Manifying blib\lib/Bio/Tree/TreeI.pm -> blib\libdoc\Bio.Tree.TreeI.3 Manifying blib\lib/Bio/Tools/Phylo/Gerp.pm -> blib\libdoc\Bio.Tools.Phylo.Gerp.3 Manifying blib\lib/Bio/Tools/EUtilities/Info/FieldInfo.pm -> blib\libdoc\Bio.Tools.EUtilities.Info.FieldInfo.3 Manifying blib\lib/Bio/Tools/EUtilities/History.pm -> blib\libdoc\Bio.Tools.EUtilities.History.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_sanger22pseudo.3 Manifying blib\lib/Bio/Seq.pm -> blib\libdoc\Bio.Seq.3 Manifying blib\lib/Bio/TreeIO/lintree.pm -> blib\libdoc\Bio.TreeIO.lintree.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/biofetch.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.biofetch.3 Manifying blib\lib/Bio/Ontology/InterProTerm.pm -> blib\libdoc\Bio.Ontology.InterProTerm.3 Manifying blib\lib/Bio/Tools/EUtilities/Info/LinkInfo.pm -> blib\libdoc\Bio.Tools.EUtilities.Info.LinkInfo.3 Manifying blib\lib/Bio/Biblio/Service.pm -> blib\libdoc\Bio.Biblio.Service.3 Manifying blib\lib/Bio/SeqIO/ztr.pm -> blib\libdoc\Bio.SeqIO.ztr.3 Manifying blib\lib/Bio/Tools/Gel.pm -> blib\libdoc\Bio.Tools.Gel.3 Manifying blib\lib/Bio/Search/Result/BlastResult.pm -> blib\libdoc\Bio.Search.Result.BlastResult.3 Manifying blib\lib/Bio/Annotation/Collection.pm -> blib\libdoc\Bio.Annotation.Collection.3 Manifying blib\lib/Bio/Biblio/IO/medline2ref.pm -> blib\libdoc\Bio.Biblio.IO.medline2ref.3 Manifying blib\lib/Bio/Search/BlastUtils.pm -> blib\libdoc\Bio.Search.BlastUtils.3 Manifying blib\lib/Bio/Restriction/Enzyme/MultiSite.pm -> blib\libdoc\Bio.Restriction.Enzyme.MultiSite.3 Manifying blib\lib/Bio/Assembly/IO/phrap.pm -> blib\libdoc\Bio.Assembly.IO.phrap.3 Manifying blib\lib/Bio/Search/HSP/PsiBlastHSP.pm -> blib\libdoc\Bio.Search.HSP.PsiBlastHSP.3 Manifying blib\lib/Bio/Assembly/ScaffoldI.pm -> blib\libdoc\Bio.Assembly.ScaffoldI.3 Manifying blib\lib/Bio/SeqIO/chaosxml.pm -> blib\libdoc\Bio.SeqIO.chaosxml.3 Manifying blib\lib/Bio/Biblio/IO.pm -> blib\libdoc\Bio.Biblio.IO.3 Manifying blib\lib/Bio/SeqIO/seqxml.pm -> blib\libdoc\Bio.SeqIO.seqxml.3 Manifying blib\lib/Bio/SearchIO/Writer/BSMLResultWriter.pm -> blib\libdoc\Bio.SearchIO.Writer.BSMLResultWriter.3 Manifying blib\lib/Bio/AlignIO/largemultifasta.pm -> blib\libdoc\Bio.AlignIO.largemultifasta.3 Manifying blib\lib/Bio/Biblio/IO/medlinexml.pm -> blib\libdoc\Bio.Biblio.IO.medlinexml.3 Manifying blib\lib/Bio/PhyloNetwork/FactoryX.pm -> blib\libdoc\Bio.PhyloNetwork.FactoryX.3 Manifying blib\lib/Bio/TreeIO/cluster.pm -> blib\libdoc\Bio.TreeIO.cluster.3 Manifying blib\lib/Bio/Root/Test.pm -> blib\libdoc\Bio.Root.Test.3 Manifying blib\lib/Bio/DB/EUtilities.pm -> blib\libdoc\Bio.DB.EUtilities.3 Manifying blib\lib/Bio/SearchIO/cross_match.pm -> blib\libdoc\Bio.SearchIO.cross_match.3 Manifying blib\lib/Bio/SeqIO/abi.pm -> blib\libdoc\Bio.SeqIO.abi.3 Manifying blib\lib/Bio/DB/Flat/BDB.pm -> blib\libdoc\Bio.DB.Flat.BDB.3 Manifying blib\lib/Bio/Map/TranscriptionFactor.pm -> blib\libdoc\Bio.Map.TranscriptionFactor.3 Manifying blib\lib/Bio/DB/Expression/geo.pm -> blib\libdoc\Bio.DB.Expression.geo.3 Manifying blib\lib/Bio/Matrix/IO.pm -> blib\libdoc\Bio.Matrix.IO.3 Manifying blib\lib/Bio/Matrix/PSM/IO.pm -> blib\libdoc\Bio.Matrix.PSM.IO.3 Manifying blib\lib/Bio/DB/Query/WebQuery.pm -> blib\libdoc\Bio.DB.Query.WebQuery.3 Manifying blib\lib/Bio/Variation/VariantI.pm -> blib\libdoc\Bio.Variation.VariantI.3 Manifying blib\lib/Bio/Tools/IUPAC.pm -> blib\libdoc\Bio.Tools.IUPAC.3 Manifying blib\lib/Bio/Root/Build.pm -> blib\libdoc\Bio.Root.Build.3 Manifying blib\lib/Bio/PopGen/Statistics.pm -> blib\libdoc\Bio.PopGen.Statistics.3 Manifying blib\lib/Bio/OntologyIO/InterProParser.pm -> blib\libdoc\Bio.OntologyIO.InterProParser.3 Manifying blib\lib/Bio/DB/BiblioI.pm -> blib\libdoc\Bio.DB.BiblioI.3 Manifying blib\lib/Bio/Symbol/AlphabetI.pm -> blib\libdoc\Bio.Symbol.AlphabetI.3 Manifying blib\lib/Bio/Species.pm -> blib\libdoc\Bio.Species.3 Manifying blib\lib/Bio/Tree/Tree.pm -> blib\libdoc\Bio.Tree.Tree.3 Manifying blib\lib/Bio/Search/Result/CrossMatchResult.pm -> blib\libdoc\Bio.Search.Result.CrossMatchResult.3 Manifying blib\lib/Bio/DB/NCBIHelper.pm -> blib\libdoc\Bio.DB.NCBIHelper.3 Manifying blib\lib/Bio/Tools/Phylo/Gumby.pm -> blib\libdoc\Bio.Tools.Phylo.Gumby.3 Manifying blib\lib/Bio/DB/GFF/Util/Rearrange.pm -> blib\libdoc\Bio.DB.GFF.Util.Rearrange.3 Manifying blib\lib/Bio/Index/Hmmer.pm -> blib\libdoc\Bio.Index.Hmmer.3 Manifying blib\lib/Bio/SeqFeature/Tools/TypeMapper.pm -> blib\libdoc\Bio.SeqFeature.Tools.TypeMapper.3 Manifying blib\lib/Bio/DB/Biblio/soap.pm -> blib\libdoc\Bio.DB.Biblio.soap.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/Mitoprot.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.Mitoprot.3 Manifying blib\lib/Bio/DB/BioFetch.pm -> blib\libdoc\Bio.DB.BioFetch.3 Manifying blib\lib/Bio/AnalysisI.pm -> blib\libdoc\Bio.AnalysisI.3 Manifying blib\lib/Bio/SearchIO/blast_pull.pm -> blib\libdoc\Bio.SearchIO.blast_pull.3 Manifying blib\lib/Bio/Event/EventHandlerI.pm -> blib\libdoc\Bio.Event.EventHandlerI.3 Manifying blib\lib/Bio/SeqFeature/Gene/GeneStructure.pm -> blib\libdoc\Bio.SeqFeature.Gene.GeneStructure.3 Manifying blib\lib/Bio/Biblio/Thesis.pm -> blib\libdoc\Bio.Biblio.Thesis.3 Manifying blib\lib/Bio/Tools/Blat.pm -> blib\libdoc\Bio.Tools.Blat.3 Manifying blib\lib/Bio/SeqIO/bsml_sax.pm -> blib\libdoc\Bio.SeqIO.bsml_sax.3 Manifying blib\lib/Bio/Coordinate/Pair.pm -> blib\libdoc\Bio.Coordinate.Pair.3 Manifying blib\lib/Bio/SeqIO/kegg.pm -> blib\libdoc\Bio.SeqIO.kegg.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.FeatureFileLoader.3 Manifying blib\lib/Bio/AlignIO/pfam.pm -> blib\libdoc\Bio.AlignIO.pfam.3 Manifying blib\lib/Bio/Variation/RNAChange.pm -> blib\libdoc\Bio.Variation.RNAChange.3 Manifying blib\lib/Bio/SeqFeatureI.pm -> blib\libdoc\Bio.SeqFeatureI.3 Manifying blib\lib/Bio/DB/Flat/BDB/genbank.pm -> blib\libdoc\Bio.DB.Flat.BDB.genbank.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/clone.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.clone.3 Manifying blib\lib/Bio/SeqFeature/SimilarityPair.pm -> blib\libdoc\Bio.SeqFeature.SimilarityPair.3 Manifying blib\lib/Bio/Tools/ERPIN.pm -> blib\libdoc\Bio.Tools.ERPIN.3 Manifying blib\lib/Bio/SeqIO/scf.pm -> blib\libdoc\Bio.SeqIO.scf.3 Manifying blib\lib/Bio/Tools/Run/WrapperBase.pm -> blib\libdoc\Bio.Tools.Run.WrapperBase.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/Loader.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.Loader.3 Manifying blib\lib/Bio/Tools/Run/StandAloneWUBlast.pm -> blib\libdoc\Bio.Tools.Run.StandAloneWUBlast.3 Manifying blib\lib/Bio/Tools/Prediction/Gene.pm -> blib\libdoc\Bio.Tools.Prediction.Gene.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/Sopma.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.Sopma.3 Manifying blib\lib/Bio/Tools/Prints.pm -> blib\libdoc\Bio.Tools.Prints.3 Manifying blib\lib/Bio/Index/SwissPfam.pm -> blib\libdoc\Bio.Index.SwissPfam.3 Manifying blib\lib/Bio/Tools/Alignment/Trim.pm -> blib\libdoc\Bio.Tools.Alignment.Trim.3 Manifying blib\lib/Bio/SeqIO/tab.pm -> blib\libdoc\Bio.SeqIO.tab.3 Manifying blib\lib/Bio/Coordinate/Utils.pm -> blib\libdoc\Bio.Coordinate.Utils.3 Manifying blib\lib/Bio/DB/HIV.pm -> blib\libdoc\Bio.DB.HIV.3 Manifying blib\lib/Bio/Root/Test/Warn.pm -> blib\libdoc\Bio.Root.Test.Warn.3 Manifying blib\lib/Bio/FeatureIO/interpro.pm -> blib\libdoc\Bio.FeatureIO.interpro.3 Manifying blib\lib/Bio/Tools/Promoterwise.pm -> blib\libdoc\Bio.Tools.Promoterwise.3 Manifying blib\lib/Bio/Root/Utilities.pm -> blib\libdoc\Bio.Root.Utilities.3 Manifying blib\lib/Bio/DB/SeqVersion/gi.pm -> blib\libdoc\Bio.DB.SeqVersion.gi.3 Manifying blib\lib/Bio/Matrix/PSM/PsmHeaderI.pm -> blib\libdoc\Bio.Matrix.PSM.PsmHeaderI.3 Manifying blib\lib/Bio/Map/MarkerI.pm -> blib\libdoc\Bio.Map.MarkerI.3 Manifying blib\lib/Bio/SeqIO/raw.pm -> blib\libdoc\Bio.SeqIO.raw.3 Manifying blib\lib/Bio/Perl.pm -> blib\libdoc\Bio.Perl.3 Manifying blib\lib/Bio/Tools/Infernal.pm -> blib\libdoc\Bio.Tools.Infernal.3 Manifying blib\lib/Bio/PopGen/TagHaplotype.pm -> blib\libdoc\Bio.PopGen.TagHaplotype.3 Manifying blib\lib/Bio/PopGen/Simulation/GeneticDrift.pm -> blib\libdoc\Bio.PopGen.Simulation.GeneticDrift.3 Manifying blib\lib/Bio/Factory/ObjectFactoryI.pm -> blib\libdoc\Bio.Factory.ObjectFactoryI.3 Manifying blib\lib/Bio/Search/Hit/HitI.pm -> blib\libdoc\Bio.Search.Hit.HitI.3 Manifying blib\lib/Bio/SeqIO/game.pm -> blib\libdoc\Bio.SeqIO.game.3 Manifying blib\lib/Bio/SearchIO/axt.pm -> blib\libdoc\Bio.SearchIO.axt.3 Manifying blib\lib/Bio/AnalysisParserI.pm -> blib\libdoc\Bio.AnalysisParserI.3 Manifying blib\lib/Bio/Phenotype/MeSH/Term.pm -> blib\libdoc\Bio.Phenotype.MeSH.Term.3 Manifying blib\lib/Bio/AlignIO/po.pm -> blib\libdoc\Bio.AlignIO.po.3 Manifying blib\lib/Bio/DB/RandomAccessI.pm -> blib\libdoc\Bio.DB.RandomAccessI.3 Manifying blib\lib/Bio/Biblio/BookArticle.pm -> blib\libdoc\Bio.Biblio.BookArticle.3 Manifying blib\lib/Bio/SearchIO/sim4.pm -> blib\libdoc\Bio.SearchIO.sim4.3 Manifying blib\lib/Bio/Search/StatisticsI.pm -> blib\libdoc\Bio.Search.StatisticsI.3 Manifying blib\lib/Bio/Factory/SeqAnalysisParserFactoryI.pm -> blib\libdoc\Bio.Factory.SeqAnalysisParserFactoryI.3 Manifying blib\lib/Bio/PopGen/IO/hapmap.pm -> blib\libdoc\Bio.PopGen.IO.hapmap.3 Manifying blib\lib/Bio/LiveSeq/Range.pm -> blib\libdoc\Bio.LiveSeq.Range.3 Manifying blib\lib/Bio/Variation/AAReverseMutate.pm -> blib\libdoc\Bio.Variation.AAReverseMutate.3 Manifying blib\lib/Bio/Tools/EUtilities/Info.pm -> blib\libdoc\Bio.Tools.EUtilities.Info.3 Manifying blib\lib/Bio/Biblio/Ref.pm -> blib\libdoc\Bio.Biblio.Ref.3 Manifying blib\lib/Bio/SeqIO/nexml.pm -> blib\libdoc\Bio.SeqIO.nexml.3 Manifying blib\lib/Bio/Root/HTTPget.pm -> blib\libdoc\Bio.Root.HTTPget.3 Manifying blib\lib/Bio/Phenotype/Phenotype.pm -> blib\libdoc\Bio.Phenotype.Phenotype.3 Manifying blib\lib/Bio/Annotation/DBLink.pm -> blib\libdoc\Bio.Annotation.DBLink.3 Manifying blib\lib/Bio/FeatureIO.pm -> blib\libdoc\Bio.FeatureIO.3 Manifying blib\lib/Bio/DB/Expression.pm -> blib\libdoc\Bio.DB.Expression.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/oracleace.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.oracleace.3 Manifying blib\lib/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm -> blib\libdoc\Bio.OntologyIO.Handlers.InterPro_BioSQL_Handler.3 Manifying blib\lib/Bio/Tools/EUtilities/HistoryI.pm -> blib\libdoc\Bio.Tools.EUtilities.HistoryI.3 Manifying blib\lib/Bio/Index/Stockholm.pm -> blib\libdoc\Bio.Index.Stockholm.3 Manifying blib\lib/Bio/Tools/Run/RemoteBlast.pm -> blib\libdoc\Bio.Tools.Run.RemoteBlast.3 Manifying blib\lib/Bio/Search/Result/HMMERResult.pm -> blib\libdoc\Bio.Search.Result.HMMERResult.3 Manifying blib\lib/Bio/Search/HSP/PullHSPI.pm -> blib\libdoc\Bio.Search.HSP.PullHSPI.3 Manifying blib\lib/Bio/Root/Version.pm -> blib\libdoc\Bio.Root.Version.3 Manifying blib\lib/Bio/PullParserI.pm -> blib\libdoc\Bio.PullParserI.3 Manifying blib\lib/Bio/Map/FPCMarker.pm -> blib\libdoc\Bio.Map.FPCMarker.3 Manifying blib\lib/Bio/DB/RefSeq.pm -> blib\libdoc\Bio.DB.RefSeq.3 Manifying blib\lib/Bio/DB/Taxonomy.pm -> blib\libdoc\Bio.DB.Taxonomy.3 Manifying blib\lib/Bio/SeqIO/game/gameWriter.pm -> blib\libdoc\Bio.SeqIO.game.gameWriter.3 Manifying blib\lib/Bio/Tools/pSW.pm -> blib\libdoc\Bio.Tools.pSW.3 Manifying blib\lib/Bio/Tools/RNAMotif.pm -> blib\libdoc\Bio.Tools.RNAMotif.3 Manifying blib\lib/Bio/SeqIO/game/featHandler.pm -> blib\libdoc\Bio.SeqIO.game.featHandler.3 Manifying blib\lib/Bio/Factory/TreeFactoryI.pm -> blib\libdoc\Bio.Factory.TreeFactoryI.3 Manifying blib\lib/Bio/Tools/RepeatMasker.pm -> blib\libdoc\Bio.Tools.RepeatMasker.3 Manifying blib\lib/Bio/SearchIO/hmmer2.pm -> blib\libdoc\Bio.SearchIO.hmmer2.3 Manifying blib\lib/Bio/Map/Prediction.pm -> blib\libdoc\Bio.Map.Prediction.3 Manifying blib\lib/Bio/AlignIO/psi.pm -> blib\libdoc\Bio.AlignIO.psi.3 Manifying blib\lib/Bio/Biblio/JournalArticle.pm -> blib\libdoc\Bio.Biblio.JournalArticle.3 Manifying blib\lib/Bio/OntologyIO/soflat.pm -> blib\libdoc\Bio.OntologyIO.soflat.3 Manifying blib\lib/Bio/Ontology/TermI.pm -> blib\libdoc\Bio.Ontology.TermI.3 Manifying blib\lib/Bio/Search/GenericDatabase.pm -> blib\libdoc\Bio.Search.GenericDatabase.3 Manifying blib\lib/Bio/PhyloNetwork.pm -> blib\libdoc\Bio.PhyloNetwork.3 Manifying blib\lib/Bio/Map/RelativeI.pm -> blib\libdoc\Bio.Map.RelativeI.3 Manifying blib\lib/Bio/PhyloNetwork/TreeFactory.pm -> blib\libdoc\Bio.PhyloNetwork.TreeFactory.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.berkeleydb.iterator.3 Manifying blib\lib/Bio/Variation/SeqDiff.pm -> blib\libdoc\Bio.Variation.SeqDiff.3 Manifying blib\lib/Bio/Biblio/PubmedArticle.pm -> blib\libdoc\Bio.Biblio.PubmedArticle.3 Manifying blib\lib/Bio/TreeIO/svggraph.pm -> blib\libdoc\Bio.TreeIO.svggraph.3 Manifying blib\lib/Bio/DB/GFF/Util/Binning.pm -> blib\libdoc\Bio.DB.GFF.Util.Binning.3 Manifying blib\lib/Bio/Tools/Phylo/PAML.pm -> blib\libdoc\Bio.Tools.Phylo.PAML.3 Manifying blib\lib/Bio/Tools/CodonTable.pm -> blib\libdoc\Bio.Tools.CodonTable.3 Manifying blib\lib/Bio/Tools/EUtilities/Summary/DocSum.pm -> blib\libdoc\Bio.Tools.EUtilities.Summary.DocSum.3 Manifying blib\lib/Bio/SeqIO/alf.pm -> blib\libdoc\Bio.SeqIO.alf.3 Manifying blib\lib/Bio/Coordinate/Graph.pm -> blib\libdoc\Bio.Coordinate.Graph.3 Manifying blib\lib/Bio/AnalysisResultI.pm -> blib\libdoc\Bio.AnalysisResultI.3 Manifying blib\lib/Bio/Seq/TraceI.pm -> blib\libdoc\Bio.Seq.TraceI.3 Manifying blib\lib/Bio/SearchIO/gmap_f9.pm -> blib\libdoc\Bio.SearchIO.gmap_f9.3 Manifying blib\lib/Bio/Search/Hit/GenericHit.pm -> blib\libdoc\Bio.Search.Hit.GenericHit.3 Manifying blib\lib/Bio/Tools/EPCR.pm -> blib\libdoc\Bio.Tools.EPCR.3 Manifying blib\lib/Bio/DB/FileCache.pm -> blib\libdoc\Bio.DB.FileCache.3 Manifying blib\lib/Bio/DB/Taxonomy/entrez.pm -> blib\libdoc\Bio.DB.Taxonomy.entrez.3 Manifying blib\lib/Bio/Biblio/IO/pubmedxml.pm -> blib\libdoc\Bio.Biblio.IO.pubmedxml.3 Manifying blib\lib/Bio/Factory/LocationFactoryI.pm -> blib\libdoc\Bio.Factory.LocationFactoryI.3 Manifying blib\lib/Bio/Taxonomy/Taxon.pm -> blib\libdoc\Bio.Taxonomy.Taxon.3 Manifying blib\lib/Bio/DB/GFF.pm -> blib\libdoc\Bio.DB.GFF.3 Manifying blib\lib/Bio/SeqIO/excel.pm -> blib\libdoc\Bio.SeqIO.excel.3 Manifying blib\lib/Bio/Taxon.pm -> blib\libdoc\Bio.Taxon.3 Manifying blib\lib/Bio/SeqIO/chadoxml.pm -> blib\libdoc\Bio.SeqIO.chadoxml.3 Manifying blib\lib/Bio/Align/StatisticsI.pm -> blib\libdoc\Bio.Align.StatisticsI.3 Manifying blib\lib/Bio/SeqIO/genbank.pm -> blib\libdoc\Bio.SeqIO.genbank.3 Manifying blib\lib/Bio/Structure/IO.pm -> blib\libdoc\Bio.Structure.IO.3 Manifying blib\lib/Bio/Restriction/Enzyme/MultiCut.pm -> blib\libdoc\Bio.Restriction.Enzyme.MultiCut.3 Manifying blib\lib/Bio/AnnotationCollectionI.pm -> blib\libdoc\Bio.AnnotationCollectionI.3 Manifying blib\lib/Bio/Root/Storable.pm -> blib\libdoc\Bio.Root.Storable.3 Manifying blib\lib/Bio/DB/TFBS.pm -> blib\libdoc\Bio.DB.TFBS.3 Manifying blib\lib/Bio/DB/GFF/Aggregator.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.3 Manifying blib\lib/Bio/Structure/Entry.pm -> blib\libdoc\Bio.Structure.Entry.3 Manifying blib\lib/Bio/DB/Registry.pm -> blib\libdoc\Bio.DB.Registry.3 Manifying blib\lib/Bio/LiveSeq/Repeat_Unit.pm -> blib\libdoc\Bio.LiveSeq.Repeat_Unit.3 Manifying blib\lib/Bio/Biblio/BiblioBase.pm -> blib\libdoc\Bio.Biblio.BiblioBase.3 Manifying blib\lib/Bio/Tree/RandomFactory.pm -> blib\libdoc\Bio.Tree.RandomFactory.3 Manifying blib\lib/Bio/Tools/EUtilities/Query.pm -> blib\libdoc\Bio.Tools.EUtilities.Query.3 Manifying blib\lib/Bio/Search/HSP/WABAHSP.pm -> blib\libdoc\Bio.Search.HSP.WABAHSP.3 Manifying blib\lib/Bio/Factory/SequenceFactoryI.pm -> blib\libdoc\Bio.Factory.SequenceFactoryI.3 Manifying blib\lib/Bio/DB/UpdateableSeqI.pm -> blib\libdoc\Bio.DB.UpdateableSeqI.3 Manifying blib\lib/Bio/Seq/Meta.pm -> blib\libdoc\Bio.Seq.Meta.3 Manifying blib\lib/Bio/SeqFeature/SiRNA/Pair.pm -> blib\libdoc\Bio.SeqFeature.SiRNA.Pair.3 Manifying blib\lib/Bio/Tools/Phylo/Molphy.pm -> blib\libdoc\Bio.Tools.Phylo.Molphy.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_unigene.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_unigene.3 Manifying blib\lib/Bio/Map/GenePosition.pm -> blib\libdoc\Bio.Map.GenePosition.3 Manifying blib\lib/Bio/Restriction/Analysis.pm -> blib\libdoc\Bio.Restriction.Analysis.3 Manifying blib\lib/Bio/Search/HSP/GenericHSP.pm -> blib\libdoc\Bio.Search.HSP.GenericHSP.3 Manifying blib\lib/Bio/Coordinate/GeneMapper.pm -> blib\libdoc\Bio.Coordinate.GeneMapper.3 Manifying blib\lib/Bio/Ontology/PathI.pm -> blib\libdoc\Bio.Ontology.PathI.3 Manifying blib\lib/Bio/Search/Hit/ModelHit.pm -> blib\libdoc\Bio.Search.Hit.ModelHit.3 Manifying blib\lib/Bio/Search/Result/hmmer3Result.pm -> blib\libdoc\Bio.Search.Result.hmmer3Result.3 Manifying blib\lib/Bio/PhyloNetwork/TreeFactoryMulti.pm -> blib\libdoc\Bio.PhyloNetwork.TreeFactoryMulti.3 Manifying blib\lib/Bio/Tools/AnalysisResult.pm -> blib\libdoc\Bio.Tools.AnalysisResult.3 Manifying blib\lib/Bio/SearchIO/XML/PsiBlastHandler.pm -> blib\libdoc\Bio.SearchIO.XML.PsiBlastHandler.3 Manifying blib\lib/Bio/Nexml/Factory.pm -> blib\libdoc\Bio.Nexml.Factory.3 Manifying blib\lib/Bio/LiveSeq/SeqI.pm -> blib\libdoc\Bio.LiveSeq.SeqI.3 Manifying blib\lib/Bio/Factory/FTLocationFactory.pm -> blib\libdoc\Bio.Factory.FTLocationFactory.3 Manifying blib\lib/Bio/Index/Fastq.pm -> blib\libdoc\Bio.Index.Fastq.3 Manifying blib\lib/Bio/Matrix/IO/phylip.pm -> blib\libdoc\Bio.Matrix.IO.phylip.3 Manifying blib\lib/Bio/DB/GenPept.pm -> blib\libdoc\Bio.DB.GenPept.3 Manifying blib\lib/Bio/Tools/SiRNA.pm -> blib\libdoc\Bio.Tools.SiRNA.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/berkeleydb3.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.berkeleydb3.3 Manifying blib\lib/Bio/Matrix/PSM/ProtMatrix.pm -> blib\libdoc\Bio.Matrix.PSM.ProtMatrix.3 Manifying blib\lib/Bio/Ontology/OntologyStore.pm -> blib\libdoc\Bio.Ontology.OntologyStore.3 Manifying blib\lib/Bio/Tools/AlignFactory.pm -> blib\libdoc\Bio.Tools.AlignFactory.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_twinscan.3 Manifying blib\lib/Bio/Align/PairwiseStatistics.pm -> blib\libdoc\Bio.Align.PairwiseStatistics.3 Manifying blib\lib/Bio/DB/Ace.pm -> blib\libdoc\Bio.DB.Ace.3 Manifying blib\lib/Bio/Seq/LargeLocatableSeq.pm -> blib\libdoc\Bio.Seq.LargeLocatableSeq.3 Manifying blib\lib/Bio/Assembly/ContigAnalysis.pm -> blib\libdoc\Bio.Assembly.ContigAnalysis.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_acembly.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_acembly.3 Manifying blib\lib/Bio/SeqIO/gbxml.pm -> blib\libdoc\Bio.SeqIO.gbxml.3 Manifying blib\lib/Bio/SeqIO/agave.pm -> blib\libdoc\Bio.SeqIO.agave.3 Manifying blib\lib/Bio/SeqFeature/Annotated.pm -> blib\libdoc\Bio.SeqFeature.Annotated.3 Manifying blib\lib/Bio/Index/Swissprot.pm -> blib\libdoc\Bio.Index.Swissprot.3 Manifying blib\lib/Bio/MapIO/mapmaker.pm -> blib\libdoc\Bio.MapIO.mapmaker.3 Manifying blib\lib/Bio/SearchIO/Writer/TextResultWriter.pm -> blib\libdoc\Bio.SearchIO.Writer.TextResultWriter.3 Manifying blib\lib/Bio/SeqFeature/CollectionI.pm -> blib\libdoc\Bio.SeqFeature.CollectionI.3 Manifying blib\lib/Bio/SearchIO/Writer/HitTableWriter.pm -> blib\libdoc\Bio.SearchIO.Writer.HitTableWriter.3 Manifying blib\lib/Bio/SearchIO/megablast.pm -> blib\libdoc\Bio.SearchIO.megablast.3 Manifying blib\lib/Bio/Assembly/Tools/ContigSpectrum.pm -> blib\libdoc\Bio.Assembly.Tools.ContigSpectrum.3 Manifying blib\lib/Bio/Matrix/PSM/IO/masta.pm -> blib\libdoc\Bio.Matrix.PSM.IO.masta.3 Manifying blib\lib/Bio/Cluster/SequenceFamily.pm -> blib\libdoc\Bio.Cluster.SequenceFamily.3 Manifying blib\lib/Bio/Factory/DriverFactory.pm -> blib\libdoc\Bio.Factory.DriverFactory.3 Manifying blib\lib/Bio/SeqIO/asciitree.pm -> blib\libdoc\Bio.SeqIO.asciitree.3 Manifying blib\lib/Bio/Search/Tiling/TilingI.pm -> blib\libdoc\Bio.Search.Tiling.TilingI.3 Manifying blib\lib/Bio/LiveSeq/Repeat_Region.pm -> blib\libdoc\Bio.LiveSeq.Repeat_Region.3 Manifying blib\lib/Bio/UpdateableSeqI.pm -> blib\libdoc\Bio.UpdateableSeqI.3 Manifying blib\lib/Bio/PhyloNetwork/Factory.pm -> blib\libdoc\Bio.PhyloNetwork.Factory.3 Manifying blib\lib/Bio/Factory/SequenceStreamI.pm -> blib\libdoc\Bio.Factory.SequenceStreamI.3 Manifying blib\lib/Bio/Variation/DNAMutation.pm -> blib\libdoc\Bio.Variation.DNAMutation.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/NetPhos.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.NetPhos.3 Manifying blib\lib/Bio/Tools/Spidey/Exon.pm -> blib\libdoc\Bio.Tools.Spidey.Exon.3 Manifying blib\lib/Bio/Assembly/IO/bowtie.pm -> blib\libdoc\Bio.Assembly.IO.bowtie.3 Manifying blib\lib/Bio/AlignIO/Handler/GenericAlignHandler.pm -> blib\libdoc\Bio.AlignIO.Handler.GenericAlignHandler.3 Manifying blib\lib/Bio/Taxonomy/FactoryI.pm -> blib\libdoc\Bio.Taxonomy.FactoryI.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/processed_transcript.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.processed_transcript.3 Manifying blib\lib/Bio/OntologyIO.pm -> blib\libdoc\Bio.OntologyIO.3 Manifying blib\lib/Bio/DB/Fasta.pm -> blib\libdoc\Bio.DB.Fasta.3 Manifying blib\lib/Bio/SeqFeature/Similarity.pm -> blib\libdoc\Bio.SeqFeature.Similarity.3 Manifying blib\lib/Bio/Coordinate/MapperI.pm -> blib\libdoc\Bio.Coordinate.MapperI.3 Manifying blib\lib/Bio/Biblio/Patent.pm -> blib\libdoc\Bio.Biblio.Patent.3 Manifying blib\lib/Bio/Tools/Geneid.pm -> blib\libdoc\Bio.Tools.Geneid.3 Manifying blib\lib/Bio/Cluster/ClusterFactory.pm -> blib\libdoc\Bio.Cluster.ClusterFactory.3 Manifying blib\lib/Bio/Matrix/MatrixI.pm -> blib\libdoc\Bio.Matrix.MatrixI.3 Manifying blib\lib/Bio/Ontology/SimpleOntologyEngine.pm -> blib\libdoc\Bio.Ontology.SimpleOntologyEngine.3 Manifying blib\lib/Bio/Matrix/Mlagan.pm -> blib\libdoc\Bio.Matrix.Mlagan.3 Manifying blib\lib/Bio/Restriction/IO.pm -> blib\libdoc\Bio.Restriction.IO.3 Manifying blib\lib/Bio/Coordinate/Collection.pm -> blib\libdoc\Bio.Coordinate.Collection.3 Manifying blib\lib/Bio/Matrix/PSM/SiteMatrixI.pm -> blib\libdoc\Bio.Matrix.PSM.SiteMatrixI.3 Manifying blib\lib/Bio/Search/Processor.pm -> blib\libdoc\Bio.Search.Processor.3 Manifying blib\lib/Bio/Map/Contig.pm -> blib\libdoc\Bio.Map.Contig.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/berkeleydb.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.berkeleydb.3 Manifying blib\lib/Bio/Ontology/Relationship.pm -> blib\libdoc\Bio.Ontology.Relationship.3 Manifying blib\lib/Bio/SeqIO/ctf.pm -> blib\libdoc\Bio.SeqIO.ctf.3 Manifying blib\lib/Bio/Ontology/OBOEngine.pm -> blib\libdoc\Bio.Ontology.OBOEngine.3 Manifying blib\lib/Bio/Assembly/Scaffold.pm -> blib\libdoc\Bio.Assembly.Scaffold.3 Manifying blib\lib/Bio/AlignIO/clustalw.pm -> blib\libdoc\Bio.AlignIO.clustalw.3 Manifying blib\lib/Bio/Map/Gene.pm -> blib\libdoc\Bio.Map.Gene.3 Manifying blib\lib/Bio/Search/Hit/BlastHit.pm -> blib\libdoc\Bio.Search.Hit.BlastHit.3 Manifying blib\lib/Bio/DB/QueryI.pm -> blib\libdoc\Bio.DB.QueryI.3 Manifying blib\lib/Bio/Symbol/ProteinAlphabet.pm -> blib\libdoc\Bio.Symbol.ProteinAlphabet.3 Manifying blib\lib/Bio/Biblio/MedlineBookArticle.pm -> blib\libdoc\Bio.Biblio.MedlineBookArticle.3 Manifying blib\lib/Bio/AlignIO/nexml.pm -> blib\libdoc\Bio.AlignIO.nexml.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/DBI/SQLite.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.DBI.SQLite.3 Manifying blib\lib/Bio/AnnotatableI.pm -> blib\libdoc\Bio.AnnotatableI.3 Manifying blib\lib/Bio/SearchIO/EventHandlerI.pm -> blib\libdoc\Bio.SearchIO.EventHandlerI.3 Manifying blib\lib/Bio/Tools/Hmmpfam.pm -> blib\libdoc\Bio.Tools.Hmmpfam.3 Manifying blib\lib/Bio/Map/Physical.pm -> blib\libdoc\Bio.Map.Physical.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/orf.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.orf.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_genscan.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_genscan.3 Manifying blib\lib/Bio/Index/Qual.pm -> blib\libdoc\Bio.Index.Qual.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/LoadHelper.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.LoadHelper.3 Manifying blib\lib/Bio/SeqIO/entrezgene.pm -> blib\libdoc\Bio.SeqIO.entrezgene.3 Manifying blib\lib/Bio/Tools/PrositeScan.pm -> blib\libdoc\Bio.Tools.PrositeScan.3 Manifying blib\lib/Bio/Map/LinkageMap.pm -> blib\libdoc\Bio.Map.LinkageMap.3 Manifying blib\lib/Bio/Ontology/RelationshipType.pm -> blib\libdoc\Bio.Ontology.RelationshipType.3 Manifying blib\lib/Bio/FeatureHolderI.pm -> blib\libdoc\Bio.FeatureHolderI.3 Manifying blib\lib/Bio/SeqIO/game/gameSubs.pm -> blib\libdoc\Bio.SeqIO.game.gameSubs.3 Manifying blib\lib/Bio/PhyloNetwork/muVector.pm -> blib\libdoc\Bio.PhyloNetwork.muVector.3 Manifying blib\lib/Bio/AlignIO/mase.pm -> blib\libdoc\Bio.AlignIO.mase.3 Manifying blib\lib/Bio/DB/DBFetch.pm -> blib\libdoc\Bio.DB.DBFetch.3 Manifying blib\lib/Bio/Tools/Signalp/ExtendedSignalp.pm -> blib\libdoc\Bio.Tools.Signalp.ExtendedSignalp.3 Manifying blib\lib/Bio/Biblio/PubmedBookArticle.pm -> blib\libdoc\Bio.Biblio.PubmedBookArticle.3 Manifying blib\lib/Bio/Restriction/IO/prototype.pm -> blib\libdoc\Bio.Restriction.IO.prototype.3 Manifying blib\lib/Bio/Tools/EMBOSS/Palindrome.pm -> blib\libdoc\Bio.Tools.EMBOSS.Palindrome.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/ucsc_refgene.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.ucsc_refgene.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/Domcut.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.Domcut.3 Manifying blib\lib/Bio/DB/Taxonomy/list.pm -> blib\libdoc\Bio.DB.Taxonomy.list.3 Manifying blib\lib/Bio/Tree/AlleleNode.pm -> blib\libdoc\Bio.Tree.AlleleNode.3 Manifying blib\lib/Bio/Search/HSP/FastaHSP.pm -> blib\libdoc\Bio.Search.HSP.FastaHSP.3 Manifying blib\lib/Bio/Index/BlastTable.pm -> blib\libdoc\Bio.Index.BlastTable.3 Manifying blib\lib/Bio/SeqFeature/Generic.pm -> blib\libdoc\Bio.SeqFeature.Generic.3 Manifying blib\lib/Bio/Map/CytoMarker.pm -> blib\libdoc\Bio.Map.CytoMarker.3 Manifying blib\lib/Bio/PopGen/Population.pm -> blib\libdoc\Bio.PopGen.Population.3 Manifying blib\lib/Bio/Annotation/AnnotationFactory.pm -> blib\libdoc\Bio.Annotation.AnnotationFactory.3 Manifying blib\lib/Bio/DB/SeqFeature/NormalizedFeature.pm -> blib\libdoc\Bio.DB.SeqFeature.NormalizedFeature.3 Manifying blib\lib/Bio/DB/Flat/BDB/fasta.pm -> blib\libdoc\Bio.DB.Flat.BDB.fasta.3 Manifying blib\lib/Bio/Map/Relative.pm -> blib\libdoc\Bio.Map.Relative.3 Manifying blib\lib/Bio/Search/Hit/BlastPullHit.pm -> blib\libdoc\Bio.Search.Hit.BlastPullHit.3 Manifying blib\lib/Bio/Tools/EUtilities/Link/UrlLink.pm -> blib\libdoc\Bio.Tools.EUtilities.Link.UrlLink.3 Manifying blib\lib/Bio/Tree/DistanceFactory.pm -> blib\libdoc\Bio.Tree.DistanceFactory.3 Manifying blib\lib/Bio/SeqIO/msout.pm -> blib\libdoc\Bio.SeqIO.msout.3 Manifying blib\lib/Bio/SeqIO/fastq.pm -> blib\libdoc\Bio.SeqIO.fastq.3 Manifying blib\lib/Bio/Tools/Genemark.pm -> blib\libdoc\Bio.Tools.Genemark.3 Manifying blib\lib/Bio/Ontology/OBOterm.pm -> blib\libdoc\Bio.Ontology.OBOterm.3 Manifying blib\lib/Bio/Tools/Sigcleave.pm -> blib\libdoc\Bio.Tools.Sigcleave.3 Manifying blib\lib/Bio/PrimarySeqI.pm -> blib\libdoc\Bio.PrimarySeqI.3 Manifying blib\lib/Bio/Location/FuzzyLocationI.pm -> blib\libdoc\Bio.Location.FuzzyLocationI.3 Manifying blib\lib/Bio/PopGen/PopulationI.pm -> blib\libdoc\Bio.PopGen.PopulationI.3 Manifying blib\lib/Bio/Tools/Sim4/Exon.pm -> blib\libdoc\Bio.Tools.Sim4.Exon.3 Manifying blib\lib/Bio/Matrix/IO/mlagan.pm -> blib\libdoc\Bio.Matrix.IO.mlagan.3 Manifying blib\lib/Bio/Coordinate/Result/Match.pm -> blib\libdoc\Bio.Coordinate.Result.Match.3 Manifying blib\lib/Bio/Annotation/SimpleValue.pm -> blib\libdoc\Bio.Annotation.SimpleValue.3 Manifying blib\lib/Bio/DB/Biblio/biofetch.pm -> blib\libdoc\Bio.DB.Biblio.biofetch.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/Scansite.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.Scansite.3 Manifying blib\lib/Bio/Biblio/Article.pm -> blib\libdoc\Bio.Biblio.Article.3 Manifying blib\lib/Bio/Search/GenericStatistics.pm -> blib\libdoc\Bio.Search.GenericStatistics.3 Manifying blib\lib/Bio/SearchIO/blast.pm -> blib\libdoc\Bio.SearchIO.blast.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.3 Manifying blib\lib/Bio/Tools/Phylo/Phylip/ProtDist.pm -> blib\libdoc\Bio.Tools.Phylo.Phylip.ProtDist.3 Manifying blib\lib/Bio/Structure/Atom.pm -> blib\libdoc\Bio.Structure.Atom.3 Manifying blib\lib/Bio/Root/Root.pm -> blib\libdoc\Bio.Root.Root.3 Manifying blib\lib/Bio/Symbol/SymbolI.pm -> blib\libdoc\Bio.Symbol.SymbolI.3 Manifying blib\lib/Bio/RangeI.pm -> blib\libdoc\Bio.RangeI.3 Manifying blib\lib/Bio/Ontology/RelationshipFactory.pm -> blib\libdoc\Bio.Ontology.RelationshipFactory.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/alignment.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.alignment.3 Manifying blib\lib/Bio/Draw/Pictogram.pm -> blib\libdoc\Bio.Draw.Pictogram.3 Manifying blib\lib/Bio/Factory/ObjectFactory.pm -> blib\libdoc\Bio.Factory.ObjectFactory.3 Manifying blib\lib/Bio/Search/Iteration/IterationI.pm -> blib\libdoc\Bio.Search.Iteration.IterationI.3 Manifying blib\lib/Bio/LiveSeq/Transcript.pm -> blib\libdoc\Bio.LiveSeq.Transcript.3 Manifying blib\lib/Bio/Search/DatabaseI.pm -> blib\libdoc\Bio.Search.DatabaseI.3 Manifying blib\lib/Bio/SearchIO/exonerate.pm -> blib\libdoc\Bio.SearchIO.exonerate.3 Manifying blib\lib/Bio/Tools/Run/StandAloneNCBIBlast.pm -> blib\libdoc\Bio.Tools.Run.StandAloneNCBIBlast.3 Manifying blib\lib/Bio/Taxonomy/Node.pm -> blib\libdoc\Bio.Taxonomy.Node.3 Manifying blib\lib/Bio/MapIO.pm -> blib\libdoc\Bio.MapIO.3 Manifying blib\lib/Bio/Tools/QRNA.pm -> blib\libdoc\Bio.Tools.QRNA.3 Manifying blib\lib/Bio/SearchIO/waba.pm -> blib\libdoc\Bio.SearchIO.waba.3 Manifying blib\lib/Bio/Search/SearchUtils.pm -> blib\libdoc\Bio.Search.SearchUtils.3 Manifying blib\lib/Bio/Biblio/IO/pubmed2ref.pm -> blib\libdoc\Bio.Biblio.IO.pubmed2ref.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/memory.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.memory.3 Manifying blib\lib/Bio/SeqIO/pln.pm -> blib\libdoc\Bio.SeqIO.pln.3 Manifying blib\lib/Bio/Annotation/Tree.pm -> blib\libdoc\Bio.Annotation.Tree.3 Manifying blib\lib/Bio/Tools/Primer/Pair.pm -> blib\libdoc\Bio.Tools.Primer.Pair.3 Manifying blib\lib/Bio/Tools/OddCodes.pm -> blib\libdoc\Bio.Tools.OddCodes.3 Manifying blib\lib/Bio/DB/GFF/Homol.pm -> blib\libdoc\Bio.DB.GFF.Homol.3 Manifying blib\lib/Bio/AlignIO/fasta.pm -> blib\libdoc\Bio.AlignIO.fasta.3 Manifying blib\lib/Bio/DB/Taxonomy/flatfile.pm -> blib\libdoc\Bio.DB.Taxonomy.flatfile.3 Manifying blib\lib/Bio/Map/OrderedPositionWithDistance.pm -> blib\libdoc\Bio.Map.OrderedPositionWithDistance.3 Manifying blib\lib/Bio/SeqFeature/Gene/UTR.pm -> blib\libdoc\Bio.SeqFeature.Gene.UTR.3 Manifying blib\lib/Bio/SeqFeature/Tools/Unflattener.pm -> blib\libdoc\Bio.SeqFeature.Tools.Unflattener.3 Manifying blib\lib/Bio/DB/SwissProt.pm -> blib\libdoc\Bio.DB.SwissProt.3 Manifying blib\lib/Bio/Index/AbstractSeq.pm -> blib\libdoc\Bio.Index.AbstractSeq.3 Manifying blib\lib/Bio/Matrix/PSM/PsmI.pm -> blib\libdoc\Bio.Matrix.PSM.PsmI.3 Manifying blib\lib/Bio/Variation/Allele.pm -> blib\libdoc\Bio.Variation.Allele.3 Manifying blib\lib/Bio/Tools/Seg.pm -> blib\libdoc\Bio.Tools.Seg.3 Manifying blib\lib/Bio/PopGen/Utilities.pm -> blib\libdoc\Bio.PopGen.Utilities.3 Manifying blib\lib/Bio/TreeIO/nhx.pm -> blib\libdoc\Bio.TreeIO.nhx.3 Manifying blib\lib/Bio/SearchIO/rnamotif.pm -> blib\libdoc\Bio.SearchIO.rnamotif.3 Manifying blib\lib/Bio/LiveSeq/Prim_Transcript.pm -> blib\libdoc\Bio.LiveSeq.Prim_Transcript.3 Manifying blib\lib/Bio/DB/CUTG.pm -> blib\libdoc\Bio.DB.CUTG.3 Manifying blib\lib/Bio/Coordinate/Result.pm -> blib\libdoc\Bio.Coordinate.Result.3 Manifying blib\lib/Bio/DB/ReferenceI.pm -> blib\libdoc\Bio.DB.ReferenceI.3 Manifying blib\lib/Bio/TreeIO/pag.pm -> blib\libdoc\Bio.TreeIO.pag.3 Manifying blib\lib/Bio/SeqFeature/FeaturePair.pm -> blib\libdoc\Bio.SeqFeature.FeaturePair.3 Manifying blib\lib/Bio/DB/GFF/RelSegment.pm -> blib\libdoc\Bio.DB.GFF.RelSegment.3 Manifying blib\lib/Bio/Location/NarrowestCoordPolicy.pm -> blib\libdoc\Bio.Location.NarrowestCoordPolicy.3 Manifying blib\lib/Bio/Biblio/Journal.pm -> blib\libdoc\Bio.Biblio.Journal.3 Manifying blib\lib/Bio/DB/SeqI.pm -> blib\libdoc\Bio.DB.SeqI.3 Manifying blib\lib/Bio/Root/IO.pm -> blib\libdoc\Bio.Root.IO.3 Manifying blib\lib/Bio/Tools/RandomDistFunctions.pm -> blib\libdoc\Bio.Tools.RandomDistFunctions.3 Manifying blib\lib/Bio/Biblio/Provider.pm -> blib\libdoc\Bio.Biblio.Provider.3 Manifying blib\lib/Bio/AlignIO/xmfa.pm -> blib\libdoc\Bio.AlignIO.xmfa.3 Manifying blib\lib/Bio/Search/HSP/HSPFactory.pm -> blib\libdoc\Bio.Search.HSP.HSPFactory.3 Manifying blib\lib/Bio/Phenotype/Measure.pm -> blib\libdoc\Bio.Phenotype.Measure.3 Manifying blib\lib/Bio/DB/Qual.pm -> blib\libdoc\Bio.DB.Qual.3 Manifying blib\lib/Bio/Search/Result/PullResultI.pm -> blib\libdoc\Bio.Search.Result.PullResultI.3 Manifying blib\lib/Bio/Seq/LargeSeq.pm -> blib\libdoc\Bio.Seq.LargeSeq.3 Manifying blib\lib/Bio/DB/GFF/Segment.pm -> blib\libdoc\Bio.DB.GFF.Segment.3 Manifying blib\lib/Bio/Tools/Grail.pm -> blib\libdoc\Bio.Tools.Grail.3 Manifying blib\lib/Bio/AlignIO/meme.pm -> blib\libdoc\Bio.AlignIO.meme.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/DBI/Iterator.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.DBI.Iterator.3 Manifying blib\lib/Bio/DB/Flat/BDB/embl.pm -> blib\libdoc\Bio.DB.Flat.BDB.embl.3 Manifying blib\lib/Bio/PopGen/IO/phase.pm -> blib\libdoc\Bio.PopGen.IO.phase.3 Manifying blib\lib/Bio/Restriction/EnzymeI.pm -> blib\libdoc\Bio.Restriction.EnzymeI.3 Manifying blib\lib/Bio/Search/Result/HmmpfamResult.pm -> blib\libdoc\Bio.Search.Result.HmmpfamResult.3 Manifying blib\lib/Bio/Biblio/Proceeding.pm -> blib\libdoc\Bio.Biblio.Proceeding.3 Manifying blib\lib/Bio/FeatureIO/gff.pm -> blib\libdoc\Bio.FeatureIO.gff.3 Manifying blib\lib/Bio/Location/AvWithinCoordPolicy.pm -> blib\libdoc\Bio.Location.AvWithinCoordPolicy.3 Manifying blib\lib/Bio/SeqFeature/Gene/GeneStructureI.pm -> blib\libdoc\Bio.SeqFeature.Gene.GeneStructureI.3 Manifying blib\lib/Bio/LiveSeq/Chain.pm -> blib\libdoc\Bio.LiveSeq.Chain.3 Manifying blib\lib/Bio/Tools/Run/ParametersI.pm -> blib\libdoc\Bio.Tools.Run.ParametersI.3 Manifying blib\lib/Bio/Matrix/PSM/IO/meme.pm -> blib\libdoc\Bio.Matrix.PSM.IO.meme.3 Manifying blib\lib/Bio/Tools/Analysis/SimpleAnalysisBase.pm -> blib\libdoc\Bio.Tools.Analysis.SimpleAnalysisBase.3 Manifying blib\lib/Bio/Seq/MetaI.pm -> blib\libdoc\Bio.Seq.MetaI.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/DBI/mysql.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.DBI.mysql.3 Manifying blib\lib/Bio/DB/InMemoryCache.pm -> blib\libdoc\Bio.DB.InMemoryCache.3 Manifying blib\lib/Bio/Seq/RichSeqI.pm -> blib\libdoc\Bio.Seq.RichSeqI.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/memory/iterator.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.memory.iterator.3 Manifying blib\lib/Bio/SearchDist.pm -> blib\libdoc\Bio.SearchDist.3 Manifying blib\lib/Bio/PopGen/Simulation/Coalescent.pm -> blib\libdoc\Bio.PopGen.Simulation.Coalescent.3 Manifying blib\lib/Bio/DB/Query/HIVQuery.pm -> blib\libdoc\Bio.DB.Query.HIVQuery.3 Manifying blib\lib/Bio/Tools/SiRNA/Ruleset/saigo.pm -> blib\libdoc\Bio.Tools.SiRNA.Ruleset.saigo.3 Manifying blib\lib/Bio/ClusterIO/dbsnp.pm -> blib\libdoc\Bio.ClusterIO.dbsnp.3 Manifying blib\lib/Bio/Tools/EUtilities/Link/LinkSet.pm -> blib\libdoc\Bio.Tools.EUtilities.Link.LinkSet.3 Manifying blib\lib/Bio/Structure/Chain.pm -> blib\libdoc\Bio.Structure.Chain.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/so_transcript.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.so_transcript.3 Manifying blib\lib/Bio/Biblio/MedlineJournal.pm -> blib\libdoc\Bio.Biblio.MedlineJournal.3 Manifying blib\lib/Bio/SeqEvolution/DNAPoint.pm -> blib\libdoc\Bio.SeqEvolution.DNAPoint.3 Manifying blib\lib/Bio/LiveSeq/ChainI.pm -> blib\libdoc\Bio.LiveSeq.ChainI.3 Manifying blib\lib/Bio/LiveSeq/DNA.pm -> blib\libdoc\Bio.LiveSeq.DNA.3 Manifying blib\lib/Bio/PopGen/Individual.pm -> blib\libdoc\Bio.PopGen.Individual.3 Manifying blib\lib/Bio/Matrix/IO/scoring.pm -> blib\libdoc\Bio.Matrix.IO.scoring.3 Manifying blib\lib/Bio/Tools/Phylo/PAML/Result.pm -> blib\libdoc\Bio.Tools.Phylo.PAML.Result.3 Manifying blib\lib/Bio/SeqAnalysisParserI.pm -> blib\libdoc\Bio.SeqAnalysisParserI.3 Manifying blib\lib/Bio/Ontology/GOterm.pm -> blib\libdoc\Bio.Ontology.GOterm.3 Manifying blib\lib/Bio/Tools/EUtilities/Query/GlobalQuery.pm -> blib\libdoc\Bio.Tools.EUtilities.Query.GlobalQuery.3 Manifying blib\lib/Bio/Map/GeneRelative.pm -> blib\libdoc\Bio.Map.GeneRelative.3 Manifying blib\lib/Bio/SeqIO/swissdriver.pm -> blib\libdoc\Bio.SeqIO.swissdriver.3 Manifying blib\lib/Bio/SeqFeature/AnnotationAdaptor.pm -> blib\libdoc\Bio.SeqFeature.AnnotationAdaptor.3 Manifying blib\lib/Bio/Symbol/Alphabet.pm -> blib\libdoc\Bio.Symbol.Alphabet.3 Manifying blib\lib/Bio/Tools/pICalculator.pm -> blib\libdoc\Bio.Tools.pICalculator.3 Manifying blib\lib/Bio/IdentifiableI.pm -> blib\libdoc\Bio.IdentifiableI.3 Manifying blib\lib/Bio/AlignIO/bl2seq.pm -> blib\libdoc\Bio.AlignIO.bl2seq.3 Manifying blib\lib/Bio/Search/BlastStatistics.pm -> blib\libdoc\Bio.Search.BlastStatistics.3 Manifying blib\lib/Bio/Das/SegmentI.pm -> blib\libdoc\Bio.Das.SegmentI.3 Manifying blib\lib/Bio/SimpleAlign.pm -> blib\libdoc\Bio.SimpleAlign.3 Manifying blib\lib/Bio/SearchIO/blasttable.pm -> blib\libdoc\Bio.SearchIO.blasttable.3 Manifying blib\lib/Bio/Ontology/Path.pm -> blib\libdoc\Bio.Ontology.Path.3 Manifying blib\lib/Bio/SeqFeature/Gene/Transcript.pm -> blib\libdoc\Bio.SeqFeature.Gene.Transcript.3 Manifying blib\lib/Bio/DB/HIV/HIVAnnotProcessor.pm -> blib\libdoc\Bio.DB.HIV.HIVAnnotProcessor.3 Manifying blib\lib/Bio/MolEvol/CodonModel.pm -> blib\libdoc\Bio.MolEvol.CodonModel.3 Manifying blib\lib/Bio/Location/WidestCoordPolicy.pm -> blib\libdoc\Bio.Location.WidestCoordPolicy.3 Manifying blib\lib/Bio/Tools/Primer/AssessorI.pm -> blib\libdoc\Bio.Tools.Primer.AssessorI.3 Manifying blib\lib/Bio/Annotation/OntologyTerm.pm -> blib\libdoc\Bio.Annotation.OntologyTerm.3 Manifying blib\lib/Bio/Seq/PrimaryQual.pm -> blib\libdoc\Bio.Seq.PrimaryQual.3 Manifying blib\lib/Bio/Matrix/PSM/PsmHeader.pm -> blib\libdoc\Bio.Matrix.PSM.PsmHeader.3 Manifying blib\lib/Bio/PopGen/Genotype.pm -> blib\libdoc\Bio.PopGen.Genotype.3 Manifying blib\lib/Bio/Tools/ipcress.pm -> blib\libdoc\Bio.Tools.ipcress.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.memory.feature_serializer.3 Manifying blib\lib/Bio/Matrix/PSM/IO/transfac.pm -> blib\libdoc\Bio.Matrix.PSM.IO.transfac.3 Manifying blib\lib/Bio/Ontology/OntologyI.pm -> blib\libdoc\Bio.Ontology.OntologyI.3 Manifying blib\lib/Bio/Phenotype/OMIM/MiniMIMentry.pm -> blib\libdoc\Bio.Phenotype.OMIM.MiniMIMentry.3 Manifying blib\lib/Bio/Location/Split.pm -> blib\libdoc\Bio.Location.Split.3 Manifying blib\lib/Bio/Tools/GuessSeqFormat.pm -> blib\libdoc\Bio.Tools.GuessSeqFormat.3 Manifying blib\lib/Bio/DB/GenBank.pm -> blib\libdoc\Bio.DB.GenBank.3 Manifying blib\lib/Bio/Tree/Statistics.pm -> blib\libdoc\Bio.Tree.Statistics.3 Manifying blib\lib/Bio/Assembly/IO/maq.pm -> blib\libdoc\Bio.Assembly.IO.maq.3 Manifying blib\lib/Bio/DB/Flat/BDB/swiss.pm -> blib\libdoc\Bio.DB.Flat.BDB.swiss.3 Manifying blib\lib/Bio/Factory/MapFactoryI.pm -> blib\libdoc\Bio.Factory.MapFactoryI.3 Manifying blib\lib/Bio/SeqUtils.pm -> blib\libdoc\Bio.SeqUtils.3 Manifying blib\lib/Bio/Tools/dpAlign.pm -> blib\libdoc\Bio.Tools.dpAlign.3 Manifying blib\lib/Bio/Variation/IO/flat.pm -> blib\libdoc\Bio.Variation.IO.flat.3 Manifying blib\lib/Bio/Tools/Match.pm -> blib\libdoc\Bio.Tools.Match.3 Manifying blib\lib/Bio/TreeIO/newick.pm -> blib\libdoc\Bio.TreeIO.newick.3 Manifying blib\lib/Bio/SeqFeature/TypedSeqFeatureI.pm -> blib\libdoc\Bio.SeqFeature.TypedSeqFeatureI.3 Manifying blib\lib/Bio/Tools/SeqWords.pm -> blib\libdoc\Bio.Tools.SeqWords.3 Manifying blib\lib/Bio/Assembly/IO/sam.pm -> blib\libdoc\Bio.Assembly.IO.sam.3 Manifying blib\lib/Bio/Tree/Draw/Cladogram.pm -> blib\libdoc\Bio.Tree.Draw.Cladogram.3 Manifying blib\lib/Bio/Tree/NodeI.pm -> blib\libdoc\Bio.Tree.NodeI.3 Manifying blib\lib/Bio/SearchIO/Writer/ResultTableWriter.pm -> blib\libdoc\Bio.SearchIO.Writer.ResultTableWriter.3 Manifying blib\lib/Bio/Seq/SeqWithQuality.pm -> blib\libdoc\Bio.Seq.SeqWithQuality.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/oracle.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.oracle.3 Manifying blib\lib/Bio/LiveSeq/Mutator.pm -> blib\libdoc\Bio.LiveSeq.Mutator.3 Manifying blib\lib/Bio/SeqFeature/SiRNA/Oligo.pm -> blib\libdoc\Bio.SeqFeature.SiRNA.Oligo.3 Manifying blib\lib/Bio/Map/Mappable.pm -> blib\libdoc\Bio.Map.Mappable.3 Manifying blib\lib/Bio/Tree/Compatible.pm -> blib\libdoc\Bio.Tree.Compatible.3 Manifying blib\lib/Bio/CodonUsage/IO.pm -> blib\libdoc\Bio.CodonUsage.IO.3 Manifying blib\lib/Bio/Range.pm -> blib\libdoc\Bio.Range.3 Manifying blib\lib/Bio/Tools/SiRNA/Ruleset/tuschl.pm -> blib\libdoc\Bio.Tools.SiRNA.Ruleset.tuschl.3 Manifying blib\lib/Bio/Align/DNAStatistics.pm -> blib\libdoc\Bio.Align.DNAStatistics.3 Manifying blib\lib/Bio/SeqIO/gcg.pm -> blib\libdoc\Bio.SeqIO.gcg.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.dbi.mysqlopt.3 Manifying blib\lib/Bio/TreeIO/tabtree.pm -> blib\libdoc\Bio.TreeIO.tabtree.3 Manifying blib\lib/Bio/SearchIO/IteratedSearchResultEventBuilder.pm -> blib\libdoc\Bio.SearchIO.IteratedSearchResultEventBuilder.3 Manifying blib\lib/Bio/Phenotype/Correlate.pm -> blib\libdoc\Bio.Phenotype.Correlate.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/GFF3Loader.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.GFF3Loader.3 Manifying blib\lib/Bio/AlignIO.pm -> blib\libdoc\Bio.AlignIO.3 Manifying blib\lib/Bio/Search/HSP/ModelHSP.pm -> blib\libdoc\Bio.Search.HSP.ModelHSP.3 Manifying blib\lib/Bio/PopGen/HtSNP.pm -> blib\libdoc\Bio.PopGen.HtSNP.3 Manifying blib\lib/Bio/Tools/Phylo/PAML/Codeml.pm -> blib\libdoc\Bio.Tools.Phylo.PAML.Codeml.3 Manifying blib\lib/Bio/SeqI.pm -> blib\libdoc\Bio.SeqI.3 Manifying blib\lib/Bio/TreeIO.pm -> blib\libdoc\Bio.TreeIO.3 Manifying blib\lib/Bio/DB/GFF/Typename.pm -> blib\libdoc\Bio.DB.GFF.Typename.3 Manifying blib\lib/Bio/Annotation/TagTree.pm -> blib\libdoc\Bio.Annotation.TagTree.3 Manifying blib\lib/Bio/Seq/Meta/Array.pm -> blib\libdoc\Bio.Seq.Meta.Array.3 Manifying blib\lib/Bio/ConfigData.pm -> blib\libdoc\Bio.ConfigData.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/ELM.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.ELM.3 Manifying blib\lib/Bio/Search/Result/ResultI.pm -> blib\libdoc\Bio.Search.Result.ResultI.3 Manifying blib\lib/Bio/Annotation/TypeManager.pm -> blib\libdoc\Bio.Annotation.TypeManager.3 Manifying blib\lib/Bio/PopGen/PopStats.pm -> blib\libdoc\Bio.PopGen.PopStats.3 Manifying blib\lib/Bio/Restriction/IO/base.pm -> blib\libdoc\Bio.Restriction.IO.base.3 Manifying blib\lib/Bio/DB/GFF/Adaptor/berkeleydb.pm -> blib\libdoc\Bio.DB.GFF.Adaptor.berkeleydb.3 Manifying blib\lib/Bio/Tools/EUtilities/Summary/Item.pm -> blib\libdoc\Bio.Tools.EUtilities.Summary.Item.3 Manifying blib\lib/Bio/Tools/SeqStats.pm -> blib\libdoc\Bio.Tools.SeqStats.3 Manifying blib\lib/Bio/Tools/Spidey/Results.pm -> blib\libdoc\Bio.Tools.Spidey.Results.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/gene.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.gene.3 Manifying blib\lib/Bio/Tools/ESTScan.pm -> blib\libdoc\Bio.Tools.ESTScan.3 Manifying blib\lib/Bio/Map/CytoMap.pm -> blib\libdoc\Bio.Map.CytoMap.3 Manifying blib\lib/Bio/AlignIO/msf.pm -> blib\libdoc\Bio.AlignIO.msf.3 Manifying blib\lib/Bio/DB/SeqFeature/NormalizedFeatureI.pm -> blib\libdoc\Bio.DB.SeqFeature.NormalizedFeatureI.3 Manifying blib\lib/Bio/Phenotype/OMIM/OMIMentry.pm -> blib\libdoc\Bio.Phenotype.OMIM.OMIMentry.3 Manifying blib\lib/Bio/DB/SeqHound.pm -> blib\libdoc\Bio.DB.SeqHound.3 Manifying blib\lib/Bio/Search/Tiling/MapTileUtils.pm -> blib\libdoc\Bio.Search.Tiling.MapTileUtils.3 Manifying blib\lib/Bio/Annotation/Relation.pm -> blib\libdoc\Bio.Annotation.Relation.3 Manifying blib\lib/Bio/SeqIO/bsml.pm -> blib\libdoc\Bio.SeqIO.bsml.3 Manifying blib\lib/Bio/DB/GFF/Feature.pm -> blib\libdoc\Bio.DB.GFF.Feature.3 Manifying blib\lib/Bio/Matrix/PSM/ProtPsm.pm -> blib\libdoc\Bio.Matrix.PSM.ProtPsm.3 Manifying blib\lib/Bio/Symbol/DNAAlphabet.pm -> blib\libdoc\Bio.Symbol.DNAAlphabet.3 Manifying blib\lib/Bio/Search/Result/WABAResult.pm -> blib\libdoc\Bio.Search.Result.WABAResult.3 Manifying blib\lib/Bio/SeqFeature/PositionProxy.pm -> blib\libdoc\Bio.SeqFeature.PositionProxy.3 Manifying blib\lib/Bio/Seq/SeqBuilder.pm -> blib\libdoc\Bio.Seq.SeqBuilder.3 Manifying blib\lib/Bio/Tools/EUtilities/EUtilParameters.pm -> blib\libdoc\Bio.Tools.EUtilities.EUtilParameters.3 Manifying blib\lib/Bio/Assembly/Contig.pm -> blib\libdoc\Bio.Assembly.Contig.3 Manifying blib\lib/Bio/Tools/Est2Genome.pm -> blib\libdoc\Bio.Tools.Est2Genome.3 Manifying blib\lib/Bio/TreeIO/NewickParser.pm -> blib\libdoc\Bio.TreeIO.NewickParser.3 Manifying blib\lib/Bio/Biblio/MedlineArticle.pm -> blib\libdo./Build: blib\script\bp_bulk_load_gff.pl: cannot resolve L in paragraph 25. ./Build: blib\script\bp_bulk_load_gff.pl: cannot resolve L in paragraph 25. c\Bio.Biblio.MedlineArticle.3 Manifying blib\lib/Bio/Map/Microsatellite.pm -> blib\libdoc\Bio.Map.Microsatellite.3 Manifying blib\lib/Bio/OntologyIO/obo.pm -> blib\libdoc\Bio.OntologyIO.obo.3 Manifying blib\lib/Bio/DB/HIV/HIVQueryHelper.pm -> blib\libdoc\Bio.DB.HIV.HIVQueryHelper.3 Manifying blib\lib/Bio/Restriction/EnzymeCollection.pm -> blib\libdoc\Bio.Restriction.EnzymeCollection.3 Manifying blib\lib/Bio/Variation/IO/xml.pm -> blib\libdoc\Bio.Variation.IO.xml.3 Manifying blib\lib/Bio/Tools/Prediction/Exon.pm -> blib\libdoc\Bio.Tools.Prediction.Exon.3 Manifying blib\lib/Bio/Map/PositionWithSequence.pm -> blib\libdoc\Bio.Map.PositionWithSequence.3 Manifying blib\lib/Bio/PopGen/IndividualI.pm -> blib\libdoc\Bio.PopGen.IndividualI.3 Manifying blib\lib/Bio/Root/Exception.pm -> blib\libdoc\Bio.Root.Exception.3 Manifying blib\lib/Bio/SeqIO/Handler/GenericRichSeqHandler.pm -> blib\libdoc\Bio.SeqIO.Handler.GenericRichSeqHandler.3 Manifying blib\lib/Bio/Phenotype/PhenotypeI.pm -> blib\libdoc\Bio.Phenotype.PhenotypeI.3 Manifying blib\lib/Bio/Search/HSP/hmmer3HSP.pm -> blib\libdoc\Bio.Search.HSP.hmmer3HSP.3 Manifying blib\lib/Bio/DB/SeqFeature/Segment.pm -> blib\libdoc\Bio.DB.SeqFeature.Segment.3 Manifying blib\lib/Bio/Tools/isPcr.pm -> blib\libdoc\Bio.Tools.isPcr.3 Manifying blib\lib/Bio/DB/MeSH.pm -> blib\libdoc\Bio.DB.MeSH.3 Manifying blib\lib/Bio/SeqIO/swiss.pm -> blib\libdoc\Bio.SeqIO.swiss.3 Manifying blib\lib/Bio/DB/SeqFeature/Store/GFF2Loader.pm -> blib\libdoc\Bio.DB.SeqFeature.Store.GFF2Loader.3 Manifying blib\lib/Bio/DB/GFF/Aggregator/coding.pm -> blib\libdoc\Bio.DB.GFF.Aggregator.coding.3 Manifying blib\lib/Bio/SeqIO/lasergene.pm -> blib\libdoc\Bio.SeqIO.lasergene.3 Manifying blib\lib/Bio/Matrix/Generic.pm -> blib\libdoc\Bio.Matrix.Generic.3 Manifying blib\lib/Bio/SeqIO/flybase_chadoxml.pm -> blib\libdoc\Bio.SeqIO.flybase_chadoxml.3 Manifying blib\lib/Bio/Seq/BaseSeqProcessor.pm -> blib\libdoc\Bio.Seq.BaseSeqProcessor.3 Manifying blib\lib/Bio/Tools/MZEF.pm -> blib\libdoc\Bio.Tools.MZEF.3 Manifying blib\lib/Bio/LiveSeq/Intron.pm -> blib\libdoc\Bio.LiveSeq.Intron.3 Manifying blib\lib/Bio/Structure/Residue.pm -> blib\libdoc\Bio.Structure.Residue.3 Manifying blib\lib/Bio/Ontology/SimpleGOEngine/GraphAdaptor02.pm -> blib\libdoc\Bio.Ontology.SimpleGOEngine.GraphAdaptor02.3 Manifying blib\lib/Bio/Tools/Pseudowise.pm -> blib\libdoc\Bio.Tools.Pseudowise.3 Manifying blib\lib/Bio/Tools/EUtilities/EUtilDataI.pm -> blib\libdoc\Bio.Tools.EUtilities.EUtilDataI.3 Manifying blib\lib/Bio/Tree/Node.pm -> blib\libdoc\Bio.Tree.Node.3 Manifying blib\lib/Bio/Index/EMBL.pm -> blib\libdoc\Bio.Index.EMBL.3 Manifying blib\lib/Bio/Seq/RichSeq.pm -> blib\libdoc\Bio.Seq.RichSeq.3 Manifying blib\lib/Bio/SeqIO/phd.pm -> blib\libdoc\Bio.SeqIO.phd.3 Manifying blib\lib/Bio/Location/CoordinatePolicyI.pm -> blib\libdoc\Bio.Location.CoordinatePolicyI.3 Manifying blib\lib/Bio/OntologyIO/Handlers/BaseSAXHandler.pm -> blib\libdoc\Bio.OntologyIO.Handlers.BaseSAXHandler.3 Manifying blib\lib/Bio/Search/HSP/HSPI.pm -> blib\libdoc\Bio.Search.HSP.HSPI.3 Manifying blib\lib/Bio/Index/Blast.pm -> blib\libdoc\Bio.Index.Blast.3 Manifying blib\lib/Bio/Tools/Analysis/Protein/HNN.pm -> blib\libdoc\Bio.Tools.Analysis.Protein.HNN.3 Manifying blib\lib/Bio/Tools/Protparam.pm -> blib\libdoc\Bio.Tools.Protparam.3 Manifying blib\lib/Bio/Factory/ApplicationFactoryI.pm -> blib\libdoc\Bio.Factory.ApplicationFactoryI.3 Manifying blib\lib/Bio/PhyloNetwork/TreeFactoryX.pm -> blib\libdoc\Bio.PhyloNetwork.TreeFactoryX.3 Manifying blib\lib/Bio/SeqFeature/Lite.pm -> blib\libdoc\Bio.SeqFeature.Lite.3 Manifying blib\lib/Bio/Matrix/PSM/IO/mast.pm -> blib\libdoc\Bio.Matrix.PSM.IO.mast.3 Manifying blib\lib/Bio/SeqIO/tigrxml.pm -> blib\libdoc\Bio.SeqIO.tigrxml.3 HTMLifying blib\script\bp_bulk_load_gff.pl -> blib\binhtml\bin\bp_bulk_load_gff.html HTMLifying blib\script\bp_fastam9_to_table.pl -> blib\binhtml\bin\bp_fastam9_to_table.html HTMLifying blib\script\bp_meta_gff.pl -> blib\binhtml\bin\bp_meta_gff.html HTMLifying blib\script\bp_process_wormbas./Build: blib\script\bp_process_wormbase.pl: cannot resolve L in paragraph 44. ./Build: blib\script\bp_process_wormbase.pl: cannot resolve L in paragraph 44. ./Build: blib\script\bp_process_sgd.pl: cannot resolve L in paragraph 29. ./Build: blib\script\bp_process_sgd.pl: cannot resolve L in paragraph 29. ./Build: blib\script\bp_load_gff.pl: cannot resolve L in paragraph 20. ./Build: blib\script\bp_load_gff.pl: cannot resolve L in paragraph 20. ./Build: blib\script\bp_fast_load_gff.pl: cannot resolve L in paragraph 25. ./Build: blib\script\bp_fast_load_gff.pl: cannot resolve L in paragraph 25. ./Build: blib\script\bp_genbank2gff.pl: cannot resolve L in paragraph 15. ./Build: blib\script\bp_genbank2gff.pl: cannot resolve L in paragraph 15. ./Build: blib\script\bp_seqconvert.pl: cannot resolve L in paragraph 19. ./Build: blib\script\bp_process_gadfly.pl: cannot resolve L in paragraph 39. ./Build: blib\script\bp_process_gadfly.pl: cannot resolve L in paragraph 39. e.pl -> blib\binhtml\bin\bp_process_wormbase.html HTMLifying blib\script\bp_make_mrna_protein.pl -> blib\binhtml\bin\bp_make_mrna_protein.html HTMLifying blib\script\bp_translate_seq.pl -> blib\binhtml\bin\bp_translate_seq.html HTMLifying blib\script\bp_bioflat_index.pl -> blib\binhtml\bin\bp_bioflat_index.html HTMLifying blib\script\bp_oligo_count.pl -> blib\binhtml\bin\bp_oligo_count.html HTMLifying blib\script\bp_search2alnblocks.pl -> blib\binhtml\bin\bp_search2alnblocks.html HTMLifying blib\script\bp_nrdb.pl -> blib\binhtml\bin\bp_nrdb.html HTMLifying blib\script\bp_netinstall.pl -> blib\binhtml\bin\bp_netinstall.html HTMLifying blib\script\bp_process_sgd.pl -> blib\binhtml\bin\bp_process_sgd.html HTMLifying blib\script\bp_extract_feature_seq.pl -> blib\binhtml\bin\bp_extract_feature_seq.html HTMLifying blib\script\bp_dbsplit.pl -> blib\binhtml\bin\bp_dbsplit.html HTMLifying blib\script\bp_seqfeature_load.pl -> blib\binhtml\bin\bp_seqfeature_load.html HTMLifying blib\script\bp_classify_hits_kingdom.pl -> blib\binhtml\bin\bp_classify_hits_kingdom.html HTMLifying blib\script\bp_einfo.pl -> blib\binhtml\bin\bp_einfo.html HTMLifying blib\script\bp_fetch.pl -> blib\binhtml\bin\bp_fetch.html HTMLifying blib\script\bp_load_gff.pl -> blib\binhtml\bin\bp_load_gff.html HTMLifying blib\script\bp_aacomp.pl -> blib\binhtml\bin\bp_aacomp.html HTMLifying blib\script\bp_fast_load_gff.pl -> blib\binhtml\bin\bp_fast_load_gff.html HTMLifying blib\script\bp_heterogeneity_test.pl -> blib\binhtml\bin\bp_heterogeneity_test.html HTMLifying blib\script\bp_search2gff.pl -> blib\binhtml\bin\bp_search2gff.html HTMLifying blib\script\bp_biblio.pl -> blib\binhtml\bin\bp_biblio.html HTMLifying blib\script\bp_tree2pag.pl -> blib\binhtml\bin\bp_tree2pag.html HTMLifying blib\script\bp_biogetseq.pl -> blib\binhtml\bin\bp_biogetseq.html HTMLifying blib\script\bp_unflatten_seq.pl -> blib\binhtml\bin\bp_unflatten_seq.html HTMLifying blib\script\bp_mask_by_search.pl -> blib\binhtml\bin\bp_mask_by_search.html HTMLifying blib\script\bp_search2BSML.pl -> blib\binhtml\bin\bp_search2BSML.html HTMLifying blib\script\bp_genbank2gff.pl -> blib\binhtml\bin\bp_genbank2gff.html HTMLifying blib\script\bp_biofetch_genbank_proxy.pl -> blib\binhtml\bin\bp_biofetch_genbank_proxy.html HTMLifying blib\script\bp_query_entrez_taxa.pl -> blib\binhtml\bin\bp_query_entrez_taxa.html HTMLifying blib\script\bp_generate_histogram.pl -> blib\binhtml\bin\bp_generate_histogram.html HTMLifying blib\script\bp_local_taxonomydb_query.pl -> blib\binhtml\bin\bp_local_taxonomydb_query.html HTMLifying blib\script\bp_seq_length.pl -> blib\binhtml\bin\bp_seq_length.html HTMLifying blib\script\bp_search2tribe.pl -> blib\binhtml\bin\bp_search2tribe.html HTMLifying blib\script\bp_parse_hmmsearch.pl -> blib\binhtml\bin\bp_parse_hmmsearch.html HTMLifying blib\script\bp_seqconvert.pl -> blib\binhtml\bin\bp_seqconvert.html HTMLifying blib\script\bp_taxid4species.pl -> blib\binhtml\bin\bp_taxid4species.html HTMLifying blib\script\bp_index.pl -> blib\binhtml\bin\bp_index.html HTMLifying blib\script\bp_filter_search.pl -> blib\binhtml\bin\bp_filter_search.html HTMLifying blib\script\bp_blast2tree.pl -> blib\binhtml\bin\bp_blast2tree.html HTMLifying blib\script\bp_hivq.pl -> blib\binhtml\bin\bp_hivq.html HTMLifying blib\script\bp_sreformat.pl -> blib\binhtml\bin\bp_sreformat.html HTMLifying blib\script\bp_process_gadfly.pl -> blib\binhtml\bin\bp_process_gadfly.html HTMLifying blib\script\bp_pairwise_kaks.pl -> blib\binhtml\bin\bp_pairwise_kaks.html HTMLifying blib\script\bp_gccalc.pl -> blib\binhtml\bin\bp_gccalc.html HTMLifying blib\script\bp_mutate.pl -> blib\binhtml\bin\bp_mutate.html HTMLifying blib\script\bp_mrtrans.pl -> blib\binhtml\bin\bp_mrtrans.html HTMLifying blib\script\bp_search2table.pl -> blib\binhtml\bin\bp_search2table.html HTMLifying blib\script\bp_revtrans-motif.pl -> blib\binhtml\bin\bp_revtrans-motif.html HTMLifying blib\script\bp_remote_blast.pl -> blib\binhtml\bin\bp_remote_blast.html HTMLifying blib\script\bp_nexus2nh.pl -> blib\bin./Build: blib\lib\Bio\Tools\Run\WrapperBase\CommandExts.pm: cannot resolve L in paragraph 94. html\bin\bp_nexus2nh.html HTMLifying blib\script\bp_composite_LD.pl -> blib\binhtml\bin\bp_composite_LD.html HTMLifying blib\script\bp_hmmer_to_table.pl -> blib\binhtml\bin\bp_hmmer_to_table.html HTMLifying blib\script\bp_download_query_genbank.pl -> blib\binhtml\bin\bp_download_query_genbank.html HTMLifying blib\script\bp_seqret.pl -> blib\binhtml\bin\bp_seqret.html HTMLifying blib\script\bp_flanks.pl -> blib\binhtml\bin\bp_flanks.html HTMLifying blib\script\bp_taxonomy2tree.pl -> blib\binhtml\bin\bp_taxonomy2tree.html HTMLifying blib\script\bp_split_seq.pl -> blib\binhtml\bin\bp_split_seq.html HTMLifying blib\script\bp_seqretsplit.pl -> blib\binhtml\bin\bp_seqretsplit.html HTMLifying blib\script\bp_genbank2gff3.pl -> blib\binhtml\bin\bp_genbank2gff3.html HTMLifying blib\script\bp_chaos_plot.pl -> blib\binhtml\bin\bp_chaos_plot.html HTMLifying blib\lib\Bio\Tools\EUtilities.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities.html HTMLifying blib\lib\Bio\Search\Hit\HitFactory.pm -> blib\libhtml\site\lib\Bio\Search\Hit\HitFactory.html HTMLifying blib\lib\Bio\Index\Abstract.pm -> blib\libhtml\site\lib\Bio\Index\Abstract.html HTMLifying blib\lib\Bio\Structure\SecStr\DSSP\Res.pm -> blib\libhtml\site\lib\Bio\Structure\SecStr\DSSP\Res.html HTMLifying blib\lib\Bio\SearchIO\Writer\HSPTableWriter.pm -> blib\libhtml\site\lib\Bio\SearchIO\Writer\HSPTableWriter.html HTMLifying blib\lib\Bio\Location\Simple.pm -> blib\libhtml\site\lib\Bio\Location\Simple.html HTMLifying blib\lib\Bio\SearchIO\blastxml.pm -> blib\libhtml\site\lib\Bio\SearchIO\blastxml.html HTMLifying blib\lib\Bio\Search\HSP\BlastHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\BlastHSP.html HTMLifying blib\lib\Bio\LiveSeq\AARange.pm -> blib\libhtml\site\lib\Bio\LiveSeq\AARange.html HTMLifying blib\lib\Bio\SeqIO\tinyseq.pm -> blib\libhtml\site\lib\Bio\SeqIO\tinyseq.html HTMLifying blib\lib\Bio\AlignIO\metafasta.pm -> blib\libhtml\site\lib\Bio\AlignIO\metafasta.html HTMLifying blib\lib\Bio\Tools\Run\WrapperBase\CommandExts.pm -> blib\libhtml\site\lib\Bio\Tools\Run\WrapperBase\CommandExts.html HTMLifying blib\lib\Bio\Tools\TargetP.pm -> blib\libhtml\site\lib\Bio\Tools\TargetP.html HTMLifying blib\lib\Bio\Ontology\TermFactory.pm -> blib\libhtml\site\lib\Bio\Ontology\TermFactory.html HTMLifying blib\lib\Bio\Tools\Fgenesh.pm -> blib\libhtml\site\lib\Bio\Tools\Fgenesh.html HTMLifying blib\lib\Bio\Tools\FootPrinter.pm -> blib\libhtml\site\lib\Bio\Tools\FootPrinter.html HTMLifying blib\lib\Bio\TreeIO\TreeEventBuilder.pm -> blib\libhtml\site\lib\Bio\TreeIO\TreeEventBuilder.html HTMLifying blib\lib\Bio\Ontology\DocumentRegistry.pm -> blib\libhtml\site\lib\Bio\Ontology\DocumentRegistry.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\match.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\match.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\iterator.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\iterator.html HTMLifying blib\lib\Bio\HandlerBaseI.pm -> blib\libhtml\site\lib\Bio\HandlerBaseI.html HTMLifying blib\lib\Bio\Event\EventGeneratorI.pm -> blib\libhtml\site\lib\Bio\Event\EventGeneratorI.html HTMLifying blib\lib\Bio\Structure\SecStr\STRIDE\Res.pm -> blib\libhtml\site\lib\Bio\Structure\SecStr\STRIDE\Res.html HTMLifying blib\lib\Bio\SeqIO\exp.pm -> blib\libhtml\site\lib\Bio\SeqIO\exp.html HTMLifying blib\lib\Bio\AlignIO\mega.pm -> blib\libhtml\site\lib\Bio\AlignIO\mega.html HTMLifying blib\lib\Bio\SeqIO\game\gameHandler.pm -> blib\libhtml\site\lib\Bio\SeqIO\game\gameHandler.html HTMLifying blib\lib\Bio\Search\HSP\BlastPullHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\BlastPullHSP.html HTMLifying blib\lib\Bio\Ontology\RelationshipI.pm -> blib\libhtml\site\lib\Bio\Ontology\RelationshipI.html HTMLifying blib\lib\Bio\AlignIO\proda.pm -> blib\libhtml\site\lib\Bio\AlignIO\proda.html HTMLifying blib\lib\Bio\SearchIO\hmmer.pm -> blib\libhtml\site\lib\Bio\SearchIO\hmmer.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_softberry.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_softberry.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\ace.pm -> ./Build: blib\lib\Bio\DB\GFF\Adaptor\ace.pm: cannot resolve L in paragraph 8. ./Build: blib\lib\Bio\Search\Hit\hmmer3Hit.pm: cannot resolve L in paragraph 15. ./Build: blib\lib\Bio\Search\Hit\hmmer3Hit.pm: cannot resolve L in paragraph 45. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlace.pm: cannot resolve L in paragraph 8. ./Build: blib\lib\Bio\Variation\IO.pm: cannot resolve L in paragraph 66. ./Build: blib\lib\Bio\SeqIO.pm: cannot resolve L in paragraph 74. blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\ace.html HTMLifying blib\lib\Bio\SeqFeature\Gene\ExonI.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\ExonI.html HTMLifying blib\lib\Bio\Seq\EncodedSeq.pm -> blib\libhtml\site\lib\Bio\Seq\EncodedSeq.html HTMLifying blib\lib\Bio\Search\Result\GenericResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\GenericResult.html HTMLifying blib\lib\Bio\SeqFeature\Tools\FeatureNamer.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Tools\FeatureNamer.html HTMLifying blib\lib\Bio\Tools\Genomewise.pm -> blib\libhtml\site\lib\Bio\Tools\Genomewise.html HTMLifying blib\lib\Bio\Restriction\IO\bairoch.pm -> blib\libhtml\site\lib\Bio\Restriction\IO\bairoch.html HTMLifying blib\lib\Bio\Map\PositionI.pm -> blib\libhtml\site\lib\Bio\Map\PositionI.html HTMLifying blib\lib\Bio\SeqIO\tigr.pm -> blib\libhtml\site\lib\Bio\SeqIO\tigr.html HTMLifying blib\lib\Bio\Cluster\UniGene.pm -> blib\libhtml\site\lib\Bio\Cluster\UniGene.html HTMLifying blib\lib\Bio\Tools\HMMER\Domain.pm -> blib\libhtml\site\lib\Bio\Tools\HMMER\Domain.html HTMLifying blib\lib\Bio\Seq\SeqFactory.pm -> blib\libhtml\site\lib\Bio\Seq\SeqFactory.html HTMLifying blib\lib\Bio\Tools\tRNAscanSE.pm -> blib\libhtml\site\lib\Bio\Tools\tRNAscanSE.html HTMLifying blib\lib\Bio\SeqEvolution\EvolutionI.pm -> blib\libhtml\site\lib\Bio\SeqEvolution\EvolutionI.html HTMLifying blib\lib\Bio\Search\Hit\hmmer3Hit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\hmmer3Hit.html HTMLifying blib\lib\Bio\Map\CytoPosition.pm -> blib\libhtml\site\lib\Bio\Map\CytoPosition.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlace.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\mysqlace.html HTMLifying blib\lib\Bio\Biblio\WebResource.pm -> blib\libhtml\site\lib\Bio\Biblio\WebResource.html HTMLifying blib\lib\Bio\Map\Marker.pm -> blib\libhtml\site\lib\Bio\Map\Marker.html HTMLifying blib\lib\Bio\PopGen\IO\prettybase.pm -> blib\libhtml\site\lib\Bio\PopGen\IO\prettybase.html HTMLifying blib\lib\Bio\Tree\NodeNHX.pm -> blib\libhtml\site\lib\Bio\Tree\NodeNHX.html HTMLifying blib\lib\Bio\Biblio\Organisation.pm -> blib\libhtml\site\lib\Bio\Biblio\Organisation.html HTMLifying blib\lib\Bio\DescribableI.pm -> blib\libhtml\site\lib\Bio\DescribableI.html HTMLifying blib\lib\Bio\Root\RootI.pm -> blib\libhtml\site\lib\Bio\Root\RootI.html HTMLifying blib\lib\Bio\Tools\HMMER\Set.pm -> blib\libhtml\site\lib\Bio\Tools\HMMER\Set.html HTMLifying blib\lib\Bio\Tools\Genewise.pm -> blib\libhtml\site\lib\Bio\Tools\Genewise.html HTMLifying blib\lib\Bio\Variation\IO.pm -> blib\libhtml\site\lib\Bio\Variation\IO.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\bdb.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\bdb.html HTMLifying blib\lib\Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm -> blib\libhtml\site\lib\Bio\Phenotype\OMIM\OMIMentryAllelicVariant.html HTMLifying blib\lib\Bio\SearchIO\psl.pm -> blib\libhtml\site\lib\Bio\SearchIO\psl.html HTMLifying blib\lib\Bio\Align\AlignI.pm -> blib\libhtml\site\lib\Bio\Align\AlignI.html HTMLifying blib\lib\Bio\Tools\Run\StandAloneBlast.pm -> blib\libhtml\site\lib\Bio\Tools\Run\StandAloneBlast.html HTMLifying blib\lib\Bio\SeqIO\tinyseq\tinyseqHandler.pm -> blib\libhtml\site\lib\Bio\SeqIO\tinyseq\tinyseqHandler.html HTMLifying blib\lib\Bio\Seq\PrimedSeq.pm -> blib\libhtml\site\lib\Bio\Seq\PrimedSeq.html HTMLifying blib\lib\Bio\Coordinate\ExtrapolatingPair.pm -> blib\libhtml\site\lib\Bio\Coordinate\ExtrapolatingPair.html HTMLifying blib\lib\Bio\SimpleAnalysisI.pm -> blib\libhtml\site\lib\Bio\SimpleAnalysisI.html HTMLifying blib\lib\Bio\FeatureIO\vecscreen_simple.pm -> blib\libhtml\site\lib\Bio\FeatureIO\vecscreen_simple.html HTMLifying blib\lib\Bio\SeqIO.pm -> blib\libhtml\site\lib\Bio\SeqIO.html HTMLifying blib\lib\Bio\SeqIO\interpro.pm -> blib\libhtml\site\lib\Bio\SeqIO\interpro.html HTMLifying blib\lib\Bio\Cluster\UniGeneI.pm -> blib\libhtml\site\lib\Bio\Cluster\UniGeneI.html HTMLifying blib\lib\Bio\Map\GeneMap.pm -> blib\libhtml\site\lib\Bio\Map\GeneMap.html HTMLifying blib\lib\Bio\Annotation\Comment.pm -> blib\libhtml\site\./Build: blib\lib\Bio\SearchIO\hmmer3.pm: cannot resolve L in paragraph 15. lib\Bio\Annotation\Comment.html HTMLifying blib\lib\Bio\SeqIO\MultiFile.pm -> blib\libhtml\site\lib\Bio\SeqIO\MultiFile.html HTMLifying blib\lib\Bio\Map\MapI.pm -> blib\libhtml\site\lib\Bio\Map\MapI.html HTMLifying blib\lib\Bio\TreeIO\nexml.pm -> blib\libhtml\site\lib\Bio\TreeIO\nexml.html HTMLifying blib\lib\Bio\AlignIO\phylip.pm -> blib\libhtml\site\lib\Bio\AlignIO\phylip.html HTMLifying blib\lib\Bio\Ontology\OntologyEngineI.pm -> blib\libhtml\site\lib\Bio\Ontology\OntologyEngineI.html HTMLifying blib\lib\Bio\AlignIO\arp.pm -> blib\libhtml\site\lib\Bio\AlignIO\arp.html HTMLifying blib\lib\Bio\TreeIO\nexus.pm -> blib\libhtml\site\lib\Bio\TreeIO\nexus.html HTMLifying blib\lib\Bio\Tools\TandemRepeatsFinder.pm -> blib\libhtml\site\lib\Bio\Tools\TandemRepeatsFinder.html HTMLifying blib\lib\Bio\Index\GenBank.pm -> blib\libhtml\site\lib\Bio\Index\GenBank.html HTMLifying blib\lib\Bio\Tools\Eponine.pm -> blib\libhtml\site\lib\Bio\Tools\Eponine.html HTMLifying blib\lib\Bio\SearchIO\hmmer3.pm -> blib\libhtml\site\lib\Bio\SearchIO\hmmer3.html HTMLifying blib\lib\Bio\DB\Universal.pm -> blib\libhtml\site\lib\Bio\DB\Universal.html HTMLifying blib\lib\Bio\Index\Fasta.pm -> blib\libhtml\site\lib\Bio\Index\Fasta.html HTMLifying blib\lib\Bio\Matrix\PSM\IO\psiblast.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\IO\psiblast.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\GOR4.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\GOR4.html HTMLifying blib\lib\Bio\Biblio\MedlineBook.pm -> blib\libhtml\site\lib\Bio\Biblio\MedlineBook.html HTMLifying blib\lib\Bio\SeqIO\table.pm -> blib\libhtml\site\lib\Bio\SeqIO\table.html HTMLifying blib\lib\Bio\AlignIO\emboss.pm -> blib\libhtml\site\lib\Bio\AlignIO\emboss.html HTMLifying blib\lib\Bio\Factory\SequenceProcessorI.pm -> blib\libhtml\site\lib\Bio\Factory\SequenceProcessorI.html HTMLifying blib\lib\Bio\AlignIO\nexus.pm -> blib\libhtml\site\lib\Bio\AlignIO\nexus.html HTMLifying blib\lib\Bio\OntologyIO\Handlers\InterProHandler.pm -> blib\libhtml\site\lib\Bio\OntologyIO\Handlers\InterProHandler.html HTMLifying blib\lib\Bio\Matrix\PSM\Psm.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\Psm.html HTMLifying blib\lib\Bio\Assembly\Singlet.pm -> blib\libhtml\site\lib\Bio\Assembly\Singlet.html HTMLifying blib\lib\Bio\AlignIO\maf.pm -> blib\libhtml\site\lib\Bio\AlignIO\maf.html HTMLifying blib\lib\Bio\SearchIO\Writer\GbrowseGFF.pm -> blib\libhtml\site\lib\Bio\SearchIO\Writer\GbrowseGFF.html HTMLifying blib\lib\Bio\Search\HSP\PSLHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\PSLHSP.html HTMLifying blib\lib\Bio\Biblio\MedlineJournalArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\MedlineJournalArticle.html HTMLifying blib\lib\Bio\Variation\AAChange.pm -> blib\libhtml\site\lib\Bio\Variation\AAChange.html HTMLifying blib\lib\Bio\DB\Query\GenBank.pm -> blib\libhtml\site\lib\Bio\DB\Query\GenBank.html HTMLifying blib\lib\Bio\Search\Hit\Fasta.pm -> blib\libhtml\site\lib\Bio\Search\Hit\Fasta.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\biofetch_oracle.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\biofetch_oracle.html HTMLifying blib\lib\Bio\DB\EMBL.pm -> blib\libhtml\site\lib\Bio\DB\EMBL.html HTMLifying blib\lib\Bio\Assembly\IO.pm -> blib\libhtml\site\lib\Bio\Assembly\IO.html HTMLifying blib\lib\Bio\Structure\StructureI.pm -> blib\libhtml\site\lib\Bio\Structure\StructureI.html HTMLifying blib\lib\Bio\LocatableSeq.pm -> blib\libhtml\site\lib\Bio\LocatableSeq.html HTMLifying blib\lib\Bio\Tools\Lucy.pm -> blib\libhtml\site\lib\Bio\Tools\Lucy.html HTMLifying blib\lib\Bio\Tools\Profile.pm -> blib\libhtml\site\lib\Bio\Tools\Profile.html HTMLifying blib\lib\Bio\Restriction\IO\itype2.pm -> blib\libhtml\site\lib\Bio\Restriction\IO\itype2.html HTMLifying blib\lib\Bio\Tools\Coil.pm -> blib\libhtml\site\lib\Bio\Tools\Coil.html HTMLifying blib\lib\Bio\Search\Result\BlastPullResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\BlastPullResult.html HTMLifying blib\lib\Bio\MapIO\fpc.pm -> blib\libhtml\site\lib\Bio\MapIO\fpc.html HTMLifying blib\lib\Bio\SeqFeature\Computation.pm -> blib\libhtml\sit./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysql.pm: cannot resolve L in paragraph 165. ./Build: blib\lib\Bio\DB\SeqFeature.pm: cannot resolve L in paragraph 107. ./Build: blib\lib\Bio\Restriction\Enzyme.pm: cannot resolve L in paragraph 214. ./Build: blib\lib\Bio\DB\SeqFeature\NormalizedTableFeatureI.pm: cannot resolve L in paragraph 12. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.pm: cannot resolve L in paragraph 44. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.pm: cannot resolve L in paragraph 44. e\lib\Bio\SeqFeature\Computation.html HTMLifying blib\lib\Bio\SearchIO\SearchWriterI.pm -> blib\libhtml\site\lib\Bio\SearchIO\SearchWriterI.html HTMLifying blib\lib\Bio\PrimarySeq.pm -> blib\libhtml\site\lib\Bio\PrimarySeq.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\mysql.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\mysql.html HTMLifying blib\lib\Bio\Ontology\Ontology.pm -> blib\libhtml\site\lib\Bio\Ontology\Ontology.html HTMLifying blib\lib\Bio\Map\PositionHandlerI.pm -> blib\libhtml\site\lib\Bio\Map\PositionHandlerI.html HTMLifying blib\lib\Bio\Tools\SeqPattern.pm -> blib\libhtml\site\lib\Bio\Tools\SeqPattern.html HTMLifying blib\lib\Bio\Tools\Analysis\DNA\ESEfinder.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\DNA\ESEfinder.html HTMLifying blib\lib\Bio\SeqIO\metafasta.pm -> blib\libhtml\site\lib\Bio\SeqIO\metafasta.html HTMLifying blib\lib\Bio\Location\Fuzzy.pm -> blib\libhtml\site\lib\Bio\Location\Fuzzy.html HTMLifying blib\lib\Bio\Taxonomy.pm -> blib\libhtml\site\lib\Bio\Taxonomy.html HTMLifying blib\lib\Bio\AlignIO\selex.pm -> blib\libhtml\site\lib\Bio\AlignIO\selex.html HTMLifying blib\lib\Bio\Map\LinkagePosition.pm -> blib\libhtml\site\lib\Bio\Map\LinkagePosition.html HTMLifying blib\lib\Bio\OntologyIO\goflat.pm -> blib\libhtml\site\lib\Bio\OntologyIO\goflat.html HTMLifying blib\lib\Bio\Annotation\Target.pm -> blib\libhtml\site\lib\Bio\Annotation\Target.html HTMLifying blib\lib\Bio\SearchIO\FastHitEventBuilder.pm -> blib\libhtml\site\lib\Bio\SearchIO\FastHitEventBuilder.html HTMLifying blib\lib\Bio\Search\HSP\HMMERHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\HMMERHSP.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\DBI\Pg.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\DBI\Pg.html HTMLifying blib\lib\Bio\SeqEvolution\Factory.pm -> blib\libhtml\site\lib\Bio\SeqEvolution\Factory.html HTMLifying blib\lib\Bio\ClusterIO\unigene.pm -> blib\libhtml\site\lib\Bio\ClusterIO\unigene.html HTMLifying blib\lib\Bio\DB\SeqFeature.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature.html HTMLifying blib\lib\Bio\Tree\TreeFunctionsI.pm -> blib\libhtml\site\lib\Bio\Tree\TreeFunctionsI.html HTMLifying blib\lib\Bio\Restriction\Enzyme.pm -> blib\libhtml\site\lib\Bio\Restriction\Enzyme.html HTMLifying blib\lib\Bio\Map\MappableI.pm -> blib\libhtml\site\lib\Bio\Map\MappableI.html HTMLifying blib\lib\Bio\DB\Biblio\eutils.pm -> blib\libhtml\site\lib\Bio\DB\Biblio\eutils.html HTMLifying blib\lib\Bio\Biblio\Book.pm -> blib\libhtml\site\lib\Bio\Biblio\Book.html HTMLifying blib\lib\Bio\Tree\AnnotatableNode.pm -> blib\libhtml\site\lib\Bio\Tree\AnnotatableNode.html HTMLifying blib\lib\Bio\Tools\Glimmer.pm -> blib\libhtml\site\lib\Bio\Tools\Glimmer.html HTMLifying blib\lib\Bio\Annotation\StructuredValue.pm -> blib\libhtml\site\lib\Bio\Annotation\StructuredValue.html HTMLifying blib\lib\Bio\LiveSeq\Mutation.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Mutation.html HTMLifying blib\lib\Bio\DB\TFBS\transfac_pro.pm -> blib\libhtml\site\lib\Bio\DB\TFBS\transfac_pro.html HTMLifying blib\lib\Bio\DB\SeqFeature\NormalizedTableFeatureI.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\NormalizedTableFeatureI.html HTMLifying blib\lib\Bio\SearchIO\infernal.pm -> blib\libhtml\site\lib\Bio\SearchIO\infernal.html HTMLifying blib\lib\Bio\Matrix\PSM\InstanceSiteI.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\InstanceSiteI.html HTMLifying blib\lib\Bio\SeqFeature\Tools\IDHandler.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Tools\IDHandler.html HTMLifying blib\lib\Bio\Coordinate\Result\Gap.pm -> blib\libhtml\site\lib\Bio\Coordinate\Result\Gap.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\pg.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\pg.html HTMLifying blib\lib\Bio\SeqIO\locuslink.pm -> blib\libhtml\site\lib\Bio\SeqIO\locuslink.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.html HTMLifying blib\lib\Bio\SeqFeature\Gene\Exon.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\Exon.html HTMLifying blib\lib\Bio\LiveSeq\Exon.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Ex./Build: blib\lib\Bio\DB\GFF\Featname.pm: cannot resolve L in paragraph 44. ./Build: blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm: cannot resolve L in paragraph 77. ./Build: blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm: cannot resolve L in paragraph 86. ./Build: blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm: cannot resolve L in paragraph 97. ./Build: blib\lib\Bio\SeqIO\embldriver.pm: cannot resolve L in paragraph 23. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 83. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 89. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 100. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 105. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 110. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 115. ./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L in paragraph 222. on.html HTMLifying blib\lib\Bio\DB\GFF\Featname.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Featname.html HTMLifying blib\lib\Bio\Map\EntityI.pm -> blib\libhtml\site\lib\Bio\Map\EntityI.html HTMLifying blib\lib\Bio\Tools\Sim4\Results.pm -> blib\libhtml\site\lib\Bio\Tools\Sim4\Results.html HTMLifying blib\lib\Bio\Tools\GFF.pm -> blib\libhtml\site\lib\Bio\Tools\GFF.html HTMLifying blib\lib\Bio\SearchIO\wise.pm -> blib\libhtml\site\lib\Bio\SearchIO\wise.html HTMLifying blib\lib\Bio\Cluster\FamilyI.pm -> blib\libhtml\site\lib\Bio\Cluster\FamilyI.html HTMLifying blib\lib\Bio\Coordinate\ResultI.pm -> blib\libhtml\site\lib\Bio\Coordinate\ResultI.html HTMLifying blib\lib\Bio\Tools\Tmhmm.pm -> blib\libhtml\site\lib\Bio\Tools\Tmhmm.html HTMLifying blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm -> blib\libhtml\site\lib\Bio\SearchIO\Writer\HTMLResultWriter.html HTMLifying blib\lib\Bio\SeqIO\FTHelper.pm -> blib\libhtml\site\lib\Bio\SeqIO\FTHelper.html HTMLifying blib\lib\Bio\Assembly\IO\ace.pm -> blib\libhtml\site\lib\Bio\Assembly\IO\ace.html HTMLifying blib\lib\Bio\Matrix\PSM\InstanceSite.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\InstanceSite.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_ensgene.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_ensgene.html HTMLifying blib\lib\Bio\SeqIO\pir.pm -> blib\libhtml\site\lib\Bio\SeqIO\pir.html HTMLifying blib\lib\Bio\SearchIO\erpin.pm -> blib\libhtml\site\lib\Bio\SearchIO\erpin.html HTMLifying blib\lib\Bio\SeqIO\qual.pm -> blib\libhtml\site\lib\Bio\SeqIO\qual.html HTMLifying blib\lib\Bio\Tools\EUtilities\Link.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Link.html HTMLifying blib\lib\Bio\Biblio\PubmedJournalArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\PubmedJournalArticle.html HTMLifying blib\lib\Bio\Tools\Phylo\Molphy\Result.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\Molphy\Result.html HTMLifying blib\lib\Bio\Restriction\IO\withrefm.pm -> blib\libhtml\site\lib\Bio\Restriction\IO\withrefm.html HTMLifying blib\lib\Bio\CodonUsage\Table.pm -> blib\libhtml\site\lib\Bio\CodonUsage\Table.html HTMLifying blib\lib\Bio\SearchIO\fasta.pm -> blib\libhtml\site\lib\Bio\SearchIO\fasta.html HTMLifying blib\lib\Bio\PopGen\MarkerI.pm -> blib\libhtml\site\lib\Bio\PopGen\MarkerI.html HTMLifying blib\lib\Bio\PhyloNetwork\GraphViz.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\GraphViz.html HTMLifying blib\lib\Bio\LiveSeq\IO\BioPerl.pm -> blib\libhtml\site\lib\Bio\LiveSeq\IO\BioPerl.html HTMLifying blib\lib\Bio\SeqFeature\Gene\Intron.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\Intron.html HTMLifying blib\lib\Bio\SeqIO\embldriver.pm -> blib\libhtml\site\lib\Bio\SeqIO\embldriver.html HTMLifying blib\lib\Bio\DB\WebDBSeqI.pm -> blib\libhtml\site\lib\Bio\DB\WebDBSeqI.html HTMLifying blib\lib\Bio\Map\Position.pm -> blib\libhtml\site\lib\Bio\Map\Position.html HTMLifying blib\lib\Bio\SeqIO\mbsout.pm -> blib\libhtml\site\lib\Bio\SeqIO\mbsout.html HTMLifying blib\lib\Bio\Biblio\TechReport.pm -> blib\libhtml\site\lib\Bio\Biblio\TechReport.html HTMLifying blib\lib\Bio\Structure\IO\pdb.pm -> blib\libhtml\site\lib\Bio\Structure\IO\pdb.html HTMLifying blib\lib\Bio\SeqIO\chaos.pm -> blib\libhtml\site\lib\Bio\SeqIO\chaos.html HTMLifying blib\lib\Bio\DB\Failover.pm -> blib\libhtml\site\lib\Bio\DB\Failover.html HTMLifying blib\lib\Bio\NexmlIO.pm -> blib\libhtml\site\lib\Bio\NexmlIO.html HTMLifying blib\lib\Bio\Biblio.pm -> blib\libhtml\site\lib\Bio\Biblio.html HTMLifying blib\lib\Bio\SearchIO\SearchResultEventBuilder.pm -> blib\libhtml\site\lib\Bio\SearchIO\SearchResultEventBuilder.html HTMLifying blib\lib\Bio\Tools\Genscan.pm -> blib\libhtml\site\lib\Bio\Tools\Genscan.html HTMLifying blib\lib\Bio\Tools\EUtilities\Summary\ItemContainerI.