Start 2010-05-07T20:10:27 ActivePerl-1200 CPAN-1.9402 LIB=C:\PROGRA~1\MICROS~3\VC98\Lib\PSDK;C:\PROGRA~1\MICROS~2\Lib;C:\PROGRA~1\MICROS~3\VC98\Lib;C:\PROGRA~1\MICROS~3\VC98\MFC\Lib INCLUDE=C:\PROGRA~1\MICROS~2\Include;C:\PROGRA~1\MICROS~3\VC98\ATL\Include;C:\PROGRA~1\MICROS~3\VC98\Include;C:\PROGRA~1\MICROS~3\VC98\MFC\Include PATH=C:/CPANFL~1.12/var/libs/bin;C:\PROGRA~1\MICROS~2\Bin;C:\PROGRA~1\MICROS~2\Bin\WinNT;C:\PROGRA~1\MICROS~3\VC98\Bin;C:\PROGRA~1\MICROS~3\Common\MSDev98\Bin;C:\Perl-5.12\site\bin;C:\Perl-5.12\bin;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0 Going to read 'C:\cpanfly-5.12\var\cpan\Metadata' Database was generated on Fri, 07 May 2010 21:27:07 GMT Running make for B/BI/BIRNEY/bioperl-1.4.tar.gz Fetching with LWP: http://cpan.nas.activestate.com/authors/id/B/BI/BIRNEY/bioperl-1.4.tar.gz Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\B\BI\BIRNEY\bioperl-1.4.tar.gz ok bioperl-1.4/ bioperl-1.4/DEPRECATED bioperl-1.4/AUTHORS bioperl-1.4/BUGS bioperl-1.4/Changes bioperl-1.4/INSTALL bioperl-1.4/FAQ bioperl-1.4/Bio/ bioperl-1.4/Bio/Align/ bioperl-1.4/Bio/Align/AlignI.pm bioperl-1.4/Bio/Align/DNAStatistics.pm bioperl-1.4/Bio/Align/PairwiseStatistics.pm bioperl-1.4/Bio/Align/StatisticsI.pm bioperl-1.4/Bio/Align/Utilities.pm bioperl-1.4/Bio/AlignIO.pm bioperl-1.4/Bio/AnalysisI.pm bioperl-1.4/Bio/AnalysisParserI.pm bioperl-1.4/Bio/AnalysisResultI.pm bioperl-1.4/Bio/AnnotatableI.pm bioperl-1.4/Bio/AnnotationCollectionI.pm bioperl-1.4/Bio/AnnotationI.pm bioperl-1.4/Bio/Biblio.pm bioperl-1.4/Bio/ClusterI.pm bioperl-1.4/Bio/ClusterIO.pm bioperl-1.4/Bio/DBLinkContainerI.pm bioperl-1.4/Bio/DasI.pm bioperl-1.4/Bio/DescribableI.pm bioperl-1.4/Bio/FeatureHolderI.pm bioperl-1.4/Bio/Graphics.pm bioperl-1.4/Bio/IdCollectionI.pm bioperl-1.4/Bio/IdentifiableI.pm bioperl-1.4/Bio/LocatableSeq.pm bioperl-1.4/Bio/LocationI.pm bioperl-1.4/Bio/MapIO.pm bioperl-1.4/Bio/OntologyIO.pm bioperl-1.4/Bio/Perl.pm bioperl-1.4/Bio/PrimarySeq.pm bioperl-1.4/Bio/PrimarySeqI.pm bioperl-1.4/Bio/Range.pm bioperl-1.4/Bio/RangeI.pm bioperl-1.4/Bio/SearchDist.pm bioperl-1.4/Bio/SearchIO.pm bioperl-1.4/Bio/Seq.pm bioperl-1.4/Bio/SeqAnalysisParserI.pm bioperl-1.4/Bio/SeqFeatureI.pm bioperl-1.4/Bio/SeqI.pm bioperl-1.4/Bio/SeqIO.pm bioperl-1.4/Bio/SeqUtils.pm bioperl-1.4/Bio/SimpleAlign.pm bioperl-1.4/Bio/SimpleAnalysisI.pm bioperl-1.4/Bio/Species.pm bioperl-1.4/Bio/Taxonomy.pm bioperl-1.4/Bio/TreeIO.pm bioperl-1.4/Bio/UpdateableSeqI.pm bioperl-1.4/Bio/WebAgent.pm bioperl-1.4/Bio/AlignIO/ bioperl-1.4/Bio/AlignIO/bl2seq.pm bioperl-1.4/Bio/AlignIO/clustalw.pm bioperl-1.4/Bio/AlignIO/emboss.pm bioperl-1.4/Bio/AlignIO/fasta.pm bioperl-1.4/Bio/AlignIO/maf.pm bioperl-1.4/Bio/AlignIO/mase.pm bioperl-1.4/Bio/AlignIO/mega.pm bioperl-1.4/Bio/AlignIO/meme.pm bioperl-1.4/Bio/AlignIO/metafasta.pm bioperl-1.4/Bio/AlignIO/msf.pm bioperl-1.4/Bio/AlignIO/nexus.pm bioperl-1.4/Bio/AlignIO/pfam.pm bioperl-1.4/Bio/AlignIO/phylip.pm bioperl-1.4/Bio/AlignIO/prodom.pm bioperl-1.4/Bio/AlignIO/psi.pm bioperl-1.4/Bio/AlignIO/selex.pm bioperl-1.4/Bio/AlignIO/stockholm.pm bioperl-1.4/Bio/Annotation/ bioperl-1.4/Bio/Annotation/AnnotationFactory.pm bioperl-1.4/Bio/Annotation/Collection.pm bioperl-1.4/Bio/Annotation/Comment.pm bioperl-1.4/Bio/Annotation/DBLink.pm bioperl-1.4/Bio/Annotation/OntologyTerm.pm bioperl-1.4/Bio/Annotation/Reference.pm bioperl-1.4/Bio/Annotation/SimpleValue.pm bioperl-1.4/Bio/Annotation/StructuredValue.pm bioperl-1.4/Bio/Annotation/TypeManager.pm bioperl-1.4/Bio/Assembly/ bioperl-1.4/Bio/Assembly/IO/ bioperl-1.4/Bio/Assembly/IO/phrap.pm bioperl-1.4/Bio/Assembly/IO/ace.pm bioperl-1.4/Bio/Assembly/Contig.pm bioperl-1.4/Bio/Assembly/ContigAnalysis.pm bioperl-1.4/Bio/Assembly/IO.pm bioperl-1.4/Bio/Assembly/Scaffold.pm bioperl-1.4/Bio/Assembly/ScaffoldI.pm bioperl-1.4/Bio/Biblio/ bioperl-1.4/Bio/Biblio/IO/ bioperl-1.4/Bio/Biblio/IO/medline2ref.pm bioperl-1.4/Bio/Biblio/IO/medlinexml.pm bioperl-1.4/Bio/Biblio/IO/pubmed2ref.pm bioperl-1.4/Bio/Biblio/IO/pubmedxml.pm bioperl-1.4/Bio/Biblio/Article.pm bioperl-1.4/Bio/Biblio/BiblioBase.pm bioperl-1.4/Bio/Biblio/Book.pm bioperl-1.4/Bio/Biblio/BookArticle.pm bioperl-1.4/Bio/Biblio/IO.pm bioperl-1.4/Bio/Biblio/Journal.pm bioperl-1.4/Bio/Biblio/JournalArticle.pm bioperl-1.4/Bio/Biblio/MedlineArticle.pm bioperl-1.4/Bio/Biblio/MedlineBook.pm bioperl-1.4/Bio/Biblio/MedlineBookArticle.pm bioperl-1.4/Bio/Biblio/MedlineJournal.pm bioperl-1.4/Bio/Biblio/MedlineJournalArticle.pm bioperl-1.4/Bio/Biblio/Organisation.pm bioperl-1.4/Bio/Biblio/Patent.pm bioperl-1.4/Bio/Biblio/Person.pm bioperl-1.4/Bio/Biblio/Proceeding.pm bioperl-1.4/Bio/Biblio/Provider.pm bioperl-1.4/Bio/Biblio/PubmedArticle.pm bioperl-1.4/Bio/Biblio/PubmedBookArticle.pm