PATH=C:\mingw\bin;C:\cygwin\bin;C:\cpanfly-5.18\var\megalib\bin;C:\Perl-5.18\site\bin;C:\Perl-5.18\bin;C:\cygwin\bin;C:\Program Files\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\instantclient_11_2;C:\cygwin\bin;C:\Program Files\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\WINDOWS\system32\WindowsPowerShell\v1.0 Start 2014-02-22T11:55:28 ActivePerl-1800 CPAN-2.00 LIB=C:\PROGRA~1\MICROS~3\VC98\Lib\PSDK PATH=C:/CPANFL~1.18/var/libs/bin;C:\mingw\bin;C:\cygwin\bin;C:\CPANFL~1.18\var\megalib\bin;C:\Perl-5.18\site\bin;C:\Perl-5.18\bin;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\INSTAN~1;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\WINDOWS\system32\WINDOW~2\v1.0 Reading 'C:\cpanfly-5.18\var\cpan\Metadata' Database was generated on Sat, 22 Feb 2014 18:53:02 GMT Running make for C/CJ/CJFIELDS/BioPerl-1.6.922.tar.gz Checksum for C:\cpanfly-5.18\var\cpan\sources\authors\id\C\CJ\CJFIELDS\BioPerl-1.6.922.tar.gz ok BioPerl-1.6.922 BioPerl-1.6.922/.travis.yml BioPerl-1.6.922/AUTHORS BioPerl-1.6.922/BioPerl.pm BioPerl-1.6.922/BUGS BioPerl-1.6.922/Build.PL BioPerl-1.6.922/Changes BioPerl-1.6.922/DEPENDENCIES BioPerl-1.6.922/DEPRECATED BioPerl-1.6.922/INSTALL BioPerl-1.6.922/INSTALL.SKIP BioPerl-1.6.922/INSTALL.WIN BioPerl-1.6.922/LICENSE BioPerl-1.6.922/MANIFEST BioPerl-1.6.922/META.json BioPerl-1.6.922/META.yml BioPerl-1.6.922/README BioPerl-1.6.922/README.md BioPerl-1.6.922/Bio BioPerl-1.6.922/Bio/AlignIO.pm BioPerl-1.6.922/Bio/AnalysisI.pm BioPerl-1.6.922/Bio/AnalysisParserI.pm BioPerl-1.6.922/Bio/AnalysisResultI.pm BioPerl-1.6.922/Bio/AnnotatableI.pm BioPerl-1.6.922/Bio/AnnotationCollectionI.pm BioPerl-1.6.922/Bio/AnnotationI.pm BioPerl-1.6.922/Bio/ClusterI.pm BioPerl-1.6.922/Bio/ClusterIO.pm BioPerl-1.6.922/Bio/DasI.pm BioPerl-1.6.922/Bio/DBLinkContainerI.pm BioPerl-1.6.922/Bio/DescribableI.pm BioPerl-1.6.922/Bio/FeatureHolderI.pm BioPerl-1.6.922/Bio/HandlerBaseI.pm BioPerl-1.6.922/Bio/IdCollectionI.pm BioPerl-1.6.922/Bio/IdentifiableI.pm BioPerl-1.6.922/Bio/LocatableSeq.pm BioPerl-1.6.922/Bio/LocationI.pm BioPerl-1.6.922/Bio/MapIO.pm BioPerl-1.6.922/Bio/NexmlIO.pm BioPerl-1.6.922/Bio/OntologyIO.pm BioPerl-1.6.922/Bio/ParameterBaseI.pm BioPerl-1.6.922/Bio/Perl.pm BioPerl-1.6.922/Bio/PhyloNetwork.pm BioPerl-1.6.922/Bio/PrimarySeq.pm BioPerl-1.6.922/Bio/PrimarySeqI.pm BioPerl-1.6.922/Bio/PullParserI.pm BioPerl-1.6.922/Bio/Range.pm BioPerl-1.6.922/Bio/RangeI.pm BioPerl-1.6.922/Bio/SearchDist.pm BioPerl-1.6.922/Bio/SearchIO.pm BioPerl-1.6.922/Bio/Seq.pm BioPerl-1.6.922/Bio/SeqAnalysisParserI.pm BioPerl-1.6.922/Bio/SeqFeatureI.pm BioPerl-1.6.922/Bio/SeqI.pm BioPerl-1.6.922/Bio/SeqIO.pm BioPerl-1.6.922/Bio/SeqUtils.pm BioPerl-1.6.922/Bio/SimpleAlign.pm BioPerl-1.6.922/Bio/SimpleAnalysisI.pm BioPerl-1.6.922/Bio/Species.pm BioPerl-1.6.922/Bio/Taxon.pm BioPerl-1.6.922/Bio/Taxonomy.pm BioPerl-1.6.922/Bio/TreeIO.pm BioPerl-1.6.922/Bio/UpdateableSeqI.pm BioPerl-1.6.922/Bio/WebAgent.pm BioPerl-1.6.922/Bio/Align BioPerl-1.6.922/Bio/Align/AlignI.pm BioPerl-1.6.922/Bio/Align/DNAStatistics.pm BioPerl-1.6.922/Bio/Align/Graphics.pm BioPerl-1.6.922/Bio/Align/PairwiseStatistics.pm BioPerl-1.6.922/Bio/Align/ProteinStatistics.pm BioPerl-1.6.922/Bio/Align/StatisticsI.pm BioPerl-1.6.922/Bio/Align/Utilities.pm BioPerl-1.6.922/Bio/AlignIO BioPerl-1.6.922/Bio/AlignIO/arp.pm BioPerl-1.6.922/Bio/AlignIO/bl2seq.pm BioPerl-1.6.922/Bio/AlignIO/clustalw.pm BioPerl-1.6.922/Bio/AlignIO/emboss.pm BioPerl-1.6.922/Bio/AlignIO/fasta.pm BioPerl-1.6.922/Bio/AlignIO/largemultifasta.pm BioPerl-1.6.922/Bio/AlignIO/maf.pm BioPerl-1.6.922/Bio/AlignIO/mase.pm BioPerl-1.6.922/Bio/AlignIO/mega.pm BioPerl-1.6.922/Bio/AlignIO/meme.pm BioPerl-1.6.922/Bio/AlignIO/metafasta.pm BioPerl-1.6.922/Bio/AlignIO/msf.pm BioPerl-1.6.922/Bio/AlignIO/nexml.pm BioPerl-1.6.922/Bio/AlignIO/nexus.pm BioPerl-1.6.922/Bio/AlignIO/pfam.pm BioPerl-1.6.922/Bio/AlignIO/phylip.pm BioPerl-1.6.922/Bio/AlignIO/po.pm BioPerl-1.6.922/Bio/AlignIO/proda.pm BioPerl-1.6.922/Bio/AlignIO/prodom.pm BioPerl-1.6.922/Bio/AlignIO/psi.pm BioPerl-1.6.922/Bio/AlignIO/selex.pm BioPerl-1.6.922/Bio/AlignIO/stockholm.pm BioPerl-1.6.922/Bio/AlignIO/xmfa.pm BioPerl-1.6.922/Bio/AlignIO/Handler BioPerl-1.6.922/Bio/AlignIO/Handler/GenericAlignHandler.pm BioPerl-1.6.922/Bio/Annotation BioPerl-1.6.922/Bio/Annotation/AnnotationFactory.pm BioPerl-1.6.922/Bio/Annotation/Collection.pm BioPerl-1.6.922/Bio/Annotation/Comment.pm BioPerl-1.6.922/Bio/Annotation/DBLink.pm BioPerl-1.6.922/Bio/Annotation/OntologyTerm.pm BioPerl-1.6.922/Bio/Annotation/Reference.pm BioPerl-1.6.922/Bio/Annotation/Relation.pm BioPerl-1.6.922/Bio/Annotation/SimpleValue.pm BioPerl-1.6.922/Bio/Annotation/StructuredValue.pm BioPerl-1.6.922/Bio/Annotation/TagTree.pm BioPerl-1.6.922/Bio/Annotation/Target.pm BioPerl-1.6.922/Bio/Annotation/Tree.pm BioPerl-1.6.922/Bio/Annotation/TypeManager.pm BioPerl-1.6.922/Bio/Assembly BioPerl-1.6.922/Bio/Assembly/Contig.pm BioPerl-1.6.922/Bio/Assembly/ContigAnalysis.pm BioPerl-1.6.922/Bio/Assembly/IO.pm BioPerl-1.6.922/Bio/Assembly/Scaffold.pm BioPerl-1.6.922/Bio/Assembly/ScaffoldI.pm BioPerl-1.6.922/Bio/Assembly/Singlet.pm BioPerl-1.6.922/Bio/Assembly/IO BioPerl-1.6.922/Bio/Assembly/IO/ace.pm BioPerl-1.6.922/Bio/Assembly/IO/bowtie.pm BioPerl-1.6.922/Bio/Assembly/IO/maq.pm BioPerl-1.6.922/Bio/Assembly/IO/phrap.pm BioPerl-1.6.922/Bio/Assembly/IO/sam.pm BioPerl-1.6.922/Bio/Assembly/IO/tigr.pm BioPerl-1.6.922/Bio/Assembly/Tools BioPerl-1.6.922/Bio/Assembly/Tools/ContigSpectrum.pm BioPerl-1.6.922/Bio/Cluster BioPerl-1.6.922/Bio/Cluster/ClusterFactory.pm BioPerl-1.6.922/Bio/Cluster/FamilyI.pm BioPerl-1.6.922/Bio/Cluster/SequenceFamily.pm BioPerl-1.6.922/Bio/Cluster/UniGene.pm BioPerl-1.6.922/Bio/Cluster/UniGeneI.pm BioPerl-1.6.922/Bio/ClusterIO BioPerl-1.6.922/Bio/ClusterIO/dbsnp.pm BioPerl-1.6.922/Bio/ClusterIO/unigene.pm BioPerl-1.6.922/Bio/CodonUsage BioPerl-1.6.922/Bio/CodonUsage/IO.pm BioPerl-1.6.922/Bio/CodonUsage/Table.pm BioPerl-1.6.922/Bio/Coordinate BioPerl-1.6.922/Bio/Coordinate/Chain.pm BioPerl-1.6.922/Bio/Coordinate/Collection.pm BioPerl-1.6.922/Bio/Coordinate/ExtrapolatingPair.pm BioPerl-1.6.922/Bio/Coordinate/GeneMapper.pm BioPerl-1.6.922/Bio/Coordinate/Graph.pm BioPerl-1.6.922/Bio/Coordinate/MapperI.pm BioPerl-1.6.922/Bio/Coordinate/Pair.pm BioPerl-1.6.922/Bio/Coordinate/Result.pm BioPerl-1.6.922/Bio/Coordinate/ResultI.pm BioPerl-1.6.922/Bio/Coordinate/Utils.pm BioPerl-1.6.922/Bio/Coordinate/Result BioPerl-1.6.922/Bio/Coordinate/Result/Gap.pm BioPerl-1.6.922/Bio/Coordinate/Result/Match.pm BioPerl-1.6.922/Bio/Das BioPerl-1.6.922/Bio/Das/FeatureTypeI.pm BioPerl-1.6.922/Bio/Das/SegmentI.pm BioPerl-1.6.922/Bio/DB BioPerl-1.6.922/Bio/DB/Ace.pm BioPerl-1.6.922/Bio/DB/BioFetch.pm BioPerl-1.6.922/Bio/DB/CUTG.pm BioPerl-1.6.922/Bio/DB/DBFetch.pm BioPerl-1.6.922/Bio/DB/EMBL.pm BioPerl-1.6.922/Bio/DB/EntrezGene.pm BioPerl-1.6.922/Bio/DB/Expression.pm BioPerl-1.6.922/Bio/DB/Failover.pm BioPerl-1.6.922/Bio/DB/Fasta.pm BioPerl-1.6.922/Bio/DB/FileCache.pm BioPerl-1.6.922/Bio/DB/Flat.pm BioPerl-1.6.922/Bio/DB/GenBank.pm BioPerl-1.6.922/Bio/DB/GenericWebAgent.pm BioPerl-1.6.922/Bio/DB/GenPept.pm BioPerl-1.6.922/Bio/DB/GFF.pm BioPerl-1.6.922/Bio/DB/HIV.pm BioPerl-1.6.922/Bio/DB/IndexedBase.pm BioPerl-1.6.922/Bio/DB/InMemoryCache.pm BioPerl-1.6.922/Bio/DB/LocationI.pm BioPerl-1.6.922/Bio/DB/MeSH.pm BioPerl-1.6.922/Bio/DB/NCBIHelper.pm BioPerl-1.6.922/Bio/DB/Qual.pm BioPerl-1.6.922/Bio/DB/QueryI.pm BioPerl-1.6.922/Bio/DB/RandomAccessI.pm BioPerl-1.6.922/Bio/DB/ReferenceI.pm BioPerl-1.6.922/Bio/DB/RefSeq.pm BioPerl-1.6.922/Bio/DB/Registry.pm BioPerl-1.6.922/Bio/DB/SeqFeature.pm BioPerl-1.6.922/Bio/DB/SeqHound.pm BioPerl-1.6.922/Bio/DB/SeqI.pm BioPerl-1.6.922/Bio/DB/SeqVersion.pm BioPerl-1.6.922/Bio/DB/SwissProt.pm BioPerl-1.6.922/Bio/DB/Taxonomy.pm BioPerl-1.6.922/Bio/DB/TFBS.pm BioPerl-1.6.922/Bio/DB/Universal.pm BioPerl-1.6.922/Bio/DB/UpdateableSeqI.pm BioPerl-1.6.922/Bio/DB/WebDBSeqI.pm BioPerl-1.6.922/Bio/DB/Expression BioPerl-1.6.922/Bio/DB/Expression/geo.pm BioPerl-1.6.922/Bio/DB/Flat BioPerl-1.6.922/Bio/DB/Flat/BDB.pm BioPerl-1.6.922/Bio/DB/Flat/BinarySearch.pm BioPerl-1.6.922/Bio/DB/Flat/BDB BioPerl-1.6.922/Bio/DB/Flat/BDB/embl.pm BioPerl-1.6.922/Bio/DB/Flat/BDB/fasta.pm BioPerl-1.6.922/Bio/DB/Flat/BDB/genbank.pm BioPerl-1.6.922/Bio/DB/Flat/BDB/swiss.pm BioPerl-1.6.922/Bio/DB/GFF BioPerl-1.6.922/Bio/DB/GFF/Aggregator.pm BioPerl-1.6.922/Bio/DB/GFF/Featname.pm BioPerl-1.6.922/Bio/DB/GFF/Feature.pm BioPerl-1.6.922/Bio/DB/GFF/Homol.pm BioPerl-1.6.922/Bio/DB/GFF/RelSegment.pm BioPerl-1.6.922/Bio/DB/GFF/Segment.pm BioPerl-1.6.922/Bio/DB/GFF/Typename.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor BioPerl-1.6.922/Bio/DB/GFF/Adaptor/ace.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/berkeleydb.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/biofetch.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/biofetch_oracle.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/memory.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/berkeleydb BioPerl-1.6.922/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/iterator.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/mysql.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/oracle.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/oracleace.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/pg.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/memory BioPerl-1.6.922/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm BioPerl-1.6.922/Bio/DB/GFF/Adaptor/memory/iterator.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator BioPerl-1.6.922/Bio/DB/GFF/Aggregator/alignment.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/clone.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/coding.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/gene.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/match.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/none.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/orf.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/processed_transcript.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/so_transcript.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/transcript.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_acembly.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_genscan.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_refgene.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_softberry.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm BioPerl-1.6.922/Bio/DB/GFF/Aggregator/ucsc_unigene.pm BioPerl-1.6.922/Bio/DB/GFF/Util BioPerl-1.6.922/Bio/DB/GFF/Util/Binning.pm BioPerl-1.6.922/Bio/DB/GFF/Util/Rearrange.pm BioPerl-1.6.922/Bio/DB/HIV BioPerl-1.6.922/Bio/DB/HIV/HIVAnnotProcessor.pm BioPerl-1.6.922/Bio/DB/HIV/HIVQueryHelper.pm BioPerl-1.6.922/Bio/DB/HIV/lanl-schema.xml BioPerl-1.6.922/Bio/DB/Query BioPerl-1.6.922/Bio/DB/Query/GenBank.pm BioPerl-1.6.922/Bio/DB/Query/HIVQuery.pm BioPerl-1.6.922/Bio/DB/Query/WebQuery.pm BioPerl-1.6.922/Bio/DB/SeqFeature BioPerl-1.6.922/Bio/DB/SeqFeature/NormalizedFeature.pm BioPerl-1.6.922/Bio/DB/SeqFeature/NormalizedFeatureI.pm BioPerl-1.6.922/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Segment.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store BioPerl-1.6.922/Bio/DB/SeqFeature/Store/bdb.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/berkeleydb.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/berkeleydb3.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/GFF2Loader.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/GFF3Loader.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/Loader.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/LoadHelper.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/memory.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/DBI BioPerl-1.6.922/Bio/DB/SeqFeature/Store/DBI/Iterator.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/DBI/mysql.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/DBI/Pg.pm BioPerl-1.6.922/Bio/DB/SeqFeature/Store/DBI/SQLite.pm BioPerl-1.6.922/Bio/DB/SeqVersion BioPerl-1.6.922/Bio/DB/SeqVersion/gi.pm BioPerl-1.6.922/Bio/DB/Taxonomy BioPerl-1.6.922/Bio/DB/Taxonomy/entrez.pm BioPerl-1.6.922/Bio/DB/Taxonomy/flatfile.pm BioPerl-1.6.922/Bio/DB/Taxonomy/greengenes.pm BioPerl-1.6.922/Bio/DB/Taxonomy/list.pm BioPerl-1.6.922/Bio/DB/Taxonomy/silva.pm BioPerl-1.6.922/Bio/DB/TFBS BioPerl-1.6.922/Bio/DB/TFBS/transfac_pro.pm BioPerl-1.6.922/Bio/Draw BioPerl-1.6.922/Bio/Draw/Pictogram.pm BioPerl-1.6.922/Bio/Event BioPerl-1.6.922/Bio/Event/EventGeneratorI.pm BioPerl-1.6.922/Bio/Event/EventHandlerI.pm BioPerl-1.6.922/Bio/Factory BioPerl-1.6.922/Bio/Factory/AnalysisI.pm BioPerl-1.6.922/Bio/Factory/ApplicationFactoryI.pm BioPerl-1.6.922/Bio/Factory/DriverFactory.pm BioPerl-1.6.922/Bio/Factory/FTLocationFactory.pm BioPerl-1.6.922/Bio/Factory/LocationFactoryI.pm BioPerl-1.6.922/Bio/Factory/MapFactoryI.pm BioPerl-1.6.922/Bio/Factory/ObjectBuilderI.pm BioPerl-1.6.922/Bio/Factory/ObjectFactory.pm BioPerl-1.6.922/Bio/Factory/ObjectFactoryI.pm BioPerl-1.6.922/Bio/Factory/SeqAnalysisParserFactory.pm BioPerl-1.6.922/Bio/Factory/SeqAnalysisParserFactoryI.pm BioPerl-1.6.922/Bio/Factory/SequenceFactoryI.pm BioPerl-1.6.922/Bio/Factory/SequenceProcessorI.pm BioPerl-1.6.922/Bio/Factory/SequenceStreamI.pm BioPerl-1.6.922/Bio/Factory/TreeFactoryI.pm BioPerl-1.6.922/Bio/Index BioPerl-1.6.922/Bio/Index/Abstract.pm BioPerl-1.6.922/Bio/Index/AbstractSeq.pm BioPerl-1.6.922/Bio/Index/Blast.pm BioPerl-1.6.922/Bio/Index/BlastTable.pm BioPerl-1.6.922/Bio/Index/EMBL.pm BioPerl-1.6.922/Bio/Index/Fasta.pm BioPerl-1.6.922/Bio/Index/Fastq.pm BioPerl-1.6.922/Bio/Index/GenBank.pm BioPerl-1.6.922/Bio/Index/Hmmer.pm BioPerl-1.6.922/Bio/Index/Qual.pm BioPerl-1.6.922/Bio/Index/Stockholm.pm BioPerl-1.6.922/Bio/Index/SwissPfam.pm BioPerl-1.6.922/Bio/Index/Swissprot.pm BioPerl-1.6.922/Bio/LiveSeq BioPerl-1.6.922/Bio/LiveSeq/AARange.pm BioPerl-1.6.922/Bio/LiveSeq/Chain.pm BioPerl-1.6.922/Bio/LiveSeq/ChainI.pm BioPerl-1.6.922/Bio/LiveSeq/DNA.pm BioPerl-1.6.922/Bio/LiveSeq/Exon.pm BioPerl-1.6.922/Bio/LiveSeq/Gene.pm BioPerl-1.6.922/Bio/LiveSeq/Intron.pm BioPerl-1.6.922/Bio/LiveSeq/Mutation.pm BioPerl-1.6.922/Bio/LiveSeq/Mutator.pm BioPerl-1.6.922/Bio/LiveSeq/Prim_Transcript.pm BioPerl-1.6.922/Bio/LiveSeq/Range.pm BioPerl-1.6.922/Bio/LiveSeq/Repeat_Region.pm BioPerl-1.6.922/Bio/LiveSeq/Repeat_Unit.pm BioPerl-1.6.922/Bio/LiveSeq/SeqI.pm BioPerl-1.6.922/Bio/LiveSeq/Transcript.pm BioPerl-1.6.922/Bio/LiveSeq/Translation.pm BioPerl-1.6.922/Bio/LiveSeq/IO BioPerl-1.6.922/Bio/LiveSeq/IO/BioPerl.pm BioPerl-1.6.922/Bio/LiveSeq/IO/Loader.pm BioPerl-1.6.922/Bio/LiveSeq/IO/README BioPerl-1.6.922/Bio/Location BioPerl-1.6.922/Bio/Location/Atomic.pm BioPerl-1.6.922/Bio/Location/AvWithinCoordPolicy.pm BioPerl-1.6.922/Bio/Location/CoordinatePolicyI.pm BioPerl-1.6.922/Bio/Location/Fuzzy.pm BioPerl-1.6.922/Bio/Location/FuzzyLocationI.pm BioPerl-1.6.922/Bio/Location/NarrowestCoordPolicy.pm BioPerl-1.6.922/Bio/Location/Simple.pm BioPerl-1.6.922/Bio/Location/Split.pm BioPerl-1.6.922/Bio/Location/SplitLocationI.pm BioPerl-1.6.922/Bio/Location/WidestCoordPolicy.pm BioPerl-1.6.922/Bio/Map BioPerl-1.6.922/Bio/Map/Clone.pm BioPerl-1.6.922/Bio/Map/Contig.pm BioPerl-1.6.922/Bio/Map/CytoMap.pm BioPerl-1.6.922/Bio/Map/CytoMarker.pm BioPerl-1.6.922/Bio/Map/CytoPosition.pm BioPerl-1.6.922/Bio/Map/EntityI.pm BioPerl-1.6.922/Bio/Map/FPCMarker.pm BioPerl-1.6.922/Bio/Map/Gene.pm BioPerl-1.6.922/Bio/Map/GeneMap.pm BioPerl-1.6.922/Bio/Map/GenePosition.pm BioPerl-1.6.922/Bio/Map/GeneRelative.pm BioPerl-1.6.922/Bio/Map/LinkageMap.pm BioPerl-1.6.922/Bio/Map/LinkagePosition.pm BioPerl-1.6.922/Bio/Map/MapI.pm BioPerl-1.6.922/Bio/Map/Mappable.pm BioPerl-1.6.922/Bio/Map/MappableI.pm BioPerl-1.6.922/Bio/Map/Marker.pm BioPerl-1.6.922/Bio/Map/MarkerI.pm BioPerl-1.6.922/Bio/Map/Microsatellite.pm BioPerl-1.6.922/Bio/Map/OrderedPosition.pm BioPerl-1.6.922/Bio/Map/OrderedPositionWithDistance.pm BioPerl-1.6.922/Bio/Map/Physical.pm BioPerl-1.6.922/Bio/Map/Position.pm BioPerl-1.6.922/Bio/Map/PositionHandler.pm BioPerl-1.6.922/Bio/Map/PositionHandlerI.pm BioPerl-1.6.922/Bio/Map/PositionI.pm BioPerl-1.6.922/Bio/Map/PositionWithSequence.pm BioPerl-1.6.922/Bio/Map/Prediction.pm BioPerl-1.6.922/Bio/Map/Relative.pm BioPerl-1.6.922/Bio/Map/RelativeI.pm BioPerl-1.6.922/Bio/Map/SimpleMap.pm BioPerl-1.6.922/Bio/Map/TranscriptionFactor.pm BioPerl-1.6.922/Bio/MapIO BioPerl-1.6.922/Bio/MapIO/fpc.pm BioPerl-1.6.922/Bio/MapIO/mapmaker.pm BioPerl-1.6.922/Bio/Matrix BioPerl-1.6.922/Bio/Matrix/Generic.pm BioPerl-1.6.922/Bio/Matrix/IO.pm BioPerl-1.6.922/Bio/Matrix/MatrixI.pm BioPerl-1.6.922/Bio/Matrix/Mlagan.pm BioPerl-1.6.922/Bio/Matrix/PhylipDist.pm BioPerl-1.6.922/Bio/Matrix/Scoring.pm BioPerl-1.6.922/Bio/Matrix/IO BioPerl-1.6.922/Bio/Matrix/IO/mlagan.pm BioPerl-1.6.922/Bio/Matrix/IO/phylip.pm BioPerl-1.6.922/Bio/Matrix/IO/scoring.pm BioPerl-1.6.922/Bio/Matrix/PSM BioPerl-1.6.922/Bio/Matrix/PSM/InstanceSite.pm BioPerl-1.6.922/Bio/Matrix/PSM/InstanceSiteI.pm BioPerl-1.6.922/Bio/Matrix/PSM/IO.pm BioPerl-1.6.922/Bio/Matrix/PSM/ProtMatrix.pm BioPerl-1.6.922/Bio/Matrix/PSM/ProtPsm.pm BioPerl-1.6.922/Bio/Matrix/PSM/Psm.pm BioPerl-1.6.922/Bio/Matrix/PSM/PsmHeader.pm BioPerl-1.6.922/Bio/Matrix/PSM/PsmHeaderI.pm BioPerl-1.6.922/Bio/Matrix/PSM/PsmI.pm BioPerl-1.6.922/Bio/Matrix/PSM/SiteMatrix.pm BioPerl-1.6.922/Bio/Matrix/PSM/SiteMatrixI.pm BioPerl-1.6.922/Bio/Matrix/PSM/IO BioPerl-1.6.922/Bio/Matrix/PSM/IO/mast.pm BioPerl-1.6.922/Bio/Matrix/PSM/IO/masta.pm BioPerl-1.6.922/Bio/Matrix/PSM/IO/meme.pm BioPerl-1.6.922/Bio/Matrix/PSM/IO/psiblast.pm BioPerl-1.6.922/Bio/Matrix/PSM/IO/transfac.pm BioPerl-1.6.922/Bio/MolEvol BioPerl-1.6.922/Bio/MolEvol/CodonModel.pm BioPerl-1.6.922/Bio/Nexml BioPerl-1.6.922/Bio/Nexml/Factory.pm BioPerl-1.6.922/Bio/Ontology BioPerl-1.6.922/Bio/Ontology/DocumentRegistry.pm BioPerl-1.6.922/Bio/Ontology/GOterm.pm BioPerl-1.6.922/Bio/Ontology/InterProTerm.pm BioPerl-1.6.922/Bio/Ontology/OBOEngine.pm BioPerl-1.6.922/Bio/Ontology/OBOterm.pm BioPerl-1.6.922/Bio/Ontology/Ontology.pm BioPerl-1.6.922/Bio/Ontology/OntologyEngineI.pm BioPerl-1.6.922/Bio/Ontology/OntologyI.pm BioPerl-1.6.922/Bio/Ontology/OntologyStore.pm BioPerl-1.6.922/Bio/Ontology/Path.pm BioPerl-1.6.922/Bio/Ontology/PathI.pm BioPerl-1.6.922/Bio/Ontology/Relationship.pm BioPerl-1.6.922/Bio/Ontology/RelationshipFactory.pm BioPerl-1.6.922/Bio/Ontology/RelationshipI.pm BioPerl-1.6.922/Bio/Ontology/RelationshipType.pm BioPerl-1.6.922/Bio/Ontology/SimpleOntologyEngine.pm BioPerl-1.6.922/Bio/Ontology/Term.pm BioPerl-1.6.922/Bio/Ontology/TermFactory.pm BioPerl-1.6.922/Bio/Ontology/TermI.pm BioPerl-1.6.922/Bio/Ontology/SimpleGOEngine BioPerl-1.6.922/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm BioPerl-1.6.922/Bio/OntologyIO BioPerl-1.6.922/Bio/OntologyIO/dagflat.pm BioPerl-1.6.922/Bio/OntologyIO/goflat.pm BioPerl-1.6.922/Bio/OntologyIO/InterProParser.pm BioPerl-1.6.922/Bio/OntologyIO/obo.pm BioPerl-1.6.922/Bio/OntologyIO/simplehierarchy.pm BioPerl-1.6.922/Bio/OntologyIO/soflat.pm BioPerl-1.6.922/Bio/OntologyIO/Handlers BioPerl-1.6.922/Bio/OntologyIO/Handlers/BaseSAXHandler.pm BioPerl-1.6.922/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm BioPerl-1.6.922/Bio/OntologyIO/Handlers/InterProHandler.pm BioPerl-1.6.922/Bio/Phenotype BioPerl-1.6.922/Bio/Phenotype/Correlate.pm BioPerl-1.6.922/Bio/Phenotype/Measure.pm BioPerl-1.6.922/Bio/Phenotype/Phenotype.pm BioPerl-1.6.922/Bio/Phenotype/PhenotypeI.pm BioPerl-1.6.922/Bio/Phenotype/MeSH BioPerl-1.6.922/Bio/Phenotype/MeSH/Term.pm BioPerl-1.6.922/Bio/Phenotype/MeSH/Twig.pm BioPerl-1.6.922/Bio/Phenotype/OMIM BioPerl-1.6.922/Bio/Phenotype/OMIM/MiniMIMentry.pm BioPerl-1.6.922/Bio/Phenotype/OMIM/OMIMentry.pm BioPerl-1.6.922/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm BioPerl-1.6.922/Bio/Phenotype/OMIM/OMIMparser.pm BioPerl-1.6.922/Bio/PhyloNetwork BioPerl-1.6.922/Bio/PhyloNetwork/Factory.pm BioPerl-1.6.922/Bio/PhyloNetwork/FactoryX.pm BioPerl-1.6.922/Bio/PhyloNetwork/GraphViz.pm BioPerl-1.6.922/Bio/PhyloNetwork/muVector.pm BioPerl-1.6.922/Bio/PhyloNetwork/RandomFactory.pm BioPerl-1.6.922/Bio/PhyloNetwork/TreeFactory.pm BioPerl-1.6.922/Bio/PhyloNetwork/TreeFactoryMulti.pm BioPerl-1.6.922/Bio/PhyloNetwork/TreeFactoryX.pm BioPerl-1.6.922/Bio/PopGen BioPerl-1.6.922/Bio/PopGen/Genotype.pm BioPerl-1.6.922/Bio/PopGen/GenotypeI.pm BioPerl-1.6.922/Bio/PopGen/HtSNP.pm BioPerl-1.6.922/Bio/PopGen/Individual.pm BioPerl-1.6.922/Bio/PopGen/IndividualI.pm BioPerl-1.6.922/Bio/PopGen/IO.pm BioPerl-1.6.922/Bio/PopGen/Marker.pm BioPerl-1.6.922/Bio/PopGen/MarkerI.pm BioPerl-1.6.922/Bio/PopGen/PopStats.pm BioPerl-1.6.922/Bio/PopGen/Population.pm BioPerl-1.6.922/Bio/PopGen/PopulationI.pm BioPerl-1.6.922/Bio/PopGen/Statistics.pm BioPerl-1.6.922/Bio/PopGen/TagHaplotype.pm BioPerl-1.6.922/Bio/PopGen/Utilities.pm BioPerl-1.6.922/Bio/PopGen/IO BioPerl-1.6.922/Bio/PopGen/IO/csv.pm BioPerl-1.6.922/Bio/PopGen/IO/hapmap.pm BioPerl-1.6.922/Bio/PopGen/IO/phase.pm BioPerl-1.6.922/Bio/PopGen/IO/prettybase.pm BioPerl-1.6.922/Bio/PopGen/Simulation BioPerl-1.6.922/Bio/PopGen/Simulation/Coalescent.pm BioPerl-1.6.922/Bio/PopGen/Simulation/GeneticDrift.pm BioPerl-1.6.922/Bio/Restriction BioPerl-1.6.922/Bio/Restriction/Analysis.pm BioPerl-1.6.922/Bio/Restriction/Enzyme.pm BioPerl-1.6.922/Bio/Restriction/EnzymeCollection.pm BioPerl-1.6.922/Bio/Restriction/EnzymeI.pm BioPerl-1.6.922/Bio/Restriction/IO.pm BioPerl-1.6.922/Bio/Restriction/Enzyme BioPerl-1.6.922/Bio/Restriction/Enzyme/MultiCut.pm BioPerl-1.6.922/Bio/Restriction/Enzyme/MultiSite.pm BioPerl-1.6.922/Bio/Restriction/IO BioPerl-1.6.922/Bio/Restriction/IO/bairoch.pm BioPerl-1.6.922/Bio/Restriction/IO/base.pm BioPerl-1.6.922/Bio/Restriction/IO/itype2.pm BioPerl-1.6.922/Bio/Restriction/IO/prototype.pm BioPerl-1.6.922/Bio/Restriction/IO/withrefm.pm BioPerl-1.6.922/Bio/Root BioPerl-1.6.922/Bio/Root/Build.pm BioPerl-1.6.922/Bio/Root/Exception.pm BioPerl-1.6.922/Bio/Root/HTTPget.pm BioPerl-1.6.922/Bio/Root/IO.pm BioPerl-1.6.922/Bio/Root/Root.pm BioPerl-1.6.922/Bio/Root/RootI.pm BioPerl-1.6.922/Bio/Root/Storable.pm BioPerl-1.6.922/Bio/Root/Test.pm BioPerl-1.6.922/Bio/Root/Utilities.pm BioPerl-1.6.922/Bio/Root/Version.pm BioPerl-1.6.922/Bio/Search BioPerl-1.6.922/Bio/Search/BlastStatistics.pm BioPerl-1.6.922/Bio/Search/BlastUtils.pm BioPerl-1.6.922/Bio/Search/DatabaseI.pm BioPerl-1.6.922/Bio/Search/GenericDatabase.pm BioPerl-1.6.922/Bio/Search/GenericStatistics.pm BioPerl-1.6.922/Bio/Search/Processor.pm BioPerl-1.6.922/Bio/Search/SearchUtils.pm BioPerl-1.6.922/Bio/Search/StatisticsI.pm BioPerl-1.6.922/Bio/Search/Hit BioPerl-1.6.922/Bio/Search/Hit/BlastHit.pm BioPerl-1.6.922/Bio/Search/Hit/BlastPullHit.pm BioPerl-1.6.922/Bio/Search/Hit/Fasta.pm BioPerl-1.6.922/Bio/Search/Hit/GenericHit.pm BioPerl-1.6.922/Bio/Search/Hit/HitFactory.pm BioPerl-1.6.922/Bio/Search/Hit/HitI.pm BioPerl-1.6.922/Bio/Search/Hit/hmmer3Hit.pm BioPerl-1.6.922/Bio/Search/Hit/HMMERHit.pm BioPerl-1.6.922/Bio/Search/Hit/HmmpfamHit.pm BioPerl-1.6.922/Bio/Search/Hit/ModelHit.pm BioPerl-1.6.922/Bio/Search/Hit/PsiBlastHit.pm BioPerl-1.6.922/Bio/Search/Hit/PullHitI.pm BioPerl-1.6.922/Bio/Search/HSP BioPerl-1.6.922/Bio/Search/HSP/BlastHSP.pm BioPerl-1.6.922/Bio/Search/HSP/BlastPullHSP.pm BioPerl-1.6.922/Bio/Search/HSP/FastaHSP.pm BioPerl-1.6.922/Bio/Search/HSP/GenericHSP.pm BioPerl-1.6.922/Bio/Search/HSP/HMMERHSP.pm BioPerl-1.6.922/Bio/Search/HSP/HmmpfamHSP.pm BioPerl-1.6.922/Bio/Search/HSP/HSPFactory.pm BioPerl-1.6.922/Bio/Search/HSP/HSPI.pm BioPerl-1.6.922/Bio/Search/HSP/ModelHSP.pm BioPerl-1.6.922/Bio/Search/HSP/PsiBlastHSP.pm BioPerl-1.6.922/Bio/Search/HSP/PSLHSP.pm BioPerl-1.6.922/Bio/Search/HSP/PullHSPI.pm BioPerl-1.6.922/Bio/Search/HSP/WABAHSP.pm BioPerl-1.6.922/Bio/Search/Iteration BioPerl-1.6.922/Bio/Search/Iteration/GenericIteration.pm BioPerl-1.6.922/Bio/Search/Iteration/IterationI.pm BioPerl-1.6.922/Bio/Search/Result BioPerl-1.6.922/Bio/Search/Result/BlastPullResult.pm BioPerl-1.6.922/Bio/Search/Result/BlastResult.pm BioPerl-1.6.922/Bio/Search/Result/CrossMatchResult.pm BioPerl-1.6.922/Bio/Search/Result/GenericResult.pm BioPerl-1.6.922/Bio/Search/Result/hmmer3Result.pm BioPerl-1.6.922/Bio/Search/Result/HMMERResult.pm BioPerl-1.6.922/Bio/Search/Result/HmmpfamResult.pm BioPerl-1.6.922/Bio/Search/Result/PullResultI.pm BioPerl-1.6.922/Bio/Search/Result/ResultFactory.pm BioPerl-1.6.922/Bio/Search/Result/ResultI.pm BioPerl-1.6.922/Bio/Search/Result/WABAResult.pm BioPerl-1.6.922/Bio/Search/Tiling BioPerl-1.6.922/Bio/Search/Tiling/MapTileUtils.pm BioPerl-1.6.922/Bio/Search/Tiling/MapTiling.pm BioPerl-1.6.922/Bio/Search/Tiling/TilingI.pm BioPerl-1.6.922/Bio/SearchIO BioPerl-1.6.922/Bio/SearchIO/axt.pm BioPerl-1.6.922/Bio/SearchIO/blast.pm BioPerl-1.6.922/Bio/SearchIO/blast_pull.pm BioPerl-1.6.922/Bio/SearchIO/blasttable.pm BioPerl-1.6.922/Bio/SearchIO/blastxml.pm BioPerl-1.6.922/Bio/SearchIO/cross_match.pm BioPerl-1.6.922/Bio/SearchIO/erpin.pm BioPerl-1.6.922/Bio/SearchIO/EventHandlerI.pm BioPerl-1.6.922/Bio/SearchIO/exonerate.pm BioPerl-1.6.922/Bio/SearchIO/fasta.pm BioPerl-1.6.922/Bio/SearchIO/FastHitEventBuilder.pm BioPerl-1.6.922/Bio/SearchIO/gmap_f9.pm BioPerl-1.6.922/Bio/SearchIO/hmmer.pm BioPerl-1.6.922/Bio/SearchIO/hmmer2.pm BioPerl-1.6.922/Bio/SearchIO/hmmer3.pm BioPerl-1.6.922/Bio/SearchIO/hmmer_pull.pm BioPerl-1.6.922/Bio/SearchIO/infernal.pm BioPerl-1.6.922/Bio/SearchIO/IteratedSearchResultEventBuilder.pm BioPerl-1.6.922/Bio/SearchIO/megablast.pm BioPerl-1.6.922/Bio/SearchIO/psl.pm BioPerl-1.6.922/Bio/SearchIO/rnamotif.pm BioPerl-1.6.922/Bio/SearchIO/SearchResultEventBuilder.pm BioPerl-1.6.922/Bio/SearchIO/SearchWriterI.pm BioPerl-1.6.922/Bio/SearchIO/sim4.pm BioPerl-1.6.922/Bio/SearchIO/waba.pm BioPerl-1.6.922/Bio/SearchIO/wise.pm BioPerl-1.6.922/Bio/SearchIO/Writer BioPerl-1.6.922/Bio/SearchIO/Writer/BSMLResultWriter.pm BioPerl-1.6.922/Bio/SearchIO/Writer/GbrowseGFF.pm BioPerl-1.6.922/Bio/SearchIO/Writer/HitTableWriter.pm BioPerl-1.6.922/Bio/SearchIO/Writer/HSPTableWriter.pm BioPerl-1.6.922/Bio/SearchIO/Writer/HTMLResultWriter.pm BioPerl-1.6.922/Bio/SearchIO/Writer/ResultTableWriter.pm BioPerl-1.6.922/Bio/SearchIO/Writer/TextResultWriter.pm BioPerl-1.6.922/Bio/SearchIO/XML BioPerl-1.6.922/Bio/SearchIO/XML/BlastHandler.pm BioPerl-1.6.922/Bio/SearchIO/XML/PsiBlastHandler.pm BioPerl-1.6.922/Bio/Seq BioPerl-1.6.922/Bio/Seq/BaseSeqProcessor.pm BioPerl-1.6.922/Bio/Seq/EncodedSeq.pm BioPerl-1.6.922/Bio/Seq/LargeLocatableSeq.pm BioPerl-1.6.922/Bio/Seq/LargePrimarySeq.pm BioPerl-1.6.922/Bio/Seq/LargeSeq.pm BioPerl-1.6.922/Bio/Seq/LargeSeqI.pm BioPerl-1.6.922/Bio/Seq/Meta.pm BioPerl-1.6.922/Bio/Seq/MetaI.pm BioPerl-1.6.922/Bio/Seq/PrimaryQual.pm BioPerl-1.6.922/Bio/Seq/PrimedSeq.pm BioPerl-1.6.922/Bio/Seq/QualI.pm BioPerl-1.6.922/Bio/Seq/Quality.pm BioPerl-1.6.922/Bio/Seq/RichSeq.pm BioPerl-1.6.922/Bio/Seq/RichSeqI.pm BioPerl-1.6.922/Bio/Seq/SeqBuilder.pm BioPerl-1.6.922/Bio/Seq/SeqFactory.pm BioPerl-1.6.922/Bio/Seq/SeqFastaSpeedFactory.pm BioPerl-1.6.922/Bio/Seq/SequenceTrace.pm BioPerl-1.6.922/Bio/Seq/SeqWithQuality.pm BioPerl-1.6.922/Bio/Seq/SimulatedRead.pm BioPerl-1.6.922/Bio/Seq/TraceI.pm BioPerl-1.6.922/Bio/Seq/Meta BioPerl-1.6.922/Bio/Seq/Meta/Array.pm BioPerl-1.6.922/Bio/SeqEvolution BioPerl-1.6.922/Bio/SeqEvolution/DNAPoint.pm BioPerl-1.6.922/Bio/SeqEvolution/EvolutionI.pm BioPerl-1.6.922/Bio/SeqEvolution/Factory.pm BioPerl-1.6.922/Bio/SeqFeature BioPerl-1.6.922/Bio/SeqFeature/Amplicon.pm BioPerl-1.6.922/Bio/SeqFeature/AnnotationAdaptor.pm BioPerl-1.6.922/Bio/SeqFeature/Collection.pm BioPerl-1.6.922/Bio/SeqFeature/CollectionI.pm BioPerl-1.6.922/Bio/SeqFeature/Computation.pm BioPerl-1.6.922/Bio/SeqFeature/FeaturePair.pm BioPerl-1.6.922/Bio/SeqFeature/Generic.pm BioPerl-1.6.922/Bio/SeqFeature/Lite.pm BioPerl-1.6.922/Bio/SeqFeature/PositionProxy.pm BioPerl-1.6.922/Bio/SeqFeature/Primer.pm BioPerl-1.6.922/Bio/SeqFeature/Similarity.pm BioPerl-1.6.922/Bio/SeqFeature/SimilarityPair.pm BioPerl-1.6.922/Bio/SeqFeature/SubSeq.pm BioPerl-1.6.922/Bio/SeqFeature/TypedSeqFeatureI.pm BioPerl-1.6.922/Bio/SeqFeature/Gene BioPerl-1.6.922/Bio/SeqFeature/Gene/Exon.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/ExonI.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/GeneStructure.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/GeneStructureI.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/Intron.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/NC_Feature.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/Poly_A_site.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/Promoter.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/Transcript.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/TranscriptI.pm BioPerl-1.6.922/Bio/SeqFeature/Gene/UTR.pm BioPerl-1.6.922/Bio/SeqFeature/SiRNA BioPerl-1.6.922/Bio/SeqFeature/SiRNA/Oligo.pm BioPerl-1.6.922/Bio/SeqFeature/SiRNA/Pair.pm BioPerl-1.6.922/Bio/SeqFeature/Tools BioPerl-1.6.922/Bio/SeqFeature/Tools/FeatureNamer.pm BioPerl-1.6.922/Bio/SeqFeature/Tools/IDHandler.pm BioPerl-1.6.922/Bio/SeqFeature/Tools/TypeMapper.pm BioPerl-1.6.922/Bio/SeqFeature/Tools/Unflattener.pm BioPerl-1.6.922/Bio/SeqIO BioPerl-1.6.922/Bio/SeqIO/abi.pm BioPerl-1.6.922/Bio/SeqIO/ace.pm BioPerl-1.6.922/Bio/SeqIO/agave.pm BioPerl-1.6.922/Bio/SeqIO/alf.pm BioPerl-1.6.922/Bio/SeqIO/asciitree.pm BioPerl-1.6.922/Bio/SeqIO/bsml.pm BioPerl-1.6.922/Bio/SeqIO/bsml_sax.pm BioPerl-1.6.922/Bio/SeqIO/chadoxml.pm BioPerl-1.6.922/Bio/SeqIO/chaos.pm BioPerl-1.6.922/Bio/SeqIO/chaosxml.pm BioPerl-1.6.922/Bio/SeqIO/ctf.pm BioPerl-1.6.922/Bio/SeqIO/embl.pm BioPerl-1.6.922/Bio/SeqIO/embldriver.pm BioPerl-1.6.922/Bio/SeqIO/entrezgene.pm BioPerl-1.6.922/Bio/SeqIO/excel.pm BioPerl-1.6.922/Bio/SeqIO/exp.pm BioPerl-1.6.922/Bio/SeqIO/fasta.pm BioPerl-1.6.922/Bio/SeqIO/fastq.pm BioPerl-1.6.922/Bio/SeqIO/flybase_chadoxml.pm BioPerl-1.6.922/Bio/SeqIO/FTHelper.pm BioPerl-1.6.922/Bio/SeqIO/game.pm BioPerl-1.6.922/Bio/SeqIO/gbdriver.pm BioPerl-1.6.922/Bio/SeqIO/gbxml.pm BioPerl-1.6.922/Bio/SeqIO/gcg.pm BioPerl-1.6.922/Bio/SeqIO/genbank.pm BioPerl-1.6.922/Bio/SeqIO/interpro.pm BioPerl-1.6.922/Bio/SeqIO/kegg.pm BioPerl-1.6.922/Bio/SeqIO/largefasta.pm BioPerl-1.6.922/Bio/SeqIO/lasergene.pm BioPerl-1.6.922/Bio/SeqIO/locuslink.pm BioPerl-1.6.922/Bio/SeqIO/mbsout.pm BioPerl-1.6.922/Bio/SeqIO/metafasta.pm BioPerl-1.6.922/Bio/SeqIO/msout.pm BioPerl-1.6.922/Bio/SeqIO/MultiFile.pm BioPerl-1.6.922/Bio/SeqIO/nexml.pm BioPerl-1.6.922/Bio/SeqIO/phd.pm BioPerl-1.6.922/Bio/SeqIO/pir.pm BioPerl-1.6.922/Bio/SeqIO/pln.pm BioPerl-1.6.922/Bio/SeqIO/qual.pm BioPerl-1.6.922/Bio/SeqIO/raw.pm BioPerl-1.6.922/Bio/SeqIO/scf.pm BioPerl-1.6.922/Bio/SeqIO/seqxml.pm BioPerl-1.6.922/Bio/SeqIO/strider.pm BioPerl-1.6.922/Bio/SeqIO/swiss.pm BioPerl-1.6.922/Bio/SeqIO/swissdriver.pm BioPerl-1.6.922/Bio/SeqIO/tab.pm BioPerl-1.6.922/Bio/SeqIO/table.pm BioPerl-1.6.922/Bio/SeqIO/tigr.pm BioPerl-1.6.922/Bio/SeqIO/tigrxml.pm BioPerl-1.6.922/Bio/SeqIO/tinyseq.pm BioPerl-1.6.922/Bio/SeqIO/ztr.pm BioPerl-1.6.922/Bio/SeqIO/game BioPerl-1.6.922/Bio/SeqIO/game/featHandler.pm BioPerl-1.6.922/Bio/SeqIO/game/gameHandler.pm BioPerl-1.6.922/Bio/SeqIO/game/gameSubs.pm BioPerl-1.6.922/Bio/SeqIO/game/gameWriter.pm BioPerl-1.6.922/Bio/SeqIO/game/seqHandler.pm BioPerl-1.6.922/Bio/SeqIO/Handler BioPerl-1.6.922/Bio/SeqIO/Handler/GenericRichSeqHandler.pm BioPerl-1.6.922/Bio/SeqIO/tinyseq BioPerl-1.6.922/Bio/SeqIO/tinyseq/tinyseqHandler.pm BioPerl-1.6.922/Bio/Structure BioPerl-1.6.922/Bio/Structure/Atom.pm BioPerl-1.6.922/Bio/Structure/Chain.pm BioPerl-1.6.922/Bio/Structure/Entry.pm BioPerl-1.6.922/Bio/Structure/IO.pm BioPerl-1.6.922/Bio/Structure/Model.pm BioPerl-1.6.922/Bio/Structure/Residue.pm BioPerl-1.6.922/Bio/Structure/StructureI.pm BioPerl-1.6.922/Bio/Structure/IO BioPerl-1.6.922/Bio/Structure/IO/pdb.pm BioPerl-1.6.922/Bio/Structure/SecStr BioPerl-1.6.922/Bio/Structure/SecStr/DSSP BioPerl-1.6.922/Bio/Structure/SecStr/DSSP/Res.pm BioPerl-1.6.922/Bio/Structure/SecStr/STRIDE BioPerl-1.6.922/Bio/Structure/SecStr/STRIDE/Res.pm BioPerl-1.6.922/Bio/Symbol BioPerl-1.6.922/Bio/Symbol/Alphabet.pm BioPerl-1.6.922/Bio/Symbol/AlphabetI.pm BioPerl-1.6.922/Bio/Symbol/DNAAlphabet.pm BioPerl-1.6.922/Bio/Symbol/ProteinAlphabet.pm BioPerl-1.6.922/Bio/Symbol/README.Symbol BioPerl-1.6.922/Bio/Symbol/Symbol.pm BioPerl-1.6.922/Bio/Symbol/SymbolI.pm BioPerl-1.6.922/Bio/Taxonomy BioPerl-1.6.922/Bio/Taxonomy/FactoryI.pm BioPerl-1.6.922/Bio/Taxonomy/Node.pm BioPerl-1.6.922/Bio/Taxonomy/Taxon.pm BioPerl-1.6.922/Bio/Taxonomy/Tree.pm BioPerl-1.6.922/Bio/Tools BioPerl-1.6.922/Bio/Tools/AlignFactory.pm BioPerl-1.6.922/Bio/Tools/AmpliconSearch.pm BioPerl-1.6.922/Bio/Tools/AnalysisResult.pm BioPerl-1.6.922/Bio/Tools/Blat.pm BioPerl-1.6.922/Bio/Tools/CodonTable.pm BioPerl-1.6.922/Bio/Tools/Coil.pm BioPerl-1.6.922/Bio/Tools/dpAlign.pm BioPerl-1.6.922/Bio/Tools/ECnumber.pm BioPerl-1.6.922/Bio/Tools/EPCR.pm BioPerl-1.6.922/Bio/Tools/Eponine.pm BioPerl-1.6.922/Bio/Tools/ERPIN.pm BioPerl-1.6.922/Bio/Tools/Est2Genome.pm BioPerl-1.6.922/Bio/Tools/ESTScan.pm BioPerl-1.6.922/Bio/Tools/Fgenesh.pm BioPerl-1.6.922/Bio/Tools/FootPrinter.pm BioPerl-1.6.922/Bio/Tools/Gel.pm BioPerl-1.6.922/Bio/Tools/Geneid.pm BioPerl-1.6.922/Bio/Tools/Genemark.pm BioPerl-1.6.922/Bio/Tools/Genewise.pm BioPerl-1.6.922/Bio/Tools/Genomewise.pm BioPerl-1.6.922/Bio/Tools/Genscan.pm BioPerl-1.6.922/Bio/Tools/GFF.pm BioPerl-1.6.922/Bio/Tools/Glimmer.pm BioPerl-1.6.922/Bio/Tools/Grail.pm BioPerl-1.6.922/Bio/Tools/GuessSeqFormat.pm BioPerl-1.6.922/Bio/Tools/Hmmpfam.pm BioPerl-1.6.922/Bio/Tools/Infernal.pm BioPerl-1.6.922/Bio/Tools/ipcress.pm BioPerl-1.6.922/Bio/Tools/isPcr.pm BioPerl-1.6.922/Bio/Tools/IUPAC.pm BioPerl-1.6.922/Bio/Tools/Lucy.pm BioPerl-1.6.922/Bio/Tools/Match.pm BioPerl-1.6.922/Bio/Tools/MZEF.pm BioPerl-1.6.922/Bio/Tools/OddCodes.pm BioPerl-1.6.922/Bio/Tools/pICalculator.pm BioPerl-1.6.922/Bio/Tools/Primer3.pm BioPerl-1.6.922/Bio/Tools/Prints.pm BioPerl-1.6.922/Bio/Tools/Profile.pm BioPerl-1.6.922/Bio/Tools/Promoterwise.pm BioPerl-1.6.922/Bio/Tools/PrositeScan.pm BioPerl-1.6.922/Bio/Tools/Protparam.pm BioPerl-1.6.922/Bio/Tools/Pseudowise.pm BioPerl-1.6.922/Bio/Tools/pSW.pm BioPerl-1.6.922/Bio/Tools/QRNA.pm BioPerl-1.6.922/Bio/Tools/RandomDistFunctions.pm BioPerl-1.6.922/Bio/Tools/RepeatMasker.pm BioPerl-1.6.922/Bio/Tools/RNAMotif.pm BioPerl-1.6.922/Bio/Tools/Seg.pm BioPerl-1.6.922/Bio/Tools/SeqPattern.pm BioPerl-1.6.922/Bio/Tools/SeqStats.pm BioPerl-1.6.922/Bio/Tools/SeqWords.pm BioPerl-1.6.922/Bio/Tools/Sigcleave.pm BioPerl-1.6.922/Bio/Tools/Signalp.pm BioPerl-1.6.922/Bio/Tools/SiRNA.pm BioPerl-1.6.922/Bio/Tools/TandemRepeatsFinder.pm BioPerl-1.6.922/Bio/Tools/TargetP.pm BioPerl-1.6.922/Bio/Tools/Tmhmm.pm BioPerl-1.6.922/Bio/Tools/tRNAscanSE.pm BioPerl-1.6.922/Bio/Tools/Alignment BioPerl-1.6.922/Bio/Tools/Alignment/Consed.pm BioPerl-1.6.922/Bio/Tools/Alignment/Trim.pm BioPerl-1.6.922/Bio/Tools/Analysis BioPerl-1.6.922/Bio/Tools/Analysis/SimpleAnalysisBase.pm BioPerl-1.6.922/Bio/Tools/Analysis/DNA BioPerl-1.6.922/Bio/Tools/Analysis/DNA/ESEfinder.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein BioPerl-1.6.922/Bio/Tools/Analysis/Protein/Domcut.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/ELM.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/GOR4.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/HNN.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/Mitoprot.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/NetPhos.