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Summary\ItemContainerI.html HTMLifying blib\lib\Bio\SeqIO\largefasta.pm -> blib\libhtml\site\lib\Bio\SeqIO\largefasta.html HTMLifying blib\lib\Bio\Tools\Alignment\Consed.pm -> blib\libhtml\site\lib\Bio\Tools\Alignment\Consed.html HTMLifying blib\lib\Bio\Matrix\Scoring.pm -> blib\libhtml\sit./Build: blib\lib\Bio\SeqIO\embl.pm: cannot resolve L in paragraph 23. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm: cannot resolve L in paragraph 183. ./Build: blib\lib\Bio\ClusterIO.pm: cannot resolve L in paragraph 29. ./Build: blib\lib\Bio\Search\Hit\HMMERHit.pm: cannot resolve L in paragraph 70. ./Build: blib\lib\Bio\Search\Hit\HMMERHit.pm: cannot resolve L in paragraph 78. e\lib\Bio\Matrix\Scoring.html HTMLifying blib\lib\Bio\Tools\HMMER\Results.pm -> blib\libhtml\site\lib\Bio\Tools\HMMER\Results.html HTMLifying blib\lib\Bio\SeqIO\embl.pm -> blib\libhtml\site\lib\Bio\SeqIO\embl.html HTMLifying blib\lib\Bio\Location\Atomic.pm -> blib\libhtml\site\lib\Bio\Location\Atomic.html HTMLifying blib\lib\Bio\SearchIO\XML\BlastHandler.pm -> blib\libhtml\site\lib\Bio\SearchIO\XML\BlastHandler.html HTMLifying blib\lib\Bio\LocationI.pm -> blib\libhtml\site\lib\Bio\LocationI.html HTMLifying blib\lib\Bio\Annotation\Reference.pm -> blib\libhtml\site\lib\Bio\Annotation\Reference.html HTMLifying blib\lib\Bio\Tools\Signalp.pm -> blib\libhtml\site\lib\Bio\Tools\Signalp.html HTMLifying blib\lib\Bio\AlignIO\stockholm.pm -> blib\libhtml\site\lib\Bio\AlignIO\stockholm.html HTMLifying blib\lib\Bio\Seq\LargeSeqI.pm -> blib\libhtml\site\lib\Bio\Seq\LargeSeqI.html HTMLifying blib\lib\Bio\Matrix\PSM\SiteMatrix.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\SiteMatrix.html HTMLifying blib\lib\Bio\Factory\ObjectBuilderI.pm -> blib\libhtml\site\lib\Bio\Factory\ObjectBuilderI.html HTMLifying blib\lib\Bio\Symbol\Symbol.pm -> blib\libhtml\site\lib\Bio\Symbol\Symbol.html HTMLifying blib\lib\Bio\PopGen\GenotypeI.pm -> blib\libhtml\site\lib\Bio\PopGen\GenotypeI.html HTMLifying blib\lib\Bio\Assembly\IO\tigr.pm -> blib\libhtml\site\lib\Bio\Assembly\IO\tigr.html HTMLifying blib\lib\Bio\Seq\SequenceTrace.pm -> blib\libhtml\site\lib\Bio\Seq\SequenceTrace.html HTMLifying blib\lib\Bio\PopGen\Marker.pm -> blib\libhtml\site\lib\Bio\PopGen\Marker.html HTMLifying blib\lib\Bio\SeqIO\gbdriver.pm -> blib\libhtml\site\lib\Bio\SeqIO\gbdriver.html HTMLifying blib\lib\Bio\SearchIO\hmmer_pull.pm -> blib\libhtml\site\lib\Bio\SearchIO\hmmer_pull.html HTMLifying blib\lib\Bio\Biblio\Person.pm -> blib\libhtml\site\lib\Bio\Biblio\Person.html HTMLifying blib\lib\Bio\Search\HSP\HmmpfamHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\HmmpfamHSP.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store.html HTMLifying blib\lib\Bio\ClusterI.pm -> blib\libhtml\site\lib\Bio\ClusterI.html HTMLifying blib\lib\Bio\SeqIO\strider.pm -> blib\libhtml\site\lib\Bio\SeqIO\strider.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\mysqlcmap.html HTMLifying blib\lib\Bio\ClusterIO.pm -> blib\libhtml\site\lib\Bio\ClusterIO.html HTMLifying blib\lib\Bio\Map\SimpleMap.pm -> blib\libhtml\site\lib\Bio\Map\SimpleMap.html HTMLifying blib\lib\Bio\Factory\AnalysisI.pm -> blib\libhtml\site\lib\Bio\Factory\AnalysisI.html HTMLifying blib\lib\Bio\PopGen\IO.pm -> blib\libhtml\site\lib\Bio\PopGen\IO.html HTMLifying blib\lib\Bio\DB\LocationI.pm -> blib\libhtml\site\lib\Bio\DB\LocationI.html HTMLifying blib\lib\Bio\FeatureIO\gtf.pm -> blib\libhtml\site\lib\Bio\FeatureIO\gtf.html HTMLifying blib\lib\Bio\FeatureIO\bed.pm -> blib\libhtml\site\lib\Bio\FeatureIO\bed.html HTMLifying blib\lib\Bio\Structure\Model.pm -> blib\libhtml\site\lib\Bio\Structure\Model.html HTMLifying blib\lib\Bio\FeatureIO\ptt.pm -> blib\libhtml\site\lib\Bio\FeatureIO\ptt.html HTMLifying blib\lib\Bio\Search\Hit\HMMERHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\HMMERHit.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\transcript.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\transcript.html HTMLifying blib\lib\Bio\IdCollectionI.pm -> blib\libhtml\site\lib\Bio\IdCollectionI.html HTMLifying blib\lib\Bio\Search\Result\ResultFactory.pm -> blib\libhtml\site\lib\Bio\Search\Result\ResultFactory.html HTMLifying blib\lib\Bio\Map\Clone.pm -> blib\libhtml\site\lib\Bio\Map\Clone.html HTMLifying blib\lib\Bio\Search\Iteration\GenericIteration.pm -> blib\libhtml\site\lib\Bio\Search\Iteration\GenericIteration.html HTMLifying blib\lib\Bio\PopGen\IO\csv.pm -> blib\libhtml\site\lib\Bio\PopGen\IO\csv.html HTMLifying blib\lib\Bio\OntologyIO\simplehierarchy.pm -> blib\libhtml\site\lib\Bio\OntologyIO\simplehierarchy.html HTMLifying blib\lib\Bio\PhyloNetwork\RandomFactory.pm -> blib\libhtml\site\lib\Bio\PhyloN./Build: blib\lib\Bio\Search\Hit\PullHitI.pm: cannot resolve L in paragraph 142. ./Build: blib\lib\Bio\Search\Hit\PullHitI.pm: cannot resolve L in paragraph 142. ./Build: blib\lib\Bio\Seq\Quality.pm: cannot resolve L in paragraph 26. ./Build: blib\lib\Bio\Search\Tiling\MapTiling.pm: cannot resolve L in paragraph 20. ./Build: blib\lib\Bio\Align\Graphics.pm: cannot resolve L in paragraph 205. etwork\RandomFactory.html HTMLifying blib\lib\Bio\Align\Utilities.pm -> blib\libhtml\site\lib\Bio\Align\Utilities.html HTMLifying blib\lib\Bio\Phenotype\MeSH\Twig.pm -> blib\libhtml\site\lib\Bio\Phenotype\MeSH\Twig.html HTMLifying blib\lib\Bio\Tools\SeqPattern\Backtranslate.pm -> blib\libhtml\site\lib\Bio\Tools\SeqPattern\Backtranslate.html HTMLifying blib\lib\Bio\Tools\Phylo\PAML\ModelResult.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\PAML\ModelResult.html HTMLifying blib\lib\Bio\Seq\QualI.pm -> blib\libhtml\site\lib\Bio\Seq\QualI.html HTMLifying blib\lib\Bio\Search\Hit\PullHitI.pm -> blib\libhtml\site\lib\Bio\Search\Hit\PullHitI.html HTMLifying blib\lib\Bio\Coordinate\Chain.pm -> blib\libhtml\site\lib\Bio\Coordinate\Chain.html HTMLifying blib\lib\Bio\SeqFeature\Gene\TranscriptI.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\TranscriptI.html HTMLifying blib\lib\Bio\WebAgent.pm -> blib\libhtml\site\lib\Bio\WebAgent.html HTMLifying blib\lib\Bio\Seq\Quality.pm -> blib\libhtml\site\lib\Bio\Seq\Quality.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22.html HTMLifying blib\lib\Bio\Tools\EUtilities\Summary.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Summary.html HTMLifying blib\lib\Bio\AnnotationI.pm -> blib\libhtml\site\lib\Bio\AnnotationI.html HTMLifying blib\lib\Bio\Variation\SNP.pm -> blib\libhtml\site\lib\Bio\Variation\SNP.html HTMLifying blib\lib\Bio\TreeIO\phyloxml.pm -> blib\libhtml\site\lib\Bio\TreeIO\phyloxml.html HTMLifying blib\lib\Bio\Search\Tiling\MapTiling.pm -> blib\libhtml\site\lib\Bio\Search\Tiling\MapTiling.html HTMLifying blib\lib\Bio\Map\PositionHandler.pm -> blib\libhtml\site\lib\Bio\Map\PositionHandler.html HTMLifying blib\lib\Bio\Map\OrderedPosition.pm -> blib\libhtml\site\lib\Bio\Map\OrderedPosition.html HTMLifying blib\lib\Bio\SeqIO\fasta.pm -> blib\libhtml\site\lib\Bio\SeqIO\fasta.html HTMLifying blib\lib\Bio\Align\Graphics.pm -> blib\libhtml\site\lib\Bio\Align\Graphics.html HTMLifying blib\lib\Bio\Align\ProteinStatistics.pm -> blib\libhtml\site\lib\Bio\Align\ProteinStatistics.html HTMLifying blib\lib\Bio\DasI.pm -> blib\libhtml\site\lib\Bio\DasI.html HTMLifying blib\lib\Bio\Seq\LargePrimarySeq.pm -> blib\libhtml\site\lib\Bio\Seq\LargePrimarySeq.html HTMLifying blib\lib\Bio\DB\GenericWebAgent.pm -> blib\libhtml\site\lib\Bio\DB\GenericWebAgent.html HTMLifying blib\lib\Bio\LiveSeq\Gene.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Gene.html HTMLifying blib\lib\Bio\Tools\ECnumber.pm -> blib\libhtml\site\lib\Bio\Tools\ECnumber.html HTMLifying blib\lib\Bio\Seq\SeqFastaSpeedFactory.pm -> blib\libhtml\site\lib\Bio\Seq\SeqFastaSpeedFactory.html HTMLifying blib\lib\Bio\Phenotype\OMIM\OMIMparser.pm -> blib\libhtml\site\lib\Bio\Phenotype\OMIM\OMIMparser.html HTMLifying blib\lib\Bio\DB\Flat\BinarySearch.pm -> blib\libhtml\site\lib\Bio\DB\Flat\BinarySearch.html HTMLifying blib\lib\Bio\SeqFeature\Gene\Promoter.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\Promoter.html HTMLifying blib\lib\Bio\Location\SplitLocationI.pm -> blib\libhtml\site\lib\Bio\Location\SplitLocationI.html HTMLifying blib\lib\Bio\SeqFeature\Primer.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Primer.html HTMLifying blib\lib\Bio\Ontology\SimpleGOEngine\GraphAdaptor.pm -> blib\libhtml\site\lib\Bio\Ontology\SimpleGOEngine\GraphAdaptor.html HTMLifying blib\lib\Bio\ParameterBaseI.pm -> blib\libhtml\site\lib\Bio\ParameterBaseI.html HTMLifying blib\lib\Bio\DB\Flat.pm -> blib\libhtml\site\lib\Bio\DB\Flat.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\none.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\none.html HTMLifying blib\lib\Bio\OntologyIO\dagflat.pm -> blib\libhtml\site\lib\Bio\OntologyIO\dagflat.html HTMLifying blib\lib\Bio\Tools\Primer\Feature.pm -> blib\libhtml\site\lib\Bio\Tools\Primer\Feature.html HTMLifying blib\lib\Bio\SeqFeature\Collection.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Collection.html HTMLifying blib\lib\Bio\Matrix\PhylipDist.pm -> blib\libhtml\site\lib\Bio\Matrix\PhylipDist.html HTMLifying blib\lib\Bio\Taxon./Build: blib\lib\Bio\DB\GFF\Adaptor\memory.pm: cannot resolve L in paragraph 22. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm: cannot resolve L in paragraph 56. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm: cannot resolve L in paragraph 56. ./Build: blib\lib\Bio\Search\Hit\HmmpfamHit.pm: cannot resolve L in paragraph 76. omy\Tree.pm -> blib\libhtml\site\lib\Bio\Taxonomy\Tree.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\memory.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\memory.html HTMLifying blib\lib\Bio\Factory\SeqAnalysisParserFactory.pm -> blib\libhtml\site\lib\Bio\Factory\SeqAnalysisParserFactory.html HTMLifying blib\lib\Bio\DBLinkContainerI.pm -> blib\libhtml\site\lib\Bio\DBLinkContainerI.html HTMLifying blib\lib\Bio\SeqIO\ace.pm -> blib\libhtml\site\lib\Bio\SeqIO\ace.html HTMLifying blib\lib\Bio\Search\Hit\PsiBlastHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\PsiBlastHit.html HTMLifying blib\lib\Bio\DB\EntrezGene.pm -> blib\libhtml\site\lib\Bio\DB\EntrezGene.html HTMLifying blib\lib\Bio\DB\SeqVersion.pm -> blib\libhtml\site\lib\Bio\DB\SeqVersion.html HTMLifying blib\lib\Bio\AlignIO\prodom.pm -> blib\libhtml\site\lib\Bio\AlignIO\prodom.html HTMLifying blib\lib\Bio\Das\FeatureTypeI.pm -> blib\libhtml\site\lib\Bio\Das\FeatureTypeI.html HTMLifying blib\lib\Bio\SeqFeature\Gene\Poly_A_site.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\Poly_A_site.html HTMLifying blib\lib\Bio\Tools\Primer3.pm -> blib\libhtml\site\lib\Bio\Tools\Primer3.html HTMLifying blib\lib\Bio\SeqIO\game\seqHandler.pm -> blib\libhtml\site\lib\Bio\SeqIO\game\seqHandler.html HTMLifying blib\lib\Bio\SearchIO.pm -> blib\libhtml\site\lib\Bio\SearchIO.html HTMLifying blib\lib\Bio\Tools\Run\GenericParameters.pm -> blib\libhtml\site\lib\Bio\Tools\Run\GenericParameters.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.html HTMLifying blib\lib\Bio\LiveSeq\IO\Loader.pm -> blib\libhtml\site\lib\Bio\LiveSeq\IO\Loader.html HTMLifying blib\lib\Bio\Search\Hit\HmmpfamHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\HmmpfamHit.html HTMLifying blib\lib\Bio\Tools\Primer\Assessor\Base.pm -> blib\libhtml\site\lib\Bio\Tools\Primer\Assessor\Base.html HTMLifying blib\lib\Bio\Ontology\Term.pm -> blib\libhtml\site\lib\Bio\Ontology\Term.html HTMLifying blib\lib\Bio\LiveSeq\Translation.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Translation.html HTMLifying blib\lib\Bio\SeqFeature\Gene\NC_Feature.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\NC_Feature.html HTMLifying blib\lib\Bio\Tree\TreeI.pm -> blib\libhtml\site\lib\Bio\Tree\TreeI.html HTMLifying blib\lib\Bio\Tools\Phylo\Gerp.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\Gerp.html HTMLifying blib\lib\Bio\Tools\EUtilities\Info\FieldInfo.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Info\FieldInfo.html HTMLifying blib\lib\Bio\Tools\EUtilities\History.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\History.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.html HTMLifying blib\lib\Bio\Seq.pm -> blib\libhtml\site\lib\Bio\Seq.html HTMLifying blib\lib\Bio\TreeIO\lintree.pm -> blib\libhtml\site\lib\Bio\TreeIO\lintree.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\biofetch.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\biofetch.html HTMLifying blib\lib\Bio\Ontology\InterProTerm.pm -> blib\libhtml\site\lib\Bio\Ontology\InterProTerm.html HTMLifying blib\lib\Bio\Tools\EUtilities\Info\LinkInfo.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Info\LinkInfo.html HTMLifying blib\lib\Bio\Biblio\Service.pm -> blib\libhtml\site\lib\Bio\Biblio\Service.html HTMLifying blib\lib\Bio\SeqIO\ztr.pm -> blib\libhtml\site\lib\Bio\SeqIO\ztr.html HTMLifying blib\lib\Bio\Tools\Gel.pm -> blib\libhtml\site\lib\Bio\Tools\Gel.html HTMLifying blib\lib\Bio\Search\Result\BlastResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\BlastResult.html HTMLifying blib\lib\Bio\Annotation\Collection.pm -> blib\libhtml\site\lib\Bio\Annotation\Collection.html HTMLifying blib\lib\Bio\Biblio\IO\medline2ref.pm -> blib\libhtml\site\lib\Bio\Biblio\IO\medline2ref.html HTMLifying blib\lib\Bio\Search\BlastUtils.pm -> blib\libhtml\site\lib\Bio\Search\BlastUtils.html HTMLifying blib\lib\Bio\Restriction\Enzyme\MultiSite.pm -> blib\libhtml\site\lib\Bio\Restriction\Enzyme\MultiSite.html HTMLifying blib\lib\Bio\Assembly\IO\phrap.pm -> blib\libhtml\site\lib\Bio\Assembly\IO\phrap.html HTMLifying blib\lib\Bio\Search\HSP\PsiBlastHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\PsiBlastHSP.html HTMLifying blib\lib\Bio\Assembly\ScaffoldI.pm -> blib\libhtml\site\lib\Bio\Assembly\ScaffoldI.html HTMLifying blib\lib\Bio\SeqIO\chaosxml.pm -> blib\libhtml\site\lib\Bio\SeqIO\chaosxml.html HTMLifying blib\lib\Bio\Biblio\IO.pm -> blib\libhtml\site\lib\Bio\Biblio\IO.html HTMLifying blib\lib\Bio\SeqIO\seqxml.pm -> blib\libhtml\site\lib\Bio\SeqIO\seqxml.html HTMLifying blib\lib\Bio\SearchIO\Writer\BSMLResultWriter.pm -> blib\libhtml\site\lib\Bio\SearchIO\Writer\BSMLResultWriter.html HTMLifying blib\lib\Bio\AlignIO\largemultifasta.pm -> blib\libhtml\site\lib\Bio\AlignIO\largemultifasta.html HTMLifying blib\lib\Bio\Biblio\IO\medlinexml.pm -> blib\libhtml\site\lib\Bio\Biblio\IO\medlinexml.html HTMLifying blib\lib\Bio\PhyloNetwork\FactoryX.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\FactoryX.html HTMLifying blib\lib\Bio\TreeIO\cluster.pm -> blib\libhtml\site\lib\Bio\TreeIO\cluster.html HTMLifying blib\lib\Bio\Root\Test.pm -> blib\libhtml\site\lib\Bio\Root\Test.html HTMLifying blib\lib\Bio\DB\EUtilities.pm -> blib\libhtml\site\lib\Bio\DB\EUtilities.html HTMLifying blib\lib\Bio\SearchIO\cross_match.pm -> blib\libhtml\site\lib\Bio\SearchIO\cross_match.html HTMLifying blib\lib\Bio\SeqIO\abi.pm -> blib\libhtml\site\lib\Bio\SeqIO\abi.html HTMLifying blib\lib\Bio\DB\Flat\BDB.pm -> blib\libhtml\site\lib\Bio\DB\Flat\BDB.html HTMLifying blib\lib\Bio\Map\TranscriptionFactor.pm -> blib\libhtml\site\lib\Bio\Map\TranscriptionFactor.html HTMLifying blib\lib\Bio\DB\Expression\geo.pm -> blib\libhtml\site\lib\Bio\DB\Expression\geo.html HTMLifying blib\lib\Bio\Matrix\IO.pm -> blib\libhtml\site\lib\Bio\Matrix\IO.html HTMLifying blib\lib\Bio\Matrix\PSM\IO.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\IO.html HTMLifying blib\lib\Bio\DB\Query\WebQuery.pm -> blib\libhtml\site\lib\Bio\DB\Query\WebQuery.html HTMLifying blib\lib\Bio\Variation\VariantI.pm -> blib\libhtml\site\lib\Bio\Variation\VariantI.html HTMLifying blib\lib\Bio\Tools\IUPAC.pm -> blib\libhtml\site\lib\Bio\Tools\IUPAC.html HTMLifying blib\lib\Bio\Root\Build.pm -> blib\libhtml\site\lib\Bio\Root\Build.html HTMLifying blib\lib\Bio\PopGen\Statistics.pm -> blib\libhtml\site\lib\Bio\PopGen\Statistics.html HTMLifying blib\lib\Bio\OntologyIO\InterProParser.pm -> blib\libhtml\site\lib\Bio\OntologyIO\InterProParser.html HTMLifying blib\lib\Bio\DB\BiblioI.pm -> blib\libhtml\site\lib\Bio\DB\BiblioI.html HTMLifying blib\lib\Bio\Symbol\AlphabetI.pm -> blib\libhtml\site\lib\Bio\Symbol\AlphabetI.html HTMLifying blib\lib\Bio\Species.pm -> blib\libhtml\site\lib\Bio\Species.html HTMLifying blib\lib\Bio\Tree\Tree.pm -> blib\libhtml\site\lib\Bio\Tree\Tree.html HTMLifying blib\lib\Bio\Search\Result\CrossMatchResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\CrossMatchResult.html HTMLifying blib\lib\Bio\DB\NCBIHelper.pm -> blib\libhtml\site\lib\Bio\DB\NCBIHelper.html HTMLifying blib\lib\Bio\Tools\Phylo\Gumby.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\Gumby.html HTMLifying blib\lib\Bio\DB\GFF\Util\Rearrange.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Util\Rearrange.html HTMLifying blib\lib\Bio\Index\Hmmer.pm -> blib\libhtml\site\lib\Bio\Index\Hmmer.html HTMLifying blib\lib\Bio\SeqFeature\Tools\TypeMapper.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Tools\TypeMapper.html HTMLifying blib\lib\Bio\DB\Biblio\soap.pm -> blib\libhtml\site\lib\Bio\DB\Biblio\soap.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\Mitoprot.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\Mitoprot.html HTMLifying blib\lib\Bio\DB\BioFetch.pm -> blib\libhtml\site\lib\Bio\DB\BioFetch.html HTMLifying blib\lib\Bio\AnalysisI.pm -> blib\libhtml\site\lib\Bio\AnalysisI.html HTMLifying blib\lib\Bio\SearchIO\blast_pull.pm -> blib\libhtml\site\lib\Bio\SearchIO\blast_pull.html HTMLifying blib\lib\Bio\Event\EventHandlerI.pm -> blib\libhtml\site\lib\Bio\Event\EventHandlerI.html HTMLifying blib\lib\Bio\SeqFeature\Gene\GeneStructu./Build: blib\lib\Bio\DB\SeqFeature\Store\Loader.pm: cannot resolve L in paragraph 187. ./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L in paragraph 126. ./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L in paragraph 126. ./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L in paragraph 136. ./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L in paragraph 136. re.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\GeneStructure.html HTMLifying blib\lib\Bio\Biblio\Thesis.pm -> blib\libhtml\site\lib\Bio\Biblio\Thesis.html HTMLifying blib\lib\Bio\Tools\Blat.pm -> blib\libhtml\site\lib\Bio\Tools\Blat.html HTMLifying blib\lib\Bio\SeqIO\bsml_sax.pm -> blib\libhtml\site\lib\Bio\SeqIO\bsml_sax.html HTMLifying blib\lib\Bio\Coordinate\Pair.pm -> blib\libhtml\site\lib\Bio\Coordinate\Pair.html HTMLifying blib\lib\Bio\SeqIO\kegg.pm -> blib\libhtml\site\lib\Bio\SeqIO\kegg.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\FeatureFileLoader.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\FeatureFileLoader.html HTMLifying blib\lib\Bio\AlignIO\pfam.pm -> blib\libhtml\site\lib\Bio\AlignIO\pfam.html HTMLifying blib\lib\Bio\Variation\RNAChange.pm -> blib\libhtml\site\lib\Bio\Variation\RNAChange.html HTMLifying blib\lib\Bio\SeqFeatureI.pm -> blib\libhtml\site\lib\Bio\SeqFeatureI.html HTMLifying blib\lib\Bio\DB\Flat\BDB\genbank.pm -> blib\libhtml\site\lib\Bio\DB\Flat\BDB\genbank.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\clone.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\clone.html HTMLifying blib\lib\Bio\SeqFeature\SimilarityPair.pm -> blib\libhtml\site\lib\Bio\SeqFeature\SimilarityPair.html HTMLifying blib\lib\Bio\Tools\ERPIN.pm -> blib\libhtml\site\lib\Bio\Tools\ERPIN.html HTMLifying blib\lib\Bio\SeqIO\scf.pm -> blib\libhtml\site\lib\Bio\SeqIO\scf.html HTMLifying blib\lib\Bio\Tools\Run\WrapperBase.pm -> blib\libhtml\site\lib\Bio\Tools\Run\WrapperBase.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\Loader.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\Loader.html HTMLifying blib\lib\Bio\Tools\Run\StandAloneWUBlast.pm -> blib\libhtml\site\lib\Bio\Tools\Run\StandAloneWUBlast.html HTMLifying blib\lib\Bio\Tools\Prediction\Gene.pm -> blib\libhtml\site\lib\Bio\Tools\Prediction\Gene.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\Sopma.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\Sopma.html HTMLifying blib\lib\Bio\Tools\Prints.pm -> blib\libhtml\site\lib\Bio\Tools\Prints.html HTMLifying blib\lib\Bio\Index\SwissPfam.pm -> blib\libhtml\site\lib\Bio\Index\SwissPfam.html HTMLifying blib\lib\Bio\Tools\Alignment\Trim.pm -> blib\libhtml\site\lib\Bio\Tools\Alignment\Trim.html HTMLifying blib\lib\Bio\SeqIO\tab.pm -> blib\libhtml\site\lib\Bio\SeqIO\tab.html HTMLifying blib\lib\Bio\Coordinate\Utils.pm -> blib\libhtml\site\lib\Bio\Coordinate\Utils.html HTMLifying blib\lib\Bio\DB\HIV.pm -> blib\libhtml\site\lib\Bio\DB\HIV.html HTMLifying blib\lib\Bio\Root\Test\Warn.pm -> blib\libhtml\site\lib\Bio\Root\Test\Warn.html HTMLifying blib\lib\Bio\FeatureIO\interpro.pm -> blib\libhtml\site\lib\Bio\FeatureIO\interpro.html HTMLifying blib\lib\Bio\Tools\Promoterwise.pm -> blib\libhtml\site\lib\Bio\Tools\Promoterwise.html HTMLifying blib\lib\Bio\Root\Utilities.pm -> blib\libhtml\site\lib\Bio\Root\Utilities.html HTMLifying blib\lib\Bio\DB\SeqVersion\gi.pm -> blib\libhtml\site\lib\Bio\DB\SeqVersion\gi.html HTMLifying blib\lib\Bio\Matrix\PSM\PsmHeaderI.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\PsmHeaderI.html HTMLifying blib\lib\Bio\Map\MarkerI.pm -> blib\libhtml\site\lib\Bio\Map\MarkerI.html HTMLifying blib\lib\Bio\SeqIO\raw.pm -> blib\libhtml\site\lib\Bio\SeqIO\raw.html HTMLifying blib\lib\Bio\Perl.pm -> blib\libhtml\site\lib\Bio\Perl.html HTMLifying blib\lib\Bio\Tools\Infernal.pm -> blib\libhtml\site\lib\Bio\Tools\Infernal.html HTMLifying blib\lib\Bio\PopGen\TagHaplotype.pm -> blib\libhtml\site\lib\Bio\PopGen\TagHaplotype.html HTMLifying blib\lib\Bio\PopGen\Simulation\GeneticDrift.pm -> blib\libhtml\site\lib\Bio\PopGen\Simulation\GeneticDrift.html HTMLifying blib\lib\Bio\Factory\ObjectFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\ObjectFactoryI.html HTMLifying blib\lib\Bio\Search\Hit\HitI.pm -> blib\libhtml\site\lib\Bio\Search\Hit\HitI.html HTMLifying blib\lib\Bio\SeqIO\game.pm -> blib\libhtml\site\lib\Bio\SeqIO\game.html HTMLifying blib\lib\Bio\SearchIO\axt.pm -> blib\libhtml\site\lib\Bio\SearchIO\axt.html HTMLifying blib\lib\Bio\AnalysisParserI.pm -> bli./Build: blib\lib\Bio\FeatureIO.pm: cannot resolve L in paragraph 55. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\oracleace.pm: cannot resolve L in paragraph 8. ./Build: blib\lib\Bio\Tools\Run\RemoteBlast.pm: cannot resolve L in paragraph 36. ./Build: blib\lib\Bio\Search\Result\HMMERResult.pm: cannot resolve L in paragraph 9. b\libhtml\site\lib\Bio\AnalysisParserI.html HTMLifying blib\lib\Bio\Phenotype\MeSH\Term.pm -> blib\libhtml\site\lib\Bio\Phenotype\MeSH\Term.html HTMLifying blib\lib\Bio\AlignIO\po.pm -> blib\libhtml\site\lib\Bio\AlignIO\po.html HTMLifying blib\lib\Bio\DB\RandomAccessI.pm -> blib\libhtml\site\lib\Bio\DB\RandomAccessI.html HTMLifying blib\lib\Bio\Biblio\BookArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\BookArticle.html HTMLifying blib\lib\Bio\SearchIO\sim4.pm -> blib\libhtml\site\lib\Bio\SearchIO\sim4.html HTMLifying blib\lib\Bio\Search\StatisticsI.pm -> blib\libhtml\site\lib\Bio\Search\StatisticsI.html HTMLifying blib\lib\Bio\Factory\SeqAnalysisParserFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\SeqAnalysisParserFactoryI.html HTMLifying blib\lib\Bio\PopGen\IO\hapmap.pm -> blib\libhtml\site\lib\Bio\PopGen\IO\hapmap.html HTMLifying blib\lib\Bio\LiveSeq\Range.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Range.html HTMLifying blib\lib\Bio\Variation\AAReverseMutate.pm -> blib\libhtml\site\lib\Bio\Variation\AAReverseMutate.html HTMLifying blib\lib\Bio\Tools\EUtilities\Info.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Info.html HTMLifying blib\lib\Bio\Biblio\Ref.pm -> blib\libhtml\site\lib\Bio\Biblio\Ref.html HTMLifying blib\lib\Bio\SeqIO\nexml.pm -> blib\libhtml\site\lib\Bio\SeqIO\nexml.html HTMLifying blib\lib\Bio\Root\HTTPget.pm -> blib\libhtml\site\lib\Bio\Root\HTTPget.html HTMLifying blib\lib\Bio\Phenotype\Phenotype.pm -> blib\libhtml\site\lib\Bio\Phenotype\Phenotype.html HTMLifying blib\lib\Bio\Annotation\DBLink.pm -> blib\libhtml\site\lib\Bio\Annotation\DBLink.html HTMLifying blib\lib\Bio\FeatureIO.pm -> blib\libhtml\site\lib\Bio\FeatureIO.html HTMLifying blib\lib\Bio\DB\Expression.pm -> blib\libhtml\site\lib\Bio\DB\Expression.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\oracleace.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\oracleace.html HTMLifying blib\lib\Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm -> blib\libhtml\site\lib\Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.html HTMLifying blib\lib\Bio\Tools\EUtilities\HistoryI.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\HistoryI.html HTMLifying blib\lib\Bio\Index\Stockholm.pm -> blib\libhtml\site\lib\Bio\Index\Stockholm.html HTMLifying blib\lib\Bio\Tools\Run\RemoteBlast.pm -> blib\libhtml\site\lib\Bio\Tools\Run\RemoteBlast.html HTMLifying blib\lib\Bio\Search\Result\HMMERResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\HMMERResult.html HTMLifying blib\lib\Bio\Search\HSP\PullHSPI.pm -> blib\libhtml\site\lib\Bio\Search\HSP\PullHSPI.html HTMLifying blib\lib\Bio\Root\Version.pm -> blib\libhtml\site\lib\Bio\Root\Version.html HTMLifying blib\lib\Bio\PullParserI.pm -> blib\libhtml\site\lib\Bio\PullParserI.html HTMLifying blib\lib\Bio\Map\FPCMarker.pm -> blib\libhtml\site\lib\Bio\Map\FPCMarker.html HTMLifying blib\lib\Bio\DB\RefSeq.pm -> blib\libhtml\site\lib\Bio\DB\RefSeq.html HTMLifying blib\lib\Bio\DB\Taxonomy.pm -> blib\libhtml\site\lib\Bio\DB\Taxonomy.html HTMLifying blib\lib\Bio\SeqIO\game\gameWriter.pm -> blib\libhtml\site\lib\Bio\SeqIO\game\gameWriter.html HTMLifying blib\lib\Bio\Tools\pSW.pm -> blib\libhtml\site\lib\Bio\Tools\pSW.html HTMLifying blib\lib\Bio\Tools\RNAMotif.pm -> blib\libhtml\site\lib\Bio\Tools\RNAMotif.html HTMLifying blib\lib\Bio\SeqIO\game\featHandler.pm -> blib\libhtml\site\lib\Bio\SeqIO\game\featHandler.html HTMLifying blib\lib\Bio\Factory\TreeFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\TreeFactoryI.html HTMLifying blib\lib\Bio\Tools\RepeatMasker.pm -> blib\libhtml\site\lib\Bio\Tools\RepeatMasker.html HTMLifying blib\lib\Bio\SearchIO\hmmer2.pm -> blib\libhtml\site\lib\Bio\SearchIO\hmmer2.html HTMLifying blib\lib\Bio\Map\Prediction.pm -> blib\libhtml\site\lib\Bio\Map\Prediction.html HTMLifying blib\lib\Bio\AlignIO\psi.pm -> blib\libhtml\site\lib\Bio\AlignIO\psi.html HTMLifying blib\lib\Bio\Biblio\JournalArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\JournalArticle.html HTMLifying blib\lib\Bio\OntologyIO\soflat.pm -> blib\libhtml\site\lib\Bio\OntologyIO\soflat.html HTMLifying bl./Build: blib\lib\Bio\Search\Hit\GenericHit.pm: cannot resolve L in paragraph 134. ./Build: blib\lib\Bio\SeqIO\genbank.pm: cannot resolve L in paragraph 22. ./Build: blib\lib\Bio\Structure\IO.pm: cannot resolve L in paragraph 56. ib\lib\Bio\Ontology\TermI.pm -> blib\libhtml\site\lib\Bio\Ontology\TermI.html HTMLifying blib\lib\Bio\Search\GenericDatabase.pm -> blib\libhtml\site\lib\Bio\Search\GenericDatabase.html HTMLifying blib\lib\Bio\PhyloNetwork.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork.html HTMLifying blib\lib\Bio\Map\RelativeI.pm -> blib\libhtml\site\lib\Bio\Map\RelativeI.html HTMLifying blib\lib\Bio\PhyloNetwork\TreeFactory.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\TreeFactory.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\berkeleydb\iterator.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\berkeleydb\iterator.html HTMLifying blib\lib\Bio\Variation\SeqDiff.pm -> blib\libhtml\site\lib\Bio\Variation\SeqDiff.html HTMLifying blib\lib\Bio\Biblio\PubmedArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\PubmedArticle.html HTMLifying blib\lib\Bio\TreeIO\svggraph.pm -> blib\libhtml\site\lib\Bio\TreeIO\svggraph.html HTMLifying blib\lib\Bio\DB\GFF\Util\Binning.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Util\Binning.html HTMLifying blib\lib\Bio\Tools\Phylo\PAML.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\PAML.html HTMLifying blib\lib\Bio\Tools\CodonTable.pm -> blib\libhtml\site\lib\Bio\Tools\CodonTable.html HTMLifying blib\lib\Bio\Tools\EUtilities\Summary\DocSum.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Summary\DocSum.html HTMLifying blib\lib\Bio\SeqIO\alf.pm -> blib\libhtml\site\lib\Bio\SeqIO\alf.html HTMLifying blib\lib\Bio\Coordinate\Graph.pm -> blib\libhtml\site\lib\Bio\Coordinate\Graph.html HTMLifying blib\lib\Bio\AnalysisResultI.pm -> blib\libhtml\site\lib\Bio\AnalysisResultI.html HTMLifying blib\lib\Bio\Seq\TraceI.pm -> blib\libhtml\site\lib\Bio\Seq\TraceI.html HTMLifying blib\lib\Bio\SearchIO\gmap_f9.pm -> blib\libhtml\site\lib\Bio\SearchIO\gmap_f9.html HTMLifying blib\lib\Bio\Search\Hit\GenericHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\GenericHit.html HTMLifying blib\lib\Bio\Tools\EPCR.pm -> blib\libhtml\site\lib\Bio\Tools\EPCR.html HTMLifying blib\lib\Bio\DB\FileCache.pm -> blib\libhtml\site\lib\Bio\DB\FileCache.html HTMLifying blib\lib\Bio\DB\Taxonomy\entrez.pm -> blib\libhtml\site\lib\Bio\DB\Taxonomy\entrez.html HTMLifying blib\lib\Bio\Biblio\IO\pubmedxml.pm -> blib\libhtml\site\lib\Bio\Biblio\IO\pubmedxml.html HTMLifying blib\lib\Bio\Factory\LocationFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\LocationFactoryI.html HTMLifying blib\lib\Bio\Taxonomy\Taxon.pm -> blib\libhtml\site\lib\Bio\Taxonomy\Taxon.html HTMLifying blib\lib\Bio\DB\GFF.pm -> blib\libhtml\site\lib\Bio\DB\GFF.html HTMLifying blib\lib\Bio\SeqIO\excel.pm -> blib\libhtml\site\lib\Bio\SeqIO\excel.html HTMLifying blib\lib\Bio\Taxon.pm -> blib\libhtml\site\lib\Bio\Taxon.html HTMLifying blib\lib\Bio\SeqIO\chadoxml.pm -> blib\libhtml\site\lib\Bio\SeqIO\chadoxml.html HTMLifying blib\lib\Bio\Align\StatisticsI.pm -> blib\libhtml\site\lib\Bio\Align\StatisticsI.html HTMLifying blib\lib\Bio\SeqIO\genbank.pm -> blib\libhtml\site\lib\Bio\SeqIO\genbank.html HTMLifying blib\lib\Bio\Structure\IO.pm -> blib\libhtml\site\lib\Bio\Structure\IO.html HTMLifying blib\lib\Bio\Restriction\Enzyme\MultiCut.pm -> blib\libhtml\site\lib\Bio\Restriction\Enzyme\MultiCut.html HTMLifying blib\lib\Bio\AnnotationCollectionI.pm -> blib\libhtml\site\lib\Bio\AnnotationCollectionI.html HTMLifying blib\lib\Bio\Root\Storable.pm -> blib\libhtml\site\lib\Bio\Root\Storable.html HTMLifying blib\lib\Bio\DB\TFBS.pm -> blib\libhtml\site\lib\Bio\DB\TFBS.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator.html HTMLifying blib\lib\Bio\Structure\Entry.pm -> blib\libhtml\site\lib\Bio\Structure\Entry.html HTMLifying blib\lib\Bio\DB\Registry.pm -> blib\libhtml\site\lib\Bio\DB\Registry.html HTMLifying blib\lib\Bio\LiveSeq\Repeat_Unit.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Repeat_Unit.html HTMLifying blib\lib\Bio\Biblio\BiblioBase.pm -> blib\libhtml\site\lib\Bio\Biblio\BiblioBase.html HTMLifying blib\lib\Bio\Tree\RandomFactory.pm -> blib\libhtml\site\lib\Bio\Tree\RandomFactory.html HTMLifying blib\lib\Bio\Tools\EUtilities\Query.pm -> blib\lib./Build: blib\lib\Bio\Search\Hit\ModelHit.pm: cannot resolve L in paragraph 104. ./Build: blib\lib\Bio\Search\Hit\ModelHit.pm: cannot resolve L in paragraph 104. ./Build: blib\lib\Bio\Search\Result\hmmer3Result.pm: cannot resolve L in paragraph 15. ./Build: blib\lib\Bio\DB\SeqFeature\Store\berkeleydb3.pm: cannot resolve L in paragraph 15. html\site\lib\Bio\Tools\EUtilities\Query.html HTMLifying blib\lib\Bio\Search\HSP\WABAHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\WABAHSP.html HTMLifying blib\lib\Bio\Factory\SequenceFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\SequenceFactoryI.html HTMLifying blib\lib\Bio\DB\UpdateableSeqI.pm -> blib\libhtml\site\lib\Bio\DB\UpdateableSeqI.html HTMLifying blib\lib\Bio\Seq\Meta.pm -> blib\libhtml\site\lib\Bio\Seq\Meta.html HTMLifying blib\lib\Bio\SeqFeature\SiRNA\Pair.pm -> blib\libhtml\site\lib\Bio\SeqFeature\SiRNA\Pair.html HTMLifying blib\lib\Bio\Tools\Phylo\Molphy.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\Molphy.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_unigene.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_unigene.html HTMLifying blib\lib\Bio\Map\GenePosition.pm -> blib\libhtml\site\lib\Bio\Map\GenePosition.html HTMLifying blib\lib\Bio\Restriction\Analysis.pm -> blib\libhtml\site\lib\Bio\Restriction\Analysis.html HTMLifying blib\lib\Bio\Search\HSP\GenericHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\GenericHSP.html HTMLifying blib\lib\Bio\Coordinate\GeneMapper.pm -> blib\libhtml\site\lib\Bio\Coordinate\GeneMapper.html HTMLifying blib\lib\Bio\Ontology\PathI.pm -> blib\libhtml\site\lib\Bio\Ontology\PathI.html HTMLifying blib\lib\Bio\Search\Hit\ModelHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\ModelHit.html HTMLifying blib\lib\Bio\Search\Result\hmmer3Result.pm -> blib\libhtml\site\lib\Bio\Search\Result\hmmer3Result.html HTMLifying blib\lib\Bio\PhyloNetwork\TreeFactoryMulti.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\TreeFactoryMulti.html HTMLifying blib\lib\Bio\Tools\AnalysisResult.pm -> blib\libhtml\site\lib\Bio\Tools\AnalysisResult.html HTMLifying blib\lib\Bio\SearchIO\XML\PsiBlastHandler.pm -> blib\libhtml\site\lib\Bio\SearchIO\XML\PsiBlastHandler.html HTMLifying blib\lib\Bio\Nexml\Factory.pm -> blib\libhtml\site\lib\Bio\Nexml\Factory.html HTMLifying blib\lib\Bio\LiveSeq\SeqI.pm -> blib\libhtml\site\lib\Bio\LiveSeq\SeqI.html HTMLifying blib\lib\Bio\Factory\FTLocationFactory.pm -> blib\libhtml\site\lib\Bio\Factory\FTLocationFactory.html HTMLifying blib\lib\Bio\Index\Fastq.pm -> blib\libhtml\site\lib\Bio\Index\Fastq.html HTMLifying blib\lib\Bio\Matrix\IO\phylip.pm -> blib\libhtml\site\lib\Bio\Matrix\IO\phylip.html HTMLifying blib\lib\Bio\DB\GenPept.pm -> blib\libhtml\site\lib\Bio\DB\GenPept.html HTMLifying blib\lib\Bio\Tools\SiRNA.pm -> blib\libhtml\site\lib\Bio\Tools\SiRNA.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\berkeleydb3.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\berkeleydb3.html HTMLifying blib\lib\Bio\Matrix\PSM\ProtMatrix.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\ProtMatrix.html HTMLifying blib\lib\Bio\Ontology\OntologyStore.pm -> blib\libhtml\site\lib\Bio\Ontology\OntologyStore.html HTMLifying blib\lib\Bio\Tools\AlignFactory.pm -> blib\libhtml\site\lib\Bio\Tools\AlignFactory.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_twinscan.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_twinscan.html HTMLifying blib\lib\Bio\Align\PairwiseStatistics.pm -> blib\libhtml\site\lib\Bio\Align\PairwiseStatistics.html HTMLifying blib\lib\Bio\DB\Ace.pm -> blib\libhtml\site\lib\Bio\DB\Ace.html HTMLifying blib\lib\Bio\Seq\LargeLocatableSeq.pm -> blib\libhtml\site\lib\Bio\Seq\LargeLocatableSeq.html HTMLifying blib\lib\Bio\Assembly\ContigAnalysis.pm -> blib\libhtml\site\lib\Bio\Assembly\ContigAnalysis.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_acembly.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_acembly.html HTMLifying blib\lib\Bio\SeqIO\gbxml.pm -> blib\libhtml\site\lib\Bio\SeqIO\gbxml.html HTMLifying blib\lib\Bio\SeqIO\agave.pm -> blib\libhtml\site\lib\Bio\SeqIO\agave.html HTMLifying blib\lib\Bio\SeqFeature\Annotated.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Annotated.html HTMLifying blib\lib\Bio\Index\Swissprot.pm -> blib\libhtml\site\lib\Bio\Index\Swissprot.html HTMLifying blib\lib\Bio\MapIO\mapmaker.pm -> blib\libhtml\site\lib\Bio\MapIO\mapmaker.html HTMLifying blib\lib\Bio\SearchIO\Writer\TextResultWriter.pm -./Build: blib\lib\Bio\DB\Fasta.pm: cannot resolve L in paragraph 123. ./Build: blib\lib\Bio\DB\SeqFeature\Store\berkeleydb.pm: cannot resolve L in paragraph 264. > blib\libhtml\site\lib\Bio\SearchIO\Writer\TextResultWriter.html HTMLifying blib\lib\Bio\SeqFeature\CollectionI.pm -> blib\libhtml\site\lib\Bio\SeqFeature\CollectionI.html HTMLifying blib\lib\Bio\SearchIO\Writer\HitTableWriter.pm -> blib\libhtml\site\lib\Bio\SearchIO\Writer\HitTableWriter.html HTMLifying blib\lib\Bio\SearchIO\megablast.pm -> blib\libhtml\site\lib\Bio\SearchIO\megablast.html HTMLifying blib\lib\Bio\Assembly\Tools\ContigSpectrum.pm -> blib\libhtml\site\lib\Bio\Assembly\Tools\ContigSpectrum.html HTMLifying blib\lib\Bio\Matrix\PSM\IO\masta.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\IO\masta.html HTMLifying blib\lib\Bio\Cluster\SequenceFamily.pm -> blib\libhtml\site\lib\Bio\Cluster\SequenceFamily.html HTMLifying blib\lib\Bio\Factory\DriverFactory.pm -> blib\libhtml\site\lib\Bio\Factory\DriverFactory.html HTMLifying blib\lib\Bio\SeqIO\asciitree.pm -> blib\libhtml\site\lib\Bio\SeqIO\asciitree.html HTMLifying blib\lib\Bio\Search\Tiling\TilingI.pm -> blib\libhtml\site\lib\Bio\Search\Tiling\TilingI.html HTMLifying blib\lib\Bio\LiveSeq\Repeat_Region.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Repeat_Region.html HTMLifying blib\lib\Bio\UpdateableSeqI.pm -> blib\libhtml\site\lib\Bio\UpdateableSeqI.html HTMLifying blib\lib\Bio\PhyloNetwork\Factory.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\Factory.html HTMLifying blib\lib\Bio\Factory\SequenceStreamI.pm -> blib\libhtml\site\lib\Bio\Factory\SequenceStreamI.html HTMLifying blib\lib\Bio\Variation\DNAMutation.pm -> blib\libhtml\site\lib\Bio\Variation\DNAMutation.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\NetPhos.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\NetPhos.html HTMLifying blib\lib\Bio\Tools\Spidey\Exon.pm -> blib\libhtml\site\lib\Bio\Tools\Spidey\Exon.html HTMLifying blib\lib\Bio\Assembly\IO\bowtie.pm -> blib\libhtml\site\lib\Bio\Assembly\IO\bowtie.html HTMLifying blib\lib\Bio\AlignIO\Handler\GenericAlignHandler.pm -> blib\libhtml\site\lib\Bio\AlignIO\Handler\GenericAlignHandler.html HTMLifying blib\lib\Bio\Taxonomy\FactoryI.pm -> blib\libhtml\site\lib\Bio\Taxonomy\FactoryI.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\processed_transcript.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\processed_transcript.html HTMLifying blib\lib\Bio\OntologyIO.pm -> blib\libhtml\site\lib\Bio\OntologyIO.html HTMLifying blib\lib\Bio\DB\Fasta.pm -> blib\libhtml\site\lib\Bio\DB\Fasta.html HTMLifying blib\lib\Bio\SeqFeature\Similarity.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Similarity.html HTMLifying blib\lib\Bio\Coordinate\MapperI.pm -> blib\libhtml\site\lib\Bio\Coordinate\MapperI.html HTMLifying blib\lib\Bio\Biblio\Patent.pm -> blib\libhtml\site\lib\Bio\Biblio\Patent.html HTMLifying blib\lib\Bio\Tools\Geneid.pm -> blib\libhtml\site\lib\Bio\Tools\Geneid.html HTMLifying blib\lib\Bio\Cluster\ClusterFactory.pm -> blib\libhtml\site\lib\Bio\Cluster\ClusterFactory.html HTMLifying blib\lib\Bio\Matrix\MatrixI.pm -> blib\libhtml\site\lib\Bio\Matrix\MatrixI.html HTMLifying blib\lib\Bio\Ontology\SimpleOntologyEngine.pm -> blib\libhtml\site\lib\Bio\Ontology\SimpleOntologyEngine.html HTMLifying blib\lib\Bio\Matrix\Mlagan.pm -> blib\libhtml\site\lib\Bio\Matrix\Mlagan.html HTMLifying blib\lib\Bio\Restriction\IO.pm -> blib\libhtml\site\lib\Bio\Restriction\IO.html HTMLifying blib\lib\Bio\Coordinate\Collection.pm -> blib\libhtml\site\lib\Bio\Coordinate\Collection.html HTMLifying blib\lib\Bio\Matrix\PSM\SiteMatrixI.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\SiteMatrixI.html HTMLifying blib\lib\Bio\Search\Processor.pm -> blib\libhtml\site\lib\Bio\Search\Processor.html HTMLifying blib\lib\Bio\Map\Contig.pm -> blib\libhtml\site\lib\Bio\Map\Contig.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\berkeleydb.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\berkeleydb.html HTMLifying blib\lib\Bio\Ontology\Relationship.pm -> blib\libhtml\site\lib\Bio\Ontology\Relationship.html HTMLifying blib\lib\Bio\SeqIO\ctf.pm -> blib\libhtml\site\lib\Bio\SeqIO\ctf.html HTMLifying blib\lib\Bio\Ontology\OBOEngine.pm -> blib\libhtml\site\lib\Bio\Ontology\OBOEn./Build: blib\lib\Bio\DB\SeqFeature\Store\LoadHelper.pm: cannot resolve L in paragraph 9. ./Build: blib\lib\Bio\DB\DBFetch.pm: cannot resolve LEwww.ebi.ac.ukEcgi-binEdbfetch> in paragraph 8. gine.html HTMLifying blib\lib\Bio\Assembly\Scaffold.pm -> blib\libhtml\site\lib\Bio\Assembly\Scaffold.html HTMLifying blib\lib\Bio\AlignIO\clustalw.pm -> blib\libhtml\site\lib\Bio\AlignIO\clustalw.html HTMLifying blib\lib\Bio\Map\Gene.pm -> blib\libhtml\site\lib\Bio\Map\Gene.html HTMLifying blib\lib\Bio\Search\Hit\BlastHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\BlastHit.html HTMLifying blib\lib\Bio\DB\QueryI.pm -> blib\libhtml\site\lib\Bio\DB\QueryI.html HTMLifying blib\lib\Bio\Symbol\ProteinAlphabet.pm -> blib\libhtml\site\lib\Bio\Symbol\ProteinAlphabet.html HTMLifying blib\lib\Bio\Biblio\MedlineBookArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\MedlineBookArticle.html HTMLifying blib\lib\Bio\AlignIO\nexml.pm -> blib\libhtml\site\lib\Bio\AlignIO\nexml.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\DBI\SQLite.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\DBI\SQLite.html HTMLifying blib\lib\Bio\AnnotatableI.pm -> blib\libhtml\site\lib\Bio\AnnotatableI.html HTMLifying blib\lib\Bio\SearchIO\EventHandlerI.pm -> blib\libhtml\site\lib\Bio\SearchIO\EventHandlerI.html HTMLifying blib\lib\Bio\Tools\Hmmpfam.pm -> blib\libhtml\site\lib\Bio\Tools\Hmmpfam.html HTMLifying blib\lib\Bio\Map\Physical.pm -> blib\libhtml\site\lib\Bio\Map\Physical.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\orf.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\orf.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_genscan.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_genscan.html HTMLifying blib\lib\Bio\Index\Qual.pm -> blib\libhtml\site\lib\Bio\Index\Qual.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\LoadHelper.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\LoadHelper.html HTMLifying blib\lib\Bio\SeqIO\entrezgene.pm -> blib\libhtml\site\lib\Bio\SeqIO\entrezgene.html HTMLifying blib\lib\Bio\Tools\PrositeScan.pm -> blib\libhtml\site\lib\Bio\Tools\PrositeScan.html HTMLifying blib\lib\Bio\Map\LinkageMap.pm -> blib\libhtml\site\lib\Bio\Map\LinkageMap.html HTMLifying blib\lib\Bio\Ontology\RelationshipType.pm -> blib\libhtml\site\lib\Bio\Ontology\RelationshipType.html HTMLifying blib\lib\Bio\FeatureHolderI.pm -> blib\libhtml\site\lib\Bio\FeatureHolderI.html HTMLifying blib\lib\Bio\SeqIO\game\gameSubs.pm -> blib\libhtml\site\lib\Bio\SeqIO\game\gameSubs.html HTMLifying blib\lib\Bio\PhyloNetwork\muVector.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\muVector.html HTMLifying blib\lib\Bio\AlignIO\mase.pm -> blib\libhtml\site\lib\Bio\AlignIO\mase.html HTMLifying blib\lib\Bio\DB\DBFetch.pm -> blib\libhtml\site\lib\Bio\DB\DBFetch.html HTMLifying blib\lib\Bio\Tools\Signalp\ExtendedSignalp.pm -> blib\libhtml\site\lib\Bio\Tools\Signalp\ExtendedSignalp.html HTMLifying blib\lib\Bio\Biblio\PubmedBookArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\PubmedBookArticle.html HTMLifying blib\lib\Bio\Restriction\IO\prototype.pm -> blib\libhtml\site\lib\Bio\Restriction\IO\prototype.html HTMLifying blib\lib\Bio\Tools\EMBOSS\Palindrome.pm -> blib\libhtml\site\lib\Bio\Tools\EMBOSS\Palindrome.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\ucsc_refgene.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\ucsc_refgene.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\Domcut.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\Domcut.html HTMLifying blib\lib\Bio\DB\Taxonomy\list.pm -> blib\libhtml\site\lib\Bio\DB\Taxonomy\list.html HTMLifying blib\lib\Bio\Tree\AlleleNode.pm -> blib\libhtml\site\lib\Bio\Tree\AlleleNode.html HTMLifying blib\lib\Bio\Search\HSP\FastaHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\FastaHSP.html HTMLifying blib\lib\Bio\Index\BlastTable.pm -> blib\libhtml\site\lib\Bio\Index\BlastTable.html HTMLifying blib\lib\Bio\SeqFeature\Generic.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Generic.html HTMLifying blib\lib\Bio\Map\CytoMarker.pm -> blib\libhtml\site\lib\Bio\Map\CytoMarker.html HTMLifying blib\lib\Bio\PopGen\Population.pm -> blib\libhtml\site\lib\Bio\PopGen\Population.html HTMLifying blib\lib\Bio\Annotation\AnnotationFactory.pm -> blib\libhtml\site\lib\Bio\Annotation\AnnotationFactory.html HTMLify./Build: blib\lib\Bio\DB\SeqFeature\NormalizedFeature.pm: cannot resolve L in paragraph 159. ./Build: blib\lib\Bio\Search\Hit\BlastPullHit.pm: cannot resolve L in paragraph 74. ./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi.pm: cannot resolve L in paragraph 496. ./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L in paragraph 21. ./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L in paragraph 22. ./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L in paragraph 22. ./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L in paragraph 36. ing blib\lib\Bio\DB\SeqFeature\NormalizedFeature.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\NormalizedFeature.html HTMLifying blib\lib\Bio\DB\Flat\BDB\fasta.pm -> blib\libhtml\site\lib\Bio\DB\Flat\BDB\fasta.html HTMLifying blib\lib\Bio\Map\Relative.pm -> blib\libhtml\site\lib\Bio\Map\Relative.html HTMLifying blib\lib\Bio\Search\Hit\BlastPullHit.pm -> blib\libhtml\site\lib\Bio\Search\Hit\BlastPullHit.html HTMLifying blib\lib\Bio\Tools\EUtilities\Link\UrlLink.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Link\UrlLink.html HTMLifying blib\lib\Bio\Tree\DistanceFactory.pm -> blib\libhtml\site\lib\Bio\Tree\DistanceFactory.html HTMLifying blib\lib\Bio\SeqIO\msout.pm -> blib\libhtml\site\lib\Bio\SeqIO\msout.html HTMLifying blib\lib\Bio\SeqIO\fastq.pm -> blib\libhtml\site\lib\Bio\SeqIO\fastq.html HTMLifying blib\lib\Bio\Tools\Genemark.pm -> blib\libhtml\site\lib\Bio\Tools\Genemark.html HTMLifying blib\lib\Bio\Ontology\OBOterm.pm -> blib\libhtml\site\lib\Bio\Ontology\OBOterm.html HTMLifying blib\lib\Bio\Tools\Sigcleave.pm -> blib\libhtml\site\lib\Bio\Tools\Sigcleave.html HTMLifying blib\lib\Bio\PrimarySeqI.pm -> blib\libhtml\site\lib\Bio\PrimarySeqI.html HTMLifying blib\lib\Bio\Location\FuzzyLocationI.pm -> blib\libhtml\site\lib\Bio\Location\FuzzyLocationI.html HTMLifying blib\lib\Bio\PopGen\PopulationI.pm -> blib\libhtml\site\lib\Bio\PopGen\PopulationI.html HTMLifying blib\lib\Bio\Tools\Sim4\Exon.pm -> blib\libhtml\site\lib\Bio\Tools\Sim4\Exon.html HTMLifying blib\lib\Bio\Matrix\IO\mlagan.pm -> blib\libhtml\site\lib\Bio\Matrix\IO\mlagan.html HTMLifying blib\lib\Bio\Coordinate\Result\Match.pm -> blib\libhtml\site\lib\Bio\Coordinate\Result\Match.html HTMLifying blib\lib\Bio\Annotation\SimpleValue.pm -> blib\libhtml\site\lib\Bio\Annotation\SimpleValue.html HTMLifying blib\lib\Bio\DB\Biblio\biofetch.pm -> blib\libhtml\site\lib\Bio\DB\Biblio\biofetch.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\Scansite.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\Scansite.html HTMLifying blib\lib\Bio\Biblio\Article.pm -> blib\libhtml\site\lib\Bio\Biblio\Article.html HTMLifying blib\lib\Bio\Search\GenericStatistics.pm -> blib\libhtml\site\lib\Bio\Search\GenericStatistics.html HTMLifying blib\lib\Bio\SearchIO\blast.pm -> blib\libhtml\site\lib\Bio\SearchIO\blast.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi.html HTMLifying blib\lib\Bio\Tools\Phylo\Phylip\ProtDist.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\Phylip\ProtDist.html HTMLifying blib\lib\Bio\Structure\Atom.pm -> blib\libhtml\site\lib\Bio\Structure\Atom.html HTMLifying blib\lib\Bio\Root\Root.pm -> blib\libhtml\site\lib\Bio\Root\Root.html HTMLifying blib\lib\Bio\Symbol\SymbolI.pm -> blib\libhtml\site\lib\Bio\Symbol\SymbolI.html HTMLifying blib\lib\Bio\RangeI.pm -> blib\libhtml\site\lib\Bio\RangeI.html HTMLifying blib\lib\Bio\Ontology\RelationshipFactory.pm -> blib\libhtml\site\lib\Bio\Ontology\RelationshipFactory.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\alignment.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\alignment.html HTMLifying blib\lib\Bio\Draw\Pictogram.pm -> blib\libhtml\site\lib\Bio\Draw\Pictogram.html HTMLifying blib\lib\Bio\Factory\ObjectFactory.pm -> blib\libhtml\site\lib\Bio\Factory\ObjectFactory.html HTMLifying blib\lib\Bio\Search\Iteration\IterationI.pm -> blib\libhtml\site\lib\Bio\Search\Iteration\IterationI.html HTMLifying blib\lib\Bio\LiveSeq\Transcript.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Transcript.html HTMLifying blib\lib\Bio\Search\DatabaseI.pm -> blib\libhtml\site\lib\Bio\Search\DatabaseI.html HTMLifying blib\lib\Bio\SearchIO\exonerate.pm -> blib\libhtml\site\lib\Bio\SearchIO\exonerate.html HTMLifying blib\lib\Bio\Tools\Run\StandAloneNCBIBlast.pm -> blib\libhtml\site\lib\Bio\Tools\Run\StandAloneNCBIBlast.html HTMLifying blib\lib\Bio\Taxonomy\Node.pm -> blib\libhtml\site\lib\Bio\Taxonomy\Node.html HTMLifying blib\lib\Bio\MapIO.pm -> blib\libhtml\site\lib\Bio\MapIO.html HTMLifying blib\lib\Bio\Tools\QRNA.pm -> blib\libhtml\site\lib\Bio\Tools\QRNA.h./Build: blib\lib\Bio\Search\SearchUtils.pm: cannot resolve L<_adjust_contigs> in paragraph 16. ./Build: blib\lib\Bio\DB\SeqFeature\Store\memory.pm: cannot resolve L in paragraph 125. ./Build: blib\lib\Bio\DB\GFF\Homol.pm: cannot resolve L in paragraph 28. ./Build: blib\lib\Bio\DB\GFF\RelSegment.pm: cannot resolve L in paragraph 251. ./Build: blib\lib\Bio\DB\GFF\Segment.pm: cannot resolve L in paragraph 229. tml HTMLifying blib\lib\Bio\SearchIO\waba.pm -> blib\libhtml\site\lib\Bio\SearchIO\waba.html HTMLifying blib\lib\Bio\Search\SearchUtils.pm -> blib\libhtml\site\lib\Bio\Search\SearchUtils.html HTMLifying blib\lib\Bio\Biblio\IO\pubmed2ref.pm -> blib\libhtml\site\lib\Bio\Biblio\IO\pubmed2ref.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\memory.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\memory.html HTMLifying blib\lib\Bio\SeqIO\pln.pm -> blib\libhtml\site\lib\Bio\SeqIO\pln.html HTMLifying blib\lib\Bio\Annotation\Tree.pm -> blib\libhtml\site\lib\Bio\Annotation\Tree.html HTMLifying blib\lib\Bio\Tools\Primer\Pair.pm -> blib\libhtml\site\lib\Bio\Tools\Primer\Pair.html HTMLifying blib\lib\Bio\Tools\OddCodes.pm -> blib\libhtml\site\lib\Bio\Tools\OddCodes.html HTMLifying blib\lib\Bio\DB\GFF\Homol.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Homol.html HTMLifying blib\lib\Bio\AlignIO\fasta.pm -> blib\libhtml\site\lib\Bio\AlignIO\fasta.html HTMLifying blib\lib\Bio\DB\Taxonomy\flatfile.pm -> blib\libhtml\site\lib\Bio\DB\Taxonomy\flatfile.html HTMLifying blib\lib\Bio\Map\OrderedPositionWithDistance.pm -> blib\libhtml\site\lib\Bio\Map\OrderedPositionWithDistance.html HTMLifying blib\lib\Bio\SeqFeature\Gene\UTR.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\UTR.html HTMLifying blib\lib\Bio\SeqFeature\Tools\Unflattener.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Tools\Unflattener.html HTMLifying blib\lib\Bio\DB\SwissProt.pm -> blib\libhtml\site\lib\Bio\DB\SwissProt.html HTMLifying blib\lib\Bio\Index\AbstractSeq.pm -> blib\libhtml\site\lib\Bio\Index\AbstractSeq.html HTMLifying blib\lib\Bio\Matrix\PSM\PsmI.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\PsmI.html HTMLifying blib\lib\Bio\Variation\Allele.pm -> blib\libhtml\site\lib\Bio\Variation\Allele.html HTMLifying blib\lib\Bio\Tools\Seg.pm -> blib\libhtml\site\lib\Bio\Tools\Seg.html HTMLifying blib\lib\Bio\PopGen\Utilities.pm -> blib\libhtml\site\lib\Bio\PopGen\Utilities.html HTMLifying blib\lib\Bio\TreeIO\nhx.pm -> blib\libhtml\site\lib\Bio\TreeIO\nhx.html HTMLifying blib\lib\Bio\SearchIO\rnamotif.pm -> blib\libhtml\site\lib\Bio\SearchIO\rnamotif.html HTMLifying blib\lib\Bio\LiveSeq\Prim_Transcript.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Prim_Transcript.html HTMLifying blib\lib\Bio\DB\CUTG.pm -> blib\libhtml\site\lib\Bio\DB\CUTG.html HTMLifying blib\lib\Bio\Coordinate\Result.pm -> blib\libhtml\site\lib\Bio\Coordinate\Result.html HTMLifying blib\lib\Bio\DB\ReferenceI.pm -> blib\libhtml\site\lib\Bio\DB\ReferenceI.html HTMLifying blib\lib\Bio\TreeIO\pag.pm -> blib\libhtml\site\lib\Bio\TreeIO\pag.html HTMLifying blib\lib\Bio\SeqFeature\FeaturePair.pm -> blib\libhtml\site\lib\Bio\SeqFeature\FeaturePair.html HTMLifying blib\lib\Bio\DB\GFF\RelSegment.pm -> blib\libhtml\site\lib\Bio\DB\GFF\RelSegment.html HTMLifying blib\lib\Bio\Location\NarrowestCoordPolicy.pm -> blib\libhtml\site\lib\Bio\Location\NarrowestCoordPolicy.html HTMLifying blib\lib\Bio\Biblio\Journal.pm -> blib\libhtml\site\lib\Bio\Biblio\Journal.html HTMLifying blib\lib\Bio\DB\SeqI.pm -> blib\libhtml\site\lib\Bio\DB\SeqI.html HTMLifying blib\lib\Bio\Root\IO.pm -> blib\libhtml\site\lib\Bio\Root\IO.html HTMLifying blib\lib\Bio\Tools\RandomDistFunctions.pm -> blib\libhtml\site\lib\Bio\Tools\RandomDistFunctions.html HTMLifying blib\lib\Bio\Biblio\Provider.pm -> blib\libhtml\site\lib\Bio\Biblio\Provider.html HTMLifying blib\lib\Bio\AlignIO\xmfa.pm -> blib\libhtml\site\lib\Bio\AlignIO\xmfa.html HTMLifying blib\lib\Bio\Search\HSP\HSPFactory.pm -> blib\libhtml\site\lib\Bio\Search\HSP\HSPFactory.html HTMLifying blib\lib\Bio\Phenotype\Measure.pm -> blib\libhtml\site\lib\Bio\Phenotype\Measure.html HTMLifying blib\lib\Bio\DB\Qual.pm -> blib\libhtml\site\lib\Bio\DB\Qual.html HTMLifying blib\lib\Bio\Search\Result\PullResultI.pm -> blib\libhtml\site\lib\Bio\Search\Result\PullResultI.html HTMLifying blib\lib\Bio\Seq\LargeSeq.pm -> blib\libhtml\site\lib\Bio\Seq\LargeSeq.html HTMLifying blib\lib\Bio\DB\GFF\Segment.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Segment.html HTMLifying blib\lib\Bio\Tools\Grail.pm ->./Build: blib\lib\Bio\Seq\MetaI.pm: cannot resolve L in paragraph 14. ./Build: blib\lib\Bio\SeqEvolution\DNAPoint.pm: cannot resolve L in paragraph 9. blib\libhtml\site\lib\Bio\Tools\Grail.html HTMLifying blib\lib\Bio\AlignIO\meme.pm -> blib\libhtml\site\lib\Bio\AlignIO\meme.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\DBI\Iterator.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\DBI\Iterator.html HTMLifying blib\lib\Bio\DB\Flat\BDB\embl.pm -> blib\libhtml\site\lib\Bio\DB\Flat\BDB\embl.html HTMLifying blib\lib\Bio\PopGen\IO\phase.pm -> blib\libhtml\site\lib\Bio\PopGen\IO\phase.html HTMLifying blib\lib\Bio\Restriction\EnzymeI.pm -> blib\libhtml\site\lib\Bio\Restriction\EnzymeI.html HTMLifying blib\lib\Bio\Search\Result\HmmpfamResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\HmmpfamResult.html HTMLifying blib\lib\Bio\Biblio\Proceeding.pm -> blib\libhtml\site\lib\Bio\Biblio\Proceeding.html HTMLifying blib\lib\Bio\FeatureIO\gff.pm -> blib\libhtml\site\lib\Bio\FeatureIO\gff.html HTMLifying blib\lib\Bio\Location\AvWithinCoordPolicy.pm -> blib\libhtml\site\lib\Bio\Location\AvWithinCoordPolicy.html HTMLifying blib\lib\Bio\SeqFeature\Gene\GeneStructureI.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\GeneStructureI.html HTMLifying blib\lib\Bio\LiveSeq\Chain.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Chain.html HTMLifying blib\lib\Bio\Tools\Run\ParametersI.pm -> blib\libhtml\site\lib\Bio\Tools\Run\ParametersI.html HTMLifying blib\lib\Bio\Matrix\PSM\IO\meme.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\IO\meme.html HTMLifying blib\lib\Bio\Tools\Analysis\SimpleAnalysisBase.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\SimpleAnalysisBase.html HTMLifying blib\lib\Bio\Seq\MetaI.pm -> blib\libhtml\site\lib\Bio\Seq\MetaI.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\DBI\mysql.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\DBI\mysql.html HTMLifying blib\lib\Bio\DB\InMemoryCache.pm -> blib\libhtml\site\lib\Bio\DB\InMemoryCache.html HTMLifying blib\lib\Bio\Seq\RichSeqI.pm -> blib\libhtml\site\lib\Bio\Seq\RichSeqI.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\memory\iterator.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\memory\iterator.html HTMLifying blib\lib\Bio\SearchDist.pm -> blib\libhtml\site\lib\Bio\SearchDist.html HTMLifying blib\lib\Bio\PopGen\Simulation\Coalescent.pm -> blib\libhtml\site\lib\Bio\PopGen\Simulation\Coalescent.html HTMLifying blib\lib\Bio\DB\Query\HIVQuery.pm -> blib\libhtml\site\lib\Bio\DB\Query\HIVQuery.html HTMLifying blib\lib\Bio\Tools\SiRNA\Ruleset\saigo.pm -> blib\libhtml\site\lib\Bio\Tools\SiRNA\Ruleset\saigo.html HTMLifying blib\lib\Bio\ClusterIO\dbsnp.pm -> blib\libhtml\site\lib\Bio\ClusterIO\dbsnp.html HTMLifying blib\lib\Bio\Tools\EUtilities\Link\LinkSet.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Link\LinkSet.html HTMLifying blib\lib\Bio\Structure\Chain.pm -> blib\libhtml\site\lib\Bio\Structure\Chain.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\so_transcript.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\so_transcript.html HTMLifying blib\lib\Bio\Biblio\MedlineJournal.pm -> blib\libhtml\site\lib\Bio\Biblio\MedlineJournal.html HTMLifying blib\lib\Bio\SeqEvolution\DNAPoint.pm -> blib\libhtml\site\lib\Bio\SeqEvolution\DNAPoint.html HTMLifying blib\lib\Bio\LiveSeq\ChainI.pm -> blib\libhtml\site\lib\Bio\LiveSeq\ChainI.html HTMLifying blib\lib\Bio\LiveSeq\DNA.pm -> blib\libhtml\site\lib\Bio\LiveSeq\DNA.html HTMLifying blib\lib\Bio\PopGen\Individual.pm -> blib\libhtml\site\lib\Bio\PopGen\Individual.html HTMLifying blib\lib\Bio\Matrix\IO\scoring.pm -> blib\libhtml\site\lib\Bio\Matrix\IO\scoring.html HTMLifying blib\lib\Bio\Tools\Phylo\PAML\Result.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\PAML\Result.html HTMLifying blib\lib\Bio\SeqAnalysisParserI.pm -> blib\libhtml\site\lib\Bio\SeqAnalysisParserI.html HTMLifying blib\lib\Bio\Ontology\GOterm.pm -> blib\libhtml\site\lib\Bio\Ontology\GOterm.html HTMLifying blib\lib\Bio\Tools\EUtilities\Query\GlobalQuery.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Query\GlobalQuery.html HTMLifying blib\lib\Bio\Map\GeneRelative.pm -> blib\libhtml\site\lib\Bio\Map\GeneRelative.html HTMLifying blib\lib\Bio\SeqIO\swissdriver.pm -> blib\libhtml\site\lib\Bio\SeqIO\swiss./Build: blib\lib\Bio\Assembly\IO\sam.pm: cannot resolve L in paragraph 44. driver.html HTMLifying blib\lib\Bio\SeqFeature\AnnotationAdaptor.pm -> blib\libhtml\site\lib\Bio\SeqFeature\AnnotationAdaptor.html HTMLifying blib\lib\Bio\Symbol\Alphabet.pm -> blib\libhtml\site\lib\Bio\Symbol\Alphabet.html HTMLifying blib\lib\Bio\Tools\pICalculator.pm -> blib\libhtml\site\lib\Bio\Tools\pICalculator.html HTMLifying blib\lib\Bio\IdentifiableI.pm -> blib\libhtml\site\lib\Bio\IdentifiableI.html HTMLifying blib\lib\Bio\AlignIO\bl2seq.pm -> blib\libhtml\site\lib\Bio\AlignIO\bl2seq.html HTMLifying blib\lib\Bio\Search\BlastStatistics.pm -> blib\libhtml\site\lib\Bio\Search\BlastStatistics.html HTMLifying blib\lib\Bio\Das\SegmentI.pm -> blib\libhtml\site\lib\Bio\Das\SegmentI.html HTMLifying blib\lib\Bio\SimpleAlign.pm -> blib\libhtml\site\lib\Bio\SimpleAlign.html HTMLifying blib\lib\Bio\SearchIO\blasttable.pm -> blib\libhtml\site\lib\Bio\SearchIO\blasttable.html HTMLifying blib\lib\Bio\Ontology\Path.pm -> blib\libhtml\site\lib\Bio\Ontology\Path.html HTMLifying blib\lib\Bio\SeqFeature\Gene\Transcript.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Gene\Transcript.html HTMLifying blib\lib\Bio\DB\HIV\HIVAnnotProcessor.pm -> blib\libhtml\site\lib\Bio\DB\HIV\HIVAnnotProcessor.html HTMLifying blib\lib\Bio\MolEvol\CodonModel.pm -> blib\libhtml\site\lib\Bio\MolEvol\CodonModel.html HTMLifying blib\lib\Bio\Location\WidestCoordPolicy.pm -> blib\libhtml\site\lib\Bio\Location\WidestCoordPolicy.html HTMLifying blib\lib\Bio\Tools\Primer\AssessorI.pm -> blib\libhtml\site\lib\Bio\Tools\Primer\AssessorI.html HTMLifying blib\lib\Bio\Annotation\OntologyTerm.pm -> blib\libhtml\site\lib\Bio\Annotation\OntologyTerm.html HTMLifying blib\lib\Bio\Seq\PrimaryQual.pm -> blib\libhtml\site\lib\Bio\Seq\PrimaryQual.html HTMLifying blib\lib\Bio\Matrix\PSM\PsmHeader.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\PsmHeader.html HTMLifying blib\lib\Bio\PopGen\Genotype.pm -> blib\libhtml\site\lib\Bio\PopGen\Genotype.html HTMLifying blib\lib\Bio\Tools\ipcress.pm -> blib\libhtml\site\lib\Bio\Tools\ipcress.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\memory\feature_serializer.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\memory\feature_serializer.html HTMLifying blib\lib\Bio\Matrix\PSM\IO\transfac.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\IO\transfac.html HTMLifying blib\lib\Bio\Ontology\OntologyI.pm -> blib\libhtml\site\lib\Bio\Ontology\OntologyI.html HTMLifying blib\lib\Bio\Phenotype\OMIM\MiniMIMentry.pm -> blib\libhtml\site\lib\Bio\Phenotype\OMIM\MiniMIMentry.html HTMLifying blib\lib\Bio\Location\Split.pm -> blib\libhtml\site\lib\Bio\Location\Split.html HTMLifying blib\lib\Bio\Tools\GuessSeqFormat.pm -> blib\libhtml\site\lib\Bio\Tools\GuessSeqFormat.html HTMLifying blib\lib\Bio\DB\GenBank.pm -> blib\libhtml\site\lib\Bio\DB\GenBank.html HTMLifying blib\lib\Bio\Tree\Statistics.pm -> blib\libhtml\site\lib\Bio\Tree\Statistics.html HTMLifying blib\lib\Bio\Assembly\IO\maq.pm -> blib\libhtml\site\lib\Bio\Assembly\IO\maq.html HTMLifying blib\lib\Bio\DB\Flat\BDB\swiss.pm -> blib\libhtml\site\lib\Bio\DB\Flat\BDB\swiss.html HTMLifying blib\lib\Bio\Factory\MapFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\MapFactoryI.html HTMLifying blib\lib\Bio\SeqUtils.pm -> blib\libhtml\site\lib\Bio\SeqUtils.html HTMLifying blib\lib\Bio\Tools\dpAlign.pm -> blib\libhtml\site\lib\Bio\Tools\dpAlign.html HTMLifying blib\lib\Bio\Variation\IO\flat.pm -> blib\libhtml\site\lib\Bio\Variation\IO\flat.html HTMLifying blib\lib\Bio\Tools\Match.pm -> blib\libhtml\site\lib\Bio\Tools\Match.html HTMLifying blib\lib\Bio\TreeIO\newick.pm -> blib\libhtml\site\lib\Bio\TreeIO\newick.html HTMLifying blib\lib\Bio\SeqFeature\TypedSeqFeatureI.pm -> blib\libhtml\site\lib\Bio\SeqFeature\TypedSeqFeatureI.html HTMLifying blib\lib\Bio\Tools\SeqWords.pm -> blib\libhtml\site\lib\Bio\Tools\SeqWords.html HTMLifying blib\lib\Bio\Assembly\IO\sam.pm -> blib\libhtml\site\lib\Bio\Assembly\IO\sam.html HTMLifying blib\lib\Bio\Tree\Draw\Cladogram.pm -> blib\libhtml\site\lib\Bio\Tree\Draw\Cladogram.html HTMLifying blib\lib\Bio\Tree\NodeI.pm -> blib\libhtml\site\lib\Bio\Tree\NodeI.htm./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm: cannot resolve L in paragraph 8. ./Build: blib\lib\Bio\AlignIO.pm: cannot resolve L in paragraph 51. ./Build: blib\lib\Bio\AlignIO.pm: cannot resolve L in paragraph 66. ./Build: blib\lib\Bio\Search\HSP\ModelHSP.pm: cannot resolve L in paragraph 52. ./Build: blib\lib\Bio\DB\GFF\Typename.pm: cannot resolve L in paragraph 49. ./Build: blib\lib\Bio\DB\GFF\Adaptor\berkeleydb.pm: cannot resolve L in paragraph 33. l HTMLifying blib\lib\Bio\SearchIO\Writer\ResultTableWriter.pm -> blib\libhtml\site\lib\Bio\SearchIO\Writer\ResultTableWriter.html HTMLifying blib\lib\Bio\Seq\SeqWithQuality.pm -> blib\libhtml\site\lib\Bio\Seq\SeqWithQuality.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\oracle.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\oracle.html HTMLifying blib\lib\Bio\LiveSeq\Mutator.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Mutator.html HTMLifying blib\lib\Bio\SeqFeature\SiRNA\Oligo.pm -> blib\libhtml\site\lib\Bio\SeqFeature\SiRNA\Oligo.html HTMLifying blib\lib\Bio\Map\Mappable.pm -> blib\libhtml\site\lib\Bio\Map\Mappable.html HTMLifying blib\lib\Bio\Tree\Compatible.pm -> blib\libhtml\site\lib\Bio\Tree\Compatible.html HTMLifying blib\lib\Bio\CodonUsage\IO.pm -> blib\libhtml\site\lib\Bio\CodonUsage\IO.html HTMLifying blib\lib\Bio\Range.pm -> blib\libhtml\site\lib\Bio\Range.html HTMLifying blib\lib\Bio\Tools\SiRNA\Ruleset\tuschl.pm -> blib\libhtml\site\lib\Bio\Tools\SiRNA\Ruleset\tuschl.html HTMLifying blib\lib\Bio\Align\DNAStatistics.pm -> blib\libhtml\site\lib\Bio\Align\DNAStatistics.html HTMLifying blib\lib\Bio\SeqIO\gcg.pm -> blib\libhtml\site\lib\Bio\SeqIO\gcg.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\dbi\mysqlopt.html HTMLifying blib\lib\Bio\TreeIO\tabtree.pm -> blib\libhtml\site\lib\Bio\TreeIO\tabtree.html HTMLifying blib\lib\Bio\SearchIO\IteratedSearchResultEventBuilder.pm -> blib\libhtml\site\lib\Bio\SearchIO\IteratedSearchResultEventBuilder.html HTMLifying blib\lib\Bio\Phenotype\Correlate.pm -> blib\libhtml\site\lib\Bio\Phenotype\Correlate.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\GFF3Loader.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\GFF3Loader.html HTMLifying blib\lib\Bio\AlignIO.pm -> blib\libhtml\site\lib\Bio\AlignIO.html HTMLifying blib\lib\Bio\Search\HSP\ModelHSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\ModelHSP.html HTMLifying blib\lib\Bio\PopGen\HtSNP.pm -> blib\libhtml\site\lib\Bio\PopGen\HtSNP.html HTMLifying blib\lib\Bio\Tools\Phylo\PAML\Codeml.pm -> blib\libhtml\site\lib\Bio\Tools\Phylo\PAML\Codeml.html HTMLifying blib\lib\Bio\SeqI.pm -> blib\libhtml\site\lib\Bio\SeqI.html HTMLifying blib\lib\Bio\TreeIO.pm -> blib\libhtml\site\lib\Bio\TreeIO.html HTMLifying blib\lib\Bio\DB\GFF\Typename.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Typename.html HTMLifying blib\lib\Bio\Annotation\TagTree.pm -> blib\libhtml\site\lib\Bio\Annotation\TagTree.html HTMLifying blib\lib\Bio\Seq\Meta\Array.pm -> blib\libhtml\site\lib\Bio\Seq\Meta\Array.html HTMLifying blib\lib\Bio\ConfigData.pm -> blib\libhtml\site\lib\Bio\ConfigData.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\ELM.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\ELM.html HTMLifying blib\lib\Bio\Search\Result\ResultI.pm -> blib\libhtml\site\lib\Bio\Search\Result\ResultI.html HTMLifying blib\lib\Bio\Annotation\TypeManager.pm -> blib\libhtml\site\lib\Bio\Annotation\TypeManager.html HTMLifying blib\lib\Bio\PopGen\PopStats.pm -> blib\libhtml\site\lib\Bio\PopGen\PopStats.html HTMLifying blib\lib\Bio\Restriction\IO\base.pm -> blib\libhtml\site\lib\Bio\Restriction\IO\base.html HTMLifying blib\lib\Bio\DB\GFF\Adaptor\berkeleydb.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Adaptor\berkeleydb.html HTMLifying blib\lib\Bio\Tools\EUtilities\Summary\Item.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\Summary\Item.html HTMLifying blib\lib\Bio\Tools\SeqStats.pm -> blib\libhtml\site\lib\Bio\Tools\SeqStats.html HTMLifying blib\lib\Bio\Tools\Spidey\Results.pm -> blib\libhtml\site\lib\Bio\Tools\Spidey\Results.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\gene.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\gene.html HTMLifying blib\lib\Bio\Tools\ESTScan.pm -> blib\libhtml\site\lib\Bio\Tools\ESTScan.html HTMLifying blib\lib\Bio\Map\CytoMap.pm -> blib\libhtml\site\lib\Bio\Map\CytoMap.html HTMLifying blib\lib\Bio\AlignIO\msf.pm -> blib\libhtml\site\lib\Bio\AlignIO\msf.html HTMLifying blib\lib\Bio\DB\SeqFeature\NormalizedFeatureI.pm -> blib\libhtml\site\lib\Bio\DB\Seq./Build: blib\lib\Bio\DB\SeqFeature\NormalizedFeatureI.pm: cannot resolve L in paragraph 12. ./Build: blib\lib\Bio\DB\GFF\Feature.pm: cannot resolve L in paragraph 295. ./Build: blib\lib\Bio\Assembly\Contig.pm: cannot resolve L in paragraph 120. ./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L in paragraph . ./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L in paragraph 12. ./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L in paragraph 40. ./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L in paragraph 46. ./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L in paragraph 91. ./Build: blib\lib\Bio\Search\HSP\hmmer3HSP.pm: cannot resolve L in paragraph 15. ./Build: blib\lib\Bio\DB\SeqFeature\Segment.pm: cannot resolve L in paragraph 121. ./Build: blib\lib\Bio\SeqIO\swiss.pm: cannot resolve L in paragraph 45. ./Build: blib\lib\Bio\DB\SeqFeature\Store\GFF2Loader.pm: cannot resolve L in paragraph 181. Feature\NormalizedFeatureI.html HTMLifying blib\lib\Bio\Phenotype\OMIM\OMIMentry.pm -> blib\libhtml\site\lib\Bio\Phenotype\OMIM\OMIMentry.html HTMLifying blib\lib\Bio\DB\SeqHound.pm -> blib\libhtml\site\lib\Bio\DB\SeqHound.html HTMLifying blib\lib\Bio\Search\Tiling\MapTileUtils.pm -> blib\libhtml\site\lib\Bio\Search\Tiling\MapTileUtils.html HTMLifying blib\lib\Bio\Annotation\Relation.pm -> blib\libhtml\site\lib\Bio\Annotation\Relation.html HTMLifying blib\lib\Bio\SeqIO\bsml.pm -> blib\libhtml\site\lib\Bio\SeqIO\bsml.html HTMLifying blib\lib\Bio\DB\GFF\Feature.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Feature.html HTMLifying blib\lib\Bio\Matrix\PSM\ProtPsm.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\ProtPsm.html HTMLifying blib\lib\Bio\Symbol\DNAAlphabet.pm -> blib\libhtml\site\lib\Bio\Symbol\DNAAlphabet.html HTMLifying blib\lib\Bio\Search\Result\WABAResult.pm -> blib\libhtml\site\lib\Bio\Search\Result\WABAResult.html HTMLifying blib\lib\Bio\SeqFeature\PositionProxy.pm -> blib\libhtml\site\lib\Bio\SeqFeature\PositionProxy.html HTMLifying blib\lib\Bio\Seq\SeqBuilder.pm -> blib\libhtml\site\lib\Bio\Seq\SeqBuilder.html HTMLifying blib\lib\Bio\Tools\EUtilities\EUtilParameters.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\EUtilParameters.html HTMLifying blib\lib\Bio\Assembly\Contig.pm -> blib\libhtml\site\lib\Bio\Assembly\Contig.html HTMLifying blib\lib\Bio\Tools\Est2Genome.pm -> blib\libhtml\site\lib\Bio\Tools\Est2Genome.html HTMLifying blib\lib\Bio\TreeIO\NewickParser.pm -> blib\libhtml\site\lib\Bio\TreeIO\NewickParser.html HTMLifying blib\lib\Bio\Biblio\MedlineArticle.pm -> blib\libhtml\site\lib\Bio\Biblio\MedlineArticle.html HTMLifying blib\lib\Bio\Map\Microsatellite.pm -> blib\libhtml\site\lib\Bio\Map\Microsatellite.html HTMLifying blib\lib\Bio\OntologyIO\obo.pm -> blib\libhtml\site\lib\Bio\OntologyIO\obo.html HTMLifying blib\lib\Bio\DB\HIV\HIVQueryHelper.pm -> blib\libhtml\site\lib\Bio\DB\HIV\HIVQueryHelper.html HTMLifying blib\lib\Bio\Restriction\EnzymeCollection.pm -> blib\libhtml\site\lib\Bio\Restriction\EnzymeCollection.html HTMLifying blib\lib\Bio\Variation\IO\xml.pm -> blib\libhtml\site\lib\Bio\Variation\IO\xml.html HTMLifying blib\lib\Bio\Tools\Prediction\Exon.pm -> blib\libhtml\site\lib\Bio\Tools\Prediction\Exon.html HTMLifying blib\lib\Bio\Map\PositionWithSequence.pm -> blib\libhtml\site\lib\Bio\Map\PositionWithSequence.html HTMLifying blib\lib\Bio\PopGen\IndividualI.pm -> blib\libhtml\site\lib\Bio\PopGen\IndividualI.html HTMLifying blib\lib\Bio\Root\Exception.pm -> blib\libhtml\site\lib\Bio\Root\Exception.html HTMLifying blib\lib\Bio\SeqIO\Handler\GenericRichSeqHandler.pm -> blib\libhtml\site\lib\Bio\SeqIO\Handler\GenericRichSeqHandler.html HTMLifying blib\lib\Bio\Phenotype\PhenotypeI.pm -> blib\libhtml\site\lib\Bio\Phenotype\PhenotypeI.html HTMLifying blib\lib\Bio\Search\HSP\hmmer3HSP.pm -> blib\libhtml\site\lib\Bio\Search\HSP\hmmer3HSP.html HTMLifying blib\lib\Bio\DB\SeqFeature\Segment.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Segment.html HTMLifying blib\lib\Bio\Tools\isPcr.pm -> blib\libhtml\site\lib\Bio\Tools\isPcr.html HTMLifying blib\lib\Bio\DB\MeSH.pm -> blib\libhtml\site\lib\Bio\DB\MeSH.html HTMLifying blib\lib\Bio\SeqIO\swiss.pm -> blib\libhtml\site\lib\Bio\SeqIO\swiss.html HTMLifying blib\lib\Bio\DB\SeqFeature\Store\GFF2Loader.pm -> blib\libhtml\site\lib\Bio\DB\SeqFeature\Store\GFF2Loader.html HTMLifying blib\lib\Bio\DB\GFF\Aggregator\coding.pm -> blib\libhtml\site\lib\Bio\DB\GFF\Aggregator\coding.html HTMLifying blib\lib\Bio\SeqIO\lasergene.pm -> blib\libhtml\site\lib\Bio\SeqIO\lasergene.html HTMLifying blib\lib\Bio\Matrix\Generic.pm -> blib\libhtml\site\lib\Bio\Matrix\Generic.html HTMLifying blib\lib\Bio\SeqIO\flybase_chadoxml.pm -> blib\libhtml\site\lib\Bio\SeqIO\flybase_chadoxml.html HTMLifying blib\lib\Bio\Seq\BaseSeqProcessor.pm -> blib\libhtml\site\lib\Bio\Seq\BaseSeqProcessor.html HTMLifying blib\lib\Bio\Tools\MZEF.pm -> blib\libhtml\site\lib\Bio\Tools\MZEF.html HTMLifying blib\lib\Bio\LiveSeq\Intron.pm -> blib\libhtml\site\lib\Bio\LiveSeq\Intron.html HTMLifying blib\lib\Bio\Structure\Residue.pm -> blib\libhtml\site\lib\Bio\Structure\Residue.html HTMLifying blib\lib\Bio\Ontology\SimpleGOEngine\GraphAdaptor02.pm -> blib\libhtml\site\lib\Bio\Ontology\SimpleGOEngine\GraphAdaptor02.html HTMLifying blib\lib\Bio\Tools\Pseudowise.pm -> blib\libhtml\site\lib\Bio\Tools\Pseudowise.html HTMLifying blib\lib\Bio\Tools\EUtilities\EUtilDataI.pm -> blib\libhtml\site\lib\Bio\Tools\EUtilities\EUtilDataI.html HTMLifying blib\lib\Bio\Tree\Node.pm -> blib\libhtml\site\lib\Bio\Tree\Node.html HTMLifying blib\lib\Bio\Index\EMBL.pm -> blib\libhtml\site\lib\Bio\Index\EMBL.html HTMLifying blib\lib\Bio\Seq\RichSeq.pm -> blib\libhtml\site\lib\Bio\Seq\RichSeq.html HTMLifying blib\lib\Bio\SeqIO\phd.pm -> blib\libhtml\site\lib\Bio\SeqIO\phd.html HTMLifying blib\lib\Bio\Location\CoordinatePolicyI.pm -> blib\libhtml\site\lib\Bio\Location\CoordinatePolicyI.html HTMLifying blib\lib\Bio\OntologyIO\Handlers\BaseSAXHandler.pm -> blib\libhtml\site\lib\Bio\OntologyIO\Handlers\BaseSAXHandler.html HTMLifying blib\lib\Bio\Search\HSP\HSPI.pm -> blib\libhtml\site\lib\Bio\Search\HSP\HSPI.html HTMLifying blib\lib\Bio\Index\Blast.pm -> blib\libhtml\site\lib\Bio\Index\Blast.html HTMLifying blib\lib\Bio\Tools\Analysis\Protein\HNN.pm -> blib\libhtml\site\lib\Bio\Tools\Analysis\Protein\HNN.html HTMLifying blib\lib\Bio\Tools\Protparam.pm -> blib\libhtml\site\lib\Bio\Tools\Protparam.html HTMLifying blib\lib\Bio\Factory\ApplicationFactoryI.pm -> blib\libhtml\site\lib\Bio\Factory\ApplicationFactoryI.html HTMLifying blib\lib\Bio\PhyloNetwork\TreeFactoryX.pm -> blib\libhtml\site\lib\Bio\PhyloNetwork\TreeFactoryX.html HTMLifying blib\lib\Bio\SeqFeature\Lite.pm -> blib\libhtml\site\lib\Bio\SeqFeature\Lite.html HTMLifying blib\lib\Bio\Matrix\PSM\IO\mast.pm -> blib\libhtml\site\lib\Bio\Matrix\PSM\IO\mast.html HTMLifying blib\lib\Bio\SeqIO\tigrxml.pm -> blib\libhtml\site\lib\Bio\SeqIO\tigrxml.html CJFIELDS/BioPerl-1.6.900.tar.gz C:\Perl64\bin\perl.exe ./Build -- OK Prepending C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly/var/cpan/build for 'test' Running Build test >>> C:\Perl64\bin\perl.exe ./Build test verbose=1 Copying scripts\utilities\search2alnblocks.PLS -> blib\script\search2alnblocks.PLS Changing sharpbang in blib\script\search2alnblocks.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\search2alnblocks.PLS.bak Copying scripts\DB\bioflat_index.PLS -> blib\script\bioflat_index.PLS Changing sharpbang in blib\script\bioflat_index.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bioflat_index.PLS.bak Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_gff3.PLS -> blib\script\bp_seqfeature_gff3.PLS Copying scripts\utilities\mask_by_search.PLS -> blib\script\mask_by_search.PLS Changing sharpbang in blib\script\mask_by_search.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\mask_by_search.PLS.bak Copying scripts\utilities\bp_mrtrans.PLS -> blib\script\bp_mrtrans.PLS Changing sharpbang in blib\script\bp_mrtrans.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_mrtrans.PLS.bak Copying scripts\utilities\bp_sreformat.PLS -> blib\script\bp_sreformat.PLS Changing sharpbang in blib\script\bp_sreformat.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_sreformat.PLS.bak Copying scripts\utilities\search2gff.PLS -> blib\script\search2gff.PLS Changing sharpbang in blib\script\search2gff.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\search2gff.PLS.bak Copying scripts\searchio\hmmer_to_table.PLS -> blib\script\hmmer_to_table.PLS Changing sharpbang in blib\script\hmmer_to_table.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\hmmer_to_table.PLS.bak Copying scripts\seq\seqconvert.PLS -> blib\script\seqconvert.PLS Changing sharpbang in blib\script\seqconvert.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\seqconvert.PLS.bak Copying scripts\DB\flanks.PLS -> blib\script\flanks.PLS Changing sharpbang in blib\script\flanks.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\flanks.PLS.bak Copying scripts\utilities\seq_length.PLS -> blib\script\seq_length.PLS Changing sharpbang in blib\script\seq_length.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\seq_length.PLS.bak Copying scripts\DB-HIV\hivq.PLS -> blib\script\hivq.PLS Changing sharpbang in blib\script\hivq.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\hivq.PLS.bak Copying scripts\Bio-DB-GFF\genbank2gff.PLS -> blib\script\genbank2gff.PLS Changing sharpbang in blib\script\genbank2gff.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\genbank2gff.PLS.bak Copying scripts\Bio-DB-EUtilities\einfo.PLS -> blib\script\einfo.PLS Changing sharpbang in blib\script\einfo.