bioperl-1.4/Bio/Biblio/PubmedJournalArticle.pm bioperl-1.4/Bio/Biblio/Ref.pm bioperl-1.4/Bio/Biblio/Service.pm bioperl-1.4/Bio/Biblio/TechReport.pm bioperl-1.4/Bio/Biblio/Thesis.pm bioperl-1.4/Bio/Biblio/WebResource.pm bioperl-1.4/Bio/Cluster/ bioperl-1.4/Bio/Cluster/ClusterFactory.pm bioperl-1.4/Bio/Cluster/FamilyI.pm bioperl-1.4/Bio/Cluster/SequenceFamily.pm bioperl-1.4/Bio/Cluster/UniGene.pm bioperl-1.4/Bio/Cluster/UniGeneI.pm bioperl-1.4/Bio/ClusterIO/ bioperl-1.4/Bio/ClusterIO/dbsnp.pm bioperl-1.4/Bio/ClusterIO/unigene.pm bioperl-1.4/Bio/CodonUsage/ bioperl-1.4/Bio/CodonUsage/Table.pm bioperl-1.4/Bio/CodonUsage/IO.pm bioperl-1.4/Bio/Coordinate/ bioperl-1.4/Bio/Coordinate/Result/ bioperl-1.4/Bio/Coordinate/Result/Match.pm bioperl-1.4/Bio/Coordinate/Result/Gap.pm bioperl-1.4/Bio/Coordinate/Chain.pm bioperl-1.4/Bio/Coordinate/Collection.pm bioperl-1.4/Bio/Coordinate/ExtrapolatingPair.pm bioperl-1.4/Bio/Coordinate/GeneMapper.pm bioperl-1.4/Bio/Coordinate/Graph.pm bioperl-1.4/Bio/Coordinate/MapperI.pm bioperl-1.4/Bio/Coordinate/Pair.pm bioperl-1.4/Bio/Coordinate/Result.pm bioperl-1.4/Bio/Coordinate/ResultI.pm bioperl-1.4/Bio/Coordinate/Utils.pm bioperl-1.4/Bio/DB/ bioperl-1.4/Bio/DB/BiblioI.pm bioperl-1.4/Bio/DB/Ace.pm bioperl-1.4/Bio/DB/Biblio/ bioperl-1.4/Bio/DB/Biblio/biofetch.pm bioperl-1.4/Bio/DB/Biblio/soap.pm bioperl-1.4/Bio/DB/BioFetch.pm bioperl-1.4/Bio/DB/CUTG.pm bioperl-1.4/Bio/DB/DBFetch.pm bioperl-1.4/Bio/DB/EMBL.pm bioperl-1.4/Bio/DB/Failover.pm bioperl-1.4/Bio/DB/Fasta.pm bioperl-1.4/Bio/DB/FileCache.pm bioperl-1.4/Bio/DB/Flat.pm bioperl-1.4/Bio/DB/GDB.pm bioperl-1.4/Bio/DB/GFF.pm bioperl-1.4/Bio/DB/GenBank.pm bioperl-1.4/Bio/DB/GenPept.pm bioperl-1.4/Bio/DB/InMemoryCache.pm bioperl-1.4/Bio/DB/MANIFEST bioperl-1.4/Bio/DB/Makefile.PL bioperl-1.4/Bio/DB/MeSH.pm bioperl-1.4/Bio/DB/NCBIHelper.pm bioperl-1.4/Bio/DB/QueryI.pm bioperl-1.4/Bio/DB/RandomAccessI.pm bioperl-1.4/Bio/DB/RefSeq.pm bioperl-1.4/Bio/DB/Registry.pm bioperl-1.4/Bio/DB/SeqI.pm bioperl-1.4/Bio/DB/SwissProt.pm bioperl-1.4/Bio/DB/Taxonomy.pm bioperl-1.4/Bio/DB/Universal.pm bioperl-1.4/Bio/DB/UpdateableSeqI.pm bioperl-1.4/Bio/DB/WebDBSeqI.pm bioperl-1.4/Bio/DB/XEMBL.pm bioperl-1.4/Bio/DB/XEMBLService.pm bioperl-1.4/Bio/DB/Flat/ bioperl-1.4/Bio/DB/Flat/BDB/ bioperl-1.4/Bio/DB/Flat/BDB/fasta.pm bioperl-1.4/Bio/DB/Flat/BDB/embl.pm bioperl-1.4/Bio/DB/Flat/BDB/genbank.pm bioperl-1.4/Bio/DB/Flat/BDB/swiss.pm bioperl-1.4/Bio/DB/Flat/BDB/swissprot.pm bioperl-1.4/Bio/DB/Flat/BDB.pm bioperl-1.4/Bio/DB/Flat/BinarySearch.pm bioperl-1.4/Bio/DB/GFF/ bioperl-1.4/Bio/DB/GFF/Adaptor/ bioperl-1.4/Bio/DB/GFF/Adaptor/biofetch.pm bioperl-1.4/Bio/DB/GFF/Adaptor/ace.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/ bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/iterator.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/mysql.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/oracle.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/oracleace.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi/pg.pm bioperl-1.4/Bio/DB/GFF/Adaptor/biofetch_oracle.pm bioperl-1.4/Bio/DB/GFF/Adaptor/dbi.pm bioperl-1.4/Bio/DB/GFF/Adaptor/memory.pm bioperl-1.4/Bio/DB/GFF/Adaptor/memory_iterator.pm bioperl-1.4/Bio/DB/GFF/Aggregator.pm bioperl-1.4/Bio/DB/GFF/Featname.pm bioperl-1.4/Bio/DB/GFF/Feature.pm bioperl-1.4/Bio/DB/GFF/Homol.pm bioperl-1.4/Bio/DB/GFF/RelSegment.pm bioperl-1.4/Bio/DB/GFF/Segment.pm bioperl-1.4/Bio/DB/GFF/Typename.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ bioperl-1.4/Bio/DB/GFF/Aggregator/alignment.pm bioperl-1.4/Bio/DB/GFF/Aggregator/clone.pm bioperl-1.4/Bio/DB/GFF/Aggregator/coding.pm bioperl-1.4/Bio/DB/GFF/Aggregator/match.pm bioperl-1.4/Bio/DB/GFF/Aggregator/none.pm bioperl-1.4/Bio/DB/GFF/Aggregator/processed_transcript.pm bioperl-1.4/Bio/DB/GFF/Aggregator/transcript.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_acembly.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_genscan.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_refgene.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_softberry.