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/Scansite.pm BioPerl-1.6.922/Bio/Tools/Analysis/Protein/Sopma.pm BioPerl-1.6.922/Bio/Tools/EMBOSS BioPerl-1.6.922/Bio/Tools/EMBOSS/Palindrome.pm BioPerl-1.6.922/Bio/Tools/HMMER BioPerl-1.6.922/Bio/Tools/HMMER/Domain.pm BioPerl-1.6.922/Bio/Tools/HMMER/Results.pm BioPerl-1.6.922/Bio/Tools/HMMER/Set.pm BioPerl-1.6.922/Bio/Tools/Phylo BioPerl-1.6.922/Bio/Tools/Phylo/Gerp.pm BioPerl-1.6.922/Bio/Tools/Phylo/Gumby.pm BioPerl-1.6.922/Bio/Tools/Phylo/Molphy.pm BioPerl-1.6.922/Bio/Tools/Phylo/PAML.pm BioPerl-1.6.922/Bio/Tools/Phylo/Molphy BioPerl-1.6.922/Bio/Tools/Phylo/Molphy/Result.pm BioPerl-1.6.922/Bio/Tools/Phylo/PAML BioPerl-1.6.922/Bio/Tools/Phylo/PAML/Codeml.pm BioPerl-1.6.922/Bio/Tools/Phylo/PAML/ModelResult.pm BioPerl-1.6.922/Bio/Tools/Phylo/PAML/Result.pm BioPerl-1.6.922/Bio/Tools/Phylo/Phylip BioPerl-1.6.922/Bio/Tools/Phylo/Phylip/ProtDist.pm BioPerl-1.6.922/Bio/Tools/Prediction BioPerl-1.6.922/Bio/Tools/Prediction/Exon.pm BioPerl-1.6.922/Bio/Tools/Prediction/Gene.pm BioPerl-1.6.922/Bio/Tools/Primer BioPerl-1.6.922/Bio/Tools/Primer/AssessorI.pm BioPerl-1.6.922/Bio/Tools/Primer/Feature.pm BioPerl-1.6.922/Bio/Tools/Primer/Pair.pm BioPerl-1.6.922/Bio/Tools/Primer/Assessor BioPerl-1.6.922/Bio/Tools/Primer/Assessor/Base.pm BioPerl-1.6.922/Bio/Tools/Run BioPerl-1.6.922/Bio/Tools/Run/GenericParameters.pm BioPerl-1.6.922/Bio/Tools/Run/hmmer3.pm BioPerl-1.6.922/Bio/Tools/Run/ParametersI.pm BioPerl-1.6.922/Bio/Tools/Run/README BioPerl-1.6.922/Bio/Tools/Run/RemoteBlast.pm BioPerl-1.6.922/Bio/Tools/Run/StandAloneBlast.pm BioPerl-1.6.922/Bio/Tools/Run/StandAloneNCBIBlast.pm BioPerl-1.6.922/Bio/Tools/Run/StandAloneWUBlast.pm BioPerl-1.6.922/Bio/Tools/Run/WrapperBase.pm BioPerl-1.6.922/Bio/Tools/Run/WrapperBase BioPerl-1.6.922/Bio/Tools/Run/WrapperBase/CommandExts.pm BioPerl-1.6.922/Bio/Tools/SeqPattern BioPerl-1.6.922/Bio/Tools/SeqPattern/Backtranslate.pm BioPerl-1.6.922/Bio/Tools/Signalp BioPerl-1.6.922/Bio/Tools/Signalp/ExtendedSignalp.pm BioPerl-1.6.922/Bio/Tools/Sim4 BioPerl-1.6.922/Bio/Tools/Sim4/Exon.pm BioPerl-1.6.922/Bio/Tools/Sim4/Results.pm BioPerl-1.6.922/Bio/Tools/SiRNA BioPerl-1.6.922/Bio/Tools/SiRNA/Ruleset BioPerl-1.6.922/Bio/Tools/SiRNA/Ruleset/saigo.pm BioPerl-1.6.922/Bio/Tools/SiRNA/Ruleset/tuschl.pm BioPerl-1.6.922/Bio/Tools/Spidey BioPerl-1.6.922/Bio/Tools/Spidey/Exon.pm BioPerl-1.6.922/Bio/Tools/Spidey/Results.pm BioPerl-1.6.922/Bio/Tree BioPerl-1.6.922/Bio/Tree/AlleleNode.pm BioPerl-1.6.922/Bio/Tree/AnnotatableNode.pm BioPerl-1.6.922/Bio/Tree/Compatible.pm BioPerl-1.6.922/Bio/Tree/DistanceFactory.pm BioPerl-1.6.922/Bio/Tree/Node.pm BioPerl-1.6.922/Bio/Tree/NodeI.pm BioPerl-1.6.922/Bio/Tree/NodeNHX.pm BioPerl-1.6.922/Bio/Tree/RandomFactory.pm BioPerl-1.6.922/Bio/Tree/Statistics.pm BioPerl-1.6.922/Bio/Tree/Tree.pm BioPerl-1.6.922/Bio/Tree/TreeFunctionsI.pm BioPerl-1.6.922/Bio/Tree/TreeI.pm BioPerl-1.6.922/Bio/Tree/Draw BioPerl-1.6.922/Bio/Tree/Draw/Cladogram.pm BioPerl-1.6.922/Bio/TreeIO BioPerl-1.6.922/Bio/TreeIO/cluster.pm BioPerl-1.6.922/Bio/TreeIO/lintree.pm BioPerl-1.6.922/Bio/TreeIO/newick.pm BioPerl-1.6.922/Bio/TreeIO/NewickParser.pm BioPerl-1.6.922/Bio/TreeIO/nexml.pm BioPerl-1.6.922/Bio/TreeIO/nexus.pm BioPerl-1.6.922/Bio/TreeIO/nhx.pm BioPerl-1.6.922/Bio/TreeIO/pag.pm BioPerl-1.6.922/Bio/TreeIO/phyloxml.pm BioPerl-1.6.922/Bio/TreeIO/svggraph.pm BioPerl-1.6.922/Bio/TreeIO/tabtree.pm BioPerl-1.6.922/Bio/TreeIO/TreeEventBuilder.pm BioPerl-1.6.922/Bio/Variation BioPerl-1.6.922/Bio/Variation/AAChange.pm BioPerl-1.6.922/Bio/Variation/AAReverseMutate.pm BioPerl-1.6.922/Bio/Variation/Allele.pm BioPerl-1.6.922/Bio/Variation/DNAMutation.pm BioPerl-1.6.922/Bio/Variation/IO.pm BioPerl-1.6.922/Bio/Variation/README BioPerl-1.6.922/Bio/Variation/RNAChange.pm BioPerl-1.6.922/Bio/Variation/SeqDiff.pm BioPerl-1.6.922/Bio/Variation/SNP.pm BioPerl-1.6.922/Bio/Variation/VariantI.pm BioPerl-1.6.922/Bio/Variation/IO BioPerl-1.6.922/Bio/Variation/IO/flat.pm BioPerl-1.6.922/Bio/Variation/IO/xml.pm BioPerl-1.6.922/doc BioPerl-1.6.922/doc/makedoc.PL BioPerl-1.6.922/doc/README BioPerl-1.6.922/doc/Deobfuscator BioPerl-1.6.922/doc/Deobfuscator/Build.PL BioPerl-1.6.922/doc/Deobfuscator/Changes BioPerl-1.6.922/doc/Deobfuscator/excluded_modules.txt BioPerl-1.6.922/doc/Deobfuscator/LICENSE BioPerl-1.6.922/doc/Deobfuscator/Makefile.PL BioPerl-1.6.922/doc/Deobfuscator/MANIFEST BioPerl-1.6.922/doc/Deobfuscator/META.yml BioPerl-1.6.922/doc/Deobfuscator/README BioPerl-1.6.922/doc/Deobfuscator/bin BioPerl-1.6.922/doc/Deobfuscator/bin/deob_index.pl BioPerl-1.6.922/doc/Deobfuscator/cgi-bin BioPerl-1.6.922/doc/Deobfuscator/cgi-bin/deob_detail.cgi BioPerl-1.6.922/doc/Deobfuscator/cgi-bin/deob_flowchart.png BioPerl-1.6.922/doc/Deobfuscator/cgi-bin/deob_help.html BioPerl-1.6.922/doc/Deobfuscator/cgi-bin/deob_interface.cgi BioPerl-1.6.922/doc/Deobfuscator/lib BioPerl-1.6.922/doc/Deobfuscator/lib/Deobfuscator.pm BioPerl-1.6.922/doc/Deobfuscator/t BioPerl-1.6.922/doc/Deobfuscator/t/00.load.t BioPerl-1.6.922/doc/Deobfuscator/t/pod.t BioPerl-1.6.922/examples BioPerl-1.6.922/examples/bioperl.pl BioPerl-1.6.922/examples/generate_random_seq.pl BioPerl-1.6.922/examples/longorf.pl BioPerl-1.6.922/examples/make_primers.pl BioPerl-1.6.922/examples/rev_and_trans.pl BioPerl-1.6.922/examples/revcom_dir.pl BioPerl-1.6.922/examples/subsequence.cgi BioPerl-1.6.922/examples/align BioPerl-1.6.922/examples/align/align_on_codons.pl BioPerl-1.6.922/examples/align/aligntutorial.pl BioPerl-1.6.922/examples/align/clustalw.pl BioPerl-1.6.922/examples/align/FastAlign.pl BioPerl-1.6.922/examples/align/simplealign.pl BioPerl-1.6.922/examples/Bio-DB-GFF BioPerl-1.6.922/examples/Bio-DB-GFF/load_ucsc.pl BioPerl-1.6.922/examples/cluster BioPerl-1.6.922/examples/cluster/dbsnp.pl BioPerl-1.6.922/examples/contributed BioPerl-1.6.922/examples/contributed/nmrpdb_parse.pl BioPerl-1.6.922/examples/contributed/prosite2perl.pl BioPerl-1.6.922/examples/contributed/rebase2list.pl BioPerl-1.6.922/examples/db BioPerl-1.6.922/examples/db/dbfetch BioPerl-1.6.922/examples/db/est_tissue_query.pl BioPerl-1.6.922/examples/db/gb2features.pl BioPerl-1.6.922/examples/db/get_seqs.pl BioPerl-1.6.922/examples/db/getGenBank.pl BioPerl-1.6.922/examples/db/rfetch.pl BioPerl-1.6.922/examples/db/use_registry.pl BioPerl-1.6.922/examples/liveseq BioPerl-1.6.922/examples/liveseq/change_gene.pl BioPerl-1.6.922/examples/popgen BioPerl-1.6.922/examples/popgen/parse_calc_stats.pl BioPerl-1.6.922/examples/quality BioPerl-1.6.922/examples/quality/svgtrace.pl BioPerl-1.6.922/examples/root BioPerl-1.6.922/examples/root/exceptions1.pl BioPerl-1.6.922/examples/root/exceptions2.pl BioPerl-1.6.922/examples/root/exceptions3.pl BioPerl-1.6.922/examples/root/exceptions4.pl BioPerl-1.6.922/examples/root/README BioPerl-1.6.922/examples/root/lib BioPerl-1.6.922/examples/root/lib/TestInterface.pm BioPerl-1.6.922/examples/root/lib/TestObject.pm BioPerl-1.6.922/examples/searchio BioPerl-1.6.922/examples/searchio/blast_example.pl BioPerl-1.6.922/examples/searchio/custom_writer.pl BioPerl-1.6.922/examples/searchio/hitwriter.pl BioPerl-1.6.922/examples/searchio/hspwriter.pl BioPerl-1.6.922/examples/searchio/htmlwriter.pl BioPerl-1.6.922/examples/searchio/psiblast_features.pl BioPerl-1.6.922/examples/searchio/psiblast_iterations.pl BioPerl-1.6.922/examples/searchio/rawwriter.pl BioPerl-1.6.922/examples/searchio/resultwriter.pl BioPerl-1.6.922/examples/searchio/waba2gff.pl BioPerl-1.6.922/examples/searchio/waba2gff3.pl BioPerl-1.6.922/examples/sirna BioPerl-1.6.922/examples/sirna/rnai_finder.cgi BioPerl-1.6.922/examples/sirna/TAG BioPerl-1.6.922/examples/structure BioPerl-1.6.922/examples/structure/structure-io.pl BioPerl-1.6.922/examples/tk BioPerl-1.6.922/examples/tk/gsequence.pl BioPerl-1.6.922/examples/tk/hitdisplay.pl BioPerl-1.6.922/examples/tools BioPerl-1.6.922/examples/tools/extract_genes.pl BioPerl-1.6.922/examples/tools/gb_to_gff.pl BioPerl-1.6.922/examples/tools/gff2ps.pl BioPerl-1.6.922/examples/tools/parse_codeml.pl BioPerl-1.6.922/examples/tools/psw.pl BioPerl-1.6.922/examples/tools/reverse-translate.pl BioPerl-1.6.922/examples/tools/run_genscan.pl BioPerl-1.6.922/examples/tools/run_primer3.pl BioPerl-1.6.922/examples/tools/seq_pattern.pl BioPerl-1.6.922/examples/tools/standaloneblast.pl BioPerl-1.6.922/examples/tree BioPerl-1.6.922/examples/tree/paup2phylip.pl BioPerl-1.6.922/ide BioPerl-1.6.922/ide/bioperl.komodo BioPerl-1.6.922/ide/bioperl-mode BioPerl-1.6.922/ide/bioperl-mode/README BioPerl-1.6.922/ide/bioperl-mode/dist BioPerl-1.6.922/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar BioPerl-1.6.922/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5 BioPerl-1.6.922/ide/bioperl-mode/dist/bioperl-mode.tar BioPerl-1.6.922/ide/bioperl-mode/dist/bioperl-mode.tar.md5 BioPerl-1.6.922/ide/bioperl-mode/dist/Changes BioPerl-1.6.922/ide/bioperl-mode/dist/package-me BioPerl-1.6.922/ide/bioperl-mode/dist/SKIP BioPerl-1.6.922/ide/bioperl-mode/etc BioPerl-1.6.922/ide/bioperl-mode/etc/images BioPerl-1.6.922/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm BioPerl-1.6.922/ide/bioperl-mode/etc/images/bpmode-tool.xpm BioPerl-1.6.922/ide/bioperl-mode/site-lisp BioPerl-1.6.922/ide/bioperl-mode/site-lisp/bioperl-init.el BioPerl-1.6.922/ide/bioperl-mode/site-lisp/bioperl-mode.el BioPerl-1.6.922/ide/bioperl-mode/site-lisp/bioperl-skel.el BioPerl-1.6.922/ide/bioperl-mode/site-lisp/pod.el BioPerl-1.6.922/maintenance BioPerl-1.6.922/maintenance/authors.pl BioPerl-1.6.922/maintenance/check_NAME.pl BioPerl-1.6.922/maintenance/check_URLs.pl BioPerl-1.6.922/maintenance/cvs2cl_by_file.pl BioPerl-1.6.922/maintenance/dependencies.pl BioPerl-1.6.922/maintenance/deprecated.pl BioPerl-1.6.922/maintenance/find_mod_deps.pl BioPerl-1.6.922/maintenance/module_usage.pl BioPerl-1.6.922/maintenance/modules.pl BioPerl-1.6.922/maintenance/ncbi_blast_switches.pl BioPerl-1.6.922/maintenance/perltidy.conf BioPerl-1.6.922/maintenance/pod.pl BioPerl-1.6.922/maintenance/README BioPerl-1.6.922/maintenance/symlink_script.pl BioPerl-1.6.922/maintenance/version.pl BioPerl-1.6.922/maintenance/big_split BioPerl-1.6.922/maintenance/big_split/file_classification.csv BioPerl-1.6.922/maintenance/big_split/rbuels_notes.txt BioPerl-1.6.922/models BioPerl-1.6.922/models/biblio.dia BioPerl-1.6.922/models/bio_liveseq_variation.dia BioPerl-1.6.922/models/bio_map.dia BioPerl-1.6.922/models/bio_restriction.dia BioPerl-1.6.922/models/bioperl.dia BioPerl-1.6.922/models/coordinatemapper.dia BioPerl-1.6.922/models/map_proposal.txt BioPerl-1.6.922/models/maps_and_markers.dia BioPerl-1.6.922/models/popgen.dia BioPerl-1.6.922/models/population_proposal.txt BioPerl-1.6.922/models/README BioPerl-1.6.922/scripts BioPerl-1.6.922/scripts/README BioPerl-1.6.922/scripts/Bio-DB-GFF BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_bulk_load_gff.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_fast_load_gff.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_genbank2gff.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_genbank2gff3.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_generate_histogram.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_load_gff.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_meta_gff.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_process_gadfly.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_process_sgd.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/bp_process_wormbase.pl BioPerl-1.6.922/scripts/Bio-DB-GFF/README BioPerl-1.6.922/scripts/Bio-DB-SeqFeature-Store BioPerl-1.6.922/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl BioPerl-1.6.922/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl BioPerl-1.6.922/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl BioPerl-1.6.922/scripts/das BioPerl-1.6.922/scripts/das/bp_das_server.pl BioPerl-1.6.922/scripts/das/README BioPerl-1.6.922/scripts/das/TAG BioPerl-1.6.922/scripts/DB BioPerl-1.6.922/scripts/DB/bp_biofetch_genbank_proxy.pl BioPerl-1.6.922/scripts/DB/bp_bioflat_index.pl BioPerl-1.6.922/scripts/DB/bp_biogetseq.pl BioPerl-1.6.922/scripts/DB/bp_flanks.pl BioPerl-1.6.922/scripts/DB/TAG BioPerl-1.6.922/scripts/DB-HIV BioPerl-1.6.922/scripts/DB-HIV/bp_hivq.pl BioPerl-1.6.922/scripts/index BioPerl-1.6.922/scripts/index/bp_fetch.pl BioPerl-1.6.922/scripts/index/bp_index.pl BioPerl-1.6.922/scripts/index/bp_seqret.pl BioPerl-1.6.922/scripts/index/TAG BioPerl-1.6.922/scripts/popgen BioPerl-1.6.922/scripts/popgen/bp_composite_LD.pl BioPerl-1.6.922/scripts/popgen/bp_heterogeneity_test.pl BioPerl-1.6.922/scripts/searchio BioPerl-1.6.922/scripts/searchio/bp_fastam9_to_table.pl BioPerl-1.6.922/scripts/searchio/bp_filter_search.pl BioPerl-1.6.922/scripts/searchio/bp_hmmer_to_table.pl BioPerl-1.6.922/scripts/searchio/bp_parse_hmmsearch.pl BioPerl-1.6.922/scripts/searchio/bp_search2table.pl BioPerl-1.6.922/scripts/searchio/README BioPerl-1.6.922/scripts/searchio/TAG BioPerl-1.6.922/scripts/seq BioPerl-1.6.922/scripts/seq/bp_extract_feature_seq.pl BioPerl-1.6.922/scripts/seq/bp_make_mrna_protein.pl BioPerl-1.6.922/scripts/seq/bp_seqconvert.pl BioPerl-1.6.922/scripts/seq/bp_seqcut.pl BioPerl-1.6.922/scripts/seq/bp_seqpart.pl BioPerl-1.6.922/scripts/seq/bp_seqretsplit.pl BioPerl-1.6.922/scripts/seq/bp_split_seq.pl BioPerl-1.6.922/scripts/seq/bp_translate_seq.pl BioPerl-1.6.922/scripts/seq/bp_unflatten_seq.pl BioPerl-1.6.922/scripts/seq/TAG BioPerl-1.6.922/scripts/seqstats BioPerl-1.6.922/scripts/seqstats/bp_aacomp.pl BioPerl-1.6.922/scripts/seqstats/bp_chaos_plot.pl BioPerl-1.6.922/scripts/seqstats/bp_gccalc.pl BioPerl-1.6.922/scripts/seqstats/bp_oligo_count.pl BioPerl-1.6.922/scripts/seqstats/TAG BioPerl-1.6.922/scripts/taxa BioPerl-1.6.922/scripts/taxa/bp_classify_hits_kingdom.pl BioPerl-1.6.922/scripts/taxa/bp_local_taxonomydb_query.pl BioPerl-1.6.922/scripts/taxa/bp_query_entrez_taxa.pl BioPerl-1.6.922/scripts/taxa/bp_taxid4species.pl BioPerl-1.6.922/scripts/taxa/bp_taxonomy2tree.pl BioPerl-1.6.922/scripts/taxa/TAG BioPerl-1.6.922/scripts/tree BioPerl-1.6.922/scripts/tree/bp_blast2tree.pl BioPerl-1.6.922/scripts/tree/bp_nexus2nh.pl BioPerl-1.6.922/scripts/tree/bp_tree2pag.pl BioPerl-1.6.922/scripts/tree/TAG BioPerl-1.6.922/scripts/utilities BioPerl-1.6.922/scripts/utilities/bp_dbsplit.pl BioPerl-1.6.922/scripts/utilities/bp_download_query_genbank.pl BioPerl-1.6.922/scripts/utilities/bp_mask_by_search.pl BioPerl-1.6.922/scripts/utilities/bp_mrtrans.pl BioPerl-1.6.922/scripts/utilities/bp_mutate.pl BioPerl-1.6.922/scripts/utilities/bp_netinstall.pl BioPerl-1.6.922/scripts/utilities/bp_nrdb.pl BioPerl-1.6.922/scripts/utilities/bp_pairwise_kaks.pl BioPerl-1.6.922/scripts/utilities/bp_remote_blast.pl BioPerl-1.6.922/scripts/utilities/bp_revtrans-motif.pl BioPerl-1.6.922/scripts/utilities/bp_search2alnblocks.pl BioPerl-1.6.922/scripts/utilities/bp_search2BSML.pl BioPerl-1.6.922/scripts/utilities/bp_search2gff.pl BioPerl-1.6.922/scripts/utilities/bp_search2tribe.pl BioPerl-1.6.922/scripts/utilities/bp_seq_length.pl BioPerl-1.6.922/scripts/utilities/bp_sreformat.pl BioPerl-1.6.922/scripts/utilities/README BioPerl-1.6.922/scripts/utilities/TAG BioPerl-1.6.922/t BioPerl-1.6.922/t/Alphabet.t BioPerl-1.6.922/t/nexml.t BioPerl-1.6.922/t/Perl.t BioPerl-1.6.922/t/PodSyntax.t BioPerl-1.6.922/t/SearchDist.t BioPerl-1.6.922/t/SeqEvolution.t BioPerl-1.6.922/t/Species.t BioPerl-1.6.922/t/Symbol.t BioPerl-1.6.922/t/TaxonTree.t BioPerl-1.6.922/t/Align BioPerl-1.6.922/t/Align/AlignStats.t BioPerl-1.6.922/t/Align/AlignUtil.t BioPerl-1.6.922/t/Align/Graphics.t BioPerl-1.6.922/t/Align/SimpleAlign.t BioPerl-1.6.922/t/Align/TreeBuild.t BioPerl-1.6.922/t/Align/Utilities.t BioPerl-1.6.922/t/AlignIO BioPerl-1.6.922/t/AlignIO/AlignIO.t BioPerl-1.6.922/t/AlignIO/arp.t BioPerl-1.6.922/t/AlignIO/bl2seq.t BioPerl-1.6.922/t/AlignIO/clustalw.t BioPerl-1.6.922/t/AlignIO/emboss.t BioPerl-1.6.922/t/AlignIO/fasta.t BioPerl-1.6.922/t/AlignIO/largemultifasta.t BioPerl-1.6.922/t/AlignIO/maf.t BioPerl-1.6.922/t/AlignIO/mase.t BioPerl-1.6.922/t/AlignIO/mega.t BioPerl-1.6.922/t/AlignIO/meme.t BioPerl-1.6.922/t/AlignIO/metafasta.t BioPerl-1.6.922/t/AlignIO/msf.t BioPerl-1.6.922/t/AlignIO/nexml.t BioPerl-1.6.922/t/AlignIO/nexus.t BioPerl-1.6.922/t/AlignIO/pfam.t BioPerl-1.6.922/t/AlignIO/phylip.t BioPerl-1.6.922/t/AlignIO/po.t BioPerl-1.6.922/t/AlignIO/prodom.t BioPerl-1.6.922/t/AlignIO/psi.t BioPerl-1.6.922/t/AlignIO/selex.t BioPerl-1.6.922/t/AlignIO/stockholm.t BioPerl-1.6.922/t/AlignIO/xmfa.t BioPerl-1.6.922/t/Annotation BioPerl-1.6.922/t/Annotation/Annotation.t BioPerl-1.6.922/t/Annotation/AnnotationAdaptor.t BioPerl-1.6.922/t/Assembly BioPerl-1.6.922/t/Assembly/ContigSpectrum.t BioPerl-1.6.922/t/Assembly/core.t BioPerl-1.6.922/t/Assembly/IO BioPerl-1.6.922/t/Assembly/IO/bowtie.t BioPerl-1.6.922/t/Assembly/IO/sam.t BioPerl-1.6.922/t/Cluster BioPerl-1.6.922/t/Cluster/UniGene.t BioPerl-1.6.922/t/ClusterIO BioPerl-1.6.922/t/ClusterIO/ClusterIO.t BioPerl-1.6.922/t/ClusterIO/SequenceFamily.t BioPerl-1.6.922/t/ClusterIO/unigene.t BioPerl-1.6.922/t/Coordinate BioPerl-1.6.922/t/Coordinate/CoordinateBoundaryTest.t BioPerl-1.6.922/t/Coordinate/CoordinateGraph.t BioPerl-1.6.922/t/Coordinate/CoordinateMapper.t BioPerl-1.6.922/t/Coordinate/GeneCoordinateMapper.t BioPerl-1.6.922/t/data BioPerl-1.6.922/t/data/01_basic.xml BioPerl-1.6.922/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.922/t/data/02_dogfish_no_taxrefs.xml BioPerl-1.6.922/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.922/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.922/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.922/t/data/02_mackerel_no_taxrefs.xml BioPerl-1.6.922/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.922/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.922/t/data/03_bootstraps.xml BioPerl-1.6.922/t/data/03_bootstraps_in_tag.xml BioPerl-1.6.922/t/data/04_labeled_ancestors.xml BioPerl-1.6.922/t/data/05_ancestral_states.xml BioPerl-1.6.922/t/data/13-pilE-F.scf BioPerl-1.6.922/t/data/1A11.pdb BioPerl-1.6.922/t/data/1A3I.pdb BioPerl-1.6.922/t/data/1BPT.pdb BioPerl-1.6.922/t/data/1ZZ19XR301R-Alignment.tblastn BioPerl-1.6.922/t/data/2008.blasttable BioPerl-1.6.922/t/data/27-contig_Newbler.ace BioPerl-1.6.922/t/data/503384.MEGABLAST.0 BioPerl-1.6.922/t/data/503384.MEGABLAST.2 BioPerl-1.6.922/t/data/5X_1895.FASTXY BioPerl-1.6.922/t/data/8HVP.pdb BioPerl-1.6.922/t/data/a_thaliana.blastn BioPerl-1.6.922/t/data/AAC12660.fa BioPerl-1.6.922/t/data/aaml.mlc BioPerl-1.6.922/t/data/aaml_pairwise.mlc BioPerl-1.6.922/t/data/AB077698.gb BioPerl-1.6.922/t/data/acefile.ace.1 BioPerl-1.6.922/t/data/acefile.singlets BioPerl-1.6.922/t/data/adh.mb_tree.nexus BioPerl-1.6.922/t/data/AE003528_ecoli.bls BioPerl-1.6.922/t/data/AE003644_Adh-genomic.gb BioPerl-1.6.922/t/data/AF032047.gbk BioPerl-1.6.922/t/data/AF165282.gb BioPerl-1.6.922/t/data/AF305198.gb BioPerl-1.6.922/t/data/AHCYL1.kegg BioPerl-1.6.922/t/data/alleles.fas BioPerl-1.6.922/t/data/alnfile.fasta BioPerl-1.6.922/t/data/amino.fa BioPerl-1.6.922/t/data/AnnIX-v003.gbk BioPerl-1.6.922/t/data/ar.embl BioPerl-1.6.922/t/data/assembly_with_singlets.ace BioPerl-1.6.922/t/data/ATF14F8.gbk BioPerl-1.6.922/t/data/atp1.matrix BioPerl-1.6.922/t/data/ay007676.gb BioPerl-1.6.922/t/data/AY095303S1.gbk BioPerl-1.6.922/t/data/ay116458.gb BioPerl-1.6.922/t/data/ay149291.gb BioPerl-1.6.922/t/data/AY763288.gb BioPerl-1.6.922/t/data/BAB68554.gb BioPerl-1.6.922/t/data/badfasta.fa BioPerl-1.6.922/t/data/barns-combined.nex BioPerl-1.6.922/t/data/baseml.pairwise BioPerl-1.6.922/t/data/baseml.usertree BioPerl-1.6.922/t/data/basic-bush.nex BioPerl-1.6.922/t/data/basic-ladder.nex BioPerl-1.6.922/t/data/BC000007.gbk BioPerl-1.6.922/t/data/BEL16-LTR_AG.embl BioPerl-1.6.922/t/data/biofpc.cor BioPerl-1.6.922/t/data/biofpc.fpc BioPerl-1.6.922/t/data/biorecipe.nhx BioPerl-1.6.922/t/data/Bird_Ovomucoids.nex BioPerl-1.6.922/t/data/BK000016-tpa.gbk BioPerl-1.6.922/t/data/bl2seq.blastn BioPerl-1.6.922/t/data/bl2seq.blastn.rev BioPerl-1.6.922/t/data/bl2seq.blastx.out BioPerl-1.6.922/t/data/bl2seq.bug940.out BioPerl-1.6.922/t/data/bl2seq.out BioPerl-1.6.922/t/data/bl2seq.tblastx.out BioPerl-1.6.922/t/data/blast.report BioPerl-1.6.922/t/data/blast_no_hit_desc.txt BioPerl-1.6.922/t/data/blast_plus.blastp BioPerl-1.6.922/t/data/blastp2215.blast BioPerl-1.6.922/t/data/blat.psLayout3 BioPerl-1.6.922/t/data/BLOSUM50 BioPerl-1.6.922/t/data/blosum62.bla BioPerl-1.6.922/t/data/BN000066-tpa.embl BioPerl-1.6.922/t/data/bootstrap.tre BioPerl-1.6.922/t/data/BOSS_DROME.FASTP_v35_04 BioPerl-1.6.922/t/data/branchSite.mlc BioPerl-1.6.922/t/data/brassica_ATH.WUBLASTN BioPerl-1.6.922/t/data/bug1986.blast2 BioPerl-1.6.922/t/data/bug1986.blastp BioPerl-1.6.922/t/data/bug2120.phd BioPerl-1.6.922/t/data/bug2246.blast BioPerl-1.6.922/t/data/bug2391.megablast BioPerl-1.6.922/t/data/bug2399.tblastn BioPerl-1.6.922/t/data/bug2453.maf BioPerl-1.6.922/t/data/bug2473.fasta BioPerl-1.6.922/t/data/bug2862.pmr BioPerl-1.6.922/t/data/bug2869.tree BioPerl-1.6.922/t/data/bug2901.fa BioPerl-1.6.922/t/data/bug2937.fasta BioPerl-1.6.922/t/data/bug2942.blastx BioPerl-1.6.922/t/data/bug2982.embl BioPerl-1.6.922/t/data/bug2982.gb BioPerl-1.6.922/t/data/bug3021.gmap BioPerl-1.6.922/t/data/bug3086.embl BioPerl-1.6.922/t/data/bug3331.mlc BioPerl-1.6.922/t/data/c200-vs-yeast.BLASTN BioPerl-1.6.922/t/data/c200-vs-yeast.BLASTN.m8 BioPerl-1.6.922/t/data/calm.swiss BioPerl-1.6.922/t/data/catalase-webblast.BLASTP BioPerl-1.6.922/t/data/cds-266.fas BioPerl-1.6.922/t/data/cds_sample.embl BioPerl-1.6.922/t/data/CG11099.fasaln BioPerl-1.6.922/t/data/CG2865.fasaln BioPerl-1.6.922/t/data/chad100.scf BioPerl-1.6.922/t/data/char-interleave.nex BioPerl-1.6.922/t/data/char-matrix-spaces.nex BioPerl-1.6.922/t/data/characters+trees.nexml.xml BioPerl-1.6.922/t/data/characters.nexml.old.xml BioPerl-1.6.922/t/data/codeml.mlc BioPerl-1.6.922/t/data/codeml315.mlc BioPerl-1.6.922/t/data/codeml4.mlc BioPerl-1.6.922/t/data/codeml43.mlc BioPerl-1.6.922/t/data/codeml43_nssites.mlc BioPerl-1.6.922/t/data/codeml45.mlc BioPerl-1.6.922/t/data/codeml45b.mlc BioPerl-1.6.922/t/data/codeml_nan.mlc BioPerl-1.6.922/t/data/codeml_nssites.mlc BioPerl-1.6.922/t/data/compLD_missingtest.prettybase BioPerl-1.6.922/t/data/compLD_test.prettybase BioPerl-1.6.922/t/data/component.ontology.test BioPerl-1.6.922/t/data/component.ontology.test2 BioPerl-1.6.922/t/data/contig-by-hand.wublastp BioPerl-1.6.922/t/data/contigspectrumtest.tigr BioPerl-1.6.922/t/data/crab.dat.cn BioPerl-1.6.922/t/data/crab.nj BioPerl-1.6.922/t/data/crab.njb BioPerl-1.6.922/t/data/crypto.sim4-0 BioPerl-1.6.922/t/data/crypto.sim4-3 BioPerl-1.6.922/t/data/crypto.sim4-4 BioPerl-1.6.922/t/data/ctgdemo.fpc BioPerl-1.6.922/t/data/cys1_dicdi.water BioPerl-1.6.922/t/data/cysprot.fa BioPerl-1.6.922/t/data/cysprot.msf BioPerl-1.6.922/t/data/cysprot.needle BioPerl-1.6.922/t/data/cysprot.tblastn BioPerl-1.6.922/t/data/cysprot.water BioPerl-1.6.922/t/data/cysprot1.fa BioPerl-1.6.922/t/data/cysprot1.FASTA BioPerl-1.6.922/t/data/cysprot1a.fa BioPerl-1.6.922/t/data/cysprot1a.msf BioPerl-1.6.922/t/data/cysprot1b.fa BioPerl-1.6.922/t/data/cysprot1b.hmmsearch BioPerl-1.6.922/t/data/cysprot1b.msf BioPerl-1.6.922/t/data/cysprot1b.newick BioPerl-1.6.922/t/data/cysprot_vs_gadfly.FASTA BioPerl-1.6.922/t/data/D10483.gbk BioPerl-1.6.922/t/data/D12555.gbk BioPerl-1.6.922/t/data/dcr1_sp.WUBLASTP BioPerl-1.6.922/t/data/dmel_2Lchunk.gb BioPerl-1.6.922/t/data/dna1.fa BioPerl-1.6.922/t/data/dna2.fa BioPerl-1.6.922/t/data/dnaE-bsub-prot.fa BioPerl-1.6.922/t/data/dnaE-bsub.fa BioPerl-1.6.922/t/data/dnaEbsub_ecoli.wublastx BioPerl-1.6.922/t/data/dnaEbsub_ecoli.wutblastn BioPerl-1.6.922/t/data/dnaEbsub_ecoli.wutblastx BioPerl-1.6.922/t/data/DQ018368.gb BioPerl-1.6.922/t/data/dq519393.gb BioPerl-1.6.922/t/data/ECAPAH02.embl BioPerl-1.6.922/t/data/echofilter.wublastn BioPerl-1.6.922/t/data/ecoli-trna-qrna.out BioPerl-1.6.922/t/data/ecoli_domains.rps.xml BioPerl-1.6.922/t/data/ecoli_domains.rpsblast BioPerl-1.6.922/t/data/ecolitst.bls BioPerl-1.6.922/t/data/ecolitst.fa BioPerl-1.6.922/t/data/ecolitst.noseqs.wublastp BioPerl-1.6.922/t/data/ecolitst.wublastp BioPerl-1.6.922/t/data/EG352462.gbxml BioPerl-1.6.922/t/data/empty.bl2seq BioPerl-1.6.922/t/data/ENr111.mfa.example.elems BioPerl-1.6.922/t/data/entrezgene.dat BioPerl-1.6.922/t/data/ex1.nucl.nhx BioPerl-1.6.922/t/data/example.hap BioPerl-1.6.922/t/data/example.phase BioPerl-1.6.922/t/data/example.vcf BioPerl-1.6.922/t/data/exonerate.output.dontwork BioPerl-1.6.922/t/data/exonerate.output.negativescore.works BioPerl-1.6.922/t/data/exonerate.output.works BioPerl-1.6.922/t/data/exonerate.whitespace_before_query.works BioPerl-1.6.922/t/data/expected.blast.out BioPerl-1.6.922/t/data/exsignalp.out BioPerl-1.6.922/t/data/factor7.embl BioPerl-1.6.922/t/data/Fang_2003.xml BioPerl-1.6.922/t/data/fgenesh.out BioPerl-1.6.922/t/data/footprinter.out BioPerl-1.6.922/t/data/forward_primer.fa BioPerl-1.6.922/t/data/forward_reverse_primers.fa BioPerl-1.6.922/t/data/frac_problems.blast BioPerl-1.6.922/t/data/frac_problems2.blast BioPerl-1.6.922/t/data/frac_problems3.blast BioPerl-1.6.922/t/data/geneid_1.0.out BioPerl-1.6.922/t/data/genemark-fragment.out BioPerl-1.6.922/t/data/genemark.out BioPerl-1.6.922/t/data/genewise.out BioPerl-1.6.922/t/data/genewise_output.paracel_btk BioPerl-1.6.922/t/data/genomewise.out BioPerl-1.6.922/t/data/genomic-seq.epcr BioPerl-1.6.922/t/data/genomic-seq.fasta BioPerl-1.6.922/t/data/genomic-seq.genscan BioPerl-1.6.922/t/data/genomic-seq.mzef BioPerl-1.6.922/t/data/Genscan.FastA BioPerl-1.6.922/t/data/gf-s71.needle BioPerl-1.6.922/t/data/Glimmer2.out BioPerl-1.6.922/t/data/glimmer3-fragment.detail BioPerl-1.6.922/t/data/glimmer3-fragment.predict BioPerl-1.6.922/t/data/Glimmer3.detail BioPerl-1.6.922/t/data/Glimmer3.predict BioPerl-1.6.922/t/data/GlimmerHMM.out BioPerl-1.6.922/t/data/GlimmerM.out BioPerl-1.6.922/t/data/gmap_f9-multiple_results.txt BioPerl-1.6.922/t/data/gmap_f9-reverse-strand.txt BioPerl-1.6.922/t/data/gmap_f9.txt BioPerl-1.6.922/t/data/GO.defs.test BioPerl-1.6.922/t/data/GO.defs.test2 BioPerl-1.6.922/t/data/headerless.psl BioPerl-1.6.922/t/data/hemoglobinA.meg BioPerl-1.6.922/t/data/hg16_chroms.gff BioPerl-1.6.922/t/data/hmmpfam.out BioPerl-1.6.922/t/data/hmmpfam_cs.out BioPerl-1.6.922/t/data/hmmpfam_fake.out BioPerl-1.6.922/t/data/hmmpfam_HSPdashline.txt BioPerl-1.6.922/t/data/hmmpfam_multiresult.out BioPerl-1.6.922/t/data/hmmscan.out BioPerl-1.6.922/t/data/hmmscan_multi_domain.out BioPerl-1.6.922/t/data/hmmscan_sec_struct.out BioPerl-1.6.922/t/data/hmmsearch.out BioPerl-1.6.922/t/data/hmmsearch3.out BioPerl-1.6.922/t/data/hs_est.est2genome BioPerl-1.6.922/t/data/hs_fugu.newick BioPerl-1.6.922/t/data/hs_owlmonkey.aln BioPerl-1.6.922/t/data/hs_owlmonkey.fas BioPerl-1.6.922/t/data/hs_owlmonkey.fasta BioPerl-1.6.922/t/data/hsinsulin.blastcl3.blastn BioPerl-1.6.922/t/data/HUMBETGLOA.fa BioPerl-1.6.922/t/data/HUMBETGLOA.FASTA BioPerl-1.6.922/t/data/HUMBETGLOA.gff BioPerl-1.6.922/t/data/HUMBETGLOA.grail BioPerl-1.6.922/t/data/HUMBETGLOA.grailexp BioPerl-1.6.922/t/data/HUMBETGLOA.mzef BioPerl-1.6.922/t/data/HUMBETGLOA.tblastx BioPerl-1.6.922/t/data/humor.maf BioPerl-1.6.922/t/data/humts1.pal BioPerl-1.6.922/t/data/hybrid2.gff3 BioPerl-1.6.922/t/data/in.fasta BioPerl-1.6.922/t/data/insulin.water BioPerl-1.6.922/t/data/interpro.xml BioPerl-1.6.922/t/data/interpro_ebi.xml BioPerl-1.6.922/t/data/interpro_relationship.xml BioPerl-1.6.922/t/data/interpro_sample.xml BioPerl-1.6.922/t/data/interpro_short.xml BioPerl-1.6.922/t/data/intrablock-comment.nex BioPerl-1.6.922/t/data/Kingdoms_DNA.nex BioPerl-1.6.922/t/data/L77119.hmmer BioPerl-1.6.922/t/data/little.largemultifasta BioPerl-1.6.922/t/data/LittleChrY.dbsnp.xml BioPerl-1.6.922/t/data/LOAD_Ccd1.dnd BioPerl-1.6.922/t/data/long-names.nex BioPerl-1.6.922/t/data/longnames.aln BioPerl-1.6.922/t/data/longnames.dnd BioPerl-1.6.922/t/data/lucy.info BioPerl-1.6.922/t/data/lucy.qual BioPerl-1.6.922/t/data/lucy.seq BioPerl-1.6.922/t/data/lucy.stderr BioPerl-1.6.922/t/data/lysozyme6.protml BioPerl-1.6.922/t/data/lysozyme6.simple.protml BioPerl-1.6.922/t/data/M0.mlc BioPerl-1.6.922/t/data/M12730.gb BioPerl-1.6.922/t/data/mapmaker.out BioPerl-1.6.922/t/data/mapmaker.txt BioPerl-1.6.922/t/data/mast.dat BioPerl-1.6.922/t/data/masta.dat BioPerl-1.6.922/t/data/match.output BioPerl-1.6.922/t/data/Mcjanrna_rdbII.gbk BioPerl-1.6.922/t/data/megablast_output.paracel_btk BioPerl-1.6.922/t/data/meme.dat BioPerl-1.6.922/t/data/mini-AE001405.gb BioPerl-1.6.922/t/data/mini-align.aln BioPerl-1.6.922/t/data/mixedmast.dat BioPerl-1.6.922/t/data/MmCT BioPerl-1.6.922/t/data/mpath.ontology.test BioPerl-1.6.922/t/data/MSGEFTUA.gb BioPerl-1.6.922/t/data/multi.blast.m8 BioPerl-1.6.922/t/data/multi.blast.m9 BioPerl-1.6.922/t/data/multi.phd BioPerl-1.6.922/t/data/multi_1.fa BioPerl-1.6.922/t/data/multi_2.fa BioPerl-1.6.922/t/data/multi_blast.bls BioPerl-1.6.922/t/data/multifa.seq BioPerl-1.6.922/t/data/multifa.seq.qual BioPerl-1.6.922/t/data/multiline-intrablock-comment.nex BioPerl-1.6.922/t/data/multiresult_blastn+.bls BioPerl-1.6.922/t/data/multiseq.bls BioPerl-1.6.922/t/data/multiseq_tags.phd BioPerl-1.6.922/t/data/mus.bls.xml BioPerl-1.6.922/t/data/mutations.dat BioPerl-1.6.922/t/data/mutations.old.dat BioPerl-1.6.922/t/data/mutations.old.xml BioPerl-1.6.922/t/data/mutations.xml BioPerl-1.6.922/t/data/myco_sites.gff BioPerl-1.6.922/t/data/NC_000007-ribosomal-slippage.gb BioPerl-1.6.922/t/data/NC_001284.gbk BioPerl-1.6.922/t/data/NC_002058_multDBLINK_bug3375.gb BioPerl-1.6.922/t/data/NC_006346.gb BioPerl-1.6.922/t/data/NC_006511-short.gbk BioPerl-1.6.922/t/data/NC_008536.gb BioPerl-1.6.922/t/data/nei_gojobori_test.aln BioPerl-1.6.922/t/data/neighbor.dist BioPerl-1.6.922/t/data/new_blastn.txt BioPerl-1.6.922/t/data/newblast.xml BioPerl-1.6.922/t/data/nhmmer-3.1.out BioPerl-1.6.922/t/data/nhx-bacteria.nhx BioPerl-1.6.922/t/data/NM_002254.gb BioPerl-1.6.922/t/data/no-genes.genscan BioPerl-1.6.922/t/data/no_cds_example.gb BioPerl-1.6.922/t/data/no_FH.embl BioPerl-1.6.922/t/data/no_hsps.blastp BioPerl-1.6.922/t/data/no_semicolon.newick BioPerl-1.6.922/t/data/noninterleaved.phy BioPerl-1.6.922/t/data/NT_021877.gbk BioPerl-1.6.922/t/data/nucmatrix.txt BioPerl-1.6.922/t/data/O_sat.wgs BioPerl-1.6.922/t/data/omim_genemap_test BioPerl-1.6.922/t/data/omim_genemap_test_nolinebreak BioPerl-1.6.922/t/data/omim_text_test BioPerl-1.6.922/t/data/P33897 BioPerl-1.6.922/t/data/P35527.gb BioPerl-1.6.922/t/data/P39765.gb BioPerl-1.6.922/t/data/PAM250 BioPerl-1.6.922/t/data/pep-266.aln BioPerl-1.6.922/t/data/pfam_tests.stk BioPerl-1.6.922/t/data/pfamOutput-bug3376.out BioPerl-1.6.922/t/data/phi.out BioPerl-1.6.922/t/data/phipsi.out BioPerl-1.6.922/t/data/phylipdist-36.out BioPerl-1.6.922/t/data/phylipdist.out BioPerl-1.6.922/t/data/phyloxml_examples.xml BioPerl-1.6.922/t/data/pictogram.fa BioPerl-1.6.922/t/data/plague_yeast.bls.xml BioPerl-1.6.922/t/data/polymorphism.dat BioPerl-1.6.922/t/data/polymorphism.old.xml BioPerl-1.6.922/t/data/polymorphism.xml BioPerl-1.6.922/t/data/popgen_saureus.dat BioPerl-1.6.922/t/data/popgen_saureus.multidat BioPerl-1.6.922/t/data/popstats.prettybase BioPerl-1.6.922/t/data/pre_rel9.swiss BioPerl-1.6.922/t/data/Primate_mtDNA.nex BioPerl-1.6.922/t/data/primedseq.fa BioPerl-1.6.922/t/data/primer3_infile.txt BioPerl-1.6.922/t/data/primer3_outfile.txt BioPerl-1.6.922/t/data/primer3_output.txt BioPerl-1.6.922/t/data/prints.out BioPerl-1.6.922/t/data/promoterwise.out BioPerl-1.6.922/t/data/protpars.phy BioPerl-1.6.922/t/data/protpars_longid.phy BioPerl-1.6.922/t/data/pseudowise.out BioPerl-1.6.922/t/data/psi_xml.dat BioPerl-1.6.922/t/data/psiblast.xml BioPerl-1.6.922/t/data/psiblastreport.out BioPerl-1.6.922/t/data/purine_v081.infernal BioPerl-1.6.922/t/data/puzzle.tre BioPerl-1.6.922/t/data/PX1CG.gb BioPerl-1.6.922/t/data/Q8GBD3.swiss BioPerl-1.6.922/t/data/qrna-relloc.out BioPerl-1.6.922/t/data/qualfile.qual BioPerl-1.6.922/t/data/quoted-strings1.nex BioPerl-1.6.922/t/data/quoted-strings2.nex BioPerl-1.6.922/t/data/Rab1.chaos-xml BioPerl-1.6.922/t/data/radical-whitespace.nex BioPerl-1.6.922/t/data/radical-whitespace_02.nex BioPerl-1.6.922/t/data/rebase.itype2 BioPerl-1.6.922/t/data/rebase.withrefm BioPerl-1.6.922/t/data/reference_ace.ace BioPerl-1.6.922/t/data/regulation_test.obo BioPerl-1.6.922/t/data/rel9.swiss BioPerl-1.6.922/t/data/repeatmasker.fa.out BioPerl-1.6.922/t/data/revcomp_mrna.gb BioPerl-1.6.922/t/data/rfam_tests.stk BioPerl-1.6.922/t/data/ribosome-slippage.gb BioPerl-1.6.922/t/data/roa1.dat BioPerl-1.6.922/t/data/roa1.gbxml BioPerl-1.6.922/t/data/roa1.genbank BioPerl-1.6.922/t/data/roa1.swiss BioPerl-1.6.922/t/data/roa1_v2.dat BioPerl-1.6.922/t/data/rpsblast.bls BioPerl-1.6.922/t/data/rpsblast_no_hits.bls BioPerl-1.6.922/t/data/sample_dataset.tigr BioPerl-1.6.922/t/data/sbay_c127.fas BioPerl-1.6.922/t/data/sbay_c545-yeast.BLASTZ.PSL BioPerl-1.6.922/t/data/seg.out BioPerl-1.6.922/t/data/semicolon.newick BioPerl-1.6.922/t/data/seqdatabase.ini BioPerl-1.6.922/t/data/seqfile.pir BioPerl-1.6.922/t/data/seqs.fas BioPerl-1.6.922/t/data/sequencefamily.dat BioPerl-1.6.922/t/data/seqxml.xml BioPerl-1.6.922/t/data/short.blx BioPerl-1.6.922/t/data/signalp.hmm.short BioPerl-1.6.922/t/data/signalp.hmm.summary BioPerl-1.6.922/t/data/signalp.negative.out BioPerl-1.6.922/t/data/signalp.nn.short BioPerl-1.6.922/t/data/signalp.nn.summary BioPerl-1.6.922/t/data/signalp.positive.out BioPerl-1.6.922/t/data/signalp.short BioPerl-1.6.922/t/data/signalp.summary BioPerl-1.6.922/t/data/sim4.for.for BioPerl-1.6.922/t/data/sim4.for.rev BioPerl-1.6.922/t/data/sim4.rev BioPerl-1.6.922/t/data/singleNSsite.mlc BioPerl-1.6.922/t/data/singlescore.gbk BioPerl-1.6.922/t/data/singlet_w_CT.ace BioPerl-1.6.922/t/data/so.obo BioPerl-1.6.922/t/data/sofa.ontology BioPerl-1.6.922/t/data/sp_subset.obo BioPerl-1.6.922/t/data/spaced_fasta.fa BioPerl-1.6.922/t/data/spaces.nex BioPerl-1.6.922/t/data/SPAN_Family4nl.nex BioPerl-1.6.922/t/data/SPAN_Family7n.nex BioPerl-1.6.922/t/data/SPAN_Family8a.nex BioPerl-1.6.922/t/data/sparsealn.needle BioPerl-1.6.922/t/data/spidey.noalignment BioPerl-1.6.922/t/data/spidey.test1 BioPerl-1.6.922/t/data/sprintf.rnamotif BioPerl-1.6.922/t/data/ssp160.embl.1 BioPerl-1.6.922/t/data/sv40_small.xml BioPerl-1.6.922/t/data/swiss.dat BioPerl-1.6.922/t/data/swisspfam.data BioPerl-1.6.922/t/data/SwissProt.dat BioPerl-1.6.922/t/data/T7.aln BioPerl-1.6.922/t/data/tab1part.mif BioPerl-1.6.922/t/data/tab2part.mif BioPerl-1.6.922/t/data/tab3part.mif BioPerl-1.6.922/t/data/tandem_repeats_finder.dat BioPerl-1.6.922/t/data/tandem_repeats_finder.noresults BioPerl-1.6.922/t/data/tandem_repeats_finder_no_desc.dat BioPerl-1.6.922/t/data/targetp.out BioPerl-1.6.922/t/data/tblastn.out BioPerl-1.6.922/t/data/test 2.txt BioPerl-1.6.922/t/data/test-3.0-1.meme BioPerl-1.6.922/t/data/test-3.0-2.meme BioPerl-1.6.922/t/data/test-4.9.meme BioPerl-1.6.922/t/data/test.abi BioPerl-1.6.922/t/data/test.ace BioPerl-1.6.922/t/data/test.bam BioPerl-1.6.922/t/data/test.bowtie BioPerl-1.6.922/t/data/test.cns.fastq BioPerl-1.6.922/t/data/test.ctf BioPerl-1.6.922/t/data/test.embl BioPerl-1.6.922/t/data/test.embl2sq BioPerl-1.6.922/t/data/test.exp BioPerl-1.6.922/t/data/test.fasta BioPerl-1.6.922/t/data/test.fastq BioPerl-1.6.922/t/data/test.game BioPerl-1.6.922/t/data/test.gcg BioPerl-1.6.922/t/data/test.gcgblast BioPerl-1.6.922/t/data/test.gcgfasta BioPerl-1.6.922/t/data/test.genbank BioPerl-1.6.922/t/data/test.genbank.noseq BioPerl-1.6.922/t/data/test.infernal BioPerl-1.6.922/t/data/test.interpro BioPerl-1.6.922/t/data/test.interpro-go.xml BioPerl-1.6.922/t/data/test.lasergene BioPerl-1.6.922/t/data/test.locuslink BioPerl-1.6.922/t/data/test.maq BioPerl-1.6.922/t/data/test.mase BioPerl-1.6.922/t/data/test.metafasta BioPerl-1.6.922/t/data/test.nh BioPerl-1.6.922/t/data/test.nhx BioPerl-1.6.922/t/data/test.pfam BioPerl-1.6.922/t/data/test.phd BioPerl-1.6.922/t/data/test.pir BioPerl-1.6.922/t/data/test.pln BioPerl-1.6.922/t/data/test.raw BioPerl-1.6.922/t/data/test.ref.fas BioPerl-1.6.922/t/data/test.swiss BioPerl-1.6.922/t/data/test.tab BioPerl-1.6.922/t/data/test.tigrxml BioPerl-1.6.922/t/data/test.tseq BioPerl-1.6.922/t/data/test.tsv BioPerl-1.6.922/t/data/test.txt BioPerl-1.6.922/t/data/test.waba BioPerl-1.6.922/t/data/test.xls BioPerl-1.6.922/t/data/test.ztr BioPerl-1.6.922/t/data/test1.blasttab3 BioPerl-1.6.922/t/data/test1.wublastp BioPerl-1.6.922/t/data/test2.infernal BioPerl-1.6.922/t/data/test2.raw BioPerl-1.6.922/t/data/test_badlf.gcg BioPerl-1.6.922/t/data/test_clear_range.fastq BioPerl-1.6.922/t/data/test_data.axt BioPerl-1.6.922/t/data/test_singlets.cns.fastq BioPerl-1.6.922/t/data/test_singlets.maq BioPerl-1.6.922/t/data/testaln.aln BioPerl-1.6.922/t/data/testaln.arp BioPerl-1.6.922/t/data/testaln.fasta BioPerl-1.6.922/t/data/testaln.fastq BioPerl-1.6.922/t/data/testaln.list BioPerl-1.6.922/t/data/testaln.mase BioPerl-1.6.922/t/data/testaln.metafasta BioPerl-1.6.922/t/data/testaln.msf BioPerl-1.6.922/t/data/testaln.nexus BioPerl-1.6.922/t/data/testaln.pfam BioPerl-1.6.922/t/data/testaln.phylip BioPerl-1.6.922/t/data/testaln.po BioPerl-1.6.922/t/data/testaln.prodom BioPerl-1.6.922/t/data/testaln.psi BioPerl-1.6.922/t/data/testaln.selex BioPerl-1.6.922/t/data/testaln.stockholm BioPerl-1.6.922/t/data/testaln.xmfa BioPerl-1.6.922/t/data/testaln2.arp BioPerl-1.6.922/t/data/testaln2.fasta BioPerl-1.6.922/t/data/testdat.exonerate BioPerl-1.6.922/t/data/testdata.crossmatch BioPerl-1.6.922/t/data/testdbaccnums.out BioPerl-1.6.922/t/data/testfile.erpin BioPerl-1.6.922/t/data/testfuzzy.genbank BioPerl-1.6.922/t/data/tiny.stk BioPerl-1.6.922/t/data/tmhmm.out BioPerl-1.6.922/t/data/tmp.fst BioPerl-1.6.922/t/data/tol-2010-02-18.nhx BioPerl-1.6.922/t/data/traits.tab BioPerl-1.6.922/t/data/traittree.nexus BioPerl-1.6.922/t/data/transfac.dat BioPerl-1.6.922/t/data/tree_nonewline.nexus BioPerl-1.6.922/t/data/Treebase-chlamy-dna.nex BioPerl-1.6.922/t/data/trees.nexml.old.xml BioPerl-1.6.922/t/data/tricky.wublast BioPerl-1.6.922/t/data/trna.strict.rnamotif BioPerl-1.6.922/t/data/U58726.gb BioPerl-1.6.922/t/data/U71225.gb BioPerl-1.6.922/t/data/U71225.gb.unix BioPerl-1.6.922/t/data/U71225.gb.win BioPerl-1.6.922/t/data/U83300.bsml BioPerl-1.6.922/t/data/UnaSmithHIV-both.nex BioPerl-1.6.922/t/data/unigene.data BioPerl-1.6.922/t/data/urease.tre.nexus BioPerl-1.6.922/t/data/version2.scf BioPerl-1.6.922/t/data/version3.scf BioPerl-1.6.922/t/data/wellcome_tol.nhx BioPerl-1.6.922/t/data/withrefm.906 BioPerl-1.6.922/t/data/worm_fam_2785.cdna BioPerl-1.6.922/t/data/X98338_Adh-mRNA.gb BioPerl-1.6.922/t/data/yeast.tRNAscanSE BioPerl-1.6.922/t/data/yn00.mlc BioPerl-1.6.922/t/data/yn00_45.mlc BioPerl-1.6.922/t/data/ZABJ4EA7014.CH878695.1.blast.txt BioPerl-1.6.922/t/data/bad_dbfa BioPerl-1.6.922/t/data/bad_dbfa/bug3172.fa BioPerl-1.6.922/t/data/bad_dbfa/shotdb.fa BioPerl-1.6.922/t/data/biodbgff BioPerl-1.6.922/t/data/biodbgff/test.gff BioPerl-1.6.922/t/data/biodbgff/test.gff3 BioPerl-1.6.922/t/data/codeml_lysozyme BioPerl-1.6.922/t/data/codeml_lysozyme/2NG.dN BioPerl-1.6.922/t/data/codeml_lysozyme/2NG.dS BioPerl-1.6.922/t/data/codeml_lysozyme/2NG.tt BioPerl-1.6.922/t/data/codeml_lysozyme/4fold.nuc BioPerl-1.6.922/t/data/codeml_lysozyme/lnf BioPerl-1.6.922/t/data/codeml_lysozyme/lysozymeSmall.ctl BioPerl-1.6.922/t/data/codeml_lysozyme/lysozymeSmall.trees BioPerl-1.6.922/t/data/codeml_lysozyme/lysozymeSmall.txt BioPerl-1.6.922/t/data/codeml_lysozyme/mlc BioPerl-1.6.922/t/data/codeml_lysozyme/rst BioPerl-1.6.922/t/data/codeml_lysozyme/rst1 BioPerl-1.6.922/t/data/codeml_lysozyme/rub BioPerl-1.6.922/t/data/consed_project BioPerl-1.6.922/t/data/consed_project/edit_dir BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.contigs BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.log BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1 BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2 BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.log BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.problems BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.qual BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.fasta.screen.view BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.newtags BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.phrap.out BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project.screen.out BioPerl-1.6.922/t/data/consed_project/edit_dir/test_project_to_alu.cross BioPerl-1.6.922/t/data/consed_project/edit_dir/test_projectNewChromats.fof BioPerl-1.6.922/t/data/consed_project/phd_dir BioPerl-1.6.922/t/data/consed_project/phd_dir/ML4922R.phd.1 BioPerl-1.6.922/t/data/consed_project/phd_dir/ML4924F.phd.1 BioPerl-1.6.922/t/data/consed_project/phd_dir/ML4924R.phd.1 BioPerl-1.6.922/t/data/consed_project/phd_dir/ML4947F.phd.1 BioPerl-1.6.922/t/data/dbfa BioPerl-1.6.922/t/data/dbfa/1.fa BioPerl-1.6.922/t/data/dbfa/2.fa BioPerl-1.6.922/t/data/dbfa/3.fa BioPerl-1.6.922/t/data/dbfa/4.fa BioPerl-1.6.922/t/data/dbfa/5.fa BioPerl-1.6.922/t/data/dbfa/6.fa BioPerl-1.6.922/t/data/dbfa/7.fa BioPerl-1.6.922/t/data/dbfa/mixed_alphabet.fasta BioPerl-1.6.922/t/data/dbqual BioPerl-1.6.922/t/data/dbqual/1.qual BioPerl-1.6.922/t/data/dbqual/2.qual BioPerl-1.6.922/t/data/dbqual/3.qual BioPerl-1.6.922/t/data/fastq BioPerl-1.6.922/t/data/fastq/bug2335.fastq BioPerl-1.6.922/t/data/fastq/error_diff_ids.fastq BioPerl-1.6.922/t/data/fastq/error_double_qual.fastq BioPerl-1.6.922/t/data/fastq/error_double_seq.fastq BioPerl-1.6.922/t/data/fastq/error_long_qual.fastq BioPerl-1.6.922/t/data/fastq/error_no_qual.fastq BioPerl-1.6.922/t/data/fastq/error_qual_del.fastq BioPerl-1.6.922/t/data/fastq/error_qual_escape.fastq BioPerl-1.6.922/t/data/fastq/error_qual_null.fastq BioPerl-1.6.922/t/data/fastq/error_qual_space.fastq BioPerl-1.6.922/t/data/fastq/error_qual_tab.fastq BioPerl-1.6.922/t/data/fastq/error_qual_unit_sep.fastq BioPerl-1.6.922/t/data/fastq/error_qual_vtab.fastq BioPerl-1.6.922/t/data/fastq/error_short_qual.fastq BioPerl-1.6.922/t/data/fastq/error_spaces.fastq BioPerl-1.6.922/t/data/fastq/error_tabs.