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\einfo.PLS.bak Copying scripts\Bio-DB-GFF\process_gadfly.PLS -> blib\script\process_gadfly.PLS Changing sharpbang in blib\script\process_gadfly.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\process_gadfly.PLS.bak Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_delete.PLS -> blib\script\bp_seqfeature_delete.PLS Changing sharpbang in blib\script\bp_seqfeature_delete.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_seqfeature_delete.PLS.bak Copying scripts\seq\extract_feature_seq.PLS -> blib\script\extract_feature_seq.PLS Changing sharpbang in blib\script\extract_feature_seq.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\extract_feature_seq.PLS.bak Copying scripts\seq\make_mrna_protein.PLS -> blib\script\make_mrna_protein.PLS Changing sharpbang in blib\script\make_mrna_protein.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\make_mrna_protein.PLS.bak Copying scripts\DB\biofetch_genbank_proxy.PLS -> blib\script\biofetch_genbank_proxy.PLS Changing sharpbang in blib\script\biofetch_genbank_proxy.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\biofetch_genbank_proxy.PLS.bak Copying scripts\tree\nexus2nh.PLS -> blib\script\nexus2nh.PLS Changing sharpbang in blib\script\nexus2nh.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\nexus2nh.PLS.bak Copying scripts\searchio\filter_search.PLS -> blib\script\filter_search.PLS Changing sharpbang in blib\script\filter_search.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\filter_search.PLS.bak Copying scripts\tree\tree2pag.PLS -> blib\script\tree2pag.PLS Changing sharpbang in blib\script\tree2pag.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\tree2pag.PLS.bak Copying scripts\taxa\local_taxonomydb_query.PLS -> blib\script\local_taxonomydb_query.PLS Changing sharpbang in blib\script\local_taxonomydb_query.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\local_taxonomydb_query.PLS.bak Copying scripts\utilities\search2BSML.PLS -> blib\script\search2BSML.PLS Changing sharpbang in blib\script\search2BSML.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\search2BSML.PLS.bak Copying scripts\Bio-DB-GFF\process_sgd.PLS -> blib\script\process_sgd.PLS Changing sharpbang in blib\script\process_sgd.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\process_sgd.PLS.bak Copying scripts\utilities\search2tribe.PLS -> blib\script\search2tribe.PLS Changing sharpbang in blib\script\search2tribe.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\search2tribe.PLS.bak Copying scripts\Bio-DB-GFF\generate_histogram.PLS -> blib\script\generate_histogram.PLS Changing sharpbang in blib\script\generate_histogram.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\generate_histogram.PLS.bak Copying scripts\taxa\query_entrez_taxa.PLS -> blib\script\query_entrez_taxa.PLS Changing sharpbang in blib\script\query_entrez_taxa.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\query_entrez_taxa.PLS.bak Copying scripts\utilities\dbsplit.PLS -> blib\script\dbsplit.PLS Changing sharpbang in blib\script\dbsplit.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\dbsplit.PLS.bak Copying scripts\tree\blast2tree.PLS -> blib\script\blast2tree.PLS Changing sharpbang in blib\script\blast2tree.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\blast2tree.PLS.bak Copying scripts\Bio-DB-GFF\load_gff.PLS -> blib\script\load_gff.PLS Changing sharpbang in blib\script\load_gff.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\load_gff.PLS.bak Copying scripts\das\das_server.pl -> blib\script\das_server.pl Changing sharpbang in blib\script\das_server.pl to C:\Perl64\bin\perl.exeDeleting blib\script\das_server.pl.bak Copying scripts\utilities\mutate.PLS -> blib\script\mutate.PLS Changing sharpbang in blib\script\mutate.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\mutate.PLS.bak Copying scripts\seq\unflatten_seq.PLS -> blib\script\unflatten_seq.PLS Changing sharpbang in blib\script\unflatten_seq.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\unflatten_seq.PLS.bak Copying scripts\seqstats\chaos_plot.PLS -> blib\script\chaos_plot.PLS Changing sharpbang in blib\script\chaos_plot.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\chaos_plot.PLS.bak Copying scripts\Bio-DB-GFF\bulk_load_gff.PLS -> blib\script\bulk_load_gff.PLS Changing sharpbang in blib\script\bulk_load_gff.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bulk_load_gff.PLS.bak Copying scripts\Bio-DB-GFF\fast_load_gff.PLS -> blib\script\fast_load_gff.PLS Changing sharpbang in blib\script\fast_load_gff.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\fast_load_gff.PLS.bak Copying scripts\utilities\revtrans-motif.PLS -> blib\script\revtrans-motif.PLS Changing sharpbang in blib\script\revtrans-motif.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\revtrans-motif.PLS.bak Copying scripts\searchio\search2table.PLS -> blib\script\search2table.PLS Changing sharpbang in blib\script\search2table.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\search2table.PLS.bak Copying scripts\index\bp_seqret.PLS -> blib\script\bp_seqret.PLS Changing sharpbang in blib\script\bp_seqret.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_seqret.PLS.bak Copying scripts\popgen\composite_LD.PLS -> blib\script\composite_LD.PLS Changing sharpbang in blib\script\composite_LD.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\composite_LD.PLS.bak Copying scripts\biblio\biblio.PLS -> blib\script\biblio.PLS Changing sharpbang in blib\script\biblio.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\biblio.PLS.bak Copying scripts\seq\split_seq.PLS -> blib\script\split_seq.PLS Changing sharpbang in blib\script\split_seq.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\split_seq.PLS.bak Copying scripts\searchio\parse_hmmsearch.PLS -> blib\script\parse_hmmsearch.PLS Changing sharpbang in blib\script\parse_hmmsearch.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\parse_hmmsearch.PLS.bak Copying scripts\Bio-DB-GFF\process_wormbase.PLS -> blib\script\process_wormbase.PLS Changing sharpbang in blib\script\process_wormbase.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\process_wormbase.PLS.bak Copying scripts\utilities\download_query_genbank.PLS -> blib\script\download_query_genbank.PLS Changing sharpbang in blib\script\download_query_genbank.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\download_query_genbank.PLS.bak Copying scripts\seqstats\aacomp.PLS -> blib\script\aacomp.PLS Changing sharpbang in blib\script\aacomp.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\aacomp.PLS.bak Copying scripts\utilities\bp_nrdb.PLS -> blib\script\bp_nrdb.PLS Changing sharpbang in blib\script\bp_nrdb.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_nrdb.PLS.bak Copying scripts\popgen\heterogeneity_test.PLS -> blib\script\heterogeneity_test.PLS Changing sharpbang in blib\script\heterogeneity_test.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\heterogeneity_test.PLS.bak Copying scripts\index\bp_fetch.PLS -> blib\script\bp_fetch.PLS Changing sharpbang in blib\script\bp_fetch.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_fetch.PLS.bak Copying scripts\taxa\taxid4species.PLS -> blib\script\taxid4species.PLS Changing sharpbang in blib\script\taxid4species.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\taxid4species.PLS.bak Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_load.PLS -> blib\script\bp_seqfeature_load.PLS Changing sharpbang in blib\script\bp_seqfeature_load.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_seqfeature_load.PLS.bak Copying scripts\taxa\taxonomy2tree.PLS -> blib\script\taxonomy2tree.PLS Changing sharpbang in blib\script\taxonomy2tree.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\taxonomy2tree.PLS.bak Copying scripts\Bio-DB-GFF\genbank2gff3.PLS -> blib\script\genbank2gff3.PLS Changing sharpbang in blib\script\genbank2gff3.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\genbank2gff3.PLS.bak Copying scripts\Bio-DB-GFF\meta_gff.PLS -> blib\script\meta_gff.PLS Changing sharpbang in blib\script\meta_gff.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\meta_gff.PLS.bak Copying scripts\seqstats\oligo_count.PLS -> blib\script\oligo_count.PLS Changing sharpbang in blib\script\oligo_count.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\oligo_count.PLS.bak Copying scripts\seq\seqretsplit.PLS -> blib\script\seqretsplit.PLS Changing sharpbang in blib\script\seqretsplit.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\seqretsplit.PLS.bak Copying scripts\index\bp_index.PLS -> blib\script\bp_index.PLS Changing sharpbang in blib\script\bp_index.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_index.PLS.bak Copying scripts\utilities\bp_netinstall.PLS -> blib\script\bp_netinstall.PLS Changing sharpbang in blib\script\bp_netinstall.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\bp_netinstall.PLS.bak Copying scripts\seqstats\gccalc.PLS -> blib\script\gccalc.PLS Changing sharpbang in blib\script\gccalc.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\gccalc.PLS.bak Copying scripts\DB\biogetseq.PLS -> blib\script\biogetseq.PLS Changing sharpbang in blib\script\biogetseq.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\biogetseq.PLS.bak Copying scripts\seq\translate_seq.PLS -> blib\script\translate_seq.PLS Changing sharpbang in blib\script\translate_seq.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\translate_seq.PLS.bak Copying scripts\searchio\fastam9_to_table.PLS -> blib\script\fastam9_to_table.PLS Changing sharpbang in blib\script\fastam9_to_table.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\fastam9_to_table.PLS.bak Copying scripts\taxa\classify_hits_kingdom.PLS -> blib\script\classify_hits_kingdom.PLS Changing sharpbang in blib\script\classify_hits_kingdom.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\classify_hits_kingdom.PLS.bak Copying scripts\utilities\remote_blast.PLS -> blib\script\remote_blast.PLS Changing sharpbang in blib\script\remote_blast.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\remote_blast.PLS.bak Copying scripts\utilities\pairwise_kaks.PLS -> blib\script\pairwise_kaks.PLS Changing sharpbang in blib\script\pairwise_kaks.PLS to C:\Perl64\bin\perl.exeDeleting blib\script\pairwise_kaks.PLS.bak t/Align/AlignStats.t ......................... 1..45 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::AlignIO; ok 4 - The object isa Bio::Align::AlignI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - The object isa Bio::Align::AlignI ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - The object isa Bio::Align::AlignI ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - The object isa Bio::Align::AlignI ok 38 - The object isa Bio::Matrix::PhylipDist ok 39 ok 40 ok 41 ok 42 - The object isa Bio::PrimarySeqI ok 43 ok 44 - Warn if seqs don't overlap ok 45 ok t/Align/AlignUtil.t .......................... 1..33 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqIO; ok 4 - The object isa Bio::Align::AlignI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok t/Align/Graphics.t ........................... 1..41 ok 1 - use Bio::Align::Graphics; ok 2 - require Bio::Align::Graphics; ok 3 - Bio::Align::Graphics->can(...) ok 4 - input is defined ok 5 - AlignIO object is defined ok 6 - The object isa Bio::AlignIO ok 7 - alignment is there and defined ok 8 - all starts are present ok 9 - all ends are present ok 10 - all colors are present ok 11 - first end is further than first start ok 12 - second end is further than second start ok 13 - third end is further than third start ok 14 - domain labels are present ok 15 - domain starts are present ok 16 - domain ends are present ok 17 - domain colors are present ok 18 - label - first end is further than first start ok 19 - label - second end is further than second start ok 20 - label - third end is further than third start ok 21 - first label start is within domain range ok 22 - second label start is within domain range ok 23 - third label start is within domain range ok 24 - first label end is within domain range ok 25 - second label end is within domain range ok 26 - third label end is within domain range ok 27 - individual labels work ok 28 - The object isa Bio::Align::Graphics ok 29 - new object is defined ok 30 - pad_bottom is right ok 31 - default pad_top is right ok 32 - start point loaded ok 33 - end point loaded ok 34 - color of domain loaded ok 35 - domain labels loaded ok 36 - label starts loaded ok 37 - label ends loaded ok 38 - label colors loaded ok 39 - labels loaded ok 40 - output file is png ok 41 - wrapping length is not zero ok t/Align/SimpleAlign.t ........................ 1..199 ok 1 - use Bio::SimpleAlign; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Location::Simple; ok 5 - use Bio::Location::Split; ok 6 - The object isa Bio::AlignIO ok 7 - pfam input test ok 8 - match_line ok 9 - The object isa Bio::Align::AlignI ok 10 - num_sequences ok 11 - num_sequences ok 12 - select_noncont ok 13 - select_noncont ok 14 - num_sequences ok 15 - select_noncont ok 16 - select_noncont ok 17 - each_seq ok 18 - get_nse ok 19 - id ok 20 - num_gaps ok 21 - each_alphabetically ok 22 - column_from_residue_number ok 23 - display_name get/set ok 24 - display_name get ok 25 - consensus_string ok 26 - consensus_string ok 27 - consensus_string ok 28 ok 29 - each_seq_with_id ok 30 - is_flush ok 31 - id get/set ok 32 - length ok 33 - num_residues ok 34 - num_sequences ok 35 - overall_percentage_identity ok 36 - overall_percentage_identity (align) ok 37 - overall_percentage_identity (short) ok 38 - overall_percentage_identity (long) ok 39 - average_percentage_identity ok 40 ok 41 - set_displayname_count ok 42 ok 43 - set_displayname_flat ok 44 ok 45 - set_displayname_normal ok 46 ok 47 ok 48 - uppercase, map_chars ok 49 - match_line ok 50 - remove_seqs ok 51 - remove_seqs ok 52 - add_seq ok 53 - add_seq ok 54 - get_seq_by_pos ok 55 - get_seq_by_pos ok 56 ok 57 ok 58 ok 59 - purge ok 60 - purge ok 61 - IO::String consensus_iupac ok 62 - IO::String write_aln normal ok 63 - IO::String write_aln slice ok 64 - IO::String write_aln slice ok 65 - IO::String write_aln slice ok 66 - IO::String write_aln slice ok 67 - IO::String write_aln slice ok 68 ok 69 - remove_columns by position ok 70 - remove_columns by position (wrong order) ok 71 - cigar_line ok 72 - cigar_line ok 73 - cigar_line ok 74 - cigar_line ok 75 - sort_alphabetically - before ok 76 ok 77 - sort_alphabetically - after ok 78 - remove_gaps ok 79 - remove_gaps all_gaps_only ok 80 - set_new_reference ok 81 - set_new_reference ok 82 - uniq_seq ok 83 - bug 2099 ok 84 - bug 2099 ok 85 - bug 2793 ok 86 - bug 2793 ok 87 - bug 2793 ok 88 - bug 2793 ok 89 - Bad sequence, bad! ok 90 - added 3 seqs ok 91 - first 2 features added ok 92 - 3rd feature added not ok 93 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 1. # Overriding value [0] with value 1 for Bio::LocatableSeq::end(). # ? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly\var\megalib/Test/Exception.pm:103 # STACK: Test::Exception::lives_ok C:\cpanfly\var\megalib/Test/Exception.pm:259 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 94 - slice 1 len ok 95 - correct masked seq ok 96 - correct masked seq ok 97 - correct masked seq not ok 98 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 3. # Overriding value [2] with value 3 for Bio::LocatableSeq::end(). # ? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly\var\megalib/Test/Exception.pm:103 # STACK: Test::Exception::lives_ok C:\cpanfly\var\megalib/Test/Exception.pm:259 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 99 - slice 2 len ok 100 - correct masked seq ok 101 - correct masked seq ok 102 - correct masked seq not ok 103 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 3. # Overriding value [1] with value 3 for Bio::LocatableSeq::end(). # ?? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly\var\megalib/Test/Exception.pm:103 # STACK: Test::Exception::lives_ok C:\cpanfly\var\megalib/Test/Exception.pm:259 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 104 - slice 3 len ok 105 - correct masked seq ok 106 - correct masked seq ok 107 - correct masked seq not ok 108 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 6. # Overriding value [4] with value 6 for Bio::LocatableSeq::end(). # ?? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly\var\megalib/Test/Exception.pm:103 # STACK: Test::Exception::lives_ok C:\cpanfly\var\megalib/Test/Exception.pm:259 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 109 - slice 4 len ok 110 - correct masked seq ok 111 - correct masked seq ok 112 - correct masked seq ok 113 - initial display id ok ok 114 - safe display id ok ok 115 - restored display id ok ok 116 - sort by list ok ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 - BIC:GGATCCATT[C/C]CTACT ok 124 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT ok 125 - BIC:G[G/C]ATCCATT[C/G]CTACT ok 126 - BIC:GGATCCATT[C/G]CTACT ok 127 - BIC:GGATCCATT[C/G]CTAC[T/A] ok 128 - BIC:GGATCCATT[C/G]CTA[C/G][T/A] ok 129 - BIC:GGATCCATT[C/G]CTACT ok 130 - BIC:GGATCCATT{C.C}CTACT ok 131 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT ok 132 - BIC:G{G.C}ATCCATT{C.G}CTACT ok 133 - BIC:GGATCCATT{C.G}CTACT ok 134 - BIC:GGATCCATT{C.G}CTAC{T.A} ok 135 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A} ok 136 - BIC:GGATCCATT{C.G}CTACT ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 - The object isa Bio::SimpleAlign ok 195 - consensus string looks ok ok 196 - looks like correct unmasked alignment (from clustalw) ok 197 - looks like correct masked alignment (from clustalw) ok 198 ok 199 - align after looks ok ok t/Align/TreeBuild.t .......................... 1..13 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::Align::Utilities; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Tree::DistanceFactory; ok 6 - use Bio::TreeIO; ok 7 - SimpleAlign object parsed out isa Bio::SimpleAlign ok 8 - Protein distance matrix retrieved isa Bio::Matrix::MatrixI ok 9 - Tree object gotten back isa Bio::Tree::TreeI ok 10 - NJ calculated Branch length ok 11 - NJ calculated Branch length ok 12 - Make sure two nodes are sister ok 13 - 10 replicates formulated ok t/Align/Utilities.t .......................... 1..13 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::SimpleAlign; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::AlignIO; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 96, line 86. Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 128, line 86. Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 153, line 86. Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 174, line 86. Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 199, line 86. Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 229, line 86. Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 265, line 86. Subroutine new redefined at Bio\Seq\Meta.pm line 225, line 64. Subroutine meta redefined at Bio\Seq\Meta.pm line 269, line 64. Subroutine meta_text redefined at Bio\Seq\Meta.pm line 284, line 64. Subroutine named_meta redefined at Bio\Seq\Meta.pm line 300, line 64. Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 347, line 64. Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 377, line 64. Subroutine submeta redefined at Bio\Seq\Meta.pm line 409, line 64. Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 425, line 64. Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 444, line 64. Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 503, line 64. Subroutine meta_names redefined at Bio\Seq\Meta.pm line 518, line 64. Subroutine meta_length redefined at Bio\Seq\Meta.pm line 540, line 64. Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 556, line 64. Subroutine force_flush redefined at Bio\Seq\Meta.pm line 577, line 64. Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 604, line 64. Subroutine is_flush redefined at Bio\Seq\Meta.pm line 637, line 64. Subroutine revcom redefined at Bio\Seq\Meta.pm line 679, line 64. Subroutine trunc redefined at Bio\Seq\Meta.pm line 702, line 64. Subroutine to_string redefined at Bio\Seq\Meta.pm line 726, line 64. t/AlignIO/AlignIO.t .......................... 1..28 ok 1 - use Bio::AlignIO; ok 2 - input filehandle method test : metafasta ok 3 - input filehandle method test : po ok 4 - input filehandle method test : nexus ok 5 - input filehandle method test : clustalw ok 6 - input filehandle method test : prodom ok 7 - input filehandle method test : fasta ok 8 - input filehandle method test : arp ok 9 - input filehandle method test : xmfa ok 10 - input filehandle method test : mase ok 11 - input filehandle method test : psi ok 12 - input filehandle method test : phylip ok 13 - input filehandle method test : pfam ok 14 - input filehandle method test : selex ok 15 - input filehandle method test : stockholm ok 16 - input filehandle method test : msf ok 17 - filehandle output test : metafasta ok 18 - filehandle output test : po ok 19 - filehandle output test : nexus ok 20 - filehandle output test : clustalw ok 21 - filehandle output test : fasta ok 22 - filehandle output test : xmfa ok 23 - filehandle output test : psi ok 24 - filehandle output test : phylip ok 25 - filehandle output test : pfam ok 26 - filehandle output test : selex ok 27 - filehandle output test : stockholm ok 28 - filehandle output test : msf ok Subroutine next_aln redefined at Bio\AlignIO\arp.pm line 116. Subroutine write_aln redefined at Bio\AlignIO\arp.pm line 199. Subroutine _process_sequence redefined at Bio\AlignIO\arp.pm line 206. Subroutine _process_annotation redefined at Bio\AlignIO\arp.pm line 218. Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 96, line 86. Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 128, line 86. Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 153, line 86. Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 174, line 86. Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 199, line 86. Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 229, line 86. Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 265, line 86. t/AlignIO/arp.t .............................. 1..48 ok 1 - use Bio::AlignIO::arp; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 - ARP get_nse() ok 5 ok 6 - ARP num_sequences() ok 7 - ARP id() ok 8 - ARP description() ok 9 - The object isa Bio::AnnotationCollectionI ok 10 - The object isa Bio::AnnotationI ok 11 ok 12 ok 13 ok 14 ok 15 - The object isa Bio::AlignIO ok 16 - The object isa Bio::Align::AlignI ok 17 - ARP get_nse() ok 18 - ARP num_sequences() ok 19 - ARP id() ok 20 - ARP description() ok 21 - The object isa Bio::AnnotationCollectionI ok 22 - The object isa Bio::AnnotationI ok 23 ok 24 ok 25 ok 26 ok 27 - The object isa Bio::Align::AlignI ok 28 - ARP get_nse() ok 29 - ARP num_sequences() ok 30 - ARP id() ok 31 - ARP description() ok 32 - The object isa Bio::AnnotationCollectionI ok 33 - The object isa Bio::AnnotationI ok 34 ok 35 ok 36 ok 37 ok 38 - The object isa Bio::Align::AlignI ok 39 - ARP get_nse() ok 40 - ARP num_sequences() ok 41 - ARP id() ok 42 - ARP description() ok 43 - The object isa Bio::AnnotationCollectionI ok 44 - The object isa Bio::AnnotationI ok 45 ok 46 ok 47 ok 48 ok Subroutine _initialize redefined at Bio\AlignIO\bl2seq.pm line 124. Subroutine next_aln redefined at Bio\AlignIO\bl2seq.pm line 142. Subroutine write_aln redefined at Bio\AlignIO\bl2seq.pm line 184. Subroutine report_type redefined at Bio\AlignIO\bl2seq.pm line 200. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 64. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 64. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 64. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 64. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 64. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 64. t/AlignIO/bl2seq.t ........................... 1..3 ok 1 - use Bio::AlignIO::bl2seq; ok 2 - The object isa Bio::Align::AlignI ok 3 - BLAST bl2seq format test ok Subroutine _initialize redefined at Bio\AlignIO\clustalw.pm line 100. Subroutine next_aln redefined at Bio\AlignIO\clustalw.pm line 121. Subroutine write_aln redefined at Bio\AlignIO\clustalw.pm line 233. Subroutine percentages redefined at Bio\AlignIO\clustalw.pm line 332. Subroutine line_length redefined at Bio\AlignIO\clustalw.pm line 351. t/AlignIO/clustalw.t ......................... 1..6 ok 1 - use Bio::AlignIO::clustalw; ok 2 - The object isa Bio::Align::AlignI ok 3 - clustalw consensus_string test ok 4 - clustalw (.aln) output test ok 5 - The object isa Bio::Align::AlignI ok 6 - clustalw (.aln) input test ok Subroutine _initialize redefined at Bio\AlignIO\emboss.pm line 92. Subroutine next_aln redefined at Bio\AlignIO\emboss.pm line 109. Subroutine write_aln redefined at Bio\AlignIO\emboss.pm line 252. t/AlignIO/emboss.t ........................... 1..37 ok 1 - use Bio::AlignIO::emboss; ok 2 - The object isa Bio::Align::AlignI ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - The object isa Bio::Align::AlignI ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Align::AlignI ok 15 ok 16 ok 17 ok 18 - The object isa Bio::Align::AlignI ok 19 ok 20 ok 21 - The object isa Bio::Align::AlignI ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - The object isa Bio::Align::AlignI ok 33 ok 34 ok 35 ok 36 ok 37 ok Subroutine next_aln redefined at Bio\AlignIO\fasta.pm line 80. Subroutine write_aln redefined at Bio\AlignIO\fasta.pm line 185. Subroutine _get_len redefined at Bio\AlignIO\fasta.pm line 228. Subroutine width redefined at Bio\AlignIO\fasta.pm line 247. t/AlignIO/fasta.t ............................ 1..10 ok 1 - use Bio::AlignIO::fasta; ok 2 - The object isa Bio::Align::AlignI ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for end ok 7 - fasta input test for description ok 8 - fasta output test ok 9 - filehandle input test ok 10 - filehandle output test ok Subroutine _initialize redefined at Bio\AlignIO\largemultifasta.pm line 81. Subroutine next_seq redefined at Bio\AlignIO\largemultifasta.pm line 102. Subroutine next_aln redefined at Bio\AlignIO\largemultifasta.pm line 143. Subroutine write_aln redefined at Bio\AlignIO\largemultifasta.pm line 176. t/AlignIO/largemultifasta.t .................. 1..7 ok 1 - use Bio::AlignIO::largemultifasta; ok 2 - The object isa Bio::Align::AlignI ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for description ok 7 - fasta output test ok Subroutine _initialize redefined at Bio\AlignIO\maf.pm line 102. Subroutine next_aln redefined at Bio\AlignIO\maf.pm line 121. Subroutine write_aln redefined at Bio\AlignIO\maf.pm line 187. t/AlignIO/maf.t .............................. 1..11 ok 1 - use Bio::AlignIO::maf; ok 2 - The object isa Bio::Align::AlignI ok 3 - maf input test ok 4 ok 5 - The object isa Bio::Align::AlignI ok 6 - maf input test ok 7 ok 8 - maf input test ok 9 ok 10 - maf input test ok 11 ok Subroutine next_aln redefined at Bio\AlignIO\mase.pm line 82. Subroutine write_aln redefined at Bio\AlignIO\mase.pm line 158. t/AlignIO/mase.t ............................. 1..3 ok 1 - use Bio::AlignIO::mase; ok 2 - The object isa Bio::Align::AlignI ok 3 - mase input test ok Subroutine next_aln redefined at Bio\AlignIO\mega.pm line 115. Subroutine write_aln redefined at Bio\AlignIO\mega.pm line 188. t/AlignIO/mega.t ............................. 1..6 ok 1 - use Bio::AlignIO::mega; ok 2 - The object isa Bio::Align::AlignI ok 3 ok 4 ok 5 ok 6 - mega output test ok Subroutine next_aln redefined at Bio\AlignIO\meme.pm line 104. Subroutine write_aln redefined at Bio\AlignIO\meme.pm line 198. Subroutine _initialize redefined at Bio\AlignIO\meme.pm line 207. t/AlignIO/meme.t ............................. 1..14 ok 1 - use Bio::AlignIO::meme; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 ok 6 ok 7 ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine _initialize redefined at Bio\AlignIO\metafasta.pm line 89. Subroutine next_aln redefined at Bio\AlignIO\metafasta.pm line 107. Subroutine write_aln redefined at Bio\AlignIO\metafasta.pm line 181. Subroutine width redefined at Bio\AlignIO\metafasta.pm line 225. t/AlignIO/metafasta.t ........................ 1..4 ok 1 - use Bio::AlignIO::metafasta; ok 2 - The object isa Bio::Align::AlignI ok 3 - consensus_string on metafasta ok 4 - symbol_chars() using metafasta ok Subroutine next_aln redefined at Bio\AlignIO\msf.pm line 90. Subroutine write_aln redefined at Bio\AlignIO\msf.pm line 173. t/AlignIO/msf.t .............................. 1..4 ok 1 - use Bio::AlignIO::msf; ok 2 - The object isa Bio::Align::AlignI ok 3 - msf input test ok 4 - msf output test ok Subroutine _initialize redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\AlignIO\nexml.pm line 71. Subroutine next_aln redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\AlignIO\nexml.pm line 90. Subroutine rewind redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\AlignIO\nexml.pm line 110. Subroutine doc redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\AlignIO\nexml.pm line 125. Subroutine _parse redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\AlignIO\nexml.pm line 133. Subroutine write_aln redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\AlignIO\nexml.pm line 165. # Begin tests for write/read roundtrip t/AlignIO/nexml.t ............................ 1..35 ok 1 - use Bio::AlignIO::nexml; ok 2 - make stream ok 3 - nexml matrix to aln ok 4 - obj ok isa Bio::SimpleAlign ok 5 - aln id ok 6 - alphabet ok 7 - display_id ok 8 - sequence correct ok 9 - alphabet ok 10 - display_id ok 11 - sequence correct ok 12 - alphabet ok 13 - display_id ok 14 - sequence correct ok 15 - out stream ok ok 16 - write nexml ok 17 - reopen ok 18 - get aln (rt) ok 19 - aln obj (rt) isa Bio::SimpleAlign ok 20 - aln id (rt) ok 21 - alphabet (rt) ok 22 - display_id (rt) ok 23 - sequence (rt) ok 24 - alphabet (rt) ok 25 - display_id (rt) ok 26 - sequence (rt) ok 27 - alphabet (rt) ok 28 - display_id (rt) ok 29 - sequence (rt) ok 30 - taxa id ok ok 31 - taxa label ok ok 32 - Number of taxa ok ok 33 - DNA sequences.row_1 taxon ok ok 34 - DNA sequences.row_2 taxon ok ok 35 - DNA sequences.row_3 taxon ok ok Subroutine _initialize redefined at Bio\AlignIO\nexus.pm line 103. Subroutine next_aln redefined at Bio\AlignIO\nexus.pm line 142. Subroutine _read_taxlabels redefined at Bio\AlignIO\nexus.pm line 339. Subroutine write_aln redefined at Bio\AlignIO\nexus.pm line 367. Subroutine flag redefined at Bio\AlignIO\nexus.pm line 463. t/AlignIO/nexus.t ............................ 1..43 ok 1 - use Bio::AlignIO::nexus; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - nexus output test ok 6 - The object isa Bio::AlignIO ok 7 - The object isa Bio::Align::AlignI ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 - The object isa Bio::AlignIO ok 11 - The object isa Bio::Align::AlignI ok 12 - The object isa Bio::AlignIO ok 13 - The object isa Bio::Align::AlignI ok 14 - The object isa Bio::AlignIO ok 15 - The object isa Bio::Align::AlignI ok 16 - The object isa Bio::AlignIO ok 17 - The object isa Bio::Align::AlignI ok 18 - The object isa Bio::AlignIO ok 19 - The object isa Bio::Align::AlignI ok 20 - The object isa Bio::AlignIO ok 21 - The object isa Bio::Align::AlignI ok 22 - The object isa Bio::AlignIO ok 23 - The object isa Bio::Align::AlignI ok 24 - The object isa Bio::AlignIO ok 25 - The object isa Bio::Align::AlignI ok 26 - The object isa Bio::AlignIO ok 27 - The object isa Bio::Align::AlignI ok 28 - The object isa Bio::AlignIO ok 29 - The object isa Bio::Align::AlignI ok 30 - The object isa Bio::AlignIO ok 31 - The object isa Bio::Align::AlignI ok 32 - The object isa Bio::AlignIO ok 33 - The object isa Bio::Align::AlignI ok 34 - The object isa Bio::AlignIO ok 35 - The object isa Bio::Align::AlignI ok 36 - The object isa Bio::AlignIO ok 37 - The object isa Bio::Align::AlignI ok 38 - The object isa Bio::AlignIO ok 39 - The object isa Bio::Align::AlignI ok 40 - The object isa Bio::AlignIO ok 41 - The object isa Bio::Align::AlignI ok 42 - The object isa Bio::AlignIO ok 43 - The object isa Bio::Align::AlignI ok Subroutine next_aln redefined at Bio\AlignIO\pfam.pm line 81. Subroutine write_aln redefined at Bio\AlignIO\pfam.pm line 140. t/AlignIO/pfam.t ............................. 1..5 ok 1 - use Bio::AlignIO::pfam; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - pfam output test ok Subroutine _initialize redefined at Bio\AlignIO\phylip.pm line 134. Subroutine next_aln redefined at Bio\AlignIO\phylip.pm line 171. Subroutine write_aln redefined at Bio\AlignIO\phylip.pm line 323. Subroutine interleaved redefined at Bio\AlignIO\phylip.pm line 443. Subroutine flag_SI redefined at Bio\AlignIO\phylip.pm line 466. Subroutine idlength redefined at Bio\AlignIO\phylip.pm line 486. Subroutine line_length redefined at Bio\AlignIO\phylip.pm line 505. Subroutine tag_length redefined at Bio\AlignIO\phylip.pm line 526. Subroutine id_linebreak redefined at Bio\AlignIO\phylip.pm line 546. Subroutine wrap_sequential redefined at Bio\AlignIO\phylip.pm line 566. Subroutine longid redefined at Bio\AlignIO\phylip.pm line 585. t/AlignIO/phylip.t ........................... 1..16 ok 1 - use Bio::AlignIO::phylip; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - phylip output test ok 6 ok 7 ok 8 not ok 9 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 44. # got: undef # expected: '0' not ok 10 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 45. # got: '50' # expected: '47' ok 11 - The object isa Bio::Align::AlignI ok 12 ok 13 - The object isa Bio::AlignIO ok 14 - The object isa Bio::Align::AlignI ok 15 ok 16 ok Subroutine next_aln redefined at Bio\AlignIO\po.pm line 83. Subroutine write_aln redefined at Bio\AlignIO\po.pm line 228. t/AlignIO/po.t ............................... 1..11 ok 1 - use Bio::AlignIO::po; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - The object isa Bio::AlignIO ok 6 - The object isa Bio::Align::AlignI ok 7 - po output test ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 ok 11 ok Subroutine next_aln redefined at Bio\AlignIO\prodom.pm line 81. Subroutine write_aln redefined at Bio\AlignIO\prodom.pm line 134. t/AlignIO/prodom.t ........................... 1..3 ok 1 - use Bio::AlignIO::prodom; ok 2 - The object isa Bio::Align::AlignI ok 3 - prodom input test ok Subroutine next_aln redefined at Bio\AlignIO\psi.pm line 107. Subroutine write_aln redefined at Bio\AlignIO\psi.pm line 147. t/AlignIO/psi.t .............................. 1..5 ok 1 - use Bio::AlignIO::psi; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 ok Subroutine next_aln redefined at Bio\AlignIO\selex.pm line 95. Subroutine write_aln redefined at Bio\AlignIO\selex.pm line 162. t/AlignIO/selex.t ............................ 1..4 ok 1 - use Bio::AlignIO::selex; ok 2 - The object isa Bio::Align::AlignI ok 3 - selex format test ok 4 - selex output test ok Subroutine _initialize redefined at Bio\AlignIO\stockholm.pm line 354. Subroutine next_aln redefined at Bio\AlignIO\stockholm.pm line 379. Subroutine write_aln redefined at Bio\AlignIO\stockholm.pm line 514. Subroutine line_length redefined at Bio\AlignIO\stockholm.pm line 660. Subroutine spaces redefined at Bio\AlignIO\stockholm.pm line 679. Subroutine alignhandler redefined at Bio\AlignIO\stockholm.pm line 695. Subroutine _print_seqs redefined at Bio\AlignIO\stockholm.pm line 707. Subroutine new redefined at Bio\Seq\Meta.pm line 225, line 64. Subroutine meta redefined at Bio\Seq\Meta.pm line 269, line 64. Subroutine meta_text redefined at Bio\Seq\Meta.pm line 284, line 64. Subroutine named_meta redefined at Bio\Seq\Meta.pm line 300, line 64. Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 347, line 64. Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 377, line 64. Subroutine submeta redefined at Bio\Seq\Meta.pm line 409, line 64. Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 425, line 64. Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 444, line 64. Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 503, line 64. Subroutine meta_names redefined at Bio\Seq\Meta.pm line 518, line 64. Subroutine meta_length redefined at Bio\Seq\Meta.pm line 540, line 64. Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 556, line 64. Subroutine force_flush redefined at Bio\Seq\Meta.pm line 577, line 64. Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 604, line 64. Subroutine is_flush redefined at Bio\Seq\Meta.pm line 637, line 64. Subroutine revcom redefined at Bio\Seq\Meta.pm line 679, line 64. Subroutine trunc redefined at Bio\Seq\Meta.pm line 702, line 64. Subroutine to_string redefined at Bio\Seq\Meta.pm line 726, line 64. t/AlignIO/stockholm.t ........................ 1..84 ok 1 - use Bio::AlignIO::stockholm; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - The object isa Bio::Annotation::Comment ok 10 - Stockholm annotation ok 11 - Stockholm annotation ok 12 - stockholm output test ok 13 - The object isa Bio::Align::AlignI ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 - Stockholm annotation isa Bio::Annotation::Reference ok 21 - Stockholm annotation ok 22 - Stockholm annotation ok 23 - Stockholm annotation ok 24 - Stockholm annotation ok 25 - The object isa Bio::Seq::MetaI ok 26 - Rfam meta data ok 27 - Rfam meta data ok 28 ok 29 - The object isa Bio::Align::AlignI ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - The object isa Bio::Seq::MetaI ok 36 - Rfam meta data ok 37 - Rfam meta data ok 38 - The object isa Bio::AlignIO ok 39 ok 40 - The object isa Bio::Align::AlignI ok 41 ok 42 ok 43 ok 44 ok 45 - The object isa Bio::Annotation::SimpleValue ok 46 - Pfam annotation ok 47 ok 48 - The object isa Bio::Align::AlignI ok 49 ok 50 ok 51 ok 52 ok 53 - The object isa Bio::Align::AlignI ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - The object isa Bio::Seq::MetaI ok 60 - Pfam aln meta data ok 61 - Pfam aln meta data ok 62 - Pfam aln meta data ok 63 - Pfam aln meta data ok 64 - Pfam aln meta data ok 65 - Pfam aln meta data ok 66 - Pfam seq meta data ok 67 - Pfam seq meta data ok 68 - Pfam seq meta data ok 69 - Pfam seq meta data ok 70 ok 71 - The object isa Bio::SeqFeatureI ok 72 - The object isa Bio::Seq::Meta ok 73 - The object isa Bio::AnnotationI ok 74 - The object isa Bio::Annotation::DBLink ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok Subroutine next_aln redefined at Bio\AlignIO\xmfa.pm line 87. Subroutine write_aln redefined at Bio\AlignIO\xmfa.pm line 141. Subroutine _get_len redefined at Bio\AlignIO\xmfa.pm line 194. Subroutine width redefined at Bio\AlignIO\xmfa.pm line 212. Subroutine _process_seq redefined at Bio\AlignIO\xmfa.pm line 221. t/AlignIO/xmfa.t ............................. 1..30 ok 1 - use Bio::AlignIO::xmfa; ok 2 - The object isa Bio::Align::AlignI ok 3 - xmfa input test ok 4 - xmfa input test for start ok 5 - xmfa input test for end ok 6 - xmfa strand test ok 7 - xmfa input test for id ok 8 - xmfa input test for id ok 9 - xmfa input test ok 10 - xmfa input test for start ok 11 - xmfa input test for end ok 12 - xmfa strand test ok 13 - xmfa input test for id ok 14 - xmfa input test for id ok 15 - xmfa input test ok 16 - xmfa input test for start ok 17 - xmfa input test for end ok 18 - xmfa strand test ok 19 - xmfa input test for id ok 20 - xmfa input test for id ok 21 - xmfa alignment score ok 22 - The object isa Bio::Align::AlignI ok 23 - xmfa input test ok 24 - xmfa strand ok 25 - xmfa input test for description ok 26 - xmfa input test for id ok 27 - xmfa input test for end ok 28 - xmfa input test for end ok 29 - xmfa alignment score ok 30 - xmfa output test ok t/Alphabet.t ................................. 1..100 ok 1 - use Bio::Symbol::Alphabet; ok 2 - use Bio::Symbol::Symbol; ok 3 - use Bio::Symbol::DNAAlphabet; ok 4 - use Bio::Symbol::ProteinAlphabet; ok 5 - The object isa Bio::Symbol::Alphabet ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - The object isa Bio::Symbol::AlphabetI ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - The object isa Bio::Symbol::AlphabetI ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 96. Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 128. Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 153. Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 174. Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 199. Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 229. Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 265. Subroutine new redefined at Bio\Annotation\OntologyTerm.pm line 128. Subroutine as_text redefined at Bio\Annotation\OntologyTerm.pm line 172. Subroutine display_text redefined at Bio\Annotation\OntologyTerm.pm line 197. Subroutine hash_tree redefined at Bio\Annotation\OntologyTerm.pm line 218. Subroutine tagname redefined at Bio\Annotation\OntologyTerm.pm line 246. Subroutine term redefined at Bio\Annotation\OntologyTerm.pm line 274. Subroutine identifier redefined at Bio\Annotation\OntologyTerm.pm line 297. Subroutine name redefined at Bio\Annotation\OntologyTerm.pm line 313. Subroutine definition redefined at Bio\Annotation\OntologyTerm.pm line 330. Subroutine ontology redefined at Bio\Annotation\OntologyTerm.pm line 348. Subroutine is_obsolete redefined at Bio\Annotation\OntologyTerm.pm line 364. Subroutine comment redefined at Bio\Annotation\OntologyTerm.pm line 380. Subroutine get_synonyms redefined at Bio\Annotation\OntologyTerm.pm line 394. Subroutine add_synonym redefined at Bio\Annotation\OntologyTerm.pm line 410. Subroutine remove_synonyms redefined at Bio\Annotation\OntologyTerm.pm line 425. Subroutine get_dblinks redefined at Bio\Annotation\OntologyTerm.pm line 441. Subroutine get_dbxrefs redefined at Bio\Annotation\OntologyTerm.pm line 457. Subroutine add_dblink redefined at Bio\Annotation\OntologyTerm.pm line 477. Subroutine add_dbxref redefined at Bio\Annotation\OntologyTerm.pm line 496. Subroutine remove_dblinks redefined at Bio\Annotation\OntologyTerm.pm line 512. Subroutine remove_dbxrefs redefined at Bio\Annotation\OntologyTerm.pm line 528. Subroutine get_secondary_ids redefined at Bio\Annotation\OntologyTerm.pm line 546. Subroutine add_secondary_id redefined at Bio\Annotation\OntologyTerm.pm line 563. Subroutine remove_secondary_ids redefined at Bio\Annotation\OntologyTerm.pm line 578. Subroutine new redefined at Bio\Annotation\Comment.pm line 64. Subroutine as_text redefined at Bio\Annotation\Comment.pm line 92. Subroutine display_text redefined at Bio\Annotation\Comment.pm line 117. Subroutine hash_tree redefined at Bio\Annotation\Comment.pm line 138. Subroutine tagname redefined at Bio\Annotation\Comment.pm line 166. Subroutine text redefined at Bio\Annotation\Comment.pm line 193. Subroutine type redefined at Bio\Annotation\Comment.pm line 231. Subroutine Bio::Annotation::Comment::value redefined at Bio\Annotation\Comment.pm line 215. Subroutine new redefined at Bio\Annotation\Target.pm line 67. Subroutine as_text redefined at Bio\Annotation\Target.pm line 104. Subroutine display_text redefined at Bio\Annotation\Target.pm line 134. Subroutine tagname redefined at Bio\Annotation\Target.pm line 163. Subroutine target_id redefined at Bio\Annotation\Target.pm line 198. Subroutine new redefined at Bio\Tree\Tree.pm line 131. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283. Subroutine id redefined at Bio\Tree\Tree.pm line 306. Subroutine score redefined at Bio\Tree\Tree.pm line 327. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520. Subroutine clone redefined at Bio\Tree\Tree.pm line 540. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558. Subroutine new redefined at Bio\Tree\Node.pm line 110. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461. Subroutine description redefined at Bio\Tree\Node.pm line 482. Subroutine id redefined at Bio\Tree\Node.pm line 511. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588. Subroutine height redefined at Bio\Tree\Node.pm line 606. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800. Subroutine new redefined at Bio\Annotation\Tree.pm line 73. Subroutine as_text redefined at Bio\Annotation\Tree.pm line 114. Subroutine display_text redefined at Bio\Annotation\Tree.pm line 141. Subroutine hash_tree redefined at Bio\Annotation\Tree.pm line 161. Subroutine tagname redefined at Bio\Annotation\Tree.pm line 185. Subroutine tree_id redefined at Bio\Annotation\Tree.pm line 206. Subroutine tree redefined at Bio\Annotation\Tree.pm line 223. Subroutine new redefined at Bio\Annotation\TagTree.pm line 139. Subroutine as_text redefined at Bio\Annotation\TagTree.pm line 178. Subroutine display_text redefined at Bio\Annotation\TagTree.pm line 202. Subroutine hash_tree redefined at Bio\Annotation\TagTree.pm line 223. Subroutine tagname redefined at Bio\Annotation\TagTree.pm line 243. Subroutine value redefined at Bio\Annotation\TagTree.pm line 265. Subroutine tagformat redefined at Bio\Annotation\TagTree.pm line 313. Subroutine node redefined at Bio\Annotation\TagTree.pm line 336. Subroutine element redefined at Bio\Annotation\TagTree.pm line 378. Subroutine data redefined at Bio\Annotation\TagTree.pm line 394. Subroutine children redefined at Bio\Annotation\TagTree.pm line 418. Subroutine subnodes redefined at Bio\Annotation\TagTree.pm line 436. Subroutine get redefined at Bio\Annotation\TagTree.pm line 453. Subroutine find redefined at Bio\Annotation\TagTree.pm line 470. Subroutine findnode redefined at Bio\Annotation\TagTree.pm line 487. Subroutine findval redefined at Bio\Annotation\TagTree.pm line 503. Subroutine addchild redefined at Bio\Annotation\TagTree.pm line 526. Subroutine add redefined at Bio\Annotation\TagTree.pm line 561. Subroutine set redefined at Bio\Annotation\TagTree.pm line 583. Subroutine unset redefined at Bio\Annotation\TagTree.pm line 604. Subroutine free redefined at Bio\Annotation\TagTree.pm line 619. Subroutine hash redefined at Bio\Annotation\TagTree.pm line 635. Subroutine pairs redefined at Bio\Annotation\TagTree.pm line 652. Subroutine qmatch redefined at Bio\Annotation\TagTree.pm line 668. Subroutine tnodes redefined at Bio\Annotation\TagTree.pm line 683. Subroutine ntnodes redefined at Bio\Annotation\TagTree.pm line 698. Subroutine get_all_values redefined at Bio\Annotation\TagTree.pm line 721. t/Annotation/Annotation.t .................... 1..159 ok 1 - use Bio::Annotation::Collection; ok 2 - use Bio::Annotation::DBLink; ok 3 - use Bio::Annotation::Comment; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Target; ok 7 - use Bio::Annotation::AnnotationFactory; ok 8 - use Bio::Annotation::StructuredValue; ok 9 - use Bio::Annotation::TagTree; ok 10 - use Bio::Annotation::Tree; ok 11 - use Bio::Seq; ok 12 - use Bio::SimpleAlign; ok 13 - use Bio::Cluster::UniGene; ok 14 - The object isa Bio::AnnotationI ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - The object isa Bio::AnnotationI ok 22 ok 23 ok 24 ok 25 - The object isa Bio::AnnotationCollectionI ok 26 ok 27 ok 28 - The object isa Bio::AnnotationI ok 29 ok 30 - The object isa Bio::AnnotationI ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - The object isa Bio::AnnotationI ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 - The object isa Bio::AnnotationCollectionI ok 69 ok 70 ok 71 ok 72 ok 73 - The object isa Bio::Annotation::StructuredValue ok 74 ok 75 ok 76 ok 77 ok 78 - use Bio::Annotation::OntologyTerm; ok 79 - The object isa Bio::Ontology::Term ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 - The object isa Bio::AnnotatableI ok 86 - isa SeqFeatureI isa Bio::SeqFeatureI ok 87 - isa AnnotatableI isa Bio::AnnotatableI ok 88 - isa SeqFeatureI isa Bio::SeqFeatureI ok 89 - isa AnnotatableI isa Bio::AnnotatableI ok 90 - The object isa Bio::AnnotatableI ok 91 - The object isa Bio::AnnotatableI ok 92 - The object isa Bio::Factory::ObjectFactoryI ok 93 - The object isa Bio::Annotation::SimpleValue ok 94 ok 95 - The object isa Bio::Annotation::OntologyTerm ok 96 - Bio::Annotation::Comment ok 97 - The object isa Bio::Annotation::Comment ok 98 ok 99 - Bio::Annotation::Comment ok 100 - The object isa Bio::Annotation::Comment ok 101 - Bio::Annotation::Comment ok 102 - The object isa Bio::Annotation::Comment ok 103 ok 104 - The object isa Bio::Annotation::Target ok 105 ok 106 ok 107 - The object isa Bio::AnnotationI ok 108 - tree_id() ok 109 - tagname() ok 110 - The object isa Bio::AnnotatableI ok 111 ok 112 - add tree to AlignI ok 113 - get seq from node id ok 114 ok 115 - The object isa Bio::Annotation::Tree ok 116 - The object isa Bio::AnnotationI ok 117 - default itext ok 118 - roundtrip ok 119 - itext ok 120 - spxr ok 121 - indent ok 122 - xml ok 123 - The object isa Data::Stag::StagI ok 124 ok 125 - child changes ok 126 - The object isa Data::Stag::StagI ok 127 ok 128 - child changes ok 129 - The object isa Data::Stag::StagI ok 130 ok 131 - child changes ok 132 - child changes in parent node ok 133 - no tags ok 134 - before Stag node ok 135 - after Stag node ok 136 - both stag nodes ok 137 - different instances ok 138 - before TagTree ok 139 - after TagTree ok 140 - both stag nodes ok 141 - different instances ok 142 - before TagTree ok 143 - after TagTree ok 144 - stag nodes ok 145 - same instance ok 146 - before TagTree ok 147 - after TagTree ok 148 - stag nodes ok 149 - different instance ok 150 - The object isa Bio::AnnotationI ok 151 - The object isa Data::Stag::StagI ok 152 - child changes ok 153 - The object isa Data::Stag::StagI ok 154 - child changes ok 155 - The object isa Data::Stag::StagI ok 156 - child changes ok 157 ok 158 ok 159 - The object isa Bio::Annotation::TagTree ok t/Annotation/AnnotationAdaptor.t ............. 1..23 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::AnnotationAdaptor; ok 3 - use Bio::Annotation::DBLink; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok Bio::Assembly::IO: could not load tigr - for more details on supported formats please see the Assembly::IO docs Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::Assembly::IO::tigr. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio/SeqFeature/Collection.pm line 146. BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146. Compilation failed in require at Bio/Assembly/Singlet.pm line 91. BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91. Compilation failed in require at Bio\Assembly\IO\tigr.pm line 237. BEGIN failed--compilation aborted at Bio\Assembly\IO\tigr.pm line 237. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:296 STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:138 STACK: t/Assembly/ContigSpectrum.t:12 ----------------------------------------------------------- # Failed test 'The thing isa Bio::Assembly::IO' # at t/Assembly/ContigSpectrum.t line 16. # The thing isn't defined Can't call method "next_assembly" on an undefined value at t/Assembly/ContigSpectrum.t line 17. # Looks like you planned 236 tests but ran 3. # Looks like you failed 1 test of 3 run. # Looks like your test exited with 2 just after 3. t/Assembly/ContigSpectrum.t .................. 1..236 ok 1 - use Bio::Assembly::IO; ok 2 - use Bio::Assembly::Tools::ContigSpectrum; not ok 3 - The thing isa Bio::Assembly::IO Dubious, test returned 2 (wstat 512, 0x200) Failed 234/236 subtests t/Assembly/IO/bowtie.t ....................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/IO/sam.t .......................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/core.t ............................ skipped: The optional module DB_File (or dependencies thereof) was not installed t/Biblio/Biblio.t ............................ 1..24 ok 1 - use Bio::Biblio; ok 2 - use Bio::Biblio::IO; ok 3 ok 4 ok 5 - citation 1 ok 6 - citation 2 ok 7 - citation 3 ok 8 - in callback ok 9 - in callback ok 10 - in callback ok 11 - calling callback ok 12 - citation 1 ok 13 - citation 2 ok 14 - citation 1 ok 15 - citation 2 ok 16 ok 17 - citation 1 ok 18 - citation 2 ok 19 - citation 3 ok 20 - citation 4 ok 21 - filehandle test ok 22 - filehandle test ok 23 - filehandle test ok 24 - filehandle test ok t/Biblio/References.t ........................ 1..537 ok 1 - use Bio::Biblio::Article; ok 2 - use Bio::Biblio::Book; ok 3 - use Bio::Biblio::BookArticle; ok 4 - use Bio::Biblio::Journal; ok 5 - use Bio::Biblio::JournalArticle; ok 6 - use Bio::Biblio::MedlineArticle; ok 7 - use Bio::Biblio::MedlineBook; ok 8 - use Bio::Biblio::MedlineBookArticle; ok 9 - use Bio::Biblio::MedlineJournal; ok 10 - use Bio::Biblio::MedlineJournalArticle; ok 11 - use Bio::Biblio::Organisation; ok 12 - use Bio::Biblio::Patent; ok 13 - use Bio::Biblio::Person; ok 14 - use Bio::Biblio::Proceeding; ok 15 - use Bio::Biblio::Provider; ok 16 - use Bio::Biblio::Ref; ok 17 - use Bio::Biblio::Service; ok 18 - use Bio::Biblio::TechReport; ok 19 - use Bio::Biblio::Thesis; ok 20 - use Bio::Biblio::WebResource; ok 21 - use Bio::Biblio::PubmedArticle; ok 22 - use Bio::Biblio::PubmedBookArticle; ok 23 - use Bio::Biblio::PubmedJournalArticle; ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 - set 'abstract' ok 48 - get 'abstract' ok 49 - set 'abstract_language' ok 50 - get 'abstract_language' ok 51 - set 'abstract_type' ok 52 - get 'abstract_type' ok 53 - set 'author_list_complete' ok 54 - get 'author_list_complete' ok 55 - set 'cross_references_list_complete' ok 56 - get 'cross_references_list_complete' ok 57 - set 'date' ok 58 - get 'date' ok 59 - set 'date_completed' ok 60 - get 'date_completed' ok 61 - set 'date_created' ok 62 - get 'date_created' ok 63 - set 'date_revised' ok 64 - get 'date_revised' ok 65 - set 'format' ok 66 - get 'format' ok 67 - set 'identifier' ok 68 - get 'identifier' ok 69 - set 'language' ok 70 - get 'language' ok 71 - set 'last_modified_date' ok 72 - get 'last_modified_date' ok 73 - set 'repository_subset' ok 74 - get 'repository_subset' ok 75 - set 'rights' ok 76 - get 'rights' ok 77 - set 'spatial_location' ok 78 - get 'spatial_location' ok 79 - set 'subject_headings_source' ok 80 - get 'subject_headings_source' ok 81 - set 'temporal_period' ok 82 - get 'temporal_period' ok 83 - set 'title' ok 84 - get 'title' ok 85 - set 'toc' ok 86 - get 'toc' ok 87 - set 'toc_type' ok 88 - get 'toc_type' ok 89 - set 'type' ok 90 - get 'type' ok 91 - set 'first_page' ok 92 - get 'first_page' ok 93 - set 'last_page' ok 94 - get 'last_page' ok 95 - set 'issue' ok 96 - get 'issue' ok 97 - set 'issue_supplement' ok 98 - get 'issue_supplement' ok 99 - set 'volume' ok 100 - get 'volume' ok 101 - set 'affiliation' ok 102 - get 'affiliation' ok 103 - set 'citation_owner' ok 104 - get 'citation_owner' ok 105 - set 'date_of_electronic_publication' ok 106 - get 'date_of_electronic_publication' ok 107 - set 'gene_symbols' ok 108 - get 'gene_symbols' ok 109 - set 'grant_list_complete' ok 110 - get 'grant_list_complete' ok 111 - set 'medline_date' ok 112 - get 'medline_date' ok 113 - set 'medline_id' ok 114 - get 'medline_id' ok 115 - set 'medline_page' ok 116 - get 'medline_page' ok 117 - set 'number_of_references' ok 118 - get 'number_of_references' ok 119 - set 'other_languages' ok 120 - get 'other_languages' ok 121 - set 'pmid' ok 122 - get 'pmid' ok 123 - set 'season' ok 124 - get 'season' ok 125 - set 'status' ok 126 - get 'status' ok 127 - set 'vernacular_title' ok 128 - get 'vernacular_title' ok 129 ok 130 - abstract ok 131 - abstract_language ok 132 - abstract_type ok 133 - author_list_complete ok 134 - cross_references_list_complete ok 135 - date ok 136 - date_completed ok 137 - date_created ok 138 - date_revised ok 139 - format ok 140 - identifier ok 141 - language ok 142 - last_modified_date ok 143 - repository_subset ok 144 - rights ok 145 - spatial_location ok 146 - subject_headings_source ok 147 - temporal_period ok 148 - title ok 149 - toc ok 150 - toc_type ok 151 - type ok 152 - first_page ok 153 - last_page ok 154 - issue ok 155 - issue_supplement ok 156 - volume ok 157 - affiliation ok 158 - citation_owner ok 159 - date_of_electronic_publication ok 160 - gene_symbols ok 161 - grant_list_complete ok 162 - medline_date ok 163 - medline_id ok 164 - medline_page ok 165 - number_of_references ok 166 - other_languages ok 167 - pmid ok 168 - season ok 169 - status ok 170 - vernacular_title ok 171 - get 'authors' ok 172 - get 'cross_references' ok 173 - get 'codes' ok 174 - get 'contributors' ok 175 - get 'keywords' ok 176 - get 'publisher' ok 177 - get 'subject_headings' ok 178 - get 'journal' ok 179 - get 'chemicals' ok 180 - get 'comment_ins' ok 181 - get 'comment_ons' ok 182 - get 'erratum_fors' ok 183 - get 'erratum_ins' ok 184 - get 'general_notes' ok 185 - get 'grants' ok 186 - get 'mesh_headings' ok 187 - get 'original_report_ins' ok 188 - get 'other_abstracts' ok 189 - get 'other_ids' ok 190 - get 'republished_froms' ok 191 - get 'republished_ins' ok 192 - get 'retraction_ins' ok 193 - get 'retraction_ofs' ok 194 - get 'summary_for_patients_ins' ok 195 - get 'update_ins' ok 196 - get 'update_ofs' ok 197 - get 'journal' ok 198 - add_author 1 ok 199 - add_author 2 ok 200 - get authors ok 201 - add_contributor 1 ok 202 - add_contributor 2 ok 203 - get contributors ok 204 - add_cross_reference 1 ok 205 - add_cross_reference 2 ok 206 - get cross_references ok 207 - get cross_references ok 208 - set 'abstract' ok 209 - get 'abstract' ok 210 - set 'abstract_language' ok 211 - get 'abstract_language' ok 212 - set 'abstract_type' ok 213 - get 'abstract_type' ok 214 - set 'author_list_complete' ok 215 - get 'author_list_complete' ok 216 - set 'cross_references_list_complete' ok 217 - get 'cross_references_list_complete' ok 218 - set 'date' ok 219 - get 'date' ok 220 - set 'date_completed' ok 221 - get 'date_completed' ok 222 - set 'date_created' ok 223 - get 'date_created' ok 224 - set 'date_revised' ok 225 - get 'date_revised' ok 226 - set 'format' ok 227 - get 'format' ok 228 - set 'identifier' ok 229 - get 'identifier' ok 230 - set 'language' ok 231 - get 'language' ok 232 - set 'last_modified_date' ok 233 - get 'last_modified_date' ok 234 - set 'repository_subset' ok 235 - get 'repository_subset' ok 236 - set 'rights' ok 237 - get 'rights' ok 238 - set 'spatial_location' ok 239 - get 'spatial_location' ok 240 - set 'subject_headings_source' ok 241 - get 'subject_headings_source' ok 242 - set 'temporal_period' ok 243 - get 'temporal_period' ok 244 - set 'title' ok 245 - get 'title' ok 246 - set 'toc' ok 247 - get 'toc' ok 248 - set 'toc_type' ok 249 - get 'toc_type' ok 250 - set 'type' ok 251 - get 'type' ok 252 - set 'first_page' ok 253 - get 'first_page' ok 254 - set 'last_page' ok 255 - get 'last_page' ok 256 - set 'affiliation' ok 257 - get 'affiliation' ok 258 - set 'citation_owner' ok 259 - get 'citation_owner' ok 260 - set 'date_of_electronic_publication' ok 261 - get 'date_of_electronic_publication' ok 262 - set 'gene_symbols' ok 263 - get 'gene_symbols' ok 264 - set 'grant_list_complete' ok 265 - get 'grant_list_complete' ok 266 - set 'medline_date' ok 267 - get 'medline_date' ok 268 - set 'medline_id' ok 269 - get 'medline_id' ok 270 - set 'medline_page' ok 271 - get 'medline_page' ok 272 - set 'number_of_references' ok 273 - get 'number_of_references' ok 274 - set 'other_languages' ok 275 - get 'other_languages' ok 276 - set 'pmid' ok 277 - get 'pmid' ok 278 - set 'season' ok 279 - get 'season' ok 280 - set 'status' ok 281 - get 'status' ok 282 - set 'vernacular_title' ok 283 - get 'vernacular_title' ok 284 ok 285 - abstract ok 286 - abstract_language ok 287 - abstract_type ok 288 - author_list_complete ok 289 - cross_references_list_complete ok 290 - date ok 291 - date_completed ok 292 - date_created ok 293 - date_revised ok 294 - format ok 295 - identifier ok 296 - language ok 297 - last_modified_date ok 298 - repository_subset ok 299 - rights ok 300 - spatial_location ok 301 - subject_headings_source ok 302 - temporal_period ok 303 - title ok 304 - toc ok 305 - toc_type ok 306 - type ok 307 - first_page ok 308 - last_page ok 309 - affiliation ok 310 - citation_owner ok 311 - date_of_electronic_publication ok 312 - gene_symbols ok 313 - grant_list_complete ok 314 - medline_date ok 315 - medline_id ok 316 - medline_page ok 317 - number_of_references ok 318 - other_languages ok 319 - pmid ok 320 - season ok 321 - status ok 322 - vernacular_title ok 323 - get 'authors' ok 324 - get 'cross_references' ok 325 - get 'codes' ok 326 - get 'contributors' ok 327 - get 'keywords' ok 328 - get 'publisher' ok 329 - get 'subject_headings' ok 330 - get 'book' ok 331 - get 'chemicals' ok 332 - get 'comment_ins' ok 333 - get 'comment_ons' ok 334 - get 'erratum_fors' ok 335 - get 'erratum_ins' ok 336 - get 'general_notes' ok 337 - get 'grants' ok 338 - get 'mesh_headings' ok 339 - get 'original_report_ins' ok 340 - get 'other_abstracts' ok 341 - get 'other_ids' ok 342 - get 'republished_froms' ok 343 - get 'republished_ins' ok 344 - get 'retraction_ins' ok 345 - get 'retraction_ofs' ok 346 - get 'summary_for_patients_ins' ok 347 - get 'update_ins' ok 348 - get 'update_ofs' ok 349 - get 'book' ok 350 - set 'abstract' ok 351 - get 'abstract' ok 352 - set 'abstract_language' ok 353 - get 'abstract_language' ok 354 - set 'abstract_type' ok 355 - get 'abstract_type' ok 356 - set 'author_list_complete' ok 357 - get 'author_list_complete' ok 358 - set 'cross_references_list_complete' ok 359 - get 'cross_references_list_complete' ok 360 - set 'date' ok 361 - get 'date' ok 362 - set 'date_completed' ok 363 - get 'date_completed' ok 364 - set 'date_created' ok 365 - get 'date_created' ok 366 - set 'date_revised' ok 367 - get 'date_revised' ok 368 - set 'format' ok 369 - get 'format' ok 370 - set 'identifier' ok 371 - get 'identifier' ok 372 - set 'language' ok 373 - get 'language' ok 374 - set 'last_modified_date' ok 375 - get 'last_modified_date' ok 376 - set 'repository_subset' ok 377 - get 'repository_subset' ok 378 - set 'rights' ok 379 - get 'rights' ok 380 - set 'spatial_location' ok 381 - get 'spatial_location' ok 382 - set 'subject_headings_source' ok 383 - get 'subject_headings_source' ok 384 - set 'temporal_period' ok 385 - get 'temporal_period' ok 386 - set 'title' ok 387 - get 'title' ok 388 - set 'toc' ok 389 - get 'toc' ok 390 - set 'toc_type' ok 391 - get 'toc_type' ok 392 - set 'type' ok 393 - get 'type' ok 394 - set 'edition' ok 395 - get 'edition' ok 396 - set 'isbn' ok 397 - get 'isbn' ok 398 - set 'series' ok 399 - get 'series' ok 400 - set 'volume' ok 401 - get 'volume' ok 402 ok 403 - abstract ok 404 - abstract_language ok 405 - abstract_type ok 406 - author_list_complete ok 407 - cross_references_list_complete ok 408 - date ok 409 - date_completed ok 410 - date_created ok 411 - date_revised ok 412 - format ok 413 - identifier ok 414 - language ok 415 - last_modified_date ok 416 - repository_subset ok 417 - rights ok 418 - spatial_location ok 419 - subject_headings_source ok 420 - temporal_period ok 421 - title ok 422 - toc ok 423 - toc_type ok 424 - type ok 425 - edition ok 426 - isbn ok 427 - series ok 428 - volume ok 429 - get 'authors' ok 430 - get 'cross_references' ok 431 - get 'codes' ok 432 - get 'contributors' ok 433 - get 'keywords' ok 434 - get 'publisher' ok 435 - get 'subject_headings' ok 436 - get 'editor' ok 437 - set 'abbreviation' ok 438 - get 'abbreviation' ok 439 - set 'issn' ok 440 - get 'issn' ok 441 - set 'name' ok 442 - get 'name' ok 443 - set 'coden' ok 444 - get 'coden' ok 445 - set 'country' ok 446 - get 'country' ok 447 - set 'medline_code' ok 448 - get 'medline_code' ok 449 - set 'medline_ta' ok 450 - get 'medline_ta' ok 451 - set 'nlm_unique_id' ok 452 - get 'nlm_unique_id' ok 453 ok 454 - abbreviation ok 455 - issn ok 456 - name ok 457 - coden ok 458 - country ok 459 - medline_code ok 460 - medline_ta ok 461 - nlm_unique_id ok 462 - set 'doc_number' ok 463 - get 'doc_number' ok 464 - set 'doc_office' ok 465 - get 'doc_office' ok 466 - set 'doc_type' ok 467 - get 'doc_type' ok 468 ok 469 - doc_number ok 470 - doc_office ok 471 - doc_type ok 472 - get 'applicants' ok 473 - set 'url' ok 474 - get 'url' ok 475 - set 'estimated_size' ok 476 - get 'estimated_size' ok 477 - set 'cost' ok 478 - get 'cost' ok 479 ok 480 - url ok 481 - estimated_size ok 482 - cost ok 483 - set 'type' ok 484 - get 'type' ok 485 - set 'affiliation' ok 486 - get 'affiliation' ok 487 - set 'email' ok 488 - get 'email' ok 489 - set 'firstname' ok 490 - get 'firstname' ok 491 - set 'forename' ok 492 - get 'forename' ok 493 - set 'initials' ok 494 - get 'initials' ok 495 - set 'lastname' ok 496 - get 'lastname' ok 497 - set 'middlename' ok 498 - get 'middlename' ok 499 - set 'postal_address' ok 500 - get 'postal_address' ok 501 - set 'suffix' ok 502 - get 'suffix' ok 503 ok 504 - type ok 505 - affiliation ok 506 - email ok 507 - firstname ok 508 - forename ok 509 - initials ok 510 - lastname ok 511 - middlename ok 512 - postal_address ok 513 - suffix ok 514 - set 'type' ok 515 - get 'type' ok 516 - set 'name' ok 517 - get 'name' ok 518 ok 519 - type ok 520 - name ok 521 - set 'type' ok 522 - get 'type' ok 523 - set 'name' ok 524 - get 'name' ok 525 ok 526 - type ok 527 - name ok 528 - set 'pubmed_status' ok 529 - get 'pubmed_status' ok 530 - set 'pubmed_provider_id' ok 531 - get 'pubmed_provider_id' ok 532 ok 533 - pubmed_status ok 534 - pubmed_provider_id ok 535 - get 'pubmed_history_list' ok 536 - get 'pubmed_article_id_list' ok 537 - get 'pubmed_url_list' ok t/Biblio/biofetch.t .......................... skipped: Network tests have not been requested t/Biblio/eutils.t ............................ skipped: Network tests have not been requested t/ClusterIO/ClusterIO.t ...................... 1..12 ok 1 - use Bio::ClusterIO; ok 2 - use Bio::Cluster::ClusterFactory; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - The object isa Bio::Cluster::UniGeneI ok 12 - The object isa Bio::Cluster::UniGeneI ok t/ClusterIO/SequenceFamily.t ................. 1..19 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Cluster::SequenceFamily; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok Subroutine new redefined at Bio\Cluster\UniGene.pm line 258. Subroutine unigene_id redefined at Bio\Cluster\UniGene.pm line 320. Subroutine title redefined at Bio\Cluster\UniGene.pm line 342. Subroutine gene redefined at Bio\Cluster\UniGene.pm line 363. Subroutine cytoband redefined at Bio\Cluster\UniGene.pm line 381. Subroutine mgi redefined at Bio\Cluster\UniGene.pm line 398. Subroutine locuslink redefined at Bio\Cluster\UniGene.pm line 426. Subroutine homol redefined at Bio\Cluster\UniGene.pm line 455. Subroutine restr_expr redefined at Bio\Cluster\UniGene.pm line 472. Subroutine gnm_terminus redefined at Bio\Cluster\UniGene.pm line 490. Subroutine scount redefined at Bio\Cluster\UniGene.pm line 506. Subroutine express redefined at Bio\Cluster\UniGene.pm line 528. Subroutine chromosome redefined at Bio\Cluster\UniGene.pm line 546. Subroutine sts redefined at Bio\Cluster\UniGene.pm line 564. Subroutine txmap redefined at Bio\Cluster\UniGene.pm line 582. Subroutine protsim redefined at Bio\Cluster\UniGene.pm line 600. Subroutine sequences redefined at Bio\Cluster\UniGene.pm line 623. Subroutine species redefined at Bio\Cluster\UniGene.pm line 643. Subroutine display_id redefined at Bio\Cluster\UniGene.pm line 675. Subroutine description redefined at Bio\Cluster\UniGene.pm line 692. Subroutine size redefined at Bio\Cluster\UniGene.pm line 710. Subroutine cluster_score redefined at Bio\Cluster\UniGene.pm line 742. Subroutine get_members redefined at Bio\Cluster\UniGene.pm line 765. Subroutine annotation redefined at Bio\Cluster\UniGene.pm line 814. Subroutine add_member redefined at Bio\Cluster\UniGene.pm line 846. Subroutine remove_members redefined at Bio\Cluster\UniGene.pm line 876. Subroutine next_locuslink redefined at Bio\Cluster\UniGene.pm line 905. Subroutine next_express redefined at Bio\Cluster\UniGene.pm line 931. Subroutine next_chromosome redefined at Bio\Cluster\UniGene.pm line 958. Subroutine next_protsim redefined at Bio\Cluster\UniGene.pm line 985. Subroutine next_sts redefined at Bio\Cluster\UniGene.pm line 1012. Subroutine next_txmap redefined at Bio\Cluster\UniGene.pm line 1039. Subroutine _next_element redefined at Bio\Cluster\UniGene.pm line 1052. Subroutine object_id redefined at Bio\Cluster\UniGene.pm line 1089. Subroutine version redefined at Bio\Cluster\UniGene.pm line 1111. Subroutine authority redefined at Bio\Cluster\UniGene.pm line 1133. Subroutine namespace redefined at Bio\Cluster\UniGene.pm line 1155. Subroutine display_name redefined at Bio\Cluster\UniGene.pm line 1183. Subroutine next_seq redefined at Bio\Cluster\UniGene.pm line 1234. Subroutine sequence_factory redefined at Bio\Cluster\UniGene.pm line 1292. Subroutine _annotation_value redefined at Bio\Cluster\UniGene.pm line 1320. Subroutine _annotation_value_ary redefined at Bio\Cluster\UniGene.pm line 1361. Subroutine _annotation_dblink redefined at Bio\Cluster\UniGene.pm line 1397. Subroutine _remove_dblink redefined at Bio\Cluster\UniGene.pm line 1432. Subroutine Bio::Cluster::UniGene::sequence redefined at Bio\Cluster\UniGene.pm line 1456. t/ClusterIO/unigene.t ........................ 1..73 ok 1 - use Bio::ClusterIO; ok 2 - new Bio::ClusterIO object defined ok 3 ok 4 - The object isa Bio::Cluster::UniGeneI ok 5 - The object isa Bio::ClusterI ok 6 - The object isa Bio::IdentifiableI ok 7 - The object isa Bio::DescribableI ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - The object isa Bio::PrimarySeqI ok 49 ok 50 ok 51 - annotation object defined ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 - The object isa Bio::PrimarySeqI ok 67 ok 68 - next cluster ok 69 ok 70 ok 71 ok 72 ok 73 ok t/Coordinate/CoordinateGraph.t ............... 1..7 ok 1 - use Bio::Coordinate::Graph; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok t/Coordinate/CoordinateMapper.t .............. 1..175 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::Result::Match; ok 4 - use Bio::Coordinate::Result::Gap; ok 5 - use Bio::Coordinate::Chain; ok 6 - use Bio::Coordinate::Collection; ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Coordinate::Result ok 15 - The object isa Bio::Location::SplitLocationI ok 16 ok 17 ok 18 ok 19 - The object isa Bio::LocationI ok 20 - The object isa Bio::Coordinate::Result::Match ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - The object isa Bio::Coordinate::Result::Gap ok 38 - The object isa Bio::LocationI ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - The object isa Bio::Coordinate::Result::Match ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Match: |314696| Test: 314696| ok 139 ok 140 ok 141 ok 142 - Match: |341| Test: 341| ok 143 ok 144 ok 145 ok 146 - Match: |315843| Test: 315843| ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - Match: |627011| Test: 627011| ok 153 ok 154 ok 155 ok 156 - Match: |chr1| Test: chr1| ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok t/Coordinate/GeneCoordinateMapper.t .......... 1..116 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::ExtrapolatingPair; ok 4 - use Bio::Coordinate::GeneMapper; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Location::Simple ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 - The object isa Bio::Location::Simple ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/Draw/Pictogram.t ........................... 1..6 ok 1 - use Bio::Draw::Pictogram; ok 2 - use Bio::SeqIO; ok 3 - use Bio::Matrix::PSM::IO; ok 4 - The object isa Bio::Draw::Pictogram ok 5 ok 6 ok t/LiveSeq/Chain.t ............................ 1..45 ok 1 - use Bio::LiveSeq::Chain; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok t/LiveSeq/LiveSeq.t .......................... 1..48 ok 1 - use Bio::LiveSeq::IO::BioPerl; ok 2 ok 3 ok 4 - Bio::LiveSeq::Gene ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok t/LiveSeq/Mutation.t ......................... 1..19 ok 1 - use Bio::LiveSeq::Mutation; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/LiveSeq/Mutator.t .......................... 1..24 ok 1 - use Bio::LiveSeq::Mutator; ok 2 - use Bio::LiveSeq::IO::BioPerl; ok 3 - use Bio::Variation::IO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/LocalDB/BioDBGFF.t ......................... skipped: Not compatible with your Operating System t/LocalDB/DBFasta.t .......................... 1..17 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - bug 3126 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - threw Regexp ((?-xism:FASTA header doesn't match)) ok t/LocalDB/DBQual.t ........................... 1..38 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Seq::PrimaryQual ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - The object isa Bio::Seq::PrimaryQual ok 26 ok 27 ok 28 - The object isa Bio::Seq::PrimaryQual ok 29 ok 30 ok 31 ok 32 - The object isa Bio::Seq::PrimaryQual ok 33 ok 34 - The object isa Bio::Seq::PrimaryQual ok 35 ok 36 ok 37 ok 38 ok t/LocalDB/Flat.t ............................. skipped: The optional module DB_File (or dependencies thereof) was not installed Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. t/LocalDB/Index/Blast.t ...................... 1..26 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::Blast; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok --------------------- WARNING --------------------- MSG: overwriting a current value stored for SP130_MOUSE --------------------------------------------------- --------------------- WARNING --------------------- MSG: overwriting a current value stored for SDS3_MOUSE --------------------------------------------------- --------------------- WARNING --------------------- MSG: overwriting a current value stored for IKZF1_MOUSE --------------------------------------------------- t/LocalDB/Index/BlastTable.t ................. 1..27 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::BlastTable; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/LocalDB/Index/Index.t ...................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/LocalDB/Registry.t ......................... 1..14 ok 1 - use Bio::DB::Registry; ok 2 - use Bio::DB::Flat; ok 3 ok 4 # skip The optional module DB_File (or dependencies thereof) was not installed ok 5 # skip The optional module DB_File (or dependencies thereof) was not installed ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok # Failed test 'use Bio::DB::SeqFeature::Store::GFF3Loader;' # in t/LocalDB/SeqFeature.t at line 16. # Tried to use 'Bio::DB::SeqFeature::Store::GFF3Loader'. # Error: Can't locate DB_File.pm in @INC (@INC contains: . .. ./t/lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio/DB/SeqFeature/Store/LoadHelper.pm line 38. # BEGIN failed--compilation aborted at t/LocalDB/SeqFeature.t line 16. # Compilation failed in require at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72. # Compilation failed in require at (eval 58) line 2. # BEGIN failed--compilation aborted at (eval 58) line 2. # Looks like you planned 116 tests but ran 1 extra. # Looks like you failed 1 test of 117 run. t/LocalDB/SeqFeature.t ....................... 