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm bioperl-1.4/Bio/DB/GFF/Aggregator/ucsc_unigene.pm bioperl-1.4/Bio/DB/GFF/Util/ bioperl-1.4/Bio/DB/GFF/Util/Binning.pm bioperl-1.4/Bio/DB/GFF/Util/Rearrange.pm bioperl-1.4/Bio/DB/Query/ bioperl-1.4/Bio/DB/Query/GenBank.pm bioperl-1.4/Bio/DB/Query/WebQuery.pm bioperl-1.4/Bio/DB/Taxonomy/ bioperl-1.4/Bio/DB/Taxonomy/entrez.pm bioperl-1.4/Bio/DB/Taxonomy/flatfile.pm bioperl-1.4/Bio/Das/ bioperl-1.4/Bio/Das/FeatureTypeI.pm bioperl-1.4/Bio/Das/SegmentI.pm bioperl-1.4/Bio/Event/ bioperl-1.4/Bio/Event/EventGeneratorI.pm bioperl-1.4/Bio/Event/EventHandlerI.pm bioperl-1.4/Bio/Expression/ bioperl-1.4/Bio/Expression/FeatureGroup/ bioperl-1.4/Bio/Expression/FeatureGroup/FeatureGroupMas50.pm bioperl-1.4/Bio/Expression/FeatureGroup.pm bioperl-1.4/Bio/Expression/FeatureI.pm bioperl-1.4/Bio/Expression/FeatureSet/ bioperl-1.4/Bio/Expression/FeatureSet/FeatureSetMas50.pm bioperl-1.4/Bio/Factory/ bioperl-1.4/Bio/Factory/AnalysisI.pm bioperl-1.4/Bio/Factory/ApplicationFactoryI.pm bioperl-1.4/Bio/Factory/DriverFactory.pm bioperl-1.4/Bio/Factory/FTLocationFactory.pm bioperl-1.4/Bio/Factory/HitFactoryI.pm bioperl-1.4/Bio/Factory/LocationFactoryI.pm bioperl-1.4/Bio/Factory/MapFactoryI.pm bioperl-1.4/Bio/Factory/ObjectBuilderI.pm bioperl-1.4/Bio/Factory/ObjectFactory.pm bioperl-1.4/Bio/Factory/ObjectFactoryI.pm bioperl-1.4/Bio/Factory/ResultFactoryI.pm bioperl-1.4/Bio/Factory/SeqAnalysisParserFactory.pm bioperl-1.4/Bio/Factory/SeqAnalysisParserFactoryI.pm bioperl-1.4/Bio/Factory/SequenceFactoryI.pm bioperl-1.4/Bio/Factory/SequenceProcessorI.pm bioperl-1.4/Bio/Factory/SequenceStreamI.pm bioperl-1.4/Bio/Factory/TreeFactoryI.pm bioperl-1.4/Bio/Graphics/ bioperl-1.4/Bio/Graphics/FeatureFile/ bioperl-1.4/Bio/Graphics/FeatureFile/Iterator.pm bioperl-1.4/Bio/Graphics/ConfiguratorI.pm bioperl-1.4/Bio/Graphics/Feature.pm bioperl-1.4/Bio/Graphics/FeatureFile.pm bioperl-1.4/Bio/Graphics/Glyph.pm bioperl-1.4/Bio/Graphics/Panel.pm bioperl-1.4/Bio/Graphics/Pictogram.pm bioperl-1.4/Bio/Graphics/RendererI.pm bioperl-1.4/Bio/Graphics/Util.pm bioperl-1.4/Bio/Graphics/Glyph/ bioperl-1.4/Bio/Graphics/Glyph/Factory.pm bioperl-1.4/Bio/Graphics/Glyph/alignment.pm bioperl-1.4/Bio/Graphics/Glyph/anchored_arrow.pm bioperl-1.4/Bio/Graphics/Glyph/arrow.pm bioperl-1.4/Bio/Graphics/Glyph/box.pm bioperl-1.4/Bio/Graphics/Glyph/cds.pm bioperl-1.4/Bio/Graphics/Glyph/crossbox.pm bioperl-1.4/Bio/Graphics/Glyph/diamond.pm bioperl-1.4/Bio/Graphics/Glyph/dna.pm bioperl-1.4/Bio/Graphics/Glyph/dot.pm bioperl-1.4/Bio/Graphics/Glyph/ellipse.pm bioperl-1.4/Bio/Graphics/Glyph/ex.pm bioperl-1.4/Bio/Graphics/Glyph/extending_arrow.pm bioperl-1.4/Bio/Graphics/Glyph/generic.pm bioperl-1.4/Bio/Graphics/Glyph/graded_segments.pm bioperl-1.4/Bio/Graphics/Glyph/group.pm bioperl-1.4/Bio/Graphics/Glyph/heterogeneous_segments.pm bioperl-1.4/Bio/Graphics/Glyph/line.pm bioperl-1.4/Bio/Graphics/Glyph/minmax.pm bioperl-1.4/Bio/Graphics/Glyph/oval.pm bioperl-1.4/Bio/Graphics/Glyph/pinsertion.pm bioperl-1.4/Bio/Graphics/Glyph/primers.pm bioperl-1.4/Bio/Graphics/Glyph/processed_transcript.pm bioperl-1.4/Bio/Graphics/Glyph/redgreen_box.pm bioperl-1.4/Bio/Graphics/Glyph/redgreen_segment.pm bioperl-1.4/Bio/Graphics/Glyph/rndrect.pm bioperl-1.4/Bio/Graphics/Glyph/ruler_arrow.pm bioperl-1.4/Bio/Graphics/Glyph/segmented_keyglyph.pm bioperl-1.4/Bio/Graphics/Glyph/segments.pm bioperl-1.4/Bio/Graphics/Glyph/span.pm bioperl-1.4/Bio/Graphics/Glyph/splice_site.pm bioperl-1.4/Bio/Graphics/Glyph/toomany.pm bioperl-1.4/Bio/Graphics/Glyph/track.pm bioperl-1.4/Bio/Graphics/Glyph/transcript.pm bioperl-1.4/Bio/Graphics/Glyph/transcript2.pm bioperl-1.4/Bio/Graphics/Glyph/translation.pm bioperl-1.4/Bio/Graphics/Glyph/triangle.pm bioperl-1.4/Bio/Graphics/Glyph/xyplot.pm bioperl-1.4/Bio/Index/ bioperl-1.4/Bio/Index/Abstract.pm bioperl-1.4/Bio/Index/AbstractSeq.pm bioperl-1.4/Bio/Index/Blast.pm bioperl-1.4/Bio/Index/EMBL.pm bioperl-1.4/Bio/Index/Fasta.pm bioperl-1.4/Bio/Index/Fastq.pm bioperl-1.4/Bio/Index/GenBank.pm bioperl-1.4/Bio/Index/SwissPfam.pm bioperl-1.4/Bio/Index/Swissprot.pm bioperl-1.4/Bio/LiveSeq/ bioperl-1.4/Bio/LiveSeq/IO/ bioperl-1.4/Bio/LiveSeq/IO/BioPerl.pm bioperl-1.4/Bio/LiveSeq/IO/Loader.pm bioperl-1.4/Bio/LiveSeq/IO/README bioperl-1.4/Bio/LiveSeq/IO/SRS.pm bioperl-1.4/Bio/LiveSeq/AARange.pm bioperl-1.4/Bio/LiveSeq/Chain.pm bioperl-1.4/Bio/LiveSeq/ChainI.pm bioperl-1.4/Bio/LiveSeq/DNA.pm bioperl-1.4/Bio/LiveSeq/Exon.pm bioperl-1.4/Bio/LiveSeq/Gene.pm bioperl-1.4/Bio/LiveSeq/Intron.pm bioperl-1.4/Bio/LiveSeq/Mutation.pm bioperl-1.4/Bio/LiveSeq/Mutator.pm bioperl-1.4/Bio/LiveSeq/Prim_Transcript.pm bioperl-1.4/Bio/LiveSeq/Range.pm bioperl-1.4/Bio/LiveSeq/Repeat_Region.pm bioperl-1.4/Bio/LiveSeq/Repeat_Unit.pm bioperl-1.4/Bio/LiveSeq/SeqI.pm bioperl-1.4/Bio/LiveSeq/Transcript.pm bioperl-1.4/Bio/LiveSeq/Translation.pm bioperl-1.4/Bio/Location/ bioperl-1.4/Bio/Location/Atomic.pm bioperl-1.4/Bio/Location/AvWithinCoordPolicy.pm bioperl-1.4/Bio/Location/CoordinatePolicyI.pm bioperl-1.4/Bio/Location/Fuzzy.pm bioperl-1.4/Bio/Location/FuzzyLocationI.pm bioperl-1.4/Bio/Location/NarrowestCoordPolicy.pm bioperl-1.4/Bio/Location/Simple.pm bioperl-1.4/Bio/Location/Split.pm bioperl-1.4/Bio/Location/SplitLocationI.pm bioperl-1.4/Bio/Location/WidestCoordPolicy.pm bioperl-1.4/Bio/Map/ bioperl-1.4/Bio/Map/CytoMap.pm bioperl-1.4/Bio/Map/CytoMarker.pm bioperl-1.4/Bio/Map/CytoPosition.pm bioperl-1.4/Bio/Map/LinkageMap.pm