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_at_plus.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_at_qual.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_at_seq.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_in_plus.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_in_qual.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_in_seq.fastq BioPerl-1.6.922/t/data/fastq/error_trunc_in_title.fastq BioPerl-1.6.922/t/data/fastq/evil_wrapping.fastq BioPerl-1.6.922/t/data/fastq/example.fasta BioPerl-1.6.922/t/data/fastq/example.fastq BioPerl-1.6.922/t/data/fastq/example.qual BioPerl-1.6.922/t/data/fastq/illumina_faked.fastq BioPerl-1.6.922/t/data/fastq/sanger_93.fastq BioPerl-1.6.922/t/data/fastq/sanger_faked.fastq BioPerl-1.6.922/t/data/fastq/solexa_example.fastq BioPerl-1.6.922/t/data/fastq/solexa_faked.fastq BioPerl-1.6.922/t/data/fastq/test1_sanger.fastq BioPerl-1.6.922/t/data/fastq/test2_solexa.fastq BioPerl-1.6.922/t/data/fastq/test3_illumina.fastq BioPerl-1.6.922/t/data/fastq/tricky.fastq BioPerl-1.6.922/t/data/fastq/wrapping_issues.fastq BioPerl-1.6.922/t/data/fastq/zero_qual.fastq BioPerl-1.6.922/t/data/map_hem BioPerl-1.6.922/t/data/map_hem/HEM1-HEM12.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM12.fa.revcom BioPerl-1.6.922/t/data/map_hem/HEM1-HEM12.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1-HEM13.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM13.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1-HEM14.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM14.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1-HEM2.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM2.fa.revcom BioPerl-1.6.922/t/data/map_hem/HEM1-HEM2.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1-HEM3.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM3.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1-HEM4.fa BioPerl-1.6.922/t/data/map_hem/HEM1-HEM4.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM1.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM1.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM12-HEM13.fa BioPerl-1.6.922/t/data/map_hem/HEM12-HEM13.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM12-HEM14.fa BioPerl-1.6.922/t/data/map_hem/HEM12-HEM14.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM12-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM12-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM12.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM12.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM13-HEM14.fa BioPerl-1.6.922/t/data/map_hem/HEM13-HEM14.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM13-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM13-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM13.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM13.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM14-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM14-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM14.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM14.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM15.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM15.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM2-HEM12.fa BioPerl-1.6.922/t/data/map_hem/HEM2-HEM12.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM2-HEM13.fa BioPerl-1.6.922/t/data/map_hem/HEM2-HEM13.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM2-HEM14.fa BioPerl-1.6.922/t/data/map_hem/HEM2-HEM14.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM2-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM2-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM2-HEM3.fa BioPerl-1.6.922/t/data/map_hem/HEM2-HEM3.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM2-HEM4.fa BioPerl-1.6.922/t/data/map_hem/HEM2-HEM4.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM2.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM2.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM3-HEM12.fa BioPerl-1.6.922/t/data/map_hem/HEM3-HEM12.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM3-HEM13.fa BioPerl-1.6.922/t/data/map_hem/HEM3-HEM13.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM3-HEM14.fa BioPerl-1.6.922/t/data/map_hem/HEM3-HEM14.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM3-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM3-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM3-HEM4.fa BioPerl-1.6.922/t/data/map_hem/HEM3-HEM4.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM3.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM3.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/HEM4-HEM12.fa BioPerl-1.6.922/t/data/map_hem/HEM4-HEM12.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM4-HEM13.fa BioPerl-1.6.922/t/data/map_hem/HEM4-HEM13.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM4-HEM14.fa BioPerl-1.6.922/t/data/map_hem/HEM4-HEM14.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM4-HEM15.fa BioPerl-1.6.922/t/data/map_hem/HEM4-HEM15.meme.txt BioPerl-1.6.922/t/data/map_hem/HEM4.ups.fa_ BioPerl-1.6.922/t/data/map_hem/HEM4.ups.fa_.revcom BioPerl-1.6.922/t/data/map_hem/yeast.nc.1.freq BioPerl-1.6.922/t/data/mbsout BioPerl-1.6.922/t/data/mbsout/mbsout_infile1 BioPerl-1.6.922/t/data/mbsout/mbsout_infile2 BioPerl-1.6.922/t/data/mbsout/mbsout_infile3 BioPerl-1.6.922/t/data/msout BioPerl-1.6.922/t/data/msout/bad_msout_infile1 BioPerl-1.6.922/t/data/msout/bad_msout_infile2 BioPerl-1.6.922/t/data/msout/msout_infile1 BioPerl-1.6.922/t/data/msout/msout_infile2 BioPerl-1.6.922/t/data/msout/msout_infile3 BioPerl-1.6.922/t/data/msout/msout_infile4 BioPerl-1.6.922/t/data/nexml BioPerl-1.6.922/t/data/nexml/characters.nexml.8.xml BioPerl-1.6.922/t/data/nexml/characters.nexml.xml BioPerl-1.6.922/t/data/nexml/trees.nexml.8.xml BioPerl-1.6.922/t/data/nexml/trees.nexml.xml BioPerl-1.6.922/t/data/registry BioPerl-1.6.922/t/data/registry/bdb BioPerl-1.6.922/t/data/registry/bdb/seqdatabase.ini BioPerl-1.6.922/t/data/registry/flat BioPerl-1.6.922/t/data/registry/flat/seqdatabase.ini BioPerl-1.6.922/t/data/seqfeaturedb BioPerl-1.6.922/t/data/seqfeaturedb/test.gff3 BioPerl-1.6.922/t/data/taxdump BioPerl-1.6.922/t/data/taxdump/names.dmp BioPerl-1.6.922/t/data/taxdump/nodes.dmp BioPerl-1.6.922/t/data/taxonomy BioPerl-1.6.922/t/data/taxonomy/greengenes_taxonomy_16S_candiv_gg_2011_1.txt BioPerl-1.6.922/t/data/taxonomy/silva_SSURef_108_tax_silva_trunc.fasta BioPerl-1.6.922/t/data/transfac_pro BioPerl-1.6.922/t/data/transfac_pro/factor.dat BioPerl-1.6.922/t/data/transfac_pro/fragment.dat BioPerl-1.6.922/t/data/transfac_pro/gene.dat BioPerl-1.6.922/t/data/transfac_pro/matrix.dat BioPerl-1.6.922/t/data/transfac_pro/readme.txt BioPerl-1.6.922/t/data/transfac_pro/reference.dat BioPerl-1.6.922/t/data/transfac_pro/site.dat BioPerl-1.6.922/t/Draw BioPerl-1.6.922/t/Draw/Pictogram.t BioPerl-1.6.922/t/lib BioPerl-1.6.922/t/lib/Error.pm BioPerl-1.6.922/t/LiveSeq BioPerl-1.6.922/t/LiveSeq/Chain.t BioPerl-1.6.922/t/LiveSeq/LiveSeq.t BioPerl-1.6.922/t/LiveSeq/Mutation.t BioPerl-1.6.922/t/LiveSeq/Mutator.t BioPerl-1.6.922/t/LocalDB BioPerl-1.6.922/t/LocalDB/BioDBGFF.t BioPerl-1.6.922/t/LocalDB/Fasta.t BioPerl-1.6.922/t/LocalDB/Flat.t BioPerl-1.6.922/t/LocalDB/Qual.t BioPerl-1.6.922/t/LocalDB/Registry.t BioPerl-1.6.922/t/LocalDB/SeqFeature.t BioPerl-1.6.922/t/LocalDB/transfac_pro.t BioPerl-1.6.922/t/LocalDB/Index BioPerl-1.6.922/t/LocalDB/Index/Blast.t BioPerl-1.6.922/t/LocalDB/Index/BlastTable.t BioPerl-1.6.922/t/LocalDB/Index/Index.t BioPerl-1.6.922/t/LocalDB/Taxonomy BioPerl-1.6.922/t/LocalDB/Taxonomy/greengenes.t BioPerl-1.6.922/t/LocalDB/Taxonomy/silva.t BioPerl-1.6.922/t/Map BioPerl-1.6.922/t/Map/Cyto.t BioPerl-1.6.922/t/Map/Linkage.t BioPerl-1.6.922/t/Map/Map.t BioPerl-1.6.922/t/Map/MapIO.t BioPerl-1.6.922/t/Map/MicrosatelliteMarker.t BioPerl-1.6.922/t/Map/Physical.t BioPerl-1.6.922/t/Matrix BioPerl-1.6.922/t/Matrix/InstanceSite.t BioPerl-1.6.922/t/Matrix/Matrix.t BioPerl-1.6.922/t/Matrix/ProtMatrix.t BioPerl-1.6.922/t/Matrix/ProtPsm.t BioPerl-1.6.922/t/Matrix/SiteMatrix.t BioPerl-1.6.922/t/Matrix/IO BioPerl-1.6.922/t/Matrix/IO/masta.t BioPerl-1.6.922/t/Matrix/IO/psm.t BioPerl-1.6.922/t/Ontology BioPerl-1.6.922/t/Ontology/GOterm.t BioPerl-1.6.922/t/Ontology/GraphAdaptor.t BioPerl-1.6.922/t/Ontology/Ontology.t BioPerl-1.6.922/t/Ontology/OntologyEngine.t BioPerl-1.6.922/t/Ontology/OntologyStore.t BioPerl-1.6.922/t/Ontology/Relationship.t BioPerl-1.6.922/t/Ontology/RelationshipType.t BioPerl-1.6.922/t/Ontology/Term.t BioPerl-1.6.922/t/Ontology/IO BioPerl-1.6.922/t/Ontology/IO/go.t BioPerl-1.6.922/t/Ontology/IO/interpro.t BioPerl-1.6.922/t/Ontology/IO/obo.t BioPerl-1.6.922/t/Phenotype BioPerl-1.6.922/t/Phenotype/Correlate.t BioPerl-1.6.922/t/Phenotype/Measure.t BioPerl-1.6.922/t/Phenotype/MeSH.t BioPerl-1.6.922/t/Phenotype/MiniMIMentry.t BioPerl-1.6.922/t/Phenotype/OMIMentry.t BioPerl-1.6.922/t/Phenotype/OMIMentryAllelicVariant.t BioPerl-1.6.922/t/Phenotype/OMIMparser.t BioPerl-1.6.922/t/Phenotype/Phenotype.t BioPerl-1.6.922/t/PopGen BioPerl-1.6.922/t/PopGen/Coalescent.t BioPerl-1.6.922/t/PopGen/HtSNP.t BioPerl-1.6.922/t/PopGen/MK.t BioPerl-1.6.922/t/PopGen/PopGen.t BioPerl-1.6.922/t/PopGen/PopGenSims.t BioPerl-1.6.922/t/PopGen/TagHaplotype.t BioPerl-1.6.922/t/RemoteDB BioPerl-1.6.922/t/RemoteDB/BioFetch.t BioPerl-1.6.922/t/RemoteDB/CUTG.t BioPerl-1.6.922/t/RemoteDB/EMBL.t BioPerl-1.6.922/t/RemoteDB/EntrezGene.t BioPerl-1.6.922/t/RemoteDB/GenBank.t BioPerl-1.6.922/t/RemoteDB/GenPept.t BioPerl-1.6.922/t/RemoteDB/MeSH.t BioPerl-1.6.922/t/RemoteDB/RefSeq.t BioPerl-1.6.922/t/RemoteDB/SeqHound.t BioPerl-1.6.922/t/RemoteDB/SeqRead_fail.t BioPerl-1.6.922/t/RemoteDB/SeqVersion.t BioPerl-1.6.922/t/RemoteDB/SwissProt.t BioPerl-1.6.922/t/RemoteDB/Taxonomy.t BioPerl-1.6.922/t/RemoteDB/HIV BioPerl-1.6.922/t/RemoteDB/HIV/HIV.t BioPerl-1.6.922/t/RemoteDB/HIV/HIVAnnotProcessor.t BioPerl-1.6.922/t/RemoteDB/HIV/HIVQuery.t BioPerl-1.6.922/t/RemoteDB/HIV/HIVQueryHelper.t BioPerl-1.6.922/t/RemoteDB/Query BioPerl-1.6.922/t/RemoteDB/Query/GenBank.t BioPerl-1.6.922/t/Restriction BioPerl-1.6.922/t/Restriction/Analysis-refac.t BioPerl-1.6.922/t/Restriction/Analysis.t BioPerl-1.6.922/t/Restriction/Gel.t BioPerl-1.6.922/t/Restriction/IO.t BioPerl-1.6.922/t/Root BioPerl-1.6.922/t/Root/Exception.t BioPerl-1.6.922/t/Root/HTTPget.t BioPerl-1.6.922/t/Root/RootI.t BioPerl-1.6.922/t/Root/RootIO.t BioPerl-1.6.922/t/Root/Storable.t BioPerl-1.6.922/t/Root/Tempfile.t BioPerl-1.6.922/t/Root/Utilities.t BioPerl-1.6.922/t/SearchIO BioPerl-1.6.922/t/SearchIO/axt.t BioPerl-1.6.922/t/SearchIO/blast.t BioPerl-1.6.922/t/SearchIO/blast_pull.t BioPerl-1.6.922/t/SearchIO/blasttable.t BioPerl-1.6.922/t/SearchIO/blastxml.t BioPerl-1.6.922/t/SearchIO/CigarString.t BioPerl-1.6.922/t/SearchIO/cross_match.t BioPerl-1.6.922/t/SearchIO/erpin.t BioPerl-1.6.922/t/SearchIO/exonerate.t BioPerl-1.6.922/t/SearchIO/fasta.t BioPerl-1.6.922/t/SearchIO/gmap_f9.t BioPerl-1.6.922/t/SearchIO/hmmer.t BioPerl-1.6.922/t/SearchIO/hmmer_pull.t BioPerl-1.6.922/t/SearchIO/infernal.t BioPerl-1.6.922/t/SearchIO/megablast.t BioPerl-1.6.922/t/SearchIO/psl.t BioPerl-1.6.922/t/SearchIO/rnamotif.t BioPerl-1.6.922/t/SearchIO/SearchIO.t BioPerl-1.6.922/t/SearchIO/sim4.t BioPerl-1.6.922/t/SearchIO/SimilarityPair.t BioPerl-1.6.922/t/SearchIO/Tiling.t BioPerl-1.6.922/t/SearchIO/waba.t BioPerl-1.6.922/t/SearchIO/wise.t BioPerl-1.6.922/t/SearchIO/Writer BioPerl-1.6.922/t/SearchIO/Writer/GbrowseGFF.t BioPerl-1.6.922/t/SearchIO/Writer/HitTableWriter.t BioPerl-1.6.922/t/SearchIO/Writer/HSPTableWriter.t BioPerl-1.6.922/t/SearchIO/Writer/HTMLWriter.t BioPerl-1.6.922/t/SearchIO/Writer/TextWriter.t BioPerl-1.6.922/t/Seq BioPerl-1.6.922/t/Seq/DBLink.t BioPerl-1.6.922/t/Seq/EncodedSeq.t BioPerl-1.6.922/t/Seq/LargeLocatableSeq.t BioPerl-1.6.922/t/Seq/LargePSeq.t BioPerl-1.6.922/t/Seq/LocatableSeq.t BioPerl-1.6.922/t/Seq/MetaSeq.t BioPerl-1.6.922/t/Seq/PrimaryQual.t BioPerl-1.6.922/t/Seq/PrimarySeq.t BioPerl-1.6.922/t/Seq/PrimedSeq.t BioPerl-1.6.922/t/Seq/Quality.t BioPerl-1.6.922/t/Seq/Seq.t BioPerl-1.6.922/t/Seq/SimulatedRead.t BioPerl-1.6.922/t/Seq/WithQuality.t BioPerl-1.6.922/t/SeqFeature BioPerl-1.6.922/t/SeqFeature/Amplicon.t BioPerl-1.6.922/t/SeqFeature/Clone.t BioPerl-1.6.922/t/SeqFeature/Collection.t BioPerl-1.6.922/t/SeqFeature/Computation.t BioPerl-1.6.922/t/SeqFeature/FeaturePair.t BioPerl-1.6.922/t/SeqFeature/Gene.t BioPerl-1.6.922/t/SeqFeature/Generic.t BioPerl-1.6.922/t/SeqFeature/Location.t BioPerl-1.6.922/t/SeqFeature/LocationFactory.t BioPerl-1.6.922/t/SeqFeature/Primer.t BioPerl-1.6.922/t/SeqFeature/Range.t BioPerl-1.6.922/t/SeqFeature/RangeI.t BioPerl-1.6.922/t/SeqFeature/SeqAnalysisParser.t BioPerl-1.6.922/t/SeqFeature/SubSeq.t BioPerl-1.6.922/t/SeqFeature/Unflattener.t BioPerl-1.6.922/t/SeqFeature/Unflattener2.t BioPerl-1.6.922/t/SeqIO BioPerl-1.6.922/t/SeqIO/abi.t BioPerl-1.6.922/t/SeqIO/ace.t BioPerl-1.6.922/t/SeqIO/agave.t BioPerl-1.6.922/t/SeqIO/alf.t BioPerl-1.6.922/t/SeqIO/asciitree.t BioPerl-1.6.922/t/SeqIO/bsml.t BioPerl-1.6.922/t/SeqIO/bsml_sax.t BioPerl-1.6.922/t/SeqIO/chadoxml.t BioPerl-1.6.922/t/SeqIO/chaos.t BioPerl-1.6.922/t/SeqIO/chaosxml.t BioPerl-1.6.922/t/SeqIO/ctf.t BioPerl-1.6.922/t/SeqIO/embl.t BioPerl-1.6.922/t/SeqIO/entrezgene.t BioPerl-1.6.922/t/SeqIO/excel.t BioPerl-1.6.922/t/SeqIO/exp.t BioPerl-1.6.922/t/SeqIO/fasta.t BioPerl-1.6.922/t/SeqIO/fastq.t BioPerl-1.6.922/t/SeqIO/flybase_chadoxml.t BioPerl-1.6.922/t/SeqIO/game.t BioPerl-1.6.922/t/SeqIO/gbxml.t BioPerl-1.6.922/t/SeqIO/gcg.t BioPerl-1.6.922/t/SeqIO/genbank.t BioPerl-1.6.922/t/SeqIO/Handler.t BioPerl-1.6.922/t/SeqIO/interpro.t BioPerl-1.6.922/t/SeqIO/kegg.t BioPerl-1.6.922/t/SeqIO/largefasta.t BioPerl-1.6.922/t/SeqIO/lasergene.t BioPerl-1.6.922/t/SeqIO/locuslink.t BioPerl-1.6.922/t/SeqIO/mbsout.t BioPerl-1.6.922/t/SeqIO/metafasta.t BioPerl-1.6.922/t/SeqIO/msout.t BioPerl-1.6.922/t/SeqIO/MultiFile.t BioPerl-1.6.922/t/SeqIO/Multiple_fasta.t BioPerl-1.6.922/t/SeqIO/nexml.t BioPerl-1.6.922/t/SeqIO/phd.t BioPerl-1.6.922/t/SeqIO/pir.t BioPerl-1.6.922/t/SeqIO/pln.t BioPerl-1.6.922/t/SeqIO/qual.t BioPerl-1.6.922/t/SeqIO/raw.t BioPerl-1.6.922/t/SeqIO/scf.t BioPerl-1.6.922/t/SeqIO/SeqBuilder.t BioPerl-1.6.922/t/SeqIO/SeqIO.t BioPerl-1.6.922/t/SeqIO/seqxml.t BioPerl-1.6.922/t/SeqIO/Splicedseq.t BioPerl-1.6.922/t/SeqIO/strider.t BioPerl-1.6.922/t/SeqIO/swiss.t BioPerl-1.6.922/t/SeqIO/tab.t BioPerl-1.6.922/t/SeqIO/table.t BioPerl-1.6.922/t/SeqIO/tigr.t BioPerl-1.6.922/t/SeqIO/tigrxml.t BioPerl-1.6.922/t/SeqIO/tinyseq.t BioPerl-1.6.922/t/SeqIO/ztr.t BioPerl-1.6.922/t/SeqTools BioPerl-1.6.922/t/SeqTools/Backtranslate.t BioPerl-1.6.922/t/SeqTools/CodonTable.t BioPerl-1.6.922/t/SeqTools/ECnumber.t BioPerl-1.6.922/t/SeqTools/GuessSeqFormat.t BioPerl-1.6.922/t/SeqTools/OddCodes.t BioPerl-1.6.922/t/SeqTools/SeqPattern.t BioPerl-1.6.922/t/SeqTools/SeqStats.t BioPerl-1.6.922/t/SeqTools/SeqUtils.t BioPerl-1.6.922/t/SeqTools/SeqWords.t BioPerl-1.6.922/t/Structure BioPerl-1.6.922/t/Structure/IO.t BioPerl-1.6.922/t/Structure/Structure.t BioPerl-1.6.922/t/Tools BioPerl-1.6.922/t/Tools/AmpliconSearch.t BioPerl-1.6.922/t/Tools/ePCR.t BioPerl-1.6.922/t/Tools/Est2Genome.t BioPerl-1.6.922/t/Tools/FootPrinter.t BioPerl-1.6.922/t/Tools/Geneid.t BioPerl-1.6.922/t/Tools/Genewise.t BioPerl-1.6.922/t/Tools/Genomewise.t BioPerl-1.6.922/t/Tools/Genpred.t BioPerl-1.6.922/t/Tools/GFF.t BioPerl-1.6.922/t/Tools/GuessSeqFormat.t BioPerl-1.6.922/t/Tools/Hmmer.t BioPerl-1.6.922/t/Tools/IUPAC.t BioPerl-1.6.922/t/Tools/Lucy.t BioPerl-1.6.922/t/Tools/Match.t BioPerl-1.6.922/t/Tools/pICalculator.t BioPerl-1.6.922/t/Tools/Primer3.t BioPerl-1.6.922/t/Tools/Promoterwise.t BioPerl-1.6.922/t/Tools/Pseudowise.t BioPerl-1.6.922/t/Tools/QRNA.t BioPerl-1.6.922/t/Tools/RandDistFunctions.t BioPerl-1.6.922/t/Tools/RepeatMasker.t BioPerl-1.6.922/t/Tools/rnamotif.t BioPerl-1.6.922/t/Tools/Seg.t BioPerl-1.6.922/t/Tools/Sigcleave.t BioPerl-1.6.922/t/Tools/Signalp.t BioPerl-1.6.922/t/Tools/Sim4.t BioPerl-1.6.922/t/Tools/SiRNA.t BioPerl-1.6.922/t/Tools/TandemRepeatsFinder.t BioPerl-1.6.922/t/Tools/TargetP.t BioPerl-1.6.922/t/Tools/Tmhmm.t BioPerl-1.6.922/t/Tools/tRNAscanSE.t BioPerl-1.6.922/t/Tools/Alignment BioPerl-1.6.922/t/Tools/Alignment/Consed.t BioPerl-1.6.922/t/Tools/Analysis BioPerl-1.6.922/t/Tools/Analysis/DNA BioPerl-1.6.922/t/Tools/Analysis/DNA/ESEfinder.t BioPerl-1.6.922/t/Tools/Analysis/Protein BioPerl-1.6.922/t/Tools/Analysis/Protein/Domcut.t BioPerl-1.6.922/t/Tools/Analysis/Protein/ELM.t BioPerl-1.6.922/t/Tools/Analysis/Protein/GOR4.t BioPerl-1.6.922/t/Tools/Analysis/Protein/HNN.t BioPerl-1.6.922/t/Tools/Analysis/Protein/Mitoprot.t BioPerl-1.6.922/t/Tools/Analysis/Protein/NetPhos.t BioPerl-1.6.922/t/Tools/Analysis/Protein/Scansite.t BioPerl-1.6.922/t/Tools/Analysis/Protein/Sopma.t BioPerl-1.6.922/t/Tools/EMBOSS BioPerl-1.6.922/t/Tools/EMBOSS/Palindrome.t BioPerl-1.6.922/t/Tools/Phylo BioPerl-1.6.922/t/Tools/Phylo/Gerp.t BioPerl-1.6.922/t/Tools/Phylo/Molphy.t BioPerl-1.6.922/t/Tools/Phylo/PAML.t BioPerl-1.6.922/t/Tools/Phylo/Phylip BioPerl-1.6.922/t/Tools/Phylo/Phylip/ProtDist.t BioPerl-1.6.922/t/Tools/Run BioPerl-1.6.922/t/Tools/Run/Dummy.pm BioPerl-1.6.922/t/Tools/Run/RemoteBlast.t BioPerl-1.6.922/t/Tools/Run/RemoteBlast_rpsblast.t BioPerl-1.6.922/t/Tools/Run/StandAloneBlast.t BioPerl-1.6.922/t/Tools/Run/WBCommandExts.t BioPerl-1.6.922/t/Tools/Run/WrapperBase.t BioPerl-1.6.922/t/Tools/Run/Dummy BioPerl-1.6.922/t/Tools/Run/Dummy/Config.pm BioPerl-1.6.922/t/Tools/Signalp BioPerl-1.6.922/t/Tools/Signalp/ExtendedSignalp.t BioPerl-1.6.922/t/Tools/Spidey BioPerl-1.6.922/t/Tools/Spidey/Spidey.t BioPerl-1.6.922/t/Tree BioPerl-1.6.922/t/Tree/Compatible.t BioPerl-1.6.922/t/Tree/Node.t BioPerl-1.6.922/t/Tree/RandomTreeFactory.t BioPerl-1.6.922/t/Tree/Tree.t BioPerl-1.6.922/t/Tree/TreeIO.t BioPerl-1.6.922/t/Tree/TreeStatistics.t BioPerl-1.6.922/t/Tree/PhyloNetwork BioPerl-1.6.922/t/Tree/PhyloNetwork/Factory.t BioPerl-1.6.922/t/Tree/PhyloNetwork/GraphViz.t BioPerl-1.6.922/t/Tree/PhyloNetwork/MuVector.t BioPerl-1.6.922/t/Tree/PhyloNetwork/PhyloNetwork.t BioPerl-1.6.922/t/Tree/PhyloNetwork/RandomFactory.t BioPerl-1.6.922/t/Tree/PhyloNetwork/TreeFactory.t BioPerl-1.6.922/t/Tree/TreeIO BioPerl-1.6.922/t/Tree/TreeIO/lintree.t BioPerl-1.6.922/t/Tree/TreeIO/newick.t BioPerl-1.6.922/t/Tree/TreeIO/nexml.t BioPerl-1.6.922/t/Tree/TreeIO/nexus.t BioPerl-1.6.922/t/Tree/TreeIO/nhx.t BioPerl-1.6.922/t/Tree/TreeIO/phyloxml.t BioPerl-1.6.922/t/Tree/TreeIO/svggraph.t BioPerl-1.6.922/t/Tree/TreeIO/tabtree.t BioPerl-1.6.922/t/Variation BioPerl-1.6.922/t/Variation/AAChange.t BioPerl-1.6.922/t/Variation/AAReverseMutate.t BioPerl-1.6.922/t/Variation/Allele.t BioPerl-1.6.922/t/Variation/DNAMutation.t BioPerl-1.6.922/t/Variation/RNAChange.t BioPerl-1.6.922/t/Variation/SeqDiff.t BioPerl-1.6.922/t/Variation/SNP.t BioPerl-1.6.922/t/Variation/Variation_IO.t BioPerl-1.6.922/travis_scripts BioPerl-1.6.922/travis_scripts/dependency_installs CPAN.pm: Building C/CJ/CJFIELDS/BioPerl-1.6.922.tar.gz >>> C:\Perl-5.18\bin\perl.exe Build.PL could not find ParserDetails.ini in C:/cpanfly-5.18/var/megalib/XML/SAX Checking prerequisites... requires: ! DB_File is not installed recommends: * Algorithm::Munkres is not installed * Convert::Binary::C is not installed * GraphViz is not installed * Math::Random is not installed * PostScript::TextBlock is not installed * SOAP::Lite is not installed * SVG::Graph is not installed * YAML is not installed Checking optional features... DB_File Tests.........disabled requires: ! DB_File is not installed EntrezGene............disabled requires: ! Bio::ASN1::EntrezGene is not installed MySQL Tests...........disabled requires: ! DBD::mysql is not installed ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions of the modules indicated above before proceeding with this installation ############################# WARNING ############################# Bio::ASN1::EntrezGene not found. This is an *optional* module; however, because it has a circular dependency with BioPerl we do not include it on our list of recommended modules. If you require EntrezGene functionality, you can install Bio::ASN1::EntrezGene after BioPerl has finished installing. ############################# WARNING ############################# Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts Do you want to run tests that require connection to servers across the internet (likely to cause some failures)? y/n [n] - will not run internet-requiring tests Created MYMETA.yml and MYMETA.json Creating new 'Build' script for 'BioPerl' version '1.006922' ---- Unsatisfied dependencies detected during ---- ---- CJFIELDS/BioPerl-1.6.922.tar.gz ---- DB_File [requires] Running Build test Delayed until after prerequisites Running test for module 'DB_File' ______________________ D i s t r o P r e f s ______________________ DB_File.yml[0] Running make for P/PM/PMQS/DB_File-1.831.tar.gz Disabled via prefs file 'C:\cpanfly-5.18\etc\distroprefs\DB_File.yml' doc 0 PMQS/DB_File-1.831.tar.gz [disabled] -- NA Disabled via prefs file 'C:\cpanfly-5.18\etc\distroprefs\DB_File.yml' doc 0 Running Build for C/CJ/CJFIELDS/BioPerl-1.6.922.tar.gz Has already been unwrapped into directory C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK CPAN.pm: Building C/CJ/CJFIELDS/BioPerl-1.6.922.tar.gz Warning: Prerequisite 'DB_File => 0' for 'CJFIELDS/BioPerl-1.6.922.tar.gz' failed when processing 'PMQS/DB_File-1.831.tar.gz' with 'unwrapped => NO Disabled via prefs file 'C:\cpanfly-5.18\etc\distroprefs\DB_File.yml' doc 0'. Continuing, but chances to succeed are limited. >>> C:\Perl-5.18\bin\perl.exe ./Build Building BioPerl CJFIELDS/BioPerl-1.6.922.tar.gz C:\Perl-5.18\bin\perl.exe ./Build -- OK Running Build test >>> C:\Perl-5.18\bin\perl.exe ./Build test verbose=1 # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Align/AlignStats.t ................... 1..45 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::AlignIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::Matrix::PhylipDist' isa 'Bio::Matrix::PhylipDist' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 43 ok 44 - Warn if seqs don't overlap ok 45 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Align/AlignUtil.t .................... 1..47 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Align/Graphics.t ..................... 1..41 ok 1 - use Bio::Align::Graphics; ok 2 - require Bio::Align::Graphics; ok 3 - Bio::Align::Graphics->can(...) ok 4 - input is defined ok 5 - AlignIO object is defined ok 6 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 7 - alignment is there and defined ok 8 - all starts are present ok 9 - all ends are present ok 10 - all colors are present ok 11 - first end is further than first start ok 12 - second end is further than second start ok 13 - third end is further than third start ok 14 - domain labels are present ok 15 - domain starts are present ok 16 - domain ends are present ok 17 - domain colors are present ok 18 - label - first end is further than first start ok 19 - label - second end is further than second start ok 20 - label - third end is further than third start ok 21 - first label start is within domain range ok 22 - second label start is within domain range ok 23 - third label start is within domain range ok 24 - first label end is within domain range ok 25 - second label end is within domain range ok 26 - third label end is within domain range ok 27 - individual labels work ok 28 - An object of class 'Bio::Align::Graphics' isa 'Bio::Align::Graphics' ok 29 - new object is defined ok 30 - pad_bottom is right ok 31 - default pad_top is right ok 32 - start point loaded ok 33 - end point loaded ok 34 - color of domain loaded ok 35 - domain labels loaded ok 36 - label starts loaded ok 37 - label ends loaded ok 38 - label colors loaded ok 39 - labels loaded ok 40 - output file is png ok 41 - wrapping length is not zero ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Align/SimpleAlign.t .................. 1..206 ok 1 - use Bio::SimpleAlign; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Location::Simple; ok 5 - use Bio::Location::Split; ok 6 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 7 - pfam input test ok 8 - match_line ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - num_sequences ok 11 - num_sequences ok 12 - select_noncont ok 13 - select_noncont ok 14 - num_sequences ok 15 - select_noncont ok 16 - select_noncont ok 17 - select_noncont_by_name ok 18 - select_noncont_by_name ok 19 - select_noncont_by_name ok 20 - select_noncont_by_name ok 21 - each_seq ok 22 - get_nse ok 23 - id ok 24 - num_gaps ok 25 - each_alphabetically ok 26 - column_from_residue_number ok 27 - display_name get/set ok 28 - display_name get ok 29 - consensus_string ok 30 - consensus_string ok 31 - consensus_string ok 32 ok 33 - each_seq_with_id ok 34 - is_flush ok 35 - id get/set ok 36 - length ok 37 - num_residues ok 38 - num_sequences ok 39 - overall_percentage_identity ok 40 - overall_percentage_identity (align) ok 41 - overall_percentage_identity (short) ok 42 - overall_percentage_identity (long) ok 43 - average_percentage_identity ok 44 ok 45 - set_displayname_count ok 46 ok 47 - set_displayname_flat ok 48 ok 49 - set_displayname_normal ok 50 ok 51 ok 52 - uppercase, map_chars ok 53 - match_line ok 54 - remove_seqs ok 55 - remove_seqs ok 56 - add_seq ok 57 - add_seq ok 58 - get_seq_by_pos ok 59 - get_seq_by_pos ok 60 ok 61 ok 62 ok 63 - purge ok 64 - purge ok 65 - IO::String consensus_iupac ok 66 - IO::String write_aln normal ok 67 - IO::String write_aln slice ok 68 - IO::String write_aln slice ok 69 - IO::String write_aln slice ok 70 - IO::String write_aln slice ok 71 - IO::String write_aln slice ok 72 ok 73 - remove_columns by position ok 74 - remove_columns by position (wrong order) ok 75 - cigar_line ok 76 - cigar_line ok 77 - cigar_line ok 78 - cigar_line ok 79 - sort_alphabetically - before ok 80 ok 81 - sort_alphabetically - after ok 82 - remove_gaps ok 83 - remove_gaps all_gaps_only ok 84 - set_new_reference ok 85 - set_new_reference ok 86 - uniq_seq ok 87 - bug 2099 ok 88 - bug 2099 ok 89 - bug 2793 ok 90 - bug 2793 ok 91 - bug 2793 ok 92 - bug 2793 ok 93 - Bad sequence, bad! ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 95 - added 3 seqs ok 96 - first 2 features added ok 97 - 3rd feature added not ok 98 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 432. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 1. # Overriding value [0] with value 1 for Bio::LocatableSeq::end(). # ? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:201 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1167 # STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:432 # STACK: t/Align/SimpleAlign.t:432 # ----------------------------------------------------------- # ) ok 99 - slice 1 len ok 100 - correct masked seq ok 101 - correct masked seq ok 102 - correct masked seq not ok 103 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 432. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 3. # Overriding value [2] with value 3 for Bio::LocatableSeq::end(). # ? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:201 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1167 # STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:432 # STACK: t/Align/SimpleAlign.t:432 # ----------------------------------------------------------- # ) ok 104 - slice 2 len ok 105 - correct masked seq ok 106 - correct masked seq ok 107 - correct masked seq not ok 108 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 432. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 3. # Overriding value [1] with value 3 for Bio::LocatableSeq::end(). # ?? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:201 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1167 # STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:432 # STACK: t/Align/SimpleAlign.t:432 # ----------------------------------------------------------- # ) ok 109 - slice 3 len ok 110 - correct masked seq ok 111 - correct masked seq ok 112 - correct masked seq not ok 113 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 432. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 6. # Overriding value [4] with value 6 for Bio::LocatableSeq::end(). # ?? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:201 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1167 # STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:432 # STACK: t/Align/SimpleAlign.t:432 # ----------------------------------------------------------- # ) ok 114 - slice 4 len ok 115 - correct masked seq ok 116 - correct masked seq ok 117 - correct masked seq ok 118 - initial display id ok ok 119 - safe display id ok ok 120 - restored display id ok ok 121 - sort by list ok ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 - BIC:GGATCCATT[C/C]CTACT ok 129 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT ok 130 - BIC:G[G/C]ATCCATT[C/G]CTACT ok 131 - BIC:GGATCCATT[C/G]CTACT ok 132 - BIC:GGATCCATT[C/G]CTAC[T/A] ok 133 - BIC:GGATCCATT[C/G]CTA[C/G][T/A] ok 134 - BIC:GGATCCATT[C/G]CTACT ok 135 - BIC:GGATCCATT{C.C}CTACT ok 136 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT ok 137 - BIC:G{G.C}ATCCATT{C.G}CTACT ok 138 - BIC:GGATCCATT{C.G}CTACT ok 139 - BIC:GGATCCATT{C.G}CTAC{T.A} ok 140 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A} ok 141 - BIC:GGATCCATT{C.G}CTACT ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 200 - consensus string looks ok ok 201 - conservation length ok 202 - conservation scores ok 203 - looks like correct unmasked alignment (from clustalw) ok 204 - looks like correct masked alignment (from clustalw) ok 205 ok 206 - align after looks ok ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Align/TreeBuild.t .................... 1..13 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::Align::Utilities; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Tree::DistanceFactory; ok 6 - use Bio::TreeIO; ok 7 - 'SimpleAlign object parsed out' isa 'Bio::SimpleAlign' ok 8 - 'Protein distance matrix retrieved' isa 'Bio::Matrix::MatrixI' ok 9 - 'Tree object gotten back' isa 'Bio::Tree::TreeI' ok 10 - NJ calculated Branch length ok 11 - NJ calculated Branch length ok 12 - Make sure two nodes are sister ok 13 - 10 replicates formulated ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Align/Utilities.t .................... 1..13 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::SimpleAlign; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::AlignIO; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/AlignIO.t .................... 1..29 ok 1 - use Bio::AlignIO; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 3 - input filehandle method test : msf ok 4 - input filehandle method test : mase ok 5 - input filehandle method test : pfam ok 6 - input filehandle method test : phylip ok 7 - input filehandle method test : selex ok 8 - input filehandle method test : xmfa ok 9 - input filehandle method test : stockholm ok 10 - input filehandle method test : po ok 11 - input filehandle method test : prodom ok 12 - input filehandle method test : metafasta ok 13 - input filehandle method test : arp ok 14 - input filehandle method test : clustalw ok 15 - input filehandle method test : psi ok 16 - input filehandle method test : fasta ok 17 - input filehandle method test : nexus ok 18 - filehandle output test : msf ok 19 - filehandle output test : pfam ok 20 - filehandle output test : phylip ok 21 - filehandle output test : selex ok 22 - filehandle output test : xmfa ok 23 - filehandle output test : stockholm ok 24 - filehandle output test : po ok 25 - filehandle output test : metafasta ok 26 - filehandle output test : clustalw ok 27 - filehandle output test : psi ok 28 - filehandle output test : fasta ok 29 - filehandle output test : nexus ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/arp.t ........................ 1..48 ok 1 - use Bio::AlignIO::arp; ok 2 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 - ARP get_nse() ok 5 ok 6 - ARP num_sequences() ok 7 - ARP id() ok 8 - ARP description() ok 9 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 10 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 - ARP get_nse() ok 18 - ARP num_sequences() ok 19 - ARP id() ok 20 - ARP description() ok 21 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 22 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 23 ok 24 ok 25 ok 26 ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - ARP get_nse() ok 29 - ARP num_sequences() ok 30 - ARP id() ok 31 - ARP description() ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 33 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 34 ok 35 ok 36 ok 37 ok 38 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 39 - ARP get_nse() ok 40 - ARP num_sequences() ok 41 - ARP id() ok 42 - ARP description() ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 44 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 45 ok 46 ok 47 ok 48 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/bl2seq.t ..................... 1..3 ok 1 - use Bio::AlignIO::bl2seq; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - BLAST bl2seq format test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/clustalw.t ................... 