1..116 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::DB::SeqFeature::Store; not ok 3 - use Bio::DB::SeqFeature::Store::GFF3Loader; ok 4 - use Bio::Root::IO; ok 5 - use Bio::DB::Fasta; ok 6 - use File::Copy; ok 7 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 8 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 9 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 10 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 11 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 12 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 13 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 14 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 15 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 16 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 17 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 18 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 19 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 20 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 21 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 22 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 23 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 24 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 25 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 26 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 27 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 28 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 29 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 30 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 31 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 32 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 33 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 34 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 35 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 36 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 37 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 38 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 39 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 40 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 41 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 42 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 43 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 44 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 45 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 46 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 47 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 48 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 49 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 50 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 51 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 52 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 53 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 54 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 55 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 56 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 57 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 58 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 59 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 60 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 61 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 62 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 63 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 64 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 65 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 66 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 67 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 68 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 69 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 70 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 71 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 72 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 73 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 74 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 75 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 76 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 77 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 78 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 79 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 80 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 81 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 82 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 83 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 84 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 85 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 86 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 87 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 88 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 89 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 90 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 91 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 92 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 93 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 94 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 95 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 96 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 97 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 98 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 99 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 100 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 101 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 102 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 103 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 104 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 105 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 106 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 107 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 108 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 109 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 110 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 111 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 112 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 113 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 114 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 115 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 116 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # ok 117 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 73) line 3. # at t/LocalDB/SeqFeature.t line 32 # Dubious, test returned 1 (wstat 256, 0x100) Failed 1/116 subtests (less 111 skipped subtests: 4 okay) ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio\DB\Taxonomy\flatfile.pm line 89. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114 STACK: t/LocalDB/transfac_pro.t:18 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio\DB\Taxonomy\flatfile.pm line 89. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114 STACK: t/LocalDB/transfac_pro.t:18 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio\DB\TFBS\transfac_pro.pm line 118. BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151 STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130 STACK: t/LocalDB/transfac_pro.t:25 ----------------------------------------------------------- Bio::DB::TFBS: transfac_pro cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio\DB\TFBS\transfac_pro.pm line 118. BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151 STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130 STACK: t/LocalDB/transfac_pro.t:25 ----------------------------------------------------------- For more information about the Bio::DB::TFBS system please see the Bio::DB::TFBS docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/LocalDB/transfac_pro.t line 25. Can't call method "get_reference_ids" on an undefined value at t/LocalDB/transfac_pro.t line 33. # Looks like you planned 115 tests but ran 4. # Looks like you failed 1 test of 4 run. # Looks like your test exited with 2 just after 4. t/LocalDB/transfac_pro.t ..................... 1..115 ok 1 - use Bio::Matrix::PSM::IO; ok 2 - use Bio::DB::TFBS; ok 3 - use Bio::DB::Taxonomy; not ok 4 Dubious, test returned 2 (wstat 512, 0x200) Failed 112/115 subtests t/Map/Cyto.t ................................. 1..110 ok 1 - use Bio::Map::CytoMap; ok 2 - use Bio::Map::CytoPosition; ok 3 - use Bio::Map::CytoMarker; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Map::CytoPosition ok 15 ok 16 ok 17 ok 18 - The object isa Bio::Range ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok t/Map/Linkage.t .............................. 1..18 ok 1 - use Bio::Map::LinkagePosition; ok 2 - use Bio::Map::Microsatellite; ok 3 - use Bio::Map::LinkageMap; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/Map/Map.t .................................. 1..267 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Marker; ok 3 - use Bio::Map::Position; ok 4 - use Bio::Map::Relative; ok 5 - use Bio::Map::Mappable; ok 6 ok 7 ok 8 ok 9 ok 10 - Length is 0 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 - use Bio::Map::Gene; ok 152 - use Bio::Map::GeneMap; ok 153 - use Bio::Map::TranscriptionFactor; ok 154 - use Bio::Map::GeneRelative; ok 155 - use Bio::Map::GenePosition; ok 156 - use Bio::Map::Prediction; ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok t/Map/MapIO.t ................................ 1..51 ok 1 - use Bio::MapIO; ok 2 ok 3 - The object isa Bio::Map::MapI ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Map/MicrosatelliteMarker.t ................. 1..8 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Position; ok 3 - use Bio::Map::Microsatellite; ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Map/Physical.t ............................. 1..39 ok 1 - use Bio::Map::Physical; ok 2 - use Bio::MapIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - code holds and returns a string, definition requires a boolean ok 13 - code holds and returns a string, definition requires a boolean ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok t/Matrix/IO/masta.t .......................... 1..16 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/Matrix/IO/psm.t ............................ 1..63 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Matrix/InstanceSite.t ...................... 1..6 ok 1 - use Bio::Matrix::PSM::InstanceSite; ok 2 ok 3 ok 4 ok 5 ok 6 ok t/Matrix/Matrix.t ............................ 1..77 ok 1 - use Bio::Matrix::Generic; ok 2 - use Bio::Matrix::IO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - The object isa Bio::Matrix::Scoring ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - The object isa Bio::Matrix::Scoring ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok t/Matrix/ProtMatrix.t ........................ 1..14 ok 1 - use Bio::Matrix::PSM::ProtMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Matrix/ProtPsm.t ........................... 1..14 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 # skip TODO: Module incomplete ok 6 # skip TODO: Module incomplete ok 7 # skip TODO: Module incomplete ok 8 # skip TODO: Module incomplete ok 9 # skip TODO: Module incomplete ok 10 # skip TODO: Module incomplete ok 11 # skip TODO: Module incomplete ok 12 # skip TODO: Module incomplete ok 13 # skip TODO: Module incomplete ok 14 # skip TODO: Module incomplete ok t/Matrix/SiteMatrix.t ........................ 1..14 ok 1 - use Bio::Matrix::PSM::SiteMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Ontology/GOterm.t .......................... 1..62 ok 1 - use Bio::Ontology::GOterm; ok 2 - use Bio::Ontology::Ontology; ok 3 - use Bio::Annotation::DBLink; ok 4 - The object isa Bio::Ontology::GOterm ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok t/Ontology/GraphAdaptor.t .................... 1..28 ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Ontology/IO/go.t ........................... 1..102 ok 1 - use Bio::OntologyIO; ok 2 ok 3 - The object isa Bio::Ontology::OntologyI ok 4 ok 5 - The object isa Bio::Ontology::OntologyEngineI ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/Ontology/IO/interpro.t ..................... 1..69 ok 1 - use Bio::OntologyIO; ok 2 - The object isa Bio::OntologyIO::InterProParser ok 3 ok 4 - get_dbxrefs on leaf terms is non-empty ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty ok 11 - get_members on leaf terms is non-empty ok 12 - class_list on leaf terms is non-empty ok 13 - get_examples on leaf terms is non-empty ok 14 - get_external_documents on leaf terms is non-empty ok 15 - get_references on leaf terms is non-empty ok 16 - protein_count on leaf terms is non-empty ok 17 - to_string looks reasonable ok 18 - There are 8 root InterPro terms ok 19 - The object isa Bio::Ontology::Ontology ok 20 - term Integrins alpha chain in ontology InterPro ok 21 - The object isa Bio::Ontology::Ontology ok 22 - term post-translational modification in ontology InterPro ok 23 - The object isa Bio::Ontology::Ontology ok 24 - term Repeat in ontology InterPro ok 25 - The object isa Bio::Ontology::Ontology ok 26 - term Binding Site in ontology InterPro ok 27 - The object isa Bio::Ontology::Ontology ok 28 - term Cdc20/Fizzy in ontology InterPro ok 29 - The object isa Bio::Ontology::Ontology ok 30 - term Conserved Site in ontology InterPro ok 31 - The object isa Bio::Ontology::Ontology ok 32 - term Region in ontology InterPro ok 33 - The object isa Bio::Ontology::Ontology ok 34 - term Kringle in ontology InterPro ok 35 - The object isa Bio::Ontology::Ontology ok 36 - term Helix-turn-helix, AraC type in ontology InterPro ok 37 - The object isa Bio::Ontology::Ontology ok 38 - term Active Site in ontology InterPro ok 39 - The object isa Bio::Ontology::Ontology ok 40 - term Active Site in ontology InterPro ok 41 - The object isa Bio::Ontology::Ontology ok 42 - term Binding Site in ontology InterPro ok 43 - The object isa Bio::Ontology::Ontology ok 44 - term Conserved Site in ontology InterPro ok 45 - The object isa Bio::Ontology::Ontology ok 46 - term Domain in ontology InterPro ok 47 - The object isa Bio::Ontology::Ontology ok 48 - term Family in ontology InterPro ok 49 - The object isa Bio::Ontology::Ontology ok 50 - term Region in ontology InterPro ok 51 - The object isa Bio::Ontology::Ontology ok 52 - term Repeat in ontology InterPro ok 53 - The object isa Bio::Ontology::Ontology ok 54 - term post-translational modification in ontology InterPro ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Integrins alpha chain term has one parent ok 62 - Integrins alpha chain term has one ancestor ok 63 - Cdc20/Fizzy term has one parent ok 64 - Cdc20/Fizzy term has one ancestor ok 65 - Kringle term has one parent ok 66 - Kringle term has one ancestor ok 67 - Helix-turn-helix, AraC type term has one parent ok 68 - Helix-turn-helix, AraC type term has one ancestor ok 69 - secondary accession map has 2 keys ok t/Ontology/IO/obo.t .......................... 1..92 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - got a ontology IO handler isa Bio::OntologyIO ok 47 - got ontology parser2 isa Bio::Ontology::Ontology ok 48 - got OBO engine object isa Bio::Ontology::OBOEngine ok 49 - got ontology parser2 isa Bio::Ontology::Ontology ok 50 - got OBO engine object isa Bio::Ontology::OBOEngine ok 51 - got ontology parser2 isa Bio::Ontology::Ontology ok 52 - got OBO engine object isa Bio::Ontology::OBOEngine ok 53 - Gene ontology ok 54 - biological process ok 55 - molecular function ok 56 - Got root ok 57 - Got root ok 58 - Got regulates # from gene_ontology ok 59 - Got # positively regulates from gene_ontology ok 60 - Got # regulates from biological_process ok 61 - Got # positively regulates from biological_process ok 62 - Got predicates for gene_ontology ok 63 - Got predicates for biological_process ok 64 - Got regulates predicate ok 65 - Got positively regulates predicate ok 66 - Got relationships for biological_process ok 67 - Got relationships for molecular_function ok 68 - Got is a relationship from # molecular_function ok 69 - Got term object isa Bio::Ontology::Term ok 70 - Got term id ok 71 - Got term name ok 72 - Got regulated object isa Bio::Ontology::Term ok 73 - Got regulated term1 id ok 74 - Got term1 object isa Bio::Ontology::Term ok 75 - Got back the child ok 76 - Got term object isa Bio::Ontology::Term ok 77 - Got term id ok 78 - Got term name ok 79 - Got regulated object isa Bio::Ontology::Term ok 80 - Got regulated term1 id ok 81 - Got identical regulation ok 82 - Got term1 object isa Bio::Ontology::Term ok 83 - Got back the child ok 84 - got a ontology IO handler isa Bio::OntologyIO ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok t/Ontology/Ontology.t ........................ 1..55 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 - The object isa Bio::Ontology::Ontology ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - Interpro XML file interpro.xml can be parsed ok 54 - Interpro XML file interpro_sample.xml can be parsed ok 55 - Interpro XML file interpro_relationship.xml can be parsed ok Subroutine new redefined at Bio\Ontology\Relationship.pm line 139. Subroutine init redefined at Bio\Ontology\Relationship.pm line 190. Subroutine identifier redefined at Bio\Ontology\Relationship.pm line 215. Subroutine subject_term redefined at Bio\Ontology\Relationship.pm line 245. Subroutine object_term redefined at Bio\Ontology\Relationship.pm line 276. Subroutine predicate_term redefined at Bio\Ontology\Relationship.pm line 307. Subroutine ontology redefined at Bio\Ontology\Relationship.pm line 333. Subroutine to_string redefined at Bio\Ontology\Relationship.pm line 361. Subroutine _check_class redefined at Bio\Ontology\Relationship.pm line 383. Subroutine Bio::Ontology::Relationship::child_term redefined at Bio\Ontology\Relationship.pm line 409. Subroutine Bio::Ontology::Relationship::parent_term redefined at Bio\Ontology\Relationship.pm line 410. Subroutine Bio::Ontology::Relationship::relationship_type redefined at Bio\Ontology\Relationship.pm line 411. t/Ontology/OntologyEngine.t .................. 1..31 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::Relationship; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - use Bio::Ontology::SimpleOntologyEngine; ok 5 - use Bio::Ontology::Ontology; ok 6 - The object isa Bio::Ontology::OntologyEngineI ok 7 ok 8 - adding a relationship with an undef object term fails ok 9 - adding a relationship with an undef object term fails ok 10 - adding a relationship with an undef subject term fails ok 11 - adding a relationship with an undef subject term fails ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/Ontology/OntologyStore.t ................... skipped: Network tests have not been requested t/Ontology/Relationship.t .................... 1..12 ok 1 - use Bio::Ontology::Relationship; ok 2 - use Bio::Ontology::GOterm; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - The object isa Bio::Ontology::RelationshipType ok 5 - The object isa Bio::Ontology::GOterm ok 6 - The object isa Bio::Ontology::GOterm ok 7 - The object isa Bio::Ontology::Relationship ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Ontology/RelationshipType.t ................ 1..23 ok 1 - use Bio::Ontology::RelationshipType; ok 2 - use Bio::Ontology::Ontology; ok 3 - The object isa Bio::Ontology::RelationshipType ok 4 - The object isa Bio::Ontology::TermI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok Constant subroutine Bio::Ontology::Term::TRUE redefined at C:\cpanfly\var\megalib/constant.pm line 131. Constant subroutine Bio::Ontology::Term::FALSE redefined at C:\cpanfly\var\megalib/constant.pm line 131. Subroutine new redefined at Bio\Ontology\Term.pm line 145. Subroutine init redefined at Bio\Ontology\Term.pm line 176. Subroutine identifier redefined at Bio\Ontology\Term.pm line 207. Subroutine name redefined at Bio\Ontology\Term.pm line 227. Subroutine definition redefined at Bio\Ontology\Term.pm line 247. Subroutine ontology redefined at Bio\Ontology\Term.pm line 275. Subroutine version redefined at Bio\Ontology\Term.pm line 305. Subroutine is_obsolete redefined at Bio\Ontology\Term.pm line 324. Subroutine comment redefined at Bio\Ontology\Term.pm line 344. Subroutine get_synonyms redefined at Bio\Ontology\Term.pm line 361. Subroutine add_synonym redefined at Bio\Ontology\Term.pm line 381. Subroutine remove_synonyms redefined at Bio\Ontology\Term.pm line 405. Subroutine get_dblinks redefined at Bio\Ontology\Term.pm line 428. Subroutine get_dbxrefs redefined at Bio\Ontology\Term.pm line 454. Subroutine get_dblink_context redefined at Bio\Ontology\Term.pm line 479. Subroutine get_dbxref_context redefined at Bio\Ontology\Term.pm line 495. Subroutine add_dblink redefined at Bio\Ontology\Term.pm line 515. Subroutine add_dbxref redefined at Bio\Ontology\Term.pm line 542. Subroutine has_dblink redefined at Bio\Ontology\Term.pm line 581. Subroutine has_dbxref redefined at Bio\Ontology\Term.pm line 599. Subroutine add_dblink_context redefined at Bio\Ontology\Term.pm line 630. Subroutine remove_dblinks redefined at Bio\Ontology\Term.pm line 651. Subroutine remove_dbxrefs redefined at Bio\Ontology\Term.pm line 668. Subroutine get_references redefined at Bio\Ontology\Term.pm line 690. Subroutine add_reference redefined at Bio\Ontology\Term.pm line 706. Subroutine remove_references redefined at Bio\Ontology\Term.pm line 729. Subroutine get_secondary_ids redefined at Bio\Ontology\Term.pm line 750. Subroutine add_secondary_id redefined at Bio\Ontology\Term.pm line 770. Subroutine remove_secondary_ids redefined at Bio\Ontology\Term.pm line 794. Subroutine _is_true_or_false redefined at Bio\Ontology\Term.pm line 808. Subroutine object_id redefined at Bio\Ontology\Term.pm line 833. Subroutine authority redefined at Bio\Ontology\Term.pm line 854. Subroutine namespace redefined at Bio\Ontology\Term.pm line 883. Subroutine display_name redefined at Bio\Ontology\Term.pm line 907. Subroutine description redefined at Bio\Ontology\Term.pm line 931. Subroutine each_dblink redefined at Bio\Ontology\Term.pm line 945. Subroutine add_dblinks redefined at Bio\Ontology\Term.pm line 946. Subroutine Bio::Ontology::Term::add_dbxrefs redefined at Bio\Ontology\Term.pm line 566. Subroutine Bio::Ontology::Term::each_synonym redefined at Bio\Ontology\Term.pm line 947. Subroutine Bio::Ontology::Term::add_synonyms redefined at Bio\Ontology\Term.pm line 948. t/Ontology/Term.t ............................ 1..54 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::TermFactory; ok 3 - use Bio::Annotation::DBLink; ok 4 - The object isa Bio::Ontology::TermI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - The object isa Bio::Ontology::TermI ok 45 ok 46 - The object isa Bio::Ontology::TermI ok 47 - The object isa Bio::Ontology::GOterm ok 48 ok 49 ok 50 - The object isa Bio::Ontology::TermI ok 51 - The object isa Bio::AnnotationI ok 52 ok 53 ok 54 ok t/Perl.t ..................................... 1..29 ok 1 - use Bio::Perl; ok 2 ok 3 - The object isa Bio::SeqI ok 4 ok 5 - The object isa Bio::SeqI ok 6 ok 7 - The object isa Bio::SeqI ok 8 - The object isa Bio::SeqI ok 9 ok 10 ok 11 - The object isa Bio::SeqI ok 12 ok 13 - The object isa Bio::SeqI ok 14 ok 15 - The object isa Bio::PrimarySeqI ok 16 ok 17 ok 18 ok 19 ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok t/Phenotype/Correlate.t ...................... 1..17 ok 1 - use Bio::Phenotype::Correlate; ok 2 - use Bio::Species; ok 3 - The object isa Bio::Phenotype::Correlate ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/Phenotype/MeSH.t ........................... 1..24 ok 1 - use Bio::Phenotype::MeSH::Term; ok 2 - use Bio::Phenotype::MeSH::Twig; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Phenotype/Measure.t ........................ 1..21 ok 1 - use Bio::Phenotype::Measure; ok 2 - The object isa Bio::Phenotype::Measure ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Phenotype/MiniMIMentry.t ................... 1..15 ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 2 - The object isa Bio::Phenotype::OMIM::MiniMIMentry ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/Phenotype/OMIMentry.t ...................... 1..153 ok 1 - use Bio::Phenotype::OMIM::OMIMentry; ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 3 - use Bio::Species; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Map::CytoPosition; ok 6 - use Bio::Phenotype::Correlate; ok 7 - use Bio::Phenotype::Measure; ok 8 - use Bio::Annotation::DBLink; ok 9 - The object isa Bio::Phenotype::OMIM::OMIMentry ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - operator overloading in AnnotationI is deprecated ok 80 - operator overloading in AnnotationI is deprecated ok 81 ok 82 ok 83 - operator overloading in AnnotationI is deprecated ok 84 - operator overloading in AnnotationI is deprecated ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - operator overloading in AnnotationI is deprecated ok 137 - operator overloading in AnnotationI is deprecated ok 138 ok 139 ok 140 - operator overloading in AnnotationI is deprecated ok 141 - operator overloading in AnnotationI is deprecated ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok t/Phenotype/OMIMentryAllelicVariant.t ........ 1..27 ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant; ok 2 - The object isa Bio::Phenotype::OMIM::OMIMentryAllelicVariant ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Phenotype/OMIMparser.t ..................... 1..175 ok 1 - use Bio::Phenotype::OMIM::OMIMparser; ok 2 - The object isa Bio::Phenotype::OMIM::OMIMparser ok 3 - The object isa Bio::Phenotype::OMIM::OMIMentry ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - The object isa Bio::Phenotype::OMIM::MiniMIMentry ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - The object isa Bio::Phenotype::OMIM::OMIMentry ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - The object isa Bio::Phenotype::OMIM::MiniMIMentry ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - missing linebreak caught ok t/Phenotype/Phenotype.t ...................... 1..116 ok 1 - use Bio::Phenotype::Phenotype; ok 2 - use Bio::Species; ok 3 - use Bio::Annotation::Reference; ok 4 - use Bio::Map::CytoPosition; ok 5 - use Bio::Phenotype::Correlate; ok 6 - use Bio::Phenotype::Measure; ok 7 - use Bio::Annotation::DBLink; ok 8 - The object isa Bio::Phenotype::PhenotypeI ok 9 - The object isa Bio::Phenotype::Phenotype ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - operator overloading in AnnotationI is deprecated ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 - operator overloading in AnnotationI is deprecated ok 47 - operator overloading in AnnotationI is deprecated ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - operator overloading in AnnotationI is deprecated ok 100 - operator overloading in AnnotationI is deprecated ok 101 ok 102 ok 103 - operator overloading in AnnotationI is deprecated ok 104 - operator overloading in AnnotationI is deprecated ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/PodSyntax.t ................................ 1..1011 ok 1 - POD test for Bio\AlignIO.pm ok 2 - POD test for Bio\AnalysisI.pm ok 3 - POD test for Bio\AnalysisParserI.pm ok 4 - POD test for Bio\AnalysisResultI.pm ok 5 - POD test for Bio\AnnotatableI.pm ok 6 - POD test for Bio\AnnotationCollectionI.pm ok 7 - POD test for Bio\AnnotationI.pm ok 8 - POD test for Bio\Biblio.pm ok 9 - POD test for Bio\ClusterI.pm ok 10 - POD test for Bio\ClusterIO.pm ok 11 - POD test for Bio\DasI.pm ok 12 - POD test for Bio\DBLinkContainerI.pm ok 13 - POD test for Bio\DescribableI.pm ok 14 - POD test for Bio\FeatureHolderI.pm ok 15 - POD test for Bio\FeatureIO.pm ok 16 - POD test for Bio\HandlerBaseI.pm ok 17 - POD test for Bio\IdCollectionI.pm ok 18 - POD test for Bio\IdentifiableI.pm ok 19 - POD test for Bio\LocatableSeq.pm ok 20 - POD test for Bio\LocationI.pm ok 21 - POD test for Bio\MapIO.pm ok 22 - POD test for Bio\NexmlIO.pm ok 23 - POD test for Bio\OntologyIO.pm ok 24 - POD test for Bio\ParameterBaseI.pm ok 25 - POD test for Bio\Perl.pm ok 26 - POD test for Bio\PhyloNetwork.pm ok 27 - POD test for Bio\PrimarySeq.pm ok 28 - POD test for Bio\PrimarySeqI.pm ok 29 - POD test for Bio\PullParserI.pm ok 30 - POD test for Bio\Range.pm ok 31 - POD test for Bio\RangeI.pm ok 32 - POD test for Bio\SearchDist.pm ok 33 - POD test for Bio\SearchIO.pm ok 34 - POD test for Bio\Seq.pm ok 35 - POD test for Bio\SeqAnalysisParserI.pm ok 36 - POD test for Bio\SeqFeatureI.pm ok 37 - POD test for Bio\SeqI.pm ok 38 - POD test for Bio\SeqIO.pm ok 39 - POD test for Bio\SeqUtils.pm ok 40 - POD test for Bio\SimpleAlign.pm ok 41 - POD test for Bio\SimpleAnalysisI.pm ok 42 - POD test for Bio\Species.pm ok 43 - POD test for Bio\Taxon.pm ok 44 - POD test for Bio\Taxonomy.pm ok 45 - POD test for Bio\TreeIO.pm ok 46 - POD test for Bio\UpdateableSeqI.pm ok 47 - POD test for Bio\WebAgent.pm ok 48 - POD test for examples\bioperl.pl (no pod) ok 49 - POD test for examples\generate_random_seq.pl (no pod) ok 50 - POD test for examples\longorf.pl ok 51 - POD test for examples\make_primers.pl (no pod) ok 52 - POD test for examples\revcom_dir.pl (no pod) ok 53 - POD test for examples\rev_and_trans.pl (no pod) ok 54 - POD test for examples\subsequence.cgi (no pod) ok 55 - POD test for maintenance\authors.pl ok 56 - POD test for maintenance\check_NAME.pl ok 57 - POD test for maintenance\check_URLs.pl ok 58 - POD test for maintenance\cvs2cl_by_file.pl ok 59 - POD test for maintenance\dependencies.pl ok 60 - POD test for maintenance\deprecated.pl ok 61 - POD test for maintenance\find_mod_deps.pl ok 62 - POD test for maintenance\modules.pl ok 63 - POD test for maintenance\module_usage.pl (no pod) ok 64 - POD test for maintenance\ncbi_blast_switches.pl (no pod) ok 65 - POD test for maintenance\pod.pl ok 66 - POD test for maintenance\symlink_script.pl ok 67 - POD test for maintenance\version.pl ok 68 - POD test for Bio\Align\AlignI.pm ok 69 - POD test for Bio\Align\DNAStatistics.pm ok 70 - POD test for Bio\Align\Graphics.pm ok 71 - POD test for Bio\Align\PairwiseStatistics.pm ok 72 - POD test for Bio\Align\ProteinStatistics.pm ok 73 - POD test for Bio\Align\StatisticsI.pm ok 74 - POD test for Bio\Align\Utilities.pm ok 75 - POD test for Bio\AlignIO\arp.pm ok 76 - POD test for Bio\AlignIO\bl2seq.pm ok 77 - POD test for Bio\AlignIO\clustalw.pm ok 78 - POD test for Bio\AlignIO\emboss.pm ok 79 - POD test for Bio\AlignIO\fasta.pm ok 80 - POD test for Bio\AlignIO\largemultifasta.pm ok 81 - POD test for Bio\AlignIO\maf.pm ok 82 - POD test for Bio\AlignIO\mase.pm ok 83 - POD test for Bio\AlignIO\mega.pm ok 84 - POD test for Bio\AlignIO\meme.pm ok 85 - POD test for Bio\AlignIO\metafasta.pm ok 86 - POD test for Bio\AlignIO\msf.pm ok 87 - POD test for Bio\AlignIO\nexml.pm ok 88 - POD test for Bio\AlignIO\nexus.pm ok 89 - POD test for Bio\AlignIO\pfam.pm ok 90 - POD test for Bio\AlignIO\phylip.pm ok 91 - POD test for Bio\AlignIO\po.pm ok 92 - POD test for Bio\AlignIO\proda.pm ok 93 - POD test for Bio\AlignIO\prodom.pm ok 94 - POD test for Bio\AlignIO\psi.pm ok 95 - POD test for Bio\AlignIO\selex.pm ok 96 - POD test for Bio\AlignIO\stockholm.pm ok 97 - POD test for Bio\AlignIO\xmfa.pm ok 98 - POD test for Bio\Annotation\AnnotationFactory.pm ok 99 - POD test for Bio\Annotation\Collection.pm ok 100 - POD test for Bio\Annotation\Comment.pm ok 101 - POD test for Bio\Annotation\DBLink.pm ok 102 - POD test for Bio\Annotation\OntologyTerm.pm ok 103 - POD test for Bio\Annotation\Reference.pm ok 104 - POD test for Bio\Annotation\Relation.pm ok 105 - POD test for Bio\Annotation\SimpleValue.pm ok 106 - POD test for Bio\Annotation\StructuredValue.pm ok 107 - POD test for Bio\Annotation\TagTree.pm ok 108 - POD test for Bio\Annotation\Target.pm ok 109 - POD test for Bio\Annotation\Tree.pm ok 110 - POD test for Bio\Annotation\TypeManager.pm ok 111 - POD test for Bio\Assembly\Contig.pm ok 112 - POD test for Bio\Assembly\ContigAnalysis.pm ok 113 - POD test for Bio\Assembly\IO.pm ok 114 - POD test for Bio\Assembly\Scaffold.pm ok 115 - POD test for Bio\Assembly\ScaffoldI.pm ok 116 - POD test for Bio\Assembly\Singlet.pm ok 117 - POD test for Bio\Biblio\Article.pm ok 118 - POD test for Bio\Biblio\BiblioBase.pm ok 119 - POD test for Bio\Biblio\Book.pm ok 120 - POD test for Bio\Biblio\BookArticle.pm ok 121 - POD test for Bio\Biblio\IO.pm ok 122 - POD test for Bio\Biblio\Journal.pm ok 123 - POD test for Bio\Biblio\JournalArticle.pm ok 124 - POD test for Bio\Biblio\MedlineArticle.pm ok 125 - POD test for Bio\Biblio\MedlineBook.pm ok 126 - POD test for Bio\Biblio\MedlineBookArticle.pm ok 127 - POD test for Bio\Biblio\MedlineJournal.pm ok 128 - POD test for Bio\Biblio\MedlineJournalArticle.pm ok 129 - POD test for Bio\Biblio\Organisation.pm ok 130 - POD test for Bio\Biblio\Patent.pm ok 131 - POD test for Bio\Biblio\Person.pm ok 132 - POD test for Bio\Biblio\Proceeding.pm ok 133 - POD test for Bio\Biblio\Provider.pm ok 134 - POD test for Bio\Biblio\PubmedArticle.pm ok 135 - POD test for Bio\Biblio\PubmedBookArticle.pm ok 136 - POD test for Bio\Biblio\PubmedJournalArticle.pm ok 137 - POD test for Bio\Biblio\Ref.pm ok 138 - POD test for Bio\Biblio\Service.pm ok 139 - POD test for Bio\Biblio\TechReport.pm ok 140 - POD test for Bio\Biblio\Thesis.pm ok 141 - POD test for Bio\Biblio\WebResource.pm ok 142 - POD test for Bio\Cluster\ClusterFactory.pm ok 143 - POD test for Bio\Cluster\FamilyI.pm ok 144 - POD test for Bio\Cluster\SequenceFamily.pm ok 145 - POD test for Bio\Cluster\UniGene.pm ok 146 - POD test for Bio\Cluster\UniGeneI.pm ok 147 - POD test for Bio\ClusterIO\dbsnp.pm ok 148 - POD test for Bio\ClusterIO\unigene.pm ok 149 - POD test for Bio\CodonUsage\IO.pm ok 150 - POD test for Bio\CodonUsage\Table.pm ok 151 - POD test for Bio\Coordinate\Chain.pm ok 152 - POD test for Bio\Coordinate\Collection.pm ok 153 - POD test for Bio\Coordinate\ExtrapolatingPair.pm ok 154 - POD test for Bio\Coordinate\GeneMapper.pm ok 155 - POD test for Bio\Coordinate\Graph.pm ok 156 - POD test for Bio\Coordinate\MapperI.pm ok 157 - POD test for Bio\Coordinate\Pair.pm ok 158 - POD test for Bio\Coordinate\Result.pm ok 159 - POD test for Bio\Coordinate\ResultI.pm ok 160 - POD test for Bio\Coordinate\Utils.pm ok 161 - POD test for Bio\Das\FeatureTypeI.pm ok 162 - POD test for Bio\Das\SegmentI.pm ok 163 - POD test for Bio\DB\Ace.pm ok 164 - POD test for Bio\DB\BiblioI.pm ok 165 - POD test for Bio\DB\BioFetch.pm ok 166 - POD test for Bio\DB\CUTG.pm ok 167 - POD test for Bio\DB\DBFetch.pm ok 168 - POD test for Bio\DB\EMBL.pm ok 169 - POD test for Bio\DB\EntrezGene.pm ok 170 - POD test for Bio\DB\EUtilities.pm ok 171 - POD test for Bio\DB\Expression.pm ok 172 - POD test for Bio\DB\Failover.pm ok 173 - POD test for Bio\DB\Fasta.pm ok 174 - POD test for Bio\DB\FileCache.pm ok 175 - POD test for Bio\DB\Flat.pm ok 176 - POD test for Bio\DB\GenBank.pm ok 177 - POD test for Bio\DB\GenericWebAgent.pm ok 178 - POD test for Bio\DB\GenPept.pm ok 179 - POD test for Bio\DB\GFF.pm ok 180 - POD test for Bio\DB\HIV.pm ok 181 - POD test for Bio\DB\InMemoryCache.pm ok 182 - POD test for Bio\DB\LocationI.pm ok 183 - POD test for Bio\DB\MeSH.pm ok 184 - POD test for Bio\DB\NCBIHelper.pm ok 185 - POD test for Bio\DB\Qual.pm ok 186 - POD test for Bio\DB\QueryI.pm ok 187 - POD test for Bio\DB\RandomAccessI.pm ok 188 - POD test for Bio\DB\ReferenceI.pm ok 189 - POD test for Bio\DB\RefSeq.pm ok 190 - POD test for Bio\DB\Registry.pm ok 191 - POD test for Bio\DB\SeqFeature.pm ok 192 - POD test for Bio\DB\SeqHound.pm ok 193 - POD test for Bio\DB\SeqI.pm ok 194 - POD test for Bio\DB\SeqVersion.pm ok 195 - POD test for Bio\DB\SwissProt.pm ok 196 - POD test for Bio\DB\Taxonomy.pm ok 197 - POD test for Bio\DB\TFBS.pm ok 198 - POD test for Bio\DB\Universal.pm ok 199 - POD test for Bio\DB\UpdateableSeqI.pm ok 200 - POD test for Bio\DB\WebDBSeqI.pm ok 201 - POD test for Bio\Draw\Pictogram.pm ok 202 - POD test for Bio\Event\EventGeneratorI.pm ok 203 - POD test for Bio\Event\EventHandlerI.pm ok 204 - POD test for Bio\Factory\AnalysisI.pm ok 205 - POD test for Bio\Factory\ApplicationFactoryI.pm ok 206 - POD test for Bio\Factory\DriverFactory.pm ok 207 - POD test for Bio\Factory\FTLocationFactory.pm ok 208 - POD test for Bio\Factory\LocationFactoryI.pm ok 209 - POD test for Bio\Factory\MapFactoryI.pm ok 210 - POD test for Bio\Factory\ObjectBuilderI.pm ok 211 - POD test for Bio\Factory\ObjectFactory.pm ok 212 - POD test for Bio\Factory\ObjectFactoryI.pm ok 213 - POD test for Bio\Factory\SeqAnalysisParserFactory.pm ok 214 - POD test for Bio\Factory\SeqAnalysisParserFactoryI.pm ok 215 - POD test for Bio\Factory\SequenceFactoryI.pm ok 216 - POD test for Bio\Factory\SequenceProcessorI.pm ok 217 - POD test for Bio\Factory\SequenceStreamI.pm ok 218 - POD test for Bio\Factory\TreeFactoryI.pm ok 219 - POD test for Bio\FeatureIO\bed.pm ok 220 - POD test for Bio\FeatureIO\gff.pm ok 221 - POD test for Bio\FeatureIO\gtf.pm ok 222 - POD test for Bio\FeatureIO\interpro.pm ok 223 - POD test for Bio\FeatureIO\ptt.pm ok 224 - POD test for Bio\FeatureIO\vecscreen_simple.pm ok 225 - POD test for Bio\Index\Abstract.pm ok 226 - POD test for Bio\Index\AbstractSeq.pm ok 227 - POD test for Bio\Index\Blast.pm ok 228 - POD test for Bio\Index\BlastTable.pm ok 229 - POD test for Bio\Index\EMBL.pm ok 230 - POD test for Bio\Index\Fasta.pm ok 231 - POD test for Bio\Index\Fastq.pm ok 232 - POD test for Bio\Index\GenBank.pm ok 233 - POD test for Bio\Index\Hmmer.pm ok 234 - POD test for Bio\Index\Qual.pm ok 235 - POD test for Bio\Index\Stockholm.pm ok 236 - POD test for Bio\Index\SwissPfam.pm ok 237 - POD test for Bio\Index\Swissprot.pm ok 238 - POD test for Bio\LiveSeq\AARange.pm ok 239 - POD test for Bio\LiveSeq\Chain.pm ok 240 - POD test for Bio\LiveSeq\ChainI.pm ok 241 - POD test for Bio\LiveSeq\DNA.pm ok 242 - POD test for Bio\LiveSeq\Exon.pm ok 243 - POD test for Bio\LiveSeq\Gene.pm ok 244 - POD test for Bio\LiveSeq\Intron.pm ok 245 - POD test for Bio\LiveSeq\Mutation.pm ok 246 - POD test for Bio\LiveSeq\Mutator.pm ok 247 - POD test for Bio\LiveSeq\Prim_Transcript.pm ok 248 - POD test for Bio\LiveSeq\Range.pm ok 249 - POD test for Bio\LiveSeq\Repeat_Region.pm ok 250 - POD test for Bio\LiveSeq\Repeat_Unit.pm ok 251 - POD test for Bio\LiveSeq\SeqI.pm ok 252 - POD test for Bio\LiveSeq\Transcript.pm ok 253 - POD test for Bio\LiveSeq\Translation.pm ok 254 - POD test for Bio\Location\Atomic.pm ok 255 - POD test for Bio\Location\AvWithinCoordPolicy.pm ok 256 - POD test for Bio\Location\CoordinatePolicyI.pm ok 257 - POD test for Bio\Location\Fuzzy.pm ok 258 - POD test for Bio\Location\FuzzyLocationI.pm ok 259 - POD test for Bio\Location\NarrowestCoordPolicy.pm ok 260 - POD test for Bio\Location\Simple.pm ok 261 - POD test for Bio\Location\Split.pm ok 262 - POD test for Bio\Location\SplitLocationI.pm ok 263 - POD test for Bio\Location\WidestCoordPolicy.pm ok 264 - POD test for Bio\Map\Clone.pm ok 265 - POD test for Bio\Map\Contig.pm ok 266 - POD test for Bio\Map\CytoMap.pm ok 267 - POD test for Bio\Map\CytoMarker.pm ok 268 - POD test for Bio\Map\CytoPosition.pm ok 269 - POD test for Bio\Map\EntityI.pm ok 270 - POD test for Bio\Map\FPCMarker.pm ok 271 - POD test for Bio\Map\Gene.pm ok 272 - POD test for Bio\Map\GeneMap.pm ok 273 - POD test for Bio\Map\GenePosition.pm ok 274 - POD test for Bio\Map\GeneRelative.pm ok 275 - POD test for Bio\Map\LinkageMap.pm ok 276 - POD test for Bio\Map\LinkagePosition.pm ok 277 - POD test for Bio\Map\MapI.pm ok 278 - POD test for Bio\Map\Mappable.pm ok 279 - POD test for Bio\Map\MappableI.pm ok 280 - POD test for Bio\Map\Marker.pm ok 281 - POD test for Bio\Map\MarkerI.pm ok 282 - POD test for Bio\Map\Microsatellite.pm ok 283 - POD test for Bio\Map\OrderedPosition.pm ok 284 - POD test for Bio\Map\OrderedPositionWithDistance.pm ok 285 - POD test for Bio\Map\Physical.pm ok 286 - POD test for Bio\Map\Position.pm ok 287 - POD test for Bio\Map\PositionHandler.pm ok 288 - POD test for Bio\Map\PositionHandlerI.pm ok 289 - POD test for Bio\Map\PositionI.pm ok 290 - POD test for Bio\Map\PositionWithSequence.pm ok 291 - POD test for Bio\Map\Prediction.pm ok 292 - POD test for Bio\Map\Relative.pm ok 293 - POD test for Bio\Map\RelativeI.pm ok 294 - POD test for Bio\Map\SimpleMap.pm ok 295 - POD test for Bio\Map\TranscriptionFactor.pm ok 296 - POD test for Bio\MapIO\fpc.pm ok 297 - POD test for Bio\MapIO\mapmaker.pm ok 298 - POD test for Bio\Matrix\Generic.pm ok 299 - POD test for Bio\Matrix\IO.pm ok 300 - POD test for Bio\Matrix\MatrixI.pm ok 301 - POD test for Bio\Matrix\Mlagan.pm ok 302 - POD test for Bio\Matrix\PhylipDist.pm ok 303 - POD test for Bio\Matrix\Scoring.pm ok 304 - POD test for Bio\MolEvol\CodonModel.pm ok 305 - POD test for Bio\Nexml\Factory.pm ok 306 - POD test for Bio\Ontology\DocumentRegistry.pm ok 307 - POD test for Bio\Ontology\GOterm.pm ok 308 - POD test for Bio\Ontology\InterProTerm.pm ok 309 - POD test for Bio\Ontology\OBOEngine.pm ok 310 - POD test for Bio\Ontology\OBOterm.pm ok 311 - POD test for Bio\Ontology\Ontology.pm ok 312 - POD test for Bio\Ontology\OntologyEngineI.pm ok 313 - POD test for Bio\Ontology\OntologyI.pm ok 314 - POD test for Bio\Ontology\OntologyStore.pm ok 315 - POD test for Bio\Ontology\Path.pm ok 316 - POD test for Bio\Ontology\PathI.pm ok 317 - POD test for Bio\Ontology\Relationship.pm ok 318 - POD test for Bio\Ontology\RelationshipFactory.pm ok 319 - POD test for Bio\Ontology\RelationshipI.pm ok 320 - POD test for Bio\Ontology\RelationshipType.pm ok 321 - POD test for Bio\Ontology\SimpleOntologyEngine.pm ok 322 - POD test for Bio\Ontology\Term.pm ok 323 - POD test for Bio\Ontology\TermFactory.pm ok 324 - POD test for Bio\Ontology\TermI.pm ok 325 - POD test for Bio\OntologyIO\dagflat.pm ok 326 - POD test for Bio\OntologyIO\goflat.pm ok 327 - POD test for Bio\OntologyIO\InterProParser.pm ok 328 - POD test for Bio\OntologyIO\obo.pm ok 329 - POD test for Bio\OntologyIO\simplehierarchy.pm ok 330 - POD test for Bio\OntologyIO\soflat.pm ok 331 - POD test for Bio\Phenotype\Correlate.pm ok 332 - POD test for Bio\Phenotype\Measure.pm ok 333 - POD test for Bio\Phenotype\Phenotype.pm ok 334 - POD test for Bio\Phenotype\PhenotypeI.pm ok 335 - POD test for Bio\PhyloNetwork\Factory.pm ok 336 - POD test for Bio\PhyloNetwork\FactoryX.pm ok 337 - POD test for Bio\PhyloNetwork\GraphViz.pm ok 338 - POD test for Bio\PhyloNetwork\muVector.pm ok 339 - POD test for Bio\PhyloNetwork\RandomFactory.pm ok 340 - POD test for Bio\PhyloNetwork\TreeFactory.pm ok 341 - POD test for Bio\PhyloNetwork\TreeFactoryMulti.pm ok 342 - POD test for Bio\PhyloNetwork\TreeFactoryX.pm ok 343 - POD test for Bio\PopGen\Genotype.pm ok 344 - POD test for Bio\PopGen\GenotypeI.pm ok 345 - POD test for Bio\PopGen\HtSNP.pm ok 346 - POD test for Bio\PopGen\Individual.pm ok 347 - POD test for Bio\PopGen\IndividualI.pm ok 348 - POD test for Bio\PopGen\IO.pm ok 349 - POD test for Bio\PopGen\Marker.pm ok 350 - POD test for Bio\PopGen\MarkerI.pm ok 351 - POD test for Bio\PopGen\PopStats.pm ok 352 - POD test for Bio\PopGen\Population.pm ok 353 - POD test for Bio\PopGen\PopulationI.pm ok 354 - POD test for Bio\PopGen\Statistics.pm ok 355 - POD test for Bio\PopGen\TagHaplotype.pm ok 356 - POD test for Bio\PopGen\Utilities.pm ok 357 - POD test for Bio\Restriction\Analysis.pm ok 358 - POD test for Bio\Restriction\Enzyme.pm ok 359 - POD test for Bio\Restriction\EnzymeCollection.pm ok 360 - POD test for Bio\Restriction\EnzymeI.pm ok 361 - POD test for Bio\Restriction\IO.pm ok 362 - POD test for Bio\Root\Build.pm ok 363 - POD test for Bio\Root\Exception.pm ok 364 - POD test for Bio\Root\HTTPget.pm ok 365 - POD test for Bio\Root\IO.pm ok 366 - POD test for Bio\Root\Root.pm ok 367 - POD test for Bio\Root\RootI.pm ok 368 - POD test for Bio\Root\Storable.pm ok 369 - POD test for Bio\Root\Test.pm ok 370 - POD test for Bio\Root\Utilities.pm ok 371 - POD test for Bio\Root\Version.pm ok 372 - POD test for Bio\Search\BlastStatistics.pm ok 373 - POD test for Bio\Search\BlastUtils.pm ok 374 - POD test for Bio\Search\DatabaseI.pm ok 375 - POD test for Bio\Search\GenericDatabase.pm ok 376 - POD test for Bio\Search\GenericStatistics.pm ok 377 - POD test for Bio\Search\Processor.pm ok 378 - POD test for Bio\Search\SearchUtils.pm ok 379 - POD test for Bio\Search\StatisticsI.pm ok 380 - POD test for Bio\SearchIO\axt.pm ok 381 - POD test for Bio\SearchIO\blast.pm ok 382 - POD test for Bio\SearchIO\blasttable.pm ok 383 - POD test for Bio\SearchIO\blastxml.pm ok 384 - POD test for Bio\SearchIO\blast_pull.pm ok 385 - POD test for Bio\SearchIO\cross_match.pm ok 386 - POD test for Bio\SearchIO\erpin.pm ok 387 - POD test for Bio\SearchIO\EventHandlerI.pm ok 388 - POD test for Bio\SearchIO\exonerate.pm ok 389 - POD test for Bio\SearchIO\fasta.pm ok 390 - POD test for Bio\SearchIO\FastHitEventBuilder.pm ok 391 - POD test for Bio\SearchIO\gmap_f9.pm ok 392 - POD test for Bio\SearchIO\hmmer.pm ok 393 - POD test for Bio\SearchIO\hmmer2.pm ok 394 - POD test for Bio\SearchIO\hmmer3.pm ok 395 - POD test for Bio\SearchIO\hmmer_pull.pm ok 396 - POD test for Bio\SearchIO\infernal.pm ok 397 - POD test for Bio\SearchIO\IteratedSearchResultEventBuilder.pm ok 398 - POD test for Bio\SearchIO\megablast.pm ok 399 - POD test for Bio\SearchIO\psl.pm ok 400 - POD test for Bio\SearchIO\rnamotif.pm ok 401 - POD test for Bio\SearchIO\SearchResultEventBuilder.pm ok 402 - POD test for Bio\SearchIO\SearchWriterI.pm ok 403 - POD test for Bio\SearchIO\sim4.pm ok 404 - POD test for Bio\SearchIO\waba.pm ok 405 - POD test for Bio\SearchIO\wise.pm ok 406 - POD test for Bio\Seq\BaseSeqProcessor.pm ok 407 - POD test for Bio\Seq\EncodedSeq.pm ok 408 - POD test for Bio\Seq\LargeLocatableSeq.pm ok 409 - POD test for Bio\Seq\LargePrimarySeq.pm ok 410 - POD test for Bio\Seq\LargeSeq.pm ok 411 - POD test for Bio\Seq\LargeSeqI.pm ok 412 - POD test for Bio\Seq\Meta.pm ok 413 - POD test for Bio\Seq\MetaI.pm ok 414 - POD test for Bio\Seq\PrimaryQual.pm ok 415 - POD test for Bio\Seq\PrimedSeq.pm ok 416 - POD test for Bio\Seq\QualI.pm ok 417 - POD test for Bio\Seq\Quality.pm ok 418 - POD test for Bio\Seq\RichSeq.pm ok 419 - POD test for Bio\Seq\RichSeqI.pm ok 420 - POD test for Bio\Seq\SeqBuilder.pm ok 421 - POD test for Bio\Seq\SeqFactory.pm ok 422 - POD test for Bio\Seq\SeqFastaSpeedFactory.pm ok 423 - POD test for Bio\Seq\SequenceTrace.pm ok 424 - POD test for Bio\Seq\SeqWithQuality.pm ok 425 - POD test for Bio\Seq\TraceI.pm ok 426 - POD test for Bio\SeqEvolution\DNAPoint.pm ok 427 - POD test for Bio\SeqEvolution\EvolutionI.pm ok 428 - POD test for Bio\SeqEvolution\Factory.pm ok 429 - POD test for Bio\SeqFeature\Annotated.pm ok 430 - POD test for Bio\SeqFeature\AnnotationAdaptor.pm ok 431 - POD test for Bio\SeqFeature\Collection.pm ok 432 - POD test for Bio\SeqFeature\CollectionI.pm ok 433 - POD test for Bio\SeqFeature\Computation.pm ok 434 - POD test for Bio\SeqFeature\FeaturePair.pm ok 435 - POD test for Bio\SeqFeature\Generic.pm ok 436 - POD test for Bio\SeqFeature\Lite.pm ok 437 - POD test for Bio\SeqFeature\PositionProxy.pm ok 438 - POD test for Bio\SeqFeature\Primer.pm ok 439 - POD test for Bio\SeqFeature\Similarity.pm ok 440 - POD test for Bio\SeqFeature\SimilarityPair.pm ok 441 - POD test for Bio\SeqFeature\TypedSeqFeatureI.pm ok 442 - POD test for Bio\SeqIO\abi.pm ok 443 - POD test for Bio\SeqIO\ace.pm ok 444 - POD test for Bio\SeqIO\agave.pm ok 445 - POD test for Bio\SeqIO\alf.pm ok 446 - POD test for Bio\SeqIO\asciitree.pm ok 447 - POD test for Bio\SeqIO\bsml.pm ok 448 - POD test for Bio\SeqIO\bsml_sax.pm ok 449 - POD test for Bio\SeqIO\chadoxml.pm ok 450 - POD test for Bio\SeqIO\chaos.pm ok 451 - POD test for Bio\SeqIO\chaosxml.pm ok 452 - POD test for Bio\SeqIO\ctf.pm ok 453 - POD test for Bio\SeqIO\embl.pm ok 454 - POD test for Bio\SeqIO\embldriver.pm ok 455 - POD test for Bio\SeqIO\entrezgene.pm ok 456 - POD test for Bio\SeqIO\excel.pm ok 457 - POD test for Bio\SeqIO\exp.pm ok 458 - POD test for Bio\SeqIO\fasta.pm ok 459 - POD test for Bio\SeqIO\fastq.pm ok 460 - POD test for Bio\SeqIO\flybase_chadoxml.pm ok 461 - POD test for Bio\SeqIO\FTHelper.pm ok 462 - POD test for Bio\SeqIO\game.pm ok 463 - POD test for Bio\SeqIO\gbdriver.pm ok 464 - POD test for Bio\SeqIO\gbxml.pm ok 465 - POD test for Bio\SeqIO\gcg.pm ok 466 - POD test for Bio\SeqIO\genbank.pm ok 467 - POD test for Bio\SeqIO\interpro.pm ok 468 - POD test for Bio\SeqIO\kegg.pm ok 469 - POD test for Bio\SeqIO\largefasta.pm ok 470 - POD test for Bio\SeqIO\lasergene.pm ok 471 - POD test for Bio\SeqIO\locuslink.pm ok 472 - POD test for Bio\SeqIO\mbsout.pm ok 473 - POD test for Bio\SeqIO\metafasta.pm ok 474 - POD test for Bio\SeqIO\msout.pm ok 475 - POD test for Bio\SeqIO\MultiFile.pm ok 476 - POD test for Bio\SeqIO\nexml.pm ok 477 - POD test for Bio\SeqIO\phd.pm ok 478 - POD test for Bio\SeqIO\pir.pm ok 479 - POD test for Bio\SeqIO\pln.pm ok 480 - POD test for Bio\SeqIO\qual.pm ok 481 - POD test for Bio\SeqIO\raw.pm ok 482 - POD test for Bio\SeqIO\scf.pm ok 483 - POD test for Bio\SeqIO\seqxml.pm ok 484 - POD test for Bio\SeqIO\strider.pm ok 485 - POD test for Bio\SeqIO\swiss.pm ok 486 - POD test for Bio\SeqIO\swissdriver.pm ok 487 - POD test for Bio\SeqIO\tab.pm ok 488 - POD test for Bio\SeqIO\table.pm ok 489 - POD test for Bio\SeqIO\tigr.pm ok 490 - POD test for Bio\SeqIO\tigrxml.pm ok 491 - POD test for Bio\SeqIO\tinyseq.pm ok 492 - POD test for Bio\SeqIO\ztr.pm ok 493 - POD test for Bio\Structure\Atom.pm ok 494 - POD test for Bio\Structure\Chain.pm ok 495 - POD test for Bio\Structure\Entry.pm ok 496 - POD test for Bio\Structure\IO.pm ok 497 - POD test for Bio\Structure\Model.pm ok 498 - POD test for Bio\Structure\Residue.pm ok 499 - POD test for Bio\Structure\StructureI.pm ok 500 - POD test for Bio\Symbol\Alphabet.pm ok 501 - POD test for Bio\Symbol\AlphabetI.pm ok 502 - POD test for Bio\Symbol\DNAAlphabet.pm ok 503 - POD test for Bio\Symbol\ProteinAlphabet.pm ok 504 - POD test for Bio\Symbol\Symbol.pm ok 505 - POD test for Bio\Symbol\SymbolI.pm ok 506 - POD test for Bio\Taxonomy\FactoryI.pm ok 507 - POD test for Bio\Taxonomy\Node.pm ok 508 - POD test for Bio\Taxonomy\Taxon.pm ok 509 - POD test for Bio\Taxonomy\Tree.pm ok 510 - POD test for Bio\Tools\AlignFactory.pm ok 511 - POD test for Bio\Tools\AnalysisResult.pm ok 512 - POD test for Bio\Tools\Blat.pm ok 513 - POD test for Bio\Tools\CodonTable.pm ok 514 - POD test for Bio\Tools\Coil.pm ok 515 - POD test for Bio\Tools\dpAlign.pm ok 516 - POD test for Bio\Tools\ECnumber.pm ok 517 - POD test for Bio\Tools\EPCR.pm ok 518 - POD test for Bio\Tools\Eponine.pm ok 519 - POD test for Bio\Tools\ERPIN.pm ok 520 - POD test for Bio\Tools\Est2Genome.pm ok 521 - POD test for Bio\Tools\ESTScan.pm ok 522 - POD test for Bio\Tools\EUtilities.pm ok 523 - POD test for Bio\Tools\Fgenesh.pm ok 524 - POD test for Bio\Tools\FootPrinter.pm ok 525 - POD test for Bio\Tools\Gel.pm ok 526 - POD test for Bio\Tools\Geneid.pm ok 527 - POD test for Bio\Tools\Genemark.pm ok 528 - POD test for Bio\Tools\Genewise.pm ok 529 - POD test for Bio\Tools\Genomewise.pm ok 530 - POD test for Bio\Tools\Genscan.pm ok 531 - POD test for Bio\Tools\GFF.pm ok 532 - POD test for Bio\Tools\Glimmer.pm ok 533 - POD test for Bio\Tools\Grail.pm ok 534 - POD test for Bio\Tools\GuessSeqFormat.pm ok 535 - POD test for Bio\Tools\Hmmpfam.pm ok 536 - POD test for Bio\Tools\Infernal.pm ok 537 - POD test for Bio\Tools\ipcress.pm ok 538 - POD test for Bio\Tools\isPcr.pm ok 539 - POD test for Bio\Tools\IUPAC.pm ok 540 - POD test for Bio\Tools\Lucy.pm ok 541 - POD test for Bio\Tools\Match.pm ok 542 - POD test for Bio\Tools\MZEF.pm ok 543 - POD test for Bio\Tools\OddCodes.pm ok 544 - POD test for Bio\Tools\pICalculator.pm ok 545 - POD test for Bio\Tools\Primer3.pm ok 546 - POD test for Bio\Tools\Prints.pm ok 547 - POD test for Bio\Tools\Profile.pm ok 548 - POD test for Bio\Tools\Promoterwise.pm ok 549 - POD test for Bio\Tools\PrositeScan.pm ok 550 - POD test for Bio\Tools\Protparam.pm ok 551 - POD test for Bio\Tools\Pseudowise.pm ok 552 - POD test for Bio\Tools\pSW.pm ok 553 - POD test for Bio\Tools\QRNA.pm ok 554 - POD test for Bio\Tools\RandomDistFunctions.pm ok 555 - POD test for Bio\Tools\RepeatMasker.pm ok 556 - POD test for Bio\Tools\RNAMotif.pm ok 557 - POD test for Bio\Tools\Seg.pm ok 558 - POD test for Bio\Tools\SeqPattern.pm ok 559 - POD test for Bio\Tools\SeqStats.pm ok 560 - POD test for Bio\Tools\SeqWords.pm ok 561 - POD test for Bio\Tools\Sigcleave.pm ok 562 - POD test for Bio\Tools\Signalp.pm ok 563 - POD test for Bio\Tools\SiRNA.pm ok 564 - POD test for Bio\Tools\TandemRepeatsFinder.pm ok 565 - POD test for Bio\Tools\TargetP.pm ok 566 - POD test for Bio\Tools\Tmhmm.pm ok 567 - POD test for Bio\Tools\tRNAscanSE.pm ok 568 - POD test for Bio\Tree\AlleleNode.pm ok 569 - POD test for Bio\Tree\AnnotatableNode.pm ok 570 - POD test for Bio\Tree\Compatible.pm ok 571 - POD test for Bio\Tree\DistanceFactory.pm ok 572 - POD test for Bio\Tree\Node.pm ok 573 - POD test for Bio\Tree\NodeI.pm ok 574 - POD test for Bio\Tree\NodeNHX.pm ok 575 - POD test for Bio\Tree\RandomFactory.pm ok 576 - POD test for Bio\Tree\Statistics.pm ok 577 - POD test for Bio\Tree\Tree.pm ok 578 - POD test for Bio\Tree\TreeFunctionsI.pm ok 579 - POD test for Bio\Tree\TreeI.pm ok 580 - POD test for Bio\TreeIO\cluster.pm ok 581 - POD test for Bio\TreeIO\lintree.pm ok 582 - POD test for Bio\TreeIO\newick.pm ok 583 - POD test for Bio\TreeIO\NewickParser.pm ok 584 - POD test for Bio\TreeIO\nexml.pm ok 585 - POD test for Bio\TreeIO\nexus.pm ok 586 - POD test for Bio\TreeIO\nhx.pm ok 587 - POD test for Bio\TreeIO\pag.pm ok 588 - POD test for Bio\TreeIO\phyloxml.pm ok 589 - POD test for Bio\TreeIO\svggraph.pm ok 590 - POD test for Bio\TreeIO\tabtree.pm ok 591 - POD test for Bio\TreeIO\TreeEventBuilder.pm ok 592 - POD test for Bio\Variation\AAChange.pm ok 593 - POD test for Bio\Variation\AAReverseMutate.pm ok 594 - POD test for Bio\Variation\Allele.pm ok 595 - POD test for Bio\Variation\DNAMutation.pm ok 596 - POD test for Bio\Variation\IO.pm ok 597 - POD test for Bio\Variation\RNAChange.pm ok 598 - POD test for Bio\Variation\SeqDiff.pm ok 599 - POD test for Bio\Variation\SNP.pm ok 600 - POD test for Bio\Variation\VariantI.pm ok 601 - POD test for scripts\biblio\biblio.PLS ok 602 - POD test for scripts\Bio-DB-EUtilities\einfo.PLS ok 603 - POD test for scripts\Bio-DB-GFF\bulk_load_gff.PLS ok 604 - POD test for scripts\Bio-DB-GFF\fast_load_gff.PLS ok 605 - POD test for scripts\Bio-DB-GFF\genbank2gff.PLS ok 606 - POD test for scripts\Bio-DB-GFF\genbank2gff3.PLS ok 607 - POD test for scripts\Bio-DB-GFF\generate_histogram.PLS ok 608 - POD test for scripts\Bio-DB-GFF\load_gff.PLS ok 609 - POD test for scripts\Bio-DB-GFF\meta_gff.PLS ok 610 - POD test for scripts\Bio-DB-GFF\process_gadfly.PLS ok 611 - POD test for scripts\Bio-DB-GFF\process_sgd.PLS ok 612 - POD test for scripts\Bio-DB-GFF\process_wormbase.PLS ok 613 - POD test for scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_delete.PLS (no pod) ok 614 - POD test for scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_gff3.PLS (no pod) ok 615 - POD test for scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_load.PLS ok 616 - POD test for scripts\das\das_server.pl (no pod) ok 617 - POD test for scripts\DB\biofetch_genbank_proxy.PLS ok 618 - POD test for scripts\DB\bioflat_index.PLS ok 619 - POD test for scripts\DB\biogetseq.PLS ok 620 - POD test for scripts\DB\flanks.PLS ok 621 - POD test for scripts\DB-HIV\hivq.PLS ok 622 - POD test for scripts\index\bp_fetch.PLS ok 623 - POD test for scripts\index\bp_index.PLS ok 624 - POD test for scripts\index\bp_seqret.PLS ok 625 - POD test for scripts\popgen\composite_LD.PLS ok 626 - POD test for scripts\popgen\heterogeneity_test.PLS ok 627 - POD test for scripts\searchio\fastam9_to_table.PLS ok 628 - POD test for scripts\searchio\filter_search.PLS ok 629 - POD test for scripts\searchio\hmmer_to_table.PLS ok 630 - POD test for scripts\searchio\parse_hmmsearch.PLS ok 631 - POD test for scripts\searchio\search2table.PLS ok 632 - POD test for scripts\seq\extract_feature_seq.PLS ok 633 - POD test for scripts\seq\make_mrna_protein.PLS ok 634 - POD test for scripts\seq\seqconvert.PLS ok 635 - POD test for scripts\seq\seqretsplit.PLS ok 636 - POD test for scripts\seq\split_seq.PLS ok 637 - POD test for scripts\seq\translate_seq.PLS ok 638 - POD test for scripts\seq\unflatten_seq.PLS ok 639 - POD test for scripts\seqstats\aacomp.PLS ok 640 - POD test for scripts\seqstats\chaos_plot.PLS ok 641 - POD test for scripts\seqstats\gccalc.PLS ok 642 - POD test for scripts\seqstats\oligo_count.PLS ok 643 - POD test for scripts\taxa\classify_hits_kingdom.PLS ok 644 - POD test for scripts\taxa\local_taxonomydb_query.PLS ok 645 - POD test for scripts\taxa\query_entrez_taxa.PLS ok 646 - POD test for scripts\taxa\taxid4species.PLS ok 647 - POD test for scripts\taxa\taxonomy2tree.PLS ok 648 - POD test for scripts\tree\blast2tree.PLS ok 649 - POD test for scripts\tree\nexus2nh.PLS ok 650 - POD test for scripts\tree\tree2pag.PLS ok 651 - POD test for scripts\utilities\bp_mrtrans.PLS ok 652 - POD test for scripts\utilities\bp_netinstall.PLS ok 653 - POD test for scripts\utilities\bp_nrdb.PLS ok 654 - POD test for scripts\utilities\bp_sreformat.PLS ok 655 - POD test for scripts\utilities\dbsplit.PLS ok 656 - POD test for scripts\utilities\download_query_genbank.PLS ok 657 - POD test for scripts\utilities\mask_by_search.PLS ok 658 - POD test for scripts\utilities\mutate.PLS ok 659 - POD test for scripts\utilities\pairwise_kaks.PLS ok 660 - POD test for scripts\utilities\remote_blast.PLS ok 661 - POD test for scripts\utilities\revtrans-motif.PLS ok 662 - POD test for scripts\utilities\search2alnblocks.PLS ok 663 - POD test for scripts\utilities\search2BSML.PLS ok 664 - POD test for scripts\utilities\search2gff.PLS ok 665 - POD test for scripts\utilities\search2tribe.PLS ok 666 - POD test for scripts\utilities\seq_length.PLS ok 667 - POD test for examples\align\aligntutorial.pl (no pod) ok 668 - POD test for examples\align\align_on_codons.pl (no pod) ok 669 - POD test for examples\align\clustalw.pl (no pod) ok 670 - POD test for examples\align\simplealign.pl (no pod) ok 671 - POD test for examples\biblio\biblio-eutils-example.pl ok 672 - POD test for examples\biblio\biblio-soap-example.pl ok 673 - POD test for examples\biblio\biblio_soap.pl (no pod) ok 674 - POD test for examples\Bio-DB-GFF\load_ucsc.pl (no pod) ok 675 - POD test for examples\cluster\dbsnp.pl (no pod) ok 676 - POD test for examples\contributed\nmrpdb_parse.pl (no pod) ok 677 - POD test for examples\contributed\prosite2perl.pl (no pod) ok 678 - POD test for examples\contributed\rebase2list.pl (no pod) ok 679 - POD test for examples\db\dbfetch ok 680 - POD test for examples\db\est_tissue_query.pl (no pod) ok 681 - POD test for examples\db\gb2features.pl (no pod) ok 682 - POD test for examples\db\getGenBank.pl (no pod) ok 683 - POD test for examples\db\get_seqs.pl (no pod) ok 684 - POD test for examples\db\rfetch.pl (no pod) ok 685 - POD test for examples\db\use_registry.pl (no pod) ok 686 - POD test for examples\liveseq\change_gene.pl (no pod) ok 687 - POD test for examples\popgen\parse_calc_stats.pl (no pod) ok 688 - POD test for examples\quality\svgtrace.pl (no pod) ok 689 - POD test for examples\root\exceptions1.pl (no pod) ok 690 - POD test for examples\root\exceptions2.pl (no pod) ok 691 - POD test for examples\root\exceptions3.pl (no pod) ok 692 - POD test for examples\root\exceptions4.pl (no pod) ok 693 - POD test for examples\searchio\blast_example.pl (no pod) ok 694 - POD test for examples\searchio\custom_writer.pl (no pod) ok 695 - POD test for examples\searchio\hitwriter.pl (no pod) ok 696 - POD test for examples\searchio\hspwriter.pl (no pod) ok 697 - POD test for examples\searchio\htmlwriter.pl (no pod) ok 698 - POD test for examples\searchio\psiblast_features.pl (no pod) ok 699 - POD test for examples\searchio\psiblast_iterations.pl (no pod) ok 700 - POD test for examples\searchio\rawwriter.pl (no pod) ok 701 - POD test for examples\searchio\resultwriter.pl (no pod) ok 702 - POD test for examples\searchio\waba2gff.pl (no pod) ok 703 - POD test for examples\searchio\waba2gff3.pl ok 704 - POD test for examples\sirna\rnai_finder.cgi ok 705 - POD test for examples\structure\structure-io.pl (no pod) ok 706 - POD test for examples\tk\gsequence.pl (no pod) ok 707 - POD test for examples\tk\hitdisplay.pl (no pod) ok 708 - POD test for examples\tools\extract_genes.pl ok 709 - POD test for examples\tools\gb_to_gff.pl (no pod) ok 710 - POD test for examples\tools\gff2ps.pl ok 711 - POD test for examples\tools\parse_codeml.pl (no pod) ok 712 - POD test for examples\tools\psw.pl (no pod) ok 713 - POD test for examples\tools\reverse-translate.pl ok 714 - POD test for examples\tools\run_genscan.pl (no pod) ok 715 - POD test for examples\tools\run_primer3.pl ok 716 - POD test for examples\tools\seq_pattern.pl (no pod) ok 717 - POD test for examples\tools\standaloneblast.pl (no pod) ok 718 - POD test for examples\tree\paup2phylip.pl (no pod) ok 719 - POD test for Bio\AlignIO\Handler\GenericAlignHandler.pm ok 720 - POD test for Bio\Assembly\IO\ace.pm ok 721 - POD test for Bio\Assembly\IO\bowtie.pm ok 722 - POD test for Bio\Assembly\IO\maq.pm ok 723 - POD test for Bio\Assembly\IO\phrap.pm ok 724 - POD test for Bio\Assembly\IO\sam.pm ok 725 - POD test for Bio\Assembly\IO\tigr.pm ok 726 - POD test for Bio\Assembly\Tools\ContigSpectrum.pm ok 727 - POD test for Bio\Biblio\IO\medline2ref.pm ok 728 - POD test for Bio\Biblio\IO\medlinexml.pm ok 729 - POD test for Bio\Biblio\IO\pubmed2ref.pm ok 730 - POD test for Bio\Biblio\IO\pubmedxml.pm ok 731 - POD test for Bio\Coordinate\Result\Gap.pm ok 732 - POD test for Bio\Coordinate\Result\Match.pm ok 733 - POD test for Bio\DB\Biblio\biofetch.pm ok 734 - POD test for Bio\DB\Biblio\eutils.pm ok 735 - POD test for Bio\DB\Biblio\soap.pm ok 736 - POD test for Bio\DB\Expression\geo.pm ok 737 - POD test for Bio\DB\Flat\BDB.pm ok 738 - POD test for Bio\DB\Flat\BinarySearch.pm ok 739 - POD test for Bio\DB\GFF\Aggregator.pm ok 740 - POD test for Bio\DB\GFF\Featname.pm ok 741 - POD test for Bio\DB\GFF\Feature.pm ok 742 - POD test for Bio\DB\GFF\Homol.pm ok 743 - POD test for Bio\DB\GFF\RelSegment.pm ok 744 - POD test for Bio\DB\GFF\Segment.pm ok 745 - POD test for Bio\DB\GFF\Typename.pm ok 746 - POD test for Bio\DB\HIV\HIVAnnotProcessor.pm ok 747 - POD test for Bio\DB\HIV\HIVQueryHelper.pm ok 748 - POD test for Bio\DB\Query\GenBank.pm ok 749 - POD test for Bio\DB\Query\HIVQuery.pm ok 750 - POD test for Bio\DB\Query\WebQuery.pm ok 751 - POD test for Bio\DB\SeqFeature\NormalizedFeature.pm ok 752 - POD test for Bio\DB\SeqFeature\NormalizedFeatureI.pm ok 753 - POD test for Bio\DB\SeqFeature\NormalizedTableFeatureI.pm ok 754 - POD test for Bio\DB\SeqFeature\Segment.pm ok 755 - POD test for Bio\DB\SeqFeature\Store.pm ok 756 - POD test for Bio\DB\SeqVersion\gi.pm ok 757 - POD test for Bio\DB\Taxonomy\entrez.pm ok 758 - POD test for Bio\DB\Taxonomy\flatfile.pm ok 759 - POD test for Bio\DB\Taxonomy\list.pm ok 760 - POD test for Bio\DB\TFBS\transfac_pro.pm ok 761 - POD test for Bio\LiveSeq\IO\BioPerl.pm ok 762 - POD test for Bio\LiveSeq\IO\Loader.pm ok 763 - POD test for Bio\Matrix\IO\mlagan.pm ok 764 - POD test for Bio\Matrix\IO\phylip.pm ok 765 - POD test for Bio\Matrix\IO\scoring.pm ok 766 - POD test for Bio\Matrix\PSM\InstanceSite.pm ok 767 - POD test for Bio\Matrix\PSM\InstanceSiteI.pm ok 768 - POD test for Bio\Matrix\PSM\IO.pm ok 769 - POD test for Bio\Matrix\PSM\ProtMatrix.pm ok 770 - POD test for Bio\Matrix\PSM\ProtPsm.pm ok 771 - POD test for Bio\Matrix\PSM\Psm.pm ok 772 - POD test for Bio\Matrix\PSM\PsmHeader.pm ok 773 - POD test for Bio\Matrix\PSM\PsmHeaderI.pm ok 774 - POD test for Bio\Matrix\PSM\PsmI.pm ok 775 - POD test for Bio\Matrix\PSM\SiteMatrix.pm ok 776 - POD test for Bio\Matrix\PSM\SiteMatrixI.pm ok 777 - POD test for Bio\Ontology\SimpleGOEngine\GraphAdaptor.pm ok 778 - POD test for Bio\Ontology\SimpleGOEngine\GraphAdaptor02.pm ok 779 - POD test for Bio\OntologyIO\Handlers\BaseSAXHandler.pm ok 780 - POD test for Bio\OntologyIO\Handlers\InterProHandler.pm ok 781 - POD test for Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm ok 782 - POD test for Bio\Phenotype\MeSH\Term.pm ok 783 - POD test for Bio\Phenotype\MeSH\Twig.pm ok 784 - POD test for Bio\Phenotype\OMIM\MiniMIMentry.pm ok 785 - POD test for Bio\Phenotype\OMIM\OMIMentry.pm ok 786 - POD test for Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm ok 787 - POD test for Bio\Phenotype\OMIM\OMIMparser.pm ok 788 - POD test for Bio\PopGen\IO\csv.pm ok 789 - POD test for Bio\PopGen\IO\hapmap.pm ok 790 - POD test for Bio\PopGen\IO\phase.pm ok 791 - POD test for Bio\PopGen\IO\prettybase.pm ok 792 - POD test for Bio\PopGen\Simulation\Coalescent.pm ok 793 - POD test for Bio\PopGen\Simulation\GeneticDrift.pm ok 794 - POD test for Bio\Restriction\Enzyme\MultiCut.pm ok 795 - POD test for Bio\Restriction\Enzyme\MultiSite.pm ok 796 - POD test for Bio\Restriction\IO\bairoch.pm ok 797 - POD test for Bio\Restriction\IO\base.pm ok 798 - POD test for Bio\Restriction\IO\itype2.pm ok 799 - POD test for Bio\Restriction\IO\prototype.pm ok 800 - POD test for Bio\Restriction\IO\withrefm.pm ok 801 - POD test for Bio\Root\Test\Warn.pm ok 802 - POD test for Bio\Search\Hit\BlastHit.pm ok 803 - POD test for Bio\Search\Hit\BlastPullHit.pm ok 804 - POD test for Bio\Search\Hit\Fasta.pm ok 805 - POD test for Bio\Search\Hit\GenericHit.pm ok 806 - POD test for Bio\Search\Hit\HitFactory.pm ok 807 - POD test for Bio\Search\Hit\HitI.pm ok 808 - POD test for Bio\Search\Hit\hmmer3Hit.pm ok 809 - POD test for Bio\Search\Hit\HMMERHit.pm ok 810 - POD test for Bio\Search\Hit\HmmpfamHit.pm ok 811 - POD test for Bio\Search\Hit\ModelHit.pm ok 812 - POD test for Bio\Search\Hit\PsiBlastHit.pm ok 813 - POD test for Bio\Search\Hit\PullHitI.pm ok 814 - POD test for Bio\Search\HSP\BlastHSP.pm ok 815 - POD test for Bio\Search\HSP\BlastPullHSP.pm ok 816 - POD test for Bio\Search\HSP\FastaHSP.pm ok 817 - POD test for Bio\Search\HSP\GenericHSP.pm ok 818 - POD test for Bio\Search\HSP\hmmer3HSP.pm ok 819 - POD test for Bio\Search\HSP\HMMERHSP.pm ok 820 - POD test for Bio\Search\HSP\HmmpfamHSP.pm ok 821 - POD test for Bio\Search\HSP\HSPFactory.pm ok 822 - POD test for Bio\Search\HSP\HSPI.pm ok 823 - POD test for Bio\Search\HSP\ModelHSP.pm ok 824 - POD test for Bio\Search\HSP\PsiBlastHSP.pm ok 825 - POD test for Bio\Search\HSP\PSLHSP.pm ok 826 - POD test for Bio\Search\HSP\PullHSPI.pm ok 827 - POD test for Bio\Search\HSP\WABAHSP.pm ok 828 - POD test for Bio\Search\Iteration\GenericIteration.pm ok 829 - POD test for Bio\Search\Iteration\IterationI.pm ok 830 - POD test for Bio\Search\Result\BlastPullResult.pm ok 831 - POD test for Bio\Search\Result\BlastResult.pm ok 832 - POD test for Bio\Search\Result\CrossMatchResult.pm ok 833 - POD test for Bio\Search\Result\GenericResult.pm ok 834 - POD test for Bio\Search\Result\hmmer3Result.pm ok 835 - POD test for Bio\Search\Result\HMMERResult.pm ok 836 - POD test for Bio\Search\Result\HmmpfamResult.pm ok 837 - POD test for Bio\Search\Result\PullResultI.pm ok 838 - POD test for Bio\Search\Result\ResultFactory.pm ok 839 - POD test for Bio\Search\Result\ResultI.pm ok 840 - POD test for Bio\Search\Result\WABAResult.pm ok 841 - POD test for Bio\Search\Tiling\MapTileUtils.pm ok 842 - POD test for Bio\Search\Tiling\MapTiling.pm ok 843 - POD test for Bio\Search\Tiling\TilingI.pm ok 844 - POD test for Bio\SearchIO\Writer\BSMLResultWriter.pm ok 845 - POD test for Bio\SearchIO\Writer\GbrowseGFF.pm ok 846 - POD test for Bio\SearchIO\Writer\HitTableWriter.pm ok 847 - POD test for Bio\SearchIO\Writer\HSPTableWriter.pm ok 848 - POD test for Bio\SearchIO\Writer\HTMLResultWriter.pm ok 849 - POD test for Bio\SearchIO\Writer\ResultTableWriter.pm ok 850 - POD test for Bio\SearchIO\Writer\TextResultWriter.pm ok 851 - POD test for Bio\SearchIO\XML\BlastHandler.pm ok 852 - POD test for Bio\SearchIO\XML\PsiBlastHandler.pm ok 853 - POD test for Bio\Seq\Meta\Array.pm ok 854 - POD test for Bio\SeqFeature\Gene\Exon.pm ok 855 - POD test for Bio\SeqFeature\Gene\ExonI.pm ok 856 - POD test for Bio\SeqFeature\Gene\GeneStructure.pm ok 857 - POD test for Bio\SeqFeature\Gene\GeneStructureI.pm ok 858 - POD test for Bio\SeqFeature\Gene\Intron.pm ok 859 - POD test for Bio\SeqFeature\Gene\NC_Feature.pm ok 860 - POD test for Bio\SeqFeature\Gene\Poly_A_site.pm ok 861 - POD test for Bio\SeqFeature\Gene\Promoter.pm ok 862 - POD test for Bio\SeqFeature\Gene\Transcript.pm ok 863 - POD test for Bio\SeqFeature\Gene\TranscriptI.pm ok 864 - POD test for Bio\SeqFeature\Gene\UTR.pm ok 865 - POD test for Bio\SeqFeature\SiRNA\Oligo.pm ok 866 - POD test for Bio\SeqFeature\SiRNA\Pair.pm ok 867 - POD test for Bio\SeqFeature\Tools\FeatureNamer.pm ok 868 - POD test for Bio\SeqFeature\Tools\IDHandler.pm ok 869 - POD test for Bio\SeqFeature\Tools\TypeMapper.pm ok 870 - POD test for Bio\SeqFeature\Tools\Unflattener.pm ok 871 - POD test for Bio\SeqIO\game\featHandler.pm ok 872 - POD test for Bio\SeqIO\game\gameHandler.pm ok 873 - POD test for Bio\SeqIO\game\gameSubs.pm ok 874 - POD test for Bio\SeqIO\game\gameWriter.pm ok 875 - POD test for Bio\SeqIO\game\seqHandler.pm ok 876 - POD test for Bio\SeqIO\Handler\GenericRichSeqHandler.pm ok 877 - POD test for Bio\SeqIO\tinyseq\tinyseqHandler.pm ok 878 - POD test for Bio\Structure\IO\pdb.pm ok 879 - POD test for Bio\Tools\Alignment\Consed.pm ok 880 - POD test for Bio\Tools\Alignment\Trim.pm ok 881 - POD test for Bio\Tools\Analysis\SimpleAnalysisBase.pm ok 882 - POD test for Bio\Tools\EMBOSS\Palindrome.pm ok 883 - POD test for Bio\Tools\EUtilities\EUtilDataI.pm ok 884 - POD test for Bio\Tools\EUtilities\EUtilParameters.pm ok 885 - POD test for Bio\Tools\EUtilities\History.pm ok 886 - POD test for Bio\Tools\EUtilities\HistoryI.pm ok 887 - POD test for Bio\Tools\EUtilities\Info.pm ok 888 - POD test for Bio\Tools\EUtilities\Link.pm ok 889 - POD test for Bio\Tools\EUtilities\Query.pm ok 890 - POD test for Bio\Tools\EUtilities\Summary.pm ok 891 - POD test for Bio\Tools\HMMER\Domain.pm ok 892 - POD test for Bio\Tools\HMMER\Results.pm ok 893 - POD test for Bio\Tools\HMMER\Set.pm ok 894 - POD test for Bio\Tools\Phylo\Gerp.pm ok 895 - POD test for Bio\Tools\Phylo\Gumby.pm ok 896 - POD test for Bio\Tools\Phylo\Molphy.pm ok 897 - POD test for Bio\Tools\Phylo\PAML.pm ok 898 - POD test for Bio\Tools\Prediction\Exon.pm ok 899 - POD test for Bio\Tools\Prediction\Gene.pm ok 900 - POD test for Bio\Tools\Primer\AssessorI.pm ok 901 - POD test for Bio\Tools\Primer\Feature.pm ok 902 - POD test for Bio\Tools\Primer\Pair.pm ok 903 - POD test for Bio\Tools\Run\GenericParameters.pm ok 904 - POD test for Bio\Tools\Run\hmmer3.pm (no pod) ok 905 - POD test for Bio\Tools\Run\ParametersI.pm ok 906 - POD test for Bio\Tools\Run\RemoteBlast.pm ok 907 - POD test for Bio\Tools\Run\StandAloneBlast.pm ok 908 - POD test for Bio\Tools\Run\StandAloneNCBIBlast.pm ok 909 - POD test for Bio\Tools\Run\StandAloneWUBlast.pm ok 910 - POD test for Bio\Tools\Run\WrapperBase.pm ok 911 - POD test for Bio\Tools\SeqPattern\Backtranslate.pm ok 912 - POD test for Bio\Tools\Signalp\ExtendedSignalp.pm ok 913 - POD test for Bio\Tools\Sim4\Exon.pm ok 914 - POD test for Bio\Tools\Sim4\Results.pm ok 915 - POD test for Bio\Tools\Spidey\Exon.pm ok 916 - POD test for Bio\Tools\Spidey\Results.pm ok 917 - POD test for Bio\Tree\Draw\Cladogram.pm ok 918 - POD test for Bio\Variation\IO\flat.pm ok 919 - POD test for Bio\Variation\IO\xml.pm ok 920 - POD test for examples\root\lib\TestInterface.pm ok 921 - POD test for examples\root\lib\TestObject.pm ok 922 - POD test for Bio\DB\Flat\BDB\embl.pm ok 923 - POD test for Bio\DB\Flat\BDB\fasta.pm ok 924 - POD test for Bio\DB\Flat\BDB\genbank.pm ok 925 - POD test for Bio\DB\Flat\BDB\swiss.pm ok 926 - POD test for Bio\DB\GFF\Adaptor\ace.pm ok 927 - POD test for Bio\DB\GFF\Adaptor\berkeleydb.pm ok 928 - POD test for Bio\DB\GFF\Adaptor\biofetch.pm ok 929 - POD test for Bio\DB\GFF\Adaptor\biofetch_oracle.pm ok 930 - POD test for Bio\DB\GFF\Adaptor\dbi.pm ok 931 - POD test for Bio\DB\GFF\Adaptor\memory.pm ok 932 - POD test for Bio\DB\GFF\Aggregator\alignment.pm ok 933 - POD test for Bio\DB\GFF\Aggregator\clone.pm ok 934 - POD test for Bio\DB\GFF\Aggregator\coding.pm ok 935 - POD test for Bio\DB\GFF\Aggregator\gene.pm ok 936 - POD test for Bio\DB\GFF\Aggregator\match.pm ok 937 - POD test for Bio\DB\GFF\Aggregator\none.pm ok 938 - POD test for Bio\DB\GFF\Aggregator\orf.pm ok 939 - POD test for Bio\DB\GFF\Aggregator\processed_transcript.pm ok 940 - POD test for Bio\DB\GFF\Aggregator\so_transcript.pm ok 941 - POD test for Bio\DB\GFF\Aggregator\transcript.pm ok 942 - POD test for Bio\DB\GFF\Aggregator\ucsc_acembly.pm ok 943 - POD test for Bio\DB\GFF\Aggregator\ucsc_ensgene.pm ok 944 - POD test for Bio\DB\GFF\Aggregator\ucsc_genscan.pm ok 945 - POD test for Bio\DB\GFF\Aggregator\ucsc_refgene.pm ok 946 - POD test for Bio\DB\GFF\Aggregator\ucsc_sanger22.pm ok 947 - POD test for Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm ok 948 - POD test for Bio\DB\GFF\Aggregator\ucsc_softberry.pm ok 949 - POD test for Bio\DB\GFF\Aggregator\ucsc_twinscan.pm ok 950 - POD test for Bio\DB\GFF\Aggregator\ucsc_unigene.pm ok 951 - POD test for Bio\DB\GFF\Util\Binning.pm ok 952 - POD test for Bio\DB\GFF\Util\Rearrange.pm ok 953 - POD test for Bio\DB\SeqFeature\Store\bdb.pm ok 954 - POD test for Bio\DB\SeqFeature\Store\berkeleydb.pm ok 955 - POD test for Bio\DB\SeqFeature\Store\berkeleydb3.pm ok 956 - POD test for Bio\DB\SeqFeature\Store\FeatureFileLoader.pm ok 957 - POD test for Bio\DB\SeqFeature\Store\GFF2Loader.pm ok 958 - POD test for Bio\DB\SeqFeature\Store\GFF3Loader.pm ok 959 - POD test for Bio\DB\SeqFeature\Store\Loader.pm ok 960 - POD test for Bio\DB\SeqFeature\Store\LoadHelper.pm ok 961 - POD test for Bio\DB\SeqFeature\Store\memory.pm ok 962 - POD test for Bio\Matrix\PSM\IO\mast.pm ok 963 - POD test for Bio\Matrix\PSM\IO\masta.pm ok 964 - POD test for Bio\Matrix\PSM\IO\meme.pm ok 965 - POD test for Bio\Matrix\PSM\IO\psiblast.pm ok 966 - POD test for Bio\Matrix\PSM\IO\transfac.pm ok 967 - POD test for Bio\Structure\SecStr\DSSP\Res.pm ok 968 - POD test for Bio\Structure\SecStr\STRIDE\Res.pm ok 969 - POD test for Bio\Tools\Analysis\DNA\ESEfinder.pm ok 970 - POD test for Bio\Tools\Analysis\Protein\Domcut.pm ok 971 - POD test for Bio\Tools\Analysis\Protein\ELM.pm ok 972 - POD test for Bio\Tools\Analysis\Protein\GOR4.pm ok 973 - POD test for Bio\Tools\Analysis\Protein\HNN.pm ok 974 - POD test for Bio\Tools\Analysis\Protein\Mitoprot.pm ok 975 - POD test for Bio\Tools\Analysis\Protein\NetPhos.pm ok 976 - POD test for Bio\Tools\Analysis\Protein\Scansite.pm ok 977 - POD test for Bio\Tools\Analysis\Protein\Sopma.pm ok 978 - POD test for Bio\Tools\EUtilities\Info\FieldInfo.pm ok 979 - POD test for Bio\Tools\EUtilities\Info\LinkInfo.pm ok 980 - POD test for Bio\Tools\EUtilities\Link\LinkSet.pm ok 981 - POD test for Bio\Tools\EUtilities\Link\UrlLink.pm ok 982 - POD test for Bio\Tools\EUtilities\Query\GlobalQuery.pm ok 983 - POD test for Bio\Tools\EUtilities\Summary\DocSum.pm ok 984 - POD test for Bio\Tools\EUtilities\Summary\Item.pm ok 985 - POD test for Bio\Tools\EUtilities\Summary\ItemContainerI.pm ok 986 - POD test for Bio\Tools\Phylo\Molphy\Result.pm ok 987 - POD test for Bio\Tools\Phylo\PAML\Codeml.pm ok 988 - POD test for Bio\Tools\Phylo\PAML\ModelResult.pm ok 989 - POD test for Bio\Tools\Phylo\PAML\Result.pm ok 990 - POD test for Bio\Tools\Phylo\Phylip\ProtDist.pm ok 991 - POD test for Bio\Tools\Primer\Assessor\Base.pm ok 992 - POD test for Bio\Tools\Run\WrapperBase\CommandExts.pm ok 993 - POD test for Bio\Tools\SiRNA\Ruleset\saigo.pm ok 994 - POD test for Bio\Tools\SiRNA\Ruleset\tuschl.pm ok 995 - POD test for Bio\DB\GFF\Adaptor\berkeleydb\iterator.pm ok 996 - POD test for Bio\DB\GFF\Adaptor\dbi\caching_handle.pm ok 997 - POD test for Bio\DB\GFF\Adaptor\dbi\iterator.pm ok 998 - POD test for Bio\DB\GFF\Adaptor\dbi\mysql.pm ok 999 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlace.pm ok 1000 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm ok 1001 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm ok 1002 - POD test for Bio\DB\GFF\Adaptor\dbi\oracle.pm ok 1003 - POD test for Bio\DB\GFF\Adaptor\dbi\oracleace.pm ok 1004 - POD test for Bio\DB\GFF\Adaptor\dbi\pg.pm ok 1005 - POD test for Bio\DB\GFF\Adaptor\dbi\pg_fts.pm ok 1006 - POD test for Bio\DB\GFF\Adaptor\memory\feature_serializer.pm ok 1007 - POD test for Bio\DB\GFF\Adaptor\memory\iterator.pm ok 1008 - POD test for Bio\DB\SeqFeature\Store\DBI\Iterator.pm ok 1009 - POD test for Bio\DB\SeqFeature\Store\DBI\mysql.pm ok 1010 - POD test for Bio\DB\SeqFeature\Store\DBI\Pg.pm ok 1011 - POD test for Bio\DB\SeqFeature\Store\DBI\SQLite.pm ok Subroutine new redefined at Bio\Tree\Tree.pm line 131. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283. Subroutine id redefined at Bio\Tree\Tree.pm line 306. Subroutine score redefined at Bio\Tree\Tree.pm line 327. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520. Subroutine clone redefined at Bio\Tree\Tree.pm line 540. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558. Subroutine new redefined at Bio\Tree\Node.pm line 110. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461. Subroutine description redefined at Bio\Tree\Node.pm line 482. Subroutine id redefined at Bio\Tree\Node.pm line 511. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588. Subroutine height redefined at Bio\Tree\Node.pm line 606. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800. t/PopGen/Coalescent.t ........................ 1..13 ok 1 - use Bio::PopGen::Simulation::Coalescent; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 - pi ok 7 - theta ok 8 - tajimaD ok 9 - all the mutations should be polymorphic (by definition) ok 10 - fu and li D ok 11 - fu and li D* ok 12 - fu and li F ok 13 - fu and li F ok t/PopGen/HtSNP.t ............................. 1..8 ok 1 - use Bio::PopGen::HtSNP; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/PopGen/MK.t ................................ 1..46 ok 1 - use Bio::AlignIO; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::PopGen::Utilities; ok 4 - The object isa Bio::PopGen::Statistics ok 5 - The object isa Bio::SimpleAlign ok 6 - The object isa Bio::PopGen::Population ok 7 - Marker Names ok 8 - Number of Inds ok 9 - number of ingroup sequences ok 10 - number of outgroup1 sequences ok 11 - number of outgroup2 sequences ok 12 - NSpoly ok 13 - NSfixed ok 14 - Spoly ok 15 - Sfixed ok 16 - McDonald Kreitman ok 17 - NSpoly ok 18 - NSfixed ok 19 - Spoly ok 20 - Sfixed ok 21 - McDonald Kreitman ok 22 - NSpoly ok 23 - NSfixed ok 24 - Spoly ok 25 - Sfixed ok 26 - The object isa Bio::SimpleAlign ok 27 - The object isa Bio::PopGen::Population ok 28 - Marker Names ok 29 - Number of Inds ok 30 - number of ingroup sequences ok 31 - number of outgroup1 sequences ok 32 - number of outgroup2 sequences ok 33 - NSpoly ok 34 - NSfixed ok 35 - Spoly ok 36 - Sfixed ok 37 - McDonald Kreitman ok 38 - NSpoly ok 39 - NSfixed ok 40 - Spoly ok 41 - Sfixed ok 42 - McDonald Kreitman ok 43 - NSpoly ok 44 - NSfixed ok 45 - Spoly ok 46 - Sfixed ok t/PopGen/PopGen.t ............................ 1..100 ok 1 - use Bio::PopGen::Individual; ok 2 - use Bio::PopGen::Genotype; ok 3 - use Bio::PopGen::Population; ok 4 - use Bio::PopGen::IO; ok 5 - use Bio::PopGen::PopStats; ok 6 - use Bio::AlignIO; ok 7 - use Bio::PopGen::Statistics; ok 8 - use Bio::PopGen::Utilities; ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - mrsa,mssa aflp1 ok 38 - all pops, aflp1 ok 39 - mrsa,envpop aflp1,aflp2 ok 40 ok 41 ok 42 ok 43 - mssa,mrsa all_bands ok 44 - env,mssa mkr1 ok 45 - env,mssa,mrsa all bands ok 46 - env,mssa,mrsa mkr2 ok 47 - mrsa,nc all_bands ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - Pi on 3-allele data ok 100 - Theta on 3-allele data ok t/PopGen/PopGenSims.t ........................ 1..23 ok 1 - use Bio::PopGen::Simulation::GeneticDrift; ok 2 - Allele freqs should sum to 1 ok 3 - Allele freqs should sum to 1 ok 4 - Allele freqs should sum to 1 ok 5 - Allele freqs should sum to 1 ok 6 - Allele freqs should sum to 1 ok 7 - Allele freqs should sum to 1 ok 8 - Allele freqs should sum to 1 ok 9 - Allele freqs should sum to 1 ok 10 - Allele freqs should sum to 1 ok 11 - Allele freqs should sum to 1 ok 12 ok 13 - All frequencies should be <= 1 ok 14 - Allele freqs should sum to 1 ok 15 - Allele freqs should sum to 1 ok 16 - Allele freqs should sum to 1 ok 17 - Allele freqs should sum to 1 ok 18 - Allele freqs should sum to 1 ok 19 - Allele freqs should sum to 1 ok 20 - Allele freqs should sum to 1 ok 21 - Allele freqs should sum to 1 ok 22 - Allele freqs should sum to 1 ok 23 - Allele freqs should sum to 1 ok t/PopGen/TagHaplotype.t ...................... 1..3 ok 1 - use Bio::PopGen::TagHaplotype; ok 2 ok 3 ok t/RemoteDB/BioFetch.t ........................ skipped: Network tests have not been requested t/RemoteDB/CUTG.t ............................ 1..37 ok 1 - use Bio::DB::CUTG; ok 2 - use Bio::CodonUsage::Table; ok 3 - use Bio::CodonUsage::IO; ok 4 - use Bio::SeqIO; ok 5 - use Bio::Tools::SeqStats; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok t/RemoteDB/EMBL.t ............................ skipped: Network tests have not been requested t/RemoteDB/EUtilities.t ...................... skipped: Valid email not provided; required for tests t/RemoteDB/EntrezGene.t ...................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/RemoteDB/GenBank.t ......................... skipped: Network tests have not been requested t/RemoteDB/GenPept.t ......................... skipped: Network tests have not been requested t/RemoteDB/HIV/HIV.t ......................... 1..30 ok 1 - use Bio::DB::HIV; ok 2 - use Bio::DB::WebDBSeqI; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - The object isa Bio::DB::HIV ok 5 - The object isa Bio::Root::Root ok 6 - Bio::DB::HIV->can(...) ok 7 - Bio::DB::HIV->can(...) ok 8 - Bio::DB::HIV->can(...) ok 9 - lanl_base set in default object ok 10 - map_db set in default object ok 11 - make_search_if set in default object ok 12 - search_ set in default object ok 13 - url_base_address set in default object ok 14 - default sequence request format (fasta) ok 15 - sorry till implemented ok 16 - sorry till implemented ok 17 - HIVQuery type exception check ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVAnnotProcessor.t ........... 1..11 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - The object isa Bio::DB::HIV::HIVAnnotProcessor ok 5 - The object isa Bio::Root::Root ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...) ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query') ok 8 - bad type set exception ok 9 - attach stream ok 10 - write exception ok 11 - access stream ok Use of uninitialized value $rest[0] in join or string at (eval 75) line 15. t/RemoteDB/HIV/HIVQuery.t .................... 1..41 ok 1 - use Bio::DB::Query::HIVQuery; ok 2 - use Bio::DB::HIV; ok 3 - use Bio::Annotation::Collection; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::Reference; ok 6 - use Bio::DB::HIV::HIVQueryHelper; ok 7 - The object isa Bio::DB::Query::HIVQuery ok 8 - The object isa Bio::Root::Root ok 9 - Bio::DB::Query::HIVQuery->can(...) ok 10 - Bio::DB::Query::HIVQuery->can(...) ok 11 - Bio::DB::Query::HIVQuery->can(...) ok 12 - _map_db_uri set in default object ok 13 - _make_search_if_uri set in default object ok 14 - _search_uri set in default object ok 15 - _schema_file set in default object ok 16 - _run_option set in default object ok 17 - annotations container available ok 18 - query syntax check 1 ok 19 - query syntax check 2 ok 20 - query syntax check 3 ok 21 - query parser check ok 22 - multiquery parse check ok 23 - use HTML::Parser; ok 24 - help html to file ok 25 - help html parsed ok 26 - bad field exception check ok 27 - bad match data exception check ok 28 - empty field not ok exception check ok 29 - uninitialized schema exception check ok 30 - query not run (level 1) warning check ok 31 - query not run (level 2) warning check ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVQueryHelper.t .............. 1..40 ok 1 - use Bio::DB::HIV::HIVQueryHelper; ok 2 - The object isa HIVSchema ok 3 - The object isa QRY ok 4 - The object isa R ok 5 - The object isa Q ok 6 - schema load ok 7 - HIVSchema->can(...) ok 8 - fields complete ok 9 - tables complete ok 10 - aliases complete ok 11 ok 12 - test field syntax ok ok 13 - test field syntax ok ok 14 - test alias by field name ok 15 - correct primary key for SequenceEntry ok 16 - correct number of foreign keys for AUthor ok 17 - correct foreign table for au_pub_id ok 18 - correct annotation key hash ok 19 - QRY->can(...) ok 20 - R->can(...) ok 21 - Q->can(...) ok 22 - null QRY ok 23 - null R (request object) ok 24 - null Q (atomic query object) ok 25 - R obj create and init (1) ok 26 - R obj create and init (2) ok 27 - R::In ok 28 - !R::In ok 29 - R::Eq ok 30 - QRY obj create and init (1) ok 31 - QRY obj create and init (2) ok 32 - QRY obj create and init (3) ok 33 - QRY overload | ok 34 - QRY overload & ok 35 - QRY nontrivial & ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]} ok 37 - make: 2 queries returned ok 38 - {annotation fields} parsed correctly ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]} ok 40 - above query is null ok t/RemoteDB/MeSH.t ............................ skipped: Network tests have not been requested t/RemoteDB/Query/GenBank.t ................... skipped: Network tests have not been requested t/RemoteDB/RefSeq.t .......................... 1..16 ok 1 - use Bio::DB::RefSeq; ok 2 - use Bio::DB::GenBank; ok 3 - use Bio::DB::EMBL; ok 4 ok 5 ok 6 ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok t/RemoteDB/SeqHound.t ........................ skipped: Network tests have not been requested t/RemoteDB/SeqRead_fail.t .................... skipped: Network tests have not been requested t/RemoteDB/SeqVersion.t ...................... 1..10 ok 1 - use Bio::DB::SeqVersion; ok 2 ok 3 # skip Network tests have not been requested ok 4 # skip Network tests have not been requested ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok t/RemoteDB/SwissProt.t ....................... skipped: Network tests have not been requested ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio\DB\Taxonomy\flatfile.pm line 89. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114 STACK: t/RemoteDB/Taxonomy.t:24 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\arch C:/cpanfly/var/cpan/build/BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0 C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f\blib\lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo\blib\lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob\blib\lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK\blib\lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5\blib\lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi\blib\lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J\blib\lib C:\cpanfly\var\megalib C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/arch C:\cpanfly\var\cpan\build\Perl-OSType-1.002-Dy4QRO/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-2.110930-0c8m4f/blib/lib C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/arch C:\cpanfly\var\cpan\build\Test-Simple-0.98-kSFsPo/blib/lib C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/arch C:\cpanfly\var\cpan\build\Parse-CPAN-Meta-1.4401-HMk8Ob/blib/lib C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/arch C:\cpanfly\var\cpan\build\JSON-PP-2.27105-vwa1mK/blib/lib C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/arch C:\cpanfly\var\cpan\build\CPAN-Meta-YAML-0.003-l0Ngg5/blib/lib C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/arch C:\cpanfly\var\cpan\build\Module-Metadata-1.000004-d0UIKi/blib/lib C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/arch C:\cpanfly\var\cpan\build\version-0.88-LpSB1J/blib/lib C:/cpanfly/var/megalib C:/Perl64/site/lib C:/Perl64/lib) at Bio\DB\Taxonomy\flatfile.pm line 89. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89. Compilation failed in require at Bio/Root/Root.pm line 543. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114 STACK: t/RemoteDB/Taxonomy.t:24 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/RemoteDB/Taxonomy.t line 24. Use of uninitialized value $db in string eq at t/RemoteDB/Taxonomy.t line 32. Can't call method "get_taxon" on an undefined value at t/RemoteDB/Taxonomy.t line 124. # Looks like you planned 103 tests but ran 82. # Looks like you failed 1 test of 82 run. # Looks like your test exited with 255 just after 82. t/RemoteDB/Taxonomy.t ........................ 1..103 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 not ok 4 ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok 42 # skip Network tests have not been requested ok 43 # skip Unable to connect to entrez database; no network or server busy? ok 44 # skip Unable to connect to entrez database; no network or server busy? ok 45 # skip Unable to connect to entrez database; no network or server busy? ok 46 # skip Unable to connect to entrez database; no network or server busy? ok 47 # skip Unable to connect to entrez database; no network or server busy? ok 48 # skip Unable to connect to entrez database; no network or server busy? ok 49 # skip Unable to connect to entrez database; no network or server busy? ok 50 # skip Unable to connect to entrez database; no network or server busy? ok 51 # skip Unable to connect to entrez database; no network or server busy? ok 52 # skip Unable to connect to entrez database; no network or server busy? ok 53 # skip Unable to connect to entrez database; no network or server busy? ok 54 # skip Unable to connect to entrez database; no network or server busy? ok 55 # skip Unable to connect to entrez database; no network or server busy? ok 56 # skip Unable to connect to entrez database; no network or server busy? ok 57 # skip Unable to connect to entrez database; no network or server busy? ok 58 # skip Unable to connect to entrez database; no network or server busy? ok 59 # skip Unable to connect to entrez database; no network or server busy? ok 60 # skip Unable to connect to entrez database; no network or server busy? ok 61 # skip Unable to connect to entrez database; no network or server busy? ok 62 # skip Unable to connect to entrez database; no network or server busy? ok 63 # skip Unable to connect to entrez database; no network or server busy? ok 64 # skip Unable to connect to entrez database; no network or server busy? ok 65 # skip Unable to connect to entrez database; no network or server busy? ok 66 # skip Unable to connect to entrez database; no network or server busy? ok 67 # skip Unable to connect to entrez database; no network or server busy? ok 68 # skip Unable to connect to entrez database; no network or server busy? ok 69 # skip Unable to connect to entrez database; no network or server busy? ok 70 # skip Unable to connect to entrez database; no network or server busy? ok 71 # skip Unable to connect to entrez database; no network or server busy? ok 72 # skip Unable to connect to entrez database; no network or server busy? ok 73 # skip Unable to connect to entrez database; no network or server busy? ok 74 # skip Unable to connect to entrez database; no network or server busy? ok 75 # skip Unable to connect to entrez database; no network or server busy? ok 76 # skip Unable to connect to entrez database; no network or server busy? ok 77 # skip Unable to connect to entrez database; no network or server busy? ok 78 # skip Unable to connect to entrez database; no network or server busy? ok 79 # skip Unable to connect to entrez database; no network or server busy? ok 80 # skip Unable to connect to entrez database; no network or server busy? ok 81 ok 82 Dubious, test returned 255 (wstat 65280, 0xff00) Failed 22/103 subtests (less 76 skipped subtests: 5 okay) t/Restriction/Analysis-refac.t ............... 1..91 ok 1 - use Bio::Restriction::IO; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Restriction::EnzymeCollection; ok 4 - use Bio::Restriction::Enzyme; ok 5 - read withrefm file ok 6 - parse withrefm file ok 7 - HindIII: nonambiguous intrasite cutter ok 8 - AarI: nonambiguous extrasite cutter ok 9 - AasI: ambiguous intrasite cutter ok 10 - BceSI: ambiguous extrasite cutter ok 11 - AjuI: cutter with central recog site ok 12 - TaqII: multi-extrasite cutter ok 13 ok 14 - HindIII plus ok 15 - HindIII minus ok 16 - AasI plus ok 17 - AasI minus ok 18 - AarI plus ok 19 - AarI minus ok 20 - BceSI plus ok 21 - BceSI minus ok 22 - AjuI plus ok 23 - AjuI minus ok 24 - TaqII plus ok 25 - TaqII minus ok 26 - build real B:R::Analysis object ok 27 - 13 fragments ok 28 - circularize ok 29 - recut ok 30 - circ: AasI # site at origin ok 31 - circ: still 13 fragments (cut site at origin) ok 32 - use Bio::Restriction::IO; ok 33 - use Bio::Restriction::Analysis; ok 34 - read withrefm file ok 35 - parse withrefm file ok 36 - Collection initiated ok 37 - AbeI: found ok into collection ok 38 - AccBSI: found ok into collection ok 39 - AciI: found ok into collection ok 40 - Asp26HI: found ok into collection ok 41 - BmgBI: found ok into collection ok 42 - AbeI plus ok 43 - AbeI minus ok 44 - AbeI fragment ok 45 - AbeI positions ok 46 - AbeI Overhang ok 47 - AbeI name ok 48 - AbeI site ok 49 - AbeI revcom_site ok 50 - AbeI cut ok 51 - AbeI complementary_cut ok 52 - AccBSI plus ok 53 - AccBSI minus ok 54 - AccBSI fragment ok 55 - AccBSI positions ok 56 - AccBSI Overhang ok 57 - AccBSI name ok 58 - AccBSI site ok 59 - AccBSI revcom_site ok 60 - AccBSI cut ok 61 - AccBSI complementary_cut ok 62 - AciI plus ok 63 - AciI minus ok 64 - AciI fragment ok 65 - AciI positions ok 66 - AciI Overhang ok 67 - AciI name ok 68 - AciI site ok 69 - AciI revcom_site ok 70 - AciI cut ok 71 - AciI complementary_cut ok 72 - Asp26HI plus ok 73 - Asp26HI minus ok 74 - Asp26HI fragment ok 75 - Asp26HI positions ok 76 - Asp26HI Overhang ok 77 - Asp26HI name ok 78 - Asp26HI site ok 79 - Asp26HI revcom_site ok 80 - Asp26HI cut ok 81 - Asp26HI complementary_cut ok 82 - BmgBI plus ok 83 - BmgBI minus ok 84 - BmgBI fragment ok 85 - BmgBI positions ok 86 - BmgBI Overhang ok 87 - BmgBI name ok 88 - BmgBI site ok 89 - BmgBI revcom_site ok 90 - BmgBI cut ok 91 - BmgBI complementary_cut ok t/Restriction/Analysis.t ..................... 1..182 ok 1 - use Bio::Restriction::Enzyme; ok 2 - use Bio::Restriction::Enzyme::MultiCut; ok 3 - use Bio::Restriction::Enzyme::MultiSite; ok 4 - use Bio::Restriction::EnzymeCollection; ok 5 - use Bio::Restriction::Analysis; ok 6 - use Bio::SeqIO; ok 7 ok 8 - The object isa Bio::Restriction::EnzymeI ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - The object isa Bio::PrimarySeqI ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - bug 2179 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - The object isa Bio::Restriction::EnzymeI ok 77 - The object isa Bio::Restriction::EnzymeI ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - The object isa Bio::Restriction::EnzymeI ok 88 - The object isa Bio::Restriction::EnzymeI ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - The object isa Bio::Restriction::Enzyme ok 100 ok 101 ok 102 - The object isa Bio::Restriction::Enzyme ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 - number of unique cutters ok 119 - number of RsaI fragments ok 120 - number of maximum cutters ok 121 - number of zero cutters ok 122 - number of cutters ok 123 - number of 3x cutters ok 124 - 4 MseI fragments ok 125 - 3 MseI cut sites ok 126 - expected 2 PspEI fragments ok 127 ok 128 ok 129 - expected 2 sizes for PspEI ok 130 ok 131 - expected 2 sizes for PspEI ok 132 ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut ok 134 ok 135 ok 136 - number of RsaI fragments ok 137 - 3 circular MseI fragments ok 138 - 3 circular MseI cut sites ok 139 - number for AciI a non-palindromic enzyme ok 140 - 1 fragment for MwoI as it cuts across the circ point ok 141 ok 142 ok 143 ok 144 ok 145 - 7 fragments in the multiple digest ok 146 - 7 positions in the multiple digest ok 147 - 7 sizes in the multiple digest ok 148 ok 149 - expected 9 cuts for HindI ok 150 - expect 9 fragment maps for HindI ok 151 - sequence for GT ok 152 - start at 40 ok 153 - end at 41 ok 154 - sequence for GGATTAAAAAAAGAGT ok 155 - start at 42 ok 156 - end at 57 ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT ok 158 - start at 58 ok 159 - end at 92 ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA ok 161 - start at 93 ok 162 - end at 123 ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA ok 164 - start at 124 ok 165 - end at 155 ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA ok 167 - start at 156 ok 168 - end at 181 ok 169 - sequence for CAACATCCATGAAACGCATTAGCA ok 170 - start at 182 ok 171 - end at 205 ok 172 - sequence for CCA ok 173 - start at 206 ok 174 - end at 208 ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT ok 176 - start at 209 ok 177 - end at 39 ok 178 ok 179 - bug 2139 ok 180 - number of HindIII fragments ok 181 - number of EcoRI fragments ok 182 - number of RsaI fragments ok t/Restriction/Gel.t .......................... 1..9 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Tools::Gel; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok Subroutine new redefined at Bio/Restriction/IO/base.pm line 90, line 532. Subroutine _initialize redefined at Bio/Restriction/IO/base.pm line 114, line 532. Subroutine read redefined at Bio/Restriction/IO/base.pm line 144, line 532. Subroutine _xln_sub redefined at Bio/Restriction/IO/base.pm line 172, line 532. Subroutine write redefined at Bio/Restriction/IO/base.pm line 189, line 532. Subroutine verify_prototype redefined at Bio/Restriction/IO/base.pm line 221, line 532. Subroutine _cuts_from_site redefined at Bio/Restriction/IO/base.pm line 258, line 532. Subroutine _meth redefined at Bio/Restriction/IO/base.pm line 279, line 532. Subroutine _coordinate_shift_to_cut redefined at Bio/Restriction/IO/base.pm line 305, line 532. Subroutine _make_multisites redefined at Bio/Restriction/IO/base.pm line 327, line 532. Subroutine _make_multicuts redefined at Bio/Restriction/IO/base.pm line 412, line 532. Subroutine _companies redefined at Bio/Restriction/IO/base.pm line 441, line 532. t/Restriction/IO.t ........................... 1..18 ok 1 - use Bio::Restriction::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT! # Failed (TODO) test at t/Restriction/IO.t line 31. ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok t/Root/Exception.t ........................... 1..8 ok 1 - use TestObject; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Root/HTTPget.t ............................. skipped: Network tests have not been requested t/Root/RootI.t ............................... 1..63 ok 1 - use Bio::Root::Root; ok 2 - use Bio::Seq; ok 3 ok 4 - The object isa Bio::Root::RootI ok 5 - threw Regexp ((?-xism:Testing throw)) ok 6 - threw Regexp ((?-xism:EXCEPTION: Bio::Root::NotImplemented)) ok 7 - threw Regexp ((?-xism:EXCEPTION )) ok 8 - threw Regexp ((?-xism:Testing throw)) ok 9 ok 10 - threw Regexp ((?-xism:Testing throw)) ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - simple ok 17 - simple ok 18 - warns for versions below current version 1.0069 ok 19 - warns for versions below current version 1.0069 ok 20 - throws for versions above 1.0069 ok 21 - throws for versions above 1.0069 ok 22 - throws for versions equal to 1.0069 ok 23 - simple ok 24 - simple ok 25 - warns for versions below current version 1.0069 ok 26 - warns for versions below current version 1.0069 ok 27 - throws for versions above 1.0069 ok 28 - throws for versions above 1.0069 ok 29 - arg callable since method was created ok 30 - mal-formed arg callable since method was created with good name ok 31 - Bio::Foo2->can('t3') ok 32 - Methods don't pollute original Bio::Root::Root namespace ok 33 - Bio::Foo2->can('test_4') ok 34 - Methods don't pollute original Bio::Root::Root namespace ok 35 - Bio::Foo3->can('t5') ok 36 - arg not in method list not created ok 37 - Bio::Foo3->can('t5') ok 38 - Methods don't pollute original Bio::Root::Root namespace ok 39 - verbose was set correctly ok 40 - synonym was set correctly ok 41 - real method of synonym was set correctly ok 42 - mal-formed arg correctly resolved to created method ok 43 - synonym of set method was set correctly ok 44 - Bio::Foo4->can('t7') ok 45 - Methods don't pollute original Bio::Root::Root namespace ok 46 - Bio::Foo4->can('test7') ok 47 - Methods don't pollute original Bio::Root::Root namespace ok 48 - Bio::Foo4->can('test_8') ok 49 - Methods don't pollute original Bio::Root::Root namespace ok 50 - Bio::Foo4->can('t8') ok 51 - Methods don't pollute original Bio::Root::Root namespace ok 52 - clone ok 53 - clone ok 54 - clone ok 55 - clone changed, original didn't ok 56 - parameters passed to clone() modify object ok 57 - original is not modified ok 58 - must use proper versioning scheme ok 59 - warns for versions >= 1.0069 ok 60 - warns for versions >= 1.0069 ok 61 - throws for versions >= 1.0069 ok 62 - throws for versions >= 1.0069 ok 63 - No warnings/exceptions below 1.0069 ok # Failed test 'executable file' # at t/Root/RootIO.t line 55. Can't do inplace edit without backup at Bio/Root/IO.pm line 513. # Looks like you planned 67 tests but ran 43. # Looks like you failed 1 test of 43 run. # Looks like your test exited with 9 just after 43. Error removing C:\cpanfly\var\tmp\IjI6nTLbtJ at C:\cpanfly\var\megalib/File/Temp.pm line 890. t/Root/RootIO.t .............................. 1..67 ok 1 - use Bio::Root::IO; ok 2 ok 3 - throw() ok 4 - throw() verbose(-1) ok 5 - warn() ok 6 - throw() verbose(1) ok 7 - stack_trace() ok 8 - set verbosity to 1 ok 9 ok 10 not ok 11 - executable file ok 12 - non-executable file ok 13 - executable dir ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - filename, read ok 20 ok 21 ok 22 - filename, write ok 23 ok 24 ok 25 ok 26 ok 27 - handle, read ok 28 ok 29 ok 30 - handle, write ok 31 ok 32 - is a write handle ok 33 - no warnings ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - _print ok 43 Dubious, test returned 9 (wstat 2304, 0x900) Failed 25/67 subtests t/Root/Storable.t ............................ 1..35 ok 1 - use Bio::Root::Storable; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok t/Root/Tempfile.t ............................ 1..18 ok 1 - use Bio::Root::IO; ok 2 ok 3 - The object isa Bio::Root::IO ok 4 ok 5 ok 6 - auto UNLINK => 1 ok 7 ok 8 ok 9 - tempfile deleted ok 10 ok 11 - UNLINK => 0 ok 12 ok 13 ok 14 ok 15 - tempfile suffix ok 16 ok 17 - tempfile() in scalar context ok 18 ok t/Root/Utilities.t ........................... 1..56 ok 1 - use Bio::Root::Utilities; ok 2 - The object isa Bio::Root::Utilities ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - file_date() ok 38 - unix (\n or 012 or ^J) ok 39 - date format ok 40 - date format ok 41 - date format ok 42 - date format ok 43 - date format ok 44 ok 45 # skip gzip not found, skipping gzip tests ok 46 # skip gzip not found, skipping gzip tests ok 47 # skip gzip not found, skipping gzip tests ok 48 # skip gzip not found, skipping gzip tests ok 49 # skip gzip not found, skipping gzip tests ok 50 # skip gzip not found, skipping gzip tests ok 51 # skip gzip not found, skipping gzip tests ok 52 # skip gzip not found, skipping gzip tests ok 53 # skip gzip not found, skipping gzip tests ok 54 # skip gzip not found, skipping gzip tests ok 55 # skip gzip not found, skipping gzip tests ok 56 # skip gzip not found, skipping gzip tests ok t/SearchDist.t ............................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 434. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 434. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 434. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 434. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 434. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 434. t/SearchIO/CigarString.t ..................... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/SearchIO.t ........................ 1..19 ok 1 - use Bio::SearchIO; ok 2 - blastxml for f.blastxml ok 3 - fasta for f.fy ok 4 - exonerate for f.exonerate ok 5 - blast for f.tblx ok 6 - fasta for f.fx ok 7 - fasta for f.osearch ok 8 - blast for filename.bls ok 9 - exonerate for f.exon ok 10 - fasta for f.SSEARCH.m9 ok 11 - blast for filename.blast ok 12 - fasta for f.m9 ok 13 - blast for f.blx ok 14 - blastxml for f.xml ok 15 - fasta for f.fasta ok 16 - fasta for f.fa ok 17 - blast for fast.bls ok 18 - fasta for f.ssearch ok 19 - fasta for f.psearch ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 434. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 434. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 434. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 434. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 434. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 434. t/SearchIO/SimilarityPair.t .................. 1..12 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SeqIO; ok 3 ok 4 - The object isa Bio::SeqI ok 5 ok 6 - The object isa Bio::SearchIO ok 7 ok 8 - The object isa Bio::Search::Hit::HitI ok 9 ok 10 - The object isa Bio::SeqFeatureI ok 11 ok 12 ok Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 127. Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 204. Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 228. Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 248. Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 268. Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 288. Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 308. Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 333. Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 355. Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 385. Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 400. Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 430. Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 458. Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 494. Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 517. Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 538. Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 564. Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 576. Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 605. Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 652. Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 694. Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 740. Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 786. Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 849. Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 887. Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 948. Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1025. Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1093. Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1150. Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1226. Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1274. Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1310. Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1364. Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1400. Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1442. Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1473. Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1535. Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1574. Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1590. Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1618. Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1666. Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1683. Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1701. Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1732. Subroutine iteration redefined at Bio\Search\Hit\GenericHit.pm line 1772. Subroutine found_again redefined at Bio\Search\Hit\GenericHit.pm line 1807. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1333. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1341. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\Search\Hit\BlastHit.pm line 105. Subroutine iteration redefined at Bio\Search\Hit\BlastHit.pm line 134. Subroutine found_again redefined at Bio\Search\Hit\BlastHit.pm line 169. Subroutine expect redefined at Bio\Search\Hit\BlastHit.pm line 176. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 2564. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 2564. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 2564. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 2564. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 2564. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 2564. t/SearchIO/Tiling.t .......................... 1..1141 ok 1 - use Bio::Search::Tiling::MapTiling; ok 2 - use Bio::Search::Tiling::MapTileUtils; ok 3 - use Bio::SearchIO; ok 4 - use Bio::Search::Hit::BlastHit; ok 5 - use File::Spec; ok 6 - parse data file ok 7 - got test hit ok 8 - create tiling ok 9 - The object isa Bio::Search::Tiling::TilingI ok 10 - implements 'next_tiling' ok 11 - implements 'rewind_tilings' ok 12 - implements 'identities' ok 13 - implements 'conserved' ok 14 - implements 'length' ok 15 - identities regression test ok 16 - conserved regression test ok 17 - tiling iterator regression test(1) ok 18 - tiling iterator regression test(2) ok 19 - tiling iterator regression test(3, rewind) ok 20 - ecolitst.wublastp ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - dnaEbsub_ecoli.wublastx ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - tricky.wublast ok 37 - tricky.wublast(1) ok 38 - tricky.wublast(2) ok 39 - tricky.wublast(3) ok 40 - tricky.wublast(4) ok 41 - ecolitst.bls ok 42 - tile ecolitst.bls hit 1 \#hsps 1 ok 43 - q id: est (0.98293) = fast (0.98293) ok 44 - q cn: est (0.98293) = fast (0.98293) ok 45 - h id: est (0.98293) = fast (0.98293) ok 46 - h cn: est (0.98293) = fast (0.98293) ok 47 - tile ecolitst.bls hit 2 \#hsps 1 ok 48 - q id: est (0.30074) = fast (0.30074) ok 49 - q cn: est (0.49876) = fast (0.49876) ok 50 - h id: est (0.30759) = fast (0.30759) ok 51 - h cn: est (0.51013) = fast (0.51013) ok 52 - tile ecolitst.bls hit 3 \#hsps 1 ok 53 - q id: est (0.31004) = fast (0.31004) ok 54 - q cn: est (0.49782) = fast (0.49782) ok 55 - h id: est (0.32054) = fast (0.32054) ok 56 - h cn: est (0.51467) = fast (0.51467) ok 57 - tile ecolitst.bls hit 4 \#hsps 1 ok 58 - q id: est (0.30435) = fast (0.30435) ok 59 - q cn: est (0.47826) = fast (0.47826) ok 60 - h id: est (0.29787) = fast (0.29787) ok 61 - h cn: est (0.46809) = fast (0.46809) ok 62 - tricky.wublast ok 63 - tile tricky.wublast hit 1 \#hsps 7 ok 64 - q id: exact (0.22153) ~ est (0.22153) ok 65 - q id: exact (0.22153) <= max (0.22153) ok 66 - q cn: exact (0.42760) ~ est (0.42760) ok 67 - q cn: exact (0.42760) <= max (0.42760) ok 68 - h id: exact (0.22704) ~ est (0.22704) ok 69 - h id: exact (0.22704) <= max (0.22704) ok 70 - h cn: exact (0.43335) ~ est (0.43335) ok 71 - h cn: exact (0.43335) <= max (0.43335) ok 72 - a_thaliana.blastn ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1 ok 74 - q id: est (0.96667) = fast (0.96667) ok 75 - q cn: est (0.96667) = fast (0.96667) ok 76 - h id: est (0.98305) = fast (0.98305) ok 77 - h cn: est (0.98305) = fast (0.98305) ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1 ok 79 - q id: est (0.96667) = fast (0.96667) ok 80 - q cn: est (0.96667) = fast (0.96667) ok 81 - h id: est (0.98305) = fast (0.98305) ok 82 - h cn: est (0.98305) = fast (0.98305) ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1 ok 84 - q id: est (1.00000) = fast (1.00000) ok 85 - q cn: est (1.00000) = fast (1.00000) ok 86 - h id: est (1.00000) = fast (1.00000) ok 87 - h cn: est (1.00000) = fast (1.00000) ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1 ok 89 - q id: est (1.00000) = fast (1.00000) ok 90 - q cn: est (1.00000) = fast (1.00000) ok 91 - h id: est (1.00000) = fast (1.00000) ok 92 - h cn: est (1.00000) = fast (1.00000) ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1 ok 94 - q id: est (0.92308) = fast (0.92308) ok 95 - q cn: est (0.92308) = fast (0.92308) ok 96 - h id: est (0.92308) = fast (0.92308) ok 97 - h cn: est (0.92308) = fast (0.92308) ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1 ok 99 - q id: est (1.00000) = fast (1.00000) ok 100 - q cn: est (1.00000) = fast (1.00000) ok 101 - h id: est (1.00000) = fast (1.00000) ok 102 - h cn: est (1.00000) = fast (1.00000) ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1 ok 104 - q id: est (1.00000) = fast (1.00000) ok 105 - q cn: est (1.00000) = fast (1.00000) ok 106 - h id: est (1.00000) = fast (1.00000) ok 107 - h cn: est (1.00000) = fast (1.00000) ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1 ok 109 - q id: est (1.00000) = fast (1.00000) ok 110 - q cn: est (1.00000) = fast (1.00000) ok 111 - h id: est (1.00000) = fast (1.00000) ok 112 - h cn: est (1.00000) = fast (1.00000) ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1 ok 114 - q id: est (1.00000) = fast (1.00000) ok 115 - q cn: est (1.00000) = fast (1.00000) ok 116 - h id: est (1.00000) = fast (1.00000) ok 117 - h cn: est (1.00000) = fast (1.00000) ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1 ok 119 - q id: est (1.00000) = fast (1.00000) ok 120 - q cn: est (1.00000) = fast (1.00000) ok 121 - h id: est (1.00000) = fast (1.00000) ok 122 - h cn: est (1.00000) = fast (1.00000) ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1 ok 124 - q id: est (1.00000) = fast (1.00000) ok 125 - q cn: est (1.00000) = fast (1.00000) ok 126 - h id: est (1.00000) = fast (1.00000) ok 127 - h cn: est (1.00000) = fast (1.00000) ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1 ok 129 - q id: est (1.00000) = fast (1.00000) ok 130 - q cn: est (1.00000) = fast (1.00000) ok 131 - h id: est (1.00000) = fast (1.00000) ok 132 - h cn: est (1.00000) = fast (1.00000) ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1 ok 134 - q id: est (1.00000) = fast (1.00000) ok 135 - q cn: est (1.00000) = fast (1.00000) ok 136 - h id: est (1.00000) = fast (1.00000) ok 137 - h cn: est (1.00000) = fast (1.00000) ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1 ok 139 - q id: est (1.00000) = fast (1.00000) ok 140 - q cn: est (1.00000) = fast (1.00000) ok 141 - h id: est (1.00000) = fast (1.00000) ok 142 - h cn: est (1.00000) = fast (1.00000) ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1 ok 144 - q id: est (1.00000) = fast (1.00000) ok 145 - q cn: est (1.00000) = fast (1.00000) ok 146 - h id: est (1.00000) = fast (1.00000) ok 147 - h cn: est (1.00000) = fast (1.00000) ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1 ok 149 - q id: est (1.00000) = fast (1.00000) ok 150 - q cn: est (1.00000) = fast (1.00000) ok 151 - h id: est (1.00000) = fast (1.00000) ok 152 - h cn: est (1.00000) = fast (1.00000) ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1 ok 154 - q id: est (1.00000) = fast (1.00000) ok 155 - q cn: est (1.00000) = fast (1.00000) ok 156 - h id: est (1.00000) = fast (1.00000) ok 157 - h cn: est (1.00000) = fast (1.00000) ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1 ok 159 - q id: est (1.00000) = fast (1.00000) ok 160 - q cn: est (1.00000) = fast (1.00000) ok 161 - h id: est (1.00000) = fast (1.00000) ok 162 - h cn: est (1.00000) = fast (1.00000) ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1 ok 164 - q id: est (1.00000) = fast (1.00000) ok 165 - q cn: est (1.00000) = fast (1.00000) ok 166 - h id: est (1.00000) = fast (1.00000) ok 167 - h cn: est (1.00000) = fast (1.00000) ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1 ok 169 - q id: est (0.95238) = fast (0.95238) ok 170 - q cn: est (0.95238) = fast (0.95238) ok 171 - h id: est (0.95238) = fast (0.95238) ok 172 - h cn: est (0.95238) = fast (0.95238) ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1 ok 174 - q id: est (1.00000) = fast (1.00000) ok 175 - q cn: est (1.00000) = fast (1.00000) ok 176 - h id: est (1.00000) = fast (1.00000) ok 177 - h cn: est (1.00000) = fast (1.00000) ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1 ok 179 - q id: est (0.95238) = fast (0.95238) ok 180 - q cn: est (0.95238) = fast (0.95238) ok 181 - h id: est (0.95238) = fast (0.95238) ok 182 - h cn: est (0.95238) = fast (0.95238) ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1 ok 184 - q id: est (1.00000) = fast (1.00000) ok 185 - q cn: est (1.00000) = fast (1.00000) ok 186 - h id: est (1.00000) = fast (1.00000) ok 187 - h cn: est (1.00000) = fast (1.00000) ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1 ok 189 - q id: est (0.95238) = fast (0.95238) ok 190 - q cn: est (0.95238) = fast (0.95238) ok 191 - h id: est (0.95238) = fast (0.95238) ok 192 - h cn: est (0.95238) = fast (0.95238) ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1 ok 194 - q id: est (1.00000) = fast (1.00000) ok 195 - q cn: est (1.00000) = fast (1.00000) ok 196 - h id: est (1.00000) = fast (1.00000) ok 197 - h cn: est (1.00000) = fast (1.00000) ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1 ok 199 - q id: est (1.00000) = fast (1.00000) ok 200 - q cn: est (1.00000) = fast (1.00000) ok 201 - h id: est (1.00000) = fast (1.00000) ok 202 - h cn: est (1.00000) = fast (1.00000) ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1 ok 204 - q id: est (1.00000) = fast (1.00000) ok 205 - q cn: est (1.00000) = fast (1.00000) ok 206 - h id: est (1.00000) = fast (1.00000) ok 207 - h cn: est (1.00000) = fast (1.00000) ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1 ok 209 - q id: est (1.00000) = fast (1.00000) ok 210 - q cn: est (1.00000) = fast (1.00000) ok 211 - h id: est (1.00000) = fast (1.00000) ok 212 - h cn: est (1.00000) = fast (1.00000) ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1 ok 214 - q id: est (1.00000) = fast (1.00000) ok 215 - q cn: est (1.00000) = fast (1.00000) ok 216 - h id: est (1.00000) = fast (1.00000) ok 217 - h cn: est (1.00000) = fast (1.00000) ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1 ok 219 - q id: est (1.00000) = fast (1.00000) ok 220 - q cn: est (1.00000) = fast (1.00000) ok 221 - h id: est (1.00000) = fast (1.00000) ok 222 - h cn: est (1.00000) = fast (1.00000) ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1 ok 224 - q id: est (1.00000) = fast (1.00000) ok 225 - q cn: est (1.00000) = fast (1.00000) ok 226 - h id: est (1.00000) = fast (1.00000) ok 227 - h cn: est (1.00000) = fast (1.00000) ok 228 - brassica_ATH.WUBLASTN ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3 ok 230 - q id: exact (0.82465) ~ est (0.82343) ok 231 - q id: exact (0.82465) <= max (0.83333) ok 232 - q cn: exact (0.85590) ~ est (0.85312) ok 233 - q cn: exact (0.85590) <= max (0.86458) ok 234 - h id: exact (0.83920) ~ est (0.83920) ok 235 - h id: exact (0.83920) <= max (0.83920) ok 236 - h cn: exact (0.86935) ~ est (0.86935) ok 237 - h cn: exact (0.86935) <= max (0.86935) ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2 ok 239 - q id: exact (0.82486) ~ est (0.82486) ok 240 - q id: exact (0.82486) <= max (0.82486) ok 241 - q cn: exact (0.85122) ~ est (0.85122) ok 242 - q cn: exact (0.85122) <= max (0.85122) ok 243 - h id: exact (0.82955) ~ est (0.82955) ok 244 - h id: exact (0.82955) <= max (0.82955) ok 245 - h cn: exact (0.85606) ~ est (0.85606) ok 246 - h cn: exact (0.85606) <= max (0.85606) ok 247 - no_hsps.blastp ok 248 - tile no_hsps.blastp hit 1 \#hsps 0 ok 249 - tile no_hsps.blastp hit 2 \#hsps 0 ok 250 - tile no_hsps.blastp hit 3 \#hsps 0 ok 251 - tile no_hsps.blastp hit 4 \#hsps 0 ok 252 - tile no_hsps.blastp hit 5 \#hsps 0 ok 253 - tile no_hsps.blastp hit 6 \#hsps 0 ok 254 - tile no_hsps.blastp hit 7 \#hsps 0 ok 255 - tile no_hsps.blastp hit 8 \#hsps 0 ok 256 - tile no_hsps.blastp hit 9 \#hsps 0 ok 257 - tile no_hsps.blastp hit 10 \#hsps 0 ok 258 - tile no_hsps.blastp hit 11 \#hsps 0 ok 259 - tile no_hsps.blastp hit 12 \#hsps 0 ok 260 - tile no_hsps.blastp hit 13 \#hsps 0 ok 261 - tile no_hsps.blastp hit 14 \#hsps 0 ok 262 - tile no_hsps.blastp hit 15 \#hsps 0 ok 263 - tile no_hsps.blastp hit 16 \#hsps 0 ok 264 - tile no_hsps.blastp hit 17 \#hsps 0 ok 265 - tile no_hsps.blastp hit 18 \#hsps 0 ok 266 - tile no_hsps.blastp hit 19 \#hsps 0 ok 267 - tile no_hsps.blastp hit 20 \#hsps 0 ok 268 - tile no_hsps.blastp hit 21 \#hsps 0 ok 269 - tile no_hsps.blastp hit 22 \#hsps 0 ok 270 - tile no_hsps.blastp hit 23 \#hsps 0 ok 271 - tile no_hsps.blastp hit 24 \#hsps 0 ok 272 - tile no_hsps.blastp hit 25 \#hsps 0 ok 273 - tile no_hsps.blastp hit 26 \#hsps 0 ok 274 - tile no_hsps.blastp hit 27 \#hsps 0 ok 275 - tile no_hsps.blastp hit 28 \#hsps 0 ok 276 - tile no_hsps.blastp hit 29 \#hsps 0 ok 277 - tile no_hsps.blastp hit 30 \#hsps 0 ok 278 - tile no_hsps.blastp hit 31 \#hsps 0 ok 279 - tile no_hsps.blastp hit 32 \#hsps 0 ok 280 - tile no_hsps.blastp hit 33 \#hsps 0 ok 281 - tile no_hsps.blastp hit 34 \#hsps 0 ok 282 - tile no_hsps.blastp hit 35 \#hsps 0 ok 283 - tile no_hsps.blastp hit 36 \#hsps 0 ok 284 - tile no_hsps.blastp hit 37 \#hsps 0 ok 285 - tile no_hsps.blastp hit 38 \#hsps 0 ok 286 - tile no_hsps.blastp hit 39 \#hsps 0 ok 287 - tile no_hsps.blastp hit 40 \#hsps 0 ok 288 - tile no_hsps.blastp hit 41 \#hsps 0 ok 289 - tile no_hsps.blastp hit 42 \#hsps 0 ok 290 - tile no_hsps.blastp hit 43 \#hsps 0 ok 291 - tile no_hsps.blastp hit 44 \#hsps 0 ok 292 - tile no_hsps.blastp hit 45 \#hsps 0 ok 293 - tile no_hsps.blastp hit 46 \#hsps 0 ok 294 - tile no_hsps.blastp hit 47 \#hsps 0 ok 295 - tile no_hsps.blastp hit 48 \#hsps 0 ok 296 - tile no_hsps.blastp hit 49 \#hsps 0 ok 297 - tile no_hsps.blastp hit 50 \#hsps 0 ok 298 - tile no_hsps.blastp hit 51 \#hsps 0 ok 299 - tile no_hsps.blastp hit 52 \#hsps 0 ok 300 - tile no_hsps.blastp hit 53 \#hsps 0 ok 301 - tile no_hsps.blastp hit 54 \#hsps 0 ok 302 - tile no_hsps.blastp hit 55 \#hsps 0 ok 303 - tile no_hsps.blastp hit 56 \#hsps 0 ok 304 - tile no_hsps.blastp hit 57 \#hsps 0 ok 305 - tile no_hsps.blastp hit 58 \#hsps 0 ok 306 - tile no_hsps.blastp hit 59 \#hsps 0 ok 307 - tile no_hsps.blastp hit 60 \#hsps 0 ok 308 - tile no_hsps.blastp hit 61 \#hsps 0 ok 309 - tile no_hsps.blastp hit 62 \#hsps 0 ok 310 - tile no_hsps.blastp hit 63 \#hsps 0 ok 311 - tile no_hsps.blastp hit 64 \#hsps 0 ok 312 - tile no_hsps.blastp hit 65 \#hsps 0 ok 313 - tile no_hsps.blastp hit 66 \#hsps 0 ok 314 - tile no_hsps.blastp hit 67 \#hsps 0 ok 315 - tile no_hsps.blastp hit 68 \#hsps 0 ok 316 - tile no_hsps.blastp hit 69 \#hsps 0 ok 317 - tile no_hsps.blastp hit 70 \#hsps 0 ok 318 - tile no_hsps.blastp hit 71 \#hsps 0 ok 319 - tile no_hsps.blastp hit 72 \#hsps 0 ok 320 - tile no_hsps.blastp hit 73 \#hsps 0 ok 321 - tile no_hsps.blastp hit 74 \#hsps 0 ok 322 - tile no_hsps.blastp hit 75 \#hsps 0 ok 323 - tile no_hsps.blastp hit 76 \#hsps 0 ok 324 - tile no_hsps.blastp hit 77 \#hsps 0 ok 325 - tile no_hsps.blastp hit 78 \#hsps 0 ok 326 - tile no_hsps.blastp hit 79 \#hsps 0 ok 327 - tile no_hsps.blastp hit 80 \#hsps 0 ok 328 - tile no_hsps.blastp hit 81 \#hsps 0 ok 329 - tile no_hsps.blastp hit 82 \#hsps 0 ok 330 - tile no_hsps.blastp hit 83 \#hsps 0 ok 331 - tile no_hsps.blastp hit 84 \#hsps 0 ok 332 - tile no_hsps.blastp hit 85 \#hsps 0 ok 333 - tile no_hsps.blastp hit 86 \#hsps 0 ok 334 - tile no_hsps.blastp hit 87 \#hsps 0 ok 335 - tile no_hsps.blastp hit 88 \#hsps 0 ok 336 - tile no_hsps.blastp hit 89 \#hsps 0 ok 337 - tile no_hsps.blastp hit 90 \#hsps 0 ok 338 - tile no_hsps.blastp hit 91 \#hsps 0 ok 339 - tile no_hsps.blastp hit 92 \#hsps 0 ok 340 - tile no_hsps.blastp hit 93 \#hsps 0 ok 341 - tile no_hsps.blastp hit 94 \#hsps 0 ok 342 - tile no_hsps.blastp hit 95 \#hsps 0 ok 343 - tile no_hsps.blastp hit 96 \#hsps 0 ok 344 - tile no_hsps.blastp hit 97 \#hsps 0 ok 345 - tile no_hsps.blastp hit 98 \#hsps 0 ok 346 - tile no_hsps.blastp hit 99 \#hsps 0 ok 347 - tile no_hsps.blastp hit 100 \#hsps 0 ok 348 - tile no_hsps.blastp hit 101 \#hsps 0 ok 349 - tile no_hsps.blastp hit 102 \#hsps 0 ok 350 - tile no_hsps.blastp hit 103 \#hsps 0 ok 351 - tile no_hsps.blastp hit 104 \#hsps 0 ok 352 - tile no_hsps.blastp hit 105 \#hsps 0 ok 353 - tile no_hsps.blastp hit 106 \#hsps 0 ok 354 - tile no_hsps.blastp hit 107 \#hsps 0 ok 355 - tile no_hsps.blastp hit 108 \#hsps 0 ok 356 - tile no_hsps.blastp hit 109 \#hsps 0 ok 357 - tile no_hsps.blastp hit 110 \#hsps 0 ok 358 - tile no_hsps.blastp hit 111 \#hsps 0 ok 359 - tile no_hsps.blastp hit 112 \#hsps 0 ok 360 - tile no_hsps.blastp hit 113 \#hsps 0 ok 361 - tile no_hsps.blastp hit 114 \#hsps 0 ok 362 - tile no_hsps.blastp hit 115 \#hsps 0 ok 363 - tile no_hsps.blastp hit 116 \#hsps 0 ok 364 - tile no_hsps.blastp hit 117 \#hsps 0 ok 365 - tile no_hsps.blastp hit 118 \#hsps 0 ok 366 - tile no_hsps.blastp hit 119 \#hsps 0 ok 367 - tile no_hsps.blastp hit 120 \#hsps 0 ok 368 - tile no_hsps.blastp hit 121 \#hsps 0 ok 369 - tile no_hsps.blastp hit 122 \#hsps 0 ok 370 - tile no_hsps.blastp hit 123 \#hsps 0 ok 371 - tile no_hsps.blastp hit 124 \#hsps 0 ok 372 - tile no_hsps.blastp hit 125 \#hsps 0 ok 373 - tile no_hsps.blastp hit 126 \#hsps 0 ok 374 - tile no_hsps.blastp hit 127 \#hsps 0 ok 375 - tile no_hsps.blastp hit 128 \#hsps 0 ok 376 - tile no_hsps.blastp hit 129 \#hsps 0 ok 377 - tile no_hsps.blastp hit 130 \#hsps 0 ok 378 - tile no_hsps.blastp hit 131 \#hsps 0 ok 379 - tile no_hsps.blastp hit 132 \#hsps 0 ok 380 - tile no_hsps.blastp hit 133 \#hsps 0 ok 381 - tile no_hsps.blastp hit 134 \#hsps 0 ok 382 - tile no_hsps.blastp hit 135 \#hsps 0 ok 383 - tile no_hsps.blastp hit 136 \#hsps 0 ok 384 - tile no_hsps.blastp hit 137 \#hsps 0 ok 385 - tile no_hsps.blastp hit 138 \#hsps 0 ok 386 - tile no_hsps.blastp hit 139 \#hsps 0 ok 387 - tile no_hsps.blastp hit 140 \#hsps 0 ok 388 - tile no_hsps.blastp hit 141 \#hsps 0 ok 389 - tile no_hsps.blastp hit 142 \#hsps 0 ok 390 - tile no_hsps.blastp hit 143 \#hsps 0 ok 391 - tile no_hsps.blastp hit 144 \#hsps 0 ok 392 - tile no_hsps.blastp hit 145 \#hsps 0 ok 393 - tile no_hsps.blastp hit 146 \#hsps 0 ok 394 - tile no_hsps.blastp hit 147 \#hsps 0 ok 395 - tile no_hsps.blastp hit 148 \#hsps 0 ok 396 - tile no_hsps.blastp hit 149 \#hsps 0 ok 397 - tile no_hsps.blastp hit 150 \#hsps 0 ok 398 - tile no_hsps.blastp hit 151 \#hsps 0 ok 399 - tile no_hsps.blastp hit 152 \#hsps 0 ok 400 - tile no_hsps.blastp hit 153 \#hsps 0 ok 401 - tile no_hsps.blastp hit 154 \#hsps 0 ok 402 - tile no_hsps.blastp hit 155 \#hsps 0 ok 403 - tile no_hsps.blastp hit 156 \#hsps 0 ok 404 - tile no_hsps.blastp hit 157 \#hsps 0 ok 405 - tile no_hsps.blastp hit 158 \#hsps 0 ok 406 - tile no_hsps.blastp hit 159 \#hsps 0 ok 407 - tile no_hsps.blastp hit 160 \#hsps 0 ok 408 - tile no_hsps.blastp hit 161 \#hsps 0 ok 409 - tile no_hsps.blastp hit 162 \#hsps 0 ok 410 - tile no_hsps.blastp hit 163 \#hsps 0 ok 411 - tile no_hsps.blastp hit 164 \#hsps 0 ok 412 - tile no_hsps.blastp hit 165 \#hsps 0 ok 413 - tile no_hsps.blastp hit 166 \#hsps 0 ok 414 - tile no_hsps.blastp hit 167 \#hsps 0 ok 415 - tile no_hsps.blastp hit 168 \#hsps 0 ok 416 - tile no_hsps.blastp hit 169 \#hsps 0 ok 417 - tile no_hsps.blastp hit 170 \#hsps 0 ok 418 - tile no_hsps.blastp hit 171 \#hsps 0 ok 419 - tile no_hsps.blastp hit 172 \#hsps 0 ok 420 - tile no_hsps.blastp hit 173 \#hsps 0 ok 421 - tile no_hsps.blastp hit 174 \#hsps 0 ok 422 - tile no_hsps.blastp hit 175 \#hsps 0 ok 423 - tile no_hsps.blastp hit 176 \#hsps 0 ok 424 - tile no_hsps.blastp hit 177 \#hsps 0 ok 425 - tile no_hsps.blastp hit 178 \#hsps 0 ok 426 - tile no_hsps.blastp hit 179 \#hsps 0 ok 427 - tile no_hsps.blastp hit 180 \#hsps 0 ok 428 - tile no_hsps.blastp hit 181 \#hsps 0 ok 429 - tile no_hsps.blastp hit 182 \#hsps 0 ok 430 - tile no_hsps.blastp hit 183 \#hsps 0 ok 431 - tile no_hsps.blastp hit 184 \#hsps 0 ok 432 - tile no_hsps.blastp hit 185 \#hsps 0 ok 433 - tile no_hsps.blastp hit 186 \#hsps 0 ok 434 - tile no_hsps.blastp hit 187 \#hsps 0 ok 435 - tile no_hsps.blastp hit 188 \#hsps 0 ok 436 - tile no_hsps.blastp hit 189 \#hsps 0 ok 437 - tile no_hsps.blastp hit 190 \#hsps 0 ok 438 - tile no_hsps.blastp hit 191 \#hsps 0 ok 439 - tile no_hsps.blastp hit 192 \#hsps 0 ok 440 - tile no_hsps.blastp hit 193 \#hsps 0 ok 441 - tile no_hsps.blastp hit 194 \#hsps 0 ok 442 - tile no_hsps.blastp hit 195 \#hsps 0 ok 443 - tile no_hsps.blastp hit 196 \#hsps 0 ok 444 - tile no_hsps.blastp hit 197 \#hsps 0 ok 445 - tile no_hsps.blastp hit 198 \#hsps 0 ok 446 - tile no_hsps.blastp hit 199 \#hsps 0 ok 447 - tile no_hsps.blastp hit 200 \#hsps 0 ok 448 - tile no_hsps.blastp hit 201 \#hsps 0 ok 449 - tile no_hsps.blastp hit 202 \#hsps 0 ok 450 - tile no_hsps.blastp hit 203 \#hsps 0 ok 451 - tile no_hsps.blastp hit 204 \#hsps 0 ok 452 - tile no_hsps.blastp hit 205 \#hsps 0 ok 453 - tile no_hsps.blastp hit 206 \#hsps 0 ok 454 - tile no_hsps.blastp hit 207 \#hsps 0 ok 455 - tile no_hsps.blastp hit 208 \#hsps 0 ok 456 - tile no_hsps.blastp hit 209 \#hsps 0 ok 457 - tile no_hsps.blastp hit 210 \#hsps 0 ok 458 - tile no_hsps.blastp hit 211 \#hsps 0 ok 459 - tile no_hsps.blastp hit 212 \#hsps 0 ok 460 - tile no_hsps.blastp hit 213 \#hsps 0 ok 461 - tile no_hsps.blastp hit 214 \#hsps 0 ok 462 - tile no_hsps.blastp hit 215 \#hsps 0 ok 463 - tile no_hsps.blastp hit 216 \#hsps 0 ok 464 - tile no_hsps.blastp hit 217 \#hsps 0 ok 465 - tile no_hsps.blastp hit 218 \#hsps 0 ok 466 - tile no_hsps.blastp hit 219 \#hsps 0 ok 467 - tile no_hsps.blastp hit 220 \#hsps 0 ok 468 - tile no_hsps.blastp hit 221 \#hsps 0 ok 469 - tile no_hsps.blastp hit 222 \#hsps 0 ok 470 - tile no_hsps.blastp hit 223 \#hsps 0 ok 471 - tile no_hsps.blastp hit 224 \#hsps 0 ok 472 - tile no_hsps.blastp hit 225 \#hsps 0 ok 473 - tile no_hsps.blastp hit 226 \#hsps 0 ok 474 - tile no_hsps.blastp hit 227 \#hsps 0 ok 475 - tile no_hsps.blastp hit 228 \#hsps 0 ok 476 - tile no_hsps.blastp hit 229 \#hsps 0 ok 477 - tile no_hsps.blastp hit 230 \#hsps 0 ok 478 - tile no_hsps.blastp hit 231 \#hsps 0 ok 479 - tile no_hsps.blastp hit 232 \#hsps 0 ok 480 - tile no_hsps.blastp hit 233 \#hsps 0 ok 481 - tile no_hsps.blastp hit 234 \#hsps 0 ok 482 - tile no_hsps.blastp hit 235 \#hsps 0 ok 483 - tile no_hsps.blastp hit 236 \#hsps 0 ok 484 - tile no_hsps.blastp hit 237 \#hsps 0 ok 485 - tile no_hsps.blastp hit 238 \#hsps 0 ok 486 - tile no_hsps.blastp hit 239 \#hsps 0 ok 487 - tile no_hsps.blastp hit 240 \#hsps 0 ok 488 - tile no_hsps.blastp hit 241 \#hsps 0 ok 489 - tile no_hsps.blastp hit 242 \#hsps 0 ok 490 - tile no_hsps.blastp hit 243 \#hsps 0 ok 491 - tile no_hsps.blastp hit 244 \#hsps 0 ok 492 - tile no_hsps.blastp hit 245 \#hsps 0 ok 493 - tile no_hsps.blastp hit 246 \#hsps 0 ok 494 - tile no_hsps.blastp hit 247 \#hsps 0 ok 495 - tile no_hsps.blastp hit 248 \#hsps 0 ok 496 - tile no_hsps.blastp hit 249 \#hsps 0 ok 497 - tile no_hsps.blastp hit 250 \#hsps 0 ok 498 - tile no_hsps.blastp hit 251 \#hsps 0 ok 499 - tile no_hsps.blastp hit 252 \#hsps 0 ok 500 - tile no_hsps.blastp hit 253 \#hsps 0 ok 501 - tile no_hsps.blastp hit 254 \#hsps 0 ok 502 - tile no_hsps.blastp hit 255 \#hsps 0 ok 503 - tile no_hsps.blastp hit 256 \#hsps 0 ok 504 - tile no_hsps.blastp hit 257 \#hsps 0 ok 505 - tile no_hsps.blastp hit 258 \#hsps 0 ok 506 - tile no_hsps.blastp hit 259 \#hsps 0 ok 507 - tile no_hsps.blastp hit 260 \#hsps 0 ok 508 - tile no_hsps.blastp hit 261 \#hsps 0 ok 509 - tile no_hsps.blastp hit 262 \#hsps 0 ok 510 - tile no_hsps.blastp hit 263 \#hsps 0 ok 511 - tile no_hsps.blastp hit 264 \#hsps 0 ok 512 - tile no_hsps.blastp hit 265 \#hsps 0 ok 513 - tile no_hsps.blastp hit 266 \#hsps 0 ok 514 - tile no_hsps.blastp hit 267 \#hsps 0 ok 515 - tile no_hsps.blastp hit 268 \#hsps 0 ok 516 - tile no_hsps.blastp hit 269 \#hsps 0 ok 517 - tile no_hsps.blastp hit 270 \#hsps 0 ok 518 - tile no_hsps.blastp hit 271 \#hsps 0 ok 519 - tile no_hsps.blastp hit 272 \#hsps 0 ok 520 - tile no_hsps.blastp hit 273 \#hsps 0 ok 521 - tile no_hsps.blastp hit 274 \#hsps 0 ok 522 - tile no_hsps.blastp hit 275 \#hsps 0 ok 523 - tile no_hsps.blastp hit 276 \#hsps 0 ok 524 - tile no_hsps.blastp hit 277 \#hsps 0 ok 525 - tile no_hsps.blastp hit 278 \#hsps 0 ok 526 - tile no_hsps.blastp hit 279 \#hsps 0 ok 527 - tile no_hsps.blastp hit 280 \#hsps 0 ok 528 - tile no_hsps.blastp hit 281 \#hsps 0 ok 529 - tile no_hsps.blastp hit 282 \#hsps 0 ok 530 - tile no_hsps.blastp hit 283 \#hsps 0 ok 531 - tile no_hsps.blastp hit 284 \#hsps 0 ok 532 - tile no_hsps.blastp hit 285 \#hsps 0 ok 533 - tile no_hsps.blastp hit 286 \#hsps 0 ok 534 - tile no_hsps.blastp hit 287 \#hsps 0 ok 535 - tile no_hsps.blastp hit 288 \#hsps 0 ok 536 - tile no_hsps.blastp hit 289 \#hsps 0 ok 537 - tile no_hsps.blastp hit 290 \#hsps 0 ok 538 - tile no_hsps.blastp hit 291 \#hsps 0 ok 539 - tile no_hsps.blastp hit 292 \#hsps 0 ok 540 - tile no_hsps.blastp hit 293 \#hsps 0 ok 541 - tile no_hsps.blastp hit 294 \#hsps 0 ok 542 - tile no_hsps.blastp hit 295 \#hsps 0 ok 543 - tile no_hsps.blastp hit 296 \#hsps 0 ok 544 - tile no_hsps.blastp hit 297 \#hsps 0 ok 545 - tile no_hsps.blastp hit 298 \#hsps 0 ok 546 - tile no_hsps.blastp hit 299 \#hsps 0 ok 547 - tile no_hsps.blastp hit 300 \#hsps 0 ok 548 - tile no_hsps.blastp hit 301 \#hsps 0 ok 549 - tile no_hsps.blastp hit 302 \#hsps 0 ok 550 - tile no_hsps.blastp hit 303 \#hsps 0 ok 551 - tile no_hsps.blastp hit 304 \#hsps 0 ok 552 - tile no_hsps.blastp hit 305 \#hsps 0 ok 553 - tile no_hsps.blastp hit 306 \#hsps 0 ok 554 - tile no_hsps.blastp hit 307 \#hsps 0 ok 555 - tile no_hsps.blastp hit 308 \#hsps 0 ok 556 - tile no_hsps.blastp hit 309 \#hsps 0 ok 557 - tile no_hsps.blastp hit 310 \#hsps 0 ok 558 - tile no_hsps.blastp hit 311 \#hsps 0 ok 559 - tile no_hsps.blastp hit 312 \#hsps 0 ok 560 - tile no_hsps.blastp hit 313 \#hsps 0 ok 561 - tile no_hsps.blastp hit 314 \#hsps 0 ok 562 - tile no_hsps.blastp hit 315 \#hsps 0 ok 563 - tile no_hsps.blastp hit 316 \#hsps 0 ok 564 - tile no_hsps.blastp hit 317 \#hsps 0 ok 565 - tile no_hsps.blastp hit 318 \#hsps 0 ok 566 - tile no_hsps.blastp hit 319 \#hsps 0 ok 567 - tile no_hsps.blastp hit 320 \#hsps 0 ok 568 - tile no_hsps.blastp hit 321 \#hsps 0 ok 569 - tile no_hsps.blastp hit 322 \#hsps 0 ok 570 - tile no_hsps.blastp hit 323 \#hsps 0 ok 571 - tile no_hsps.blastp hit 324 \#hsps 0 ok 572 - tile no_hsps.blastp hit 325 \#hsps 0 ok 573 - tile no_hsps.blastp hit 326 \#hsps 0 ok 574 - tile no_hsps.blastp hit 327 \#hsps 0 ok 575 - tile no_hsps.blastp hit 328 \#hsps 0 ok 576 - tile no_hsps.blastp hit 329 \#hsps 0 ok 577 - tile no_hsps.blastp hit 330 \#hsps 0 ok 578 - tile no_hsps.blastp hit 331 \#hsps 0 ok 579 - tile no_hsps.blastp hit 332 \#hsps 0 ok 580 - tile no_hsps.blastp hit 333 \#hsps 0 ok 581 - tile no_hsps.blastp hit 334 \#hsps 0 ok 582 - tile no_hsps.blastp hit 335 \#hsps 0 ok 583 - tile no_hsps.blastp hit 336 \#hsps 0 ok 584 - tile no_hsps.blastp hit 337 \#hsps 0 ok 585 - tile no_hsps.blastp hit 338 \#hsps 0 ok 586 - tile no_hsps.blastp hit 339 \#hsps 0 ok 587 - tile no_hsps.blastp hit 340 \#hsps 0 ok 588 - tile no_hsps.blastp hit 341 \#hsps 0 ok 589 - tile no_hsps.blastp hit 342 \#hsps 0 ok 590 - tile no_hsps.blastp hit 343 \#hsps 0 ok 591 - tile no_hsps.blastp hit 344 \#hsps 0 ok 592 - tile no_hsps.blastp hit 345 \#hsps 0 ok 593 - tile no_hsps.blastp hit 346 \#hsps 0 ok 594 - tile no_hsps.blastp hit 347 \#hsps 0 ok 595 - tile no_hsps.blastp hit 348 \#hsps 0 ok 596 - tile no_hsps.blastp hit 349 \#hsps 0 ok 597 - tile no_hsps.blastp hit 350 \#hsps 0 ok 598 - tile no_hsps.blastp hit 351 \#hsps 0 ok 599 - tile no_hsps.blastp hit 352 \#hsps 0 ok 600 - tile no_hsps.blastp hit 353 \#hsps 0 ok 601 - tile no_hsps.blastp hit 354 \#hsps 0 ok 602 - tile no_hsps.blastp hit 355 \#hsps 0 ok 603 - tile no_hsps.blastp hit 356 \#hsps 0 ok 604 - tile no_hsps.blastp hit 357 \#hsps 0 ok 605 - tile no_hsps.blastp hit 358 \#hsps 0 ok 606 - tile no_hsps.blastp hit 359 \#hsps 0 ok 607 - tile no_hsps.blastp hit 360 \#hsps 0 ok 608 - tile no_hsps.blastp hit 361 \#hsps 0 ok 609 - tile no_hsps.blastp hit 362 \#hsps 0 ok 610 - tile no_hsps.blastp hit 363 \#hsps 0 ok 611 - tile no_hsps.blastp hit 364 \#hsps 0 ok 612 - tile no_hsps.blastp hit 365 \#hsps 0 ok 613 - tile no_hsps.blastp hit 366 \#hsps 0 ok 614 - tile no_hsps.blastp hit 367 \#hsps 0 ok 615 - tile no_hsps.blastp hit 368 \#hsps 0 ok 616 - tile no_hsps.blastp hit 369 \#hsps 0 ok 617 - tile no_hsps.blastp hit 370 \#hsps 0 ok 618 - tile no_hsps.blastp hit 371 \#hsps 0 ok 619 - tile no_hsps.blastp hit 372 \#hsps 0 ok 620 - tile no_hsps.blastp hit 373 \#hsps 0 ok 621 - tile no_hsps.blastp hit 374 \#hsps 0 ok 622 - tile no_hsps.blastp hit 375 \#hsps 0 ok 623 - tile no_hsps.blastp hit 376 \#hsps 0 ok 624 - tile no_hsps.blastp hit 377 \#hsps 0 ok 625 - tile no_hsps.blastp hit 378 \#hsps 0 ok 626 - tile no_hsps.blastp hit 379 \#hsps 0 ok 627 - tile no_hsps.blastp hit 380 \#hsps 0 ok 628 - tile no_hsps.blastp hit 381 \#hsps 0 ok 629 - tile no_hsps.blastp hit 382 \#hsps 0 ok 630 - tile no_hsps.blastp hit 383 \#hsps 0 ok 631 - tile no_hsps.blastp hit 384 \#hsps 0 ok 632 - tile no_hsps.blastp hit 385 \#hsps 0 ok 633 - tile no_hsps.blastp hit 386 \#hsps 0 ok 634 - tile no_hsps.blastp hit 387 \#hsps 0 ok 635 - tile no_hsps.blastp hit 388 \#hsps 0 ok 636 - tile no_hsps.blastp hit 389 \#hsps 0 ok 637 - tile no_hsps.blastp hit 390 \#hsps 0 ok 638 - tile no_hsps.blastp hit 391 \#hsps 0 ok 639 - tile no_hsps.blastp hit 392 \#hsps 0 ok 640 - tile no_hsps.blastp hit 393 \#hsps 0 ok 641 - tile no_hsps.blastp hit 394 \#hsps 0 ok 642 - tile no_hsps.blastp hit 395 \#hsps 0 ok 643 - tile no_hsps.blastp hit 396 \#hsps 0 ok 644 - tile no_hsps.blastp hit 397 \#hsps 0 ok 645 - tile no_hsps.blastp hit 398 \#hsps 0 ok 646 - tile no_hsps.blastp hit 399 \#hsps 0 ok 647 - tile no_hsps.blastp hit 400 \#hsps 0 ok 648 - tile no_hsps.blastp hit 401 \#hsps 0 ok 649 - tile no_hsps.blastp hit 402 \#hsps 0 ok 650 - tile no_hsps.blastp hit 403 \#hsps 0 ok 651 - tile no_hsps.blastp hit 404 \#hsps 0 ok 652 - tile no_hsps.blastp hit 405 \#hsps 0 ok 653 - tile no_hsps.blastp hit 406 \#hsps 0 ok 654 - tile no_hsps.blastp hit 407 \#hsps 0 ok 655 - tile no_hsps.blastp hit 408 \#hsps 0 ok 656 - tile no_hsps.blastp hit 409 \#hsps 0 ok 657 - tile no_hsps.blastp hit 410 \#hsps 0 ok 658 - tile no_hsps.blastp hit 411 \#hsps 0 ok 659 - tile no_hsps.blastp hit 412 \#hsps 0 ok 660 - tile no_hsps.blastp hit 413 \#hsps 0 ok 661 - tile no_hsps.blastp hit 414 \#hsps 0 ok 662 - tile no_hsps.blastp hit 415 \#hsps 0 ok 663 - catalase-webblast.BLASTP ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1 ok 665 - q id: est (1.00000) = fast (1.00000) ok 666 - q cn: est (1.00000) = fast (1.00000) ok 667 - h id: est (1.00000) = fast (1.00000) ok 668 - h cn: est (1.00000) = fast (1.00000) ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1 ok 670 - q id: est (0.80973) = fast (0.80973) ok 671 - q cn: est (0.89006) = fast (0.89006) ok 672 - h id: est (0.82543) = fast (0.82543) ok 673 - h cn: est (0.90733) = fast (0.90733) ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1 ok 675 - q id: est (0.71670) = fast (0.71670) ok 676 - q cn: est (0.84144) = fast (0.84144) ok 677 - h id: est (0.72747) = fast (0.72747) ok 678 - h cn: est (0.85408) = fast (0.85408) ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1 ok 680 - q id: est (0.58910) = fast (0.58910) ok 681 - q cn: est (0.70860) = fast (0.70860) ok 682 - h id: est (0.65654) = fast (0.65654) ok 683 - h cn: est (0.78972) = fast (0.78972) ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1 ok 685 - q id: est (0.49245) = fast (0.49245) ok 686 - q cn: est (0.65257) = fast (0.65257) ok 687 - h id: est (0.49544) = fast (0.49544) ok 688 - h cn: est (0.65653) = fast (0.65653) ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1 ok 690 - q id: est (0.44366) = fast (0.44366) ok 691 - q cn: est (0.58920) = fast (0.58920) ok 692 - h id: est (0.44787) = fast (0.44787) ok 693 - h cn: est (0.59479) = fast (0.59479) ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1 ok 695 - q id: est (0.42564) = fast (0.42564) ok 696 - q cn: est (0.61282) = fast (0.61282) ok 697 - h id: est (0.43229) = fast (0.43229) ok 698 - h cn: est (0.62240) = fast (0.62240) ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1 ok 700 - q id: est (0.48358) = fast (0.48358) ok 701 - q cn: est (0.63881) = fast (0.63881) ok 702 - h id: est (0.48943) = fast (0.48943) ok 703 - h cn: est (0.64653) = fast (0.64653) ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1 ok 705 - q id: est (0.42308) = fast (0.42308) ok 706 - q cn: est (0.61282) = fast (0.61282) ok 707 - h id: est (0.42969) = fast (0.42969) ok 708 - h cn: est (0.62240) = fast (0.62240) ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1 ok 710 - q id: est (0.39675) = fast (0.39675) ok 711 - q cn: est (0.58933) = fast (0.58933) ok 712 - h id: est (0.39767) = fast (0.39767) ok 713 - h cn: est (0.59070) = fast (0.59070) ok 714 - dcr1_sp.WUBLASTP ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1 ok 716 - q id: est (1.00000) = fast (1.00000) ok 717 - q cn: est (1.00000) = fast (1.00000) ok 718 - h id: est (1.00000) = fast (1.00000) ok 719 - h cn: est (1.00000) = fast (1.00000) ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4 ok 721 - q id: exact (0.36876) ~ est (0.36973) ok 722 - q id: exact (0.36876) <= max (0.37070) ok 723 - q cn: exact (0.55022) ~ est (0.55041) ok 724 - q cn: exact (0.55022) <= max (0.55105) ok 725 - h id: exact (0.35111) ~ est (0.35111) ok 726 - h id: exact (0.35111) <= max (0.35111) ok 727 - h cn: exact (0.52305) ~ est (0.52305) ok 728 - h cn: exact (0.52305) <= max (0.52305) ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1 ok 730 - q id: est (0.38685) = fast (0.38685) ok 731 - q cn: est (0.55397) = fast (0.55397) ok 732 - h id: est (0.37613) = fast (0.37613) ok 733 - h cn: est (0.53863) = fast (0.53863) ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1 ok 735 - q id: est (0.38247) = fast (0.38247) ok 736 - q cn: est (0.55068) = fast (0.55068) ok 737 - h id: est (0.37306) = fast (0.37306) ok 738 - h cn: est (0.53715) = fast (0.53715) ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5 ok 740 - q id: exact (0.35010) ~ est (0.35010) ok 741 - q id: exact (0.35010) <= max (0.35010) ok 742 - q cn: exact (0.53183) ~ est (0.53183) ok 743 - q cn: exact (0.53183) <= max (0.53183) ok 744 - h id: exact (0.35082) ~ est (0.35082) ok 745 - h id: exact (0.35082) <= max (0.35082) ok 746 - h cn: exact (0.53292) ~ est (0.53292) ok 747 - h cn: exact (0.53292) <= max (0.53292) ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8 ok 749 - q id: exact (0.30547) ~ est (0.30659) ok 750 - q id: exact (0.30547) <= max (0.30623) ok 751 - q cn: exact (0.50076) ~ est (0.50205) ok 752 - q cn: exact (0.50076) <= max (0.50076) ok 753 - h id: exact (0.31390) ~ est (0.31179) ok 754 - h id: exact (0.31390) <= max (0.31795) ok 755 - h cn: exact (0.50531) ~ est (0.50557) ok 756 - h cn: exact (0.50531) <= max (0.51091) ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7 ok 758 - q id: exact (0.30136) ~ est (0.30184) ok 759 - q id: exact (0.30136) <= max (0.30498) ok 760 - q cn: exact (0.48688) ~ est (0.48742) ok 761 - q cn: exact (0.48688) <= max (0.49140) ok 762 - h id: exact (0.30944) ~ est (0.31034) ok 763 - h id: exact (0.30944) <= max (0.30988) ok 764 - h cn: exact (0.50178) ~ est (0.50277) ok 765 - h cn: exact (0.50178) <= max (0.50223) ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10 ok 767 - q id: exact (0.28918) ~ est (0.28961) ok 768 - q id: exact (0.28918) <= max (0.28955) ok 769 - q cn: exact (0.46418) ~ est (0.46247) ok 770 - q cn: exact (0.46418) <= max (0.46866) ok 771 - h id: exact (0.30166) ~ est (0.30299) ok 772 - h id: exact (0.30166) <= max (0.30800) ok 773 - h cn: exact (0.48179) ~ est (0.48439) ok 774 - h cn: exact (0.48179) <= max (0.48535) ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8 ok 776 - q id: exact (0.30289) ~ est (0.30238) ok 777 - q id: exact (0.30289) <= max (0.30651) ok 778 - q cn: exact (0.49955) ~ est (0.49787) ok 779 - q cn: exact (0.49955) <= max (0.50362) ok 780 - h id: exact (0.31395) ~ est (0.31347) ok 781 - h id: exact (0.31395) <= max (0.31721) ok 782 - h cn: exact (0.51535) ~ est (0.51578) ok 783 - h cn: exact (0.51535) <= max (0.51814) ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5 ok 785 - q id: exact (0.29334) ~ est (0.29534) ok 786 - q id: exact (0.29334) <= max (0.29810) ok 787 - q cn: exact (0.46617) ~ est (0.46719) ok 788 - q cn: exact (0.46617) <= max (0.47040) ok 789 - h id: exact (0.31176) ~ est (0.31176) ok 790 - h id: exact (0.31176) <= max (0.31176) ok 791 - h cn: exact (0.49299) ~ est (0.49299) ok 792 - h cn: exact (0.49299) <= max (0.49299) ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7 ok 794 - q id: exact (0.30456) ~ est (0.30514) ok 795 - q id: exact (0.30456) <= max (0.30650) ok 796 - q cn: exact (0.48739) ~ est (0.48879) ok 797 - q cn: exact (0.48739) <= max (0.49370) ok 798 - h id: exact (0.32062) ~ est (0.31987) ok 799 - h id: exact (0.32062) <= max (0.32932) ok 800 - h cn: exact (0.51071) ~ est (0.51306) ok 801 - h cn: exact (0.51071) <= max (0.52410) ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8 ok 803 - q id: exact (0.29615) ~ est (0.29879) ok 804 - q id: exact (0.29615) <= max (0.30009) ok 805 - q cn: exact (0.47419) ~ est (0.47394) ok 806 - q cn: exact (0.47419) <= max (0.48119) ok 807 - h id: exact (0.31611) ~ est (0.31482) ok 808 - h id: exact (0.31611) <= max (0.32227) ok 809 - h cn: exact (0.49779) ~ est (0.49788) ok 810 - h cn: exact (0.49779) <= max (0.50616) ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8 ok 812 - q id: exact (0.30390) ~ est (0.30440) ok 813 - q id: exact (0.30390) <= max (0.30701) ok 814 - q cn: exact (0.45874) ~ est (0.45993) ok 815 - q cn: exact (0.45874) <= max (0.45963) ok 816 - h id: exact (0.32282) ~ est (0.32324) ok 817 - h id: exact (0.32282) <= max (0.32560) ok 818 - h cn: exact (0.48052) ~ est (0.48136) ok 819 - h cn: exact (0.48052) <= max (0.48330) ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6 ok 821 - q id: exact (0.29769) ~ est (0.29851) ok 822 - q id: exact (0.29769) <= max (0.29769) ok 823 - q cn: exact (0.48480) ~ est (0.48628) ok 824 - q cn: exact (0.48480) <= max (0.48637) ok 825 - h id: exact (0.30704) ~ est (0.30810) ok 826 - h id: exact (0.30704) <= max (0.30917) ok 827 - h cn: exact (0.50107) ~ est (0.50292) ok 828 - h cn: exact (0.50107) <= max (0.50320) ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6 ok 830 - q id: exact (0.27854) ~ est (0.27854) ok 831 - q id: exact (0.27854) <= max (0.27854) ok 832 - q cn: exact (0.48174) ~ est (0.48174) ok 833 - q cn: exact (0.48174) <= max (0.48174) ok 834 - h id: exact (0.28514) ~ est (0.28623) ok 835 - h id: exact (0.28514) <= max (0.28594) ok 836 - h cn: exact (0.49197) ~ est (0.49154) ok 837 - h cn: exact (0.49197) <= max (0.49237) ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8 ok 839 - q id: exact (0.30362) ~ est (0.30824) ok 840 - q id: exact (0.30362) <= max (0.30852) ok 841 - q cn: exact (0.47111) ~ est (0.47587) ok 842 - q cn: exact (0.47111) <= max (0.47405) ok 843 - h id: exact (0.32347) ~ est (0.32392) ok 844 - h id: exact (0.32347) <= max (0.32643) ok 845 - h cn: exact (0.49310) ~ est (0.49360) ok 846 - h cn: exact (0.49310) <= max (0.49606) ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4 ok 848 - q id: exact (0.29174) ~ est (0.29174) ok 849 - q id: exact (0.29174) <= max (0.29174) ok 850 - q cn: exact (0.46230) ~ est (0.46230) ok 851 - q cn: exact (0.46230) <= max (0.46230) ok 852 - h id: exact (0.30204) ~ est (0.30204) ok 853 - h id: exact (0.30204) <= max (0.30204) ok 854 - h cn: exact (0.47862) ~ est (0.47862) ok 855 - h cn: exact (0.47862) <= max (0.47862) ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6 ok 857 - q id: exact (0.29064) ~ est (0.29089) ok 858 - q id: exact (0.29064) <= max (0.29115) ok 859 - q cn: exact (0.48765) ~ est (0.48670) ok 860 - q cn: exact (0.48765) <= max (0.48868) ok 861 - h id: exact (0.29848) ~ est (0.29887) ok 862 - h id: exact (0.29848) <= max (0.29902) ok 863 - h cn: exact (0.50108) ~ est (0.50116) ok 864 - h cn: exact (0.50108) <= max (0.50163) ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5 ok 866 - q id: exact (0.29510) ~ est (0.29505) ok 867 - q id: exact (0.29510) <= max (0.29510) ok 868 - q cn: exact (0.48982) ~ est (0.49039) ok 869 - q cn: exact (0.48982) <= max (0.49029) ok 870 - h id: exact (0.30019) ~ est (0.30019) ok 871 - h id: exact (0.30019) <= max (0.30019) ok 872 - h cn: exact (0.49906) ~ est (0.49906) ok 873 - h cn: exact (0.49906) <= max (0.49906) ok 874 - 503384.MEGABLAST.2 ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5 ok 876 - q id: exact (0.91435) ~ est (0.91435) ok 877 - q id: exact (0.91435) <= max (0.91435) ok 878 - q cn: exact (0.91435) ~ est (0.91435) ok 879 - q cn: exact (0.91435) <= max (0.91435) ok 880 - h id: exact (0.91157) ~ est (0.91157) ok 881 - h id: exact (0.91157) <= max (0.91157) ok 882 - h cn: exact (0.91157) ~ est (0.91157) ok 883 - h cn: exact (0.91157) <= max (0.91157) ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9 ok 885 - q id: exact (0.92895) ~ est (0.92895) ok 886 - q id: exact (0.92895) <= max (0.92895) ok 887 - q cn: exact (0.92895) ~ est (0.92895) ok 888 - q cn: exact (0.92895) <= max (0.92895) ok 889 - h id: exact (0.92854) ~ est (0.92854) ok 890 - h id: exact (0.92854) <= max (0.92854) ok 891 - h cn: exact (0.92854) ~ est (0.92854) ok 892 - h cn: exact (0.92854) <= max (0.92854) ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3 ok 894 - q id: exact (0.93516) ~ est (0.93516) ok 895 - q id: exact (0.93516) <= max (0.93516) ok 896 - q cn: exact (0.93516) ~ est (0.93516) ok 897 - q cn: exact (0.93516) <= max (0.93516) ok 898 - h id: exact (0.93651) ~ est (0.93651) ok 899 - h id: exact (0.93651) <= max (0.93651) ok 900 - h cn: exact (0.93651) ~ est (0.93651) ok 901 - h cn: exact (0.93651) <= max (0.93651) ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3 ok 903 - q id: exact (0.93064) ~ est (0.93064) ok 904 - q id: exact (0.93064) <= max (0.93064) ok 905 - q cn: exact (0.93064) ~ est (0.93064) ok 906 - q cn: exact (0.93064) <= max (0.93064) ok 907 - h id: exact (0.92885) ~ est (0.92885) ok 908 - h id: exact (0.92885) <= max (0.92885) ok 909 - h cn: exact (0.92885) ~ est (0.92885) ok 910 - h cn: exact (0.92885) <= max (0.92885) ok 911 - bl2seq.blastx.out ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6 ok 913 - q id: est (0.71429) = fast (0.71429) ok 914 - q cn: est (1.00000) = fast (1.00000) ok 915 - q id: exact (0.70536) ~ est (0.70495) ok 916 - q id: exact (0.70536) <= max (0.94286) ok 917 - q cn: exact (0.78810) ~ est (0.78803) ok 918 - q cn: exact (0.78810) <= max (0.96429) ok 919 - q id: est (0.35714) = fast (0.35714) ok 920 - q cn: est (0.57143) = fast (0.57143) ok 921 - h id: exact (0.61923) ~ est (0.61955) ok 922 - h id: exact (0.61923) <= max (0.64231) ok 923 - h cn: exact (0.73077) ~ est (0.73077) ok 924 - h cn: exact (0.73077) <= max (0.75000) ok 925 - dnaEbsub_ecoli.wublastx ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1 ok 927 - q id: est (0.36386) = fast (0.36386) ok 928 - q cn: est (0.53735) = fast (0.53735) ok 929 - h id: est (0.36562) = fast (0.36562) ok 930 - h cn: est (0.53995) = fast (0.53995) ok 931 - tblastn.out ok 932 - tile tblastn.out hit 1 \#hsps 2 ok 933 - q id: exact (0.31250) ~ est (0.33325) ok 934 - q id: exact (0.31250) <= max (0.33333) ok 935 - q cn: exact (0.44792) ~ est (0.47055) ok 936 - q cn: exact (0.44792) <= max (0.45833) ok 937 - h id: exact (0.33333) ~ est (0.33333) ok 938 - h id: exact (0.33333) <= max (0.33333) ok 939 - h cn: exact (0.47059) ~ est (0.47059) ok 940 - h cn: exact (0.47059) <= max (0.47059) ok 941 - tile tblastn.out hit 2 \#hsps 2 ok 942 - q id: exact (0.68750) ~ est (0.68750) ok 943 - q id: exact (0.68750) <= max (0.68750) ok 944 - q cn: exact (0.81250) ~ est (0.81250) ok 945 - q cn: exact (0.81250) <= max (0.81250) ok 946 - h id: est (0.66667) = fast (0.66667) ok 947 - h cn: est (0.77778) = fast (0.77778) ok 948 - h id: est (0.71429) = fast (0.71429) ok 949 - h cn: est (0.85714) = fast (0.85714) ok 950 - dnaEbsub_ecoli.wutblastn ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1 ok 952 - q id: est (0.36386) = fast (0.36386) ok 953 - q cn: est (0.53735) = fast (0.53735) ok 954 - h id: est (0.36562) = fast (0.36562) ok 955 - h cn: est (0.53995) = fast (0.53995) ok 956 - HUMBETGLOA.tblastx ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1 ok 958 - q id: est (0.42308) = fast (0.42308) ok 959 - q cn: est (0.61538) = fast (0.61538) ok 960 - h id: est (0.42308) = fast (0.42308) ok 961 - h cn: est (0.61538) = fast (0.61538) ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1 ok 963 - q id: est (0.47059) = fast (0.47059) ok 964 - q cn: est (0.76471) = fast (0.76471) ok 965 - h id: est (0.47059) = fast (0.47059) ok 966 - h cn: est (0.76471) = fast (0.76471) ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1 ok 968 - q id: est (0.36000) = fast (0.36000) ok 969 - q cn: est (0.56000) = fast (0.56000) ok 970 - h id: est (0.36000) = fast (0.36000) ok 971 - h cn: est (0.56000) = fast (0.56000) ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1 ok 973 - q id: est (0.29268) = fast (0.29268) ok 974 - q cn: est (0.58537) = fast (0.58537) ok 975 - h id: est (0.29268) = fast (0.29268) ok 976 - h cn: est (0.58537) = fast (0.58537) ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1 ok 978 - q id: est (0.38889) = fast (0.38889) ok 979 - q cn: est (0.55556) = fast (0.55556) ok 980 - h id: est (0.38889) = fast (0.38889) ok 981 - h cn: est (0.55556) = fast (0.55556) ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1 ok 983 - q id: est (0.43590) = fast (0.43590) ok 984 - q cn: est (0.51282) = fast (0.51282) ok 985 - h id: est (0.43590) = fast (0.43590) ok 986 - h cn: est (0.51282) = fast (0.51282) ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1 ok 988 - q id: est (0.35714) = fast (0.35714) ok 989 - q cn: est (0.42857) = fast (0.42857) ok 990 - h id: est (0.35714) = fast (0.35714) ok 991 - h cn: est (0.42857) = fast (0.42857) ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1 ok 993 - q id: est (0.33333) = fast (0.33333) ok 994 - q cn: est (0.66667) = fast (0.66667) ok 995 - h id: est (0.33333) = fast (0.33333) ok 996 - h cn: est (0.66667) = fast (0.66667) ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2 ok 998 - q id: exact (0.40541) ~ est (0.40541) ok 999 - q id: exact (0.40541) <= max (0.40541) ok 1000 - q cn: exact (0.56757) ~ est (0.56757) ok 1001 - q cn: exact (0.56757) <= max (0.56757) ok 1002 - h id: est (0.36364) = fast (0.36364) ok 1003 - h cn: est (0.63636) = fast (0.63636) ok 1004 - h id: est (0.42308) = fast (0.42308) ok 1005 - h cn: est (0.53846) = fast (0.53846) ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1 ok 1007 - q id: est (0.29167) = fast (0.29167) ok 1008 - q cn: est (0.39583) = fast (0.39583) ok 1009 - h id: est (0.29167) = fast (0.29167) ok 1010 - h cn: est (0.39583) = fast (0.39583) ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1 ok 1012 - q id: est (0.60000) = fast (0.60000) ok 1013 - q cn: est (0.65000) = fast (0.65000) ok 1014 - h id: est (0.60000) = fast (0.60000) ok 1015 - h cn: est (0.65000) = fast (0.65000) ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1 ok 1017 - q id: est (0.50000) = fast (0.50000) ok 1018 - q cn: est (0.68182) = fast (0.68182) ok 1019 - h id: est (0.50000) = fast (0.50000) ok 1020 - h cn: est (0.68182) = fast (0.68182) ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1 ok 1022 - q id: est (0.29630) = fast (0.29630) ok 1023 - q cn: est (0.48148) = fast (0.48148) ok 1024 - h id: est (0.29630) = fast (0.29630) ok 1025 - h cn: est (0.48148) = fast (0.48148) ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1 ok 1027 - q id: est (0.47826) = fast (0.47826) ok 1028 - q cn: est (0.52174) = fast (0.52174) ok 1029 - h id: est (0.47826) = fast (0.47826) ok 1030 - h cn: est (0.52174) = fast (0.52174) ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1 ok 1032 - q id: est (0.47368) = fast (0.47368) ok 1033 - q cn: est (0.63158) = fast (0.63158) ok 1034 - h id: est (0.47368) = fast (0.47368) ok 1035 - h cn: est (0.63158) = fast (0.63158) ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1 ok 1037 - q id: est (0.44444) = fast (0.44444) ok 1038 - q cn: est (0.55556) = fast (0.55556) ok 1039 - h id: est (0.44444) = fast (0.44444) ok 1040 - h cn: est (0.55556) = fast (0.55556) ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1 ok 1042 - q id: est (0.47059) = fast (0.47059) ok 1043 - q cn: est (0.70588) = fast (0.70588) ok 1044 - h id: est (0.47059) = fast (0.47059) ok 1045 - h cn: est (0.70588) = fast (0.70588) ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1 ok 1047 - q id: est (0.38889) = fast (0.38889) ok 1048 - q cn: est (0.66667) = fast (0.66667) ok 1049 - h id: est (0.38889) = fast (0.38889) ok 1050 - h cn: est (0.66667) = fast (0.66667) ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1 ok 1052 - q id: est (0.27660) = fast (0.27660) ok 1053 - q cn: est (0.48936) = fast (0.48936) ok 1054 - h id: est (0.27660) = fast (0.27660) ok 1055 - h cn: est (0.48936) = fast (0.48936) ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1 ok 1057 - q id: est (0.40000) = fast (0.40000) ok 1058 - q cn: est (0.60000) = fast (0.60000) ok 1059 - h id: est (0.40000) = fast (0.40000) ok 1060 - h cn: est (0.60000) = fast (0.60000) ok 1061 - dnaEbsub_ecoli.wutblastx ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12 ok 1063 - q id: exact (0.40224) ~ est (0.40912) ok 1064 - q id: exact (0.40224) <= max (0.42628) ok 1065 - q cn: exact (0.58494) ~ est (0.58968) ok 1066 - q cn: exact (0.58494) <= max (0.62179) ok 1067 - q id: est (0.25352) = fast (0.25352) ok 1068 - q cn: est (0.47887) = fast (0.47887) ok 1069 - q id: est (0.37500) = fast (0.37500) ok 1070 - q cn: est (0.62500) = fast (0.62500) ok 1071 - q id: exact (0.44118) ~ est (0.44118) ok 1072 - q id: exact (0.44118) <= max (0.44118) ok 1073 - q cn: exact (0.54412) ~ est (0.54412) ok 1074 - q cn: exact (0.54412) <= max (0.54412) ok 1075 - h id: est (0.25352) = fast (0.25352) ok 1076 - h cn: est (0.47887) = fast (0.47887) ok 1077 - h id: exact (0.39848) ~ est (0.40304) ok 1078 - h id: exact (0.39848) <= max (0.40355) ok 1079 - h cn: exact (0.58376) ~ est (0.58889) ok 1080 - h cn: exact (0.58376) <= max (0.58883) ok 1081 - h id: exact (0.44118) ~ est (0.44118) ok 1082 - h id: exact (0.44118) <= max (0.44118) ok 1083 - h cn: exact (0.54412) ~ est (0.54412) ok 1084 - h cn: exact (0.54412) <= max (0.54412) ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2 ok 1086 - q id: exact (0.41818) ~ est (0.41818) ok 1087 - q id: exact (0.41818) <= max (0.41818) ok 1088 - q cn: exact (0.52727) ~ est (0.52727) ok 1089 - q cn: exact (0.52727) <= max (0.52727) ok 1090 - h id: est (0.53333) = fast (0.53333) ok 1091 - h cn: est (0.66667) = fast (0.66667) ok 1092 - h id: est (0.37500) = fast (0.37500) ok 1093 - h cn: est (0.47500) = fast (0.47500) ok 1094 - bug2942: query m0: range correct ok 1095 - bug2942: query m1: range correct ok 1096 - bug2942: query m2: range correct ok 1097 - bug2942: subject all : range correct ok 1098 - get_tiled_alns ok 1099 - got all alns ok 1100 ok 1101 - aln and qfeat lengths correspond ok 1102 - q length correct ok 1103 ok 1104 - features on q and s correspond ok 1105 - aln and hfeat lengths correspond ok 1106 - s length correct ok 1107 ok 1108 - aln and qfeat lengths correspond ok 1109 - q length correct ok 1110 ok 1111 - features on q and s correspond ok 1112 - aln and hfeat lengths correspond ok 1113 - s length correct ok 1114 ok 1115 - aln and qfeat lengths correspond ok 1116 - q length correct ok 1117 ok 1118 - features on q and s correspond ok 1119 - aln and hfeat lengths correspond ok 1120 - s length correct ok 1121 ok 1122 - aln and qfeat lengths correspond ok 1123 - q length correct ok 1124 ok 1125 - features on q and s correspond ok 1126 - aln and hfeat lengths correspond ok 1127 - s length correct ok 1128 ok 1129 - aln and qfeat lengths correspond ok 1130 - q length correct ok 1131 ok 1132 - features on q and s correspond ok 1133 - aln and hfeat lengths correspond ok 1134 - s length correct ok 1135 ok 1136 - aln and qfeat lengths correspond ok 1137 - q length correct ok 1138 ok 1139 - features on q and s correspond ok 1140 - aln and hfeat lengths correspond ok 1141 - s length correct ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 193. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 193. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 193. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 193. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 193. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 193. t/SearchIO/Writer/GbrowseGFF.t ............... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 353. t/SearchIO/Writer/HSPTableWriter.t ........... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HSPTableWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 353. t/SearchIO/Writer/HTMLWriter.t ............... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 353. t/SearchIO/Writer/HitTableWriter.t ........... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HitTableWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 353. t/SearchIO/Writer/TextWriter.t ............... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::TextResultWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 7. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 7. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 7. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 7. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 7. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 7. t/SearchIO/axt.t ............................. 1..19 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 245. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 245. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 245. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 245. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 245. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 245. t/SearchIO/blast.t ........................... 1..1348 ok 1 - use Bio::SearchIO; ok 2 ok 3 - database_name() ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 not ok 411 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 584. # '0.852' # > # '0.9' not ok 412 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 585. # '1.599' # <= # '1' ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 - Multiblast query test ok 594 ok 595 - Multiblast query test ok 596 ok 597 - Multiblast query test ok 598 ok 599 - Multiblast query test ok 600 ok 601 ok 602 ok 603 ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 - The object isa Bio::Search::Result::ResultI ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 - The object isa Bio::Search::Result::ResultI ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 - The object isa Bio::Search::Result::ResultI ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 - The object isa Bio::Search::Result::ResultI ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 - The object isa Bio::Search::Result::ResultI ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 ok 979 ok 980 ok 981 ok 982 ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 - The object isa Bio::Search::Result::ResultI ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 ok 1007 ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 - The object isa Bio::Search::Result::ResultI ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 - blastxml for f.blastxml ok 1049 - fasta for f.fy ok 1050 - exonerate for f.exonerate ok 1051 - blast for f.tblx ok 1052 - fasta for f.fx ok 1053 - fasta for f.osearch ok 1054 - blast for filename.bls ok 1055 - exonerate for f.exon ok 1056 - fasta for f.SSEARCH.m9 ok 1057 - blast for filename.blast ok 1058 - fasta for f.m9 ok 1059 - blast for f.blx ok 1060 - blastxml for f.xml ok 1061 - fasta for f.fasta ok 1062 - fasta for f.fa ok 1063 - blast for fast.bls ok 1064 - fasta for f.ssearch ok 1065 - fasta for f.psearch ok 1066 ok 1067 ok 1068 ok 1069 ok 1070 ok 1071 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 - full hit name ok 1082 - hit accession ok 1083 ok 1084 ok 1085 - query start ok 1086 - query start ok 1087 ok 1088 ok 1089 ok 1090 ok 1091 ok 1092 ok 1093 ok 1094 ok 1095 ok 1096 ok 1097 ok 1098 ok 1099 ok 1100 ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 ok 1117 ok 1118 ok 1119 ok 1120 ok 1121 ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok 1146 ok 1147 ok 1148 ok 1149 ok 1150 ok 1151 ok 1152 ok 1153 ok 1154 ok 1155 ok 1156 ok 1157 ok 1158 ok 1159 ok 1160 ok 1161 ok 1162 ok 1163 ok 1164 ok 1165 ok 1166 ok 1167 ok 1168 ok 1169 ok 1170 ok 1171 ok 1172 ok 1173 ok 1174 ok 1175 ok 1176 ok 1177 ok 1178 ok 1179 ok 1180 ok 1181 ok 1182 ok 1183 ok 1184 ok 1185 ok 1186 ok 1187 ok 1188 ok 1189 ok 1190 ok 1191 ok 1192 ok 1193 ok 1194 ok 1195 ok 1196 ok 1197 ok 1198 ok 1199 ok 1200 ok 1201 ok 1202 ok 1203 ok 1204 ok 1205 ok 1206 ok 1207 ok 1208 ok 1209 ok 1210 ok 1211 ok 1212 ok 1213 ok 1214 ok 1215 ok 1216 ok 1217 ok 1218 ok 1219 ok 1220 ok 1221 ok 1222 ok 1223 ok 1224 ok 1225 ok 1226 ok 1227 ok 1228 ok 1229 ok 1230 ok 1231 ok 1232 ok 1233 ok 1234 ok 1235 ok 1236 ok 1237 ok 1238 ok 1239 ok 1240 ok 1241 ok 1242 ok 1243 ok 1244 ok 1245 ok 1246 ok 1247 ok 1248 ok 1249 ok 1250 ok 1251 ok 1252 ok 1253 ok 1254 ok 1255 ok 1256 ok 1257 ok 1258 ok 1259 ok 1260 ok 1261 ok 1262 ok 1263 ok 1264 ok 1265 ok 1266 ok 1267 ok 1268 ok 1269 ok 1270 ok 1271 ok 1272 ok 1273 ok 1274 ok 1275 ok 1276 ok 1277 ok 1278 ok 1279 ok 1280 ok 1281 ok 1282 ok 1283 ok 1284 ok 1285 ok 1286 ok 1287 ok 1288 ok 1289 ok 1290 ok 1291 ok 1292 ok 1293 ok 1294 ok 1295 ok 1296 ok 1297 ok 1298 ok 1299 ok 1300 ok 1301 ok 1302 ok 1303 ok 1304 ok 1305 ok 1306 ok 1307 ok 1308 ok 1309 ok 1310 ok 1311 ok 1312 ok 1313 ok 1314 ok 1315 ok 1316 ok 1317 ok 1318 ok 1319 ok 1320 ok 1321 ok 1322 ok 1323 ok 1324 ok 1325 ok 1326 ok 1327 ok 1328 ok 1329 ok 1330 ok 1331 ok 1332 ok 1333 ok 1334 ok 1335 ok 1336 ok 1337 ok 1338 ok 1339 ok 1340 ok 1341 ok 1342 ok 1343 ok 1344 ok 1345 ok 1346 ok 1347 ok 1348 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 46. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 46. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 46. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 46. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 46. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 46. t/SearchIO/blast_pull.t ...................... 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - database_name() ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 not ok 191 # TODO frac_identical failing! # Failed (TODO) test at t/SearchIO/blast_pull.t line 260. # got: '0.946' # expected: '0.943' ok 192 ok 193 ok 194 ok 195 ok 196 - Multiblast query test ok 197 - Multiblast query test ok 198 - Multiblast query test ok 199 - Multiblast query test ok 200 ok 201 ok 202 ok 203 - full hit name ok 204 - hit accession ok 205 ok 206 - query start ok 207 - query start ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio/Search/Hit/GenericHit.pm line 127. Subroutine add_hsp redefined at Bio/Search/Hit/GenericHit.pm line 204. Subroutine hsp_factory redefined at Bio/Search/Hit/GenericHit.pm line 228. Subroutine name redefined at Bio/Search/Hit/GenericHit.pm line 248. Subroutine accession redefined at Bio/Search/Hit/GenericHit.pm line 268. Subroutine description redefined at Bio/Search/Hit/GenericHit.pm line 288. Subroutine length redefined at Bio/Search/Hit/GenericHit.pm line 308. Subroutine algorithm redefined at Bio/Search/Hit/GenericHit.pm line 333. Subroutine raw_score redefined at Bio/Search/Hit/GenericHit.pm line 355. Subroutine score redefined at Bio/Search/Hit/GenericHit.pm line 385. Subroutine significance redefined at Bio/Search/Hit/GenericHit.pm line 400. Subroutine bits redefined at Bio/Search/Hit/GenericHit.pm line 430. Subroutine next_hsp redefined at Bio/Search/Hit/GenericHit.pm line 458. Subroutine hsps redefined at Bio/Search/Hit/GenericHit.pm line 494. Subroutine num_hsps redefined at Bio/Search/Hit/GenericHit.pm line 517. Subroutine rewind redefined at Bio/Search/Hit/GenericHit.pm line 538. Subroutine ambiguous_aln redefined at Bio/Search/Hit/GenericHit.pm line 564. Subroutine overlap redefined at Bio/Search/Hit/GenericHit.pm line 576. Subroutine n redefined at Bio/Search/Hit/GenericHit.pm line 605. Subroutine p redefined at Bio/Search/Hit/GenericHit.pm line 652. Subroutine hsp redefined at Bio/Search/Hit/GenericHit.pm line 694. Subroutine logical_length redefined at Bio/Search/Hit/GenericHit.pm line 740. Subroutine length_aln redefined at Bio/Search/Hit/GenericHit.pm line 786. Subroutine gaps redefined at Bio/Search/Hit/GenericHit.pm line 849. Subroutine matches redefined at Bio/Search/Hit/GenericHit.pm line 887. Subroutine start redefined at Bio/Search/Hit/GenericHit.pm line 948. Subroutine end redefined at Bio/Search/Hit/GenericHit.pm line 1025. Subroutine range redefined at Bio/Search/Hit/GenericHit.pm line 1093. Subroutine frac_identical redefined at Bio/Search/Hit/GenericHit.pm line 1150. Subroutine frac_conserved redefined at Bio/Search/Hit/GenericHit.pm line 1226. Subroutine frac_aligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1274. Subroutine frac_aligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1310. Subroutine num_unaligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1364. Subroutine num_unaligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1400. Subroutine seq_inds redefined at Bio/Search/Hit/GenericHit.pm line 1442. Subroutine strand redefined at Bio/Search/Hit/GenericHit.pm line 1473. Subroutine frame redefined at Bio/Search/Hit/GenericHit.pm line 1535. Subroutine rank redefined at Bio/Search/Hit/GenericHit.pm line 1574. Subroutine locus redefined at Bio/Search/Hit/GenericHit.pm line 1590. Subroutine each_accession_number redefined at Bio/Search/Hit/GenericHit.pm line 1618. Subroutine tiled_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1666. Subroutine query_length redefined at Bio/Search/Hit/GenericHit.pm line 1683. Subroutine ncbi_gi redefined at Bio/Search/Hit/GenericHit.pm line 1701. Subroutine sort_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1732. Subroutine iteration redefined at Bio/Search/Hit/GenericHit.pm line 1772. Subroutine found_again redefined at Bio/Search/Hit/GenericHit.pm line 1807. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1333. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1341. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 420. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 420. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 420. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 420. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 420. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 420. t/SearchIO/blasttable.t ...................... 1..165 ok 1 - use Bio::SearchIO; ok 2 - use Bio::Search::SearchUtils; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 - hit1_bits ok 7 - hit1_name ok 8 - hsp1_bits ok 9 - hsp1_gaps ok 10 - hsp1_he ok 11 - hsp1_hs ok 12 - hsp1_hstr ok 13 - hsp1_qe ok 14 - hsp1_qs ok 15 - hsp1_qstr ok 16 - hsp2_bits ok 17 - hsp2_gaps ok 18 - hsp2_he ok 19 - hsp2_hs ok 20 - hsp2_hstr ok 21 - hsp2_qe ok 22 - hsp2_qs ok 23 - hsp2_qstr ok 24 - hsp3_bits ok 25 - hsp3_gaps ok 26 - hsp3_he ok 27 - hsp3_hs ok 28 - hsp3_hstr ok 29 - hsp3_qe ok 30 - hsp3_qs ok 31 - hsp3_qstr ok 32 - hsp4_bits ok 33 - hsp4_gaps ok 34 - hsp4_he ok 35 - hsp4_hs ok 36 - hsp4_hstr ok 37 - hsp4_qe ok 38 - hsp4_qs ok 39 - hsp4_qstr ok 40 - hsp5_bits ok 41 - hsp5_gaps ok 42 - hsp5_he ok 43 - hsp5_hs ok 44 - hsp5_hstr ok 45 - hsp5_qe ok 46 - hsp5_qs ok 47 - hsp5_qstr ok 48 - hsp6_bits ok 49 - hsp6_gaps ok 50 - hsp6_he ok 51 - hsp6_hs ok 52 - hsp6_hstr ok 53 - hsp6_qe ok 54 - hsp6_qs ok 55 - hsp6_qstr ok 56 - hsp7_bits ok 57 - hsp7_gaps ok 58 - hsp7_he ok 59 - hsp7_hs ok 60 - hsp7_hstr ok 61 - hsp7_qe ok 62 - hsp7_qs ok 63 - hsp7_qstr ok 64 - hsp8_bits ok 65 - hsp8_gaps ok 66 - hsp8_he ok 67 - hsp8_hs ok 68 - hsp8_hstr ok 69 - hsp8_qe ok 70 - hsp8_qs ok 71 - hsp8_qstr ok 72 - query_name ok 73 - The object isa Bio::Search::Result::ResultI ok 74 ok 75 ok 76 - hit1_bits ok 77 - hit1_name ok 78 - hsp1_bits ok 79 - hsp1_gaps ok 80 - hsp1_he ok 81 - hsp1_hs ok 82 - hsp1_hstr ok 83 - hsp1_qe ok 84 - hsp1_qs ok 85 - hsp1_qstr ok 86 - hsp2_bits ok 87 - hsp2_gaps ok 88 - hsp2_he ok 89 - hsp2_hs ok 90 - hsp2_hstr ok 91 - hsp2_qe ok 92 - hsp2_qs ok 93 - hsp2_qstr ok 94 - hsp3_bits ok 95 - hsp3_gaps ok 96 - hsp3_he ok 97 - hsp3_hs ok 98 - hsp3_hstr ok 99 - hsp3_qe ok 100 - hsp3_qs ok 101 - hsp3_qstr ok 102 - hsp4_bits ok 103 - hsp4_gaps ok 104 - hsp4_he ok 105 - hsp4_hs ok 106 - hsp4_hstr ok 107 - hsp4_qe ok 108 - hsp4_qs ok 109 - hsp4_qstr ok 110 - hsp5_bits ok 111 - hsp5_gaps ok 112 - hsp5_he ok 113 - hsp5_hs ok 114 - hsp5_hstr ok 115 - hsp5_qe ok 116 - hsp5_qs ok 117 - hsp5_qstr ok 118 - hsp6_bits ok 119 - hsp6_gaps ok 120 - hsp6_he ok 121 - hsp6_hs ok 122 - hsp6_hstr ok 123 - hsp6_qe ok 124 - hsp6_qs ok 125 - hsp6_qstr ok 126 - hsp7_bits ok 127 - hsp7_gaps ok 128 - hsp7_he ok 129 - hsp7_hs ok 130 - hsp7_hstr ok 131 - hsp7_qe ok 132 - hsp7_qs ok 133 - hsp7_qstr ok 134 - hsp8_bits ok 135 - hsp8_gaps ok 136 - hsp8_he ok 137 - hsp8_hs ok 138 - hsp8_hstr ok 139 - hsp8_qe ok 140 - hsp8_qs ok 141 - hsp8_qstr ok 142 - query_name ok 143 ok 144 ok 145 ok 146 ok 147 - hit score ok 148 - hit raw_score ok 149 - The object isa Bio::SeqFeatureI ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 - The object isa Bio::SeqFeatureI ok 159 ok 160 ok 161 ok 162 - The object isa Bio::SeqFeatureI ok 163 ok 164 ok 165 ok Subroutine start_document redefined at Bio\SearchIO\XML\BlastHandler.pm line 186. Subroutine end_document redefined at Bio\SearchIO\XML\BlastHandler.pm line 203. Subroutine start_element redefined at Bio\SearchIO\XML\BlastHandler.pm line 223. Subroutine end_element redefined at Bio\SearchIO\XML\BlastHandler.pm line 246. Subroutine characters redefined at Bio\SearchIO\XML\BlastHandler.pm line 303. Subroutine eventHandler redefined at Bio\SearchIO\XML\BlastHandler.pm line 309. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175, line 617. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264, line 617. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284, line 617. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311, line 617. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337, line 617. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357, line 617. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378, line 617. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399, line 617. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420, line 617. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442, line 617. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465, line 617. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487, line 617. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508, line 617. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523, line 617. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540, line 617. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555, line 617. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574, line 617. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599, line 617. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616, line 617. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629, line 617. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646, line 617. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663, line 617. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680, line 617. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700, line 617. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728, line 617. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747, line 617. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763, line 617. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777, line 617. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794, line 617. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815, line 617. t/SearchIO/blastxml.t ........................ 1..391 ok 1 - use Bio::SearchIO; ok 2 ok 3 - The object isa Bio::Search::Result::ResultI ok 4 - database_name() ok 5 - query_name() ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - database_name() ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 - query name on HSP ok 61 - query desc on HSP ok 62 - hitname ok 63 - hitdesc ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - The object isa Bio::Search::Hit::HitI ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 - query name on HSP ok 169 - query desc on HSP ok 170 - hitname ok 171 - hitdesc ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 - query name on HSP ok 215 - query desc on HSP ok 216 - hitname ok 217 - hitdesc ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok Subroutine new redefined at Bio\Search\HSP\GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio\Search\HSP\GenericHSP.pm line 216. Subroutine algorithm redefined at Bio\Search\HSP\GenericHSP.pm line 241. Subroutine pvalue redefined at Bio\Search\HSP\GenericHSP.pm line 263. Subroutine evalue redefined at Bio\Search\HSP\GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio\Search\HSP\GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 350. Subroutine gaps redefined at Bio\Search\HSP\GenericHSP.pm line 383. Subroutine query_string redefined at Bio\Search\HSP\GenericHSP.pm line 413. Subroutine hit_string redefined at Bio\Search\HSP\GenericHSP.pm line 437. Subroutine homology_string redefined at Bio\Search\HSP\GenericHSP.pm line 463. Subroutine length redefined at Bio\Search\HSP\GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio\Search\HSP\GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio\Search\HSP\GenericHSP.pm line 538. Subroutine frame redefined at Bio\Search\HSP\GenericHSP.pm line 578. Subroutine get_aln redefined at Bio\Search\HSP\GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 679. Subroutine num_identical redefined at Bio\Search\HSP\GenericHSP.pm line 703. Subroutine rank redefined at Bio\Search\HSP\GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 873. Subroutine query redefined at Bio\Search\HSP\GenericHSP.pm line 897. Subroutine feature1 redefined at Bio\Search\HSP\GenericHSP.pm line 905. Subroutine hit redefined at Bio\Search\HSP\GenericHSP.pm line 928. Subroutine feature2 redefined at Bio\Search\HSP\GenericHSP.pm line 936. Subroutine significance redefined at Bio\Search\HSP\GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio\Search\HSP\GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio\Search\HSP\GenericHSP.pm line 1176. Subroutine n redefined at Bio\Search\HSP\GenericHSP.pm line 1197. Subroutine range redefined at Bio\Search\HSP\GenericHSP.pm line 1210. Subroutine links redefined at Bio\Search\HSP\GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio\Search\HSP\GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio\Search\HSP\GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio\Search\HSP\GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio\Search\HSP\GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio\Search\HSP\GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio\Search\HSP\GenericHSP.pm line 1690. Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 127. Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 204. Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 228. Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 248. Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 268. Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 288. Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 308. Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 333. Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 355. Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 385. Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 400. Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 430. Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 458. Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 494. Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 517. Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 538. Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 564. Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 576. Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 605. Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 652. Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 694. Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 740. Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 786. Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 849. Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 887. Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 948. Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1025. Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1093. Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1150. Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1226. Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1274. Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1310. Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1364. Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1400. Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1442. Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1473. Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1535. Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1574. Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1590. Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1618. Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1666. Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1683. Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1701. Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1732. Subroutine iteration redefined at Bio\Search\Hit\GenericHit.pm line 1772. Subroutine found_again redefined at Bio\Search\Hit\GenericHit.pm line 1807. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1333. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1341. Subroutine new redefined at Bio\Search\Result\GenericResult.pm line 175. Subroutine algorithm redefined at Bio\Search\Result\GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio\Search\Result\GenericResult.pm line 284. Subroutine next_hit redefined at Bio\Search\Result\GenericResult.pm line 311. Subroutine query_name redefined at Bio\Search\Result\GenericResult.pm line 337. Subroutine query_accession redefined at Bio\Search\Result\GenericResult.pm line 357. Subroutine query_gi redefined at Bio\Search\Result\GenericResult.pm line 378. Subroutine query_length redefined at Bio\Search\Result\GenericResult.pm line 399. Subroutine query_description redefined at Bio\Search\Result\GenericResult.pm line 420. Subroutine database_name redefined at Bio\Search\Result\GenericResult.pm line 442. Subroutine database_letters redefined at Bio\Search\Result\GenericResult.pm line 465. Subroutine database_entries redefined at Bio\Search\Result\GenericResult.pm line 487. Subroutine get_parameter redefined at Bio\Search\Result\GenericResult.pm line 508. Subroutine available_parameters redefined at Bio\Search\Result\GenericResult.pm line 523. Subroutine get_statistic redefined at Bio\Search\Result\GenericResult.pm line 540. Subroutine available_statistics redefined at Bio\Search\Result\GenericResult.pm line 555. Subroutine add_hit redefined at Bio\Search\Result\GenericResult.pm line 574. Subroutine hit_factory redefined at Bio\Search\Result\GenericResult.pm line 599. Subroutine rewind redefined at Bio\Search\Result\GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio\Search\Result\GenericResult.pm line 629. Subroutine add_parameter redefined at Bio\Search\Result\GenericResult.pm line 646. Subroutine add_statistic redefined at Bio\Search\Result\GenericResult.pm line 663. Subroutine num_hits redefined at Bio\Search\Result\GenericResult.pm line 680. Subroutine hits redefined at Bio\Search\Result\GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio\Search\Result\GenericResult.pm line 728. Subroutine program_reference redefined at Bio\Search\Result\GenericResult.pm line 747. Subroutine rid redefined at Bio\Search\Result\GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio\Search\Result\GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio\Search\Result\GenericResult.pm line 794. Subroutine to_string redefined at Bio\Search\Result\GenericResult.pm line 815. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 41. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 41. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 41. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 41. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 41. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 41. t/SearchIO/cross_match.t ..................... 1..15 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 28. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 28. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 28. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 28. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 28. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 28. t/SearchIO/erpin.t ........................... 1..91 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::Search::Result::ResultI ok 3 - Result ERPIN ok 4 - Result ERPIN reference ok 5 - Result ERPIN version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_name ok 16 - The object isa Bio::Search::Hit::HitI ok 17 - Hit accession ok 18 - Hit GI ok 19 - Hit algorithm ok 20 - Hit bits ok 21 - Hit description ok 22 - Hit length ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit overlap ok 28 - Hit query_length ok 29 - Hit rank ok 30 - Hit raw_score ok 31 - Hit score ok 32 ok 33 - The object isa Bio::Search::HSP::HSPI ok 34 - HSP algorithm ok 35 ok 36 - The object isa Bio::SeqFeature::Similarity ok 37 - The object isa Bio::SeqFeature::Similarity ok 38 - HSP frame ok 39 - HSP gaps ok 40 - HSP hit isa Bio::SeqFeature::Similarity ok 41 - HSP hit_string ok 42 - HSP homology_string ok 43 - HSP hsp_group ok 44 - HSP hsp_length ok 45 - HSP length ok 46 - HSP links ok 47 - HSP query isa Bio::SeqFeature::Similarity ok 48 - HSP query_string ok 49 - HSP range ok 50 - HSP rank ok 51 ok 52 - HSP expect ok 53 - The object isa Bio::LocatableSeq ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 ok 59 ok 60 - HSP strand ok 61 ok 62 ok 63 - ERPIN get_aln warning ok 64 - The object isa Bio::Search::HSP::HSPI ok 65 - HSP algorithm ok 66 ok 67 - The object isa Bio::SeqFeature::Similarity ok 68 - The object isa Bio::SeqFeature::Similarity ok 69 - HSP frame ok 70 - HSP gaps ok 71 - HSP hit isa Bio::SeqFeature::Similarity ok 72 - HSP hit_string ok 73 - HSP homology_string ok 74 - HSP query_string ok 75 - HSP hsp_group ok 76 - HSP hsp_length ok 77 - HSP length ok 78 - HSP links ok 79 - The object isa Bio::SeqFeature::Similarity ok 80 - HSP range ok 81 - HSP rank ok 82 ok 83 - HSP end ok 84 - HSP expect ok 85 - The object isa Bio::LocatableSeq ok 86 - HSP seq_str ok 87 - HSP start ok 88 - HSP custom_score ok 89 ok 90 ok 91 - HSP strand ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 42. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 42. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 42. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 42. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 42. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 42. t/SearchIO/exonerate.t ....................... 1..51 ok 1 - use Bio::SearchIO; ok 2 ok 3 # skip no query length available in default output ok 4 ok 5 # skip no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # skip no query length available in default output ok 26 ok 27 # skip no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - query_name ok 47 ok 48 - query_name ok 49 ok 50 - query_name ok 51 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 2549. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 2549. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 2549. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 2549. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 2549. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 2549. t/SearchIO/fasta.t ........................... 1..301 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 - TFASTXY ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 - num_identical() ok 289 - num_conserved() ok 290 - bug 2937 and FASTA version 3.5 ok 291 - algorithm version ok 292 - query name ok 293 - query description ok 294 - query length ok 295 - algorithm ok 296 - num_identical() ok 297 - num_conserved() ok 298 - hsp->strand(hit) ok 299 - hsp->hit->strand ok 300 - hsp->strand(query) ok 301 - hsp->query->strand ok Subroutine new redefined at Bio\Search\HSP\GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio\Search\HSP\GenericHSP.pm line 216. Subroutine algorithm redefined at Bio\Search\HSP\GenericHSP.pm line 241. Subroutine pvalue redefined at Bio\Search\HSP\GenericHSP.pm line 263. Subroutine evalue redefined at Bio\Search\HSP\GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio\Search\HSP\GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 350. Subroutine gaps redefined at Bio\Search\HSP\GenericHSP.pm line 383. Subroutine query_string redefined at Bio\Search\HSP\GenericHSP.pm line 413. Subroutine hit_string redefined at Bio\Search\HSP\GenericHSP.pm line 437. Subroutine homology_string redefined at Bio\Search\HSP\GenericHSP.pm line 463. Subroutine length redefined at Bio\Search\HSP\GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio\Search\HSP\GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio\Search\HSP\GenericHSP.pm line 538. Subroutine frame redefined at Bio\Search\HSP\GenericHSP.pm line 578. Subroutine get_aln redefined at Bio\Search\HSP\GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 679. Subroutine num_identical redefined at Bio\Search\HSP\GenericHSP.pm line 703. Subroutine rank redefined at Bio\Search\HSP\GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 873. Subroutine query redefined at Bio\Search\HSP\GenericHSP.pm line 897. Subroutine feature1 redefined at Bio\Search\HSP\GenericHSP.pm line 905. Subroutine hit redefined at Bio\Search\HSP\GenericHSP.pm line 928. Subroutine feature2 redefined at Bio\Search\HSP\GenericHSP.pm line 936. Subroutine significance redefined at Bio\Search\HSP\GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio\Search\HSP\GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio\Search\HSP\GenericHSP.pm line 1176. Subroutine n redefined at Bio\Search\HSP\GenericHSP.pm line 1197. Subroutine range redefined at Bio\Search\HSP\GenericHSP.pm line 1210. Subroutine links redefined at Bio\Search\HSP\GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio\Search\HSP\GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio\Search\HSP\GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio\Search\HSP\GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio\Search\HSP\GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio\Search\HSP\GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio\Search\HSP\GenericHSP.pm line 1690. Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 127. Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 204. Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 228. Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 248. Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 268. Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 288. Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 308. Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 333. Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 355. Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 385. Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 400. Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 430. Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 458. Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 494. Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 517. Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 538. Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 564. Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 576. Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 605. Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 652. Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 694. Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 740. Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 786. Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 849. Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 887. Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 948. Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1025. Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1093. Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1150. Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1226. Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1274. Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1310. Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1364. Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1400. Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1442. Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1473. Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1535. Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1574. Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1590. Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1618. Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1666. Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1683. Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1701. Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1732. Subroutine iteration redefined at Bio\Search\Hit\GenericHit.pm line 1772. Subroutine found_again redefined at Bio\Search\Hit\GenericHit.pm line 1807. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1333. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1341. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 313. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 313. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 313. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 313. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 313. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 313. t/SearchIO/gmap_f9.t ......................... 1..54 ok 1 - use Bio::SearchIO; ok 2 - Did we get a Result? isa Bio::Search::Result::GenericResult ok 3 - Did we get the expected number of hits? ok 4 - Did we get the expected algorithm? ok 5 - Did we get the expected query_name? ok 6 - Did we get a Hit? isa Bio::Search::Hit::GenericHit ok 7 - The object isa Bio::Search::Hit::HitI ok 8 - Check the name ok 9 - Check the hit length ok 10 - Check the number of hsps ok 11 - Check the query length ok 12 - The object isa Bio::Search::HSP::HSPI ok 13 - Check the algorithm ok 14 - Count gaps in the query ok 15 - Count gaps in the hit ok 16 - Length of the query ok 17 - Length of the hit ok 18 - Query sequence ok 19 - Hit sequence ok 20 - Check query start ok 21 - Check query end ok 22 - Check query end ok 23 - Check the homology string ok 24 - Check seq_inds ok 25 - Check hit start ok 26 - Check hit end ok 27 - Check hit end ok 28 - Did we get a Result? isa Bio::Search::Result::GenericResult ok 29 - Did we get the expected number of hits? ok 30 - Did we get the expected algorithm? ok 31 - Did we get the expected query_name? ok 32 - The object isa Bio::Search::Hit::HitI ok 33 - Check the name ok 34 - Check the hit length ok 35 - Check the number of hsps ok 36 - Check the query length ok 37 - The object isa Bio::Search::HSP::HSPI ok 38 - Check the algorithm ok 39 - Count gaps in the query ok 40 - Count gaps in the hit ok 41 - Length of the query ok 42 - Length of the hit ok 43 - Query sequence ok 44 - Hit sequence ok 45 - Check query start ok 46 - Check query end ok 47 - Check query end ok 48 - Check the homology string ok 49 - Check seq_inds ok 50 - Check hit start ok 51 - Check hit end ok 52 - Check hit end ok 53 - Can we loop over multiple results properly (expecting 58)? ok 54 - simple query_name now caught, bug 3021 ok Subroutine new redefined at Bio/SearchIO/hmmer.pm line 90. Subroutine _initialize redefined at Bio/SearchIO/hmmer.pm line 142. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 41. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 41. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 41. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 41. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 41. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 41. t/SearchIO/hmmer.t ........................... 1..295 ok 1 - use Bio::SearchIO; ok 2 - Check for the correct result reference type ok 3 - Check algorithm ok 4 - Check algorithm version ok 5 - Check hmm_name ok 6 - Check sequence_file ok 7 - Check query_name ok 8 - Check query_description ok 9 - Check num_hits ok 10 - Check hit name ok 11 - Check hit raw_score ok 12 - Check hit significance ok 13 - Check for the correct hit reference type ok 14 - Check num_hsps ok 15 - Check for hit hmmfrom value ok 16 - Check for hit hmm to value ok 17 - Check for query alifrom value ok 18 - Check for query ali to value ok 19 - Check for hsp score ok 20 - Check for hsp c-Evalue ok 21 - Check for query string ok 22 - Check for number of gaps in query ok 23 - Check for hit string ok 24 - Check for homology string ok 25 - Check if homology string and hit string have an equal lenght ok 26 - Check if query string and homology string have an equal lenght ok 27 - Check for hit hmmfrom value ok 28 - Check for hit hmm to value ok 29 - Check for query alifrom value ok 30 - Check for query ali to value ok 31 - Check for hsp score ok 32 - Check for hsp c-Evalue ok 33 - Check for query string ok 34 - Check for number of gaps in query ok 35 - Check for hit string ok 36 - Check for homology string ok 37 - Check if homology string and hit string have an equal lenght ok 38 - Check if query string and homology string have an equal lenght ok 39 - Check for the correct result reference type ok 40 - Check algorithm ok 41 - Check algorithm version ok 42 - Check hmm_name ok 43 - Check sequence_file ok 44 - Check database_name ok 45 - Check query_name ok 46 - Check query_description ok 47 - Check num_hits ok 48 - Check hit name ok 49 - Check for hit description ok 50 - Check hit significance ok 51 - Check hit raw_score ok 52 - Check for hsp score ok 53 - Check for hsp c-Evalue ok 54 - Check for query alifrom value ok 55 - Check for query ali to value ok 56 - Check for hit hmmfrom value ok 57 - Check for hit hmm to value ok 58 - Check for query seq_id ok 59 - Check for hit seq_id ok 60 - Check for the correct result reference type ok 61 - Check algorithm ok 62 - Check algorithm version ok 63 - Check hmm_name ok 64 - Check sequence_file ok 65 - Check query_name ok 66 - Check query_description ok 67 - Check num_hits ok 68 - Check hit name ok 69 - Check for hit description ok 70 - Check hit significance ok 71 - Check hit raw_score ok 72 - Check for hsp score ok 73 - Check for hsp evalue ok 74 - Check for query alifrom value ok 75 - Check for query ali to value ok 76 - Check for hit hmmfrom value ok 77 - Check for hit hmm to value ok 78 - Check for query seq_id ok 79 - Check for hit seq_id ok 80 - Check for hiy string ok 81 - Check for query string ok 82 - Check for homology string ok 83 - Check for nomatch indices in query ok 84 - Check for nomatch indices in hit ok 85 - Check for gap indices in query ok 86 - Check for gap indices in hit ok 87 - Check for the correct result reference type ok 88 - Check algorithm ok 89 - Check algorithm version ok 90 - Check hmm_name ok 91 - Check database_name ok 92 - Check sequence_file ok 93 - Check query_name ok 94 - Check query_accession ok 95 - Check query_description ok 96 - Check num_hits ok 97 - Check hit name ok 98 - Check for hit description ok 99 - Check hit significance ok 100 - Check hit raw_score ok 101 - Check for hsp score ok 102 - Check for hsp evalue ok 103 - Check for query alifrom value ok 104 - Check for query ali to value ok 105 - Check for hit hmmfrom value ok 106 - Check for hit hmm to value ok 107 - Check for query seq_id ok 108 - Check for hit seq_id ok 109 - Check for hiy string ok 110 - Check for homology string ok 111 - Check for query string ok 112 - Check hit name ok 113 - Check for hit description ok 114 - Check hit significance ok 115 - Check hit raw_score ok 116 - Check for hsp seq_str ok 117 - Check for the correct result reference type ok 118 - Check algorithm ok 119 - Check algorithm version ok 120 - Check hmm_name ok 121 - Check sequence_file ok 122 - Check query_name ok 123 - Check query_length ok 124 - Check query_description ok 125 - Check num_hits ok 126 - Check for the correct hit reference type ok 127 - Check hit name ok 128 - Check for hit description ok 129 - Check hit raw_score ok 130 - Check hit significance ok 131 - Check num_hsps ok 132 - Check for correct hsp reference type ok 133 - Check for hit hmmfrom value ok 134 - Check for hit hmm to value ok 135 - Check for query alifrom value ok 136 - Check for query ali to value ok 137 - Check for hsp score ok 138 - Check for hsp c-Evalue ok 139 - Check for query string ok 140 - Check for hit string ok 141 - Check for homology string ok 142 - Check for the correct result reference type ok 143 - Check algorithm ok 144 - Check algorithm version ok 145 - Check hmm_name ok 146 - Check sequence_file ok 147 - Check query_name ok 148 - Check query_length ok 149 - Check query_description ok 150 - Check num_hits ok 151 - Check for the correct result reference type ok 152 - Check algorithm ok 153 - Check algorithm version ok 154 - Check hmm_name ok 155 - Check sequence_file ok 156 - Check query_name ok 157 - Check query_length ok 158 - Check query_description ok 159 - Check num_hits ok 160 - Check for the correct hit reference type ok 161 - Check hit name ok 162 - Check for hit description ok 163 - Check hit raw_score ok 164 - Check hit significance ok 165 - Check num_hsps ok 166 - Check for correct hsp reference type ok 167 - Check for hit envfrom value ok 168 - Check for hit env to value ok 169 - Check for query hmmfrom value ok 170 - Check for query hmm to value ok 171 - Check for hsp score ok 172 - Check for hsp c-Evalue ok 173 - Check for correct hsp reference type ok 174 - Check for hit envfrom value ok 175 - Check for hit env to value ok 176 - Check for query hmmfrom value ok 177 - Check for query hmm to value ok 178 - Check for hsp score ok 179 - Check for hsp c-Evalue ok 180 - Check for correct hsp reference type ok 181 - Check for hit envfrom value ok 182 - Check for hit env to value ok 183 - Check for query hmmfrom value ok 184 - Check for query hmm to value ok 185 - Check for hsp score ok 186 - Check for hsp c-Evalue ok 187 - Check for correct hsp reference type ok 188 - Check for hit envfrom value ok 189 - Check for hit env to value ok 190 - Check for query hmmfrom value ok 191 - Check for query hmm to value ok 192 - Check for hsp score ok 193 - Check for hsp c-Evalue ok 194 - Check for correct hsp reference type ok 195 - Check for hit envfrom value ok 196 - Check for hit env to value ok 197 - Check for query hmmfrom value ok 198 - Check for query hmm to value ok 199 - Check for hsp score ok 200 - Check for hsp c-Evalue ok 201 - Check for correct hsp reference type ok 202 - Check for hit envfrom value ok 203 - Check for hit env to value ok 204 - Check for query hmmfrom value ok 205 - Check for query hmm to value ok 206 - Check for hsp score ok 207 - Check for hsp c-Evalue ok 208 - Check for the correct hit reference type ok 209 - Check hit name ok 210 - Check for hit description ok 211 - Check hit raw_score ok 212 - Check hit significance ok 213 - Check num_hsps ok 214 - Check for correct hsp reference type ok 215 - Check for hit envfrom value ok 216 - Check for hit env to value ok 217 - Check for query hmmfrom value ok 218 - Check for query hmm to value ok 219 - Check for hsp score ok 220 - Check for hsp c-Evalue ok 221 - Check for correct hsp reference type ok 222 - Check for hit envfrom value ok 223 - Check for hit env to value ok 224 - Check for query hmmfrom value ok 225 - Check for query hmm to value ok 226 - Check for hsp score ok 227 - Check for hsp c-Evalue ok 228 - Check for correct hsp reference type ok 229 - Check for hit envfrom value ok 230 - Check for hit env to value ok 231 - Check for query hmmfrom value ok 232 - Check for query hmm to value ok 233 - Check for hsp score ok 234 - Check for hsp c-Evalue ok 235 - Check for the correct result reference type ok 236 - Check algorithm ok 237 - Check algorithm version ok 238 - Check hmm_name ok 239 - Check sequence_file ok 240 - Check query_name ok 241 - Check query_length ok 242 - Check query_description ok 243 - Check num_hits ok 244 - Check for the correct hit reference type ok 245 - Check hit name ok 246 - Check for hit description ok 247 - Check hit raw_score ok 248 - Check hit significance ok 249 - Check num_hsps ok 250 - Check for correct hsp reference type ok 251 - Check hit sequence ok 252 - Check query sequence ok 253 - Check for correct hsp reference type ok 254 - Check hit sequence ok 255 - Check query sequence ok 256 - Check for the correct hit reference type ok 257 - Check hit name ok 258 - Check for hit description ok 259 - Check hit raw_score ok 260 - Check hit significance ok 261 - Check num_hsps ok 262 - Check for correct hsp reference type ok 263 - Check hit sequence ok 264 - Check query sequence ok 265 - Check for correct hsp reference type ok 266 - Check hit sequence ok 267 - Check query sequence ok 268 - Check for the correct hit reference type ok 269 - Check hit name ok 270 - Check for hit description ok 271 - Check hit raw_score ok 272 - Check hit significance ok 273 - Check num_hsps ok 274 - Check for correct hsp reference type ok 275 - Check hit sequence ok 276 - Check query sequence ok 277 - Check for correct hsp reference type ok 278 - Check hit sequence ok 279 - Check query sequence ok 280 - Check if loading hmmpfam output via the hmm2 parser directly works ok 281 - Check for the correct result reference type ok 282 - Check if loading hmmsearch2 output via the hmm2 parser directly works ok 283 - Check for the correct result reference type ok 284 - Check if loading hmmscan output via the hmm3 parser directly works ok 285 - Check for the correct result reference type ok 286 - Check if loading hmmsearch3 output via the hmm3 parser directly works ok 287 - Check for the correct result reference type ok 288 - Check if selecting the correct hmmpfam parser using -version works ok 289 - Check for the correct result reference type ok 290 - Check if selecting the correct hmmsearch2 parser using -version works ok 291 - Check for the correct result reference type ok 292 - Check if selecting the correct hmmscan parser using -version works ok 293 - Check for the correct result reference type ok 294 - Check if selecting the correct hmmsearch3 parser using -version works ok 295 - Check for the correct result reference type ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 14. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 14. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 14. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 14. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 14. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 14. t/SearchIO/hmmer_pull.t ...................... 1..290 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 80. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 80. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 80. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 80. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 80. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 80. t/SearchIO/infernal.t ........................ 1..412 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::Search::Result::ResultI ok 3 - Result ok 4 - Result reference ok 5 - Result version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_length ok 16 - Result query_name ok 17 - The object isa Bio::Search::Hit::HitI ok 18 - Hit GI ok 19 - Hit accession ok 20 - Hit algorithm ok 21 - Hit bits ok 22 - Hit description ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit length_aln() not implemented ok 28 - Hit num_unaligned_hit() not implemented ok 29 - Hit num_unaligned_query() not implemented ok 30 - Hit num_unaligned_sbjct() not implemented ok 31 - Hit start not implemented ok 32 - Hit end not implemented ok 33 - Hit strand not implemented ok 34 - Hit logical_length not implemented ok 35 - Hit frac_aligned_hit not implemented ok 36 - Hit frac_aligned_query not implemented ok 37 - Hit frac_conserved not implemented ok 38 - Hit frac_identical not implemented ok 39 - Hit matches not implemented ok 40 - Hit gaps not implemented ok 41 - Hit frame not implemented ok 42 - Hit range not implemented ok 43 - Hit seq_inds not implemented ok 44 - Hit length ok 45 - Hit overlap ok 46 - Hit query_length ok 47 - Hit rank ok 48 - Hit raw_score ok 49 - Hit score ok 50 - Hit p ok 51 ok 52 - The object isa Bio::Search::HSP::HSPI ok 53 - HSP algorithm ok 54 ok 55 - The object isa Bio::SeqFeature::Similarity ok 56 - The object isa Bio::SeqFeature::Similarity ok 57 ok 58 ok 59 - HSP frame ok 60 - HSP gaps ok 61 - Hit length ok 62 - The object isa Bio::Align::AlignI ok 63 - HSP hit isa Bio::SeqFeature::Similarity ok 64 - HSP hit_string ok 65 - HSP homology_string ok 66 - HSP hsp_group ok 67 - HSP hsp_length ok 68 - HSP length ok 69 - HSP links ok 70 - HSP n ok 71 - HSP pvalue ok 72 - HSP query isa Bio::SeqFeature::Similarity ok 73 - HSP query_string ok 74 - HSP range ok 75 - HSP rank ok 76 ok 77 - HSP end ok 78 - HSP expect ok 79 - HSP seq_inds not implemented ok 80 - HSP matches not implemented ok 81 - HSP frac_conserved not implemented ok 82 - HSP frac_identical not implemented ok 83 - HSP num_conserved not implemented ok 84 - HSP num_identical not implemented ok 85 - HSP percent_identity not implemented ok 86 - HSP cigar_string not implemented ok 87 - HSP cigar_string not implemented ok 88 - The object isa Bio::LocatableSeq ok 89 - HSP seq_str ok 90 - HSP start ok 91 - HSP custom_score ok 92 - HSP meta ok 93 - HSP strand ok 94 - The object isa Bio::Search::HSP::HSPI ok 95 - HSP algorithm ok 96 ok 97 - The object isa Bio::SeqFeature::Similarity ok 98 - The object isa Bio::SeqFeature::Similarity ok 99 - HSP frame ok 100 - HSP gaps ok 101 - The object isa Bio::Align::AlignI ok 102 - HSP hit isa Bio::SeqFeature::Similarity ok 103 - HSP hit_string ok 104 - HSP homology_string ok 105 - HSP hsp_group ok 106 - HSP hsp_length ok 107 - HSP length ok 108 - HSP links ok 109 - HSP n ok 110 - HSP pvalue ok 111 - HSP query isa Bio::SeqFeature::Similarity ok 112 - HSP query_string ok 113 - HSP range ok 114 - HSP rank ok 115 ok 116 - HSP end ok 117 - HSP expect ok 118 - The object isa Bio::LocatableSeq ok 119 - HSP seq_str ok 120 - HSP start ok 121 - HSP custom_score ok 122 - HSP meta ok 123 - HSP strand ok 124 - The object isa Bio::Search::Result::ResultI ok 125 - Result CMSEARCH ok 126 - Result CMSEARCH reference ok 127 - Result CMSEARCH version ok 128 - Result parameters ok 129 - Result statistics ok 130 - Result entries ok 131 - Result letters ok 132 - Result database_name ok 133 - Result num_hits ok 134 - Result program_reference ok 135 - Result query_accession ok 136 - Result query_description ok 137 - Result query_length ok 138 - Result query_name ok 139 - The object isa Bio::Search::Hit::HitI ok 140 - Hit GI ok 141 - Hit accession ok 142 - Hit algorithm ok 143 - Hit bits ok 144 - Hit description ok 145 - Hit locus ok 146 - Hit n ok 147 - Hit name ok 148 - Hit num_hsps ok 149 - No p values ok 150 - Hit length ok 151 - Hit overlap ok 152 - Hit query_length ok 153 - Hit rank ok 154 - Hit raw_score ok 155 - Hit score ok 156 ok 157 - The object isa Bio::Search::HSP::HSPI ok 158 - HSP algorithm ok 159 ok 160 - The object isa Bio::SeqFeature::Similarity ok 161 - The object isa Bio::SeqFeature::Similarity ok 162 ok 163 ok 164 - HSP frame ok 165 - HSP gaps ok 166 - Hit length ok 167 - The object isa Bio::Align::AlignI ok 168 - HSP hit isa Bio::SeqFeature::Similarity ok 169 - HSP hit_string ok 170 - HSP homology_string ok 171 - HSP hsp_group ok 172 - HSP hsp_length ok 173 - HSP length ok 174 - HSP links ok 175 - HSP n ok 176 - HSP pvalue ok 177 - HSP query isa Bio::SeqFeature::Similarity ok 178 - HSP query_string ok 179 - HSP range ok 180 - HSP rank ok 181 ok 182 - HSP end ok 183 - HSP expect ok 184 - The object isa Bio::LocatableSeq ok 185 - HSP seq_str ok 186 - HSP start ok 187 - HSP custom_score ok 188 - HSP meta ok 189 - HSP strand ok 190 - The object isa Bio::Search::HSP::HSPI ok 191 - HSP algorithm ok 192 ok 193 - The object isa Bio::SeqFeature::Similarity ok 194 - The object isa Bio::SeqFeature::Similarity ok 195 - HSP frame ok 196 - HSP gaps ok 197 - The object isa Bio::Align::AlignI ok 198 - HSP hit isa Bio::SeqFeature::Similarity ok 199 - HSP hit_string ok 200 - HSP homology_string ok 201 - HSP hsp_group ok 202 - HSP hsp_length ok 203 - HSP length ok 204 - HSP links ok 205 - HSP n ok 206 - HSP pvalue ok 207 - HSP query isa Bio::SeqFeature::Similarity ok 208 - HSP query_string ok 209 - HSP range ok 210 - HSP rank ok 211 ok 212 - HSP end ok 213 - HSP expect ok 214 - The object isa Bio::LocatableSeq ok 215 - HSP seq_str ok 216 - HSP start ok 217 - HSP custom_score ok 218 - HSP meta ok 219 - HSP strand ok 220 - The object isa Bio::Search::Hit::HitI ok 221 - Hit accession ok 222 - Hit GI ok 223 - Hit algorithm ok 224 - Hit bits ok 225 - Hit description ok 226 - Hit length ok 227 - Hit locus ok 228 - Hit n ok 229 - Hit name ok 230 - Hit num_hsps ok 231 - Hit overlap ok 232 - Hit query_length ok 233 - Hit rank ok 234 - Hit raw_score ok 235 - Hit score ok 236 ok 237 - The object isa Bio::Search::HSP::HSPI ok 238 - HSP algorithm ok 239 ok 240 - The object isa Bio::SeqFeature::Similarity ok 241 - The object isa Bio::SeqFeature::Similarity ok 242 - HSP frame ok 243 - HSP gaps ok 244 - The object isa Bio::Align::AlignI ok 245 - HSP hit isa Bio::SeqFeature::Similarity ok 246 - HSP hit_string ok 247 - HSP homology_string ok 248 - HSP hsp_group ok 249 - HSP hsp_length ok 250 - HSP length ok 251 - HSP links ok 252 - HSP n ok 253 - HSP query isa Bio::SeqFeature::Similarity ok 254 - HSP query_string ok 255 - HSP range ok 256 - HSP rank ok 257 ok 258 - HSP end ok 259 - HSP expect ok 260 - The object isa Bio::LocatableSeq ok 261 - HSP seq_str ok 262 - HSP start ok 263 - HSP custom_score ok 264 - HSP meta ok 265 - HSP strand ok 266 - HSP meta gap bug ok 267 - HSP meta ok 268 - HSP meta ok 269 ok 270 ok 271 - The object isa Bio::Search::Result::ResultI ok 272 - Result CMSEARCH ok 273 - Result CMSEARCH reference ok 274 - Result CMSEARCH version ok 275 - Result parameters ok 276 - Result statistics ok 277 - Result entries ok 278 - Result letters ok 279 - Result database_name ok 280 - Result num_hits ok 281 - Result program_reference ok 282 - Result query_accession ok 283 - Result query_description ok 284 - Result query_length ok 285 - Result query_name ok 286 - The object isa Bio::Search::Hit::HitI ok 287 - Hit GI ok 288 - Hit accession ok 289 - Hit algorithm ok 290 - Hit bits ok 291 - Hit description ok 292 - Hit locus ok 293 - Hit n ok 294 - Hit name ok 295 - Hit num_hsps ok 296 - No p values ok 297 - Hit length ok 298 - Hit overlap ok 299 - Hit query_length ok 300 - Hit rank ok 301 - Hit raw_score ok 302 - Hit score ok 303 ok 304 - The object isa Bio::Search::HSP::HSPI ok 305 - HSP algorithm ok 306 ok 307 - The object isa Bio::SeqFeature::Similarity ok 308 - The object isa Bio::SeqFeature::Similarity ok 309 ok 310 ok 311 - HSP frame ok 312 - HSP gaps ok 313 - Hit length ok 314 - The object isa Bio::Align::AlignI ok 315 - HSP hit isa Bio::SeqFeature::Similarity ok 316 - HSP hit_string ok 317 - HSP homology_string ok 318 - HSP hsp_group ok 319 - HSP hsp_length ok 320 - HSP length ok 321 - HSP links ok 322 - HSP n ok 323 - HSP pvalue ok 324 - HSP query isa Bio::SeqFeature::Similarity ok 325 - HSP query_string ok 326 - HSP range ok 327 - HSP rank ok 328 ok 329 - HSP end ok 330 - HSP expect ok 331 - The object isa Bio::LocatableSeq ok 332 - HSP seq_str ok 333 - HSP start ok 334 - HSP custom_score ok 335 - HSP meta ok 336 - HSP strand ok 337 - The object isa Bio::Search::HSP::HSPI ok 338 - HSP algorithm ok 339 ok 340 - The object isa Bio::SeqFeature::Similarity ok 341 - The object isa Bio::SeqFeature::Similarity ok 342 - HSP frame ok 343 - HSP gaps ok 344 - The object isa Bio::Align::AlignI ok 345 - HSP hit isa Bio::SeqFeature::Similarity ok 346 - HSP hit_string ok 347 - HSP homology_string ok 348 - HSP hsp_group ok 349 - HSP hsp_length ok 350 - HSP length ok 351 - HSP links ok 352 - HSP n ok 353 - HSP pvalue ok 354 - HSP query isa Bio::SeqFeature::Similarity ok 355 - HSP query_string ok 356 - HSP range ok 357 - HSP rank ok 358 ok 359 - HSP end ok 360 - HSP expect ok 361 - The object isa Bio::LocatableSeq ok 362 - HSP seq_str ok 363 - HSP start ok 364 - HSP custom_score ok 365 - HSP meta ok 366 - HSP strand ok 367 - The object isa Bio::Search::Hit::HitI ok 368 - Hit accession ok 369 - Hit GI ok 370 - Hit algorithm ok 371 - Hit bits ok 372 - Hit description ok 373 - Hit length ok 374 - Hit locus ok 375 - Hit n ok 376 - Hit name ok 377 - Hit num_hsps ok 378 - Hit overlap ok 379 - Hit query_length ok 380 - Hit rank ok 381 - Hit raw_score ok 382 - Hit score ok 383 ok 384 - The object isa Bio::Search::HSP::HSPI ok 385 - HSP algorithm ok 386 ok 387 - The object isa Bio::SeqFeature::Similarity ok 388 - The object isa Bio::SeqFeature::Similarity ok 389 - HSP frame ok 390 - HSP gaps ok 391 - The object isa Bio::Align::AlignI ok 392 - HSP hit isa Bio::SeqFeature::Similarity ok 393 - HSP hit_string ok 394 - HSP homology_string ok 395 - HSP hsp_group ok 396 - HSP hsp_length ok 397 - HSP length ok 398 - HSP links ok 399 - HSP n ok 400 - HSP query isa Bio::SeqFeature::Similarity ok 401 - HSP query_string ok 402 - HSP range ok 403 - HSP rank ok 404 ok 405 - HSP end ok 406 - HSP expect ok 407 - The object isa Bio::LocatableSeq ok 408 - HSP seq_str ok 409 - HSP start ok 410 - HSP custom_score ok 411 - HSP meta ok 412 - HSP strand ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 21. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 21. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 21. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 21. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 21. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 21. t/SearchIO/megablast.t ....................... 1..31 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 4. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 4. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 4. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 4. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 4. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 4. t/SearchIO/psl.t ............................. 1..53 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - next_hsp should be undef ok 51 - next_hit should be undef not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string # Failed (TODO) test 'next_result should be undef' # at t/SearchIO/psl.t line 97. # got: '' # expected: undef ok 53 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 199. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 199. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 199. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 199. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 199. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 199. t/SearchIO/rnamotif.t ........................ 1..60 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::Search::Result::ResultI ok 3 - Result RNAMOTIF ok 4 - Result RNAMOTIF reference ok 5 - Result RNAMOTIF version ok 6 - Result entries ok 7 - Result letters ok 8 - Result database_name ok 9 - Result num_hits ok 10 - Result program_reference ok 11 - Result query_accession ok 12 - Result query_description ok 13 - Result query_length ok 14 - Result query_name ok 15 - The object isa Bio::Search::Hit::HitI ok 16 - Hit accession ok 17 - Hit GI ok 18 - Hit algorithm ok 19 - Hit description ok 20 - Hit length ok 21 - Hit locus ok 22 - Hit n ok 23 - Hit name ok 24 - Hit num_hsps ok 25 - Hit overlap ok 26 - Hit rank ok 27 - Hit raw_score ok 28 - Hit score ok 29 ok 30 - The object isa Bio::Search::HSP::HSPI ok 31 - HSP algorithm ok 32 ok 33 - The object isa Bio::SeqFeature::Similarity ok 34 - The object isa Bio::SeqFeature::Similarity ok 35 - HSP frame ok 36 - HSP gaps ok 37 - RNAMotif get_aln warning ok 38 - HSP hit isa Bio::SeqFeature::Similarity ok 39 - HSP hit_string ok 40 - HSP homology_string ok 41 - HSP hsp_group ok 42 - HSP hsp_length ok 43 - HSP length ok 44 - HSP links ok 45 - HSP n ok 46 - HSP query isa Bio::SeqFeature::Similarity ok 47 - HSP query_string ok 48 - HSP range ok 49 - HSP rank ok 50 ok 51 - HSP end ok 52 - HSP expect ok 53 - The object isa Bio::LocatableSeq ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 - HSP strand ok 59 ok 60 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 6. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 6. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 6. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 6. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 6. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 6. t/SearchIO/sim4.t ............................ 1..102 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747. Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020. Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 13. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 13. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 13. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 13. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 13. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 13. t/SearchIO/waba.t ............................ 1..64 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::SearchIO ok 3 - query_name ok 4 - query database ok 5 - database name ok 6 - name ok 7 - hsps ok 8 - total length ok 9 - start ok 10 - end ok 11 - strand ok 12 - start ok 13 - end ok 14 - strand ok 15 - query string ok 16 - hit_string ok 17 - hmmstate string ok 18 ok 19 ok 20 ok 21 - total length ok 22 - start ok 23 - end ok 24 - strand ok 25 - start ok 26 - end ok 27 - strand ok 28 - query string ok 29 - hit_string ok 30 - hmmstate string ok 31 ok 32 ok 33 ok 34 - total length ok 35 - start ok 36 - end ok 37 - strand ok 38 - start ok 39 - end ok 40 - strand ok 41 - query string ok 42 - hit_string ok 43 - hmmstate string ok 44 ok 45 ok 46 ok 47 - query_name ok 48 - query database ok 49 - database name ok 50 - name ok 51 - hsps ok 52 - total length ok 53 - start ok 54 - end ok 55 - strand ok 56 - start ok 57 - end ok 58 - strand ok 59 - query string ok 60 - hit_string ok 61 - hmmstate string ok 62 ok 63 ok 64 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, chunk 2. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, chunk 2. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, chunk 2. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, chunk 2. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, chunk 2. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, chunk 2. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, chunk 2. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, chunk 2. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, chunk 2. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, chunk 2. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, chunk 2. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, chunk 2. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, chunk 2. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, chunk 2. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, chunk 2. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, chunk 2. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, chunk 2. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, chunk 2. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, chunk 2. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, chunk 2. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, chunk 2. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, chunk 2. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, chunk 2. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, chunk 2. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, chunk 2. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, chunk 2. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, chunk 2. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, chunk 2. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, chunk 2. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, chunk 2. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, chunk 2. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, chunk 2. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, chunk 2. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, chunk 2. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, chunk 2. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, chunk 2. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, chunk 2. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, chunk 2. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, chunk 2. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, chunk 2. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 3. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 3. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 3. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 3. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 3. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 3. t/SearchIO/wise.t ............................ 1..20 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok t/Seq/DBLink.t ............................... 1..131 ok 1 - use Bio::SeqIO; ok 2 - "swissprot:K1C9_HUMAN" ok 3 - no double colon ok 4 - no trailing colon ok 5 - no double space ok 6 - dblink value is splittable ok 7 - "GenBank:Z29074.1" ok 8 - no double colon ok 9 - no trailing colon ok 10 - no double space ok 11 - dblink value is splittable ok 12 - "GenPept:CAA82315.1" ok 13 - no double colon ok 14 - no trailing colon ok 15 - no double space ok 16 - dblink value is splittable ok 17 - "GenBank:S69510.1" ok 18 - no double colon ok 19 - no trailing colon ok 20 - no double space ok 21 - dblink value is splittable ok 22 - "GenPept:AAC60619.1" ok 23 - no double colon ok 24 - no trailing colon ok 25 - no double space ok 26 - dblink value is splittable ok 27 - "GenBank:X75015.1" ok 28 - no double colon ok 29 - no trailing colon ok 30 - no double space ok 31 - dblink value is splittable ok 32 - "GenPept:CAA52924.1" ok 33 - no double colon ok 34 - no trailing colon ok 35 - no double space ok 36 - dblink value is splittable ok 37 - "GenBank:AB001594.1" ok 38 - no double colon ok 39 - no trailing colon ok 40 - no double space ok 41 - dblink value is splittable ok 42 - "GenPept:BAA19418.1" ok 43 - no double colon ok 44 - no trailing colon ok 45 - no double space ok 46 - dblink value is splittable ok 47 - "GenBank:I37984" ok 48 - no double colon ok 49 - no trailing colon ok 50 - no double space ok 51 - dblink value is splittable ok 52 - "HSSP:P08670" ok 53 - no double colon ok 54 - no trailing colon ok 55 - no double space ok 56 - dblink value is splittable ok 57 - "IntAct:P35527" ok 58 - no double colon ok 59 - no trailing colon ok 60 - no double space ok 61 - dblink value is splittable ok 62 - "Ensembl:ENSG00000171403" ok 63 - no double colon ok 64 - no trailing colon ok 65 - no double space ok 66 - dblink value is splittable ok 67 - "KEGG:hsa:3857" ok 68 - no double colon ok 69 - no trailing colon ok 70 - no double space ok 71 - dblink value is splittable ok 72 - "HGNC:6447" ok 73 - no double colon ok 74 - no trailing colon ok 75 - no double space ok 76 - dblink value is splittable ok 77 - "MIM:144200" ok 78 - no double colon ok 79 - no trailing colon ok 80 - no double space ok 81 - dblink value is splittable ok 82 - "MIM:607606" ok 83 - no double colon ok 84 - no trailing colon ok 85 - no double space ok 86 - dblink value is splittable ok 87 - "ArrayExpress:P35527" ok 88 - no double colon ok 89 - no trailing colon ok 90 - no double space ok 91 - dblink value is splittable ok 92 - "GO:0005200" ok 93 - no double colon ok 94 - no trailing colon ok 95 - no double space ok 96 - dblink value is splittable ok 97 - "GO:0008544" ok 98 - no double colon ok 99 - no trailing colon ok 100 - no double space ok 101 - dblink value is splittable ok 102 - "InterPro:IPR011000" ok 103 - no double colon ok 104 - no trailing colon ok 105 - no double space ok 106 - dblink value is splittable ok 107 - "InterPro:IPR001664" ok 108 - no double colon ok 109 - no trailing colon ok 110 - no double space ok 111 - dblink value is splittable ok 112 - "InterPro:IPR002957" ok 113 - no double colon ok 114 - no trailing colon ok 115 - no double space ok 116 - dblink value is splittable ok 117 - "Pfam:PF00038" ok 118 - no double colon ok 119 - no trailing colon ok 120 - no double space ok 121 - dblink value is splittable ok 122 - "PRINTS:PR01248" ok 123 - no double colon ok 124 - no trailing colon ok 125 - no double space ok 126 - dblink value is splittable ok 127 - "PROSITE:PS00226" ok 128 - no double colon ok 129 - no trailing colon ok 130 - no double space ok 131 - dblink value is splittable ok t/Seq/EncodedSeq.t ........................... 