bioperl-1.4/Bio/Map/LinkagePosition.pm bioperl-1.4/Bio/Map/MapI.pm bioperl-1.4/Bio/Map/MappableI.pm bioperl-1.4/Bio/Map/Marker.pm bioperl-1.4/Bio/Map/MarkerI.pm bioperl-1.4/Bio/Map/Microsatellite.pm bioperl-1.4/Bio/Map/OrderedPosition.pm bioperl-1.4/Bio/Map/OrderedPositionWithDistance.pm bioperl-1.4/Bio/Map/Position.pm bioperl-1.4/Bio/Map/PositionI.pm bioperl-1.4/Bio/Map/SimpleMap.pm bioperl-1.4/Bio/MapIO/ bioperl-1.4/Bio/MapIO/mapmaker.pm bioperl-1.4/Bio/Matrix/ bioperl-1.4/Bio/Matrix/IO/ bioperl-1.4/Bio/Matrix/IO/phylip.pm bioperl-1.4/Bio/Matrix/IO/scoring.pm bioperl-1.4/Bio/Matrix/PSM/ bioperl-1.4/Bio/Matrix/PSM/PsmHeader.pm bioperl-1.4/Bio/Matrix/PSM/IO.pm bioperl-1.4/Bio/Matrix/PSM/Psm.pm bioperl-1.4/Bio/Matrix/PSM/InstanceSite.pm bioperl-1.4/Bio/Matrix/PSM/InstanceSiteI.pm bioperl-1.4/Bio/Matrix/PSM/IO/ bioperl-1.4/Bio/Matrix/PSM/IO/transfac.pm bioperl-1.4/Bio/Matrix/PSM/IO/mast.pm bioperl-1.4/Bio/Matrix/PSM/IO/meme.pm bioperl-1.4/Bio/Matrix/PSM/PsmHeaderI.pm bioperl-1.4/Bio/Matrix/PSM/PsmI.pm bioperl-1.4/Bio/Matrix/PSM/SiteMatrix.pm bioperl-1.4/Bio/Matrix/PSM/SiteMatrixI.pm bioperl-1.4/Bio/Matrix/Generic.pm bioperl-1.4/Bio/Matrix/IO.pm bioperl-1.4/Bio/Matrix/MatrixI.pm bioperl-1.4/Bio/Matrix/PhylipDist.pm bioperl-1.4/Bio/Matrix/Scoring.pm bioperl-1.4/Bio/Ontology/ bioperl-1.4/Bio/Ontology/GOterm.pm bioperl-1.4/Bio/Ontology/InterProTerm.pm bioperl-1.4/Bio/Ontology/Ontology.pm bioperl-1.4/Bio/Ontology/OntologyEngineI.pm bioperl-1.4/Bio/Ontology/OntologyI.pm bioperl-1.4/Bio/Ontology/OntologyStore.pm bioperl-1.4/Bio/Ontology/Path.pm bioperl-1.4/Bio/Ontology/PathI.pm bioperl-1.4/Bio/Ontology/Relationship.pm bioperl-1.4/Bio/Ontology/RelationshipFactory.pm bioperl-1.4/Bio/Ontology/RelationshipI.pm bioperl-1.4/Bio/Ontology/RelationshipType.pm bioperl-1.4/Bio/Ontology/SimpleGOEngine.pm bioperl-1.4/Bio/Ontology/SimpleOntologyEngine.pm bioperl-1.4/Bio/Ontology/Term.pm bioperl-1.4/Bio/Ontology/TermFactory.pm bioperl-1.4/Bio/Ontology/TermI.pm bioperl-1.4/Bio/OntologyIO/ bioperl-1.4/Bio/OntologyIO/Handlers/ bioperl-1.4/Bio/OntologyIO/Handlers/BaseSAXHandler.pm bioperl-1.4/Bio/OntologyIO/Handlers/InterProHandler.pm bioperl-1.4/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm bioperl-1.4/Bio/OntologyIO/InterProParser.pm bioperl-1.4/Bio/OntologyIO/dagflat.pm bioperl-1.4/Bio/OntologyIO/goflat.pm bioperl-1.4/Bio/OntologyIO/simplehierarchy.pm bioperl-1.4/Bio/OntologyIO/soflat.pm bioperl-1.4/Bio/Phenotype/ bioperl-1.4/Bio/Phenotype/MeSH/ bioperl-1.4/Bio/Phenotype/MeSH/Term.pm bioperl-1.4/Bio/Phenotype/MeSH/Twig.pm bioperl-1.4/Bio/Phenotype/OMIM/ bioperl-1.4/Bio/Phenotype/OMIM/MiniMIMentry.pm bioperl-1.4/Bio/Phenotype/OMIM/OMIMentry.pm bioperl-1.4/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm bioperl-1.4/Bio/Phenotype/OMIM/OMIMparser.pm bioperl-1.4/Bio/Phenotype/Correlate.pm bioperl-1.4/Bio/Phenotype/Measure.pm bioperl-1.4/Bio/Phenotype/Phenotype.pm bioperl-1.4/Bio/Phenotype/PhenotypeI.pm bioperl-1.4/Bio/PopGen/ bioperl-1.4/Bio/PopGen/IO/ bioperl-1.4/Bio/PopGen/IO/csv.pm bioperl-1.4/Bio/PopGen/IO/prettybase.pm bioperl-1.4/Bio/PopGen/Genotype.pm bioperl-1.4/Bio/PopGen/GenotypeI.pm bioperl-1.4/Bio/PopGen/IO.pm bioperl-1.4/Bio/PopGen/Individual.pm bioperl-1.4/Bio/PopGen/IndividualI.pm bioperl-1.4/Bio/PopGen/Marker.pm bioperl-1.4/Bio/PopGen/MarkerI.pm bioperl-1.4/Bio/PopGen/PopStats.pm bioperl-1.4/Bio/PopGen/Population.pm bioperl-1.4/Bio/PopGen/PopulationI.pm bioperl-1.4/Bio/PopGen/Statistics.pm bioperl-1.4/Bio/PopGen/Simulation/ bioperl-1.4/Bio/PopGen/Simulation/Coalescent.pm bioperl-1.4/Bio/PopGen/Simulation/GeneticDrift.pm bioperl-1.4/Bio/Restriction/ bioperl-1.4/Bio/Restriction/Enzyme/ bioperl-1.4/Bio/Restriction/Enzyme/MultiCut.pm bioperl-1.4/Bio/Restriction/Enzyme/MultiSite.pm bioperl-1.4/Bio/Restriction/Analysis.pm bioperl-1.4/Bio/Restriction/Enzyme.pm bioperl-1.4/Bio/Restriction/EnzymeCollection.pm bioperl-1.4/Bio/Restriction/EnzymeI.pm bioperl-1.4/Bio/Restriction/IO.pm bioperl-1.4/Bio/Restriction/IO/ bioperl-1.4/Bio/Restriction/IO/bairoch.pm bioperl-1.4/Bio/Restriction/IO/base.pm bioperl-1.4/Bio/Restriction/IO/itype2.pm bioperl-1.4/Bio/Restriction/IO/withrefm.pm bioperl-1.4/Bio/Root/ bioperl-1.4/Bio/Root/Exception.pm bioperl-1.4/Bio/Root/Err.pm bioperl-1.4/Bio/Root/Global.pm bioperl-1.4/Bio/Root/HTTPget.pm bioperl-1.4/Bio/Root/IO.pm bioperl-1.4/Bio/Root/IOManager.pm bioperl-1.4/Bio/Root/Object.pm bioperl-1.4/Bio/Root/Root.pm bioperl-1.4/Bio/Root/RootI.pm bioperl-1.4/Bio/Root/Storable.pm bioperl-1.4/Bio/Root/Utilities.pm bioperl-1.4/Bio/Root/Vector.pm bioperl-1.4/Bio/Root/Version.pm bioperl-1.4/Bio/Root/Xref.pm bioperl-1.4/Bio/Search/ bioperl-1.4/Bio/Search/HSP/ bioperl-1.4/Bio/Search/HSP/BlastHSP.pm bioperl-1.4/Bio/Search/HSP/FastaHSP.pm