1..6 ok 1 - use Bio::AlignIO::clustalw; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - clustalw consensus_string test ok 4 - clustalw (.aln) output test ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - clustalw (.aln) input test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/emboss.t ..................... 1..37 ok 1 - use Bio::AlignIO::emboss; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 19 ok 20 ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 33 ok 34 ok 35 ok 36 ok 37 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/fasta.t ...................... 1..10 ok 1 - use Bio::AlignIO::fasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for end ok 7 - fasta input test for description ok 8 - fasta output test ok 9 - filehandle input test ok 10 - filehandle output test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/largemultifasta.t ............ 1..7 ok 1 - use Bio::AlignIO::largemultifasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for description ok 7 - fasta output test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/maf.t ........................ 1..11 ok 1 - use Bio::AlignIO::maf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - maf input test ok 4 ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - maf input test ok 7 ok 8 - maf input test ok 9 ok 10 - maf input test ok 11 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/mase.t ....................... 1..3 ok 1 - use Bio::AlignIO::mase; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - mase input test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/mega.t ....................... 1..6 ok 1 - use Bio::AlignIO::mega; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 - mega output test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/meme.t ....................... 1..20 ok 1 - use Bio::AlignIO::meme; ok 2 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 ok 18 ok 19 ok 20 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/metafasta.t .................. 1..4 ok 1 - use Bio::AlignIO::metafasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - consensus_string on metafasta ok 4 - symbol_chars() using metafasta ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/msf.t ........................ 1..4 ok 1 - use Bio::AlignIO::msf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - msf input test ok 4 - msf output test ok t/AlignIO/nexml.t ...................... skipped: The optional module Bio::Phylo (or dependencies thereof) was not installed # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/nexus.t ...................... 1..43 ok 1 - use Bio::AlignIO::nexus; ok 2 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - nexus output test ok 6 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 11 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 12 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 15 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 16 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 20 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 23 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 24 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 25 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 26 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 33 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 34 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 35 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 36 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 40 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 41 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 42 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 43 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/pfam.t ....................... 1..5 ok 1 - use Bio::AlignIO::pfam; ok 2 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - pfam output test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/phylip.t ..................... 1..17 ok 1 - use Bio::AlignIO::phylip; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 - phylip output test ok 12 ok 13 ok 14 not ok 15 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 81. # got: undef # expected: '0' not ok 16 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 82. # got: '50' # expected: '47' ok 17 - newline between header and sequences is parsed correctly ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/po.t ......................... 1..11 ok 1 - use Bio::AlignIO::po; ok 2 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 6 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 7 - po output test ok 8 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/prodom.t ..................... 1..3 ok 1 - use Bio::AlignIO::prodom; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - prodom input test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/psi.t ........................ 1..5 ok 1 - use Bio::AlignIO::psi; ok 2 - An object of class 'Bio::AlignIO::psi' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/selex.t ...................... 1..4 ok 1 - use Bio::AlignIO::selex; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - selex format test ok 4 - selex output test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/stockholm.t .................. 1..87 ok 1 - use Bio::AlignIO::stockholm; ok 2 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 10 - Stockholm annotation ok 11 - Stockholm annotation ok 12 - stockholm output test ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 - 'Stockholm annotation' isa 'Bio::Annotation::Reference' ok 21 - Stockholm annotation ok 22 - Stockholm annotation ok 23 - Stockholm annotation ok 24 - Stockholm annotation ok 25 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 26 - Rfam meta data ok 27 - Rfam meta data ok 28 ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 36 - Rfam meta data ok 37 - Rfam meta data ok 38 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO' ok 39 ok 40 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 41 ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 46 - Pfam annotation ok 47 ok 48 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 49 ok 50 ok 51 ok 52 ok 53 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 60 - Pfam aln meta data ok 61 - Pfam aln meta data ok 62 - Pfam aln meta data ok 63 - Pfam aln meta data ok 64 - Pfam aln meta data ok 65 - Pfam aln meta data ok 66 - Pfam seq meta data ok 67 - Pfam seq meta data ok 68 - Pfam seq meta data ok 69 - Pfam seq meta data ok 70 ok 71 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI' ok 72 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta' ok 73 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 74 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::DBLink' ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/AlignIO/xmfa.t ....................... 1..30 ok 1 - use Bio::AlignIO::xmfa; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - xmfa input test ok 4 - xmfa input test for start ok 5 - xmfa input test for end ok 6 - xmfa strand test ok 7 - xmfa input test for id ok 8 - xmfa input test for id ok 9 - xmfa input test ok 10 - xmfa input test for start ok 11 - xmfa input test for end ok 12 - xmfa strand test ok 13 - xmfa input test for id ok 14 - xmfa input test for id ok 15 - xmfa input test ok 16 - xmfa input test for start ok 17 - xmfa input test for end ok 18 - xmfa strand test ok 19 - xmfa input test for id ok 20 - xmfa input test for id ok 21 - xmfa alignment score ok 22 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 23 - xmfa input test ok 24 - xmfa strand ok 25 - xmfa input test for description ok 26 - xmfa input test for id ok 27 - xmfa input test for end ok 28 - xmfa input test for end ok 29 - xmfa alignment score ok 30 - xmfa output test ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Alphabet.t ........................... 1..100 ok 1 - use Bio::Symbol::Alphabet; ok 2 - use Bio::Symbol::Symbol; ok 3 - use Bio::Symbol::DNAAlphabet; ok 4 - use Bio::Symbol::ProteinAlphabet; ok 5 - An object of class 'Bio::Symbol::Alphabet' isa 'Bio::Symbol::Alphabet' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Symbol::DNAAlphabet' isa 'Bio::Symbol::AlphabetI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - An object of class 'Bio::Symbol::ProteinAlphabet' isa 'Bio::Symbol::AlphabetI' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Annotation/Annotation.t .............. 1..152 ok 1 - use Bio::Annotation::Collection; ok 2 - use Bio::Annotation::DBLink; ok 3 - use Bio::Annotation::Comment; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Target; ok 7 - use Bio::Annotation::AnnotationFactory; ok 8 - use Bio::Annotation::StructuredValue; ok 9 - use Bio::Annotation::TagTree; ok 10 - use Bio::Annotation::Tree; ok 11 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::AnnotationI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::AnnotationI' ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 23 ok 24 ok 25 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 26 ok 27 - An object of class 'Bio::Annotation::Reference' isa 'Bio::AnnotationI' ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::AnnotationI' ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 66 ok 67 ok 68 ok 69 ok 70 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::Annotation::StructuredValue' ok 71 ok 72 ok 73 ok 74 ok 75 - use Bio::Annotation::OntologyTerm; ok 76 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::Term' ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 83 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 84 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 85 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 86 - An object of class 'Bio::Annotation::AnnotationFactory' isa 'Bio::Factory::ObjectFactoryI' ok 87 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 88 ok 89 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Annotation::OntologyTerm' ok 90 - Bio::Annotation::Comment ok 91 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 92 ok 93 - Bio::Annotation::Comment ok 94 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 95 - Bio::Annotation::Comment ok 96 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 97 ok 98 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::Target' ok 99 ok 100 ok 101 - An object of class 'Bio::Annotation::Tree' isa 'Bio::AnnotationI' ok 102 - tree_id() ok 103 - tagname() ok 104 ok 105 - add tree to AlignI ok 106 - get seq from node id ok 107 ok 108 - An object of class 'Bio::Annotation::Tree' isa 'Bio::Annotation::Tree' ok 109 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 110 - default itext ok 111 - roundtrip ok 112 - itext ok 113 - spxr ok 114 - indent ok 115 - xml ok 116 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 117 ok 118 - child changes ok 119 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 120 ok 121 - child changes ok 122 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 123 ok 124 - child changes ok 125 - child changes in parent node ok 126 - no tags ok 127 - before Stag node ok 128 - after Stag node ok 129 - both stag nodes ok 130 - different instances ok 131 - before TagTree ok 132 - after TagTree ok 133 - both stag nodes ok 134 - different instances ok 135 - before TagTree ok 136 - after TagTree ok 137 - stag nodes ok 138 - same instance ok 139 - before TagTree ok 140 - after TagTree ok 141 - stag nodes ok 142 - different instance ok 143 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 144 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 145 - child changes ok 146 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 147 - child changes ok 148 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 149 - child changes ok 150 ok 151 ok 152 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::Annotation::TagTree' ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Annotation/AnnotationAdaptor.t ....... 1..23 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::AnnotationAdaptor; ok 3 - use Bio::Annotation::DBLink; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 Bio::Assembly::IO: could not load tigr - for more details on supported formats please see the Assembly::IO docs Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::Assembly::IO::tigr. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio/SeqFeature/Collection.pm line 146. BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146. Compilation failed in require at Bio/Assembly/Singlet.pm line 91. BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91. Compilation failed in require at Bio\Assembly\IO\tigr.pm line 237. BEGIN failed--compilation aborted at Bio\Assembly\IO\tigr.pm line 237. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:309 STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:138 STACK: t/Assembly/ContigSpectrum.t:13 ----------------------------------------------------------- # Failed test 'undef isa 'Bio::Assembly::IO'' # at t/Assembly/ContigSpectrum.t line 17. # undef isn't defined Can't call method "next_assembly" on an undefined value at t/Assembly/ContigSpectrum.t line 18. # Looks like you planned 239 tests but ran 3. # Looks like you failed 1 test of 3 run. # Looks like your test exited with 2 just after 3. t/Assembly/ContigSpectrum.t ............ 1..239 ok 1 - use Bio::Assembly::IO; ok 2 - use Bio::Assembly::Tools::ContigSpectrum; not ok 3 - undef isa 'Bio::Assembly::IO' Dubious, test returned 2 (wstat 512, 0x200) Failed 237/239 subtests t/Assembly/IO/bowtie.t ................. skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/IO/sam.t .................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/core.t ...................... skipped: The optional module DB_File (or dependencies thereof) was not installed # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Cluster/UniGene.t .................... 1..2 ok 1 - use Bio::Cluster::UniGene; ok 2 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::AnnotatableI' ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/ClusterIO/ClusterIO.t ................ 1..12 ok 1 - use Bio::ClusterIO; ok 2 - use Bio::Cluster::ClusterFactory; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok 12 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/ClusterIO/SequenceFamily.t ........... 1..17 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Cluster::SequenceFamily; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/ClusterIO/unigene.t .................. 1..73 ok 1 - use Bio::ClusterIO; ok 2 - new Bio::ClusterIO object defined ok 3 ok 4 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok 5 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::ClusterI' ok 6 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::IdentifiableI' ok 7 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::DescribableI' ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 49 ok 50 ok 51 - annotation object defined ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 67 ok 68 - next cluster ok 69 ok 70 ok 71 ok 72 ok 73 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Coordinate/CoordinateBoundaryTest.t .. 1..174 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 ok 4 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 5 ok 6 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 7 ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 9 ok 10 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 11 ok 12 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 33 ok 34 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 35 ok 36 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 51 ok 52 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 53 ok 54 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 69 ok 70 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 71 ok 72 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 89 ok 90 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 91 ok 92 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 109 ok 110 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 111 ok 112 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 113 ok 114 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 115 ok 116 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 133 ok 134 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 143 ok 144 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 153 ok 154 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 165 ok 166 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Coordinate/CoordinateGraph.t ......... 1..7 ok 1 - use Bio::Coordinate::Graph; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Coordinate/CoordinateMapper.t ........ 1..175 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::Result::Match; ok 4 - use Bio::Coordinate::Result::Gap; ok 5 - use Bio::Coordinate::Chain; ok 6 - use Bio::Coordinate::Collection; ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 15 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Location::SplitLocationI' ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::LocationI' ok 20 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match' ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::Coordinate::Result::Gap' ok 38 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::LocationI' ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match' ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Match: |314696| Test: 314696| ok 139 ok 140 ok 141 ok 142 - Match: |341| Test: 341| ok 143 ok 144 ok 145 ok 146 - Match: |315843| Test: 315843| ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - Match: |627011| Test: 627011| ok 153 ok 154 ok 155 ok 156 - Match: |chr1| Test: chr1| ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Coordinate/GeneCoordinateMapper.t .... 1..116 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::ExtrapolatingPair; ok 4 - use Bio::Coordinate::GeneMapper; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple' ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple' ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Draw/Pictogram.t ..................... 1..6 ok 1 - use Bio::Draw::Pictogram; ok 2 - use Bio::SeqIO; ok 3 - use Bio::Matrix::PSM::IO; ok 4 - An object of class 'Bio::Draw::Pictogram' isa 'Bio::Draw::Pictogram' ok 5 ok 6 ok t/LiveSeq/Chain.t ...................... 1..45 ok 1 - use Bio::LiveSeq::Chain; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LiveSeq/LiveSeq.t .................... 1..48 ok 1 - use Bio::LiveSeq::IO::BioPerl; ok 2 ok 3 ok 4 - Bio::LiveSeq::Gene ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LiveSeq/Mutation.t ................... 1..19 ok 1 - use Bio::LiveSeq::Mutation; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LiveSeq/Mutator.t .................... 1..24 ok 1 - use Bio::LiveSeq::Mutator; ok 2 - use Bio::LiveSeq::IO::BioPerl; ok 3 - use Bio::Variation::IO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/LocalDB/BioDBGFF.t ................... skipped: Not compatible with your Operating System # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 # Failed test at t/LocalDB/Fasta.t line 185. # Failed test at t/LocalDB/Fasta.t line 197. # Structures begin differing at: # $got->[1] = '123' # $expected->[1] = '194473622' # Failed test at t/LocalDB/Fasta.t line 198. # got: 'gi|352962148|ref|NM_001251825.1|' # expected: undef # Failed test at t/LocalDB/Fasta.t line 208. # Structures begin differing at: # $got->[1] = '123' # $expected->[1] = '194473622' # Failed test at t/LocalDB/Fasta.t line 209. # got: 'gi|352962148|ref|NM_001251825.1|' # expected: undef # Looks like you failed 5 tests of 107. t/LocalDB/Fasta.t ...................... 1..107 ok 1 - Index a directory ok 2 ok 3 - An object of class 'Bio::DB::Fasta' isa 'Bio::DB::Fasta' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 29 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - bug 3126 ok 38 ok 39 ok 40 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 41 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 46 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 47 ok 48 ok 49 - use Class::Unload; ok 50 - Re-open an existing index ok 51 ok 52 - Tied hash access ok 53 ok 54 ok 55 ok 56 ok 57 - Writing with SeqIO ok 58 ok 59 ok 60 - Index a single file ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 not ok 86 ok 87 ok 88 - Make single ID not ok 89 not ok 90 ok 91 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 92 - Make multiple IDs, bug \#3389 not ok 93 not ok 94 ok 95 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 96 - Index a set of files ok 97 ok 98 ok 99 ok 100 ok 101 - threw Regexp ((?^:FASTA header doesn't match)) ok 102 - threw Regexp ((?^:Blank lines can only precede header lines)) ok 103 ok 104 - length is correct in sequences past spaces ok 105 ok 106 - subseq is correct ok 107 - subseq is correct Dubious, test returned 5 (wstat 1280, 0x500) Failed 5/107 subtests t/LocalDB/Flat.t ....................... skipped: The optional module DB_File (or dependencies thereof) was not installed # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LocalDB/Index/Blast.t ................ 1..26 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::Blast; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 --------------------- WARNING --------------------- MSG: overwriting a current value stored for SP130_MOUSE --------------------------------------------------- --------------------- WARNING --------------------- MSG: overwriting a current value stored for SDS3_MOUSE --------------------------------------------------- --------------------- WARNING --------------------- MSG: overwriting a current value stored for IKZF1_MOUSE --------------------------------------------------- t/LocalDB/Index/BlastTable.t ........... 1..27 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::BlastTable; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/LocalDB/Index/Index.t ................ skipped: The optional module DB_File (or dependencies thereof) was not installed # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LocalDB/Qual.t ....................... 1..56 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 - An object of class 'Bio::DB::Qual' isa 'Bio::DB::Qual' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 23 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 38 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 43 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 49 ok 50 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 51 ok 52 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 53 ok 54 ok 55 ok 56 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LocalDB/Registry.t ................... 1..14 ok 1 - use Bio::DB::Registry; ok 2 - use Bio::DB::Flat; ok 3 ok 4 # skip The optional module DB_File (or dependencies thereof) was not installed ok 5 # skip The optional module DB_File (or dependencies thereof) was not installed ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 # Failed test 'use Bio::DB::SeqFeature::Store::GFF3Loader;' # at t/LocalDB/SeqFeature.t line 16. # Tried to use 'Bio::DB::SeqFeature::Store::GFF3Loader'. # Error: Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . .. ./t/lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio/DB/SeqFeature/Store/LoadHelper.pm line 37. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/LoadHelper.pm line 37. # Compilation failed in require at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72. # Compilation failed in require at t/LocalDB/SeqFeature.t line 16. # BEGIN failed--compilation aborted at t/LocalDB/SeqFeature.t line 16. # Looks like you failed 1 test of 116. t/LocalDB/SeqFeature.t ................. 1..116 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::DB::SeqFeature::Store; not ok 3 - use Bio::DB::SeqFeature::Store::GFF3Loader; ok 4 - use Bio::Root::IO; ok 5 - use Bio::DB::Fasta; ok 6 - use File::Copy; ok 7 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 8 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 9 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 10 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 11 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 12 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 13 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 14 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 15 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 16 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 17 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 18 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 19 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 20 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 21 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 22 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 23 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 24 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 25 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 26 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 27 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 28 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 29 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 30 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 31 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 32 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 33 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 34 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 35 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 36 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 37 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 38 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 39 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 40 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 41 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 42 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 43 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 44 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 45 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 46 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 47 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 48 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 49 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 50 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 51 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 52 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 53 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 54 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 55 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 56 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 57 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 58 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 59 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 60 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 61 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 62 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 63 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 64 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 65 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 66 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 67 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 68 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 69 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 70 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 71 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 72 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 73 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 74 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 75 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 76 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 77 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 78 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 79 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 80 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 81 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 82 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 83 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 84 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 85 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 86 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 87 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 88 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 89 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 90 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 91 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 92 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 93 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 94 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 95 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 96 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 97 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 98 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 99 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 100 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 101 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 102 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 103 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 104 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 105 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 106 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 107 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 108 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 109 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 110 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 111 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 112 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 113 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 114 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 115 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # ok 116 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted. # Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124. # Compilation failed in require at (eval 142) line 2. # at t/LocalDB/SeqFeature.t line 32. # Dubious, test returned 1 (wstat 256, 0x100) Failed 1/116 subtests (less 110 skipped subtests: 5 okay) # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LocalDB/Taxonomy/greengenes.t ........ 1..38 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::greengenes' ok 5 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/LocalDB/Taxonomy/silva.t ............. 1..42 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::silva' ok 5 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio\DB\Taxonomy\flatfile.pm line 88. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 88. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:294 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:118 STACK: t/LocalDB/transfac_pro.t:18 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio\DB\Taxonomy\flatfile.pm line 88. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 88. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:294 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:118 STACK: t/LocalDB/transfac_pro.t:18 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio\DB\TFBS\transfac_pro.pm line 118. BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151 STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130 STACK: t/LocalDB/transfac_pro.t:25 ----------------------------------------------------------- Bio::DB::TFBS: transfac_pro cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio\DB\TFBS\transfac_pro.pm line 118. BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151 STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130 STACK: t/LocalDB/transfac_pro.t:25 ----------------------------------------------------------- For more information about the Bio::DB::TFBS system please see the Bio::DB::TFBS docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/LocalDB/transfac_pro.t line 25. Can't call method "get_reference_ids" on an undefined value at t/LocalDB/transfac_pro.t line 33. # Looks like you planned 115 tests but ran 4. # Looks like you failed 1 test of 4 run. # Looks like your test exited with 2 just after 4. t/LocalDB/transfac_pro.t ............... 1..115 ok 1 - use Bio::Matrix::PSM::IO; ok 2 - use Bio::DB::TFBS; ok 3 - use Bio::DB::Taxonomy; not ok 4 Dubious, test returned 2 (wstat 512, 0x200) Failed 112/115 subtests # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Map/Cyto.t ........................... 1..110 ok 1 - use Bio::Map::CytoMap; ok 2 - use Bio::Map::CytoPosition; ok 3 - use Bio::Map::CytoMarker; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Map::CytoPosition' isa 'Bio::Map::CytoPosition' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Range' isa 'Bio::Range' ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Map/Linkage.t ........................ 1..18 ok 1 - use Bio::Map::LinkagePosition; ok 2 - use Bio::Map::Microsatellite; ok 3 - use Bio::Map::LinkageMap; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Map/Map.t ............................ 1..267 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Marker; ok 3 - use Bio::Map::Position; ok 4 - use Bio::Map::Relative; ok 5 - use Bio::Map::Mappable; ok 6 ok 7 ok 8 ok 9 ok 10 - Length is 0 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 - use Bio::Map::Gene; ok 152 - use Bio::Map::GeneMap; ok 153 - use Bio::Map::TranscriptionFactor; ok 154 - use Bio::Map::GeneRelative; ok 155 - use Bio::Map::GenePosition; ok 156 - use Bio::Map::Prediction; ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Map/MapIO.t .......................... 1..51 ok 1 - use Bio::MapIO; ok 2 ok 3 - An object of class 'Bio::Map::SimpleMap' isa 'Bio::Map::MapI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Map/MicrosatelliteMarker.t ........... 1..8 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Position; ok 3 - use Bio::Map::Microsatellite; ok 4 ok 5 ok 6 ok 7 ok 8 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Map/Physical.t ....................... 1..40 ok 1 - use Bio::Map::Physical; ok 2 - use Bio::MapIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - code holds and returns a string, definition requires a boolean ok 13 - code holds and returns a string, definition requires a boolean ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 not ok 40 # TODO Possible hash randomization-related bug, sum of contig pos values sometimes fails with off-by-one # Failed (TODO) test at t/Map/Physical.t line 101. # got: '1248' # expected: '1249' ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/IO/masta.t .................... 1..16 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/IO/psm.t ...................... 1..63 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/InstanceSite.t ................ 1..6 ok 1 - use Bio::Matrix::PSM::InstanceSite; ok 2 ok 3 ok 4 ok 5 ok 6 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/Matrix.t ...................... 1..77 ok 1 - use Bio::Matrix::Generic; ok 2 - use Bio::Matrix::IO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/ProtMatrix.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::ProtMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/ProtPsm.t ..................... 1..14 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 # skip TODO: Module incomplete ok 6 # skip TODO: Module incomplete ok 7 # skip TODO: Module incomplete ok 8 # skip TODO: Module incomplete ok 9 # skip TODO: Module incomplete ok 10 # skip TODO: Module incomplete ok 11 # skip TODO: Module incomplete ok 12 # skip TODO: Module incomplete ok 13 # skip TODO: Module incomplete ok 14 # skip TODO: Module incomplete ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Matrix/SiteMatrix.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::SiteMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/GOterm.t .................... 1..62 ok 1 - use Bio::Ontology::GOterm; ok 2 - use Bio::Ontology::Ontology; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/GraphAdaptor.t .............. 1..28 ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/IO/go.t ..................... 1..102 ok 1 - use Bio::OntologyIO; ok 2 ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::OntologyI' ok 4 ok 5 - An object of class 'Bio::Ontology::OBOEngine' isa 'Bio::Ontology::OntologyEngineI' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/IO/interpro.t ............... 