1..37 ok 1 - use Bio::Seq::EncodedSeq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - The object isa Bio::Location::Simple ok 12 ok 13 ok 14 - The object isa Bio::Location::Simple ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok t/Seq/LargeLocatableSeq.t .................... 1..8 ok 1 - use Bio::Seq::LargeLocatableSeq; ok 2 ok 3 - The object isa Bio::Seq::LargeSeqI ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Seq/LargePSeq.t ............................ 1..30 ok 1 - use Bio::Seq::LargePrimarySeq; ok 2 - use Bio::Seq::LargeSeq; ok 3 - use Bio::Location::Simple; ok 4 - use Bio::Location::Fuzzy; ok 5 - use Bio::Location::Split; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 10 - Subseq is GGGGT ok 11 ok 12 ok 13 ok 14 - trunc seq was GGGGTGAA ok 15 ok 16 ok 17 ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 19 ok 20 - output via Bio::SeqIO::fasta ok 21 - Subseq is GGGGT ok 22 - trunc seq was GGGGTGAA ok 23 ok 24 ok 25 ok 26 - Sequence is ATGGGGTGGGGT ok 27 - Subseq is GGGGT ok 28 - trunc seq was GGGGT ok 29 ok 30 ok t/Seq/LocatableSeq.t ......................... 1..118 ok 1 - use Bio::LocatableSeq; ok 2 - use Bio::AlignIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - The object isa Bio::Location::Simple ok 13 ok 14 ok 15 - The object isa Bio::Location::Simple ok 16 ok 17 ok 18 ok 19 not ok 20 # TODO Need to fix columns before start of seq w/ start > 1 # Failed (TODO) test at t/Seq/LocatableSeq.t line 45. # got: 'Bio::Location::Simple=HASH(0x3278b00)' # expected: undef ok 21 ok 22 - The object isa Bio::AlignIO ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 - The object isa Bio::Location::Simple ok 50 ok 51 ok 52 - The object isa Bio::Location::Simple ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - * is counted in length ok 106 - * is counted in length, but end is wrong ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 not ok 117 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 301. # got: '\-\.=~' # expected: '-\?' not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 303. # got: '19' # expected: anything else ok t/Seq/MetaSeq.t .............................. 1..128 ok 1 - use Bio::Seq::Meta; ok 2 - use Bio::Seq::Meta::Array; ok 3 - use Bio::SeqIO; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Seq::Quality; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - aa-bb bb ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok t/Seq/PrimaryQual.t .......................... 1..35 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok t/Seq/PrimarySeq.t ........................... 1..87 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::Location::Split; ok 5 ok 6 - The object isa Bio::PrimarySeqI ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::IdentifiableI ok 15 - The object isa Bio::DescribableI ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - The object isa Bio::PrimarySeqI ok 30 ok 31 - The object isa Bio::PrimarySeqI ok 32 ok 33 - The object isa Bio::PrimarySeqI ok 34 ok 35 - The object isa Bio::PrimarySeqI ok 36 ok 37 ok 38 - alphabet copied through revcom not ok 39 - namespace copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms # Failed (TODO) test 'namespace copied through revcom' # at t/Seq/PrimarySeq.t line 110. # got: '' # expected: 't' not ok 40 - namespace_string copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms # Failed (TODO) test 'namespace_string copied through revcom' # at t/Seq/PrimarySeq.t line 111. # got: ':X677667' # expected: 't:X677667.47' not ok 41 - is_circular copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms # Failed (TODO) test 'is_circular copied through revcom' # at t/Seq/PrimarySeq.t line 113. # got: undef # expected: '0' ok 42 - Translation: LVAST ok 43 - Translation: MVAST ok 44 - Translation: MVAST ok 45 - Translation: MVAST* ok 46 - Translation: M* ok 47 - Translation: M ok 48 ok 49 - Translation: MWP ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 - Alphabet ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 - Bug 2438 ok 78 ok 79 - Bug \#2864 ok 80 - Terminator + inside sequence ok 81 ok 82 - _find_orfs 1 ok 83 - orfs are sorted by descending length ok 84 - got correct -orf => "longest" seq ok 85 - _find_orfs 1 ok 86 - orfs are sorted by descending length ok 87 - got correct -orf => "longest" seq ok t/Seq/PrimedSeq.t ............................ 1..10 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimedSeq; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok t/Seq/Quality.t .............................. 1..85 ok 1 - use Bio::Seq::Quality; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bug 2845 ok 73 ok 74 - Bug 2845 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok t/Seq/Seq.t .................................. 1..72 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::RichSeq; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Species; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 - truncated sequence length ok 11 - truncated sequence string ok 12 ok 13 ok 14 - alphabet ok 15 - id ok 16 - accession number ok 17 - subseq ok 18 - The object isa Bio::IdentifiableI ok 19 - The object isa Bio::DescribableI ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 - translated sequence ok 34 - translated sequence with explicit unambiguous codons ok 35 - translated sequence with unknown unambiguous codons ok 36 - translated sequence with unknown unambiguous codons, completed ok 37 - translated sequence with unambiguous codons ok 38 - translated sequence with unambiguous codons ok 39 - translated sequence with unknown unambiguous codons, completed ok 40 - translated sequence with unambiguous codons ok 41 - translated sequence with unknown unambiguous codons, completed ok 42 - translated sequence with stop ok 43 - translated sequence ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 - Bug \#2864 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok t/Seq/WithQuality.t .......................... 1..22 ok 1 - use Bio::Seq::SeqWithQuality; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - The object isa Bio::Seq::PrimaryQual ok 20 - The object isa Bio::PrimarySeq ok 21 ok 22 ok Subroutine new redefined at Bio\Seq.pm line 482. Subroutine seq redefined at Bio\Seq.pm line 568. Subroutine validate_seq redefined at Bio\Seq.pm line 595. Subroutine length redefined at Bio\Seq.pm line 610. Subroutine subseq redefined at Bio\Seq.pm line 634. Subroutine display_id redefined at Bio\Seq.pm line 664. Subroutine accession_number redefined at Bio\Seq.pm line 692. Subroutine desc redefined at Bio\Seq.pm line 708. Subroutine primary_id redefined at Bio\Seq.pm line 735. Subroutine can_call_new redefined at Bio\Seq.pm line 775. Subroutine alphabet redefined at Bio\Seq.pm line 797. Subroutine is_circular redefined at Bio\Seq.pm line 813. Subroutine object_id redefined at Bio\Seq.pm line 836. Subroutine version redefined at Bio\Seq.pm line 853. Subroutine authority redefined at Bio\Seq.pm line 870. Subroutine namespace redefined at Bio\Seq.pm line 887. Subroutine display_name redefined at Bio\Seq.pm line 910. Subroutine description redefined at Bio\Seq.pm line 930. Subroutine annotation redefined at Bio\Seq.pm line 952. Subroutine get_Annotations redefined at Bio\Seq.pm line 977. Subroutine add_Annotation redefined at Bio\Seq.pm line 1002. Subroutine remove_Annotations redefined at Bio\Seq.pm line 1017. Subroutine get_num_of_annotations redefined at Bio\Seq.pm line 1030. Subroutine num_Annotations redefined at Bio\Seq.pm line 1031. Subroutine get_SeqFeatures redefined at Bio\Seq.pm line 1064. Subroutine feature_count redefined at Bio\Seq.pm line 1111. Subroutine add_SeqFeature redefined at Bio\Seq.pm line 1136. Subroutine remove_SeqFeatures redefined at Bio\Seq.pm line 1170. Subroutine id redefined at Bio\Seq.pm line 1243. Subroutine primary_seq redefined at Bio\Seq.pm line 1266. Subroutine species redefined at Bio\Seq.pm line 1299. Subroutine DESTROY redefined at Bio\Seq.pm line 1313. Subroutine all_SeqFeatures redefined at Bio\Seq.pm line 1328. Subroutine accession redefined at Bio\Seq.pm line 1332. Subroutine Bio::Seq::flush_SeqFeature redefined at Bio\Seq.pm line 1321. Subroutine Bio::Seq::flush_SeqFeatures redefined at Bio\Seq.pm line 1322. Subroutine Bio::Seq::top_SeqFeatures redefined at Bio\Seq.pm line 1325. t/SeqEvolution.t ............................. 1..39 ok 1 - use Bio::SeqEvolution::Factory; ok 2 - use Bio::PrimarySeq; ok 3 ok 4 - The object isa Bio::SeqEvolution::DNAPoint ok 5 ok 6 - The object isa Bio::SeqEvolution::DNAPoint ok 7 ok 8 - The object isa Bio::SeqEvolution::DNAPoint ok 9 ok 10 ok 11 - get rate() ok 12 - get and set rate() ok 13 - identity() ok 14 - identity() ok 15 - pam() ok 16 - pam() ok 17 - mutation_count() ok 18 - mutation_count() ok 19 - seq_type() ok 20 - seq_type() ok 21 - next_seq() ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - each_mutation() ok 28 ok 29 ok 30 - get_alignment_identity() ok 31 ok 32 ok 33 - get_mutation_counter() ok 34 - get_sequence_counter() ok 35 - reset_sequence_counter() ok 36 - get_sequence_counter() == 0 ok 37 ok 38 ok 39 - The object isa Bio::SimpleAlign ok t/SeqFeature/Clone.t ......................... 1..17 ok 1 - clone() ok 2 - start() clone set ok 3 - start() clone get ok 4 - start() original unchanged ok 5 - clone() with arguments ok 6 - start() orig get ok 7 - end() orig get ok 8 - start() clone get ok 9 - end() clone get ok 10 - start() clone set ok 11 - start() clone get ok 12 - start() original unchanged ok 13 - location() Bio::Location::Split ok 14 - clone() ok 15 - start() clone set ok 16 - start() clone get ok 17 - start() original unchanged ok t/SeqFeature/FeatureIO.t ..................... 1..47 ok 1 - use Bio::FeatureIO; ok 2 ok 3 not ok 4 # TODO How did this ever work?!? # Failed (TODO) test at t/SeqFeature/FeatureIO.t line 43. # got: 'TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC' # expected: 'Test1' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 not ok 13 # TODO How did this ever work?!? # Failed (TODO) test at t/SeqFeature/FeatureIO.t line 103. # got: 'GATTACAGATTACA' # expected: 'Test1' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 not ok 24 # TODO How did this ever work?!? # Failed (TODO) test at t/SeqFeature/FeatureIO.t line 173. # got: 'GATTACAGATTACA' # expected: 'Test1' ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - vecscreen_simple gets the correct features ok 46 ok 47 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044. t/SeqFeature/Location.t ...................... 1..103 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Location::Split; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::SeqFeature::SimilarityPair; ok 6 - use Bio::SeqFeature::FeaturePair; ok 7 - The object isa Bio::LocationI ok 8 - The object isa Bio::RangeI ok 9 - Bio::Location::Simple tests ok 10 ok 11 ok 12 ok 13 ok 14 - Bio::SeqFeature::Generic isa Bio::SeqFeatureI ok 15 - The object isa Bio::RangeI ok 16 ok 17 ok 18 - Bio::SeqFeature::FeaturePair tests ok 19 ok 20 ok 21 ok 22 - Bio::SeqFeature::Generic tests ok 23 ok 24 - Bio::Location::Fuzzy tests ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 - Bio::Location::Split tests ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - Bugfix 1074 ok 56 ok 57 ok 58 ok 59 - Positive length ok 60 ok 61 - seq_id() on Bio::Location::Split ok 62 ok 63 ok 64 - The object isa Bio::LocationI ok 65 - The object isa Bio::RangeI ok 66 - Bio::Location::Simple EXACT ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bio::Location::Simple IN-BETWEEN ok 73 ok 74 ok 75 ok 76 ok 77 - Testing error handling ok 78 ok 79 ok 80 ok 81 - use Bio::Location::WidestCoordPolicy; ok 82 - use Bio::Location::NarrowestCoordPolicy; ok 83 - use Bio::Location::AvWithinCoordPolicy; ok 84 - Default coodinate policy ok 85 ok 86 ok 87 ok 88 - The object isa Bio::Location::WidestCoordPolicy ok 89 - Narrowest coodinate policy ok 90 ok 91 ok 92 ok 93 - The object isa Bio::Location::NarrowestCoordPolicy ok 94 - Average coodinate policy ok 95 ok 96 ok 97 ok 98 - The object isa Bio::Location::AvWithinCoordPolicy ok 99 - Widest coodinate policy ok 100 ok 101 ok 102 ok 103 - The object isa Bio::Location::WidestCoordPolicy ok t/SeqFeature/LocationFactory.t ............... 1..272 ok 1 - use Bio::Factory::FTLocationFactory; ok 2 - The object isa Bio::Factory::LocationFactoryI ok 3 - Bio::Location::Simple ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - Location String: J00194:100..202 ok 13 ok 14 - Bio::Location::Fuzzy ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - Location String: 1..? ok 24 ok 25 - Bio::Location::Fuzzy ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - Location String: (122.133)..(204.221) ok 35 ok 36 - Bio::Location::Fuzzy ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Location String: (102.110) ok 46 ok 47 - Bio::Location::Simple ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - Location String: 340..565 ok 57 ok 58 - Bio::Location::Split ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - Location String: join(12..78,134..202) ok 68 ok 69 - Bio::Location::Fuzzy ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Location String: ?..? ok 79 ok 80 - Bio::Location::Fuzzy ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - Location String: <345..500 ok 90 ok 91 - Bio::Location::Fuzzy ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 - Location String: ?22..?64 ok 101 ok 102 - Bio::Location::Simple ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 - Location String: J00194:100..202 ok 112 ok 113 - Bio::Location::Simple ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 - Location String: 467 ok 123 ok 124 - Bio::Location::Fuzzy ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 - Location String: (23.45)..600 ok 134 ok 135 - Bio::Location::Simple ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 - Location String: 123^124 ok 145 ok 146 - Bio::Location::Fuzzy ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - Location String: <1..? ok 156 ok 157 - Bio::Location::Fuzzy ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 - Location String: 145^177 ok 167 ok 168 - Bio::Location::Fuzzy ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 - Location String: 22..?64 ok 178 ok 179 - Bio::Location::Fuzzy ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 - Location String: complement(34..(122.126)) ok 189 ok 190 - Bio::Location::Split ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - Location String: complement(join(4918..5163,2691..4571)) ok 200 ok 201 - Bio::Location::Split ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599) ok 211 ok 212 - Bio::Location::Fuzzy ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 - Location String: ?..>393 ok 222 ok 223 - Bio::Location::Fuzzy ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 - Location String: ?2465..2774 ok 233 ok 234 - Bio::Location::Fuzzy ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 - Location String: (122.133)..(204.221) ok 244 ok 245 - Bio::Location::Fuzzy ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 - Location String: ?..536 ok 255 ok 256 - Bio::Location::Fuzzy ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 - Location String: <1..888 ok 266 ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294))) ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081))) ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669))) ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672))) ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000) ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19)) ok t/SeqFeature/Primer.t ........................ 1..18 ok 1 - use Bio::SeqFeature::Primer; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/SeqFeature/Range.t ......................... 1..49 ok 1 - use Bio::Range; ok 2 - BioRange object isa Bio::Range ok 3 ok 4 - BioRange object isa Bio::Range ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - BioRange object isa Bio::Range ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - BioRange object isa Bio::Range ok 26 - BioRange object isa Bio::Range ok 27 - BioRange object isa Bio::Range ok 28 - 1 & -1 ok 29 - 1 & 1 true ok 30 - 1 & 0 true ok 31 - 1 & -1 false ok 32 - 1 & 1 true ok 33 - 1 & 0 false ok 34 - 1 & -1 false ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Bio::Range object isa Bio::Range ok 46 ok 47 ok 48 ok 49 ok t/SeqFeature/RangeI.t ........................ 1..45 ok 1 - use Bio::SeqFeature::Generic; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 - subtract() of split features ok 40 - 0 start ok 41 - 0 end ok 42 - 1 start ok 43 - 1 end ok 44 - 2 start ok 45 - 2 end ok t/SeqFeature/SeqAnalysisParser.t ............. 1..14 ok 1 - use Bio::Factory::SeqAnalysisParserFactory; ok 2 - use Bio::SeqIO; ok 3 - The object isa Bio::SeqIO ok 4 - The object isa Bio::PrimarySeqI ok 5 - The object isa Bio::SeqAnalysisParserI ok 6 ok 7 ok 8 ok 9 - The object isa Bio::PrimarySeqI ok 10 - The object isa Bio::SeqAnalysisParserI ok 11 ok 12 ok 13 - The object isa Bio::SeqAnalysisParserI ok 14 ok t/SeqFeature/SeqFeatAnnotated.t .............. skipped: Network tests have not been requested t/SeqFeature/SeqFeatCollection.t ............. skipped: The optional module DB_File (or dependencies thereof) was not installed Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044. t/SeqFeature/SeqFeature.t .................... 1..249 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::SeqFeature::FeaturePair; ok 5 - use Bio::SeqFeature::Computation; ok 6 - use Bio::SeqFeature::Gene::Transcript; ok 7 - use Bio::SeqFeature::Gene::UTR; ok 8 - use Bio::SeqFeature::Gene::Exon; ok 9 - use Bio::SeqFeature::Gene::Poly_A_site; ok 10 - use Bio::SeqFeature::Gene::GeneStructure; ok 11 - use Bio::Location::Fuzzy; ok 12 - start of feature location ok 13 - end of feature location ok 14 - primary tag ok 15 - source tag ok 16 - undef phase by default ok 17 - phase accessor returns ok 18 - phase is persistent ok 19 ok 20 - set phase from constructor ok 21 ok 22 - feature1 of pair stored ok 23 - feature2 of pair stored ok 24 - feature start ok 25 - feature end ok 26 - primary tag ok 27 - source tag ok 28 - hstart ok 29 - hend ok 30 - hprimary tag ok 31 - hsource tag ok 32 - inverted end ok 33 ok 34 - seq string ok 35 - sf1 end ok 36 - sf1 start ok 37 ok 38 - sf2 ok 39 ok 40 - computation id ok 41 - score value ok 42 ok 43 ok 44 - sft[0] is exon ok 45 ok 46 - computation id ok 47 ok 48 - score value ok 49 - sfeat start for EXPAND-ED feature (bug \#947) ok 50 - sfeat end for EXPAND-ED feature (bug \#947) ok 51 ok 52 - can create feature starting and ending at 0 ok 53 ok 54 - can create feature starting and ending at 0 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 - mRNA spliced length ok 75 - has 2 UTRs ok 76 ok 77 ok 78 ok 79 ok 80 - The object isa Bio::SeqIO ok 81 - The object isa Bio::Seq ok 82 # skip Network tests have not been requested ok 83 # skip Network tests have not been requested ok 84 # skip Network tests have not been requested ok 85 # skip Network tests have not been requested ok 86 # skip Network tests have not been requested ok 87 - The object isa Bio::SeqIO ok 88 - The object isa Bio::Seq ok 89 # skip Network tests have not been requested ok 90 # skip Network tests have not been requested ok 91 - The object isa Bio::SeqIO ok 92 - spliced seq translation matches expected ok 93 - spliced seq translation matches expected ok 94 - spliced seq translation matches expected ok 95 - spliced seq translation matches expected ok 96 - spliced seq translation matches expected ok 97 - spliced seq translation matches expected ok 98 - spliced seq translation matches expected ok 99 - spliced seq translation matches expected ok 100 - spliced seq translation matches expected ok 101 - spliced seq translation matches expected ok 102 - spliced seq translation matches expected ok 103 - spliced seq translation matches expected ok 104 - spliced seq translation matches expected ok 105 - spliced seq translation matches expected ok 106 - spliced seq translation matches expected ok 107 - spliced seq translation matches expected ok 108 - spliced seq translation matches expected ok 109 - spliced seq translation matches expected ok 110 - spliced seq translation matches expected ok 111 - spliced seq translation matches expected ok 112 - spliced seq translation matches expected ok 113 - spliced seq translation matches expected ok 114 - spliced seq translation matches expected ok 115 - spliced seq translation matches expected ok 116 - spliced seq translation matches expected ok 117 - spliced seq translation matches expected ok 118 - spliced seq translation matches expected ok 119 - spliced seq translation matches expected ok 120 - spliced seq translation matches expected ok 121 - spliced seq translation matches expected ok 122 - spliced seq translation matches expected ok 123 - spliced seq translation matches expected ok 124 - spliced seq translation matches expected ok 125 - spliced seq translation matches expected ok 126 - spliced seq translation matches expected ok 127 - spliced seq translation matches expected ok 128 - spliced seq translation matches expected ok 129 - spliced seq translation matches expected ok 130 - spliced seq translation matches expected ok 131 - spliced seq translation matches expected ok 132 - spliced seq translation matches expected ok 133 - spliced seq translation matches expected ok 134 - spliced seq translation matches expected ok 135 - spliced seq translation matches expected ok 136 - spliced seq translation matches expected ok 137 - spliced seq translation matches expected ok 138 - spliced seq translation matches expected ok 139 - spliced seq translation matches expected ok 140 - spliced seq translation matches expected ok 141 - spliced seq translation matches expected ok 142 - spliced seq translation matches expected ok 143 - spliced seq translation matches expected ok 144 - spliced seq translation matches expected ok 145 - spliced seq translation matches expected ok 146 - spliced seq translation matches expected ok 147 - spliced seq translation matches expected ok 148 - spliced seq translation matches expected ok 149 - spliced seq translation matches expected ok 150 - spliced seq translation matches expected ok 151 - spliced seq translation matches expected ok 152 - spliced seq translation matches expected ok 153 - spliced seq translation matches expected ok 154 - spliced seq translation matches expected ok 155 - spliced seq translation matches expected ok 156 - spliced seq translation matches expected ok 157 - spliced seq translation matches expected ok 158 - spliced seq translation matches expected ok 159 - spliced seq translation matches expected ok 160 - spliced seq translation matches expected ok 161 - spliced seq translation matches expected ok 162 - spliced seq translation matches expected ok 163 - spliced seq translation matches expected ok 164 - spliced seq translation matches expected ok 165 - spliced seq translation matches expected ok 166 - spliced seq translation matches expected ok 167 - spliced seq translation matches expected ok 168 - spliced seq translation matches expected ok 169 - spliced seq translation matches expected ok 170 - spliced seq translation matches expected ok 171 - spliced seq translation matches expected ok 172 - spliced seq translation matches expected ok 173 - spliced seq translation matches expected ok 174 - spliced seq translation matches expected ok 175 - spliced seq translation matches expected ok 176 - spliced seq translation matches expected ok 177 - spliced seq translation matches expected ok 178 - spliced seq translation matches expected ok 179 - spliced seq translation matches expected ok 180 - spliced seq translation matches expected ok 181 - spliced seq translation matches expected ok 182 - spliced seq translation matches expected ok 183 - spliced seq translation matches expected ok 184 - spliced seq translation matches expected ok 185 - spliced seq translation matches expected ok 186 - spliced seq translation matches expected ok 187 - spliced seq translation matches expected ok 188 - spliced seq translation matches expected ok 189 - spliced seq translation matches expected ok 190 - spliced seq translation matches expected ok 191 - spliced seq translation matches expected ok 192 - spliced seq translation matches expected ok 193 - spliced seq translation matches expected ok 194 - spliced seq translation matches expected ok 195 - spliced seq translation matches expected ok 196 - spliced seq translation matches expected ok 197 - spliced seq translation matches expected ok 198 - spliced seq translation matches expected ok 199 - spliced seq translation matches expected ok 200 - spliced seq translation matches expected ok 201 - spliced seq translation matches expected ok 202 - spliced seq translation matches expected ok 203 - spliced seq translation matches expected ok 204 - spliced seq translation matches expected ok 205 - spliced seq translation matches expected ok 206 - spliced seq translation matches expected ok 207 - spliced seq translation matches expected ok 208 - spliced seq translation matches expected ok 209 ok 210 - phase check ok 211 ok 212 - phase check ok 213 ok 214 - phase check ok 215 ok 216 - phase check ok 217 ok 218 - phase check ok 219 - tags found ok 220 - get_tagset_values tag values found ok 221 - get_tagset_values tag values for multiple tags found ok 222 - get_tag_values tag values found ok 223 - get_tag_values lives with tag ok 224 - get_tagset_values no tag values found ok 225 - get_tagset_values lives with no tag ok 226 - get_tag_values throws with no tag ok 227 - Phi-X174 genome is circular ok 228 - only 3 split locations ok 229 - The object isa Bio::Location::SplitLocationI ok 230 - feature string ok 231 - first ten nucleotides ok 232 - strand not ok 233 - start # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'start' # at t/SeqFeature/SeqFeature.t line 421. # got: '1' # expected: '3981' not ok 234 - end # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'end' # at t/SeqFeature/SeqFeature.t line 422. # got: '5386' # expected: '136' not ok 235 - expected length # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'expected length' # at t/SeqFeature/SeqFeature.t line 423. # got: '5386' # expected: '1542' ok 236 - The object isa Bio::Location::SplitLocationI ok 237 - feature string ok 238 - first ten nucleotides ok 239 - strand not ok 240 - start # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'start' # at t/SeqFeature/SeqFeature.t line 421. # got: '1' # expected: '4497' not ok 241 - end # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'end' # at t/SeqFeature/SeqFeature.t line 422. # got: '5386' # expected: '136' not ok 242 - expected length # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'expected length' # at t/SeqFeature/SeqFeature.t line 423. # got: '5386' # expected: '1026' ok 243 - The object isa Bio::Location::SplitLocationI ok 244 - feature string ok 245 - first ten nucleotides ok 246 - strand not ok 247 - start # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'start' # at t/SeqFeature/SeqFeature.t line 421. # got: '1' # expected: '5075' not ok 248 - end # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'end' # at t/SeqFeature/SeqFeature.t line 422. # got: '5386' # expected: '136' not ok 249 - expected length # TODO Need to define how to deal with start, end length for circular sequences # Failed (TODO) test 'expected length' # at t/SeqFeature/SeqFeature.t line 423. # got: '5386' # expected: '363' ok t/SeqFeature/SeqFeaturePrimer.t .............. 1..8 ok 1 - use Bio::SeqFeature::Primer; ok 2 - The object isa Bio::SeqFeature::Primer ok 3 - The object isa Bio::SeqFeature::Primer ok 4 - The object isa Bio::Seq ok 5 ok 6 ok 7 ok 8 ok t/SeqFeature/Unflattener.t ................... 1..10 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Tools::Unflattener; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok t/SeqFeature/Unflattener2.t .................. 1..12 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Tools::Unflattener; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok t/SeqIO/Handler.t ............................ 1..561 ok 1 - use Bio::SeqIO; ok 2 - AI129902 ok 3 ok 4 ok 5 ok 6 - NT_021877 ok 7 ok 8 ok 9 ok 10 ok 11 - BAB68554 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - operator overloading in AnnotationI is deprecated ok 22 - NC_006346 ok 23 ok 24 ok 25 - U71225 ok 26 ok 27 - AB077698 ok 28 ok 29 - DQ018368 ok 30 - D10483 ok 31 ok 32 ok 33 ok 34 - bug 1487 ok 35 ok 36 - bug 1647 ok 37 ok 38 ok 39 - bug 1673 ok 40 ok 41 ok 42 ok 43 - AF165282 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - species parsing incorrect for genbank ok 53 - genus duplicated in genbank parsing ok 54 ok 55 ok 56 - species parsing incorrect for genbank ok 57 - genus duplicated in genbank parsing ok 58 ok 59 ok 60 - species parsing incorrect for genbank ok 61 - genus duplicated in genbank parsing ok 62 ok 63 - streaming ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 - Total number of sequences in test file ok 70 ok 71 - Fuzzy in ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 - Fuzzy out ok 84 - BK000016 ok 85 ok 86 - BK000016 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 - BK000016 ok 102 - roundtrip ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 - revcomp split location ok 121 - Bug 1925 ok 122 ok 123 ok 124 - wgs ok 125 ok 126 - wgs_scafld ok 127 ok 128 - wgs_scafld ok 129 ok 130 ok 131 - BC000007 ok 132 - BK000016-tpa.gbk ok 133 - ay116458.gb ok 134 - ay149291.gb ok 135 - NC_006346.gb ok 136 - ay007676.gb ok 137 - dq519393.gb ok 138 ok 139 - swissprot:K1C9_HUMAN ok 140 ok 141 - swissprot ok 142 ok 143 - GenBank:Z29074.1 ok 144 ok 145 - GenBank ok 146 ok 147 - GenPept:CAA82315.1 ok 148 ok 149 - GenPept ok 150 ok 151 - GenBank:S69510.1 ok 152 ok 153 - GenBank ok 154 ok 155 - GenPept:AAC60619.1 ok 156 ok 157 - GenPept ok 158 ok 159 - GenBank:X75015.1 ok 160 ok 161 - GenBank ok 162 ok 163 - GenPept:CAA52924.1 ok 164 ok 165 - GenPept ok 166 ok 167 - GenBank:AB001594.1 ok 168 ok 169 - GenBank ok 170 ok 171 - GenPept:BAA19418.1 ok 172 ok 173 - GenPept ok 174 ok 175 - GenBank:I37984 ok 176 ok 177 - GenBank ok 178 ok 179 - HSSP:P08670 ok 180 ok 181 - HSSP ok 182 ok 183 - IntAct:P35527 ok 184 ok 185 - IntAct ok 186 ok 187 - Ensembl:ENSG00000171403 ok 188 ok 189 - Ensembl ok 190 ok 191 - KEGG:hsa:3857 ok 192 ok 193 - KEGG ok 194 ok 195 - HGNC:6447 ok 196 ok 197 - HGNC ok 198 ok 199 - MIM:144200 ok 200 ok 201 - MIM ok 202 ok 203 - MIM:607606 ok 204 ok 205 - MIM ok 206 ok 207 - ArrayExpress:P35527 ok 208 ok 209 - ArrayExpress ok 210 ok 211 - GO:0005200 ok 212 ok 213 - GO ok 214 ok 215 - GO:0008544 ok 216 ok 217 - GO ok 218 ok 219 - InterPro:IPR011000 ok 220 ok 221 - InterPro ok 222 ok 223 - InterPro:IPR001664 ok 224 ok 225 - InterPro ok 226 ok 227 - InterPro:IPR002957 ok 228 ok 229 - InterPro ok 230 ok 231 - Pfam:PF00038 ok 232 ok 233 - Pfam ok 234 ok 235 - PRINTS:PR01248 ok 236 ok 237 - PRINTS ok 238 ok 239 - PROSITE:PS00226 ok 240 ok 241 - PROSITE ok 242 ok 243 - Bug 2195 ok 244 - Bug 2195 ok 245 - The object isa Bio::Annotation::SimpleValue ok 246 ok 247 - The object isa Bio::Annotation::SimpleValue ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 - success reading Embl with ^ location and badly split double quotes ok 274 ok 275 ok 276 - success writing Embl format with ^ < and > locations ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 - genus duplication test ok 310 ok 311 ok 312 - The object isa Bio::SeqIO ok 313 - The object isa Bio::Species ok 314 ok 315 ok 316 - operator overloading in AnnotationI is deprecated ok 317 ok 318 - dates ok 319 - dates ok 320 - dates ok 321 ok 322 - The object isa Bio::Seq::RichSeqI ok 323 ok 324 ok 325 ok 326 - operator overloading in AnnotationI is deprecated ok 327 ok 328 ok 329 ok 330 ok 331 - id is ROA1_HUMAN ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 - operator overloading in AnnotationI is deprecated ok 340 ok 341 ok 342 ok 343 - The object isa Bio::Seq::RichSeqI ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 - operator overloading in AnnotationI is deprecated ok 354 ok 355 ok 356 ok 357 - GC1QBP ok 358 - HABP1 ok 359 - SF2P32 ok 360 - C1QBP ok 361 ok 362 - The object isa Bio::Seq::RichSeqI ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 - F54H12.1 ok 370 - The object isa Bio::Seq::RichSeqI ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 - The object isa Bio::Seq::RichSeqI ok 383 ok 384 ok 385 ok 386 ok 387 - The object isa Bio::Seq::RichSeqI ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 - The object isa Bio::Seq::RichSeqI ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 - The object isa Bio::Species ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 - The object isa Bio::Species ok 518 ok 519 ok 520 - operator overloading in AnnotationI is deprecated ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 - P39765 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 - operator overloading in AnnotationI is deprecated ok t/SeqIO/MultiFile.t .......................... 1..3 ok 1 - use Bio::SeqIO::MultiFile; ok 2 ok 3 ok t/SeqIO/Multiple_fasta.t ..................... 1..9 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - all sequences in the file ok t/SeqIO/SeqBuilder.t ......................... 1..101 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - The object isa Bio::Factory::ObjectBuilderI ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok t/SeqIO/SeqIO.t .............................. 1..45 ok 1 - use Bio::SeqIO; ok 2 ok 3 - ID for format gcg ok 4 ok 5 ok 6 ok 7 ok 8 - ID for format fasta ok 9 ok 10 ok 11 ok 12 - accession.version ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - ID for format pir ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - ID for format tab ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - ID for format ace ok 32 ok 33 ok 34 ok 35 ok 36 - use Algorithm::Diff; ok 37 - use IO::ScalarArray; ok 38 - use IO::String; ok 39 ok 40 ok 41 not ok 42 - Must pass a file or file handle # TODO file/fh-based tests should be in Bio::Root::IO, see issue #3204 # Failed (TODO) test 'Must pass a file or file handle' # at t/SeqIO/SeqIO.t line 120. # expecting: Regexp ((?-xism:No file, fh, or string argument provided)) # found: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: Could not guess format from file/fh # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 # STACK: Bio::SeqIO::new Bio/SeqIO.pm:389 # STACK: try{} block t/SeqIO/SeqIO.t:119 # STACK: Sub::Uplevel::uplevel C:\cpanfly\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly\var\megalib/Test/Exception.pm:103 # STACK: Test::Exception::throws_ok C:\cpanfly\var\megalib/Test/Exception.pm:179 # STACK: t/SeqIO/SeqIO.t:120 # ----------------------------------------------------------- # ) ok 43 - Must pass a file or file handle ok 44 - Must pass a file or file handle ok 45 - Must pass a real file ok t/SeqIO/Splicedseq.t ......................... 1..14 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - get_SeqFeatures() ok 12 - protein sequence ok 13 - nucleotide sequence - correct CDS range ok 14 - nucleotide length ok t/SeqIO/abi.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/ace.t ................................ 1..7 ok 1 - use Bio::SeqIO; ok 2 - number of sequence objects ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters ok 4 - alphabets detected ok 5 - alphabets detected ok 6 - writing sequence ok 7 - test output ok t/SeqIO/agave.t .............................. 1..8 ok 1 - use Bio::SeqIO::agave; not ok 2 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 3 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 4 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 5 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 6 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 7 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 8 # TODO & SKIP No tests for agave format -- no sample file to test against ok t/SeqIO/alf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/asciitree.t .......................... 1..2 ok 1 - use Bio::SeqIO; ok 2 - File exists, has contents on MSWin32 ok Subroutine next_seq redefined at Bio\SeqIO\bsml.pm line 187. Subroutine GETFLOPPIES redefined at Bio\SeqIO\bsml.pm line 428. Subroutine FLOPPYVALS redefined at Bio\SeqIO\bsml.pm line 444. Subroutine FIRSTDATA redefined at Bio\SeqIO\bsml.pm line 464. Subroutine STRIP redefined at Bio\SeqIO\bsml.pm line 481. Subroutine to_bsml redefined at Bio\SeqIO\bsml.pm line 547. Subroutine write_seq redefined at Bio\SeqIO\bsml.pm line 846. Subroutine _parse_location redefined at Bio\SeqIO\bsml.pm line 894. Subroutine _parse_bsml_feature redefined at Bio\SeqIO\bsml.pm line 947. Subroutine _parse_bsml_location redefined at Bio\SeqIO\bsml.pm line 1026. Subroutine _parse_reference redefined at Bio\SeqIO\bsml.pm line 1083. Subroutine _parse_annotation redefined at Bio\SeqIO\bsml.pm line 1149. Subroutine _parse_annotation_old redefined at Bio\SeqIO\bsml.pm line 1221. Subroutine _add_page redefined at Bio\SeqIO\bsml.pm line 1266. Subroutine _addel redefined at Bio\SeqIO\bsml.pm line 1305. Subroutine _show_dna redefined at Bio\SeqIO\bsml.pm line 1329. Subroutine _initialize redefined at Bio\SeqIO\bsml.pm line 1349. Subroutine _parseparams redefined at Bio\SeqIO\bsml.pm line 1388. Subroutine _parse_xml redefined at Bio\SeqIO\bsml.pm line 1415. Subroutine DESTROY redefined at Bio\SeqIO\bsml.pm line 1428. t/SeqIO/bsml.t ............................... 1..16 ok 1 - use XML::DOM; ok 2 - use Bio::SeqIO::bsml; ok 3 - The object isa Bio::Seq::RichSeqI ok 4 - got correct number of refs ok 5 - display_id ok 6 - molecule ok 7 - is_circular ok 8 - dates ok 9 - accession_number ok 10 - seq_version ok 11 - got correct number of SeqFeatures ok 12 - feature start ok 13 - feature end ok 14 - get_tag_values db_xref ok 15 - get_Annotations reference ok 16 - get_Annotations dblink ok t/SeqIO/bsml_sax.t ........................... 1..15 ok 1 - use Bio::SeqIO; ok 2 - The object isa Bio::Seq::RichSeqI ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SeqIO/chadoxml.t ........................... 1..8 ok 1 - use Bio::SeqIO::chadoxml; not ok 2 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 3 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 4 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 5 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 6 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 7 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 8 # TODO & SKIP No tests for chadoxml format -- no sample file to test against ok t/SeqIO/chaos.t .............................. 1..8 ok 1 - use Bio::SeqIO::chaos; not ok 2 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 3 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 4 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 5 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 6 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 7 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 8 # TODO & SKIP No tests for chaos format -- no sample file to test against ok t/SeqIO/chaosxml.t ........................... 1..2 ok 1 - use Bio::SeqIO; ok 2 ok t/SeqIO/ctf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\embl.pm line 154. Subroutine next_seq redefined at Bio\SeqIO\embl.pm line 179. Subroutine _write_ID_line redefined at Bio\SeqIO\embl.pm line 494. Subroutine _is_valid_division redefined at Bio\SeqIO\embl.pm line 571. Subroutine _is_valid_molecule_type redefined at Bio\SeqIO\embl.pm line 604. Subroutine write_seq redefined at Bio\SeqIO\embl.pm line 637. Subroutine _print_EMBL_FTHelper redefined at Bio\SeqIO\embl.pm line 935. Subroutine _read_EMBL_Contig redefined at Bio\SeqIO\embl.pm line 999. Subroutine _read_EMBL_References redefined at Bio\SeqIO\embl.pm line 1030. Subroutine _read_EMBL_Species redefined at Bio\SeqIO\embl.pm line 1098. Subroutine _read_EMBL_DBLink redefined at Bio\SeqIO\embl.pm line 1205. Subroutine _read_EMBL_TaxID_DBLink redefined at Bio\SeqIO\embl.pm line 1239. Subroutine _filehandle redefined at Bio\SeqIO\embl.pm line 1272. Subroutine _read_FTHelper_EMBL redefined at Bio\SeqIO\embl.pm line 1293. Subroutine _write_line_EMBL redefined at Bio\SeqIO\embl.pm line 1418. Subroutine _write_line_EMBL_regex redefined at Bio\SeqIO\embl.pm line 1454. Subroutine _post_sort redefined at Bio\SeqIO\embl.pm line 1506. Subroutine _show_dna redefined at Bio\SeqIO\embl.pm line 1527. Subroutine _id_generation_func redefined at Bio\SeqIO\embl.pm line 1548. Subroutine _ac_generation_func redefined at Bio\SeqIO\embl.pm line 1569. Subroutine _sv_generation_func redefined at Bio\SeqIO\embl.pm line 1590. Subroutine _kw_generation_func redefined at Bio\SeqIO\embl.pm line 1611. t/SeqIO/embl.t ............................... 1..95 ok 1 - use Bio::SeqIO::embl; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - success reading Embl with ^ location and badly split double quotes ok 25 ok 26 - success writing Embl format with ^ < and > locations ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - genus duplication test ok 55 ok 56 ok 57 ok 58 ok 59 - CDS - accession on PA line ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - CDS - OX tagname ok 68 - CDS - OX database ok 69 - CDS - OX primary_id ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 - Check if product was parsed correctly ok 86 - Parse long qualifier ok 87 ok 88 - TaxID set correctly ok 89 - The read sequence has a species object ok 90 - NCBI TaxID has roundtripped ok 91 - Name has roundtripped ok 92 - TaxID set correctly ok 93 - The read sequence has a species object ok 94 - The taxid of the source feature overrides that of the OX line ok 95 - Name has roundtripped ok t/SeqIO/entrezgene.t ......................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\excel.pm line 133. Subroutine worksheet redefined at Bio\SeqIO\excel.pm line 165. Subroutine close redefined at Bio\SeqIO\excel.pm line 194. Subroutine _worksheet redefined at Bio\SeqIO\excel.pm line 223. Subroutine _next_record redefined at Bio\SeqIO\excel.pm line 248. Subroutine _get_row_values redefined at Bio\SeqIO\excel.pm line 295. t/SeqIO/excel.t .............................. 1..4 ok 1 - use Bio::SeqIO::excel; ok 2 - The object isa Bio::SeqIO ok 3 - Bio::SeqIO::excel->can('next_seq') ok 4 - Bio::SeqIO::excel->can('write_seq') ok t/SeqIO/exp.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\fasta.pm line 91. Subroutine next_seq redefined at Bio\SeqIO\fasta.pm line 111. Subroutine write_seq redefined at Bio\SeqIO\fasta.pm line 192. Subroutine width redefined at Bio\SeqIO\fasta.pm line 271. Subroutine preferred_id_type redefined at Bio\SeqIO\fasta.pm line 294. t/SeqIO/fasta.t .............................. 1..22 ok 1 - use Bio::SeqIO::fasta; ok 2 - The object isa Bio::SeqIO ok 3 - Bio::SeqIO::fasta->can('next_seq') ok 4 - Bio::SeqIO::fasta->can('write_seq') ok 5 - The object isa Bio::Seq ok 6 - sequence ok 7 - length ok 8 - primary_id ok 9 - description ok 10 - The object isa Bio::Seq ok 11 - sequence ok 12 - length ok 13 - primary_id ok 14 - description ok 15 - use Algorithm::Diff; ok 16 - use IO::ScalarArray; ok 17 - use IO::String; ok 18 - fasta format can round-trip ok 19 - dies with roa1.genbank ok 20 - dies with test.gcg ok 21 - dies with test.ace ok 22 - dies with test.raw ok Subroutine _initialize redefined at Bio\SeqIO\fastq.pm line 10. Subroutine next_seq redefined at Bio\SeqIO\fastq.pm line 27. Subroutine next_dataset redefined at Bio\SeqIO\fastq.pm line 39. Subroutine write_seq redefined at Bio\SeqIO\fastq.pm line 122. Subroutine write_fastq redefined at Bio\SeqIO\fastq.pm line 178. Subroutine write_fasta redefined at Bio\SeqIO\fastq.pm line 183. Subroutine write_qual redefined at Bio\SeqIO\fastq.pm line 191. Subroutine variant redefined at Bio\SeqIO\fastq.pm line 218. Subroutine _init_tables redefined at Bio\SeqIO\fastq.pm line 229. Subroutine validate redefined at Bio\SeqIO\fastq.pm line 267. Subroutine quality_header redefined at Bio\SeqIO\fastq.pm line 275. t/SeqIO/fastq.t .............................. 1..139 ok 1 - use Bio::SeqIO::fastq; ok 2 - use Bio::Seq::Quality; ok 3 - bug2335 parses ok 4 - correct num. seqs in bug2335 ok 5 - sample sequence obtained ok 6 - The object isa Bio::Seq::Quality ok 7 - seq() matches bug2335 ok 8 - desc() matches bug2335 ok 9 - display_id() matches bug2335 ok 10 - qual() matches bug2335 ok 11 ok 12 - evil_wrapping parses ok 13 - correct num. seqs in evil_wrapping ok 14 - sample sequence obtained ok 15 - The object isa Bio::Seq::Quality ok 16 - seq() matches evil_wrapping ok 17 - desc() matches evil_wrapping ok 18 - display_id() matches evil_wrapping ok 19 - qual() matches evil_wrapping ok 20 ok 21 - example parses ok 22 - correct num. seqs in example ok 23 - sample sequence obtained ok 24 - The object isa Bio::Seq::Quality ok 25 - seq() matches example ok 26 - desc() matches example ok 27 - display_id() matches example ok 28 - qual() matches example ok 29 ok 30 - illumina_faked parses ok 31 - correct num. seqs in illumina_faked ok 32 - sample sequence obtained ok 33 - The object isa Bio::Seq::Quality ok 34 - seq() matches illumina_faked ok 35 - desc() matches illumina_faked ok 36 - display_id() matches illumina_faked ok 37 - qual() matches illumina_faked ok 38 ok 39 - sanger_93 parses ok 40 - correct num. seqs in sanger_93 ok 41 - sample sequence obtained ok 42 - The object isa Bio::Seq::Quality ok 43 - seq() matches sanger_93 ok 44 - desc() matches sanger_93 ok 45 - display_id() matches sanger_93 ok 46 - qual() matches sanger_93 ok 47 ok 48 - sanger_faked parses ok 49 - correct num. seqs in sanger_faked ok 50 - sample sequence obtained ok 51 - The object isa Bio::Seq::Quality ok 52 - seq() matches sanger_faked ok 53 - desc() matches sanger_faked ok 54 - display_id() matches sanger_faked ok 55 - qual() matches sanger_faked ok 56 ok 57 - solexa_example parses ok 58 - correct num. seqs in solexa_example ok 59 - sample sequence obtained ok 60 - The object isa Bio::Seq::Quality ok 61 - seq() matches solexa_example ok 62 - desc() matches solexa_example ok 63 - display_id() matches solexa_example ok 64 - qual() matches solexa_example ok 65 ok 66 - solexa_faked parses ok 67 - correct num. seqs in solexa_faked ok 68 - sample sequence obtained ok 69 - The object isa Bio::Seq::Quality ok 70 - seq() matches solexa_faked ok 71 - desc() matches solexa_faked ok 72 - display_id() matches solexa_faked ok 73 - qual() matches solexa_faked ok 74 ok 75 - test1_sanger parses ok 76 - correct num. seqs in test1_sanger ok 77 - sample sequence obtained ok 78 - The object isa Bio::Seq::Quality ok 79 - seq() matches test1_sanger ok 80 - desc() matches test1_sanger ok 81 - display_id() matches test1_sanger ok 82 - qual() matches test1_sanger ok 83 ok 84 - test2_solexa parses ok 85 - correct num. seqs in test2_solexa ok 86 - sample sequence obtained ok 87 - The object isa Bio::Seq::Quality ok 88 - seq() matches test2_solexa ok 89 - desc() matches test2_solexa ok 90 - display_id() matches test2_solexa ok 91 - qual() matches test2_solexa ok 92 ok 93 - test3_illumina parses ok 94 - correct num. seqs in test3_illumina ok 95 - sample sequence obtained ok 96 - The object isa Bio::Seq::Quality ok 97 - seq() matches test3_illumina ok 98 - desc() matches test3_illumina ok 99 - display_id() matches test3_illumina ok 100 - qual() matches test3_illumina ok 101 ok 102 - tricky parses ok 103 - correct num. seqs in tricky ok 104 - sample sequence obtained ok 105 - The object isa Bio::Seq::Quality ok 106 - seq() matches tricky ok 107 - desc() matches tricky ok 108 - display_id() matches tricky ok 109 - qual() matches tricky ok 110 ok 111 - Conversion from illumina to sanger ok 112 - Conversion from illumina to illumina ok 113 - Conversion from illumina to solexa ok 114 - Conversion from sanger to sanger ok 115 - Conversion from sanger to illumina ok 116 - Conversion from sanger to solexa ok 117 - Conversion from solexa to sanger ok 118 - Conversion from solexa to illumina ok 119 - Conversion from solexa to solexa ok 120 - Exception caught for error_diff_ids ok 121 - Exception caught for error_long_qual ok 122 - Exception caught for error_no_qual ok 123 - Exception caught for error_qual_del ok 124 - Exception caught for error_qual_escape ok 125 - Exception caught for error_qual_null ok 126 - Exception caught for error_qual_space ok 127 - Exception caught for error_qual_tab ok 128 - Exception caught for error_qual_unit_sep ok 129 - Exception caught for error_qual_vtab ok 130 - Exception caught for error_short_qual ok 131 - Exception caught for error_spaces ok 132 - Exception caught for error_tabs ok 133 - Exception caught for error_trunc_at_plus ok 134 - Exception caught for error_trunc_at_qual ok 135 - Exception caught for error_trunc_at_seq ok 136 - Exception caught for error_trunc_in_plus ok 137 - Exception caught for error_trunc_in_qual ok 138 - Exception caught for error_trunc_in_seq ok 139 - Exception caught for error_trunc_in_title ok t/SeqIO/flybase_chadoxml.t ................... 1..8 ok 1 - use Bio::SeqIO::flybase_chadoxml; not ok 2 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 3 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 4 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 5 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 6 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 7 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 8 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against ok Subroutine _initialize redefined at Bio\SeqIO\game.pm line 89. Subroutine next_seq redefined at Bio\SeqIO\game.pm line 105. Subroutine write_seq redefined at Bio\SeqIO\game.pm line 130. Subroutine _getseqs redefined at Bio\SeqIO\game.pm line 148. Subroutine _hide_dna redefined at Bio\SeqIO\game.pm line 177. t/SeqIO/game.t ............................... 1..24 ok 1 - use Bio::SeqIO::game; ok 2 - The object isa Bio::SeqIO ok 3 - The object isa Bio::Seq::RichSeq ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok Subroutine _initialize redefined at Bio\SeqIO\gbxml.pm line 91. Subroutine next_seq redefined at Bio\SeqIO\gbxml.pm line 117. Subroutine start_document redefined at Bio\SeqIO\gbxml.pm line 128. Subroutine end_document redefined at Bio\SeqIO\gbxml.pm line 137. Subroutine start_element redefined at Bio\SeqIO\gbxml.pm line 143. Subroutine end_element redefined at Bio\SeqIO\gbxml.pm line 196. Subroutine characters redefined at Bio\SeqIO\gbxml.pm line 355. t/SeqIO/gbxml.t .............................. 1..14 ok 1 - use Bio::SeqIO::gbxml; ok 2 - The object isa Bio::SeqIO ok 3 - molecule ok 4 - alphabet ok 5 - primary_id ok 6 - display_id ok 7 - version ok 8 - is_circular ok 9 - description ok 10 - sequence ok 11 - classification ok 12 - feat - clone_lib ok 13 - feat - db_xref ok 14 - feat - lab_host ok Subroutine _initialize redefined at Bio\SeqIO\gcg.pm line 85. Subroutine next_seq redefined at Bio\SeqIO\gcg.pm line 105. Subroutine write_seq redefined at Bio\SeqIO\gcg.pm line 178. Subroutine GCG_checksum redefined at Bio\SeqIO\gcg.pm line 249. Subroutine _validate_checksum redefined at Bio\SeqIO\gcg.pm line 284. t/SeqIO/gcg.t ................................ 1..17 ok 1 - use Bio::SeqIO::gcg; ok 2 - The object isa Bio::SeqIO ok 3 - Bio::SeqIO::gcg->can('next_seq') ok 4 - Bio::SeqIO::gcg->can('write_seq') ok 5 - The object isa Bio::Seq ok 6 - The object isa Bio::Seq::RichSeq ok 7 - sequence ok 8 - length not ok 9 - primary_id # TODO possible bug: RichSeq not setting primary_id? # Failed (TODO) test 'primary_id' # at t/SeqIO/gcg.t line 54. # got: 'Bio::PrimarySeq=HASH(0x4cf4148)' # expected: 'roa1_drome' ok 10 - description ok 11 ok 12 - The object isa Bio::SeqI ok 13 ok 14 - use Algorithm::Diff; ok 15 - use IO::ScalarArray; ok 16 - use IO::String; ok 17 - gcg format can round-trip ok Subroutine _initialize redefined at Bio\SeqIO\genbank.pm line 229. Subroutine next_seq redefined at Bio\SeqIO\genbank.pm line 253. Subroutine write_seq redefined at Bio\SeqIO\genbank.pm line 785. Subroutine _print_GenBank_FTHelper redefined at Bio\SeqIO\genbank.pm line 1102. Subroutine _read_GenBank_References redefined at Bio\SeqIO\genbank.pm line 1147. Subroutine _add_ref_to_array redefined at Bio\SeqIO\genbank.pm line 1285. Subroutine _read_GenBank_Species redefined at Bio\SeqIO\genbank.pm line 1331. Subroutine _read_FTHelper_GenBank redefined at Bio\SeqIO\genbank.pm line 1442. Subroutine _write_line_GenBank redefined at Bio\SeqIO\genbank.pm line 1577. Subroutine _write_line_GenBank_regex redefined at Bio\SeqIO\genbank.pm line 1615. Subroutine _post_sort redefined at Bio\SeqIO\genbank.pm line 1662. Subroutine _show_dna redefined at Bio\SeqIO\genbank.pm line 1682. Subroutine _id_generation_func redefined at Bio\SeqIO\genbank.pm line 1701. Subroutine _ac_generation_func redefined at Bio\SeqIO\genbank.pm line 1720. Subroutine _sv_generation_func redefined at Bio\SeqIO\genbank.pm line 1740. Subroutine _kw_generation_func redefined at Bio\SeqIO\genbank.pm line 1761. t/SeqIO/genbank.t ............................ 1..272 ok 1 - use Bio::SeqIO::genbank; ok 2 - The object isa Bio::SeqIO ok 3 - AI129902 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - NT_021877 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - BAB68554 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 - NC_006346 ok 30 ok 31 ok 32 - U71225 ok 33 ok 34 - AB077698 ok 35 ok 36 - DQ018368 ok 37 - D10483 ok 38 ok 39 ok 40 ok 41 - bug 1487 ok 42 ok 43 - bug 1647 ok 44 ok 45 ok 46 - bug 1673 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - AF165282 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - species parsing incorrect for genbank ok 62 - genus duplicated in genbank parsing ok 63 ok 64 ok 65 - species parsing incorrect for genbank ok 66 - genus duplicated in genbank parsing ok 67 ok 68 ok 69 - species parsing incorrect for genbank ok 70 - genus duplicated in genbank parsing ok 71 ok 72 - streaming ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Total number of sequences in test file ok 79 ok 80 - Fuzzy in ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 - Fuzzy out ok 93 - BK000016 ok 94 ok 95 - BK000016 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 - BK000016 ok 111 - roundtrip ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 - revcomp split location ok 130 - Bug 1925 ok 131 ok 132 ok 133 - wgs ok 134 ok 135 - wgs_scafld ok 136 ok 137 - wgs_scafld ok 138 ok 139 ok 140 - BC000007 ok 141 - BK000016-tpa.gbk ok 142 - ay116458.gb ok 143 - ay149291.gb ok 144 - NC_006346.gb ok 145 - ay007676.gb ok 146 - dq519393.gb ok 147 ok 148 - swissprot:K1C9_HUMAN ok 149 ok 150 - swissprot ok 151 ok 152 - GenBank:Z29074.1 ok 153 ok 154 - GenBank ok 155 ok 156 - GenPept:CAA82315.1 ok 157 ok 158 - GenPept ok 159 ok 160 - GenBank:S69510.1 ok 161 ok 162 - GenBank ok 163 ok 164 - GenPept:AAC60619.1 ok 165 ok 166 - GenPept ok 167 ok 168 - GenBank:X75015.1 ok 169 ok 170 - GenBank ok 171 ok 172 - GenPept:CAA52924.1 ok 173 ok 174 - GenPept ok 175 ok 176 - GenBank:AB001594.1 ok 177 ok 178 - GenBank ok 179 ok 180 - GenPept:BAA19418.1 ok 181 ok 182 - GenPept ok 183 ok 184 - GenBank:I37984 ok 185 ok 186 - GenBank ok 187 ok 188 - HSSP:P08670 ok 189 ok 190 - HSSP ok 191 ok 192 - IntAct:P35527 ok 193 ok 194 - IntAct ok 195 ok 196 - Ensembl:ENSG00000171403 ok 197 ok 198 - Ensembl ok 199 ok 200 - KEGG:hsa:3857 ok 201 ok 202 - KEGG ok 203 ok 204 - HGNC:6447 ok 205 ok 206 - HGNC ok 207 ok 208 - MIM:144200 ok 209 ok 210 - MIM ok 211 ok 212 - MIM:607606 ok 213 ok 214 - MIM ok 215 ok 216 - ArrayExpress:P35527 ok 217 ok 218 - ArrayExpress ok 219 ok 220 - GO:0005200 ok 221 ok 222 - GO ok 223 ok 224 - GO:0008544 ok 225 ok 226 - GO ok 227 ok 228 - InterPro:IPR011000 ok 229 ok 230 - InterPro ok 231 ok 232 - InterPro:IPR001664 ok 233 ok 234 - InterPro ok 235 ok 236 - InterPro:IPR002957 ok 237 ok 238 - InterPro ok 239 ok 240 - Pfam:PF00038 ok 241 ok 242 - Pfam ok 243 ok 244 - PRINTS:PR01248 ok 245 ok 246 - PRINTS ok 247 ok 248 - PROSITE:PS00226 ok 249 ok 250 - PROSITE ok 251 ok 252 - Bug 2195 ok 253 - Bug 2195 ok 254 - The object isa Bio::Annotation::SimpleValue ok 255 ok 256 - The object isa Bio::Annotation::SimpleValue ok 257 ok 258 - P39765 ok 259 - P39765 ok 260 - P39765 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 - operator overloading in AnnotationI is deprecated ok 271 ok 272 ok Subroutine next_seq redefined at Bio\SeqIO\interpro.pm line 105. Subroutine _initialize redefined at Bio\SeqIO\interpro.pm line 218. Subroutine _sequence_factory redefined at Bio\SeqIO\interpro.pm line 255. Subroutine _xml_parser redefined at Bio\SeqIO\interpro.pm line 273. Subroutine _parse_xml redefined at Bio\SeqIO\interpro.pm line 291. Subroutine _dom redefined at Bio\SeqIO\interpro.pm line 307. t/SeqIO/interpro.t ........................... 1..20 ok 1 - use Bio::SeqIO::interpro; ok 2 - The object isa Bio::SeqIO ok 3 - seq obj is defined ok 4 - The object isa Bio::Seq::RichSeq ok 5 - right number of SeqFeatures ok 6 - The object isa Bio::SeqFeature::Generic ok 7 - display_name() ok 8 - seq object is defined ok 9 - right number of SeqFeatures ok 10 - there is no next_seq (correctly) ok 11 - bug 1908 ok 12 - right number of SeqFeatures ok 13 - primary_tag() ok 14 - display_name() ok 15 - location->end() ok 16 - right number of dblinks ok 17 - first primary_id ok 18 - second primary_id ok 19 - right number of dblinks ok 20 - primary_id via dblinks ok Subroutine _initialize redefined at Bio\SeqIO\kegg.pm line 149. Subroutine next_seq redefined at Bio\SeqIO\kegg.pm line 172. Subroutine write_seq redefined at Bio\SeqIO\kegg.pm line 323. t/SeqIO/kegg.t ............................... 1..16 ok 1 - use Bio::SeqIO::kegg; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 - The object isa Bio::Seq::RichSeq ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine _initialize redefined at Bio\SeqIO\largefasta.pm line 93. Subroutine next_seq redefined at Bio\SeqIO\largefasta.pm line 113. Subroutine write_seq redefined at Bio\SeqIO\largefasta.pm line 155. t/SeqIO/largefasta.t ......................... 1..16 ok 1 - use Bio::SeqIO::largefasta; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine next_seq redefined at Bio\SeqIO\lasergene.pm line 101. Subroutine write_seq redefined at Bio\SeqIO\lasergene.pm line 160. t/SeqIO/lasergene.t .......................... 1..13 ok 1 - use Bio::SeqIO::lasergene; ok 2 ok 3 - The object isa Bio::SeqIO ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine _initialize redefined at Bio\SeqIO\locuslink.pm line 273. Subroutine search_pattern redefined at Bio\SeqIO\locuslink.pm line 306. Subroutine read_species redefined at Bio\SeqIO\locuslink.pm line 327. Subroutine read_dblink redefined at Bio\SeqIO\locuslink.pm line 340. Subroutine read_reference redefined at Bio\SeqIO\locuslink.pm line 358. Subroutine add_annotation redefined at Bio\SeqIO\locuslink.pm line 373. Subroutine add_annotation_ref redefined at Bio\SeqIO\locuslink.pm line 396. Subroutine make_unique redefined at Bio\SeqIO\locuslink.pm line 410. Subroutine next_seq redefined at Bio\SeqIO\locuslink.pm line 427. Subroutine show_obj redefined at Bio\SeqIO\locuslink.pm line 580. t/SeqIO/locuslink.t .......................... 1..26 ok 1 - use Bio::SeqIO::locuslink; ok 2 - use Bio::SeqFeature::Generic; ok 3 - use Bio::SeqFeature::AnnotationAdaptor; ok 4 ok 5 - The object isa Bio::SeqIO ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine _initialize redefined at Bio\SeqIO\mbsout.pm line 102. Subroutine _read_start redefined at Bio\SeqIO\mbsout.pm line 164. Subroutine get_segsites redefined at Bio\SeqIO\mbsout.pm line 246. Subroutine get_current_run_segsites redefined at Bio\SeqIO\mbsout.pm line 266. Subroutine get_pop_mut_param_per_site redefined at Bio\SeqIO\mbsout.pm line 281. Subroutine get_pop_recomb_param_per_site redefined at Bio\SeqIO\mbsout.pm line 296. Subroutine get_nsites redefined at Bio\SeqIO\mbsout.pm line 311. Subroutine get_selpos redefined at Bio\SeqIO\mbsout.pm line 326. Subroutine get_nreps redefined at Bio\SeqIO\mbsout.pm line 341. Subroutine get_nfiles redefined at Bio\SeqIO\mbsout.pm line 356. Subroutine get_traj_filename redefined at Bio\SeqIO\mbsout.pm line 371. Subroutine get_runs redefined at Bio\SeqIO\mbsout.pm line 386. Subroutine get_Positions redefined at Bio\SeqIO\mbsout.pm line 401. Subroutine get_tot_run_haps redefined at Bio\SeqIO\mbsout.pm line 416. Subroutine get_mbs_info_line redefined at Bio\SeqIO\mbsout.pm line 431. Subroutine get_tot_haps redefined at Bio\SeqIO\mbsout.pm line 446. Subroutine get_next_run_num redefined at Bio\SeqIO\mbsout.pm line 463. Subroutine get_last_haps_run_num redefined at Bio\SeqIO\mbsout.pm line 480. Subroutine get_last_read_hap_num redefined at Bio\SeqIO\mbsout.pm line 497. Subroutine outgroup redefined at Bio\SeqIO\mbsout.pm line 520. Subroutine get_next_seq redefined at Bio\SeqIO\mbsout.pm line 539. Subroutine get_next_hap redefined at Bio\SeqIO\mbsout.pm line 589. Subroutine get_next_run redefined at Bio\SeqIO\mbsout.pm line 622. Subroutine get_base_conversion_table redefined at Bio\SeqIO\mbsout.pm line 671. Subroutine _get_next_clean_hap redefined at Bio\SeqIO\mbsout.pm line 680. Subroutine _load_run_info redefined at Bio\SeqIO\mbsout.pm line 728. t/SeqIO/mbsout.t ............................. 1..74 ok 1 - use Bio::SeqIO::mbsout; ok 2 - Bio::SeqIO::mbsout is at least api version 1.1.3 ok 3 - The object isa Bio::SeqIO::mbsout ok 4 - The object isa Bio::SeqIO::mbsout ok 5 - Get NSITES ok 6 - Get TRAJ_FILENAME ok 7 - Get SELPOS ok 8 - Get TOT_RUN_HAPS ok 9 - Get MBS_INFO_LINE ok 10 - Get NFILES ok 11 - Get POP_MUT_PARAM_PER_SITE ok 12 - Get POP_RECOMB_PARAM_PER_SITE ok 13 - Get NEXT_RUN_NUM ok 14 - Get CURRENT_RUN_SEGSITES ok 15 - Get RUNS ok 16 - Get LAST_READ_HAP_NUM ok 17 - Get NREPS ok 18 - Get POSITIONS ok 19 - Get SEGSITES ok 20 - Get next_hap at beginning of run ok 21 - Get next_hap after beginning of run ok 22 - Get next_pop after beginning of pop ok 23 - Get next_hap ok 24 - Get next_hap ok 25 - Get next_run after beginning of run ok 26 - Get next_run at beginning of run ok 27 - Get next_run at beginning of run ok 28 - have all lines been read? ok 29 - The object isa Bio::SeqIO::mbsout ok 30 - Get NSITES ok 31 - Get TRAJ_FILENAME ok 32 - Get SELPOS ok 33 - Get TOT_RUN_HAPS ok 34 - Get MBS_INFO_LINE ok 35 - Get NFILES ok 36 - Get POP_MUT_PARAM_PER_SITE ok 37 - Get POP_RECOMB_PARAM_PER_SITE ok 38 - Get NEXT_RUN_NUM ok 39 - Get CURRENT_RUN_SEGSITES ok 40 - Get RUNS ok 41 - Get LAST_READ_HAP_NUM ok 42 - Get NREPS ok 43 - Get POSITIONS ok 44 - Get SEGSITES ok 45 - Get next_hap at beginning of run ok 46 - Get next_hap after beginning of run ok 47 - Testing mbsout::outgroup ok 48 - Get next_run after beginning of run ok 49 - Get next_run after beginning of run ok 50 - Get next_run at beginning of run ok 51 - Get next_hap at beginning of run 2 ok 52 - Get next_run after hap ok 53 - next run should be 5. ok 54 - The object isa Bio::SeqIO::mbsout ok 55 - Get NSITES ok 56 - Get TRAJ_FILENAME ok 57 - Get SELPOS ok 58 - Get TOT_RUN_HAPS ok 59 - Get MBS_INFO_LINE ok 60 - Get NFILES ok 61 - Get POP_MUT_PARAM_PER_SITE ok 62 - Get POP_RECOMB_PARAM_PER_SITE ok 63 - Get NEXT_RUN_NUM ok 64 - Get CURRENT_RUN_SEGSITES ok 65 - Get RUNS ok 66 - Get LAST_READ_HAP_NUM ok 67 - Get NREPS ok 68 - Get POSITIONS ok 69 - Get SEGSITES ok 70 - Get next_run at end/beginning of run ok 71 - have all lines been read? ok 72 - Get next_run at eof ok 73 - Get next_hap at eof ok 74 - Get next_seq at eof ok Subroutine _initialize redefined at Bio\SeqIO\metafasta.pm line 107. Subroutine next_seq redefined at Bio\SeqIO\metafasta.pm line 127. Subroutine write_seq redefined at Bio\SeqIO\metafasta.pm line 206. Subroutine width redefined at Bio\SeqIO\metafasta.pm line 249. t/SeqIO/metafasta.t .......................... 1..6 ok 1 - use Bio::SeqIO::metafasta; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 - The object isa Bio::Seq::Meta ok 5 ok 6 ok Subroutine _initialize redefined at Bio\SeqIO\msout.pm line 101. Subroutine _read_start redefined at Bio\SeqIO\msout.pm line 159. Subroutine get_segsites redefined at Bio\SeqIO\msout.pm line 224. Subroutine get_current_run_segsites redefined at Bio\SeqIO\msout.pm line 245. Subroutine get_runs redefined at Bio\SeqIO\msout.pm line 261. Subroutine get_Seeds redefined at Bio\SeqIO\msout.pm line 279. Subroutine get_Positions redefined at Bio\SeqIO\msout.pm line 297. Subroutine get_tot_run_haps redefined at Bio\SeqIO\msout.pm line 314. Subroutine get_ms_info_line redefined at Bio\SeqIO\msout.pm line 329. Subroutine get_tot_haps redefined at Bio\SeqIO\msout.pm line 345. Subroutine get_Pops redefined at Bio\SeqIO\msout.pm line 362. Subroutine get_next_run_num redefined at Bio\SeqIO\msout.pm line 379. Subroutine get_last_haps_run_num redefined at Bio\SeqIO\msout.pm line 396. Subroutine get_last_read_hap_num redefined at Bio\SeqIO\msout.pm line 413. Subroutine outgroup redefined at Bio\SeqIO\msout.pm line 433. Subroutine get_next_haps_pop_num redefined at Bio\SeqIO\msout.pm line 454. Subroutine get_next_seq redefined at Bio\SeqIO\msout.pm line 485. Subroutine next_seq redefined at Bio\SeqIO\msout.pm line 535. Subroutine get_next_hap redefined at Bio\SeqIO\msout.pm line 553. Subroutine get_next_pop redefined at Bio\SeqIO\msout.pm line 585. Subroutine get_next_run redefined at Bio\SeqIO\msout.pm line 626. Subroutine get_base_conversion_table redefined at Bio\SeqIO\msout.pm line 680. Subroutine _get_next_clean_hap redefined at Bio\SeqIO\msout.pm line 689. Subroutine _load_run_info redefined at Bio\SeqIO\msout.pm line 737. t/SeqIO/msout.t .............................. 1..85 ok 1 - use Bio::SeqIO::msout; ok 2 - Bio::SeqIO::msout is at least api version 1.1.5 ok 3 - The object isa Bio::SeqIO::msout ok 4 - Get TOT_RUN_HAPS ok 5 - Get POPS ok 6 - Get CURRENT_RUN_SEGSITES ok 7 - Get NEXT_RUN_NUM ok 8 - Get RUNS ok 9 - Get MS_INFO_LINE ok 10 - Get LAST_READ_HAP_NUM ok 11 - Get POSITIONS ok 12 - Get SEGSITES ok 13 - Get SEEDS ok 14 - Get next_hap at beginning of run ok 15 - Get next_hap after beginning of run ok 16 - Testing msout::outgroup ok 17 - Get next_pop after beginning of pop ok 18 - Get next_pop at beginning of pop ok 19 - Get next_run after beginning of run ok 20 - Get next_pop at beginning of run ok 21 - Get next_hap after pop ok 22 - Get next_run after pop and hap ok 23 - Get next_run at beginning of run ok 24 - have all lines been read? ok 25 - The object isa Bio::SeqIO::msout ok 26 - Get TOT_RUN_HAPS ok 27 - Get POPS ok 28 - Get CURRENT_RUN_SEGSITES ok 29 - Get NEXT_RUN_NUM ok 30 - Get RUNS ok 31 - Get MS_INFO_LINE ok 32 - Get LAST_READ_HAP_NUM ok 33 - Get POSITIONS ok 34 - Get SEGSITES ok 35 - Get SEEDS ok 36 - Get next_hap at beginning of run ok 37 - Get next_hap after beginning of run ok 38 - Testing msout::outgroup ok 39 - Get next_pop after beginning of pop ok 40 - Get next_pop at beginning of pop/run ok 41 - Get next_run at beginning of run ok 42 - Get next_hap at beginning of run 2 ok 43 - Get next_run after hap ok 44 - next run should be 5. ok 45 - Get last hap through next_hap ok 46 - The object isa Bio::SeqIO::msout ok 47 - The object isa Bio::SeqIO::msout ok 48 - Get TOT_RUN_HAPS ok 49 - Get POPS ok 50 - Get CURRENT_RUN_SEGSITES ok 51 - Get NEXT_RUN_NUM ok 52 - Get RUNS ok 53 - Get MS_INFO_LINE ok 54 - Get LAST_READ_HAP_NUM ok 55 - Get POSITIONS ok 56 - Get SEGSITES ok 57 - Get SEEDS ok 58 - Get next_pop at end of run ok 59 - have all lines been read? ok 60 - Get next_pop at eof ok 61 - Get next_run at eof ok 62 - Get next_hap at eof ok 63 - Get next_seq at eof ok 64 - The object isa Bio::SeqIO::msout ok 65 - Get TOT_RUN_HAPS ok 66 - Get POPS ok 67 - Get CURRENT_RUN_SEGSITES ok 68 - Get NEXT_RUN_NUM ok 69 - Get RUNS ok 70 - Get MS_INFO_LINE ok 71 - Get LAST_READ_HAP_NUM ok 72 - Get POSITIONS ok 73 - Get SEGSITES ok 74 - Get SEEDS ok 75 - Get next_hap at beginning of run ok 76 - Get next_hap after beginning of run ok 77 - Testing msout::outgroup ok 78 - Get next_pop after beginning of pop ok 79 - Get next_pop at beginning of pop ok 80 - Get next_run after beginning of run ok 81 - Get next_pop at beginning of run ok 82 - Get next_hap after pop ok 83 - Get next_run after pop and hap ok 84 - Get next_run at beginning of run ok 85 - have all lines been read? ok Subroutine _initialize redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\nexml.pm line 88. Subroutine next_seq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\nexml.pm line 104. Subroutine rewind redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\nexml.pm line 124. Subroutine doc redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\nexml.pm line 139. Subroutine _parse redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\nexml.pm line 147. Subroutine write_seq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\nexml.pm line 184. # Begin tests for writing seq files t/SeqIO/nexml.t .............................. 1..44 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqIO::nexml; ok 3 - stream ok ok 4 - seq obj ok 5 - The object isa Bio::Seq ok 6 - alphabet ok 7 - primary_id ok 8 - display_id ok 9 - sequence ok 10 - taxa id ok 11 - taxa label ok 12 - taxon ok ok 13 - number of taxa ok 14 - taxon ok ok 15 - taxon ok ok 16 - taxon ok ok 17 - taxon ok ok 18 - taxon ok ok 19 ok 20 - alphabet ok 21 - primary_id ok 22 - display_id ok 23 - sequence ok 24 ok 25 - alphabet ok 26 - primary_id ok 27 - display_id defaults to primary ok 28 - sequence ok 29 - out stream ok ok 30 - write nexml seq ok 31 ok 32 - alphabet ok 33 - primary_id ok 34 - display_id defaults to primary ok 35 - sequence ok 36 - taxa id ok 37 - taxa label ok 38 - taxon ok ok 39 - number of taxa ok 40 - taxon ok ok 41 - taxon ok ok 42 - taxon ok ok 43 - taxon ok ok 44 - taxon ok ok Subroutine _initialize redefined at Bio\SeqIO\phd.pm line 88. Subroutine next_seq redefined at Bio\SeqIO\phd.pm line 108. Subroutine write_header redefined at Bio\SeqIO\phd.pm line 208. Subroutine write_seq redefined at Bio\SeqIO\phd.pm line 246. Subroutine Bio::Seq::Quality::attribute redefined at Bio\SeqIO\phd.pm line 280. Subroutine Bio::Seq::Quality::chromat_file redefined at Bio\SeqIO\phd.pm line 318. Subroutine Bio::Seq::Quality::abi_thumbprint redefined at Bio\SeqIO\phd.pm line 333. Subroutine Bio::Seq::Quality::phred_version redefined at Bio\SeqIO\phd.pm line 349. Subroutine Bio::Seq::Quality::call_method redefined at Bio\SeqIO\phd.pm line 365. Subroutine Bio::Seq::Quality::quality_levels redefined at Bio\SeqIO\phd.pm line 380. Subroutine Bio::Seq::Quality::trace_array_min_index redefined at Bio\SeqIO\phd.pm line 395. Subroutine Bio::Seq::Quality::trace_array_max_index redefined at Bio\SeqIO\phd.pm line 410. Subroutine Bio::Seq::Quality::chem redefined at Bio\SeqIO\phd.pm line 425. Subroutine Bio::Seq::Quality::dye redefined at Bio\SeqIO\phd.pm line 440. Subroutine Bio::Seq::Quality::time redefined at Bio\SeqIO\phd.pm line 455. Subroutine Bio::Seq::Quality::touch redefined at Bio\SeqIO\phd.pm line 470. t/SeqIO/phd.t ................................ 1..21 ok 1 - use Bio::SeqIO::phd; ok 2 - The object isa Bio::SeqIO::phd ok 3 - Did you get the 'QUALITY_LEVELS' comment? ok 4 - The object isa Bio::Seq::Quality ok 5 - The object isa Bio::SeqIO::phd ok 6 ok 7 - $seq->subseq() ok 8 - $seq->subqual_tex() ok 9 - $seq->subqual_tex() ok 10 - $phd->chromat_file() ok 11 - $phd->chromat_file() ok 12 ok 13 - $seq->subseq() ok 14 - $seq->subqual_tex() ok 15 - $seq->subqual_tex() ok 16 ok 17 - $seq->subseq() ok 18 - $seq->subqual_tex() ok 19 - $seq->subqual_tex() ok 20 - The object isa Bio::SeqIO::phd ok 21 ok Subroutine _initialize redefined at Bio\SeqIO\pir.pm line 89. Subroutine next_seq redefined at Bio\SeqIO\pir.pm line 109. Subroutine write_seq redefined at Bio\SeqIO\pir.pm line 159. t/SeqIO/pir.t ................................ 1..9 ok 1 - use Bio::SeqIO::pir; ok 2 - new instance is defined ok 3 - The object isa Bio::SeqIO ok 4 - checked length ok 5 - checked length ok 6 - checked length ok 7 - checked length ok 8 - checked length ok 9 - checked length ok t/SeqIO/pln.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/qual.t ............................... 1..18 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimaryQual; ok 3 ok 4 - The object isa Bio::Seq::PrimaryQual ok 5 ok 6 - The object isa Bio::Seq::PrimaryQual ok 7 - The object isa Bio::Seq::PrimaryQual ok 8 - The object isa Bio::Seq::PrimaryQual ok 9 - The object isa Bio::Seq::PrimaryQual ok 10 - The object isa Bio::Seq::PrimaryQual ok 11 - The object isa Bio::Seq::PrimaryQual ok 12 - The object isa Bio::Seq::PrimaryQual ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok Subroutine _initialize redefined at Bio\SeqIO\raw.pm line 97. Subroutine next_seq redefined at Bio\SeqIO\raw.pm line 122. Subroutine write_seq redefined at Bio\SeqIO\raw.pm line 149. Subroutine write_qual redefined at Bio\SeqIO\raw.pm line 171. Subroutine variant redefined at Bio\SeqIO\raw.pm line 205. Subroutine _separator redefined at Bio\SeqIO\raw.pm line 220. t/SeqIO/raw.t ................................ 1..25 ok 1 - use Bio::SeqIO::raw; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 - Bio::SeqIO::raw->can('next_seq') ok 5 - Bio::SeqIO::raw->can('write_seq') ok 6 - The object isa Bio::Seq ok 7 - sequence ok 8 - length ok 9 - The object isa Bio::Seq ok 10 - sequence ok 11 - length ok 12 - use Algorithm::Diff; ok 13 - raw format can round-trip ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok Subroutine _initialize redefined at Bio\SeqIO\scf.pm line 95. Subroutine next_seq redefined at Bio\SeqIO\scf.pm line 124. Subroutine _get_v3_quality redefined at Bio\SeqIO\scf.pm line 280. Subroutine _get_v3_peak_indices redefined at Bio\SeqIO\scf.pm line 307. Subroutine _get_v3_base_accuracies redefined at Bio\SeqIO\scf.pm line 326. Subroutine _get_comments redefined at Bio\SeqIO\scf.pm line 360. Subroutine _get_header redefined at Bio\SeqIO\scf.pm line 398. Subroutine _parse_v2_bases redefined at Bio\SeqIO\scf.pm line 433. Subroutine _parse_v2_traces redefined at Bio\SeqIO\scf.pm line 469. Subroutine get_trace_deprecated_use_the_sequencetrace_object_instead redefined at Bio\SeqIO\scf.pm line 489. Subroutine _deprecated_get_peak_indices_deprecated_use_the_sequencetrace_object_instead redefined at Bio\SeqIO\scf.pm line 500. Subroutine get_header redefined at Bio\SeqIO\scf.pm line 518. Subroutine get_comments redefined at Bio\SeqIO\scf.pm line 534. Subroutine _dump_traces_outgoing_deprecated_use_the_sequencetrace_object redefined at Bio\SeqIO\scf.pm line 539. Subroutine _dump_traces_incoming_deprecated_use_the_sequencetrace_object redefined at Bio\SeqIO\scf.pm line 561. Subroutine write_seq redefined at Bio\SeqIO\scf.pm line 609. Subroutine _get_binary_header redefined at Bio\SeqIO\scf.pm line 778. Subroutine _get_binary_traces redefined at Bio\SeqIO\scf.pm line 813. Subroutine _get_binary_bases redefined at Bio\SeqIO\scf.pm line 870. Subroutine _make_trace_string redefined at Bio\SeqIO\scf.pm line 948. Subroutine _get_binary_comments redefined at Bio\SeqIO\scf.pm line 990. Subroutine _delta redefined at Bio\SeqIO\scf.pm line 1051. Subroutine _unpack_magik redefined at Bio\SeqIO\scf.pm line 1131. Subroutine read_from_buffer redefined at Bio\SeqIO\scf.pm line 1155. Subroutine _dump_keys redefined at Bio\SeqIO\scf.pm line 1196. Subroutine _dump_base_accuracies redefined at Bio\SeqIO\scf.pm line 1219. Subroutine _dump_peak_indices_incoming redefined at Bio\SeqIO\scf.pm line 1246. Subroutine _dump_base_accuracies_incoming redefined at Bio\SeqIO\scf.pm line 1267. Subroutine _dump_comments redefined at Bio\SeqIO\scf.pm line 1294. t/SeqIO/scf.t ................................ 