bioperl-1.4/Bio/Search/HSP/GenericHSP.pm bioperl-1.4/Bio/Search/HSP/HMMERHSP.pm bioperl-1.4/Bio/Search/HSP/HSPFactory.pm bioperl-1.4/Bio/Search/HSP/HSPI.pm bioperl-1.4/Bio/Search/HSP/PSLHSP.pm bioperl-1.4/Bio/Search/HSP/PsiBlastHSP.pm bioperl-1.4/Bio/Search/HSP/WABAHSP.pm bioperl-1.4/Bio/Search/Hit/ bioperl-1.4/Bio/Search/Hit/BlastHit.pm bioperl-1.4/Bio/Search/Hit/Fasta.pm bioperl-1.4/Bio/Search/Hit/GenericHit.pm bioperl-1.4/Bio/Search/Hit/HMMERHit.pm bioperl-1.4/Bio/Search/Hit/HitFactory.pm bioperl-1.4/Bio/Search/Hit/HitI.pm bioperl-1.4/Bio/Search/Hit/PsiBlastHit.pm bioperl-1.4/Bio/Search/BlastUtils.pm bioperl-1.4/Bio/Search/DatabaseI.pm bioperl-1.4/Bio/Search/GenericDatabase.pm bioperl-1.4/Bio/Search/Processor.pm bioperl-1.4/Bio/Search/SearchUtils.pm bioperl-1.4/Bio/Search/Iteration/ bioperl-1.4/Bio/Search/Iteration/GenericIteration.pm bioperl-1.4/Bio/Search/Iteration/IterationI.pm bioperl-1.4/Bio/Search/Result/ bioperl-1.4/Bio/Search/Result/BlastResult.pm bioperl-1.4/Bio/Search/Result/GenericResult.pm bioperl-1.4/Bio/Search/Result/HMMERResult.pm bioperl-1.4/Bio/Search/Result/ResultFactory.pm bioperl-1.4/Bio/Search/Result/ResultI.pm bioperl-1.4/Bio/Search/Result/WABAResult.pm bioperl-1.4/Bio/SearchIO/ bioperl-1.4/Bio/SearchIO/Writer/ bioperl-1.4/Bio/SearchIO/Writer/BSMLResultWriter.pm bioperl-1.4/Bio/SearchIO/Writer/GbrowseGFF.pm bioperl-1.4/Bio/SearchIO/Writer/HSPTableWriter.pm bioperl-1.4/Bio/SearchIO/Writer/HTMLResultWriter.pm bioperl-1.4/Bio/SearchIO/Writer/HitTableWriter.pm bioperl-1.4/Bio/SearchIO/Writer/ResultTableWriter.pm bioperl-1.4/Bio/SearchIO/Writer/TextResultWriter.pm bioperl-1.4/Bio/SearchIO/EventHandlerI.pm bioperl-1.4/Bio/SearchIO/FastHitEventBuilder.pm bioperl-1.4/Bio/SearchIO/IteratedSearchResultEventBuilder.pm bioperl-1.4/Bio/SearchIO/SearchResultEventBuilder.pm bioperl-1.4/Bio/SearchIO/SearchWriterI.pm bioperl-1.4/Bio/SearchIO/axt.pm bioperl-1.4/Bio/SearchIO/blast.pm bioperl-1.4/Bio/SearchIO/blasttable.pm bioperl-1.4/Bio/SearchIO/blastxml.pm bioperl-1.4/Bio/SearchIO/exonerate.pm bioperl-1.4/Bio/SearchIO/fasta.pm bioperl-1.4/Bio/SearchIO/hmmer.pm bioperl-1.4/Bio/SearchIO/megablast.pm bioperl-1.4/Bio/SearchIO/psl.pm bioperl-1.4/Bio/SearchIO/sim4.pm bioperl-1.4/Bio/SearchIO/waba.pm bioperl-1.4/Bio/SearchIO/wise.pm bioperl-1.4/Bio/Seq/ bioperl-1.4/Bio/Seq/Meta/ bioperl-1.4/Bio/Seq/Meta/Array.pm bioperl-1.4/Bio/Seq/BaseSeqProcessor.pm bioperl-1.4/Bio/Seq/EncodedSeq.pm bioperl-1.4/Bio/Seq/LargePrimarySeq.pm bioperl-1.4/Bio/Seq/LargeSeq.pm bioperl-1.4/Bio/Seq/Meta.pm bioperl-1.4/Bio/Seq/MetaI.pm bioperl-1.4/Bio/Seq/PrimaryQual.pm bioperl-1.4/Bio/Seq/PrimedSeq.pm bioperl-1.4/Bio/Seq/QualI.pm bioperl-1.4/Bio/Seq/RichSeq.pm bioperl-1.4/Bio/Seq/RichSeqI.pm bioperl-1.4/Bio/Seq/SeqBuilder.pm bioperl-1.4/Bio/Seq/SeqFactory.pm bioperl-1.4/Bio/Seq/SeqFastaSpeedFactory.pm bioperl-1.4/Bio/Seq/SeqWithQuality.pm bioperl-1.4/Bio/Seq/SequenceTrace.pm bioperl-1.4/Bio/Seq/TraceI.pm bioperl-1.4/Bio/SeqFeature/ bioperl-1.4/Bio/SeqFeature/Gene/ bioperl-1.4/Bio/SeqFeature/Gene/ExonI.pm bioperl-1.4/Bio/SeqFeature/Gene/Exon.pm bioperl-1.4/Bio/SeqFeature/Gene/GeneStructure.pm bioperl-1.4/Bio/SeqFeature/Gene/GeneStructureI.pm bioperl-1.4/Bio/SeqFeature/Gene/Intron.pm bioperl-1.4/Bio/SeqFeature/Gene/NC_Feature.pm bioperl-1.4/Bio/SeqFeature/Gene/Poly_A_site.pm bioperl-1.4/Bio/SeqFeature/Gene/Promoter.pm bioperl-1.4/Bio/SeqFeature/Gene/Transcript.pm bioperl-1.4/Bio/SeqFeature/Gene/TranscriptI.pm bioperl-1.4/Bio/SeqFeature/Gene/UTR.pm bioperl-1.4/Bio/SeqFeature/AnnotationAdaptor.pm bioperl-1.4/Bio/SeqFeature/Collection.pm bioperl-1.4/Bio/SeqFeature/CollectionI.pm bioperl-1.4/Bio/SeqFeature/Computation.pm bioperl-1.4/Bio/SeqFeature/FeaturePair.pm bioperl-1.4/Bio/SeqFeature/Generic.pm bioperl-1.4/Bio/SeqFeature/PositionProxy.pm bioperl-1.4/Bio/SeqFeature/Primer.pm bioperl-1.4/Bio/SeqFeature/Similarity.pm bioperl-1.4/Bio/SeqFeature/SimilarityPair.pm bioperl-1.4/Bio/SeqFeature/SiRNA/ bioperl-1.4/Bio/SeqFeature/SiRNA/Oligo.pm bioperl-1.4/Bio/SeqFeature/SiRNA/Pair.pm bioperl-1.4/Bio/SeqFeature/Tools/ bioperl-1.4/Bio/SeqFeature/Tools/TypeMapper.pm bioperl-1.4/Bio/SeqFeature/Tools/Unflattener.pm bioperl-1.4/Bio/SeqIO/ bioperl-1.4/Bio/SeqIO/game/ bioperl-1.4/Bio/SeqIO/game/featHandler.pm bioperl-1.4/Bio/SeqIO/game/gameHandler.pm bioperl-1.4/Bio/SeqIO/game/gameSubs.pm bioperl-1.4/Bio/SeqIO/game/gameWriter.pm bioperl-1.4/Bio/SeqIO/game/seqHandler.pm bioperl-1.4/Bio/SeqIO/FTHelper.pm bioperl-1.4/Bio/SeqIO/MultiFile.pm bioperl-1.4/Bio/SeqIO/abi.pm bioperl-1.4/Bio/SeqIO/ace.pm bioperl-1.4/Bio/SeqIO/alf.pm bioperl-1.4/Bio/SeqIO/asciitree.pm bioperl-1.4/Bio/SeqIO/bsml.pm bioperl-1.4/Bio/SeqIO/chadoxml.pm bioperl-1.4/Bio/SeqIO/ctf.pm bioperl-1.4/Bio/SeqIO/embl.pm bioperl-1.4/Bio/SeqIO/exp.pm