1..69 ok 1 - use Bio::OntologyIO; ok 2 - An object of class 'Bio::OntologyIO::InterProParser' isa 'Bio::OntologyIO::InterProParser' ok 3 ok 4 - get_dbxrefs on leaf terms is non-empty ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty ok 11 - get_members on leaf terms is non-empty ok 12 - class_list on leaf terms is non-empty ok 13 - get_examples on leaf terms is non-empty ok 14 - get_external_documents on leaf terms is non-empty ok 15 - get_references on leaf terms is non-empty ok 16 - protein_count on leaf terms is non-empty ok 17 - to_string looks reasonable ok 18 - There are 8 root InterPro terms ok 19 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 20 - term Repeat in ontology InterPro ok 21 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 22 - term Conserved Site in ontology InterPro ok 23 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 24 - term Active Site in ontology InterPro ok 25 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 26 - term Integrins alpha chain in ontology InterPro ok 27 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 28 - term Helix-turn-helix, AraC type in ontology InterPro ok 29 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 30 - term post-translational modification in ontology InterPro ok 31 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 32 - term Kringle in ontology InterPro ok 33 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 34 - term Cdc20/Fizzy in ontology InterPro ok 35 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 36 - term Binding Site in ontology InterPro ok 37 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 38 - term Region in ontology InterPro ok 39 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 40 - term Active Site in ontology InterPro ok 41 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 42 - term Binding Site in ontology InterPro ok 43 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 44 - term Conserved Site in ontology InterPro ok 45 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 46 - term Domain in ontology InterPro ok 47 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 48 - term Family in ontology InterPro ok 49 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 50 - term Region in ontology InterPro ok 51 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 52 - term Repeat in ontology InterPro ok 53 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 54 - term post-translational modification in ontology InterPro ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Integrins alpha chain term has one parent ok 62 - Integrins alpha chain term has one ancestor ok 63 - Helix-turn-helix, AraC type term has one parent ok 64 - Helix-turn-helix, AraC type term has one ancestor ok 65 - Kringle term has one parent ok 66 - Kringle term has one ancestor ok 67 - Cdc20/Fizzy term has one parent ok 68 - Cdc20/Fizzy term has one ancestor ok 69 - secondary accession map has 2 keys ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/IO/obo.t .................... 1..92 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 47 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 48 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 49 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 50 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 51 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 52 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 53 - Gene ontology ok 54 - biological process ok 55 - molecular function ok 56 - Got root ok 57 - Got root ok 58 - Got regulates # from gene_ontology ok 59 - Got # positively regulates from gene_ontology ok 60 - Got # regulates from biological_process ok 61 - Got # positively regulates from biological_process ok 62 - Got predicates for gene_ontology ok 63 - Got predicates for biological_process ok 64 - Got regulates predicate ok 65 - Got positively regulates predicate ok 66 - Got relationships for biological_process ok 67 - Got relationships for molecular_function ok 68 - Got is a relationship from # molecular_function ok 69 - 'Got term object' isa 'Bio::Ontology::Term' ok 70 - Got term id ok 71 - Got term name ok 72 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 73 - Got regulated term1 id ok 74 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 75 - Got back the child ok 76 - 'Got term object' isa 'Bio::Ontology::Term' ok 77 - Got term id ok 78 - Got term name ok 79 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 80 - Got regulated term1 id ok 81 - Got identical regulation ok 82 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 83 - Got back the child ok 84 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/Ontology.t .................. 1..55 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - Interpro XML file interpro.xml can be parsed ok 54 - Interpro XML file interpro_sample.xml can be parsed ok 55 - Interpro XML file interpro_relationship.xml can be parsed ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/OntologyEngine.t ............ 1..31 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::Relationship; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - use Bio::Ontology::SimpleOntologyEngine; ok 5 - use Bio::Ontology::Ontology; ok 6 - An object of class 'Bio::Ontology::SimpleOntologyEngine' isa 'Bio::Ontology::OntologyEngineI' ok 7 ok 8 - adding a relationship with an undef object term fails ok 9 - adding a relationship with an undef object term fails ok 10 - adding a relationship with an undef subject term fails ok 11 - adding a relationship with an undef subject term fails ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/Ontology/OntologyStore.t ............. skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/Relationship.t .............. 1..12 ok 1 - use Bio::Ontology::Relationship; ok 2 - use Bio::Ontology::GOterm; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 5 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 6 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 7 - An object of class 'Bio::Ontology::Relationship' isa 'Bio::Ontology::Relationship' ok 8 ok 9 ok 10 ok 11 ok 12 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/RelationshipType.t .......... 1..23 ok 1 - use Bio::Ontology::RelationshipType; ok 2 - use Bio::Ontology::Ontology; ok 3 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Ontology/Term.t ...................... 1..54 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::TermFactory; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 45 ok 46 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::TermI' ok 47 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Ontology::TermI' ok 51 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::AnnotationI' ok 52 ok 53 ok 54 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Perl.t ............................... 1..31 ok 1 - use Bio::Perl; ok 2 ok 3 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 4 ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI' ok 6 ok 7 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 8 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 9 ok 10 ok 11 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 12 ok 13 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 14 ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 16 ok 17 ok 18 ok 19 ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/Correlate.t ................ 1..17 ok 1 - use Bio::Phenotype::Correlate; ok 2 - use Bio::Species; ok 3 - An object of class 'Bio::Phenotype::Correlate' isa 'Bio::Phenotype::Correlate' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/MeSH.t ..................... 1..24 ok 1 - use Bio::Phenotype::MeSH::Term; ok 2 - use Bio::Phenotype::MeSH::Twig; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/Measure.t .................. 1..21 ok 1 - use Bio::Phenotype::Measure; ok 2 - An object of class 'Bio::Phenotype::Measure' isa 'Bio::Phenotype::Measure' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/MiniMIMentry.t ............. 1..15 ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 2 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/OMIMentry.t ................ 1..153 ok 1 - use Bio::Phenotype::OMIM::OMIMentry; ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 3 - use Bio::Species; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Map::CytoPosition; ok 6 - use Bio::Phenotype::Correlate; ok 7 - use Bio::Phenotype::Measure; ok 8 - use Bio::Annotation::DBLink; ok 9 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - operator overloading in AnnotationI is deprecated ok 80 - operator overloading in AnnotationI is deprecated ok 81 ok 82 ok 83 - operator overloading in AnnotationI is deprecated ok 84 - operator overloading in AnnotationI is deprecated ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - operator overloading in AnnotationI is deprecated ok 137 - operator overloading in AnnotationI is deprecated ok 138 ok 139 ok 140 - operator overloading in AnnotationI is deprecated ok 141 - operator overloading in AnnotationI is deprecated ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/OMIMentryAllelicVariant.t .. 1..27 ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant; ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' isa 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/OMIMparser.t ............... 1..175 ok 1 - use Bio::Phenotype::OMIM::OMIMparser; ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMparser' isa 'Bio::Phenotype::OMIM::OMIMparser' ok 3 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - missing linebreak caught ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Phenotype/Phenotype.t ................ 1..116 ok 1 - use Bio::Phenotype::Phenotype; ok 2 - use Bio::Species; ok 3 - use Bio::Annotation::Reference; ok 4 - use Bio::Map::CytoPosition; ok 5 - use Bio::Phenotype::Correlate; ok 6 - use Bio::Phenotype::Measure; ok 7 - use Bio::Annotation::DBLink; ok 8 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::PhenotypeI' ok 9 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::Phenotype' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - operator overloading in AnnotationI is deprecated ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 - operator overloading in AnnotationI is deprecated ok 47 - operator overloading in AnnotationI is deprecated ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - operator overloading in AnnotationI is deprecated ok 100 - operator overloading in AnnotationI is deprecated ok 101 ok 102 ok 103 - operator overloading in AnnotationI is deprecated ok 104 - operator overloading in AnnotationI is deprecated ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/PodSyntax.t .......................... 1..953 ok 1 - POD test for Bio/AlignIO.pm ok 2 - POD test for Bio/AnalysisI.pm ok 3 - POD test for Bio/AnalysisParserI.pm ok 4 - POD test for Bio/AnalysisResultI.pm ok 5 - POD test for Bio/AnnotatableI.pm ok 6 - POD test for Bio/AnnotationCollectionI.pm ok 7 - POD test for Bio/AnnotationI.pm ok 8 - POD test for Bio/ClusterI.pm ok 9 - POD test for Bio/ClusterIO.pm ok 10 - POD test for Bio/DasI.pm ok 11 - POD test for Bio/DBLinkContainerI.pm ok 12 - POD test for Bio/DescribableI.pm ok 13 - POD test for Bio/FeatureHolderI.pm ok 14 - POD test for Bio/HandlerBaseI.pm ok 15 - POD test for Bio/IdCollectionI.pm ok 16 - POD test for Bio/IdentifiableI.pm ok 17 - POD test for Bio/LocatableSeq.pm ok 18 - POD test for Bio/LocationI.pm ok 19 - POD test for Bio/MapIO.pm ok 20 - POD test for Bio/NexmlIO.pm ok 21 - POD test for Bio/OntologyIO.pm ok 22 - POD test for Bio/ParameterBaseI.pm ok 23 - POD test for Bio/Perl.pm ok 24 - POD test for Bio/PhyloNetwork.pm ok 25 - POD test for Bio/PrimarySeq.pm ok 26 - POD test for Bio/PrimarySeqI.pm ok 27 - POD test for Bio/PullParserI.pm ok 28 - POD test for Bio/Range.pm ok 29 - POD test for Bio/RangeI.pm ok 30 - POD test for Bio/SearchDist.pm ok 31 - POD test for Bio/SearchIO.pm ok 32 - POD test for Bio/Seq.pm ok 33 - POD test for Bio/SeqAnalysisParserI.pm ok 34 - POD test for Bio/SeqFeatureI.pm ok 35 - POD test for Bio/SeqI.pm ok 36 - POD test for Bio/SeqIO.pm ok 37 - POD test for Bio/SeqUtils.pm ok 38 - POD test for Bio/SimpleAlign.pm ok 39 - POD test for Bio/SimpleAnalysisI.pm ok 40 - POD test for Bio/Species.pm ok 41 - POD test for Bio/Taxon.pm ok 42 - POD test for Bio/Taxonomy.pm ok 43 - POD test for Bio/TreeIO.pm ok 44 - POD test for Bio/UpdateableSeqI.pm ok 45 - POD test for Bio/WebAgent.pm ok 46 - POD test for Bio/Align/AlignI.pm ok 47 - POD test for Bio/Align/DNAStatistics.pm ok 48 - POD test for Bio/Align/Graphics.pm ok 49 - POD test for Bio/Align/PairwiseStatistics.pm ok 50 - POD test for Bio/Align/ProteinStatistics.pm ok 51 - POD test for Bio/Align/StatisticsI.pm ok 52 - POD test for Bio/Align/Utilities.pm ok 53 - POD test for Bio/AlignIO/arp.pm ok 54 - POD test for Bio/AlignIO/bl2seq.pm ok 55 - POD test for Bio/AlignIO/clustalw.pm ok 56 - POD test for Bio/AlignIO/emboss.pm ok 57 - POD test for Bio/AlignIO/fasta.pm ok 58 - POD test for Bio/AlignIO/largemultifasta.pm ok 59 - POD test for Bio/AlignIO/maf.pm ok 60 - POD test for Bio/AlignIO/mase.pm ok 61 - POD test for Bio/AlignIO/mega.pm ok 62 - POD test for Bio/AlignIO/meme.pm ok 63 - POD test for Bio/AlignIO/metafasta.pm ok 64 - POD test for Bio/AlignIO/msf.pm ok 65 - POD test for Bio/AlignIO/nexml.pm ok 66 - POD test for Bio/AlignIO/nexus.pm ok 67 - POD test for Bio/AlignIO/pfam.pm ok 68 - POD test for Bio/AlignIO/phylip.pm ok 69 - POD test for Bio/AlignIO/po.pm ok 70 - POD test for Bio/AlignIO/proda.pm ok 71 - POD test for Bio/AlignIO/prodom.pm ok 72 - POD test for Bio/AlignIO/psi.pm ok 73 - POD test for Bio/AlignIO/selex.pm ok 74 - POD test for Bio/AlignIO/stockholm.pm ok 75 - POD test for Bio/AlignIO/xmfa.pm ok 76 - POD test for Bio/AlignIO/Handler/GenericAlignHandler.pm ok 77 - POD test for Bio/Annotation/AnnotationFactory.pm ok 78 - POD test for Bio/Annotation/Collection.pm ok 79 - POD test for Bio/Annotation/Comment.pm ok 80 - POD test for Bio/Annotation/DBLink.pm ok 81 - POD test for Bio/Annotation/OntologyTerm.pm ok 82 - POD test for Bio/Annotation/Reference.pm ok 83 - POD test for Bio/Annotation/Relation.pm ok 84 - POD test for Bio/Annotation/SimpleValue.pm ok 85 - POD test for Bio/Annotation/StructuredValue.pm ok 86 - POD test for Bio/Annotation/TagTree.pm ok 87 - POD test for Bio/Annotation/Target.pm ok 88 - POD test for Bio/Annotation/Tree.pm ok 89 - POD test for Bio/Annotation/TypeManager.pm ok 90 - POD test for Bio/Assembly/Contig.pm ok 91 - POD test for Bio/Assembly/ContigAnalysis.pm ok 92 - POD test for Bio/Assembly/IO.pm ok 93 - POD test for Bio/Assembly/Scaffold.pm ok 94 - POD test for Bio/Assembly/ScaffoldI.pm ok 95 - POD test for Bio/Assembly/Singlet.pm ok 96 - POD test for Bio/Assembly/IO/ace.pm ok 97 - POD test for Bio/Assembly/IO/bowtie.pm ok 98 - POD test for Bio/Assembly/IO/maq.pm ok 99 - POD test for Bio/Assembly/IO/phrap.pm ok 100 - POD test for Bio/Assembly/IO/sam.pm ok 101 - POD test for Bio/Assembly/IO/tigr.pm ok 102 - POD test for Bio/Assembly/Tools/ContigSpectrum.pm ok 103 - POD test for Bio/Cluster/ClusterFactory.pm ok 104 - POD test for Bio/Cluster/FamilyI.pm ok 105 - POD test for Bio/Cluster/SequenceFamily.pm ok 106 - POD test for Bio/Cluster/UniGene.pm ok 107 - POD test for Bio/Cluster/UniGeneI.pm ok 108 - POD test for Bio/ClusterIO/dbsnp.pm ok 109 - POD test for Bio/ClusterIO/unigene.pm ok 110 - POD test for Bio/CodonUsage/IO.pm ok 111 - POD test for Bio/CodonUsage/Table.pm ok 112 - POD test for Bio/Coordinate/Chain.pm ok 113 - POD test for Bio/Coordinate/Collection.pm ok 114 - POD test for Bio/Coordinate/ExtrapolatingPair.pm ok 115 - POD test for Bio/Coordinate/GeneMapper.pm ok 116 - POD test for Bio/Coordinate/Graph.pm ok 117 - POD test for Bio/Coordinate/MapperI.pm ok 118 - POD test for Bio/Coordinate/Pair.pm ok 119 - POD test for Bio/Coordinate/Result.pm ok 120 - POD test for Bio/Coordinate/ResultI.pm ok 121 - POD test for Bio/Coordinate/Utils.pm ok 122 - POD test for Bio/Coordinate/Result/Gap.pm ok 123 - POD test for Bio/Coordinate/Result/Match.pm ok 124 - POD test for Bio/Das/FeatureTypeI.pm ok 125 - POD test for Bio/Das/SegmentI.pm ok 126 - POD test for Bio/DB/Ace.pm ok 127 - POD test for Bio/DB/BioFetch.pm ok 128 - POD test for Bio/DB/CUTG.pm ok 129 - POD test for Bio/DB/DBFetch.pm ok 130 - POD test for Bio/DB/EMBL.pm ok 131 - POD test for Bio/DB/EntrezGene.pm ok 132 - POD test for Bio/DB/Expression.pm ok 133 - POD test for Bio/DB/Failover.pm ok 134 - POD test for Bio/DB/Fasta.pm ok 135 - POD test for Bio/DB/FileCache.pm ok 136 - POD test for Bio/DB/Flat.pm ok 137 - POD test for Bio/DB/GenBank.pm ok 138 - POD test for Bio/DB/GenericWebAgent.pm ok 139 - POD test for Bio/DB/GenPept.pm ok 140 - POD test for Bio/DB/GFF.pm ok 141 - POD test for Bio/DB/HIV.pm ok 142 - POD test for Bio/DB/IndexedBase.pm ok 143 - POD test for Bio/DB/InMemoryCache.pm ok 144 - POD test for Bio/DB/LocationI.pm ok 145 - POD test for Bio/DB/MeSH.pm ok 146 - POD test for Bio/DB/NCBIHelper.pm ok 147 - POD test for Bio/DB/Qual.pm ok 148 - POD test for Bio/DB/QueryI.pm ok 149 - POD test for Bio/DB/RandomAccessI.pm ok 150 - POD test for Bio/DB/ReferenceI.pm ok 151 - POD test for Bio/DB/RefSeq.pm ok 152 - POD test for Bio/DB/Registry.pm ok 153 - POD test for Bio/DB/SeqFeature.pm ok 154 - POD test for Bio/DB/SeqHound.pm ok 155 - POD test for Bio/DB/SeqI.pm ok 156 - POD test for Bio/DB/SeqVersion.pm ok 157 - POD test for Bio/DB/SwissProt.pm ok 158 - POD test for Bio/DB/Taxonomy.pm ok 159 - POD test for Bio/DB/TFBS.pm ok 160 - POD test for Bio/DB/Universal.pm ok 161 - POD test for Bio/DB/UpdateableSeqI.pm ok 162 - POD test for Bio/DB/WebDBSeqI.pm ok 163 - POD test for Bio/DB/Expression/geo.pm ok 164 - POD test for Bio/DB/Flat/BDB.pm ok 165 - POD test for Bio/DB/Flat/BinarySearch.pm ok 166 - POD test for Bio/DB/Flat/BDB/embl.pm ok 167 - POD test for Bio/DB/Flat/BDB/fasta.pm ok 168 - POD test for Bio/DB/Flat/BDB/genbank.pm ok 169 - POD test for Bio/DB/Flat/BDB/swiss.pm ok 170 - POD test for Bio/DB/GFF/Aggregator.pm ok 171 - POD test for Bio/DB/GFF/Featname.pm ok 172 - POD test for Bio/DB/GFF/Feature.pm ok 173 - POD test for Bio/DB/GFF/Homol.pm ok 174 - POD test for Bio/DB/GFF/RelSegment.pm ok 175 - POD test for Bio/DB/GFF/Segment.pm ok 176 - POD test for Bio/DB/GFF/Typename.pm ok 177 - POD test for Bio/DB/GFF/Adaptor/ace.pm ok 178 - POD test for Bio/DB/GFF/Adaptor/berkeleydb.pm ok 179 - POD test for Bio/DB/GFF/Adaptor/biofetch.pm ok 180 - POD test for Bio/DB/GFF/Adaptor/biofetch_oracle.pm ok 181 - POD test for Bio/DB/GFF/Adaptor/dbi.pm ok 182 - POD test for Bio/DB/GFF/Adaptor/memory.pm ok 183 - POD test for Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm ok 184 - POD test for Bio/DB/GFF/Adaptor/dbi/caching_handle.pm ok 185 - POD test for Bio/DB/GFF/Adaptor/dbi/iterator.pm ok 186 - POD test for Bio/DB/GFF/Adaptor/dbi/mysql.pm ok 187 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlace.pm ok 188 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm ok 189 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm ok 190 - POD test for Bio/DB/GFF/Adaptor/dbi/oracle.pm ok 191 - POD test for Bio/DB/GFF/Adaptor/dbi/oracleace.pm ok 192 - POD test for Bio/DB/GFF/Adaptor/dbi/pg.pm ok 193 - POD test for Bio/DB/GFF/Adaptor/dbi/pg_fts.pm ok 194 - POD test for Bio/DB/GFF/Adaptor/memory/feature_serializer.pm ok 195 - POD test for Bio/DB/GFF/Adaptor/memory/iterator.pm ok 196 - POD test for Bio/DB/GFF/Aggregator/alignment.pm ok 197 - POD test for Bio/DB/GFF/Aggregator/clone.pm ok 198 - POD test for Bio/DB/GFF/Aggregator/coding.pm ok 199 - POD test for Bio/DB/GFF/Aggregator/gene.pm ok 200 - POD test for Bio/DB/GFF/Aggregator/match.pm ok 201 - POD test for Bio/DB/GFF/Aggregator/none.pm ok 202 - POD test for Bio/DB/GFF/Aggregator/orf.pm ok 203 - POD test for Bio/DB/GFF/Aggregator/processed_transcript.pm ok 204 - POD test for Bio/DB/GFF/Aggregator/so_transcript.pm ok 205 - POD test for Bio/DB/GFF/Aggregator/transcript.pm ok 206 - POD test for Bio/DB/GFF/Aggregator/ucsc_acembly.pm ok 207 - POD test for Bio/DB/GFF/Aggregator/ucsc_ensgene.pm ok 208 - POD test for Bio/DB/GFF/Aggregator/ucsc_genscan.pm ok 209 - POD test for Bio/DB/GFF/Aggregator/ucsc_refgene.pm ok 210 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22.pm ok 211 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm ok 212 - POD test for Bio/DB/GFF/Aggregator/ucsc_softberry.pm ok 213 - POD test for Bio/DB/GFF/Aggregator/ucsc_twinscan.pm ok 214 - POD test for Bio/DB/GFF/Aggregator/ucsc_unigene.pm ok 215 - POD test for Bio/DB/GFF/Util/Binning.pm ok 216 - POD test for Bio/DB/GFF/Util/Rearrange.pm ok 217 - POD test for Bio/DB/HIV/HIVAnnotProcessor.pm ok 218 - POD test for Bio/DB/HIV/HIVQueryHelper.pm ok 219 - POD test for Bio/DB/Query/GenBank.pm ok 220 - POD test for Bio/DB/Query/HIVQuery.pm ok 221 - POD test for Bio/DB/Query/WebQuery.pm ok 222 - POD test for Bio/DB/SeqFeature/NormalizedFeature.pm ok 223 - POD test for Bio/DB/SeqFeature/NormalizedFeatureI.pm ok 224 - POD test for Bio/DB/SeqFeature/NormalizedTableFeatureI.pm ok 225 - POD test for Bio/DB/SeqFeature/Segment.pm ok 226 - POD test for Bio/DB/SeqFeature/Store.pm ok 227 - POD test for Bio/DB/SeqFeature/Store/bdb.pm ok 228 - POD test for Bio/DB/SeqFeature/Store/berkeleydb.pm ok 229 - POD test for Bio/DB/SeqFeature/Store/berkeleydb3.pm ok 230 - POD test for Bio/DB/SeqFeature/Store/FeatureFileLoader.pm ok 231 - POD test for Bio/DB/SeqFeature/Store/GFF2Loader.pm ok 232 - POD test for Bio/DB/SeqFeature/Store/GFF3Loader.pm ok 233 - POD test for Bio/DB/SeqFeature/Store/Loader.pm ok 234 - POD test for Bio/DB/SeqFeature/Store/LoadHelper.pm ok 235 - POD test for Bio/DB/SeqFeature/Store/memory.pm ok 236 - POD test for Bio/DB/SeqFeature/Store/DBI/Iterator.pm ok 237 - POD test for Bio/DB/SeqFeature/Store/DBI/mysql.pm ok 238 - POD test for Bio/DB/SeqFeature/Store/DBI/Pg.pm ok 239 - POD test for Bio/DB/SeqFeature/Store/DBI/SQLite.pm ok 240 - POD test for Bio/DB/SeqVersion/gi.pm ok 241 - POD test for Bio/DB/Taxonomy/entrez.pm ok 242 - POD test for Bio/DB/Taxonomy/flatfile.pm ok 243 - POD test for Bio/DB/Taxonomy/greengenes.pm ok 244 - POD test for Bio/DB/Taxonomy/list.pm ok 245 - POD test for Bio/DB/Taxonomy/silva.pm ok 246 - POD test for Bio/DB/TFBS/transfac_pro.pm ok 247 - POD test for Bio/Draw/Pictogram.pm ok 248 - POD test for Bio/Event/EventGeneratorI.pm ok 249 - POD test for Bio/Event/EventHandlerI.pm ok 250 - POD test for Bio/Factory/AnalysisI.pm ok 251 - POD test for Bio/Factory/ApplicationFactoryI.pm ok 252 - POD test for Bio/Factory/DriverFactory.pm ok 253 - POD test for Bio/Factory/FTLocationFactory.pm ok 254 - POD test for Bio/Factory/LocationFactoryI.pm ok 255 - POD test for Bio/Factory/MapFactoryI.pm ok 256 - POD test for Bio/Factory/ObjectBuilderI.pm ok 257 - POD test for Bio/Factory/ObjectFactory.pm ok 258 - POD test for Bio/Factory/ObjectFactoryI.pm ok 259 - POD test for Bio/Factory/SeqAnalysisParserFactory.pm ok 260 - POD test for Bio/Factory/SeqAnalysisParserFactoryI.pm ok 261 - POD test for Bio/Factory/SequenceFactoryI.pm ok 262 - POD test for Bio/Factory/SequenceProcessorI.pm ok 263 - POD test for Bio/Factory/SequenceStreamI.pm ok 264 - POD test for Bio/Factory/TreeFactoryI.pm ok 265 - POD test for Bio/Index/Abstract.pm ok 266 - POD test for Bio/Index/AbstractSeq.pm ok 267 - POD test for Bio/Index/Blast.pm ok 268 - POD test for Bio/Index/BlastTable.pm ok 269 - POD test for Bio/Index/EMBL.pm ok 270 - POD test for Bio/Index/Fasta.pm ok 271 - POD test for Bio/Index/Fastq.pm ok 272 - POD test for Bio/Index/GenBank.pm ok 273 - POD test for Bio/Index/Hmmer.pm ok 274 - POD test for Bio/Index/Qual.pm ok 275 - POD test for Bio/Index/Stockholm.pm ok 276 - POD test for Bio/Index/SwissPfam.pm ok 277 - POD test for Bio/Index/Swissprot.pm ok 278 - POD test for Bio/LiveSeq/AARange.pm ok 279 - POD test for Bio/LiveSeq/Chain.pm ok 280 - POD test for Bio/LiveSeq/ChainI.pm ok 281 - POD test for Bio/LiveSeq/DNA.pm ok 282 - POD test for Bio/LiveSeq/Exon.pm ok 283 - POD test for Bio/LiveSeq/Gene.pm ok 284 - POD test for Bio/LiveSeq/Intron.pm ok 285 - POD test for Bio/LiveSeq/Mutation.pm ok 286 - POD test for Bio/LiveSeq/Mutator.pm ok 287 - POD test for Bio/LiveSeq/Prim_Transcript.pm ok 288 - POD test for Bio/LiveSeq/Range.pm ok 289 - POD test for Bio/LiveSeq/Repeat_Region.pm ok 290 - POD test for Bio/LiveSeq/Repeat_Unit.pm ok 291 - POD test for Bio/LiveSeq/SeqI.pm ok 292 - POD test for Bio/LiveSeq/Transcript.pm ok 293 - POD test for Bio/LiveSeq/Translation.pm ok 294 - POD test for Bio/LiveSeq/IO/BioPerl.pm ok 295 - POD test for Bio/LiveSeq/IO/Loader.pm ok 296 - POD test for Bio/Location/Atomic.pm ok 297 - POD test for Bio/Location/AvWithinCoordPolicy.pm ok 298 - POD test for Bio/Location/CoordinatePolicyI.pm ok 299 - POD test for Bio/Location/Fuzzy.pm ok 300 - POD test for Bio/Location/FuzzyLocationI.pm ok 301 - POD test for Bio/Location/NarrowestCoordPolicy.pm ok 302 - POD test for Bio/Location/Simple.pm ok 303 - POD test for Bio/Location/Split.pm ok 304 - POD test for Bio/Location/SplitLocationI.pm ok 305 - POD test for Bio/Location/WidestCoordPolicy.pm ok 306 - POD test for Bio/Map/Clone.pm ok 307 - POD test for Bio/Map/Contig.pm ok 308 - POD test for Bio/Map/CytoMap.pm ok 309 - POD test for Bio/Map/CytoMarker.pm ok 310 - POD test for Bio/Map/CytoPosition.pm ok 311 - POD test for Bio/Map/EntityI.pm ok 312 - POD test for Bio/Map/FPCMarker.pm ok 313 - POD test for Bio/Map/Gene.pm ok 314 - POD test for Bio/Map/GeneMap.pm ok 315 - POD test for Bio/Map/GenePosition.pm ok 316 - POD test for Bio/Map/GeneRelative.pm ok 317 - POD test for Bio/Map/LinkageMap.pm ok 318 - POD test for Bio/Map/LinkagePosition.pm ok 319 - POD test for Bio/Map/MapI.pm ok 320 - POD test for Bio/Map/Mappable.pm ok 321 - POD test for Bio/Map/MappableI.pm ok 322 - POD test for Bio/Map/Marker.pm ok 323 - POD test for Bio/Map/MarkerI.pm ok 324 - POD test for Bio/Map/Microsatellite.pm ok 325 - POD test for Bio/Map/OrderedPosition.pm ok 326 - POD test for Bio/Map/OrderedPositionWithDistance.pm ok 327 - POD test for Bio/Map/Physical.pm ok 328 - POD test for Bio/Map/Position.pm ok 329 - POD test for Bio/Map/PositionHandler.pm ok 330 - POD test for Bio/Map/PositionHandlerI.pm ok 331 - POD test for Bio/Map/PositionI.pm ok 332 - POD test for Bio/Map/PositionWithSequence.pm ok 333 - POD test for Bio/Map/Prediction.pm ok 334 - POD test for Bio/Map/Relative.pm ok 335 - POD test for Bio/Map/RelativeI.pm ok 336 - POD test for Bio/Map/SimpleMap.pm ok 337 - POD test for Bio/Map/TranscriptionFactor.pm ok 338 - POD test for Bio/MapIO/fpc.pm ok 339 - POD test for Bio/MapIO/mapmaker.pm ok 340 - POD test for Bio/Matrix/Generic.pm ok 341 - POD test for Bio/Matrix/IO.pm ok 342 - POD test for Bio/Matrix/MatrixI.pm ok 343 - POD test for Bio/Matrix/Mlagan.pm ok 344 - POD test for Bio/Matrix/PhylipDist.pm ok 345 - POD test for Bio/Matrix/Scoring.pm ok 346 - POD test for Bio/Matrix/IO/mlagan.pm ok 347 - POD test for Bio/Matrix/IO/phylip.pm ok 348 - POD test for Bio/Matrix/IO/scoring.pm ok 349 - POD test for Bio/Matrix/PSM/InstanceSite.pm ok 350 - POD test for Bio/Matrix/PSM/InstanceSiteI.pm ok 351 - POD test for Bio/Matrix/PSM/IO.pm ok 352 - POD test for Bio/Matrix/PSM/ProtMatrix.pm ok 353 - POD test for Bio/Matrix/PSM/ProtPsm.pm ok 354 - POD test for Bio/Matrix/PSM/Psm.pm ok 355 - POD test for Bio/Matrix/PSM/PsmHeader.pm ok 356 - POD test for Bio/Matrix/PSM/PsmHeaderI.pm ok 357 - POD test for Bio/Matrix/PSM/PsmI.pm ok 358 - POD test for Bio/Matrix/PSM/SiteMatrix.pm ok 359 - POD test for Bio/Matrix/PSM/SiteMatrixI.pm ok 360 - POD test for Bio/Matrix/PSM/IO/mast.pm ok 361 - POD test for Bio/Matrix/PSM/IO/masta.pm ok 362 - POD test for Bio/Matrix/PSM/IO/meme.pm ok 363 - POD test for Bio/Matrix/PSM/IO/psiblast.pm ok 364 - POD test for Bio/Matrix/PSM/IO/transfac.pm ok 365 - POD test for Bio/MolEvol/CodonModel.pm ok 366 - POD test for Bio/Nexml/Factory.pm ok 367 - POD test for Bio/Ontology/DocumentRegistry.pm ok 368 - POD test for Bio/Ontology/GOterm.pm ok 369 - POD test for Bio/Ontology/InterProTerm.pm ok 370 - POD test for Bio/Ontology/OBOEngine.pm ok 371 - POD test for Bio/Ontology/OBOterm.pm ok 372 - POD test for Bio/Ontology/Ontology.pm ok 373 - POD test for Bio/Ontology/OntologyEngineI.pm ok 374 - POD test for Bio/Ontology/OntologyI.pm ok 375 - POD test for Bio/Ontology/OntologyStore.pm ok 376 - POD test for Bio/Ontology/Path.pm ok 377 - POD test for Bio/Ontology/PathI.pm ok 378 - POD test for Bio/Ontology/Relationship.pm ok 379 - POD test for Bio/Ontology/RelationshipFactory.pm ok 380 - POD test for Bio/Ontology/RelationshipI.pm ok 381 - POD test for Bio/Ontology/RelationshipType.pm ok 382 - POD test for Bio/Ontology/SimpleOntologyEngine.pm ok 383 - POD test for Bio/Ontology/Term.pm ok 384 - POD test for Bio/Ontology/TermFactory.pm ok 385 - POD test for Bio/Ontology/TermI.pm ok 386 - POD test for Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm ok 387 - POD test for Bio/OntologyIO/dagflat.pm ok 388 - POD test for Bio/OntologyIO/goflat.pm ok 389 - POD test for Bio/OntologyIO/InterProParser.pm ok 390 - POD test for Bio/OntologyIO/obo.pm ok 391 - POD test for Bio/OntologyIO/simplehierarchy.pm ok 392 - POD test for Bio/OntologyIO/soflat.pm ok 393 - POD test for Bio/OntologyIO/Handlers/BaseSAXHandler.pm ok 394 - POD test for Bio/OntologyIO/Handlers/InterProHandler.pm ok 395 - POD test for Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm ok 396 - POD test for Bio/Phenotype/Correlate.pm ok 397 - POD test for Bio/Phenotype/Measure.pm ok 398 - POD test for Bio/Phenotype/Phenotype.pm ok 399 - POD test for Bio/Phenotype/PhenotypeI.pm ok 400 - POD test for Bio/Phenotype/MeSH/Term.pm ok 401 - POD test for Bio/Phenotype/MeSH/Twig.pm ok 402 - POD test for Bio/Phenotype/OMIM/MiniMIMentry.pm ok 403 - POD test for Bio/Phenotype/OMIM/OMIMentry.pm ok 404 - POD test for Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm ok 405 - POD test for Bio/Phenotype/OMIM/OMIMparser.pm ok 406 - POD test for Bio/PhyloNetwork/Factory.pm ok 407 - POD test for Bio/PhyloNetwork/FactoryX.pm ok 408 - POD test for Bio/PhyloNetwork/GraphViz.pm ok 409 - POD test for Bio/PhyloNetwork/muVector.pm ok 410 - POD test for Bio/PhyloNetwork/RandomFactory.pm ok 411 - POD test for Bio/PhyloNetwork/TreeFactory.pm ok 412 - POD test for Bio/PhyloNetwork/TreeFactoryMulti.pm ok 413 - POD test for Bio/PhyloNetwork/TreeFactoryX.pm ok 414 - POD test for Bio/PopGen/Genotype.pm ok 415 - POD test for Bio/PopGen/GenotypeI.pm ok 416 - POD test for Bio/PopGen/HtSNP.pm ok 417 - POD test for Bio/PopGen/Individual.pm ok 418 - POD test for Bio/PopGen/IndividualI.pm ok 419 - POD test for Bio/PopGen/IO.pm ok 420 - POD test for Bio/PopGen/Marker.pm ok 421 - POD test for Bio/PopGen/MarkerI.pm ok 422 - POD test for Bio/PopGen/PopStats.pm ok 423 - POD test for Bio/PopGen/Population.pm ok 424 - POD test for Bio/PopGen/PopulationI.pm ok 425 - POD test for Bio/PopGen/Statistics.pm ok 426 - POD test for Bio/PopGen/TagHaplotype.pm ok 427 - POD test for Bio/PopGen/Utilities.pm ok 428 - POD test for Bio/PopGen/IO/csv.pm ok 429 - POD test for Bio/PopGen/IO/hapmap.pm ok 430 - POD test for Bio/PopGen/IO/phase.pm ok 431 - POD test for Bio/PopGen/IO/prettybase.pm ok 432 - POD test for Bio/PopGen/Simulation/Coalescent.pm ok 433 - POD test for Bio/PopGen/Simulation/GeneticDrift.pm ok 434 - POD test for Bio/Restriction/Analysis.pm ok 435 - POD test for Bio/Restriction/Enzyme.pm ok 436 - POD test for Bio/Restriction/EnzymeCollection.pm ok 437 - POD test for Bio/Restriction/EnzymeI.pm ok 438 - POD test for Bio/Restriction/IO.pm ok 439 - POD test for Bio/Restriction/Enzyme/MultiCut.pm ok 440 - POD test for Bio/Restriction/Enzyme/MultiSite.pm ok 441 - POD test for Bio/Restriction/IO/bairoch.pm ok 442 - POD test for Bio/Restriction/IO/base.pm ok 443 - POD test for Bio/Restriction/IO/itype2.pm ok 444 - POD test for Bio/Restriction/IO/prototype.pm ok 445 - POD test for Bio/Restriction/IO/withrefm.pm ok 446 - POD test for Bio/Root/Build.pm ok 447 - POD test for Bio/Root/Exception.pm ok 448 - POD test for Bio/Root/HTTPget.pm ok 449 - POD test for Bio/Root/IO.pm ok 450 - POD test for Bio/Root/Root.pm ok 451 - POD test for Bio/Root/RootI.pm ok 452 - POD test for Bio/Root/Storable.pm ok 453 - POD test for Bio/Root/Test.pm ok 454 - POD test for Bio/Root/Utilities.pm ok 455 - POD test for Bio/Root/Version.pm ok 456 - POD test for Bio/Search/BlastStatistics.pm ok 457 - POD test for Bio/Search/BlastUtils.pm ok 458 - POD test for Bio/Search/DatabaseI.pm ok 459 - POD test for Bio/Search/GenericDatabase.pm ok 460 - POD test for Bio/Search/GenericStatistics.pm ok 461 - POD test for Bio/Search/Processor.pm ok 462 - POD test for Bio/Search/SearchUtils.pm ok 463 - POD test for Bio/Search/StatisticsI.pm ok 464 - POD test for Bio/Search/Hit/BlastHit.pm ok 465 - POD test for Bio/Search/Hit/BlastPullHit.pm ok 466 - POD test for Bio/Search/Hit/Fasta.pm ok 467 - POD test for Bio/Search/Hit/GenericHit.pm ok 468 - POD test for Bio/Search/Hit/HitFactory.pm ok 469 - POD test for Bio/Search/Hit/HitI.pm ok 470 - POD test for Bio/Search/Hit/hmmer3Hit.pm ok 471 - POD test for Bio/Search/Hit/HMMERHit.pm ok 472 - POD test for Bio/Search/Hit/HmmpfamHit.pm ok 473 - POD test for Bio/Search/Hit/ModelHit.pm ok 474 - POD test for Bio/Search/Hit/PsiBlastHit.pm ok 475 - POD test for Bio/Search/Hit/PullHitI.pm ok 476 - POD test for Bio/Search/HSP/BlastHSP.pm ok 477 - POD test for Bio/Search/HSP/BlastPullHSP.pm ok 478 - POD test for Bio/Search/HSP/FastaHSP.pm ok 479 - POD test for Bio/Search/HSP/GenericHSP.pm ok 480 - POD test for Bio/Search/HSP/HMMERHSP.pm ok 481 - POD test for Bio/Search/HSP/HmmpfamHSP.pm ok 482 - POD test for Bio/Search/HSP/HSPFactory.pm ok 483 - POD test for Bio/Search/HSP/HSPI.pm ok 484 - POD test for Bio/Search/HSP/ModelHSP.pm ok 485 - POD test for Bio/Search/HSP/PsiBlastHSP.pm ok 486 - POD test for Bio/Search/HSP/PSLHSP.pm ok 487 - POD test for Bio/Search/HSP/PullHSPI.pm ok 488 - POD test for Bio/Search/HSP/WABAHSP.pm ok 489 - POD test for Bio/Search/Iteration/GenericIteration.pm ok 490 - POD test for Bio/Search/Iteration/IterationI.pm ok 491 - POD test for Bio/Search/Result/BlastPullResult.pm ok 492 - POD test for Bio/Search/Result/BlastResult.pm ok 493 - POD test for Bio/Search/Result/CrossMatchResult.pm ok 494 - POD test for Bio/Search/Result/GenericResult.pm ok 495 - POD test for Bio/Search/Result/hmmer3Result.pm ok 496 - POD test for Bio/Search/Result/HMMERResult.pm ok 497 - POD test for Bio/Search/Result/HmmpfamResult.pm ok 498 - POD test for Bio/Search/Result/PullResultI.pm ok 499 - POD test for Bio/Search/Result/ResultFactory.pm ok 500 - POD test for Bio/Search/Result/ResultI.pm ok 501 - POD test for Bio/Search/Result/WABAResult.pm ok 502 - POD test for Bio/Search/Tiling/MapTileUtils.pm ok 503 - POD test for Bio/Search/Tiling/MapTiling.pm ok 504 - POD test for Bio/Search/Tiling/TilingI.pm ok 505 - POD test for Bio/SearchIO/axt.pm ok 506 - POD test for Bio/SearchIO/blast.pm ok 507 - POD test for Bio/SearchIO/blasttable.pm ok 508 - POD test for Bio/SearchIO/blastxml.pm ok 509 - POD test for Bio/SearchIO/blast_pull.pm ok 510 - POD test for Bio/SearchIO/cross_match.pm ok 511 - POD test for Bio/SearchIO/erpin.pm ok 512 - POD test for Bio/SearchIO/EventHandlerI.pm ok 513 - POD test for Bio/SearchIO/exonerate.pm ok 514 - POD test for Bio/SearchIO/fasta.pm ok 515 - POD test for Bio/SearchIO/FastHitEventBuilder.pm ok 516 - POD test for Bio/SearchIO/gmap_f9.pm ok 517 - POD test for Bio/SearchIO/hmmer.pm ok 518 - POD test for Bio/SearchIO/hmmer2.pm ok 519 - POD test for Bio/SearchIO/hmmer3.pm ok 520 - POD test for Bio/SearchIO/hmmer_pull.pm ok 521 - POD test for Bio/SearchIO/infernal.pm ok 522 - POD test for Bio/SearchIO/IteratedSearchResultEventBuilder.pm ok 523 - POD test for Bio/SearchIO/megablast.pm ok 524 - POD test for Bio/SearchIO/psl.pm ok 525 - POD test for Bio/SearchIO/rnamotif.pm ok 526 - POD test for Bio/SearchIO/SearchResultEventBuilder.pm ok 527 - POD test for Bio/SearchIO/SearchWriterI.pm ok 528 - POD test for Bio/SearchIO/sim4.pm ok 529 - POD test for Bio/SearchIO/waba.pm ok 530 - POD test for Bio/SearchIO/wise.pm ok 531 - POD test for Bio/SearchIO/Writer/BSMLResultWriter.pm ok 532 - POD test for Bio/SearchIO/Writer/GbrowseGFF.pm ok 533 - POD test for Bio/SearchIO/Writer/HitTableWriter.pm ok 534 - POD test for Bio/SearchIO/Writer/HSPTableWriter.pm ok 535 - POD test for Bio/SearchIO/Writer/HTMLResultWriter.pm ok 536 - POD test for Bio/SearchIO/Writer/ResultTableWriter.pm ok 537 - POD test for Bio/SearchIO/Writer/TextResultWriter.pm ok 538 - POD test for Bio/SearchIO/XML/BlastHandler.pm ok 539 - POD test for Bio/SearchIO/XML/PsiBlastHandler.pm ok 540 - POD test for Bio/Seq/BaseSeqProcessor.pm ok 541 - POD test for Bio/Seq/EncodedSeq.pm ok 542 - POD test for Bio/Seq/LargeLocatableSeq.pm ok 543 - POD test for Bio/Seq/LargePrimarySeq.pm ok 544 - POD test for Bio/Seq/LargeSeq.pm ok 545 - POD test for Bio/Seq/LargeSeqI.pm ok 546 - POD test for Bio/Seq/Meta.pm ok 547 - POD test for Bio/Seq/MetaI.pm ok 548 - POD test for Bio/Seq/PrimaryQual.pm ok 549 - POD test for Bio/Seq/PrimedSeq.pm ok 550 - POD test for Bio/Seq/QualI.pm ok 551 - POD test for Bio/Seq/Quality.pm ok 552 - POD test for Bio/Seq/RichSeq.pm ok 