1..80 ok 1 - use Bio::SeqIO::scf; ok 2 - use Bio::Seq::SequenceTrace; ok 3 ok 4 - The object isa Bio::Seq::SequenceTrace ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Seq::Quality ok 14 - The object isa Bio::Seq::Quality ok 15 - alphabet ok 16 - display_id ok 17 - primary_id is the stringified memory position ok 18 - set primary_id ok 19 - accession_number ok 20 - desc ok 21 - desc ok 22 - id ok 23 - id ok 24 - seq ok 25 - subseq ok 26 - baseat ok 27 - qualat ok 28 - trace_value_at not ok 29 - accuracies # TODO documentation and code for accuracies() do not match # Failed (TODO) test 'accuracies' # at t/SeqIO/scf.t line 78. # got: 'ARRAY(0x4d758d8)' # expected: '482' ok 30 ok 31 - sub_peak_index ok 32 - peak_index_at ok 33 ok 34 ok 35 - The object isa Bio::Seq::SequenceTrace ok 36 - accuracy_at ok 37 - The object isa Bio::Seq::SequenceTrace ok 38 ok 39 ok 40 ok 41 - The object isa Bio::Annotation::Collection ok 42 ok 43 - The object isa Bio::Annotation::Collection ok 44 ok 45 ok 46 - The object isa Bio::Annotation::Collection ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - The object isa Bio::Seq::SequenceTrace ok 55 - The object isa Bio::Annotation::Collection ok 56 ok 57 ok 58 ok 59 ok 60 - The object isa Bio::Seq::SequenceTrace ok 61 ok 62 - The object isa Bio::Seq::SequenceTrace ok 63 - qual scores match ok 64 - The object isa Bio::Seq::SequenceTrace ok 65 ok 66 - The object isa Bio::Seq::SequenceTrace not ok 67 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'ML4942R' # expected: undef ok 68 - qual scores match ok 69 - The object isa Bio::Seq::SequenceTrace ok 70 ok 71 - The object isa Bio::Seq::SequenceTrace not ok 72 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'IIABP1D4373' # expected: undef ok 73 - qual scores match ok 74 - The object isa Bio::Seq::SequenceTrace ok 75 ok 76 - The object isa Bio::Seq::SequenceTrace not ok 77 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'IIABP1D4373' # expected: undef ok 78 - qual scores match ok 79 - Bio::Sequence::Quality matches ok 80 - Bio::Sequence::Quality matches ok Constant subroutine Bio::SeqIO::seqxml::SEQXML_VERSION redefined at C:\cpanfly\var\megalib/constant.pm line 131. Constant subroutine Bio::SeqIO::seqxml::SCHEMA_LOCATION redefined at C:\cpanfly\var\megalib/constant.pm line 131. Constant subroutine Bio::SeqIO::seqxml::XMLNS_XSI redefined at C:\cpanfly\var\megalib/constant.pm line 131. Subroutine _initialize redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 152. Subroutine next_seq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 247. Subroutine write_seq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 277. Subroutine _initialize_seqxml_node_methods redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 418. Subroutine schemaLocation redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 459. Subroutine source redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 481. Subroutine sourceVersion redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 504. Subroutine seqXMLversion redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 527. Subroutine processXMLnode redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 555. Subroutine processAttribute redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 617. Subroutine parseHeader redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 644. Subroutine element_seqXML redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 674. Subroutine element_entry redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 700. Subroutine element_species redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 724. Subroutine element_description redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 765. Subroutine element_RNAseq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 779. Subroutine element_DNAseq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 799. Subroutine element_AAseq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 819. Subroutine element_DBRef redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 840. Subroutine element_property redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 883. Subroutine end_element_RNAseq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 923. Subroutine end_element_DNAseq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 942. Subroutine end_element_AAseq redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 962. Subroutine end_element_entry redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 983. Subroutine end_element_default redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 1050. Subroutine DESTROY redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 1065. Subroutine close redefined at C:\cpanfly\var\cpan\build\BioPerl-1.6.900-HWzKh0\blib\lib/Bio\SeqIO\seqxml.pm line 1086. t/SeqIO/seqxml.t ............................. 1..61 ok 1 - use Bio::SeqIO; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::SeqIO::seqxml; ok 4 - stream ok ok 5 - seqXML version ok 6 - source ok 7 - source version ok 8 - The object isa Bio::Seq ok 9 - display id ok 10 - primary id ok 11 - description ok 12 - sequence ok 13 - length ok 14 - entry source ok 15 - species isa Bio::Species ok 16 - species name ok 17 - NCBI tax id ok 18 - The object isa Bio::Annotation::DBLink ok 19 - dblink source ok 20 - dblink ID ok 21 - The object isa Bio::Annotation::SimpleValue ok 22 - boolean property ok 23 - The object isa Bio::Annotation::SimpleValue ok 24 - property with value ok 25 - writer ok ok 26 - outfile is created ok 27 - seqXML version ok 28 - source ok 29 - source version ok 30 - schemaLocation ok 31 - The object isa Bio::Seq ok 32 - display id ok 33 - primary id ok 34 - description ok 35 - sequence ok 36 - length ok 37 - entry source ok 38 - species isa Bio::Species ok 39 - species name ok 40 - NCBI tax id ok 41 - The object isa Bio::Annotation::DBLink ok 42 - dblink source ok 43 - dblink ID ok 44 - The object isa Bio::Annotation::SimpleValue ok 45 - property with value ok 46 - The object isa Bio::Annotation::SimpleValue ok 47 - boolean property ok 48 - outfile is created ok 49 - seqXML version ok 50 - source ok 51 - source version ok 52 - display id ok 53 - primary id ok 54 - description ok 55 - sequence ok 56 - length ok 57 - display id ok 58 - primary id ok 59 - description ok 60 - sequence ok 61 - length ok t/SeqIO/strider.t ............................ 1..8 ok 1 - use Bio::SeqIO::strider; not ok 2 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 3 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 4 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 5 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 6 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 7 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 8 # TODO & SKIP No tests for strider format -- no sample file to test against ok Subroutine _initialize redefined at Bio\SeqIO\swiss.pm line 232. Subroutine next_seq redefined at Bio\SeqIO\swiss.pm line 256. Subroutine write_seq redefined at Bio\SeqIO\swiss.pm line 498. Subroutine _generateCRCTable redefined at Bio\SeqIO\swiss.pm line 829. Subroutine _crc32 redefined at Bio\SeqIO\swiss.pm line 862. Subroutine _crc64 redefined at Bio\SeqIO\swiss.pm line 894. Subroutine _print_swissprot_FTHelper redefined at Bio\SeqIO\swiss.pm line 946. Subroutine _read_swissprot_References redefined at Bio\SeqIO\swiss.pm line 1033. Subroutine _read_swissprot_Species redefined at Bio\SeqIO\swiss.pm line 1123. Subroutine _read_FTHelper_swissprot redefined at Bio\SeqIO\swiss.pm line 1278. Subroutine _write_line_swissprot redefined at Bio\SeqIO\swiss.pm line 1353. Subroutine _write_line_swissprot_regex redefined at Bio\SeqIO\swiss.pm line 1388. Subroutine _post_sort redefined at Bio\SeqIO\swiss.pm line 1430. Subroutine _show_dna redefined at Bio\SeqIO\swiss.pm line 1451. Subroutine _id_generation_func redefined at Bio\SeqIO\swiss.pm line 1472. Subroutine _ac_generation_func redefined at Bio\SeqIO\swiss.pm line 1493. Subroutine _sv_generation_func redefined at Bio\SeqIO\swiss.pm line 1514. Subroutine _kw_generation_func redefined at Bio\SeqIO\swiss.pm line 1535. t/SeqIO/swiss.t .............................. 1..247 ok 1 - use Bio::SeqIO::swiss; ok 2 - The object isa Bio::SeqIO ok 3 - The object isa Bio::Species ok 4 ok 5 ok 6 - operator overloading in AnnotationI is deprecated ok 7 - dates ok 8 - dates ok 9 - dates ok 10 ok 11 - The object isa Bio::Seq::RichSeqI ok 12 ok 13 ok 14 ok 15 - operator overloading in AnnotationI is deprecated ok 16 ok 17 ok 18 ok 19 ok 20 - id is ROA1_HUMAN ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 ok 30 ok 31 ok 32 ok 33 - The object isa Bio::Seq::RichSeqI ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 ok 47 - GC1QBP ok 48 - HABP1 ok 49 - SF2P32 ok 50 - C1QBP ok 51 ok 52 - The object isa Bio::Seq::RichSeqI ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - F54H12.1 ok 60 - The object isa Bio::Seq::RichSeqI ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - The object isa Bio::Seq::RichSeqI ok 73 ok 74 ok 75 ok 76 ok 77 - The object isa Bio::Seq::RichSeqI ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 - The object isa Bio::Seq::RichSeqI ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - The object isa Bio::Species ok 176 ok 177 ok 178 - operator overloading in AnnotationI is deprecated ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 - The object isa Bio::Species ok 208 ok 209 ok 210 - operator overloading in AnnotationI is deprecated ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 - Converting to fasta seqids match ok 242 - Converting to fasta sequences match ok 243 - Can parse generated swiss ok 244 - Roundtrip, seqids match ok 245 - Roundtrip, sequences match ok 246 ok 247 ok Subroutine next_seq redefined at Bio\SeqIO\tab.pm line 123. Subroutine write_seq redefined at Bio\SeqIO\tab.pm line 151. t/SeqIO/tab.t ................................ 1..8 ok 1 - use Bio::SeqIO::tab; ok 2 - The object isa Bio::SeqIO ok 3 - seq is defined ok 4 - check seq length ok 5 - check matching ok 6 - seq is defined ok 7 - check seq length ok 8 - check matching ok Subroutine _initialize redefined at Bio\SeqIO\table.pm line 176. Subroutine next_seq redefined at Bio\SeqIO\table.pm line 282. Subroutine comment_char redefined at Bio\SeqIO\table.pm line 364. Subroutine header redefined at Bio\SeqIO\table.pm line 388. Subroutine delimiter redefined at Bio\SeqIO\table.pm line 410. Subroutine attribute_map redefined at Bio\SeqIO\table.pm line 435. Subroutine annotation_map redefined at Bio\SeqIO\table.pm line 488. Subroutine keep_annotation redefined at Bio\SeqIO\table.pm line 538. Subroutine annotation_columns redefined at Bio\SeqIO\table.pm line 564. Subroutine trim_values redefined at Bio\SeqIO\table.pm line 584. Subroutine _attribute_map redefined at Bio\SeqIO\table.pm line 617. Subroutine _annotation_map redefined at Bio\SeqIO\table.pm line 641. Subroutine _header_skipped redefined at Bio\SeqIO\table.pm line 660. Subroutine _next_record redefined at Bio\SeqIO\table.pm line 690. Subroutine _parse_header redefined at Bio\SeqIO\table.pm line 742. Subroutine _get_row_values redefined at Bio\SeqIO\table.pm line 827. t/SeqIO/table.t .............................. 1..450 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::SeqIO::table; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok t/SeqIO/tigr.t ............................... 1..8 ok 1 - use Bio::SeqIO::tigr; not ok 2 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 3 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 4 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 5 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 6 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 7 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 8 # TODO & SKIP No tests for tigr format -- no sample file to test against ok Subroutine _initialize redefined at Bio\SeqIO\tigrxml.pm line 97. Subroutine next_seq redefined at Bio\SeqIO\tigrxml.pm line 109. Subroutine start_document redefined at Bio\SeqIO\tigrxml.pm line 121. Subroutine end_document redefined at Bio\SeqIO\tigrxml.pm line 129. Subroutine start_element redefined at Bio\SeqIO\tigrxml.pm line 134. Subroutine end_element redefined at Bio\SeqIO\tigrxml.pm line 358. Subroutine characters redefined at Bio\SeqIO\tigrxml.pm line 484. Subroutine assert redefined at Bio\SeqIO\tigrxml.pm line 541. t/SeqIO/tigrxml.t ............................ 1..49 ok 1 - use Bio::SeqIO::tigrxml; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok Subroutine _initialize redefined at Bio\SeqIO\tinyseq.pm line 95. Subroutine next_seq redefined at Bio\SeqIO\tinyseq.pm line 118. Subroutine write_seq redefined at Bio\SeqIO\tinyseq.pm line 141. Subroutine _get_seqs redefined at Bio\SeqIO\tinyseq.pm line 182. Subroutine _get_species redefined at Bio\SeqIO\tinyseq.pm line 227. Subroutine _create_species redefined at Bio\SeqIO\tinyseq.pm line 248. Subroutine _assign_identifier redefined at Bio\SeqIO\tinyseq.pm line 275. Subroutine _convert_seqtype redefined at Bio\SeqIO\tinyseq.pm line 305. Subroutine _get_idstring redefined at Bio\SeqIO\tinyseq.pm line 325. Subroutine _get_writer redefined at Bio\SeqIO\tinyseq.pm line 347. Subroutine close_writer redefined at Bio\SeqIO\tinyseq.pm line 381. Subroutine _write_species redefined at Bio\SeqIO\tinyseq.pm line 394. Subroutine DESTROY redefined at Bio\SeqIO\tinyseq.pm line 401. t/SeqIO/tinyseq.t ............................ 1..16 ok 1 - use Bio::SeqIO::tinyseq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/ztr.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqTools/Backtranslate.t ................... 1..8 ok 1 - use Bio::Tools::SeqPattern::Backtranslate; ok 2 - Bio::Tools::SeqPattern::Backtranslate->can('_reverse_translate_motif') ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - threw Regexp ((?-xism:syntax token)) ok t/SeqTools/CodonTable.t ...................... 1..61 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::CodonUsage::IO; ok 3 ok 4 - The object isa Bio::Tools::CodonTable ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok t/SeqTools/ECnumber.t ........................ 1..27 ok 1 - use Bio::Tools::ECnumber; ok 2 - The object isa Bio::Tools::ECnumber ok 3 - The object isa Bio::Tools::ECnumber ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok Subroutine _initialize redefined at Bio/SeqIO/gcg.pm line 85. Subroutine next_seq redefined at Bio/SeqIO/gcg.pm line 105. Subroutine write_seq redefined at Bio/SeqIO/gcg.pm line 178. Subroutine GCG_checksum redefined at Bio/SeqIO/gcg.pm line 249. Subroutine _validate_checksum redefined at Bio/SeqIO/gcg.pm line 284. Subroutine new redefined at Bio\Seq\Meta.pm line 225, line 88. Subroutine meta redefined at Bio\Seq\Meta.pm line 269, line 88. Subroutine meta_text redefined at Bio\Seq\Meta.pm line 284, line 88. Subroutine named_meta redefined at Bio\Seq\Meta.pm line 300, line 88. Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 347, line 88. Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 377, line 88. Subroutine submeta redefined at Bio\Seq\Meta.pm line 409, line 88. Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 425, line 88. Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 444, line 88. Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 503, line 88. Subroutine meta_names redefined at Bio\Seq\Meta.pm line 518, line 88. Subroutine meta_length redefined at Bio\Seq\Meta.pm line 540, line 88. Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 556, line 88. Subroutine force_flush redefined at Bio\Seq\Meta.pm line 577, line 88. Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 604, line 88. Subroutine is_flush redefined at Bio\Seq\Meta.pm line 637, line 88. Subroutine revcom redefined at Bio\Seq\Meta.pm line 679, line 88. Subroutine trunc redefined at Bio\Seq\Meta.pm line 702, line 88. Subroutine to_string redefined at Bio\Seq\Meta.pm line 726, line 88. t/SeqTools/GuessSeqFormat.t .................. 1..52 ok 1 - use Bio::SeqIO; ok 2 - use Bio::AlignIO; ok 3 - use Bio::Tools::GuessSeqFormat; ok 4 ok 5 ok 6 ok 7 - Guessed:ace ok 8 - The object isa Bio::PrimarySeqI ok 9 - Guessed:embl ok 10 - The object isa Bio::SeqI ok 11 - Guessed:fasta ok 12 - The object isa Bio::SeqI ok 13 - Guessed:fastq ok 14 - The object isa Bio::SeqI ok 15 - Guessed:gcg ok 16 - The object isa Bio::SeqI ok 17 - Guessed:genbank ok 18 - The object isa Bio::SeqI ok 19 - Guessed:mase ok 20 - Guessed:pfam ok 21 - Guessed:pir ok 22 - The object isa Bio::SeqI ok 23 - Guessed:raw ok 24 - The object isa Bio::SeqI ok 25 - Guessed:swiss ok 26 - The object isa Bio::SeqI ok 27 - Guessed:tab ok 28 - The object isa Bio::SeqI ok 29 - Guessed:game ok 30 - The object isa Bio::SeqI ok 31 - clustalw ok 32 - The object isa Bio::Align::AlignI ok 33 - fasta ok 34 - The object isa Bio::Align::AlignI ok 35 - fastq ok 36 - mase ok 37 - The object isa Bio::Align::AlignI ok 38 - msf ok 39 - The object isa Bio::Align::AlignI ok 40 - nexus ok 41 - The object isa Bio::Align::AlignI ok 42 - pfam ok 43 - The object isa Bio::Align::AlignI ok 44 - phylip ok 45 - The object isa Bio::Align::AlignI ok 46 - prodom ok 47 - The object isa Bio::Align::AlignI ok 48 - stockholm ok 49 - The object isa Bio::Align::AlignI ok 50 ok 51 ok 52 - fasta ok t/SeqTools/OddCodes.t ........................ 1..11 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::OddCodes; ok 3 - The object isa Bio::Tools::OddCodes ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/SeqTools/SeqPattern.t ...................... 1..28 ok 1 - use Bio::Tools::SeqPattern; ok 2 ok 3 - The object isa Bio::Tools::SeqPattern ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Tools::SeqPattern ok 8 ok 9 ok 10 - The object isa Bio::Tools::SeqPattern ok 11 ok 12 - threw Regexp ((?-xism:revcom for .+ sequence types)) ok 13 - threw Regexp ((?-xism:backtranslate for .+ sequence types)) ok 14 - The object isa Bio::Tools::SeqPattern ok 15 - The object isa Bio::Tools::SeqPattern ok 16 ok 17 - The object isa Bio::Tools::SeqPattern ok 18 - The object isa Bio::Tools::SeqPattern ok 19 ok 20 - The object isa Bio::Tools::SeqPattern ok 21 - The object isa Bio::Tools::SeqPattern ok 22 ok 23 - The object isa Bio::Tools::SeqPattern ok 24 - The object isa Bio::Tools::SeqPattern ok 25 ok 26 - The object isa Bio::Tools::SeqPattern ok 27 - The object isa Bio::Tools::SeqPattern ok 28 ok t/SeqTools/SeqStats.t ........................ 1..47 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqStats; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools:SeqStats object ok 5 - count_monomers() ok 6 - count_codons() ok 7 - get_mol_wt() ok 8 ok 9 - The object isa Bio::Tools::SeqStats ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/SeqTools/SeqUtils.t ........................ 1..53 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqUtils; ok 3 - use Bio::LiveSeq::Mutation; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - cat - has expected tags ok 35 - cat - has expected tag values ok 36 - cat - note tag transfered (no throw) ok 37 - cat - note tag values transfered (correct count) ok 38 - different alphabets ok 39 ok 40 ok 41 ok 42 ok 43 - trunc_with_features - has expected tags ok 44 - trunc_with_features - has expected tag values ok 45 ok 46 - primary_tag matches original feature... ok 47 - but tagged sf is now revcom ok 48 - primary_tag matches original feature... ok 49 - but tagged sf is now revcom ok 50 - revcom_with_features - has expected tags ok 51 - revcom_with_features - has expected tag values ok 52 - still not circular ok 53 - still circular ok t/SeqTools/SeqWords.t ........................ 1..22 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqWords; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools::SeqWords object ok 5 - count_words ok 6 ok 7 - The object isa Bio::Tools::SeqWords ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - The object isa Bio::Tools::SeqWords ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Species.t .................................. 1..23 ok 1 - use Bio::Species; ok 2 - use Bio::DB::Taxonomy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 ok 23 ok t/Structure/IO.t ............................. 1..14 ok 1 - use Bio::Structure::IO; ok 2 ok 3 ok 4 - The object isa Bio::Structure::Entry ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Structure/Structure.t ...................... 1..51 ok 1 - use Bio::Structure::Entry; ok 2 - use Bio::Structure::Model; ok 3 - use Bio::Structure::Chain; ok 4 - use Bio::Structure::Residue; ok 5 - use Bio::Structure::Atom; ok 6 ok 7 - The object isa Bio::Structure::Entry ok 8 ok 9 - The object isa Bio::Structure::Model ok 10 ok 11 - The object isa Bio::Structure::Chain ok 12 ok 13 - The object isa Bio::Structure::Residue ok 14 ok 15 - The object isa Bio::Structure::Atom ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - The object isa Bio::Structure::Model ok 24 ok 25 ok 26 ok 27 - The object isa Bio::Structure::Chain ok 28 ok 29 ok 30 ok 31 ok 32 - The object isa Bio::Structure::Residue ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Symbol.t ................................... 1..9 ok 1 - use Bio::Symbol::Symbol; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/TaxonTree.t ................................ skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/Alignment/Consed.t ................... skipped: Not compatible with your Operating System t/Tools/Analysis/DNA/ESEfinder.t ............. skipped: Network tests have not been requested t/Tools/Analysis/Protein/Domcut.t ............ skipped: Network tests have not been requested t/Tools/Analysis/Protein/ELM.t ............... skipped: Network tests have not been requested t/Tools/Analysis/Protein/GOR4.t .............. skipped: Network tests have not been requested t/Tools/Analysis/Protein/HNN.t ............... skipped: Network tests have not been requested t/Tools/Analysis/Protein/Mitoprot.t .......... skipped: Network tests have not been requested t/Tools/Analysis/Protein/NetPhos.t ........... skipped: Network tests have not been requested t/Tools/Analysis/Protein/Scansite.t .......... 1..14 ok 1 - use Bio::Tools::Analysis::Protein::Scansite; ok 2 - use Bio::SeqIO; ok 3 - use Bio::WebAgent; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok t/Tools/Analysis/Protein/Sopma.t ............. 1..16 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::Analysis::Protein::Sopma; ok 3 ok 4 ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, line 13. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 13. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, line 13. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, line 13. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, line 13. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, line 13. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, line 13. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, line 13. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, line 13. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, line 13. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, line 13. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, line 13. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, line 13. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, line 13. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, line 13. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, line 13. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, line 13. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, line 13. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, line 13. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, line 13. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, line 13. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, line 13. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, line 13. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, line 13. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, line 13. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, line 13. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, line 13. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, line 13. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, line 13. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, line 13. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, line 13. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, line 13. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, line 13. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, line 13. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, line 13. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, line 13. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, line 13. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, line 13. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, line 13. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, line 13. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, line 13. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, line 13. t/Tools/EMBOSS/Palindrome.t .................. 1..13 ok 1 - use Bio::Tools::EMBOSS::Palindrome; ok 2 - use Bio::Tools::GFF; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/Tools/EUtilities/EUtilParameters.t ......... 1..13 ok 1 - use Bio::Tools::EUtilities::EUtilParameters; ok 2 ok 3 - The object isa HTTP::Request ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - available_parameters ok 11 - available_parameters ok 12 - get_parameters ok 13 - get_parameters ok t/Tools/EUtilities/egquery.t ................. 1..19 ok 1 - use Bio::Tools::EUtilities; ok 2 - get_db ok 3 - get_database ok 4 - get_databases ok 5 - get_term ok 6 - get_count ok 7 - get_count ok 8 - get_count ok 9 - get_GlobalQueries ok 10 - get_term ok 11 - get_term ok 12 - get_term ok 13 - get_term ok 14 - get_term ok 15 - get_term ok 16 - get_term ok 17 - get_term ok 18 - get_term ok 19 - get_term ok t/Tools/EUtilities/einfo.t ................... 1..51 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - get_available_databases ok 4 - get_databases ok 5 - get_db ok 6 - get_record_count ok 7 - get_menu_name ok 8 - get_last_update ok 9 - get_description ok 10 - FieldInfo ok 11 - LinkInfo ok 12 - get_db ok 13 - get_dbs ok 14 - get_record_count ok 15 - get_menu_name ok 16 - get_last_update ok 17 - get_description ok 18 - FieldInfo ok 19 - get_term_count ok 20 - get_field_name ok 21 - get_field_code ok 22 - get_field_description ok 23 - is_date ok 24 - is_singletoken ok 25 - is_hierarchy ok 26 - is_hidden ok 27 - is_numerical ok 28 - get_term_count ok 29 - get_field_name ok 30 - get_field_code ok 31 - get_field_description ok 32 - is_date ok 33 - is_singletoken ok 34 - is_hierarchy ok 35 - is_hidden ok 36 - is_numerical ok 37 - LinkInfo ok 38 - get_dbto ok 39 - get_dbfrom ok 40 - get_link_name ok 41 - get_link_description ok 42 - get_priority ok 43 - get_html_tag ok 44 - get_url ok 45 - get_dbto ok 46 - get_dbfrom ok 47 - get_link_name ok 48 - get_link_description ok 49 - get_priority ok 50 - get_html_tag ok 51 - get_url ok t/Tools/EUtilities/elink_acheck.t ............ 1..130 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - get_ids ok 7 - uncorrelated LinkSets lump everything together ok 8 ok 9 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 10 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - The object isa Bio::Tools::EUtilities::Link ok 68 ok 69 - get_ids ok 70 - get_ids ok 71 - correlated LinkSets separate ID data ok 72 ok 73 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 74 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok t/Tools/EUtilities/elink_lcheck.t ............ 1..64 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - The object isa Bio::Tools::EUtilities::Link ok 35 ok 36 - get_ids ok 37 - correlated LinkSets separate ID data ok 38 ok 39 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 40 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok t/Tools/EUtilities/elink_llinks.t ............ 1..86 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - The object isa Bio::Tools::EUtilities::Link ok 46 ok 47 - get_ids ok 48 - correlated LinkSets separate ID data ok 49 ok 50 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 51 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok t/Tools/EUtilities/elink_ncheck.t ............ 1..60 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - The object isa Bio::Tools::EUtilities::Link ok 31 ok 32 - get_ids ok 33 - correlated LinkSets separate ID data ok 34 ok 35 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 36 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok t/Tools/EUtilities/elink_neighbor.t .......... 1..63 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - The object isa Bio::Tools::EUtilities::Link ok 35 ok 36 - get_ids ok 37 - correlated LinkSets separate ID data ok 38 ok 39 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 40 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Tools/EUtilities/elink_neighbor_history.t .. 1..65 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 - The object isa Bio::Tools::EUtilities::HistoryI ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - The object isa Bio::Tools::EUtilities::Link ok 36 ok 37 - get_ids ok 38 - correlated LinkSets separate ID data ok 39 ok 40 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 41 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 42 - The object isa Bio::Tools::EUtilities::HistoryI ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok t/Tools/EUtilities/elink_scores.t ............ 1..58 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok t/Tools/EUtilities/epost.t ................... 1..17 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 4 - The object isa Bio::Tools::EUtilities::Query ok 5 - eutil ok 6 - datatype ok 7 - The object isa Bio::Tools::EUtilities::HistoryI ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - eutil ok 10 - eutil ok 11 - get_webenv ok 12 - get_query_key ok 13 - history ok 14 - get_database ok 15 - get_ids ok 16 - get_database ok 17 - get_ids ok t/Tools/EUtilities/esearch.t ................. 1..33 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - get_count ok 4 ok 5 - get_ids ok 6 - get_retstart ok 7 - get_retmax ok 8 - get_translation_from ok 9 - get_translation_to ok 10 - get_db ok 11 - get_database ok 12 - get_term ok 13 - get_db ok 14 - get_database ok 15 - get_term ok 16 - get_corrected_query ok 17 - get_replaced_terms ok 18 - get_count ok 19 - The object isa Bio::Tools::EUtilities::HistoryI ok 20 - get_webenv ok 21 - get_query_key ok 22 - history ok 23 - get_ids ok 24 - get_retstart ok 25 - get_retmax ok 26 - get_translation_from ok 27 - get_translation_to ok 28 - get_db ok 29 - get_database ok 30 - get_term ok 31 - get_corrected_query ok 32 - get_replaced_terms ok 33 - get_GlobalQueries ok t/Tools/EUtilities/espell.t .................. 1..22 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - get_db ok 4 - get_dbs ok 5 - get_database ok 6 - get_databases ok 7 - get_term ok 8 - get_corrected_query ok 9 - get_replaced_terms ok 10 - get_replaced_terms ok 11 - get_count ok 12 ok 13 - get_ids ok 14 - get_retstart ok 15 - get_retmax ok 16 - get_translation_from ok 17 - get_translation_to ok 18 - get_db ok 19 - get_dbs ok 20 - get_database ok 21 - get_databases ok 22 - get_term ok t/Tools/EUtilities/esummary.t ................ 1..83 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Summary ok 4 ok 5 - The object isa Bio::Tools::EUtilities::Summary ok 6 ok 7 - get_ids ok 8 ok 9 - The object isa Bio::Tools::EUtilities::Summary::DocSum ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Tools::EUtilities::Summary::Item ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - The object isa Bio::Tools::EUtilities::Summary::Item ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - The object isa Bio::Tools::EUtilities::Summary ok 53 ok 54 - The object isa Bio::Tools::EUtilities::Summary ok 55 ok 56 - get_ids ok 57 ok 58 - The object isa Bio::Tools::EUtilities::Summary::DocSum ok 59 ok 60 ok 61 ok 62 ok 63 - The object isa Bio::Tools::EUtilities::Summary::Item ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 2. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 2. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 2. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 2. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 2. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 2. t/Tools/Est2Genome.t ......................... 1..61 ok 1 - use Bio::Tools::Est2Genome; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok t/Tools/FootPrinter.t ........................ 1..27 ok 1 - use Bio::Tools::FootPrinter; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Tools/GFF.t ................................ 1..34 ok 1 - use Bio::Tools::GFF; ok 2 - use Bio::SeqFeature::Generic; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok t/Tools/Geneid.t ............................. 1..26 ok 1 - use Bio::Tools::Geneid; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, chunk 2. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, chunk 2. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, chunk 2. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, chunk 2. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, chunk 2. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, chunk 2. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, chunk 2. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, chunk 2. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, chunk 2. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, chunk 2. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, chunk 2. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, chunk 2. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, chunk 2. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, chunk 2. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, chunk 2. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, chunk 2. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, chunk 2. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, chunk 2. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, chunk 2. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, chunk 2. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, chunk 2. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, chunk 2. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, chunk 2. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, chunk 2. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, chunk 2. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, chunk 2. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, chunk 2. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, chunk 2. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, chunk 2. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, chunk 2. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, chunk 2. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, chunk 2. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, chunk 2. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, chunk 2. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, chunk 2. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, chunk 2. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, chunk 2. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, chunk 2. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, chunk 2. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, chunk 2. t/Tools/Genewise.t ........................... 1..33 ok 1 - use Bio::Tools::Genewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok t/Tools/Genomewise.t ......................... 1..21 ok 1 - use Bio::Tools::Genomewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Tools/Genpred.t ............................ 1..185 ok 1 - use Bio::Tools::Fgenesh; ok 2 - use Bio::Tools::Genscan; ok 3 - use Bio::Tools::Genemark; ok 4 - use Bio::Tools::Glimmer; ok 5 - use Bio::Tools::MZEF; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 ok 10 - strand match (-1 and -1) ok 11 - score match (1.05 and 1.05) ok 12 ok 13 - predicted and extracted protein seqs match ok 14 - strand match (1 and 1) ok 15 - score match (4.46 and 4.46) ok 16 ok 17 - predicted and extracted protein seqs match ok 18 - initial exons 0 ok 19 - score match 1.74 ok 20 ok 21 - predicted and extracted protein seqs match ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - Genemark tests ok 43 ok 44 ok 45 ok 46 - The object isa Bio::Location::Fuzzy ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - The object isa Bio::Location::Fuzzy ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 - The object isa Bio::Location::SplitLocationI ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 - The object isa Bio::Location::SplitLocationI ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - The object isa Bio::Location::Fuzzy ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 - The object isa Bio::Location::Fuzzy ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok t/Tools/GuessSeqFormat.t ..................... 1..4 ok 1 - use Bio::Tools::GuessSeqFormat; ok 2 ok 3 - The object isa Bio::Tools::GuessSeqFormat ok 4 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044. t/Tools/Hmmer.t .............................. 1..29 ok 1 - use Bio::Tools::HMMER::Domain; ok 2 - use Bio::Tools::HMMER::Set; ok 3 - use Bio::Tools::HMMER::Results; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok t/Tools/IUPAC.t .............................. 1..4 ok 1 - use Bio::Tools::IUPAC; ok 2 - use Bio::Seq; ok 3 ok 4 ok t/Tools/Lucy.t ............................... 1..22 ok 1 - use Bio::Tools::Lucy; ok 2 - The object isa Bio::Tools::Lucy ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Tools/Match.t .............................. 1..38 ok 1 - use Bio::Tools::Match; ok 2 ok 3 - The object isa Bio::SeqFeature::Annotated ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature core score correct ok 8 - feature matrix score correct ok 9 - feature matrix id correct ok 10 - The object isa Bio::SeqFeature::Annotated ok 11 - correct source ok 12 - feature start correct ok 13 - feature end correct ok 14 - feature core score correct ok 15 - feature matrix score correct ok 16 - feature matrix id correct ok 17 - The object isa Bio::SeqFeature::Annotated ok 18 - correct source ok 19 - feature start correct ok 20 - feature end correct ok 21 - feature core score correct ok 22 - feature matrix score correct ok 23 - feature matrix id correct ok 24 - The object isa Bio::SeqFeature::Annotated ok 25 - correct source ok 26 - feature start correct ok 27 - feature end correct ok 28 - feature core score correct ok 29 - feature matrix score correct ok 30 - feature matrix id correct ok 31 - The object isa Bio::SeqFeature::Annotated ok 32 - correct source ok 33 - feature start correct ok 34 - feature end correct ok 35 - feature core score correct ok 36 - feature matrix score correct ok 37 - feature matrix id correct ok 38 - correct number of results managed to get tested ok t/Tools/Phylo/Gerp.t ......................... 1..33 ok 1 - use Bio::Tools::Phylo::Gerp; ok 2 ok 3 - The object isa Bio::SeqFeature::Annotated ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature score correct ok 8 - feature pvalue correct ok 9 - The object isa Bio::SeqFeature::Annotated ok 10 - correct source ok 11 - feature start correct ok 12 - feature end correct ok 13 - feature score correct ok 14 - feature pvalue correct ok 15 - The object isa Bio::SeqFeature::Annotated ok 16 - correct source ok 17 - feature start correct ok 18 - feature end correct ok 19 - feature score correct ok 20 - feature pvalue correct ok 21 - The object isa Bio::SeqFeature::Annotated ok 22 - correct source ok 23 - feature start correct ok 24 - feature end correct ok 25 - feature score correct ok 26 - feature pvalue correct ok 27 - The object isa Bio::SeqFeature::Annotated ok 28 - correct source ok 29 - feature start correct ok 30 - feature end correct ok 31 - feature score correct ok 32 - feature pvalue correct ok 33 - correct number of results parsed out ok Subroutine new redefined at Bio\Tree\Tree.pm line 131, line 6. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179, line 6. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196, line 6. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230, line 6. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245, line 6. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269, line 6. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283, line 6. Subroutine id redefined at Bio\Tree\Tree.pm line 306, line 6. Subroutine score redefined at Bio\Tree\Tree.pm line 327, line 6. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375, line 6. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411, line 6. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432, line 6. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452, line 6. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472, line 6. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488, line 6. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504, line 6. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520, line 6. Subroutine clone redefined at Bio\Tree\Tree.pm line 540, line 6. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558, line 6. Subroutine new redefined at Bio\Tree\Node.pm line 110, line 6. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163, line 6. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221, line 6. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259, line 6. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322, line 6. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357, line 6. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396, line 6. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437, line 6. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461, line 6. Subroutine description redefined at Bio\Tree\Node.pm line 482, line 6. Subroutine id redefined at Bio\Tree\Node.pm line 511, line 6. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553, line 6. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567, line 6. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588, line 6. Subroutine height redefined at Bio\Tree\Node.pm line 606, line 6. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631, line 6. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652, line 6. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674, line 6. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695, line 6. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715, line 6. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731, line 6. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749, line 6. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765, line 6. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770, line 6. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800, line 6. t/Tools/Phylo/Molphy.t ....................... 1..18 ok 1 - use Bio::Tools::Phylo::Molphy; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok Subroutine new redefined at Bio\Tree\Tree.pm line 131, line 52. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179, line 52. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196, line 52. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230, line 52. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245, line 52. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269, line 52. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283, line 52. Subroutine id redefined at Bio\Tree\Tree.pm line 306, line 52. Subroutine score redefined at Bio\Tree\Tree.pm line 327, line 52. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375, line 52. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411, line 52. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432, line 52. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452, line 52. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472, line 52. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488, line 52. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504, line 52. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520, line 52. Subroutine clone redefined at Bio\Tree\Tree.pm line 540, line 52. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558, line 52. Subroutine new redefined at Bio\Tree\Node.pm line 110, line 52. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163, line 52. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221, line 52. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259, line 52. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322, line 52. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357, line 52. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396, line 52. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437, line 52. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461, line 52. Subroutine description redefined at Bio\Tree\Node.pm line 482, line 52. Subroutine id redefined at Bio\Tree\Node.pm line 511, line 52. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553, line 52. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567, line 52. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588, line 52. Subroutine height redefined at Bio\Tree\Node.pm line 606, line 52. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631, line 52. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652, line 52. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674, line 52. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695, line 52. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715, line 52. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731, line 52. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749, line 52. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765, line 52. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770, line 52. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800, line 52. t/Tools/Phylo/PAML.t ......................... 1..251 ok 1 - use Bio::Tools::Phylo::PAML; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 - node\#8 reconstructed seq ok 164 - ancestral AA ok 165 - ancestral AA ok 166 - derived AA ok 167 - ancestral AA ok 168 - ancestral AA ok 169 - derived AA ok 170 - derived AA ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 - codeml 4.3 runmode=-2 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 - codeml 4.3 two NSSites models ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 - NEB positively selected sites ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 - bug 3040 ok t/Tools/Phylo/Phylip/ProtDist.t .............. 1..47 ok 1 - use Bio::Tools::Phylo::Phylip::ProtDist; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/Tools/Primer3.t ............................ 1..14 ok 1 - use Bio::Tools::Primer3; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - The object isa Bio::Seq::PrimedSeq ok 11 ok 12 ok 13 ok 14 - bug 2862 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, line 11. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 11. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, line 11. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, line 11. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, line 11. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, line 11. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, line 11. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, line 11. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, line 11. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, line 11. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, line 11. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, line 11. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, line 11. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, line 11. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, line 11. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, line 11. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, line 11. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, line 11. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, line 11. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, line 11. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, line 11. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, line 11. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, line 11. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, line 11. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, line 11. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, line 11. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, line 11. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, line 11. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, line 11. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, line 11. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, line 11. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, line 11. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, line 11. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, line 11. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, line 11. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, line 11. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, line 11. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, line 11. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, line 11. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, line 11. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, line 11. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, line 11. t/Tools/Promoterwise.t ....................... 1..7 ok 1 - use Bio::Tools::Promoterwise; ok 2 - The object isa Bio::Tools::Promoterwise ok 3 ok 4 ok 5 ok 6 ok 7 ok t/Tools/Pseudowise.t ......................... 1..21 ok 1 - use Bio::Tools::Pseudowise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, line 30. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 30. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, line 30. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, line 30. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, line 30. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, line 30. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, line 30. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, line 30. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, line 30. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, line 30. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, line 30. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, line 30. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, line 30. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, line 30. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, line 30. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, line 30. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, line 30. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, line 30. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, line 30. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, line 30. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, line 30. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, line 30. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, line 30. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, line 30. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, line 30. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, line 30. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, line 30. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, line 30. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, line 30. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, line 30. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, line 30. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, line 30. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, line 30. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, line 30. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, line 30. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, line 30. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, line 30. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, line 30. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, line 30. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, line 30. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, line 30. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, line 30. t/Tools/QRNA.t ............................... 1..30 ok 1 - use Bio::Tools::QRNA; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok t/Tools/RandDistFunctions.t .................. 1..5 ok 1 - use Bio::Tools::RandomDistFunctions; ok 2 ok 3 ok 4 ok 5 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, line 4. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 4. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, line 4. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, line 4. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, line 4. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, line 4. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, line 4. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, line 4. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, line 4. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, line 4. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, line 4. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, line 4. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, line 4. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, line 4. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, line 4. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, line 4. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, line 4. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, line 4. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, line 4. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, line 4. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, line 4. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, line 4. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, line 4. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, line 4. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, line 4. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, line 4. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, line 4. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, line 4. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, line 4. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, line 4. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, line 4. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, line 4. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, line 4. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, line 4. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, line 4. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, line 4. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, line 4. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, line 4. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, line 4. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, line 4. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, line 4. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, line 4. t/Tools/RepeatMasker.t ....................... 1..28 ok 1 - use Bio::Tools::RepeatMasker; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Tools/Run/RemoteBlast.t .................... skipped: Network tests have not been requested t/Tools/Run/RemoteBlast_rpsblast.t ........... skipped: Network tests have not been requested t/Tools/Run/StandAloneBlast.t ................ 1..45 ok 1 - use Bio::Tools::Run::StandAloneBlast; ok 2 - use Bio::SeqIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Tools::Run::StandAloneBlast ok 14 - The object isa Bio::Tools::Run::StandAloneNCBIBlast ok 15 - The object isa Bio::Tools::Run::StandAloneBlast ok 16 - The object isa Bio::Tools::Run::StandAloneWUBlast ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 # skip blastall not installed, skipping tests ok 35 # skip blastall not installed, skipping tests ok 36 # skip blastall not installed, skipping tests ok 37 # skip blastall not installed, skipping tests ok 38 # skip blastall not installed, skipping tests ok 39 # skip blastall not installed, skipping tests ok 40 # skip blastall not installed, skipping tests ok 41 # skip blastall not installed, skipping tests ok 42 # skip blastall not installed, skipping tests ok 43 # skip blastall not installed, skipping tests ok 44 # skip blastall not installed, skipping tests ok 45 # skip blastall not installed, skipping tests ok t/Tools/Run/WBCommandExts.t .................. skipped: The optional module Bio::Tools::Run::WrapperBase::CommandExts (or dependencies thereof) was not installed t/Tools/Run/WrapperBase.t .................... 1..27 ok 1 - use Bio::Tools::Run::WrapperBase; ok 2 - The object isa Bio::Tools::Run::WrapperBase ok 3 - run() exists ok 4 - program_dir() exists ok 5 - program_name() exists ok 6 - version() exists ok 7 - error_string could be set ok 8 - arguments could be set ok 9 - no_param_checks could be set ok 10 - save_tempfiles could be set ok 11 - outfile_name could be set ok 12 - quiet could be set ok 13 - tempdir created a directory ok 14 - could create file in tempdir ok 15 - following cleanup() with save_tempfiles unset, tempdir was deleted ok 16 - The object isa Bio::Root::IO ok 17 - io() always returns the same instance of IO ok 18 - program_path was correct ok 19 - pretend program name not found as executable ok 20 - perl found as executable ok 21 - params string correct ok 22 - params string correct ok 23 - params string correct ok 24 - params string correct ok 25 - params string correct ok 26 - params string correct ok 27 - params string correct ok t/Tools/Seg.t ................................ 1..15 ok 1 - use Bio::Tools::Seg; ok 2 - parser defined ok 3 ok 4 - seq id for seq 0 identified ok 5 - start for seq 0 identified ok 6 - end for seq 0 identified ok 7 - score for seq 0 identified ok 8 - seq id for seq 1 identified ok 9 - start for seq 1 identified ok 10 - end for seq 1 identified ok 11 - score for seq 1 identified ok 12 - seq id for seq 2 identified ok 13 - start for seq 2 identified ok 14 - end for seq 2 identified ok 15 - score for seq 2 identified ok t/Tools/SiRNA.t .............................. 1..11 ok 1 - use Bio::Tools::SiRNA; ok 2 - use Bio::Seq; ok 3 - use Bio::SeqIO; ok 4 - The object isa Bio::SeqIO ok 5 - The object isa Bio::Tools::SiRNA ok 6 - CDS only: got 65 ok 7 ok 8 ok 9 - The object isa Bio::Seq ok 10 ok 11 ok t/Tools/Sigcleave.t .......................... 1..18 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::Sigcleave; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - unable to get raw sigcleave results ok 16 ok 17 - unable to get raw sigcleave results ok 18 ok t/Tools/Signalp.t ............................ 1..11 ok 1 - use Bio::Tools::Signalp; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/Tools/Signalp/ExtendedSignalp.t ............ 1..185 ok 1 - use Bio::Tools::Signalp::ExtendedSignalp; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 6. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 6. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 6. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 6. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 6. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 6. t/Tools/Sim4.t ............................... 1..27 ok 1 - use Bio::Tools::Sim4::Results; ok 2 - new Sim4 results instance ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - new Sim4 results instance ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, line 6. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, line 6. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, line 6. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, line 6. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, line 6. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, line 6. t/Tools/Spidey/Spidey.t ...................... 1..26 ok 1 - use Bio::Tools::Spidey::Results; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/Tools/TandemRepeatsFinder.t ................ 1..66 ok 1 - use Bio::Tools::TandemRepeatsFinder; ok 2 - Parser created successfully ok 3 - empty results file correctly returns no results ok 4 - Second parser created successfully ok 5 - seq_id for first result correctly parsed ok 6 - start for first result correctly parsed ok 7 - end for first result correctly parsed ok 8 - source tag for first result correctly parsed ok 9 - primary tag for first result correctly parsed ok 10 - score for first result correctly parsed ok 11 - sequence description correctly parsed. ok 12 - correctly parsed all run parameters ok 13 - correctly parsed period_size for first result ok 14 - correctly parsed copy_number for first result ok 15 - correctly parsed consensus_size for first result ok 16 - correctly parsed percent_matches for first result ok 17 - correctly parsed percent_indels for first result ok 18 - correctly parsed percent_a for first result ok 19 - correctly parsed percent_c for first result ok 20 - correctly parsed percent_g for first result ok 21 - correctly parsed percent_t for first result ok 22 - correctly parsed entropy for first result ok 23 - correctly parsed repeat_sequence for first result ok 24 - correctly parsed consensus_sequence for first result ok 25 - seq_id for second result correctly parsed ok 26 - start for second result correctly parsed ok 27 - end for second result correctly parsed ok 28 - source tag for first result correctly parsed ok 29 - primary tag for first result correctly parsed ok 30 - score for first result correctly parsed ok 31 - sequence description correctly parsed. ok 32 - correctly reatained all run parameters for second feature ok 33 - correctly parsed period_size for second result ok 34 - correctly parsed copy_number for second result ok 35 - correctly parsed consensus_size for second result ok 36 - correctly parsed percent_matches for second result ok 37 - correctly parsed percent_indels for second result ok 38 - correctly parsed percent_a for second result ok 39 - correctly parsed percent_c for second result ok 40 - correctly parsed percent_g for second result ok 41 - correctly parsed percent_t for second result ok 42 - correctly parsed entropy for second result ok 43 - correctly parsed repeat_sequence for second result ok 44 - correctly parsed consensus_sequence for second result ok 45 - seq_id for first result correctly parsed ok 46 - start for first result correctly parsed ok 47 - end for first result correctly parsed ok 48 - source tag for first result correctly parsed ok 49 - primary tag for first result correctly parsed ok 50 - score for first result correctly parsed ok 51 - sequence description correctly parsed. ok 52 - correctly reatained all run parameters for third feature ok 53 - correctly parsed period_size for third result ok 54 - correctly parsed copy_number for third result ok 55 - correctly parsed consensus_size for third result ok 56 - correctly parsed percent_matches for third result ok 57 - correctly parsed percent_indels for third result ok 58 - correctly parsed percent_a for third result ok 59 - correctly parsed percent_c for third result ok 60 - correctly parsed percent_g for third result ok 61 - correctly parsed percent_t for third result ok 62 - correctly parsed entropy for third result ok 63 - correctly parsed repeat_sequence for third result ok 64 - correctly parsed consensus_sequence for third result ok 65 - correctly return undef when no features are left ok 66 - Correctly parsed seq_id even if description does not exist ok t/Tools/TargetP.t ............................ 1..124 ok 1 - use Bio::Tools::TargetP; ok 2 ok 3 ok 4 ok 5 - good SeqID ok 6 - good Seqlength ok 7 - correct Mitochondrion cutoff ok 8 - correct signalpPeptide cutoff ok 9 - correct other cutoff ok 10 - correct location ok 11 - correct Reliability class score ok 12 - No peptide signal length reported ok 13 - good SeqID ok 14 - good Seqlength ok 15 - correct Mitochondrion cutoff ok 16 - correct signalpPeptide cutoff ok 17 - correct other cutoff ok 18 - correct location ok 19 - correct Reliability class score ok 20 - correct peptide signal length ok 21 - good SeqID ok 22 - good Seqlength ok 23 - correct Mitochondrion cutoff ok 24 - correct signalpPeptide cutoff ok 25 - correct other cutoff ok 26 - correct location ok 27 - correct Reliability class score ok 28 - correct peptide signal length ok 29 - good SeqID ok 30 - good Seqlength ok 31 - correct Mitochondrion cutoff ok 32 - correct signalpPeptide cutoff ok 33 - correct other cutoff ok 34 - correct location ok 35 - correct Reliability class score ok 36 - No peptide signal length reported ok 37 - good SeqID ok 38 - good Seqlength ok 39 - correct Mitochondrion cutoff ok 40 - correct signalpPeptide cutoff ok 41 - correct other cutoff ok 42 - correct location ok 43 - correct Reliability class score ok 44 - No peptide signal length reported ok 45 - good SeqID ok 46 - good Seqlength ok 47 - correct Mitochondrion cutoff ok 48 - correct signalpPeptide cutoff ok 49 - correct other cutoff ok 50 - correct location ok 51 - correct Reliability class score ok 52 - No peptide signal length reported ok 53 - good SeqID ok 54 - good Seqlength ok 55 - correct Mitochondrion cutoff ok 56 - correct signalpPeptide cutoff ok 57 - correct other cutoff ok 58 - correct location ok 59 - correct Reliability class score ok 60 - No peptide signal length reported ok 61 - good SeqID ok 62 - good Seqlength ok 63 - correct Mitochondrion cutoff ok 64 - correct signalpPeptide cutoff ok 65 - correct other cutoff ok 66 - correct location ok 67 - correct Reliability class score ok 68 - correct peptide signal length ok 69 - good SeqID ok 70 - good Seqlength ok 71 - correct Mitochondrion cutoff ok 72 - correct signalpPeptide cutoff ok 73 - correct other cutoff ok 74 - correct location ok 75 - correct Reliability class score ok 76 - No peptide signal length reported ok 77 - good SeqID ok 78 - good Seqlength ok 79 - correct Mitochondrion cutoff ok 80 - correct signalpPeptide cutoff ok 81 - correct other cutoff ok 82 - correct location ok 83 - correct Reliability class score ok 84 - No peptide signal length reported ok 85 - good SeqID ok 86 - good Seqlength ok 87 - correct Mitochondrion cutoff ok 88 - correct signalpPeptide cutoff ok 89 - correct other cutoff ok 90 - correct location ok 91 - correct Reliability class score ok 92 - No peptide signal length reported ok 93 - good SeqID ok 94 - good Seqlength ok 95 - correct Mitochondrion cutoff ok 96 - correct signalpPeptide cutoff ok 97 - correct other cutoff ok 98 - correct location ok 99 - correct Reliability class score ok 100 - No peptide signal length reported ok 101 - good SeqID ok 102 - good Seqlength ok 103 - correct Mitochondrion cutoff ok 104 - correct signalpPeptide cutoff ok 105 - correct other cutoff ok 106 - correct location ok 107 - correct Reliability class score ok 108 - correct peptide signal length ok 109 - good SeqID ok 110 - good Seqlength ok 111 - correct Mitochondrion cutoff ok 112 - correct signalpPeptide cutoff ok 113 - correct other cutoff ok 114 - correct location ok 115 - correct Reliability class score ok 116 - No peptide signal length reported ok 117 - good SeqID ok 118 - good Seqlength ok 119 - correct Mitochondrion cutoff ok 120 - correct signalpPeptide cutoff ok 121 - correct other cutoff ok 122 - correct location ok 123 - correct Reliability class score ok 124 - No peptide signal length reported ok t/Tools/Tmhmm.t .............................. 1..12 ok 1 - use Bio::Tools::Tmhmm; ok 2 - new() ok 3 - got 3 feat ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Tools/ePCR.t ............................... 1..27 ok 1 - use Bio::Tools::EPCR; ok 2 - use Bio::SeqIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - got 3 forward strand ePCR hits ok 27 - got 3 reverse strand ePCR hits ok t/Tools/pICalculator.t ....................... 1..38 ok 1 - use Bio::Seq; ok 2 - use Bio::Tools::pICalculator; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/Tools/rnamotif.t ........................... skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/tRNAscanSE.t ......................... 1..14 ok 1 - use Bio::Tools::tRNAscanSE; ok 2 - The object isa Bio::Tools::tRNAscanSE ok 3 ok 4 - seq_id ok 5 - codon ok 6 - start ok 7 - end ok 8 - strand ok 9 - exons ok 10 - end ok 11 - start ok 12 - start ok 13 - end ok 14 - seq_id ok Subroutine new redefined at Bio\Tree\Tree.pm line 131. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283. Subroutine id redefined at Bio\Tree\Tree.pm line 306. Subroutine score redefined at Bio\Tree\Tree.pm line 327. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520. Subroutine clone redefined at Bio\Tree\Tree.pm line 540. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558. Subroutine new redefined at Bio\Tree\Node.pm line 110. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461. Subroutine description redefined at Bio\Tree\Node.pm line 482. Subroutine id redefined at Bio\Tree\Node.pm line 511. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588. Subroutine height redefined at Bio\Tree\Node.pm line 606. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800. t/Tree/Compatible.t .......................... 1..5 ok 1 - use Bio::Tree::Compatible; ok 2 - use Bio::TreeIO; ok 3 ok 4 ok 5 ok Subroutine new redefined at Bio\Tree\Tree.pm line 131. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283. Subroutine id redefined at Bio\Tree\Tree.pm line 306. Subroutine score redefined at Bio\Tree\Tree.pm line 327. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520. Subroutine clone redefined at Bio\Tree\Tree.pm line 540. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558. Subroutine new redefined at Bio\Tree\NodeNHX.pm line 109. Subroutine DESTROY redefined at Bio\Tree\NodeNHX.pm line 118. Subroutine to_string redefined at Bio\Tree\NodeNHX.pm line 133. Subroutine nhx_tag redefined at Bio\Tree\NodeNHX.pm line 163. Subroutine _initialize redefined at Bio\TreeIO\newick.pm line 92, <$fh> line 1. Subroutine next_tree redefined at Bio\TreeIO\newick.pm line 116, <$fh> line 1. Subroutine get_default_params redefined at Bio\TreeIO\newick.pm line 155, <$fh> line 1. Subroutine write_tree redefined at Bio\TreeIO\newick.pm line 181, <$fh> line 1. Subroutine _write_tree_Helper redefined at Bio\TreeIO\newick.pm line 205, <$fh> line 1. Subroutine _node_as_string redefined at Bio\TreeIO\newick.pm line 227, <$fh> line 1. Subroutine print_tree_count redefined at Bio\TreeIO\newick.pm line 277, <$fh> line 1. Subroutine bootstrap_style redefined at Bio\TreeIO\newick.pm line 310, <$fh> line 1. Subroutine order_by redefined at Bio\TreeIO\newick.pm line 339, <$fh> line 1. Subroutine new redefined at Bio\Tree\Node.pm line 110, <$fh> line 1. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163, <$fh> line 1. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221, <$fh> line 1. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259, <$fh> line 1. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322, <$fh> line 1. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357, <$fh> line 1. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396, <$fh> line 1. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437, <$fh> line 1. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461, <$fh> line 1. Subroutine description redefined at Bio\Tree\Node.pm line 482, <$fh> line 1. Subroutine id redefined at Bio\Tree\Node.pm line 511, <$fh> line 1. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553, <$fh> line 1. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567, <$fh> line 1. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588, <$fh> line 1. Subroutine height redefined at Bio\Tree\Node.pm line 606, <$fh> line 1. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631, <$fh> line 1. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652, <$fh> line 1. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674, <$fh> line 1. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695, <$fh> line 1. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715, <$fh> line 1. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731, <$fh> line 1. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749, <$fh> line 1. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765, <$fh> line 1. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770, <$fh> line 1. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800, <$fh> line 1. t/Tree/Node.t ................................ 1..40 ok 1 - use Bio::Tree::Node; ok 2 - use Bio::Tree::AlleleNode; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - retrieve the first value ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - with fake node ok 37 - after reroot on fake node ok 38 - reroot on B ok 39 - remove fake node, reroot on former B anc ok 40 - roundtrip ok t/Tree/PhyloNetwork/Factory.t ................ 1..70 ok 1 - use Bio::PhyloNetwork::Factory; ok 2 - The object isa Bio::PhyloNetwork::Factory ok 3 - factory ok 4 - seen all the data lines ok 5 - found ok 6 - found ok 7 - found ok 8 - found ok 9 - found ok 10 - found ok 11 - found ok 12 - found ok 13 - found ok 14 - found ok 15 - found ok 16 - found ok 17 - found ok 18 - found ok 19 - found ok 20 - found ok 21 - found ok 22 - found ok 23 - found ok 24 - found ok 25 - found ok 26 - found ok 27 - found ok 28 - found ok 29 - found ok 30 - found ok 31 - found ok 32 - found ok 33 - found ok 34 - found ok 35 - found ok 36 - found ok 37 - found ok 38 - found ok 39 - found ok 40 - found ok 41 - found ok 42 - found ok 43 - found ok 44 - found ok 45 - found ok 46 - found ok 47 - found ok 48 - found ok 49 - found ok 50 - found ok 51 - found ok 52 - found ok 53 - found ok 54 - found ok 55 - found ok 56 - found ok 57 - found ok 58 - found ok 59 - found ok 60 - found ok 61 - found ok 62 - found ok 63 - found ok 64 - found ok 65 - found ok 66 - found ok 67 - found ok 68 - found ok 69 - found ok 70 - found ok t/Tree/PhyloNetwork/GraphViz.t ............... skipped: The optional module GraphViz (or dependencies thereof) was not installed t/Tree/PhyloNetwork/MuVector.t ............... 1..8 ok 1 - use Bio::PhyloNetwork::muVector; ok 2 - The object isa Bio::PhyloNetwork::muVector ok 3 - The object isa Bio::PhyloNetwork::muVector ok 4 - arithmetic ok 5 - display ok 6 - is_positive ok 7 - geq_poset ok 8 - geq_poset ok Subroutine new redefined at Bio\Tree\Tree.pm line 131. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283. Subroutine id redefined at Bio\Tree\Tree.pm line 306. Subroutine score redefined at Bio\Tree\Tree.pm line 327. Subroutine as_text redefined at Bio\Tree\Tree.pm line 375. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520. Subroutine clone redefined at Bio\Tree\Tree.pm line 540. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558. Subroutine new redefined at Bio\Tree\Node.pm line 110. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357. Subroutine ancestor redefined at Bio\Tree\Node.pm line 396. Subroutine branch_length redefined at Bio\Tree\Node.pm line 437. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461. Subroutine description redefined at Bio\Tree\Node.pm line 482. Subroutine id redefined at Bio\Tree\Node.pm line 511. Subroutine internal_id redefined at Bio\Tree\Node.pm line 553. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588. Subroutine height redefined at Bio\Tree\Node.pm line 606. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749. Subroutine has_tag redefined at Bio\Tree\Node.pm line 765. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800. Timeout (max run time is 420s) C:\Perl64\bin\perl.exe exits with 37