bioperl-1.4/Bio/SeqIO/fasta.pm bioperl-1.4/Bio/SeqIO/fastq.pm bioperl-1.4/Bio/SeqIO/game.pm bioperl-1.4/Bio/SeqIO/gcg.pm bioperl-1.4/Bio/SeqIO/genbank.pm bioperl-1.4/Bio/SeqIO/kegg.pm bioperl-1.4/Bio/SeqIO/largefasta.pm bioperl-1.4/Bio/SeqIO/locuslink.pm bioperl-1.4/Bio/SeqIO/metafasta.pm bioperl-1.4/Bio/SeqIO/phd.pm bioperl-1.4/Bio/SeqIO/pir.pm bioperl-1.4/Bio/SeqIO/pln.pm bioperl-1.4/Bio/SeqIO/qual.pm bioperl-1.4/Bio/SeqIO/raw.pm bioperl-1.4/Bio/SeqIO/scf.pm bioperl-1.4/Bio/SeqIO/swiss.pm bioperl-1.4/Bio/SeqIO/tab.pm bioperl-1.4/Bio/SeqIO/tigr.pm bioperl-1.4/Bio/SeqIO/ztr.pm bioperl-1.4/Bio/Structure/ bioperl-1.4/Bio/Structure/Chain.pm bioperl-1.4/Bio/Structure/Atom.pm bioperl-1.4/Bio/Structure/IO/ bioperl-1.4/Bio/Structure/IO/pdb.pm bioperl-1.4/Bio/Structure/Entry.pm bioperl-1.4/Bio/Structure/IO.pm bioperl-1.4/Bio/Structure/Model.pm bioperl-1.4/Bio/Structure/Residue.pm bioperl-1.4/Bio/Structure/StructureI.pm bioperl-1.4/Bio/Structure/SecStr/ bioperl-1.4/Bio/Structure/SecStr/DSSP/ bioperl-1.4/Bio/Structure/SecStr/DSSP/Res.pm bioperl-1.4/Bio/Structure/SecStr/STRIDE/ bioperl-1.4/Bio/Structure/SecStr/STRIDE/Res.pm bioperl-1.4/Bio/Symbol/ bioperl-1.4/Bio/Symbol/Alphabet.pm bioperl-1.4/Bio/Symbol/AlphabetI.pm bioperl-1.4/Bio/Symbol/DNAAlphabet.pm bioperl-1.4/Bio/Symbol/ProteinAlphabet.pm bioperl-1.4/Bio/Symbol/README.Symbol bioperl-1.4/Bio/Symbol/Symbol.pm bioperl-1.4/Bio/Symbol/SymbolI.pm bioperl-1.4/Bio/Taxonomy/ bioperl-1.4/Bio/Taxonomy/FactoryI.pm bioperl-1.4/Bio/Taxonomy/Node.pm bioperl-1.4/Bio/Taxonomy/Taxon.pm bioperl-1.4/Bio/Taxonomy/Tree.pm bioperl-1.4/Bio/Tools/ bioperl-1.4/Bio/Tools/Alignment/ bioperl-1.4/Bio/Tools/Alignment/Consed.pm bioperl-1.4/Bio/Tools/Alignment/Trim.pm bioperl-1.4/Bio/Tools/AlignFactory.pm bioperl-1.4/Bio/Tools/AnalysisResult.pm bioperl-1.4/Bio/Tools/BPbl2seq.pm bioperl-1.4/Bio/Tools/BPlite.pm bioperl-1.4/Bio/Tools/BPpsilite.pm bioperl-1.4/Bio/Tools/Blast.pm bioperl-1.4/Bio/Tools/Blat.pm bioperl-1.4/Bio/Tools/CodonTable.pm bioperl-1.4/Bio/Tools/Coil.pm bioperl-1.4/Bio/Tools/ECnumber.pm bioperl-1.4/Bio/Tools/EPCR.pm bioperl-1.4/Bio/Tools/ESTScan.pm bioperl-1.4/Bio/Tools/Eponine.pm bioperl-1.4/Bio/Tools/Est2Genome.pm bioperl-1.4/Bio/Tools/FootPrinter.pm bioperl-1.4/Bio/Tools/GFF.pm bioperl-1.4/Bio/Tools/Gel.pm bioperl-1.4/Bio/Tools/Geneid.pm bioperl-1.4/Bio/Tools/Genemark.pm bioperl-1.4/Bio/Tools/Genewise.pm bioperl-1.4/Bio/Tools/Genomewise.pm bioperl-1.4/Bio/Tools/Genscan.pm bioperl-1.4/Bio/Tools/Glimmer.pm bioperl-1.4/Bio/Tools/Grail.pm bioperl-1.4/Bio/Tools/GuessSeqFormat.pm bioperl-1.4/Bio/Tools/Hmmpfam.pm bioperl-1.4/Bio/Tools/IUPAC.pm bioperl-1.4/Bio/Tools/Lucy.pm bioperl-1.4/Bio/Tools/MZEF.pm bioperl-1.4/Bio/Tools/OddCodes.pm bioperl-1.4/Bio/Tools/Primer3.pm bioperl-1.4/Bio/Tools/Prints.pm bioperl-1.4/Bio/Tools/Profile.pm bioperl-1.4/Bio/Tools/Promoterwise.pm bioperl-1.4/Bio/Tools/PrositeScan.pm bioperl-1.4/Bio/Tools/Pseudowise.pm bioperl-1.4/Bio/Tools/QRNA.pm bioperl-1.4/Bio/Tools/RandomDistFunctions.pm bioperl-1.4/Bio/Tools/RepeatMasker.pm bioperl-1.4/Bio/Tools/RestrictionEnzyme.pm bioperl-1.4/Bio/Tools/Seg.pm bioperl-1.4/Bio/Tools/SeqAnal.pm bioperl-1.4/Bio/Tools/SeqPattern.pm bioperl-1.4/Bio/Tools/SeqStats.pm bioperl-1.4/Bio/Tools/SeqWords.pm bioperl-1.4/Bio/Tools/SiRNA.pm bioperl-1.4/Bio/Tools/Sigcleave.pm bioperl-1.4/Bio/Tools/Signalp.pm bioperl-1.4/Bio/Tools/Tmhmm.pm bioperl-1.4/Bio/Tools/WWW.pm bioperl-1.4/Bio/Tools/dpAlign.pm bioperl-1.4/Bio/Tools/pICalculator.pm bioperl-1.4/Bio/Tools/pSW.pm bioperl-1.4/Bio/Tools/Analysis/ bioperl-1.4/Bio/Tools/Analysis/DNA/ bioperl-1.4/Bio/Tools/Analysis/DNA/ESEfinder.pm bioperl-1.4/Bio/Tools/Analysis/SimpleAnalysisBase.pm bioperl-1.4/Bio/Tools/Analysis/Protein/ bioperl-1.4/Bio/Tools/Analysis/Protein/Domcut.pm bioperl-1.4/Bio/Tools/Analysis/Protein/ELM.pm bioperl-1.4/Bio/Tools/Analysis/Protein/GOR4.pm bioperl-1.4/Bio/Tools/Analysis/Protein/HNN.pm bioperl-1.4/Bio/Tools/Analysis/Protein/Mitoprot.pm bioperl-1.4/Bio/Tools/Analysis/Protein/NetPhos.pm bioperl-1.4/Bio/Tools/Analysis/Protein/Scansite.pm bioperl-1.4/Bio/Tools/Analysis/Protein/Sopma.pm bioperl-1.4/Bio/Tools/BPlite/ bioperl-1.4/Bio/Tools/BPlite/Iteration.pm bioperl-1.4/Bio/Tools/BPlite/HSP.pm bioperl-1.4/Bio/Tools/BPlite/Sbjct.pm bioperl-1.4/Bio/Tools/Blast/ bioperl-1.4/Bio/Tools/Blast/Sbjct.pm bioperl-1.4/Bio/Tools/Blast/CHANGES bioperl-1.4/Bio/Tools/Blast/HSP.pm bioperl-1.4/Bio/Tools/Blast/HTML.pm bioperl-1.4/Bio/Tools/Blast/README bioperl-1.4/Bio/Tools/EMBOSS/ bioperl-1.4/Bio/Tools/EMBOSS/Palindrome.pm bioperl-1.4/Bio/Tools/HMMER/ bioperl-1.4/Bio/Tools/HMMER/Domain.pm bioperl-1.4/Bio/Tools/HMMER/Results.pm bioperl-1.4/Bio/Tools/HMMER/Set.pm bioperl-1.4/Bio/Tools/Phylo/ bioperl-1.4/Bio/Tools/Phylo/Molphy/ bioperl-1.4/Bio/Tools/Phylo/Molphy/Result.pm