553 - POD test for Bio/Seq/RichSeqI.pm ok 554 - POD test for Bio/Seq/SeqBuilder.pm ok 555 - POD test for Bio/Seq/SeqFactory.pm ok 556 - POD test for Bio/Seq/SeqFastaSpeedFactory.pm ok 557 - POD test for Bio/Seq/SequenceTrace.pm ok 558 - POD test for Bio/Seq/SeqWithQuality.pm ok 559 - POD test for Bio/Seq/SimulatedRead.pm ok 560 - POD test for Bio/Seq/TraceI.pm ok 561 - POD test for Bio/Seq/Meta/Array.pm ok 562 - POD test for Bio/SeqEvolution/DNAPoint.pm ok 563 - POD test for Bio/SeqEvolution/EvolutionI.pm ok 564 - POD test for Bio/SeqEvolution/Factory.pm ok 565 - POD test for Bio/SeqFeature/Amplicon.pm ok 566 - POD test for Bio/SeqFeature/AnnotationAdaptor.pm ok 567 - POD test for Bio/SeqFeature/Collection.pm ok 568 - POD test for Bio/SeqFeature/CollectionI.pm ok 569 - POD test for Bio/SeqFeature/Computation.pm ok 570 - POD test for Bio/SeqFeature/FeaturePair.pm ok 571 - POD test for Bio/SeqFeature/Generic.pm ok 572 - POD test for Bio/SeqFeature/Lite.pm ok 573 - POD test for Bio/SeqFeature/PositionProxy.pm ok 574 - POD test for Bio/SeqFeature/Primer.pm ok 575 - POD test for Bio/SeqFeature/Similarity.pm ok 576 - POD test for Bio/SeqFeature/SimilarityPair.pm ok 577 - POD test for Bio/SeqFeature/SubSeq.pm ok 578 - POD test for Bio/SeqFeature/TypedSeqFeatureI.pm ok 579 - POD test for Bio/SeqFeature/Gene/Exon.pm ok 580 - POD test for Bio/SeqFeature/Gene/ExonI.pm ok 581 - POD test for Bio/SeqFeature/Gene/GeneStructure.pm ok 582 - POD test for Bio/SeqFeature/Gene/GeneStructureI.pm ok 583 - POD test for Bio/SeqFeature/Gene/Intron.pm ok 584 - POD test for Bio/SeqFeature/Gene/NC_Feature.pm ok 585 - POD test for Bio/SeqFeature/Gene/Poly_A_site.pm ok 586 - POD test for Bio/SeqFeature/Gene/Promoter.pm ok 587 - POD test for Bio/SeqFeature/Gene/Transcript.pm ok 588 - POD test for Bio/SeqFeature/Gene/TranscriptI.pm ok 589 - POD test for Bio/SeqFeature/Gene/UTR.pm ok 590 - POD test for Bio/SeqFeature/SiRNA/Oligo.pm ok 591 - POD test for Bio/SeqFeature/SiRNA/Pair.pm ok 592 - POD test for Bio/SeqFeature/Tools/FeatureNamer.pm ok 593 - POD test for Bio/SeqFeature/Tools/IDHandler.pm ok 594 - POD test for Bio/SeqFeature/Tools/TypeMapper.pm ok 595 - POD test for Bio/SeqFeature/Tools/Unflattener.pm ok 596 - POD test for Bio/SeqIO/abi.pm ok 597 - POD test for Bio/SeqIO/ace.pm ok 598 - POD test for Bio/SeqIO/agave.pm ok 599 - POD test for Bio/SeqIO/alf.pm ok 600 - POD test for Bio/SeqIO/asciitree.pm ok 601 - POD test for Bio/SeqIO/bsml.pm ok 602 - POD test for Bio/SeqIO/bsml_sax.pm ok 603 - POD test for Bio/SeqIO/chadoxml.pm ok 604 - POD test for Bio/SeqIO/chaos.pm ok 605 - POD test for Bio/SeqIO/chaosxml.pm ok 606 - POD test for Bio/SeqIO/ctf.pm ok 607 - POD test for Bio/SeqIO/embl.pm ok 608 - POD test for Bio/SeqIO/embldriver.pm ok 609 - POD test for Bio/SeqIO/entrezgene.pm ok 610 - POD test for Bio/SeqIO/excel.pm ok 611 - POD test for Bio/SeqIO/exp.pm ok 612 - POD test for Bio/SeqIO/fasta.pm ok 613 - POD test for Bio/SeqIO/fastq.pm ok 614 - POD test for Bio/SeqIO/flybase_chadoxml.pm ok 615 - POD test for Bio/SeqIO/FTHelper.pm ok 616 - POD test for Bio/SeqIO/game.pm ok 617 - POD test for Bio/SeqIO/gbdriver.pm ok 618 - POD test for Bio/SeqIO/gbxml.pm ok 619 - POD test for Bio/SeqIO/gcg.pm ok 620 - POD test for Bio/SeqIO/genbank.pm ok 621 - POD test for Bio/SeqIO/interpro.pm ok 622 - POD test for Bio/SeqIO/kegg.pm ok 623 - POD test for Bio/SeqIO/largefasta.pm ok 624 - POD test for Bio/SeqIO/lasergene.pm ok 625 - POD test for Bio/SeqIO/locuslink.pm ok 626 - POD test for Bio/SeqIO/mbsout.pm ok 627 - POD test for Bio/SeqIO/metafasta.pm ok 628 - POD test for Bio/SeqIO/msout.pm ok 629 - POD test for Bio/SeqIO/MultiFile.pm ok 630 - POD test for Bio/SeqIO/nexml.pm ok 631 - POD test for Bio/SeqIO/phd.pm ok 632 - POD test for Bio/SeqIO/pir.pm ok 633 - POD test for Bio/SeqIO/pln.pm ok 634 - POD test for Bio/SeqIO/qual.pm ok 635 - POD test for Bio/SeqIO/raw.pm ok 636 - POD test for Bio/SeqIO/scf.pm ok 637 - POD test for Bio/SeqIO/seqxml.pm ok 638 - POD test for Bio/SeqIO/strider.pm ok 639 - POD test for Bio/SeqIO/swiss.pm ok 640 - POD test for Bio/SeqIO/swissdriver.pm ok 641 - POD test for Bio/SeqIO/tab.pm ok 642 - POD test for Bio/SeqIO/table.pm ok 643 - POD test for Bio/SeqIO/tigr.pm ok 644 - POD test for Bio/SeqIO/tigrxml.pm ok 645 - POD test for Bio/SeqIO/tinyseq.pm ok 646 - POD test for Bio/SeqIO/ztr.pm ok 647 - POD test for Bio/SeqIO/game/featHandler.pm ok 648 - POD test for Bio/SeqIO/game/gameHandler.pm ok 649 - POD test for Bio/SeqIO/game/gameSubs.pm ok 650 - POD test for Bio/SeqIO/game/gameWriter.pm ok 651 - POD test for Bio/SeqIO/game/seqHandler.pm ok 652 - POD test for Bio/SeqIO/Handler/GenericRichSeqHandler.pm ok 653 - POD test for Bio/SeqIO/tinyseq/tinyseqHandler.pm ok 654 - POD test for Bio/Structure/Atom.pm ok 655 - POD test for Bio/Structure/Chain.pm ok 656 - POD test for Bio/Structure/Entry.pm ok 657 - POD test for Bio/Structure/IO.pm ok 658 - POD test for Bio/Structure/Model.pm ok 659 - POD test for Bio/Structure/Residue.pm ok 660 - POD test for Bio/Structure/StructureI.pm ok 661 - POD test for Bio/Structure/IO/pdb.pm ok 662 - POD test for Bio/Structure/SecStr/DSSP/Res.pm ok 663 - POD test for Bio/Structure/SecStr/STRIDE/Res.pm ok 664 - POD test for Bio/Symbol/Alphabet.pm ok 665 - POD test for Bio/Symbol/AlphabetI.pm ok 666 - POD test for Bio/Symbol/DNAAlphabet.pm ok 667 - POD test for Bio/Symbol/ProteinAlphabet.pm ok 668 - POD test for Bio/Symbol/Symbol.pm ok 669 - POD test for Bio/Symbol/SymbolI.pm ok 670 - POD test for Bio/Taxonomy/FactoryI.pm ok 671 - POD test for Bio/Taxonomy/Node.pm ok 672 - POD test for Bio/Taxonomy/Taxon.pm ok 673 - POD test for Bio/Taxonomy/Tree.pm ok 674 - POD test for Bio/Tools/AlignFactory.pm ok 675 - POD test for Bio/Tools/AmpliconSearch.pm ok 676 - POD test for Bio/Tools/AnalysisResult.pm ok 677 - POD test for Bio/Tools/Blat.pm ok 678 - POD test for Bio/Tools/CodonTable.pm ok 679 - POD test for Bio/Tools/Coil.pm ok 680 - POD test for Bio/Tools/dpAlign.pm ok 681 - POD test for Bio/Tools/ECnumber.pm ok 682 - POD test for Bio/Tools/EPCR.pm ok 683 - POD test for Bio/Tools/Eponine.pm ok 684 - POD test for Bio/Tools/ERPIN.pm ok 685 - POD test for Bio/Tools/Est2Genome.pm ok 686 - POD test for Bio/Tools/ESTScan.pm ok 687 - POD test for Bio/Tools/Fgenesh.pm ok 688 - POD test for Bio/Tools/FootPrinter.pm ok 689 - POD test for Bio/Tools/Gel.pm ok 690 - POD test for Bio/Tools/Geneid.pm ok 691 - POD test for Bio/Tools/Genemark.pm ok 692 - POD test for Bio/Tools/Genewise.pm ok 693 - POD test for Bio/Tools/Genomewise.pm ok 694 - POD test for Bio/Tools/Genscan.pm ok 695 - POD test for Bio/Tools/GFF.pm ok 696 - POD test for Bio/Tools/Glimmer.pm ok 697 - POD test for Bio/Tools/Grail.pm ok 698 - POD test for Bio/Tools/GuessSeqFormat.pm ok 699 - POD test for Bio/Tools/Hmmpfam.pm ok 700 - POD test for Bio/Tools/Infernal.pm ok 701 - POD test for Bio/Tools/ipcress.pm ok 702 - POD test for Bio/Tools/isPcr.pm ok 703 - POD test for Bio/Tools/IUPAC.pm ok 704 - POD test for Bio/Tools/Lucy.pm ok 705 - POD test for Bio/Tools/Match.pm ok 706 - POD test for Bio/Tools/MZEF.pm ok 707 - POD test for Bio/Tools/OddCodes.pm ok 708 - POD test for Bio/Tools/pICalculator.pm ok 709 - POD test for Bio/Tools/Primer3.pm ok 710 - POD test for Bio/Tools/Prints.pm ok 711 - POD test for Bio/Tools/Profile.pm ok 712 - POD test for Bio/Tools/Promoterwise.pm ok 713 - POD test for Bio/Tools/PrositeScan.pm ok 714 - POD test for Bio/Tools/Protparam.pm ok 715 - POD test for Bio/Tools/Pseudowise.pm ok 716 - POD test for Bio/Tools/pSW.pm ok 717 - POD test for Bio/Tools/QRNA.pm ok 718 - POD test for Bio/Tools/RandomDistFunctions.pm ok 719 - POD test for Bio/Tools/RepeatMasker.pm ok 720 - POD test for Bio/Tools/RNAMotif.pm ok 721 - POD test for Bio/Tools/Seg.pm ok 722 - POD test for Bio/Tools/SeqPattern.pm ok 723 - POD test for Bio/Tools/SeqStats.pm ok 724 - POD test for Bio/Tools/SeqWords.pm ok 725 - POD test for Bio/Tools/Sigcleave.pm ok 726 - POD test for Bio/Tools/Signalp.pm ok 727 - POD test for Bio/Tools/SiRNA.pm ok 728 - POD test for Bio/Tools/TandemRepeatsFinder.pm ok 729 - POD test for Bio/Tools/TargetP.pm ok 730 - POD test for Bio/Tools/Tmhmm.pm ok 731 - POD test for Bio/Tools/tRNAscanSE.pm ok 732 - POD test for Bio/Tools/Alignment/Consed.pm ok 733 - POD test for Bio/Tools/Alignment/Trim.pm ok 734 - POD test for Bio/Tools/Analysis/SimpleAnalysisBase.pm ok 735 - POD test for Bio/Tools/Analysis/DNA/ESEfinder.pm ok 736 - POD test for Bio/Tools/Analysis/Protein/Domcut.pm ok 737 - POD test for Bio/Tools/Analysis/Protein/ELM.pm ok 738 - POD test for Bio/Tools/Analysis/Protein/GOR4.pm ok 739 - POD test for Bio/Tools/Analysis/Protein/HNN.pm ok 740 - POD test for Bio/Tools/Analysis/Protein/Mitoprot.pm ok 741 - POD test for Bio/Tools/Analysis/Protein/NetPhos.pm ok 742 - POD test for Bio/Tools/Analysis/Protein/Scansite.pm ok 743 - POD test for Bio/Tools/Analysis/Protein/Sopma.pm ok 744 - POD test for Bio/Tools/EMBOSS/Palindrome.pm ok 745 - POD test for Bio/Tools/HMMER/Domain.pm ok 746 - POD test for Bio/Tools/HMMER/Results.pm ok 747 - POD test for Bio/Tools/HMMER/Set.pm ok 748 - POD test for Bio/Tools/Phylo/Gerp.pm ok 749 - POD test for Bio/Tools/Phylo/Gumby.pm ok 750 - POD test for Bio/Tools/Phylo/Molphy.pm ok 751 - POD test for Bio/Tools/Phylo/PAML.pm ok 752 - POD test for Bio/Tools/Phylo/Molphy/Result.pm ok 753 - POD test for Bio/Tools/Phylo/PAML/Codeml.pm ok 754 - POD test for Bio/Tools/Phylo/PAML/ModelResult.pm ok 755 - POD test for Bio/Tools/Phylo/PAML/Result.pm ok 756 - POD test for Bio/Tools/Phylo/Phylip/ProtDist.pm ok 757 - POD test for Bio/Tools/Prediction/Exon.pm ok 758 - POD test for Bio/Tools/Prediction/Gene.pm ok 759 - POD test for Bio/Tools/Primer/AssessorI.pm ok 760 - POD test for Bio/Tools/Primer/Feature.pm ok 761 - POD test for Bio/Tools/Primer/Pair.pm ok 762 - POD test for Bio/Tools/Primer/Assessor/Base.pm ok 763 - POD test for Bio/Tools/Run/GenericParameters.pm ok 764 - POD test for Bio/Tools/Run/hmmer3.pm (no pod) ok 765 - POD test for Bio/Tools/Run/ParametersI.pm ok 766 - POD test for Bio/Tools/Run/RemoteBlast.pm ok 767 - POD test for Bio/Tools/Run/StandAloneBlast.pm ok 768 - POD test for Bio/Tools/Run/StandAloneNCBIBlast.pm ok 769 - POD test for Bio/Tools/Run/StandAloneWUBlast.pm ok 770 - POD test for Bio/Tools/Run/WrapperBase.pm ok 771 - POD test for Bio/Tools/Run/WrapperBase/CommandExts.pm ok 772 - POD test for Bio/Tools/SeqPattern/Backtranslate.pm ok 773 - POD test for Bio/Tools/Signalp/ExtendedSignalp.pm ok 774 - POD test for Bio/Tools/Sim4/Exon.pm ok 775 - POD test for Bio/Tools/Sim4/Results.pm ok 776 - POD test for Bio/Tools/SiRNA/Ruleset/saigo.pm ok 777 - POD test for Bio/Tools/SiRNA/Ruleset/tuschl.pm ok 778 - POD test for Bio/Tools/Spidey/Exon.pm ok 779 - POD test for Bio/Tools/Spidey/Results.pm ok 780 - POD test for Bio/Tree/AlleleNode.pm ok 781 - POD test for Bio/Tree/AnnotatableNode.pm ok 782 - POD test for Bio/Tree/Compatible.pm ok 783 - POD test for Bio/Tree/DistanceFactory.pm ok 784 - POD test for Bio/Tree/Node.pm ok 785 - POD test for Bio/Tree/NodeI.pm ok 786 - POD test for Bio/Tree/NodeNHX.pm ok 787 - POD test for Bio/Tree/RandomFactory.pm ok 788 - POD test for Bio/Tree/Statistics.pm ok 789 - POD test for Bio/Tree/Tree.pm ok 790 - POD test for Bio/Tree/TreeFunctionsI.pm ok 791 - POD test for Bio/Tree/TreeI.pm ok 792 - POD test for Bio/Tree/Draw/Cladogram.pm ok 793 - POD test for Bio/TreeIO/cluster.pm ok 794 - POD test for Bio/TreeIO/lintree.pm ok 795 - POD test for Bio/TreeIO/newick.pm ok 796 - POD test for Bio/TreeIO/NewickParser.pm ok 797 - POD test for Bio/TreeIO/nexml.pm ok 798 - POD test for Bio/TreeIO/nexus.pm ok 799 - POD test for Bio/TreeIO/nhx.pm ok 800 - POD test for Bio/TreeIO/pag.pm ok 801 - POD test for Bio/TreeIO/phyloxml.pm ok 802 - POD test for Bio/TreeIO/svggraph.pm ok 803 - POD test for Bio/TreeIO/tabtree.pm ok 804 - POD test for Bio/TreeIO/TreeEventBuilder.pm ok 805 - POD test for Bio/Variation/AAChange.pm ok 806 - POD test for Bio/Variation/AAReverseMutate.pm ok 807 - POD test for Bio/Variation/Allele.pm ok 808 - POD test for Bio/Variation/DNAMutation.pm ok 809 - POD test for Bio/Variation/IO.pm ok 810 - POD test for Bio/Variation/RNAChange.pm ok 811 - POD test for Bio/Variation/SeqDiff.pm ok 812 - POD test for Bio/Variation/SNP.pm ok 813 - POD test for Bio/Variation/VariantI.pm ok 814 - POD test for Bio/Variation/IO/flat.pm ok 815 - POD test for Bio/Variation/IO/xml.pm ok 816 - POD test for scripts/Bio-DB-GFF/bp_bulk_load_gff.pl ok 817 - POD test for scripts/Bio-DB-GFF/bp_fast_load_gff.pl ok 818 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff.pl ok 819 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff3.pl ok 820 - POD test for scripts/Bio-DB-GFF/bp_generate_histogram.pl ok 821 - POD test for scripts/Bio-DB-GFF/bp_load_gff.pl ok 822 - POD test for scripts/Bio-DB-GFF/bp_meta_gff.pl ok 823 - POD test for scripts/Bio-DB-GFF/bp_process_gadfly.pl ok 824 - POD test for scripts/Bio-DB-GFF/bp_process_sgd.pl ok 825 - POD test for scripts/Bio-DB-GFF/bp_process_wormbase.pl ok 826 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl (no pod) ok 827 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl (no pod) ok 828 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl ok 829 - POD test for scripts/das/bp_das_server.pl (no pod) ok 830 - POD test for scripts/DB/bp_biofetch_genbank_proxy.pl ok 831 - POD test for scripts/DB/bp_bioflat_index.pl ok 832 - POD test for scripts/DB/bp_biogetseq.pl ok 833 - POD test for scripts/DB/bp_flanks.pl ok 834 - POD test for scripts/DB-HIV/bp_hivq.pl ok 835 - POD test for scripts/index/bp_fetch.pl ok 836 - POD test for scripts/index/bp_index.pl ok 837 - POD test for scripts/index/bp_seqret.pl ok 838 - POD test for scripts/popgen/bp_composite_LD.pl ok 839 - POD test for scripts/popgen/bp_heterogeneity_test.pl ok 840 - POD test for scripts/searchio/bp_fastam9_to_table.pl ok 841 - POD test for scripts/searchio/bp_filter_search.pl ok 842 - POD test for scripts/searchio/bp_hmmer_to_table.pl ok 843 - POD test for scripts/searchio/bp_parse_hmmsearch.pl ok 844 - POD test for scripts/searchio/bp_search2table.pl ok 845 - POD test for scripts/seq/bp_extract_feature_seq.pl ok 846 - POD test for scripts/seq/bp_make_mrna_protein.pl ok 847 - POD test for scripts/seq/bp_seqconvert.pl ok 848 - POD test for scripts/seq/bp_seqcut.pl ok 849 - POD test for scripts/seq/bp_seqpart.pl ok 850 - POD test for scripts/seq/bp_seqretsplit.pl ok 851 - POD test for scripts/seq/bp_split_seq.pl ok 852 - POD test for scripts/seq/bp_translate_seq.pl ok 853 - POD test for scripts/seq/bp_unflatten_seq.pl ok 854 - POD test for scripts/seqstats/bp_aacomp.pl ok 855 - POD test for scripts/seqstats/bp_chaos_plot.pl ok 856 - POD test for scripts/seqstats/bp_gccalc.pl ok 857 - POD test for scripts/seqstats/bp_oligo_count.pl ok 858 - POD test for scripts/taxa/bp_classify_hits_kingdom.pl ok 859 - POD test for scripts/taxa/bp_local_taxonomydb_query.pl ok 860 - POD test for scripts/taxa/bp_query_entrez_taxa.pl ok 861 - POD test for scripts/taxa/bp_taxid4species.pl ok 862 - POD test for scripts/taxa/bp_taxonomy2tree.pl ok 863 - POD test for scripts/tree/bp_blast2tree.pl ok 864 - POD test for scripts/tree/bp_nexus2nh.pl ok 865 - POD test for scripts/tree/bp_tree2pag.pl ok 866 - POD test for scripts/utilities/bp_dbsplit.pl ok 867 - POD test for scripts/utilities/bp_download_query_genbank.pl ok 868 - POD test for scripts/utilities/bp_mask_by_search.pl ok 869 - POD test for scripts/utilities/bp_mrtrans.pl ok 870 - POD test for scripts/utilities/bp_mutate.pl ok 871 - POD test for scripts/utilities/bp_netinstall.pl ok 872 - POD test for scripts/utilities/bp_nrdb.pl ok 873 - POD test for scripts/utilities/bp_pairwise_kaks.pl ok 874 - POD test for scripts/utilities/bp_remote_blast.pl ok 875 - POD test for scripts/utilities/bp_revtrans-motif.pl ok 876 - POD test for scripts/utilities/bp_search2alnblocks.pl ok 877 - POD test for scripts/utilities/bp_search2BSML.pl ok 878 - POD test for scripts/utilities/bp_search2gff.pl ok 879 - POD test for scripts/utilities/bp_search2tribe.pl ok 880 - POD test for scripts/utilities/bp_seq_length.pl ok 881 - POD test for scripts/utilities/bp_sreformat.pl ok 882 - POD test for examples/bioperl.pl (no pod) ok 883 - POD test for examples/generate_random_seq.pl (no pod) ok 884 - POD test for examples/longorf.pl ok 885 - POD test for examples/make_primers.pl (no pod) ok 886 - POD test for examples/revcom_dir.pl (no pod) ok 887 - POD test for examples/rev_and_trans.pl (no pod) ok 888 - POD test for examples/subsequence.cgi (no pod) ok 889 - POD test for examples/align/aligntutorial.pl (no pod) ok 890 - POD test for examples/align/align_on_codons.pl (no pod) ok 891 - POD test for examples/align/clustalw.pl (no pod) ok 892 - POD test for examples/align/FastAlign.pl ok 893 - POD test for examples/align/simplealign.pl (no pod) ok 894 - POD test for examples/Bio-DB-GFF/load_ucsc.pl (no pod) ok 895 - POD test for examples/cluster/dbsnp.pl (no pod) ok 896 - POD test for examples/contributed/nmrpdb_parse.pl (no pod) ok 897 - POD test for examples/contributed/prosite2perl.pl (no pod) ok 898 - POD test for examples/contributed/rebase2list.pl (no pod) ok 899 - POD test for examples/db/dbfetch ok 900 - POD test for examples/db/est_tissue_query.pl (no pod) ok 901 - POD test for examples/db/gb2features.pl (no pod) ok 902 - POD test for examples/db/getGenBank.pl (no pod) ok 903 - POD test for examples/db/get_seqs.pl (no pod) ok 904 - POD test for examples/db/rfetch.pl (no pod) ok 905 - POD test for examples/db/use_registry.pl (no pod) ok 906 - POD test for examples/liveseq/change_gene.pl (no pod) ok 907 - POD test for examples/popgen/parse_calc_stats.pl (no pod) ok 908 - POD test for examples/quality/svgtrace.pl (no pod) ok 909 - POD test for examples/root/exceptions1.pl (no pod) ok 910 - POD test for examples/root/exceptions2.pl (no pod) ok 911 - POD test for examples/root/exceptions3.pl (no pod) ok 912 - POD test for examples/root/exceptions4.pl (no pod) ok 913 - POD test for examples/root/lib/TestInterface.pm ok 914 - POD test for examples/root/lib/TestObject.pm ok 915 - POD test for examples/searchio/blast_example.pl (no pod) ok 916 - POD test for examples/searchio/custom_writer.pl (no pod) ok 917 - POD test for examples/searchio/hitwriter.pl (no pod) ok 918 - POD test for examples/searchio/hspwriter.pl (no pod) ok 919 - POD test for examples/searchio/htmlwriter.pl (no pod) ok 920 - POD test for examples/searchio/psiblast_features.pl (no pod) ok 921 - POD test for examples/searchio/psiblast_iterations.pl (no pod) ok 922 - POD test for examples/searchio/rawwriter.pl (no pod) ok 923 - POD test for examples/searchio/resultwriter.pl (no pod) ok 924 - POD test for examples/searchio/waba2gff.pl (no pod) ok 925 - POD test for examples/searchio/waba2gff3.pl ok 926 - POD test for examples/sirna/rnai_finder.cgi ok 927 - POD test for examples/structure/structure-io.pl (no pod) ok 928 - POD test for examples/tk/gsequence.pl (no pod) ok 929 - POD test for examples/tk/hitdisplay.pl (no pod) ok 930 - POD test for examples/tools/extract_genes.pl ok 931 - POD test for examples/tools/gb_to_gff.pl (no pod) ok 932 - POD test for examples/tools/gff2ps.pl ok 933 - POD test for examples/tools/parse_codeml.pl (no pod) ok 934 - POD test for examples/tools/psw.pl (no pod) ok 935 - POD test for examples/tools/reverse-translate.pl ok 936 - POD test for examples/tools/run_genscan.pl (no pod) ok 937 - POD test for examples/tools/run_primer3.pl ok 938 - POD test for examples/tools/seq_pattern.pl (no pod) ok 939 - POD test for examples/tools/standaloneblast.pl (no pod) ok 940 - POD test for examples/tree/paup2phylip.pl (no pod) ok 941 - POD test for maintenance/authors.pl ok 942 - POD test for maintenance/check_NAME.pl ok 943 - POD test for maintenance/check_URLs.pl ok 944 - POD test for maintenance/cvs2cl_by_file.pl ok 945 - POD test for maintenance/dependencies.pl ok 946 - POD test for maintenance/deprecated.pl ok 947 - POD test for maintenance/find_mod_deps.pl ok 948 - POD test for maintenance/modules.pl ok 949 - POD test for maintenance/module_usage.pl (no pod) ok 950 - POD test for maintenance/ncbi_blast_switches.pl (no pod) ok 951 - POD test for maintenance/pod.pl ok 952 - POD test for maintenance/symlink_script.pl ok 953 - POD test for maintenance/version.pl ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/PopGen/Coalescent.t .................. 1..13 ok 1 - use Bio::PopGen::Simulation::Coalescent; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 - pi ok 7 - theta ok 8 - tajimaD ok 9 - all the mutations should be polymorphic (by definition) ok 10 - fu and li D ok 11 - fu and li D* ok 12 - fu and li F ok 13 - fu and li F ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/PopGen/HtSNP.t ....................... 1..8 ok 1 - use Bio::PopGen::HtSNP; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/PopGen/MK.t .......................... 1..46 ok 1 - use Bio::AlignIO; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::PopGen::Utilities; ok 4 - An object of class 'Bio::PopGen::Statistics' isa 'Bio::PopGen::Statistics' ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 6 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population' ok 7 - Marker Names ok 8 - Number of Inds ok 9 - number of ingroup sequences ok 10 - number of outgroup1 sequences ok 11 - number of outgroup2 sequences ok 12 - NSpoly ok 13 - NSfixed ok 14 - Spoly ok 15 - Sfixed ok 16 - McDonald Kreitman ok 17 - NSpoly ok 18 - NSfixed ok 19 - Spoly ok 20 - Sfixed ok 21 - McDonald Kreitman ok 22 - NSpoly ok 23 - NSfixed ok 24 - Spoly ok 25 - Sfixed ok 26 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 27 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population' ok 28 - Marker Names ok 29 - Number of Inds ok 30 - number of ingroup sequences ok 31 - number of outgroup1 sequences ok 32 - number of outgroup2 sequences ok 33 - NSpoly ok 34 - NSfixed ok 35 - Spoly ok 36 - Sfixed ok 37 - McDonald Kreitman ok 38 - NSpoly ok 39 - NSfixed ok 40 - Spoly ok 41 - Sfixed ok 42 - McDonald Kreitman ok 43 - NSpoly ok 44 - NSfixed ok 45 - Spoly ok 46 - Sfixed ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/PopGen/PopGen.t ...................... 1..105 ok 1 - use IO::String; ok 2 - use Bio::PopGen::Individual; ok 3 - use Bio::PopGen::Genotype; ok 4 - use Bio::PopGen::Population; ok 5 - use Bio::PopGen::IO; ok 6 - use Bio::PopGen::PopStats; ok 7 - use Bio::AlignIO; ok 8 - use Bio::PopGen::Statistics; ok 9 - use Bio::PopGen::Utilities; ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 - mrsa,mssa aflp1 ok 41 - all pops, aflp1 ok 42 - mrsa,envpop aflp1,aflp2 ok 43 ok 44 ok 45 ok 46 - mssa,mrsa all_bands ok 47 - env,mssa mkr1 ok 48 - env,mssa,mrsa all bands ok 49 - env,mssa,mrsa mkr2 ok 50 - mrsa,nc all_bands ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 - Pi on 3-allele data ok 105 - Theta on 3-allele data ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/PopGen/PopGenSims.t .................. 1..23 ok 1 - use Bio::PopGen::Simulation::GeneticDrift; ok 2 - Allele freqs should sum to 1 ok 3 - Allele freqs should sum to 1 ok 4 - Allele freqs should sum to 1 ok 5 - Allele freqs should sum to 1 ok 6 - Allele freqs should sum to 1 ok 7 - Allele freqs should sum to 1 ok 8 - Allele freqs should sum to 1 ok 9 - Allele freqs should sum to 1 ok 10 - Allele freqs should sum to 1 ok 11 - Allele freqs should sum to 1 ok 12 ok 13 - All frequencies should be <= 1 ok 14 - Allele freqs should sum to 1 ok 15 - Allele freqs should sum to 1 ok 16 - Allele freqs should sum to 1 ok 17 - Allele freqs should sum to 1 ok 18 - Allele freqs should sum to 1 ok 19 - Allele freqs should sum to 1 ok 20 - Allele freqs should sum to 1 ok 21 - Allele freqs should sum to 1 ok 22 - Allele freqs should sum to 1 ok 23 - Allele freqs should sum to 1 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/PopGen/TagHaplotype.t ................ 1..3 ok 1 - use Bio::PopGen::TagHaplotype; ok 2 ok 3 ok t/RemoteDB/BioFetch.t .................. skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/CUTG.t ...................... 1..37 ok 1 - use Bio::DB::CUTG; ok 2 - use Bio::CodonUsage::Table; ok 3 - use Bio::CodonUsage::IO; ok 4 - use Bio::SeqIO; ok 5 - use Bio::Tools::SeqStats; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok t/RemoteDB/EMBL.t ...................... skipped: Network tests have not been requested t/RemoteDB/EntrezGene.t ................ skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/RemoteDB/GenBank.t ................... skipped: Network tests have not been requested t/RemoteDB/GenPept.t ................... skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/HIV/HIV.t ................... 1..30 ok 1 - use Bio::DB::HIV; ok 2 - use Bio::DB::WebDBSeqI; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - An object of class 'Bio::DB::HIV' isa 'Bio::DB::HIV' ok 5 - An object of class 'Bio::DB::HIV' isa 'Bio::Root::Root' ok 6 - Bio::DB::HIV->can(...) ok 7 - Bio::DB::HIV->can(...) ok 8 - Bio::DB::HIV->can(...) ok 9 - lanl_base set in default object ok 10 - map_db set in default object ok 11 - make_search_if set in default object ok 12 - search_ set in default object ok 13 - url_base_address set in default object ok 14 - default sequence request format (fasta) ok 15 - sorry till implemented ok 16 - sorry till implemented ok 17 - HIVQuery type exception check ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/HIV/HIVAnnotProcessor.t ..... 1..11 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::DB::HIV::HIVAnnotProcessor' ok 5 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::Root::Root' ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...) ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query') ok 8 - bad type set exception ok 9 - attach stream ok 10 - write exception ok 11 - access stream ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/HIV/HIVQuery.t .............. 1..41 ok 1 - use Bio::DB::Query::HIVQuery; ok 2 - use Bio::DB::HIV; ok 3 - use Bio::Annotation::Collection; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::Reference; ok 6 - use Bio::DB::HIV::HIVQueryHelper; ok 7 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::DB::Query::HIVQuery' ok 8 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::Root::Root' ok 9 - Bio::DB::Query::HIVQuery->can(...) ok 10 - Bio::DB::Query::HIVQuery->can(...) ok 11 - Bio::DB::Query::HIVQuery->can(...) ok 12 - _map_db_uri set in default object ok 13 - _make_search_if_uri set in default object ok 14 - _search_uri set in default object ok 15 - _schema_file set in default object ok 16 - _run_option set in default object ok 17 - annotations container available ok 18 - query syntax check 1 ok 19 - query syntax check 2 ok 20 - query syntax check 3 ok 21 - query parser check ok 22 - multiquery parse check ok 23 - use HTML::Parser; ok 24 - help html to file ok 25 - help html parsed ok 26 - bad field exception check ok 27 - bad match data exception check ok 28 - empty field not ok exception check ok 29 - uninitialized schema exception check ok 30 - query not run (level 1) warning check ok 31 - query not run (level 2) warning check ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/HIV/HIVQueryHelper.t ........ 1..40 ok 1 - use Bio::DB::HIV::HIVQueryHelper; ok 2 - An object of class 'HIVSchema' isa 'HIVSchema' ok 3 - An object of class 'QRY' isa 'QRY' ok 4 - An object of class 'R' isa 'R' ok 5 - An object of class 'Q' isa 'Q' ok 6 - schema load ok 7 - HIVSchema->can(...) ok 8 - fields complete ok 9 - tables complete ok 10 - aliases complete ok 11 ok 12 - test field syntax ok ok 13 - test field syntax ok ok 14 - test alias by field name ok 15 - correct primary key for SequenceEntry ok 16 - correct number of foreign keys for AUthor ok 17 - correct foreign table for au_pub_id ok 18 - correct annotation key hash ok 19 - QRY->can(...) ok 20 - R->can(...) ok 21 - Q->can(...) ok 22 - null QRY ok 23 - null R (request object) ok 24 - null Q (atomic query object) ok 25 - R obj create and init (1) ok 26 - R obj create and init (2) ok 27 - R::In ok 28 - !R::In ok 29 - R::Eq ok 30 - QRY obj create and init (1) ok 31 - QRY obj create and init (2) ok 32 - QRY obj create and init (3) ok 33 - QRY overload | ok 34 - QRY overload & ok 35 - QRY nontrivial & ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]} ok 37 - make: 2 queries returned ok 38 - {annotation fields} parsed correctly ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]} ok 40 - above query is null ok t/RemoteDB/MeSH.t ...................... skipped: Network tests have not been requested t/RemoteDB/Query/GenBank.t ............. skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/RefSeq.t .................... 1..16 ok 1 - use Bio::DB::RefSeq; ok 2 - use Bio::DB::GenBank; ok 3 - use Bio::DB::EMBL; ok 4 ok 5 ok 6 ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok t/RemoteDB/SeqHound.t .................. skipped: Network tests have not been requested t/RemoteDB/SeqRead_fail.t .............. skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/RemoteDB/SeqVersion.t ................ ok 1 - use Bio::DB::SeqVersion; ok 2 ok 3 # skip Network tests have not been requested ok 4 # skip Network tests have not been requested ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested 1..10 ok t/RemoteDB/SwissProt.t ................. skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio\DB\Taxonomy\flatfile.pm line 88. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 88. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:294 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:118 STACK: t/RemoteDB/Taxonomy.t:28 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (you may need to install the DB_File module) (@INC contains: . C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\lib C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK\blib\arch C:/cpanfly-5.18/var/cpan/build/BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\cpan\build\BioPerl-1.6.922-rDJ2XK C:\cpanfly-5.18\var\megalib C:/cpanfly-5.18/var/megalib C:/Perl-5.18/site/lib C:/Perl-5.18/lib) at Bio\DB\Taxonomy\flatfile.pm line 88. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 88. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:294 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:118 STACK: t/RemoteDB/Taxonomy.t:28 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/RemoteDB/Taxonomy.t line 28. # Failed test 'undef isa 'Bio::DB::Taxonomy::flatfile'' # at t/RemoteDB/Taxonomy.t line 33. # undef isn't defined # Failed test 'undef isa 'Bio::DB::Taxonomy'' # at t/RemoteDB/Taxonomy.t line 34. # undef isn't defined ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Attempt to reload Bio\DB\Taxonomy\flatfile.pm aborted. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:294 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:118 STACK: t/RemoteDB/Taxonomy.t:36 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Attempt to reload Bio\DB\Taxonomy\flatfile.pm aborted. Compilation failed in require at Bio/Root/Root.pm line 558. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:486 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:560 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:294 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:118 STACK: t/RemoteDB/Taxonomy.t:36 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/RemoteDB/Taxonomy.t line 36. Can't call method "get_num_taxa" on an undefined value at t/RemoteDB/Taxonomy.t line 53. # Looks like you planned 191 tests but ran 55. # Looks like you failed 4 tests of 55 run. # Looks like your test exited with 2 just after 55. t/RemoteDB/Taxonomy.t .................. 1..191 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::entrez' isa 'Bio::DB::Taxonomy::entrez' ok 5 - An object of class 'Bio::DB::Taxonomy::entrez' isa 'Bio::DB::Taxonomy' not ok 6 not ok 7 - undef isa 'Bio::DB::Taxonomy::flatfile' not ok 8 - undef isa 'Bio::DB::Taxonomy' not ok 9 ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok 42 # skip Network tests have not been requested ok 43 # skip Network tests have not been requested ok 44 # skip Network tests have not been requested ok 45 # skip Network tests have not been requested ok 46 # skip Network tests have not been requested ok 47 # skip Network tests have not been requested ok 48 # skip Network tests have not been requested ok 49 # skip Network tests have not been requested ok 50 # skip Network tests have not been requested ok 51 # skip Network tests have not been requested ok 52 # skip Network tests have not been requested ok 53 # skip Network tests have not been requested ok 54 # skip Network tests have not been requested ok 55 # skip Network tests have not been requested Dubious, test returned 2 (wstat 512, 0x200) Failed 140/191 subtests (less 46 skipped subtests: 5 okay) # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Restriction/Analysis-refac.t ......... 1..91 ok 1 - use Bio::Restriction::IO; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Restriction::EnzymeCollection; ok 4 - use Bio::Restriction::Enzyme; ok 5 - read withrefm file ok 6 - parse withrefm file ok 7 - HindIII: nonambiguous intrasite cutter ok 8 - AarI: nonambiguous extrasite cutter ok 9 - AasI: ambiguous intrasite cutter ok 10 - BceSI: ambiguous extrasite cutter ok 11 - AjuI: cutter with central recog site ok 12 - TaqII: multi-extrasite cutter ok 13 ok 14 - HindIII plus ok 15 - HindIII minus ok 16 - AasI plus ok 17 - AasI minus ok 18 - AarI plus ok 19 - AarI minus ok 20 - BceSI plus ok 21 - BceSI minus ok 22 - AjuI plus ok 23 - AjuI minus ok 24 - TaqII plus ok 25 - TaqII minus ok 26 - build real B:R::Analysis object ok 27 - 13 fragments ok 28 - circularize ok 29 - recut ok 30 - circ: AasI # site at origin ok 31 - circ: still 13 fragments (cut site at origin) ok 32 - use Bio::Restriction::IO; ok 33 - use Bio::Restriction::Analysis; ok 34 - read withrefm file ok 35 - parse withrefm file ok 36 - Collection initiated ok 37 - AbeI: found ok into collection ok 38 - AccBSI: found ok into collection ok 39 - AciI: found ok into collection ok 40 - Asp26HI: found ok into collection ok 41 - BmgBI: found ok into collection ok 42 - AbeI plus ok 43 - AbeI minus ok 44 - AbeI fragment ok 45 - AbeI positions ok 46 - AbeI Overhang ok 47 - AbeI name ok 48 - AbeI site ok 49 - AbeI revcom_site ok 50 - AbeI cut ok 51 - AbeI complementary_cut ok 52 - AccBSI plus ok 53 - AccBSI minus ok 54 - AccBSI fragment ok 55 - AccBSI positions ok 56 - AccBSI Overhang ok 57 - AccBSI name ok 58 - AccBSI site ok 59 - AccBSI revcom_site ok 60 - AccBSI cut ok 61 - AccBSI complementary_cut ok 62 - AciI plus ok 63 - AciI minus ok 64 - AciI fragment ok 65 - AciI positions ok 66 - AciI Overhang ok 67 - AciI name ok 68 - AciI site ok 69 - AciI revcom_site ok 70 - AciI cut ok 71 - AciI complementary_cut ok 72 - Asp26HI plus ok 73 - Asp26HI minus ok 74 - Asp26HI fragment ok 75 - Asp26HI positions ok 76 - Asp26HI Overhang ok 77 - Asp26HI name ok 78 - Asp26HI site ok 79 - Asp26HI revcom_site ok 80 - Asp26HI cut ok 81 - Asp26HI complementary_cut ok 82 - BmgBI plus ok 83 - BmgBI minus ok 84 - BmgBI fragment ok 85 - BmgBI positions ok 86 - BmgBI Overhang ok 87 - BmgBI name ok 88 - BmgBI site ok 89 - BmgBI revcom_site ok 90 - BmgBI cut ok 91 - BmgBI complementary_cut ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Restriction/Analysis.t ............... 1..182 ok 1 - use Bio::Restriction::Enzyme; ok 2 - use Bio::Restriction::Enzyme::MultiCut; ok 3 - use Bio::Restriction::Enzyme::MultiSite; ok 4 - use Bio::Restriction::EnzymeCollection; ok 5 - use Bio::Restriction::Analysis; ok 6 - use Bio::SeqIO; ok 7 ok 8 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::EnzymeI' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - bug 2179 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI' ok 77 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI' ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI' ok 88 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI' ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme' ok 100 ok 101 ok 102 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme' ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 - number of unique cutters ok 119 - number of RsaI fragments ok 120 - number of maximum cutters ok 121 - number of zero cutters ok 122 - number of cutters ok 123 - number of 3x cutters ok 124 - 4 MseI fragments ok 125 - 3 MseI cut sites ok 126 - expected 2 PspEI fragments ok 127 ok 128 ok 129 - expected 2 sizes for PspEI ok 130 ok 131 - expected 2 sizes for PspEI ok 132 ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut ok 134 ok 135 ok 136 - number of RsaI fragments ok 137 - 3 circular MseI fragments ok 138 - 3 circular MseI cut sites ok 139 - number for AciI a non-palindromic enzyme ok 140 - 1 fragment for MwoI as it cuts across the circ point ok 141 ok 142 ok 143 ok 144 ok 145 - 7 fragments in the multiple digest ok 146 - 7 positions in the multiple digest ok 147 - 7 sizes in the multiple digest ok 148 ok 149 - expected 9 cuts for HindI ok 150 - expect 9 fragment maps for HindI ok 151 - sequence for GT ok 152 - start at 40 ok 153 - end at 41 ok 154 - sequence for GGATTAAAAAAAGAGT ok 155 - start at 42 ok 156 - end at 57 ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT ok 158 - start at 58 ok 159 - end at 92 ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA ok 161 - start at 93 ok 162 - end at 123 ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA ok 164 - start at 124 ok 165 - end at 155 ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA ok 167 - start at 156 ok 168 - end at 181 ok 169 - sequence for CAACATCCATGAAACGCATTAGCA ok 170 - start at 182 ok 171 - end at 205 ok 172 - sequence for CCA ok 173 - start at 206 ok 174 - end at 208 ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT ok 176 - start at 209 ok 177 - end at 39 ok 178 ok 179 - bug 2139 ok 180 - number of HindIII fragments ok 181 - number of EcoRI fragments ok 182 - number of RsaI fragments ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Restriction/Gel.t .................... 