bioperl-1.4/Bio/Tools/Phylo/Molphy.pm bioperl-1.4/Bio/Tools/Phylo/PAML.pm bioperl-1.4/Bio/Tools/Phylo/PAML/ bioperl-1.4/Bio/Tools/Phylo/PAML/ModelResult.pm bioperl-1.4/Bio/Tools/Phylo/PAML/Result.pm bioperl-1.4/Bio/Tools/Phylo/Phylip/ bioperl-1.4/Bio/Tools/Phylo/Phylip/ProtDist.pm bioperl-1.4/Bio/Tools/Prediction/ bioperl-1.4/Bio/Tools/Prediction/Exon.pm bioperl-1.4/Bio/Tools/Prediction/Gene.pm bioperl-1.4/Bio/Tools/Primer/ bioperl-1.4/Bio/Tools/Primer/Assessor/ bioperl-1.4/Bio/Tools/Primer/Assessor/Base.pm bioperl-1.4/Bio/Tools/Primer/AssessorI.pm bioperl-1.4/Bio/Tools/Primer/Feature.pm bioperl-1.4/Bio/Tools/Primer/Pair.pm bioperl-1.4/Bio/Tools/Run/ bioperl-1.4/Bio/Tools/Run/README bioperl-1.4/Bio/Tools/Run/RemoteBlast.pm bioperl-1.4/Bio/Tools/Run/StandAloneBlast.pm bioperl-1.4/Bio/Tools/Run/WrapperBase.pm bioperl-1.4/Bio/Tools/Sim4/ bioperl-1.4/Bio/Tools/Sim4/Results.pm bioperl-1.4/Bio/Tools/Sim4/Exon.pm bioperl-1.4/Bio/Tree/ bioperl-1.4/Bio/Tree/AlleleNode.pm bioperl-1.4/Bio/Tree/Node.pm bioperl-1.4/Bio/Tree/NodeI.pm bioperl-1.4/Bio/Tree/NodeNHX.pm bioperl-1.4/Bio/Tree/RandomFactory.pm bioperl-1.4/Bio/Tree/Statistics.pm bioperl-1.4/Bio/Tree/Tree.pm bioperl-1.4/Bio/Tree/TreeFunctionsI.pm bioperl-1.4/Bio/Tree/TreeI.pm bioperl-1.4/Bio/TreeIO/ bioperl-1.4/Bio/TreeIO/TreeEventBuilder.pm bioperl-1.4/Bio/TreeIO/lintree.pm bioperl-1.4/Bio/TreeIO/newick.pm bioperl-1.4/Bio/TreeIO/nexus.pm bioperl-1.4/Bio/TreeIO/nhx.pm bioperl-1.4/Bio/TreeIO/svggraph.pm bioperl-1.4/Bio/TreeIO/tabtree.pm bioperl-1.4/Bio/Variation/ bioperl-1.4/Bio/Variation/IO/ bioperl-1.4/Bio/Variation/IO/flat.pm bioperl-1.4/Bio/Variation/IO/xml.pm bioperl-1.4/Bio/Variation/AAChange.pm bioperl-1.4/Bio/Variation/AAReverseMutate.pm bioperl-1.4/Bio/Variation/Allele.pm bioperl-1.4/Bio/Variation/DNAMutation.pm bioperl-1.4/Bio/Variation/IO.pm bioperl-1.4/Bio/Variation/README bioperl-1.4/Bio/Variation/RNAChange.pm bioperl-1.4/Bio/Variation/SNP.pm bioperl-1.4/Bio/Variation/SeqDiff.pm bioperl-1.4/Bio/Variation/VariantI.pm bioperl-1.4/doc/ bioperl-1.4/doc/faq/ bioperl-1.4/doc/faq/faq.html bioperl-1.4/doc/faq/faq.dtd bioperl-1.4/doc/faq/faq.pl bioperl-1.4/doc/faq/faq.xml bioperl-1.4/doc/makedoc.PL bioperl-1.4/doc/howto/ bioperl-1.4/doc/howto/examples/ bioperl-1.4/doc/howto/examples/graphics/ bioperl-1.4/doc/howto/examples/graphics/blastn.out bioperl-1.4/doc/howto/examples/graphics/data1.txt bioperl-1.4/doc/howto/examples/graphics/embl2picture.pl bioperl-1.4/doc/howto/examples/graphics/factor7.embl bioperl-1.4/doc/howto/examples/graphics/render_blast1.pl bioperl-1.4/doc/howto/examples/graphics/render_blast2.pl bioperl-1.4/doc/howto/examples/graphics/render_blast3.pl bioperl-1.4/doc/howto/examples/graphics/render_blast4.pl bioperl-1.4/doc/howto/examples/graphics/render_features.pl bioperl-1.4/doc/howto/examples/README bioperl-1.4/doc/howto/figs/ bioperl-1.4/doc/howto/figs/graphics/ bioperl-1.4/doc/howto/figs/graphics/fig1.png bioperl-1.4/doc/howto/figs/graphics/fig2.png bioperl-1.4/doc/howto/figs/graphics/fig3.png bioperl-1.4/doc/howto/figs/graphics/fig4.png bioperl-1.4/doc/howto/figs/graphics/fig5.png bioperl-1.4/doc/howto/figs/graphics/fig6.png bioperl-1.4/doc/howto/figs/README bioperl-1.4/doc/howto/html/ bioperl-1.4/doc/howto/html/images/ bioperl-1.4/doc/howto/html/images/tip.png bioperl-1.4/doc/howto/html/Flat_Databases.html bioperl-1.4/doc/howto/html/Graphics-HOWTO.html bioperl-1.4/doc/howto/html/OBDA_Access.html bioperl-1.4/doc/howto/html/PAML.html bioperl-1.4/doc/howto/html/README bioperl-1.4/doc/howto/html/SearchIO.html bioperl-1.4/doc/howto/html/SeqIO.html bioperl-1.4/doc/howto/html/SimpleWebAnalysis.html bioperl-1.4/doc/howto/html/e-novative.css bioperl-1.4/doc/howto/pdf/ bioperl-1.4/doc/howto/pdf/Flat_Databases.pdf bioperl-1.4/doc/howto/pdf/Graphics-HOWTO.pdf bioperl-1.4/doc/howto/pdf/OBDA_Access.pdf bioperl-1.4/doc/howto/pdf/PAML.pdf bioperl-1.4/doc/howto/pdf/SearchIO.pdf bioperl-1.4/doc/howto/pdf/SeqIO.pdf bioperl-1.4/doc/howto/pdf/SimpleWebAnalysis.pdf bioperl-1.4/doc/howto/pdf/Trees.pdf bioperl-1.4/doc/howto/sgml/ bioperl-1.4/doc/howto/sgml/Feature-Annotation.sgml bioperl-1.4/doc/howto/sgml/Flat_Databases.sgml bioperl-1.4/doc/howto/sgml/Graphics-HOWTO.sgml bioperl-1.4/doc/howto/sgml/OBDA_Access.sgml bioperl-1.4/doc/howto/sgml/PAML.sgml bioperl-1.4/doc/howto/sgml/README bioperl-1.4/doc/howto/sgml/SearchIO.sgml bioperl-1.4/doc/howto/sgml/SeqIO.sgml bioperl-1.4/doc/howto/sgml/SimpleWebAnalysis.sgml bioperl-1.4/doc/howto/sgml/Trees.sgml bioperl-1.4/doc/howto/txt/ bioperl-1.4/doc/howto/txt/Flat_Databases.txt bioperl-1.4/doc/howto/txt/SimpleWebAnalysis.txt bioperl-1.4/INSTALL.WIN bioperl-1.4/LICENSE bioperl-1.4/MANIFEST.SKIP bioperl-1.4/Makefile.PL bioperl-1.4/PLATFORMS bioperl-1.4/README