1..9 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Tools::Gel; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Restriction/IO.t ..................... 1..18 ok 1 - use Bio::Restriction::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT! # Failed (TODO) test at t/Restriction/IO.t line 31. ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Root/Exception.t ..................... 1..8 ok 1 - use TestObject; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Root/HTTPget.t ....................... skipped: Network tests have not been requested # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Root/RootI.t ......................... 1..63 ok 1 - use Bio::Root::Root; ok 2 - use Bio::Seq; ok 3 ok 4 - An object of class 'Bio::Root::Root' isa 'Bio::Root::RootI' ok 5 - threw Regexp ((?^:Testing throw)) ok 6 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented)) ok 7 - threw Regexp ((?^:EXCEPTION )) ok 8 - threw Regexp ((?^:Testing throw)) ok 9 ok 10 - threw Regexp ((?^:Testing throw)) ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - simple ok 17 - simple ok 18 - warns for versions below current version 1.006922 ok 19 - warns for versions below current version 1.006922 ok 20 - throws for versions above 1.006922 ok 21 - throws for versions above 1.006922 ok 22 - throws for versions equal to 1.006922 ok 23 - simple ok 24 - simple ok 25 - warns for versions below current version 1.006922 ok 26 - warns for versions below current version 1.006922 ok 27 - throws for versions above 1.006922 ok 28 - throws for versions above 1.006922 ok 29 - arg callable since method was created ok 30 - mal-formed arg callable since method was created with good name ok 31 - Bio::Foo2->can('t3') ok 32 - Methods don't pollute original Bio::Root::Root namespace ok 33 - Bio::Foo2->can('test_4') ok 34 - Methods don't pollute original Bio::Root::Root namespace ok 35 - Bio::Foo3->can('t5') ok 36 - arg not in method list not created ok 37 - Bio::Foo3->can('t5') ok 38 - Methods don't pollute original Bio::Root::Root namespace ok 39 - verbose was set correctly ok 40 - synonym was set correctly ok 41 - real method of synonym was set correctly ok 42 - mal-formed arg correctly resolved to created method ok 43 - synonym of set method was set correctly ok 44 - Bio::Foo4->can('t7') ok 45 - Methods don't pollute original Bio::Root::Root namespace ok 46 - Bio::Foo4->can('test7') ok 47 - Methods don't pollute original Bio::Root::Root namespace ok 48 - Bio::Foo4->can('test_8') ok 49 - Methods don't pollute original Bio::Root::Root namespace ok 50 - Bio::Foo4->can('t8') ok 51 - Methods don't pollute original Bio::Root::Root namespace ok 52 - clone ok 53 - clone ok 54 - clone ok 55 - clone changed, original didn't ok 56 - parameters passed to clone() modify object ok 57 - original is not modified ok 58 - must use proper versioning scheme ok 59 - warns for versions >= 1.006922 ok 60 - warns for versions >= 1.006922 ok 61 - throws for versions >= 1.006922 ok 62 - throws for versions >= 1.006922 ok 63 - No warnings/exceptions below 1.006922 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 # Failed test 'executable file' # at t/Root/RootIO.t line 59. Can't do inplace edit without backup at Bio/Root/IO.pm line 570. Error removing C:/cpanfly-5.18/var/tmp/RxU3Lh3oeQ at C:\cpanfly-5.18\var\megalib/File/Temp.pm line 762. # Looks like you planned 77 tests but ran 45. # Looks like you failed 1 test of 45 run. # Looks like your test exited with 25 just after 45. t/Root/RootIO.t ........................ 1..77 ok 1 - use Bio::Root::IO; ok 2 - use Bio::SeqIO; ok 3 - use Bio::Assembly::IO; ok 4 ok 5 - throw() ok 6 - throw() verbose(-1) ok 7 - warn() ok 8 - throw() verbose(1) ok 9 - stack_trace() ok 10 - set verbosity to 1 ok 11 ok 12 not ok 13 - executable file ok 14 - non-executable file ok 15 - executable dir ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - filename, read ok 22 ok 23 ok 24 - filename, write ok 25 ok 26 ok 27 ok 28 ok 29 - handle, read ok 30 ok 31 ok 32 - handle, write ok 33 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 34 - is a write handle ok 35 - no warnings in ->close call ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - _print ok 45 Dubious, test returned 25 (wstat 6400, 0x1900) Failed 33/77 subtests # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Root/Storable.t ...................... 1..35 ok 1 - use Bio::Root::Storable; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Root/Tempfile.t ...................... 1..18 ok 1 - use Bio::Root::IO; ok 2 ok 3 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 4 ok 5 ok 6 - auto UNLINK => 1 ok 7 ok 8 ok 9 - tempfile deleted ok 10 ok 11 - UNLINK => 0 ok 12 ok 13 ok 14 ok 15 - tempfile suffix ok 16 ok 17 - tempfile() in scalar context ok 18 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/Root/Utilities.t ..................... 1..56 ok 1 - use Bio::Root::Utilities; ok 2 - An object of class 'Bio::Root::Utilities' isa 'Bio::Root::Utilities' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - file_date() ok 38 - unix (\n or 012 or ^J) ok 39 - date format ok 40 - date format ok 41 - date format ok 42 - date format ok 43 - date format ok 44 ok 45 # skip gzip not found, skipping gzip tests ok 46 # skip gzip not found, skipping gzip tests ok 47 # skip gzip not found, skipping gzip tests ok 48 # skip gzip not found, skipping gzip tests ok 49 # skip gzip not found, skipping gzip tests ok 50 # skip gzip not found, skipping gzip tests ok 51 # skip gzip not found, skipping gzip tests ok 52 # skip gzip not found, skipping gzip tests ok 53 # skip gzip not found, skipping gzip tests ok 54 # skip gzip not found, skipping gzip tests ok 55 # skip gzip not found, skipping gzip tests ok 56 # skip gzip not found, skipping gzip tests ok t/SearchDist.t ......................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/CigarString.t ............... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/SearchIO.t .................. 1..19 ok 1 - use Bio::SearchIO; ok 2 - fasta for f.fa ok 3 - blast for filename.bls ok 4 - blastxml for f.blastxml ok 5 - fasta for f.fx ok 6 - fasta for f.fy ok 7 - blast for f.blx ok 8 - fasta for f.m9 ok 9 - fasta for f.ssearch ok 10 - blast for f.tblx ok 11 - blast for filename.blast ok 12 - fasta for f.osearch ok 13 - exonerate for f.exonerate ok 14 - fasta for f.psearch ok 15 - blast for fast.bls ok 16 - fasta for f.SSEARCH.m9 ok 17 - blastxml for f.xml ok 18 - fasta for f.fasta ok 19 - exonerate for f.exon ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/SimilarityPair.t ............ 1..12 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SeqIO; ok 3 ok 4 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 5 ok 6 - An object of class 'Bio::SearchIO::blast' isa 'Bio::SearchIO' ok 7 ok 8 - An object of class 'Bio::Search::Hit::BlastHit' isa 'Bio::Search::Hit::HitI' ok 9 ok 10 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 11 ok 12 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/Tiling.t .................... 1..1141 ok 1 - use Bio::Search::Tiling::MapTiling; ok 2 - use Bio::Search::Tiling::MapTileUtils; ok 3 - use Bio::SearchIO; ok 4 - use Bio::Search::Hit::BlastHit; ok 5 - use File::Spec; ok 6 - parse data file ok 7 - got test hit ok 8 - create tiling ok 9 - An object of class 'Bio::Search::Tiling::MapTiling' isa 'Bio::Search::Tiling::TilingI' ok 10 - implements 'next_tiling' ok 11 - implements 'rewind_tilings' ok 12 - implements 'identities' ok 13 - implements 'conserved' ok 14 - implements 'length' ok 15 - identities regression test ok 16 - conserved regression test ok 17 - tiling iterator regression test(1) ok 18 - tiling iterator regression test(2) ok 19 - tiling iterator regression test(3, rewind) ok 20 - ecolitst.wublastp ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - dnaEbsub_ecoli.wublastx ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - tricky.wublast ok 37 - tricky.wublast(1) ok 38 - tricky.wublast(2) ok 39 - tricky.wublast(3) ok 40 - tricky.wublast(4) ok 41 - ecolitst.bls ok 42 - tile ecolitst.bls hit 1 \#hsps 1 ok 43 - q id: est (0.98293) = fast (0.98293) ok 44 - q cn: est (0.98293) = fast (0.98293) ok 45 - h id: est (0.98293) = fast (0.98293) ok 46 - h cn: est (0.98293) = fast (0.98293) ok 47 - tile ecolitst.bls hit 2 \#hsps 1 ok 48 - q id: est (0.30074) = fast (0.30074) ok 49 - q cn: est (0.49876) = fast (0.49876) ok 50 - h id: est (0.30759) = fast (0.30759) ok 51 - h cn: est (0.51013) = fast (0.51013) ok 52 - tile ecolitst.bls hit 3 \#hsps 1 ok 53 - q id: est (0.31004) = fast (0.31004) ok 54 - q cn: est (0.49782) = fast (0.49782) ok 55 - h id: est (0.32054) = fast (0.32054) ok 56 - h cn: est (0.51467) = fast (0.51467) ok 57 - tile ecolitst.bls hit 4 \#hsps 1 ok 58 - q id: est (0.30435) = fast (0.30435) ok 59 - q cn: est (0.47826) = fast (0.47826) ok 60 - h id: est (0.29787) = fast (0.29787) ok 61 - h cn: est (0.46809) = fast (0.46809) ok 62 - tricky.wublast ok 63 - tile tricky.wublast hit 1 \#hsps 7 ok 64 - q id: exact (0.22153) ~ est (0.22153) ok 65 - q id: exact (0.22153) <= max (0.22153) ok 66 - q cn: exact (0.42760) ~ est (0.42760) ok 67 - q cn: exact (0.42760) <= max (0.42760) ok 68 - h id: exact (0.22704) ~ est (0.22704) ok 69 - h id: exact (0.22704) <= max (0.22704) ok 70 - h cn: exact (0.43335) ~ est (0.43335) ok 71 - h cn: exact (0.43335) <= max (0.43335) ok 72 - a_thaliana.blastn ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1 ok 74 - q id: est (0.96667) = fast (0.96667) ok 75 - q cn: est (0.96667) = fast (0.96667) ok 76 - h id: est (0.98305) = fast (0.98305) ok 77 - h cn: est (0.98305) = fast (0.98305) ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1 ok 79 - q id: est (0.96667) = fast (0.96667) ok 80 - q cn: est (0.96667) = fast (0.96667) ok 81 - h id: est (0.98305) = fast (0.98305) ok 82 - h cn: est (0.98305) = fast (0.98305) ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1 ok 84 - q id: est (1.00000) = fast (1.00000) ok 85 - q cn: est (1.00000) = fast (1.00000) ok 86 - h id: est (1.00000) = fast (1.00000) ok 87 - h cn: est (1.00000) = fast (1.00000) ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1 ok 89 - q id: est (1.00000) = fast (1.00000) ok 90 - q cn: est (1.00000) = fast (1.00000) ok 91 - h id: est (1.00000) = fast (1.00000) ok 92 - h cn: est (1.00000) = fast (1.00000) ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1 ok 94 - q id: est (0.92308) = fast (0.92308) ok 95 - q cn: est (0.92308) = fast (0.92308) ok 96 - h id: est (0.92308) = fast (0.92308) ok 97 - h cn: est (0.92308) = fast (0.92308) ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1 ok 99 - q id: est (1.00000) = fast (1.00000) ok 100 - q cn: est (1.00000) = fast (1.00000) ok 101 - h id: est (1.00000) = fast (1.00000) ok 102 - h cn: est (1.00000) = fast (1.00000) ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1 ok 104 - q id: est (1.00000) = fast (1.00000) ok 105 - q cn: est (1.00000) = fast (1.00000) ok 106 - h id: est (1.00000) = fast (1.00000) ok 107 - h cn: est (1.00000) = fast (1.00000) ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1 ok 109 - q id: est (1.00000) = fast (1.00000) ok 110 - q cn: est (1.00000) = fast (1.00000) ok 111 - h id: est (1.00000) = fast (1.00000) ok 112 - h cn: est (1.00000) = fast (1.00000) ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1 ok 114 - q id: est (1.00000) = fast (1.00000) ok 115 - q cn: est (1.00000) = fast (1.00000) ok 116 - h id: est (1.00000) = fast (1.00000) ok 117 - h cn: est (1.00000) = fast (1.00000) ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1 ok 119 - q id: est (1.00000) = fast (1.00000) ok 120 - q cn: est (1.00000) = fast (1.00000) ok 121 - h id: est (1.00000) = fast (1.00000) ok 122 - h cn: est (1.00000) = fast (1.00000) ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1 ok 124 - q id: est (1.00000) = fast (1.00000) ok 125 - q cn: est (1.00000) = fast (1.00000) ok 126 - h id: est (1.00000) = fast (1.00000) ok 127 - h cn: est (1.00000) = fast (1.00000) ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1 ok 129 - q id: est (1.00000) = fast (1.00000) ok 130 - q cn: est (1.00000) = fast (1.00000) ok 131 - h id: est (1.00000) = fast (1.00000) ok 132 - h cn: est (1.00000) = fast (1.00000) ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1 ok 134 - q id: est (1.00000) = fast (1.00000) ok 135 - q cn: est (1.00000) = fast (1.00000) ok 136 - h id: est (1.00000) = fast (1.00000) ok 137 - h cn: est (1.00000) = fast (1.00000) ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1 ok 139 - q id: est (1.00000) = fast (1.00000) ok 140 - q cn: est (1.00000) = fast (1.00000) ok 141 - h id: est (1.00000) = fast (1.00000) ok 142 - h cn: est (1.00000) = fast (1.00000) ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1 ok 144 - q id: est (1.00000) = fast (1.00000) ok 145 - q cn: est (1.00000) = fast (1.00000) ok 146 - h id: est (1.00000) = fast (1.00000) ok 147 - h cn: est (1.00000) = fast (1.00000) ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1 ok 149 - q id: est (1.00000) = fast (1.00000) ok 150 - q cn: est (1.00000) = fast (1.00000) ok 151 - h id: est (1.00000) = fast (1.00000) ok 152 - h cn: est (1.00000) = fast (1.00000) ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1 ok 154 - q id: est (1.00000) = fast (1.00000) ok 155 - q cn: est (1.00000) = fast (1.00000) ok 156 - h id: est (1.00000) = fast (1.00000) ok 157 - h cn: est (1.00000) = fast (1.00000) ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1 ok 159 - q id: est (1.00000) = fast (1.00000) ok 160 - q cn: est (1.00000) = fast (1.00000) ok 161 - h id: est (1.00000) = fast (1.00000) ok 162 - h cn: est (1.00000) = fast (1.00000) ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1 ok 164 - q id: est (1.00000) = fast (1.00000) ok 165 - q cn: est (1.00000) = fast (1.00000) ok 166 - h id: est (1.00000) = fast (1.00000) ok 167 - h cn: est (1.00000) = fast (1.00000) ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1 ok 169 - q id: est (0.95238) = fast (0.95238) ok 170 - q cn: est (0.95238) = fast (0.95238) ok 171 - h id: est (0.95238) = fast (0.95238) ok 172 - h cn: est (0.95238) = fast (0.95238) ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1 ok 174 - q id: est (1.00000) = fast (1.00000) ok 175 - q cn: est (1.00000) = fast (1.00000) ok 176 - h id: est (1.00000) = fast (1.00000) ok 177 - h cn: est (1.00000) = fast (1.00000) ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1 ok 179 - q id: est (0.95238) = fast (0.95238) ok 180 - q cn: est (0.95238) = fast (0.95238) ok 181 - h id: est (0.95238) = fast (0.95238) ok 182 - h cn: est (0.95238) = fast (0.95238) ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1 ok 184 - q id: est (1.00000) = fast (1.00000) ok 185 - q cn: est (1.00000) = fast (1.00000) ok 186 - h id: est (1.00000) = fast (1.00000) ok 187 - h cn: est (1.00000) = fast (1.00000) ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1 ok 189 - q id: est (0.95238) = fast (0.95238) ok 190 - q cn: est (0.95238) = fast (0.95238) ok 191 - h id: est (0.95238) = fast (0.95238) ok 192 - h cn: est (0.95238) = fast (0.95238) ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1 ok 194 - q id: est (1.00000) = fast (1.00000) ok 195 - q cn: est (1.00000) = fast (1.00000) ok 196 - h id: est (1.00000) = fast (1.00000) ok 197 - h cn: est (1.00000) = fast (1.00000) ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1 ok 199 - q id: est (1.00000) = fast (1.00000) ok 200 - q cn: est (1.00000) = fast (1.00000) ok 201 - h id: est (1.00000) = fast (1.00000) ok 202 - h cn: est (1.00000) = fast (1.00000) ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1 ok 204 - q id: est (1.00000) = fast (1.00000) ok 205 - q cn: est (1.00000) = fast (1.00000) ok 206 - h id: est (1.00000) = fast (1.00000) ok 207 - h cn: est (1.00000) = fast (1.00000) ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1 ok 209 - q id: est (1.00000) = fast (1.00000) ok 210 - q cn: est (1.00000) = fast (1.00000) ok 211 - h id: est (1.00000) = fast (1.00000) ok 212 - h cn: est (1.00000) = fast (1.00000) ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1 ok 214 - q id: est (1.00000) = fast (1.00000) ok 215 - q cn: est (1.00000) = fast (1.00000) ok 216 - h id: est (1.00000) = fast (1.00000) ok 217 - h cn: est (1.00000) = fast (1.00000) ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1 ok 219 - q id: est (1.00000) = fast (1.00000) ok 220 - q cn: est (1.00000) = fast (1.00000) ok 221 - h id: est (1.00000) = fast (1.00000) ok 222 - h cn: est (1.00000) = fast (1.00000) ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1 ok 224 - q id: est (1.00000) = fast (1.00000) ok 225 - q cn: est (1.00000) = fast (1.00000) ok 226 - h id: est (1.00000) = fast (1.00000) ok 227 - h cn: est (1.00000) = fast (1.00000) ok 228 - brassica_ATH.WUBLASTN ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3 ok 230 - q id: exact (0.82465) ~ est (0.82343) ok 231 - q id: exact (0.82465) <= max (0.83333) ok 232 - q cn: exact (0.85590) ~ est (0.85312) ok 233 - q cn: exact (0.85590) <= max (0.86458) ok 234 - h id: exact (0.83920) ~ est (0.83920) ok 235 - h id: exact (0.83920) <= max (0.83920) ok 236 - h cn: exact (0.86935) ~ est (0.86935) ok 237 - h cn: exact (0.86935) <= max (0.86935) ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2 ok 239 - q id: exact (0.82486) ~ est (0.82486) ok 240 - q id: exact (0.82486) <= max (0.82486) ok 241 - q cn: exact (0.85122) ~ est (0.85122) ok 242 - q cn: exact (0.85122) <= max (0.85122) ok 243 - h id: exact (0.82955) ~ est (0.82955) ok 244 - h id: exact (0.82955) <= max (0.82955) ok 245 - h cn: exact (0.85606) ~ est (0.85606) ok 246 - h cn: exact (0.85606) <= max (0.85606) ok 247 - no_hsps.blastp ok 248 - tile no_hsps.blastp hit 1 \#hsps 0 ok 249 - tile no_hsps.blastp hit 2 \#hsps 0 ok 250 - tile no_hsps.blastp hit 3 \#hsps 0 ok 251 - tile no_hsps.blastp hit 4 \#hsps 0 ok 252 - tile no_hsps.blastp hit 5 \#hsps 0 ok 253 - tile no_hsps.blastp hit 6 \#hsps 0 ok 254 - tile no_hsps.blastp hit 7 \#hsps 0 ok 255 - tile no_hsps.blastp hit 8 \#hsps 0 ok 256 - tile no_hsps.blastp hit 9 \#hsps 0 ok 257 - tile no_hsps.blastp hit 10 \#hsps 0 ok 258 - tile no_hsps.blastp hit 11 \#hsps 0 ok 259 - tile no_hsps.blastp hit 12 \#hsps 0 ok 260 - tile no_hsps.blastp hit 13 \#hsps 0 ok 261 - tile no_hsps.blastp hit 14 \#hsps 0 ok 262 - tile no_hsps.blastp hit 15 \#hsps 0 ok 263 - tile no_hsps.blastp hit 16 \#hsps 0 ok 264 - tile no_hsps.blastp hit 17 \#hsps 0 ok 265 - tile no_hsps.blastp hit 18 \#hsps 0 ok 266 - tile no_hsps.blastp hit 19 \#hsps 0 ok 267 - tile no_hsps.blastp hit 20 \#hsps 0 ok 268 - tile no_hsps.blastp hit 21 \#hsps 0 ok 269 - tile no_hsps.blastp hit 22 \#hsps 0 ok 270 - tile no_hsps.blastp hit 23 \#hsps 0 ok 271 - tile no_hsps.blastp hit 24 \#hsps 0 ok 272 - tile no_hsps.blastp hit 25 \#hsps 0 ok 273 - tile no_hsps.blastp hit 26 \#hsps 0 ok 274 - tile no_hsps.blastp hit 27 \#hsps 0 ok 275 - tile no_hsps.blastp hit 28 \#hsps 0 ok 276 - tile no_hsps.blastp hit 29 \#hsps 0 ok 277 - tile no_hsps.blastp hit 30 \#hsps 0 ok 278 - tile no_hsps.blastp hit 31 \#hsps 0 ok 279 - tile no_hsps.blastp hit 32 \#hsps 0 ok 280 - tile no_hsps.blastp hit 33 \#hsps 0 ok 281 - tile no_hsps.blastp hit 34 \#hsps 0 ok 282 - tile no_hsps.blastp hit 35 \#hsps 0 ok 283 - tile no_hsps.blastp hit 36 \#hsps 0 ok 284 - tile no_hsps.blastp hit 37 \#hsps 0 ok 285 - tile no_hsps.blastp hit 38 \#hsps 0 ok 286 - tile no_hsps.blastp hit 39 \#hsps 0 ok 287 - tile no_hsps.blastp hit 40 \#hsps 0 ok 288 - tile no_hsps.blastp hit 41 \#hsps 0 ok 289 - tile no_hsps.blastp hit 42 \#hsps 0 ok 290 - tile no_hsps.blastp hit 43 \#hsps 0 ok 291 - tile no_hsps.blastp hit 44 \#hsps 0 ok 292 - tile no_hsps.blastp hit 45 \#hsps 0 ok 293 - tile no_hsps.blastp hit 46 \#hsps 0 ok 294 - tile no_hsps.blastp hit 47 \#hsps 0 ok 295 - tile no_hsps.blastp hit 48 \#hsps 0 ok 296 - tile no_hsps.blastp hit 49 \#hsps 0 ok 297 - tile no_hsps.blastp hit 50 \#hsps 0 ok 298 - tile no_hsps.blastp hit 51 \#hsps 0 ok 299 - tile no_hsps.blastp hit 52 \#hsps 0 ok 300 - tile no_hsps.blastp hit 53 \#hsps 0 ok 301 - tile no_hsps.blastp hit 54 \#hsps 0 ok 302 - tile no_hsps.blastp hit 55 \#hsps 0 ok 303 - tile no_hsps.blastp hit 56 \#hsps 0 ok 304 - tile no_hsps.blastp hit 57 \#hsps 0 ok 305 - tile no_hsps.blastp hit 58 \#hsps 0 ok 306 - tile no_hsps.blastp hit 59 \#hsps 0 ok 307 - tile no_hsps.blastp hit 60 \#hsps 0 ok 308 - tile no_hsps.blastp hit 61 \#hsps 0 ok 309 - tile no_hsps.blastp hit 62 \#hsps 0 ok 310 - tile no_hsps.blastp hit 63 \#hsps 0 ok 311 - tile no_hsps.blastp hit 64 \#hsps 0 ok 312 - tile no_hsps.blastp hit 65 \#hsps 0 ok 313 - tile no_hsps.blastp hit 66 \#hsps 0 ok 314 - tile no_hsps.blastp hit 67 \#hsps 0 ok 315 - tile no_hsps.blastp hit 68 \#hsps 0 ok 316 - tile no_hsps.blastp hit 69 \#hsps 0 ok 317 - tile no_hsps.blastp hit 70 \#hsps 0 ok 318 - tile no_hsps.blastp hit 71 \#hsps 0 ok 319 - tile no_hsps.blastp hit 72 \#hsps 0 ok 320 - tile no_hsps.blastp hit 73 \#hsps 0 ok 321 - tile no_hsps.blastp hit 74 \#hsps 0 ok 322 - tile no_hsps.blastp hit 75 \#hsps 0 ok 323 - tile no_hsps.blastp hit 76 \#hsps 0 ok 324 - tile no_hsps.blastp hit 77 \#hsps 0 ok 325 - tile no_hsps.blastp hit 78 \#hsps 0 ok 326 - tile no_hsps.blastp hit 79 \#hsps 0 ok 327 - tile no_hsps.blastp hit 80 \#hsps 0 ok 328 - tile no_hsps.blastp hit 81 \#hsps 0 ok 329 - tile no_hsps.blastp hit 82 \#hsps 0 ok 330 - tile no_hsps.blastp hit 83 \#hsps 0 ok 331 - tile no_hsps.blastp hit 84 \#hsps 0 ok 332 - tile no_hsps.blastp hit 85 \#hsps 0 ok 333 - tile no_hsps.blastp hit 86 \#hsps 0 ok 334 - tile no_hsps.blastp hit 87 \#hsps 0 ok 335 - tile no_hsps.blastp hit 88 \#hsps 0 ok 336 - tile no_hsps.blastp hit 89 \#hsps 0 ok 337 - tile no_hsps.blastp hit 90 \#hsps 0 ok 338 - tile no_hsps.blastp hit 91 \#hsps 0 ok 339 - tile no_hsps.blastp hit 92 \#hsps 0 ok 340 - tile no_hsps.blastp hit 93 \#hsps 0 ok 341 - tile no_hsps.blastp hit 94 \#hsps 0 ok 342 - tile no_hsps.blastp hit 95 \#hsps 0 ok 343 - tile no_hsps.blastp hit 96 \#hsps 0 ok 344 - tile no_hsps.blastp hit 97 \#hsps 0 ok 345 - tile no_hsps.blastp hit 98 \#hsps 0 ok 346 - tile no_hsps.blastp hit 99 \#hsps 0 ok 347 - tile no_hsps.blastp hit 100 \#hsps 0 ok 348 - tile no_hsps.blastp hit 101 \#hsps 0 ok 349 - tile no_hsps.blastp hit 102 \#hsps 0 ok 350 - tile no_hsps.blastp hit 103 \#hsps 0 ok 351 - tile no_hsps.blastp hit 104 \#hsps 0 ok 352 - tile no_hsps.blastp hit 105 \#hsps 0 ok 353 - tile no_hsps.blastp hit 106 \#hsps 0 ok 354 - tile no_hsps.blastp hit 107 \#hsps 0 ok 355 - tile no_hsps.blastp hit 108 \#hsps 0 ok 356 - tile no_hsps.blastp hit 109 \#hsps 0 ok 357 - tile no_hsps.blastp hit 110 \#hsps 0 ok 358 - tile no_hsps.blastp hit 111 \#hsps 0 ok 359 - tile no_hsps.blastp hit 112 \#hsps 0 ok 360 - tile no_hsps.blastp hit 113 \#hsps 0 ok 361 - tile no_hsps.blastp hit 114 \#hsps 0 ok 362 - tile no_hsps.blastp hit 115 \#hsps 0 ok 363 - tile no_hsps.blastp hit 116 \#hsps 0 ok 364 - tile no_hsps.blastp hit 117 \#hsps 0 ok 365 - tile no_hsps.blastp hit 118 \#hsps 0 ok 366 - tile no_hsps.blastp hit 119 \#hsps 0 ok 367 - tile no_hsps.blastp hit 120 \#hsps 0 ok 368 - tile no_hsps.blastp hit 121 \#hsps 0 ok 369 - tile no_hsps.blastp hit 122 \#hsps 0 ok 370 - tile no_hsps.blastp hit 123 \#hsps 0 ok 371 - tile no_hsps.blastp hit 124 \#hsps 0 ok 372 - tile no_hsps.blastp hit 125 \#hsps 0 ok 373 - tile no_hsps.blastp hit 126 \#hsps 0 ok 374 - tile no_hsps.blastp hit 127 \#hsps 0 ok 375 - tile no_hsps.blastp hit 128 \#hsps 0 ok 376 - tile no_hsps.blastp hit 129 \#hsps 0 ok 377 - tile no_hsps.blastp hit 130 \#hsps 0 ok 378 - tile no_hsps.blastp hit 131 \#hsps 0 ok 379 - tile no_hsps.blastp hit 132 \#hsps 0 ok 380 - tile no_hsps.blastp hit 133 \#hsps 0 ok 381 - tile no_hsps.blastp hit 134 \#hsps 0 ok 382 - tile no_hsps.blastp hit 135 \#hsps 0 ok 383 - tile no_hsps.blastp hit 136 \#hsps 0 ok 384 - tile no_hsps.blastp hit 137 \#hsps 0 ok 385 - tile no_hsps.blastp hit 138 \#hsps 0 ok 386 - tile no_hsps.blastp hit 139 \#hsps 0 ok 387 - tile no_hsps.blastp hit 140 \#hsps 0 ok 388 - tile no_hsps.blastp hit 141 \#hsps 0 ok 389 - tile no_hsps.blastp hit 142 \#hsps 0 ok 390 - tile no_hsps.blastp hit 143 \#hsps 0 ok 391 - tile no_hsps.blastp hit 144 \#hsps 0 ok 392 - tile no_hsps.blastp hit 145 \#hsps 0 ok 393 - tile no_hsps.blastp hit 146 \#hsps 0 ok 394 - tile no_hsps.blastp hit 147 \#hsps 0 ok 395 - tile no_hsps.blastp hit 148 \#hsps 0 ok 396 - tile no_hsps.blastp hit 149 \#hsps 0 ok 397 - tile no_hsps.blastp hit 150 \#hsps 0 ok 398 - tile no_hsps.blastp hit 151 \#hsps 0 ok 399 - tile no_hsps.blastp hit 152 \#hsps 0 ok 400 - tile no_hsps.blastp hit 153 \#hsps 0 ok 401 - tile no_hsps.blastp hit 154 \#hsps 0 ok 402 - tile no_hsps.blastp hit 155 \#hsps 0 ok 403 - tile no_hsps.blastp hit 156 \#hsps 0 ok 404 - tile no_hsps.blastp hit 157 \#hsps 0 ok 405 - tile no_hsps.blastp hit 158 \#hsps 0 ok 406 - tile no_hsps.blastp hit 159 \#hsps 0 ok 407 - tile no_hsps.blastp hit 160 \#hsps 0 ok 408 - tile no_hsps.blastp hit 161 \#hsps 0 ok 409 - tile no_hsps.blastp hit 162 \#hsps 0 ok 410 - tile no_hsps.blastp hit 163 \#hsps 0 ok 411 - tile no_hsps.blastp hit 164 \#hsps 0 ok 412 - tile no_hsps.blastp hit 165 \#hsps 0 ok 413 - tile no_hsps.blastp hit 166 \#hsps 0 ok 414 - tile no_hsps.blastp hit 167 \#hsps 0 ok 415 - tile no_hsps.blastp hit 168 \#hsps 0 ok 416 - tile no_hsps.blastp hit 169 \#hsps 0 ok 417 - tile no_hsps.blastp hit 170 \#hsps 0 ok 418 - tile no_hsps.blastp hit 171 \#hsps 0 ok 419 - tile no_hsps.blastp hit 172 \#hsps 0 ok 420 - tile no_hsps.blastp hit 173 \#hsps 0 ok 421 - tile no_hsps.blastp hit 174 \#hsps 0 ok 422 - tile no_hsps.blastp hit 175 \#hsps 0 ok 423 - tile no_hsps.blastp hit 176 \#hsps 0 ok 424 - tile no_hsps.blastp hit 177 \#hsps 0 ok 425 - tile no_hsps.blastp hit 178 \#hsps 0 ok 426 - tile no_hsps.blastp hit 179 \#hsps 0 ok 427 - tile no_hsps.blastp hit 180 \#hsps 0 ok 428 - tile no_hsps.blastp hit 181 \#hsps 0 ok 429 - tile no_hsps.blastp hit 182 \#hsps 0 ok 430 - tile no_hsps.blastp hit 183 \#hsps 0 ok 431 - tile no_hsps.blastp hit 184 \#hsps 0 ok 432 - tile no_hsps.blastp hit 185 \#hsps 0 ok 433 - tile no_hsps.blastp hit 186 \#hsps 0 ok 434 - tile no_hsps.blastp hit 187 \#hsps 0 ok 435 - tile no_hsps.blastp hit 188 \#hsps 0 ok 436 - tile no_hsps.blastp hit 189 \#hsps 0 ok 437 - tile no_hsps.blastp hit 190 \#hsps 0 ok 438 - tile no_hsps.blastp hit 191 \#hsps 0 ok 439 - tile no_hsps.blastp hit 192 \#hsps 0 ok 440 - tile no_hsps.blastp hit 193 \#hsps 0 ok 441 - tile no_hsps.blastp hit 194 \#hsps 0 ok 442 - tile no_hsps.blastp hit 195 \#hsps 0 ok 443 - tile no_hsps.blastp hit 196 \#hsps 0 ok 444 - tile no_hsps.blastp hit 197 \#hsps 0 ok 445 - tile no_hsps.blastp hit 198 \#hsps 0 ok 446 - tile no_hsps.blastp hit 199 \#hsps 0 ok 447 - tile no_hsps.blastp hit 200 \#hsps 0 ok 448 - tile no_hsps.blastp hit 201 \#hsps 0 ok 449 - tile no_hsps.blastp hit 202 \#hsps 0 ok 450 - tile no_hsps.blastp hit 203 \#hsps 0 ok 451 - tile no_hsps.blastp hit 204 \#hsps 0 ok 452 - tile no_hsps.blastp hit 205 \#hsps 0 ok 453 - tile no_hsps.blastp hit 206 \#hsps 0 ok 454 - tile no_hsps.blastp hit 207 \#hsps 0 ok 455 - tile no_hsps.blastp hit 208 \#hsps 0 ok 456 - tile no_hsps.blastp hit 209 \#hsps 0 ok 457 - tile no_hsps.blastp hit 210 \#hsps 0 ok 458 - tile no_hsps.blastp hit 211 \#hsps 0 ok 459 - tile no_hsps.blastp hit 212 \#hsps 0 ok 460 - tile no_hsps.blastp hit 213 \#hsps 0 ok 461 - tile no_hsps.blastp hit 214 \#hsps 0 ok 462 - tile no_hsps.blastp hit 215 \#hsps 0 ok 463 - tile no_hsps.blastp hit 216 \#hsps 0 ok 464 - tile no_hsps.blastp hit 217 \#hsps 0 ok 465 - tile no_hsps.blastp hit 218 \#hsps 0 ok 466 - tile no_hsps.blastp hit 219 \#hsps 0 ok 467 - tile no_hsps.blastp hit 220 \#hsps 0 ok 468 - tile no_hsps.blastp hit 221 \#hsps 0 ok 469 - tile no_hsps.blastp hit 222 \#hsps 0 ok 470 - tile no_hsps.blastp hit 223 \#hsps 0 ok 471 - tile no_hsps.blastp hit 224 \#hsps 0 ok 472 - tile no_hsps.blastp hit 225 \#hsps 0 ok 473 - tile no_hsps.blastp hit 226 \#hsps 0 ok 474 - tile no_hsps.blastp hit 227 \#hsps 0 ok 475 - tile no_hsps.blastp hit 228 \#hsps 0 ok 476 - tile no_hsps.blastp hit 229 \#hsps 0 ok 477 - tile no_hsps.blastp hit 230 \#hsps 0 ok 478 - tile no_hsps.blastp hit 231 \#hsps 0 ok 479 - tile no_hsps.blastp hit 232 \#hsps 0 ok 480 - tile no_hsps.blastp hit 233 \#hsps 0 ok 481 - tile no_hsps.blastp hit 234 \#hsps 0 ok 482 - tile no_hsps.blastp hit 235 \#hsps 0 ok 483 - tile no_hsps.blastp hit 236 \#hsps 0 ok 484 - tile no_hsps.blastp hit 237 \#hsps 0 ok 485 - tile no_hsps.blastp hit 238 \#hsps 0 ok 486 - tile no_hsps.blastp hit 239 \#hsps 0 ok 487 - tile no_hsps.blastp hit 240 \#hsps 0 ok 488 - tile no_hsps.blastp hit 241 \#hsps 0 ok 489 - tile no_hsps.blastp hit 242 \#hsps 0 ok 490 - tile no_hsps.blastp hit 243 \#hsps 0 ok 491 - tile no_hsps.blastp hit 244 \#hsps 0 ok 492 - tile no_hsps.blastp hit 245 \#hsps 0 ok 493 - tile no_hsps.blastp hit 246 \#hsps 0 ok 494 - tile no_hsps.blastp hit 247 \#hsps 0 ok 495 - tile no_hsps.blastp hit 248 \#hsps 0 ok 496 - tile no_hsps.blastp hit 249 \#hsps 0 ok 497 - tile no_hsps.blastp hit 250 \#hsps 0 ok 498 - tile no_hsps.blastp hit 251 \#hsps 0 ok 499 - tile no_hsps.blastp hit 252 \#hsps 0 ok 500 - tile no_hsps.blastp hit 253 \#hsps 0 ok 501 - tile no_hsps.blastp hit 254 \#hsps 0 ok 502 - tile no_hsps.blastp hit 255 \#hsps 0 ok 503 - tile no_hsps.blastp hit 256 \#hsps 0 ok 504 - tile no_hsps.blastp hit 257 \#hsps 0 ok 505 - tile no_hsps.blastp hit 258 \#hsps 0 ok 506 - tile no_hsps.blastp hit 259 \#hsps 0 ok 507 - tile no_hsps.blastp hit 260 \#hsps 0 ok 508 - tile no_hsps.blastp hit 261 \#hsps 0 ok 509 - tile no_hsps.blastp hit 262 \#hsps 0 ok 510 - tile no_hsps.blastp hit 263 \#hsps 0 ok 511 - tile no_hsps.blastp hit 264 \#hsps 0 ok 512 - tile no_hsps.blastp hit 265 \#hsps 0 ok 513 - tile no_hsps.blastp hit 266 \#hsps 0 ok 514 - tile no_hsps.blastp hit 267 \#hsps 0 ok 515 - tile no_hsps.blastp hit 268 \#hsps 0 ok 516 - tile no_hsps.blastp hit 269 \#hsps 0 ok 517 - tile no_hsps.blastp hit 270 \#hsps 0 ok 518 - tile no_hsps.blastp hit 271 \#hsps 0 ok 519 - tile no_hsps.blastp hit 272 \#hsps 0 ok 520 - tile no_hsps.blastp hit 273 \#hsps 0 ok 521 - tile no_hsps.blastp hit 274 \#hsps 0 ok 522 - tile no_hsps.blastp hit 275 \#hsps 0 ok 523 - tile no_hsps.blastp hit 276 \#hsps 0 ok 524 - tile no_hsps.blastp hit 277 \#hsps 0 ok 525 - tile no_hsps.blastp hit 278 \#hsps 0 ok 526 - tile no_hsps.blastp hit 279 \#hsps 0 ok 527 - tile no_hsps.blastp hit 280 \#hsps 0 ok 528 - tile no_hsps.blastp hit 281 \#hsps 0 ok 529 - tile no_hsps.blastp hit 282 \#hsps 0 ok 530 - tile no_hsps.blastp hit 283 \#hsps 0 ok 531 - tile no_hsps.blastp hit 284 \#hsps 0 ok 532 - tile no_hsps.blastp hit 285 \#hsps 0 ok 533 - tile no_hsps.blastp hit 286 \#hsps 0 ok 534 - tile no_hsps.blastp hit 287 \#hsps 0 ok 535 - tile no_hsps.blastp hit 288 \#hsps 0 ok 536 - tile no_hsps.blastp hit 289 \#hsps 0 ok 537 - tile no_hsps.blastp hit 290 \#hsps 0 ok 538 - tile no_hsps.blastp hit 291 \#hsps 0 ok 539 - tile no_hsps.blastp hit 292 \#hsps 0 ok 540 - tile no_hsps.blastp hit 293 \#hsps 0 ok 541 - tile no_hsps.blastp hit 294 \#hsps 0 ok 542 - tile no_hsps.blastp hit 295 \#hsps 0 ok 543 - tile no_hsps.blastp hit 296 \#hsps 0 ok 544 - tile no_hsps.blastp hit 297 \#hsps 0 ok 545 - tile no_hsps.blastp hit 298 \#hsps 0 ok 546 - tile no_hsps.blastp hit 299 \#hsps 0 ok 547 - tile no_hsps.blastp hit 300 \#hsps 0 ok 548 - tile no_hsps.blastp hit 301 \#hsps 0 ok 549 - tile no_hsps.blastp hit 302 \#hsps 0 ok 550 - tile no_hsps.blastp hit 303 \#hsps 0 ok 551 - tile no_hsps.blastp hit 304 \#hsps 0 ok 552 - tile no_hsps.blastp hit 305 \#hsps 0 ok 553 - tile no_hsps.blastp hit 306 \#hsps 0 ok 554 - tile no_hsps.blastp hit 307 \#hsps 0 ok 555 - tile no_hsps.blastp hit 308 \#hsps 0 ok 556 - tile no_hsps.blastp hit 309 \#hsps 0 ok 557 - tile no_hsps.blastp hit 310 \#hsps 0 ok 558 - tile no_hsps.blastp hit 311 \#hsps 0 ok 559 - tile no_hsps.blastp hit 312 \#hsps 0 ok 560 - tile no_hsps.blastp hit 313 \#hsps 0 ok 561 - tile no_hsps.blastp hit 314 \#hsps 0 ok 562 - tile no_hsps.blastp hit 315 \#hsps 0 ok 563 - tile no_hsps.blastp hit 316 \#hsps 0 ok 564 - tile no_hsps.blastp hit 317 \#hsps 0 ok 565 - tile no_hsps.blastp hit 318 \#hsps 0 ok 566 - tile no_hsps.blastp hit 319 \#hsps 0 ok 567 - tile no_hsps.blastp hit 320 \#hsps 0 ok 568 - tile no_hsps.blastp hit 321 \#hsps 0 ok 569 - tile no_hsps.blastp hit 322 \#hsps 0 ok 570 - tile no_hsps.blastp hit 323 \#hsps 0 ok 571 - tile no_hsps.blastp hit 324 \#hsps 0 ok 572 - tile no_hsps.blastp hit 325 \#hsps 0 ok 573 - tile no_hsps.blastp hit 326 \#hsps 0 ok 574 - tile no_hsps.blastp hit 327 \#hsps 0 ok 575 - tile no_hsps.blastp hit 328 \#hsps 0 ok 576 - tile no_hsps.blastp hit 329 \#hsps 0 ok 577 - tile no_hsps.blastp hit 330 \#hsps 0 ok 578 - tile no_hsps.blastp hit 331 \#hsps 0 ok 579 - tile no_hsps.blastp hit 332 \#hsps 0 ok 580 - tile no_hsps.blastp hit 333 \#hsps 0 ok 581 - tile no_hsps.blastp hit 334 \#hsps 0 ok 582 - tile no_hsps.blastp hit 335 \#hsps 0 ok 583 - tile no_hsps.blastp hit 336 \#hsps 0 ok 584 - tile no_hsps.blastp hit 337 \#hsps 0 ok 585 - tile no_hsps.blastp hit 338 \#hsps 0 ok 586 - tile no_hsps.blastp hit 339 \#hsps 0 ok 587 - tile no_hsps.blastp hit 340 \#hsps 0 ok 588 - tile no_hsps.blastp hit 341 \#hsps 0 ok 589 - tile no_hsps.blastp hit 342 \#hsps 0 ok 590 - tile no_hsps.blastp hit 343 \#hsps 0 ok 591 - tile no_hsps.blastp hit 344 \#hsps 0 ok 592 - tile no_hsps.blastp hit 345 \#hsps 0 ok 593 - tile no_hsps.blastp hit 346 \#hsps 0 ok 594 - tile no_hsps.blastp hit 347 \#hsps 0 ok 595 - tile no_hsps.blastp hit 348 \#hsps 0 ok 596 - tile no_hsps.blastp hit 349 \#hsps 0 ok 597 - tile no_hsps.blastp hit 350 \#hsps 0 ok 598 - tile no_hsps.blastp hit 351 \#hsps 0 ok 599 - tile no_hsps.blastp hit 352 \#hsps 0 ok 600 - tile no_hsps.blastp hit 353 \#hsps 0 ok 601 - tile no_hsps.blastp hit 354 \#hsps 0 ok 602 - tile no_hsps.blastp hit 355 \#hsps 0 ok 603 - tile no_hsps.blastp hit 356 \#hsps 0 ok 604 - tile no_hsps.blastp hit 357 \#hsps 0 ok 605 - tile no_hsps.blastp hit 358 \#hsps 0 ok 606 - tile no_hsps.blastp hit 359 \#hsps 0 ok 607 - tile no_hsps.blastp hit 360 \#hsps 0 ok 608 - tile no_hsps.blastp hit 361 \#hsps 0 ok 609 - tile no_hsps.blastp hit 362 \#hsps 0 ok 610 - tile no_hsps.blastp hit 363 \#hsps 0 ok 611 - tile no_hsps.blastp hit 364 \#hsps 0 ok 612 - tile no_hsps.blastp hit 365 \#hsps 0 ok 613 - tile no_hsps.blastp hit 366 \#hsps 0 ok 614 - tile no_hsps.blastp hit 367 \#hsps 0 ok 615 - tile no_hsps.blastp hit 368 \#hsps 0 ok 616 - tile no_hsps.blastp hit 369 \#hsps 0 ok 617 - tile no_hsps.blastp hit 370 \#hsps 0 ok 618 - tile no_hsps.blastp hit 371 \#hsps 0 ok 619 - tile no_hsps.blastp hit 372 \#hsps 0 ok 620 - tile no_hsps.blastp hit 373 \#hsps 0 ok 621 - tile no_hsps.blastp hit 374 \#hsps 0 ok 622 - tile no_hsps.blastp hit 375 \#hsps 0 ok 623 - tile no_hsps.blastp hit 376 \#hsps 0 ok 624 - tile no_hsps.blastp hit 377 \#hsps 0 ok 625 - tile no_hsps.blastp hit 378 \#hsps 0 ok 626 - tile no_hsps.blastp hit 379 \#hsps 0 ok 627 - tile no_hsps.blastp hit 380 \#hsps 0 ok 628 - tile no_hsps.blastp hit 381 \#hsps 0 ok 629 - tile no_hsps.blastp hit 382 \#hsps 0 ok 630 - tile no_hsps.blastp hit 383 \#hsps 0 ok 631 - tile no_hsps.blastp hit 384 \#hsps 0 ok 632 - tile no_hsps.blastp hit 385 \#hsps 0 ok 633 - tile no_hsps.blastp hit 386 \#hsps 0 ok 634 - tile no_hsps.blastp hit 387 \#hsps 0 ok 635 - tile no_hsps.blastp hit 388 \#hsps 0 ok 636 - tile no_hsps.blastp hit 389 \#hsps 0 ok 637 - tile no_hsps.blastp hit 390 \#hsps 0 ok 638 - tile no_hsps.blastp hit 391 \#hsps 0 ok 639 - tile no_hsps.blastp hit 392 \#hsps 0 ok 640 - tile no_hsps.blastp hit 393 \#hsps 0 ok 641 - tile no_hsps.blastp hit 394 \#hsps 0 ok 642 - tile no_hsps.blastp hit 395 \#hsps 0 ok 643 - tile no_hsps.blastp hit 396 \#hsps 0 ok 644 - tile no_hsps.blastp hit 397 \#hsps 0 ok 645 - tile no_hsps.blastp hit 398 \#hsps 0 ok 646 - tile no_hsps.blastp hit 399 \#hsps 0 ok 647 - tile no_hsps.blastp hit 400 \#hsps 0 ok 648 - tile no_hsps.blastp hit 401 \#hsps 0 ok 649 - tile no_hsps.blastp hit 402 \#hsps 0 ok 650 - tile no_hsps.blastp hit 403 \#hsps 0 ok 651 - tile no_hsps.blastp hit 404 \#hsps 0 ok 652 - tile no_hsps.blastp hit 405 \#hsps 0 ok 653 - tile no_hsps.blastp hit 406 \#hsps 0 ok 654 - tile no_hsps.blastp hit 407 \#hsps 0 ok 655 - tile no_hsps.blastp hit 408 \#hsps 0 ok 656 - tile no_hsps.blastp hit 409 \#hsps 0 ok 657 - tile no_hsps.blastp hit 410 \#hsps 0 ok 658 - tile no_hsps.blastp hit 411 \#hsps 0 ok 659 - tile no_hsps.blastp hit 412 \#hsps 0 ok 660 - tile no_hsps.blastp hit 413 \#hsps 0 ok 661 - tile no_hsps.blastp hit 414 \#hsps 0 ok 662 - tile no_hsps.blastp hit 415 \#hsps 0 ok 663 - catalase-webblast.BLASTP ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1 ok 665 - q id: est (1.00000) = fast (1.00000) ok 666 - q cn: est (1.00000) = fast (1.00000) ok 667 - h id: est (1.00000) = fast (1.00000) ok 668 - h cn: est (1.00000) = fast (1.00000) ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1 ok 670 - q id: est (0.80973) = fast (0.80973) ok 671 - q cn: est (0.89006) = fast (0.89006) ok 672 - h id: est (0.82543) = fast (0.82543) ok 673 - h cn: est (0.90733) = fast (0.90733) ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1 ok 675 - q id: est (0.71670) = fast (0.71670) ok 676 - q cn: est (0.84144) = fast (0.84144) ok 677 - h id: est (0.72747) = fast (0.72747) ok 678 - h cn: est (0.85408) = fast (0.85408) ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1 ok 680 - q id: est (0.58910) = fast (0.58910) ok 681 - q cn: est (0.70860) = fast (0.70860) ok 682 - h id: est (0.65654) = fast (0.65654) ok 683 - h cn: est (0.78972) = fast (0.78972) ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1 ok 685 - q id: est (0.49245) = fast (0.49245) ok 686 - q cn: est (0.65257) = fast (0.65257) ok 687 - h id: est (0.49544) = fast (0.49544) ok 688 - h cn: est (0.65653) = fast (0.65653) ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1 ok 690 - q id: est (0.44366) = fast (0.44366) ok 691 - q cn: est (0.58920) = fast (0.58920) ok 692 - h id: est (0.44787) = fast (0.44787) ok 693 - h cn: est (0.59479) = fast (0.59479) ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1 ok 695 - q id: est (0.42564) = fast (0.42564) ok 696 - q cn: est (0.61282) = fast (0.61282) ok 697 - h id: est (0.43229) = fast (0.43229) ok 698 - h cn: est (0.62240) = fast (0.62240) ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1 ok 700 - q id: est (0.48358) = fast (0.48358) ok 701 - q cn: est (0.63881) = fast (0.63881) ok 702 - h id: est (0.48943) = fast (0.48943) ok 703 - h cn: est (0.64653) = fast (0.64653) ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1 ok 705 - q id: est (0.42308) = fast (0.42308) ok 706 - q cn: est (0.61282) = fast (0.61282) ok 707 - h id: est (0.42969) = fast (0.42969) ok 708 - h cn: est (0.62240) = fast (0.62240) ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1 ok 710 - q id: est (0.39675) = fast (0.39675) ok 711 - q cn: est (0.58933) = fast (0.58933) ok 712 - h id: est (0.39767) = fast (0.39767) ok 713 - h cn: est (0.59070) = fast (0.59070) ok 714 - dcr1_sp.WUBLASTP ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1 ok 716 - q id: est (1.00000) = fast (1.00000) ok 717 - q cn: est (1.00000) = fast (1.00000) ok 718 - h id: est (1.00000) = fast (1.00000) ok 719 - h cn: est (1.00000) = fast (1.00000) ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4 ok 721 - q id: exact (0.36876) ~ est (0.36973) ok 722 - q id: exact (0.36876) <= max (0.37070) ok 723 - q cn: exact (0.55022) ~ est (0.55041) ok 724 - q cn: exact (0.55022) <= max (0.55105) ok 725 - h id: exact (0.35111) ~ est (0.35111) ok 726 - h id: exact (0.35111) <= max (0.35111) ok 727 - h cn: exact (0.52305) ~ est (0.52305) ok 728 - h cn: exact (0.52305) <= max (0.52305) ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1 ok 730 - q id: est (0.38685) = fast (0.38685) ok 731 - q cn: est (0.55397) = fast (0.55397) ok 732 - h id: est (0.37613) = fast (0.37613) ok 733 - h cn: est (0.53863) = fast (0.53863) ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1 ok 735 - q id: est (0.38247) = fast (0.38247) ok 736 - q cn: est (0.55068) = fast (0.55068) ok 737 - h id: est (0.37306) = fast (0.37306) ok 738 - h cn: est (0.53715) = fast (0.53715) ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5 ok 740 - q id: exact (0.35010) ~ est (0.35010) ok 741 - q id: exact (0.35010) <= max (0.35010) ok 742 - q cn: exact (0.53183) ~ est (0.53183) ok 743 - q cn: exact (0.53183) <= max (0.53183) ok 744 - h id: exact (0.35082) ~ est (0.35082) ok 745 - h id: exact (0.35082) <= max (0.35082) ok 746 - h cn: exact (0.53292) ~ est (0.53292) ok 747 - h cn: exact (0.53292) <= max (0.53292) ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8 ok 749 - q id: exact (0.30547) ~ est (0.30659) ok 750 - q id: exact (0.30547) <= max (0.30623) ok 751 - q cn: exact (0.50076) ~ est (0.50205) ok 752 - q cn: exact (0.50076) <= max (0.50076) ok 753 - h id: exact (0.31390) ~ est (0.31179) ok 754 - h id: exact (0.31390) <= max (0.31795) ok 755 - h cn: exact (0.50531) ~ est (0.50557) ok 756 - h cn: exact (0.50531) <= max (0.51091) ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7 ok 758 - q id: exact (0.30136) ~ est (0.30184) ok 759 - q id: exact (0.30136) <= max (0.30498) ok 760 - q cn: exact (0.48688) ~ est (0.48742) ok 761 - q cn: exact (0.48688) <= max (0.49140) ok 762 - h id: exact (0.30944) ~ est (0.31034) ok 763 - h id: exact (0.30944) <= max (0.30988) ok 764 - h cn: exact (0.50178) ~ est (0.50277) ok 765 - h cn: exact (0.50178) <= max (0.50223) ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10 ok 767 - q id: exact (0.28918) ~ est (0.28961) ok 768 - q id: exact (0.28918) <= max (0.28955) ok 769 - q cn: exact (0.46418) ~ est (0.46247) ok 770 - q cn: exact (0.46418) <= max (0.46866) ok 771 - h id: exact (0.30166) ~ est (0.30299) ok 772 - h id: exact (0.30166) <= max (0.30800) ok 773 - h cn: exact (0.48179) ~ est (0.48439) ok 774 - h cn: exact (0.48179) <= max (0.48535) ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8 ok 776 - q id: exact (0.30289) ~ est (0.30238) ok 777 - q id: exact (0.30289) <= max (0.30651) ok 778 - q cn: exact (0.49955) ~ est (0.49787) ok 779 - q cn: exact (0.49955) <= max (0.50362) ok 780 - h id: exact (0.31395) ~ est (0.31347) ok 781 - h id: exact (0.31395) <= max (0.31721) ok 782 - h cn: exact (0.51535) ~ est (0.51578) ok 783 - h cn: exact (0.51535) <= max (0.51814) ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5 ok 785 - q id: exact (0.29334) ~ est (0.29534) ok 786 - q id: exact (0.29334) <= max (0.29810) ok 787 - q cn: exact (0.46617) ~ est (0.46719) ok 788 - q cn: exact (0.46617) <= max (0.47040) ok 789 - h id: exact (0.31176) ~ est (0.31176) ok 790 - h id: exact (0.31176) <= max (0.31176) ok 791 - h cn: exact (0.49299) ~ est (0.49299) ok 792 - h cn: exact (0.49299) <= max (0.49299) ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7 ok 794 - q id: exact (0.30456) ~ est (0.30514) ok 795 - q id: exact (0.30456) <= max (0.30650) ok 796 - q cn: exact (0.48739) ~ est (0.48879) ok 797 - q cn: exact (0.48739) <= max (0.49370) ok 798 - h id: exact (0.32062) ~ est (0.31987) ok 799 - h id: exact (0.32062) <= max (0.32932) ok 800 - h cn: exact (0.51071) ~ est (0.51306) ok 801 - h cn: exact (0.51071) <= max (0.52410) ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8 ok 803 - q id: exact (0.29615) ~ est (0.29879) ok 804 - q id: exact (0.29615) <= max (0.30009) ok 805 - q cn: exact (0.47419) ~ est (0.47394) ok 806 - q cn: exact (0.47419) <= max (0.48119) ok 807 - h id: exact (0.31611) ~ est (0.31482) ok 808 - h id: exact (0.31611) <= max (0.32227) ok 809 - h cn: exact (0.49779) ~ est (0.49788) ok 810 - h cn: exact (0.49779) <= max (0.50616) ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8 ok 812 - q id: exact (0.30390) ~ est (0.30440) ok 813 - q id: exact (0.30390) <= max (0.30701) ok 814 - q cn: exact (0.45874) ~ est (0.45993) ok 815 - q cn: exact (0.45874) <= max (0.45963) ok 816 - h id: exact (0.32282) ~ est (0.32324) ok 817 - h id: exact (0.32282) <= max (0.32560) ok 818 - h cn: exact (0.48052) ~ est (0.48136) ok 819 - h cn: exact (0.48052) <= max (0.48330) ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6 ok 821 - q id: exact (0.29769) ~ est (0.29851) ok 822 - q id: exact (0.29769) <= max (0.29769) ok 823 - q cn: exact (0.48480) ~ est (0.48628) ok 824 - q cn: exact (0.48480) <= max (0.48637) ok 825 - h id: exact (0.30704) ~ est (0.30810) ok 826 - h id: exact (0.30704) <= max (0.30917) ok 827 - h cn: exact (0.50107) ~ est (0.50292) ok 828 - h cn: exact (0.50107) <= max (0.50320) ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6 ok 830 - q id: exact (0.27854) ~ est (0.27854) ok 831 - q id: exact (0.27854) <= max (0.27854) ok 832 - q cn: exact (0.48174) ~ est (0.48174) ok 833 - q cn: exact (0.48174) <= max (0.48174) ok 834 - h id: exact (0.28514) ~ est (0.28623) ok 835 - h id: exact (0.28514) <= max (0.28594) ok 836 - h cn: exact (0.49197) ~ est (0.49154) ok 837 - h cn: exact (0.49197) <= max (0.49237) ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8 ok 839 - q id: exact (0.30362) ~ est (0.30824) ok 840 - q id: exact (0.30362) <= max (0.30852) ok 841 - q cn: exact (0.47111) ~ est (0.47587) ok 842 - q cn: exact (0.47111) <= max (0.47405) ok 843 - h id: exact (0.32347) ~ est (0.32392) ok 844 - h id: exact (0.32347) <= max (0.32643) ok 845 - h cn: exact (0.49310) ~ est (0.49360) ok 846 - h cn: exact (0.49310) <= max (0.49606) ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4 ok 848 - q id: exact (0.29174) ~ est (0.29174) ok 849 - q id: exact (0.29174) <= max (0.29174) ok 850 - q cn: exact (0.46230) ~ est (0.46230) ok 851 - q cn: exact (0.46230) <= max (0.46230) ok 852 - h id: exact (0.30204) ~ est (0.30204) ok 853 - h id: exact (0.30204) <= max (0.30204) ok 854 - h cn: exact (0.47862) ~ est (0.47862) ok 855 - h cn: exact (0.47862) <= max (0.47862) ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6 ok 857 - q id: exact (0.29064) ~ est (0.29089) ok 858 - q id: exact (0.29064) <= max (0.29115) ok 859 - q cn: exact (0.48765) ~ est (0.48670) ok 860 - q cn: exact (0.48765) <= max (0.48868) ok 861 - h id: exact (0.29848) ~ est (0.29887) ok 862 - h id: exact (0.29848) <= max (0.29902) ok 863 - h cn: exact (0.50108) ~ est (0.50116) ok 864 - h cn: exact (0.50108) <= max (0.50163) ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5 ok 866 - q id: exact (0.29510) ~ est (0.29505) ok 867 - q id: exact (0.29510) <= max (0.29510) ok 868 - q cn: exact (0.48982) ~ est (0.49039) ok 869 - q cn: exact (0.48982) <= max (0.49029) ok 870 - h id: exact (0.30019) ~ est (0.30019) ok 871 - h id: exact (0.30019) <= max (0.30019) ok 872 - h cn: exact (0.49906) ~ est (0.49906) ok 873 - h cn: exact (0.49906) <= max (0.49906) ok 874 - 503384.MEGABLAST.2 ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5 ok 876 - q id: exact (0.91435) ~ est (0.91435) ok 877 - q id: exact (0.91435) <= max (0.91435) ok 878 - q cn: exact (0.91435) ~ est (0.91435) ok 879 - q cn: exact (0.91435) <= max (0.91435) ok 880 - h id: exact (0.91157) ~ est (0.91157) ok 881 - h id: exact (0.91157) <= max (0.91157) ok 882 - h cn: exact (0.91157) ~ est (0.91157) ok 883 - h cn: exact (0.91157) <= max (0.91157) ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9 ok 885 - q id: exact (0.92895) ~ est (0.92895) ok 886 - q id: exact (0.92895) <= max (0.92895) ok 887 - q cn: exact (0.92895) ~ est (0.92895) ok 888 - q cn: exact (0.92895) <= max (0.92895) ok 889 - h id: exact (0.92854) ~ est (0.92854) ok 890 - h id: exact (0.92854) <= max (0.92854) ok 891 - h cn: exact (0.92854) ~ est (0.92854) ok 892 - h cn: exact (0.92854) <= max (0.92854) ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3 ok 894 - q id: exact (0.93516) ~ est (0.93516) ok 895 - q id: exact (0.93516) <= max (0.93516) ok 896 - q cn: exact (0.93516) ~ est (0.93516) ok 897 - q cn: exact (0.93516) <= max (0.93516) ok 898 - h id: exact (0.93651) ~ est (0.93651) ok 899 - h id: exact (0.93651) <= max (0.93651) ok 900 - h cn: exact (0.93651) ~ est (0.93651) ok 901 - h cn: exact (0.93651) <= max (0.93651) ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3 ok 903 - q id: exact (0.93064) ~ est (0.93064) ok 904 - q id: exact (0.93064) <= max (0.93064) ok 905 - q cn: exact (0.93064) ~ est (0.93064) ok 906 - q cn: exact (0.93064) <= max (0.93064) ok 907 - h id: exact (0.92885) ~ est (0.92885) ok 908 - h id: exact (0.92885) <= max (0.92885) ok 909 - h cn: exact (0.92885) ~ est (0.92885) ok 910 - h cn: exact (0.92885) <= max (0.92885) ok 911 - bl2seq.blastx.out ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6 ok 913 - q id: est (0.35714) = fast (0.35714) ok 914 - q cn: est (0.57143) = fast (0.57143) ok 915 - q id: exact (0.70536) ~ est (0.70495) ok 916 - q id: exact (0.70536) <= max (0.94286) ok 917 - q cn: exact (0.78810) ~ est (0.78803) ok 918 - q cn: exact (0.78810) <= max (0.96429) ok 919 - q id: est (0.71429) = fast (0.71429) ok 920 - q cn: est (1.00000) = fast (1.00000) ok 921 - h id: exact (0.61923) ~ est (0.61955) ok 922 - h id: exact (0.61923) <= max (0.64231) ok 923 - h cn: exact (0.73077) ~ est (0.73077) ok 924 - h cn: exact (0.73077) <= max (0.75000) ok 925 - dnaEbsub_ecoli.wublastx ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1 ok 927 - q id: est (0.36386) = fast (0.36386) ok 928 - q cn: est (0.53735) = fast (0.53735) ok 929 - h id: est (0.36562) = fast (0.36562) ok 930 - h cn: est (0.53995) = fast (0.53995) ok 931 - tblastn.out ok 932 - tile tblastn.out hit 1 \#hsps 2 ok 933 - q id: exact (0.31250) ~ est (0.33325) ok 934 - q id: exact (0.31250) <= max (0.33333) ok 935 - q cn: exact (0.44792) ~ est (0.47055) ok 936 - q cn: exact (0.44792) <= max (0.45833) ok 937 - h id: exact (0.33333) ~ est (0.33333) ok 938 - h id: exact (0.33333) <= max (0.33333) ok 939 - h cn: exact (0.47059) ~ est (0.47059) ok 940 - h cn: exact (0.47059) <= max (0.47059) ok 941 - tile tblastn.out hit 2 \#hsps 2 ok 942 - q id: exact (0.68750) ~ est (0.68750) ok 943 - q id: exact (0.68750) <= max (0.68750) ok 944 - q cn: exact (0.81250) ~ est (0.81250) ok 945 - q cn: exact (0.81250) <= max (0.81250) ok 946 - h id: est (0.66667) = fast (0.66667) ok 947 - h cn: est (0.77778) = fast (0.77778) ok 948 - h id: est (0.71429) = fast (0.71429) ok 949 - h cn: est (0.85714) = fast (0.85714) ok 950 - dnaEbsub_ecoli.wutblastn ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1 ok 952 - q id: est (0.36386) = fast (0.36386) ok 953 - q cn: est (0.53735) = fast (0.53735) ok 954 - h id: est (0.36562) = fast (0.36562) ok 955 - h cn: est (0.53995) = fast (0.53995) ok 956 - HUMBETGLOA.tblastx ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1 ok 958 - q id: est (0.42308) = fast (0.42308) ok 959 - q cn: est (0.61538) = fast (0.61538) ok 960 - h id: est (0.42308) = fast (0.42308) ok 961 - h cn: est (0.61538) = fast (0.61538) ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1 ok 963 - q id: est (0.47059) = fast (0.47059) ok 964 - q cn: est (0.76471) = fast (0.76471) ok 965 - h id: est (0.47059) = fast (0.47059) ok 966 - h cn: est (0.76471) = fast (0.76471) ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1 ok 968 - q id: est (0.36000) = fast (0.36000) ok 969 - q cn: est (0.56000) = fast (0.56000) ok 970 - h id: est (0.36000) = fast (0.36000) ok 971 - h cn: est (0.56000) = fast (0.56000) ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1 ok 973 - q id: est (0.29268) = fast (0.29268) ok 974 - q cn: est (0.58537) = fast (0.58537) ok 975 - h id: est (0.29268) = fast (0.29268) ok 976 - h cn: est (0.58537) = fast (0.58537) ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1 ok 978 - q id: est (0.38889) = fast (0.38889) ok 979 - q cn: est (0.55556) = fast (0.55556) ok 980 - h id: est (0.38889) = fast (0.38889) ok 981 - h cn: est (0.55556) = fast (0.55556) ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1 ok 983 - q id: est (0.43590) = fast (0.43590) ok 984 - q cn: est (0.51282) = fast (0.51282) ok 985 - h id: est (0.43590) = fast (0.43590) ok 986 - h cn: est (0.51282) = fast (0.51282) ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1 ok 988 - q id: est (0.35714) = fast (0.35714) ok 989 - q cn: est (0.42857) = fast (0.42857) ok 990 - h id: est (0.35714) = fast (0.35714) ok 991 - h cn: est (0.42857) = fast (0.42857) ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1 ok 993 - q id: est (0.33333) = fast (0.33333) ok 994 - q cn: est (0.66667) = fast (0.66667) ok 995 - h id: est (0.33333) = fast (0.33333) ok 996 - h cn: est (0.66667) = fast (0.66667) ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2 ok 998 - q id: exact (0.40541) ~ est (0.40541) ok 999 - q id: exact (0.40541) <= max (0.40541) ok 1000 - q cn: exact (0.56757) ~ est (0.56757) ok 1001 - q cn: exact (0.56757) <= max (0.56757) ok 1002 - h id: est (0.36364) = fast (0.36364) ok 1003 - h cn: est (0.63636) = fast (0.63636) ok 1004 - h id: est (0.42308) = fast (0.42308) ok 1005 - h cn: est (0.53846) = fast (0.53846) ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1 ok 1007 - q id: est (0.29167) = fast (0.29167) ok 1008 - q cn: est (0.39583) = fast (0.39583) ok 1009 - h id: est (0.29167) = fast (0.29167) ok 1010 - h cn: est (0.39583) = fast (0.39583) ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1 ok 1012 - q id: est (0.60000) = fast (0.60000) ok 1013 - q cn: est (0.65000) = fast (0.65000) ok 1014 - h id: est (0.60000) = fast (0.60000) ok 1015 - h cn: est (0.65000) = fast (0.65000) ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1 ok 1017 - q id: est (0.50000) = fast (0.50000) ok 1018 - q cn: est (0.68182) = fast (0.68182) ok 1019 - h id: est (0.50000) = fast (0.50000) ok 1020 - h cn: est (0.68182) = fast (0.68182) ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1 ok 1022 - q id: est (0.29630) = fast (0.29630) ok 1023 - q cn: est (0.48148) = fast (0.48148) ok 1024 - h id: est (0.29630) = fast (0.29630) ok 1025 - h cn: est (0.48148) = fast (0.48148) ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1 ok 1027 - q id: est (0.47826) = fast (0.47826) ok 1028 - q cn: est (0.52174) = fast (0.52174) ok 1029 - h id: est (0.47826) = fast (0.47826) ok 1030 - h cn: est (0.52174) = fast (0.52174) ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1 ok 1032 - q id: est (0.47368) = fast (0.47368) ok 1033 - q cn: est (0.63158) = fast (0.63158) ok 1034 - h id: est (0.47368) = fast (0.47368) ok 1035 - h cn: est (0.63158) = fast (0.63158) ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1 ok 1037 - q id: est (0.44444) = fast (0.44444) ok 1038 - q cn: est (0.55556) = fast (0.55556) ok 1039 - h id: est (0.44444) = fast (0.44444) ok 1040 - h cn: est (0.55556) = fast (0.55556) ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1 ok 1042 - q id: est (0.47059) = fast (0.47059) ok 1043 - q cn: est (0.70588) = fast (0.70588) ok 1044 - h id: est (0.47059) = fast (0.47059) ok 1045 - h cn: est (0.70588) = fast (0.70588) ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1 ok 1047 - q id: est (0.38889) = fast (0.38889) ok 1048 - q cn: est (0.66667) = fast (0.66667) ok 1049 - h id: est (0.38889) = fast (0.38889) ok 1050 - h cn: est (0.66667) = fast (0.66667) ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1 ok 1052 - q id: est (0.27660) = fast (0.27660) ok 1053 - q cn: est (0.48936) = fast (0.48936) ok 1054 - h id: est (0.27660) = fast (0.27660) ok 1055 - h cn: est (0.48936) = fast (0.48936) ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1 ok 1057 - q id: est (0.40000) = fast (0.40000) ok 1058 - q cn: est (0.60000) = fast (0.60000) ok 1059 - h id: est (0.40000) = fast (0.40000) ok 1060 - h cn: est (0.60000) = fast (0.60000) ok 1061 - dnaEbsub_ecoli.wutblastx ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12 ok 1063 - q id: est (0.25352) = fast (0.25352) ok 1064 - q cn: est (0.47887) = fast (0.47887) ok 1065 - q id: exact (0.40224) ~ est (0.40912) ok 1066 - q id: exact (0.40224) <= max (0.42628) ok 1067 - q cn: exact (0.58494) ~ est (0.58968) ok 1068 - q cn: exact (0.58494) <= max (0.62179) ok 1069 - q id: est (0.37500) = fast (0.37500) ok 1070 - q cn: est (0.62500) = fast (0.62500) ok 1071 - q id: exact (0.44118) ~ est (0.44118) ok 1072 - q id: exact (0.44118) <= max (0.44118) ok 1073 - q cn: exact (0.54412) ~ est (0.54412) ok 1074 - q cn: exact (0.54412) <= max (0.54412) ok 1075 - h id: exact (0.39848) ~ est (0.40304) ok 1076 - h id: exact (0.39848) <= max (0.40355) ok 1077 - h cn: exact (0.58376) ~ est (0.58889) ok 1078 - h cn: exact (0.58376) <= max (0.58883) ok 1079 - h id: exact (0.44118) ~ est (0.44118) ok 1080 - h id: exact (0.44118) <= max (0.44118) ok 1081 - h cn: exact (0.54412) ~ est (0.54412) ok 1082 - h cn: exact (0.54412) <= max (0.54412) ok 1083 - h id: est (0.25352) = fast (0.25352) ok 1084 - h cn: est (0.47887) = fast (0.47887) ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2 ok 1086 - q id: exact (0.41818) ~ est (0.41818) ok 1087 - q id: exact (0.41818) <= max (0.41818) ok 1088 - q cn: exact (0.52727) ~ est (0.52727) ok 1089 - q cn: exact (0.52727) <= max (0.52727) ok 1090 - h id: est (0.53333) = fast (0.53333) ok 1091 - h cn: est (0.66667) = fast (0.66667) ok 1092 - h id: est (0.37500) = fast (0.37500) ok 1093 - h cn: est (0.47500) = fast (0.47500) ok 1094 - bug2942: query m0: range correct ok 1095 - bug2942: query m1: range correct ok 1096 - bug2942: query m2: range correct ok 1097 - bug2942: subject all : range correct ok 1098 - get_tiled_alns ok 1099 - got all alns ok 1100 ok 1101 - aln and qfeat lengths correspond ok 1102 - q length correct ok 1103 ok 1104 - features on q and s correspond ok 1105 - aln and hfeat lengths correspond ok 1106 - s length correct ok 1107 ok 1108 - aln and qfeat lengths correspond ok 1109 - q length correct ok 1110 ok 1111 - features on q and s correspond ok 1112 - aln and hfeat lengths correspond ok 1113 - s length correct ok 1114 ok 1115 - aln and qfeat lengths correspond ok 1116 - q length correct ok 1117 ok 1118 - features on q and s correspond ok 1119 - aln and hfeat lengths correspond ok 1120 - s length correct ok 1121 ok 1122 - aln and qfeat lengths correspond ok 1123 - q length correct ok 1124 ok 1125 - features on q and s correspond ok 1126 - aln and hfeat lengths correspond ok 1127 - s length correct ok 1128 ok 1129 - aln and qfeat lengths correspond ok 1130 - q length correct ok 1131 ok 1132 - features on q and s correspond ok 1133 - aln and hfeat lengths correspond ok 1134 - s length correct ok 1135 ok 1136 - aln and qfeat lengths correspond ok 1137 - q length correct ok 1138 ok 1139 - features on q and s correspond ok 1140 - aln and hfeat lengths correspond ok 1141 - s length correct ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/Writer/GbrowseGFF.t ......... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/Writer/HSPTableWriter.t ..... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HSPTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/Writer/HTMLWriter.t ......... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/Writer/HitTableWriter.t ..... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HitTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/Writer/TextWriter.t ......... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::TextResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/axt.t ....................... 1..19 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/blast.t ..................... 1..1360 ok 1 - use Bio::SearchIO; ok 2 - Bio::SearchIO->new can handle a Path::Class object ok 3 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 4 - Bio::SearchIO->new can handle a Path::Class object ok 5 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 6 ok 7 - database_name() ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 not ok 415 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 668. # '0.852' # > # '0.9' not ok 416 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 669. # '1.599' # <= # '1' ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 - Multiblast query test ok 598 ok 599 - Multiblast query test ok 600 ok 601 - Multiblast query test ok 602 ok 603 - Multiblast query test ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 979 ok 980 ok 981 ok 982 ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1007 ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 - fasta for f.fx ok 1055 - fasta for f.ssearch ok 1056 - fasta for f.SSEARCH.m9 ok 1057 - blast for f.blx ok 1058 - fasta for f.fy ok 1059 - blastxml for f.xml ok 1060 - blast for fast.bls ok 1061 - fasta for f.fa ok 1062 - fasta for f.osearch ok 1063 - blast for f.tblx ok 1064 - fasta for f.fasta ok 1065 - exonerate for f.exon ok 1066 - blastxml for f.blastxml ok 1067 - exonerate for f.exonerate ok 1068 - blast for filename.blast ok 1069 - fasta for f.psearch ok 1070 - blast for filename.bls ok 1071 - fasta for f.m9 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 ok 1084 ok 1085 ok 1086 ok 1087 - full hit name ok 1088 - hit accession ok 1089 ok 1090 ok 1091 - query start ok 1092 - query start ok 1093 ok 1094 ok 1095 ok 1096 ok 1097 ok 1098 ok 1099 ok 1100 ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 ok 1117 ok 1118 ok 1119 ok 1120 ok 1121 ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok 1146 ok 1147 ok 1148 ok 1149 ok 1150 ok 1151 ok 1152 ok 1153 ok 1154 ok 1155 ok 1156 ok 1157 ok 1158 ok 1159 ok 1160 ok 1161 ok 1162 ok 1163 ok 1164 ok 1165 ok 1166 ok 1167 ok 1168 ok 1169 ok 1170 ok 1171 ok 1172 ok 1173 ok 1174 ok 1175 ok 1176 ok 1177 ok 1178 ok 1179 ok 1180 ok 1181 ok 1182 ok 1183 ok 1184 ok 1185 ok 1186 ok 1187 ok 1188 ok 1189 ok 1190 ok 1191 ok 1192 ok 1193 ok 1194 ok 1195 ok 1196 ok 1197 ok 1198 ok 1199 ok 1200 ok 1201 ok 1202 ok 1203 ok 1204 ok 1205 ok 1206 ok 1207 ok 1208 ok 1209 ok 1210 ok 1211 ok 1212 ok 1213 ok 1214 ok 1215 ok 1216 ok 1217 ok 1218 ok 1219 ok 1220 ok 1221 ok 1222 ok 1223 ok 1224 ok 1225 ok 1226 ok 1227 ok 1228 ok 1229 ok 1230 ok 1231 ok 1232 ok 1233 ok 1234 ok 1235 ok 1236 ok 1237 ok 1238 ok 1239 ok 1240 ok 1241 ok 1242 ok 1243 ok 1244 ok 1245 ok 1246 ok 1247 ok 1248 ok 1249 ok 1250 ok 1251 ok 1252 ok 1253 ok 1254 ok 1255 ok 1256 ok 1257 ok 1258 ok 1259 ok 1260 ok 1261 ok 1262 ok 1263 ok 1264 ok 1265 ok 1266 ok 1267 ok 1268 ok 1269 ok 1270 ok 1271 ok 1272 ok 1273 ok 1274 ok 1275 ok 1276 ok 1277 ok 1278 ok 1279 ok 1280 ok 1281 ok 1282 ok 1283 ok 1284 ok 1285 ok 1286 ok 1287 ok 1288 ok 1289 ok 1290 ok 1291 ok 1292 ok 1293 ok 1294 ok 1295 ok 1296 ok 1297 ok 1298 ok 1299 ok 1300 ok 1301 ok 1302 ok 1303 ok 1304 ok 1305 ok 1306 ok 1307 ok 1308 ok 1309 ok 1310 ok 1311 ok 1312 ok 1313 ok 1314 ok 1315 ok 1316 ok 1317 ok 1318 ok 1319 ok 1320 ok 1321 ok 1322 ok 1323 ok 1324 ok 1325 ok 1326 ok 1327 ok 1328 ok 1329 ok 1330 ok 1331 ok 1332 ok 1333 ok 1334 ok 1335 ok 1336 ok 1337 ok 1338 ok 1339 ok 1340 ok 1341 ok 1342 ok 1343 ok 1344 ok 1345 ok 1346 ok 1347 ok 1348 ok 1349 ok 1350 ok 1351 ok 1352 ok 1353 ok 1354 ok 1355 - testing Bug 3298 ok 1356 - testing Bug 3298 ok 1357 - testing Bug 3298 ok 1358 - testing Bug 3251 ok 1359 - testing Bug 3251 ok 1360 - testing Bug 3251 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/blast_pull.t ................ 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - database_name() ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 not ok 191 # TODO frac_identical failing! # Failed (TODO) test at t/SearchIO/blast_pull.t line 260. # got: '0.946' # expected: '0.943' ok 192 ok 193 ok 194 ok 195 ok 196 - Multiblast query test ok 197 - Multiblast query test ok 198 - Multiblast query test ok 199 - Multiblast query test ok 200 ok 201 ok 202 ok 203 - full hit name ok 204 - hit accession ok 205 ok 206 - query start ok 207 - query start ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 --------------------- WARNING --------------------- MSG: Did not define the number of conserved matches in the HSP; assuming conserved == identical (247) --------------------------------------------------- t/SearchIO/blasttable.t ................ 1..166 ok 1 - use Bio::SearchIO; ok 2 - use Bio::Search::SearchUtils; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 - hit1_bits ok 7 - hit1_name ok 8 - hsp1_bits ok 9 - hsp1_gaps ok 10 - hsp1_he ok 11 - hsp1_hs ok 12 - hsp1_hstr ok 13 - hsp1_qe ok 14 - hsp1_qs ok 15 - hsp1_qstr ok 16 - hsp2_bits ok 17 - hsp2_gaps ok 18 - hsp2_he ok 19 - hsp2_hs ok 20 - hsp2_hstr ok 21 - hsp2_qe ok 22 - hsp2_qs ok 23 - hsp2_qstr ok 24 - hsp3_bits ok 25 - hsp3_gaps ok 26 - hsp3_he ok 27 - hsp3_hs ok 28 - hsp3_hstr ok 29 - hsp3_qe ok 30 - hsp3_qs ok 31 - hsp3_qstr ok 32 - hsp4_bits ok 33 - hsp4_gaps ok 34 - hsp4_he ok 35 - hsp4_hs ok 36 - hsp4_hstr ok 37 - hsp4_qe ok 38 - hsp4_qs ok 39 - hsp4_qstr ok 40 - hsp5_bits ok 41 - hsp5_gaps ok 42 - hsp5_he ok 43 - hsp5_hs ok 44 - hsp5_hstr ok 45 - hsp5_qe ok 46 - hsp5_qs ok 47 - hsp5_qstr ok 48 - hsp6_bits ok 49 - hsp6_gaps ok 50 - hsp6_he ok 51 - hsp6_hs ok 52 - hsp6_hstr ok 53 - hsp6_qe ok 54 - hsp6_qs ok 55 - hsp6_qstr ok 56 - hsp7_bits ok 57 - hsp7_gaps ok 58 - hsp7_he ok 59 - hsp7_hs ok 60 - hsp7_hstr ok 61 - hsp7_qe ok 62 - hsp7_qs ok 63 - hsp7_qstr ok 64 - hsp8_bits ok 65 - hsp8_gaps ok 66 - hsp8_he ok 67 - hsp8_hs ok 68 - hsp8_hstr ok 69 - hsp8_qe ok 70 - hsp8_qs ok 71 - hsp8_qstr ok 72 - query_name ok 73 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 74 ok 75 ok 76 - hit1_bits ok 77 - hit1_name ok 78 - hsp1_bits ok 79 - hsp1_gaps ok 80 - hsp1_he ok 81 - hsp1_hs ok 82 - hsp1_hstr ok 83 - hsp1_qe ok 84 - hsp1_qs ok 85 - hsp1_qstr ok 86 - hsp2_bits ok 87 - hsp2_gaps ok 88 - hsp2_he ok 89 - hsp2_hs ok 90 - hsp2_hstr ok 91 - hsp2_qe ok 92 - hsp2_qs ok 93 - hsp2_qstr ok 94 - hsp3_bits ok 95 - hsp3_gaps ok 96 - hsp3_he ok 97 - hsp3_hs ok 98 - hsp3_hstr ok 99 - hsp3_qe ok 100 - hsp3_qs ok 101 - hsp3_qstr ok 102 - hsp4_bits ok 103 - hsp4_gaps ok 104 - hsp4_he ok 105 - hsp4_hs ok 106 - hsp4_hstr ok 107 - hsp4_qe ok 108 - hsp4_qs ok 109 - hsp4_qstr ok 110 - hsp5_bits ok 111 - hsp5_gaps ok 112 - hsp5_he ok 113 - hsp5_hs ok 114 - hsp5_hstr ok 115 - hsp5_qe ok 116 - hsp5_qs ok 117 - hsp5_qstr ok 118 - hsp6_bits ok 119 - hsp6_gaps ok 120 - hsp6_he ok 121 - hsp6_hs ok 122 - hsp6_hstr ok 123 - hsp6_qe ok 124 - hsp6_qs ok 125 - hsp6_qstr ok 126 - hsp7_bits ok 127 - hsp7_gaps ok 128 - hsp7_he ok 129 - hsp7_hs ok 130 - hsp7_hstr ok 131 - hsp7_qe ok 132 - hsp7_qs ok 133 - hsp7_qstr ok 134 - hsp8_bits ok 135 - hsp8_gaps ok 136 - hsp8_he ok 137 - hsp8_hs ok 138 - hsp8_hstr ok 139 - hsp8_qe ok 140 - hsp8_qs ok 141 - hsp8_qstr ok 142 - query_name ok 143 ok 144 ok 145 ok 146 ok 147 - hit score ok 148 - hit raw_score ok 149 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 - fixed bug 3343 (percent identity) ok 158 - side effect of fixing bug 3343 (number of gaps) ok 159 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 160 ok 161 ok 162 ok 163 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 164 ok 165 ok 166 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/blastxml.t .................. 1..391 ok 1 - use Bio::SearchIO; ok 2 ok 3 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 4 - database_name() ok 5 - query_name() ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - database_name() ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 - query name on HSP ok 61 - query desc on HSP ok 62 - hitname ok 63 - hitdesc ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 - query name on HSP ok 169 - query desc on HSP ok 170 - hitname ok 171 - hitdesc ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 - query name on HSP ok 215 - query desc on HSP ok 216 - hitname ok 217 - hitdesc ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/cross_match.t ............... 1..15 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/erpin.t ..................... 1..91 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result ERPIN ok 4 - Result ERPIN reference ok 5 - Result ERPIN version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_name ok 16 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 17 - Hit accession ok 18 - Hit GI ok 19 - Hit algorithm ok 20 - Hit bits ok 21 - Hit description ok 22 - Hit length ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit overlap ok 28 - Hit query_length ok 29 - Hit rank ok 30 - Hit raw_score ok 31 - Hit score ok 32 ok 33 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 34 - HSP algorithm ok 35 ok 36 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 37 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 38 - HSP frame ok 39 - HSP gaps ok 40 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 41 - HSP hit_string ok 42 - HSP homology_string ok 43 - HSP hsp_group ok 44 - HSP hsp_length ok 45 - HSP length ok 46 - HSP links ok 47 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 48 - HSP query_string ok 49 - HSP range ok 50 - HSP rank ok 51 ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 ok 59 ok 60 - HSP strand ok 61 ok 62 ok 63 - ERPIN get_aln warning ok 64 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 65 - HSP algorithm ok 66 ok 67 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 68 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 69 - HSP frame ok 70 - HSP gaps ok 71 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 72 - HSP hit_string ok 73 - HSP homology_string ok 74 - HSP query_string ok 75 - HSP hsp_group ok 76 - HSP hsp_length ok 77 - HSP length ok 78 - HSP links ok 79 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 80 - HSP range ok 81 - HSP rank ok 82 ok 83 - HSP end ok 84 - HSP expect ok 85 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 86 - HSP seq_str ok 87 - HSP start ok 88 - HSP custom_score ok 89 ok 90 ok 91 - HSP strand ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/exonerate.t ................. 1..52 ok 1 - use Bio::SearchIO; ok 2 ok 3 # skip no query length available in default output ok 4 ok 5 # skip no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # skip no query length available in default output ok 26 ok 27 # skip no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - query_name ok 47 ok 48 - query_name ok 49 ok 50 - query_name ok 51 ok 52 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/fasta.t ..................... 1..299 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 - TFASTXY ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 - num_identical() ok 287 - num_conserved() ok 288 - bug 2937 and FASTA version 3.5 ok 289 - algorithm version ok 290 - query name ok 291 - query description ok 292 - query length ok 293 - algorithm ok 294 - num_identical() ok 295 - num_conserved() ok 296 - hsp->strand(hit) ok 297 - hsp->hit->strand ok 298 - hsp->strand(query) ok 299 - hsp->query->strand ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 t/SearchIO/gmap_f9.t ................... 1..54 ok 1 - use Bio::SearchIO; ok 2 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 3 - Did we get the expected number of hits? ok 4 - Did we get the expected algorithm? ok 5 - Did we get the expected query_name? ok 6 - 'Did we get a Hit?' isa 'Bio::Search::Hit::GenericHit' ok 7 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 8 - Check the name ok 9 - Check the hit length ok 10 - Check the number of hsps ok 11 - Check the query length ok 12 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 13 - Check the algorithm ok 14 - Count gaps in the query ok 15 - Count gaps in the hit ok 16 - Length of the query ok 17 - Length of the hit ok 18 - Query sequence ok 19 - Hit sequence ok 20 - Check query start ok 21 - Check query end ok 22 - Check query end ok 23 - Check the homology string ok 24 - Check seq_inds ok 25 - Check hit start ok 26 - Check hit end ok 27 - Check hit end ok 28 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 29 - Did we get the expected number of hits? ok 30 - Did we get the expected algorithm? ok 31 - Did we get the expected query_name? ok 32 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 33 - Check the name ok 34 - Check the hit length ok 35 - Check the number of hsps ok 36 - Check the query length ok 37 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 38 - Check the algorithm ok 39 - Count gaps in the query ok 40 - Count gaps in the hit ok 41 - Length of the query ok 42 - Length of the hit ok 43 - Query sequence ok 44 - Hit sequence ok 45 - Check query start ok 46 - Check query end ok 47 - Check query end ok 48 - Check the homology string ok 49 - Check seq_inds ok 50 - Check hit start ok 51 - Check hit end ok 52 - Check hit end ok 53 - Can we loop over multiple results properly (expecting 58)? ok 54 - simple query_name now caught, bug 3021 ok # Acme::Override::INET replaced IO::Socket::INET with IO::Socket::IP 0.28 Timeout (max run time is 300s) C:\Perl-5.18\bin\perl.exe exits with 37.