bioperl-1.4/biodatabases.pod bioperl-1.4/biodesign.pod bioperl-1.4/bioperl.lisp bioperl-1.4/bioperl.pod bioperl-1.4/bioscripts.pod bioperl-1.4/bptutorial.pl bioperl-1.4/examples/ bioperl-1.4/examples/Bio-DB-GFF/ bioperl-1.4/examples/Bio-DB-GFF/load_ucsc.pl bioperl-1.4/examples/bioperl.pl bioperl-1.4/examples/generate_random_seq.pl bioperl-1.4/examples/longorf.pl bioperl-1.4/examples/make_mrna_protein.pl bioperl-1.4/examples/make_primers.pl bioperl-1.4/examples/rev_and_trans.pl bioperl-1.4/examples/revcom_dir.pl bioperl-1.4/examples/subsequence.cgi bioperl-1.4/examples/align/ bioperl-1.4/examples/align/align_on_codons.pl bioperl-1.4/examples/align/aligntutorial.pl bioperl-1.4/examples/align/clustalw.pl bioperl-1.4/examples/align/simplealign.pl bioperl-1.4/examples/biblio/ bioperl-1.4/examples/biblio/biblio_examples.pl bioperl-1.4/examples/biblio/biblio_soap.pl bioperl-1.4/examples/biographics/ bioperl-1.4/examples/biographics/all_glyphs.pl bioperl-1.4/examples/biographics/dynamic_glyphs.pl bioperl-1.4/examples/biographics/feature_data.gff bioperl-1.4/examples/biographics/feature_data.txt bioperl-1.4/examples/biographics/lots_of_glyphs.pl bioperl-1.4/examples/biographics/render_sequence.pl bioperl-1.4/examples/cluster/ bioperl-1.4/examples/cluster/dbsnp.pl bioperl-1.4/examples/contributed/ bioperl-1.4/examples/contributed/nmrpdb_parse.pl bioperl-1.4/examples/contributed/prosite2perl.pl bioperl-1.4/examples/contributed/rebase2list.pl bioperl-1.4/examples/db/ bioperl-1.4/examples/db/get_seqs.pl bioperl-1.4/examples/db/dbfetch bioperl-1.4/examples/db/est_tissue_query.pl bioperl-1.4/examples/db/gb2features.pl bioperl-1.4/examples/db/getGenBank.pl bioperl-1.4/examples/db/rfetch.pl bioperl-1.4/examples/db/use_registry.pl bioperl-1.4/examples/liveseq/ bioperl-1.4/examples/liveseq/change_gene.pl bioperl-1.4/examples/popgen/ bioperl-1.4/examples/popgen/parse_calc_stats.pl bioperl-1.4/examples/root/ bioperl-1.4/examples/root/lib/ bioperl-1.4/examples/root/lib/Bio/ bioperl-1.4/examples/root/lib/Bio/PrimarySeq.pm bioperl-1.4/examples/root/lib/Bio/PrimarySeqI.pm bioperl-1.4/examples/root/lib/Bio/Seq.pm bioperl-1.4/examples/root/lib/Bio/SeqI.pm bioperl-1.4/examples/root/lib/Error.pm bioperl-1.4/examples/root/lib/TestInterface.pm bioperl-1.4/examples/root/lib/TestObject.pm bioperl-1.4/examples/root/README bioperl-1.4/examples/root/exceptions1.pl bioperl-1.4/examples/root/exceptions2.pl bioperl-1.4/examples/root/exceptions3.pl bioperl-1.4/examples/root/exceptions4.pl bioperl-1.4/examples/searchio/ bioperl-1.4/examples/searchio/blast_example.pl bioperl-1.4/examples/searchio/custom_writer.pl bioperl-1.4/examples/searchio/hitwriter.pl bioperl-1.4/examples/searchio/hspwriter.pl bioperl-1.4/examples/searchio/htmlwriter.pl bioperl-1.4/examples/searchio/psiblast_features.pl bioperl-1.4/examples/searchio/psiblast_iterations.pl bioperl-1.4/examples/searchio/rawwriter.pl bioperl-1.4/examples/searchio/resultwriter.pl bioperl-1.4/examples/searchio/waba2gff.pl bioperl-1.4/examples/sirna/ bioperl-1.4/examples/sirna/TAG bioperl-1.4/examples/sirna/rnai_finder.cgi bioperl-1.4/examples/tk/ bioperl-1.4/examples/tk/gsequence.pl bioperl-1.4/examples/tk/hitdisplay.pl bioperl-1.4/examples/tools/ bioperl-1.4/examples/tools/gb_to_gff.pl bioperl-1.4/examples/tools/gff2ps.pl bioperl-1.4/examples/tools/parse_codeml.pl bioperl-1.4/examples/tools/psw.pl bioperl-1.4/examples/tools/restriction.pl bioperl-1.4/examples/tools/run_genscan.pl bioperl-1.4/examples/tools/seq_pattern.pl bioperl-1.4/examples/tools/standaloneblast.pl bioperl-1.4/examples/tree/ bioperl-1.4/examples/tree/paup2phylip.pl bioperl-1.4/maintenance/ bioperl-1.4/maintenance/authors.pl bioperl-1.4/maintenance/README bioperl-1.4/maintenance/modules.pl bioperl-1.4/maintenance/pod.pl bioperl-1.4/models/ bioperl-1.4/models/biblio.dia bioperl-1.4/models/README bioperl-1.4/models/bio_liveseq_variation.dia bioperl-1.4/models/bio_map.dia bioperl-1.4/models/bio_restriction.dia bioperl-1.4/models/bioperl.dia bioperl-1.4/models/coordinatemapper.dia bioperl-1.4/models/map_proposal.txt bioperl-1.4/models/maps_and_markers.dia bioperl-1.4/models/popgen.dia bioperl-1.4/models/population_proposal.txt bioperl-1.4/scripts/ bioperl-1.4/scripts/Bio-DB-GFF/ bioperl-1.4/scripts/Bio-DB-GFF/load_gff.PLS bioperl-1.4/scripts/Bio-DB-GFF/README bioperl-1.4/scripts/Bio-DB-GFF/TAG bioperl-1.4/scripts/Bio-DB-GFF/bp_genbank2gff.PLS bioperl-1.4/scripts/Bio-DB-GFF/bulk_load_gff.PLS bioperl-1.4/scripts/Bio-DB-GFF/fast_load_gff.PLS bioperl-1.4/scripts/Bio-DB-GFF/generate_histogram.PLS bioperl-1.4/scripts/Bio-DB-GFF/load_ucsc.pl bioperl-1.4/scripts/Bio-DB-GFF/pg_bulk_load_gff.PLS bioperl-1.4/scripts/Bio-DB-GFF/process_gadfly.PLS bioperl-1.4/scripts/Bio-DB-GFF/process_ncbi_human.PLS bioperl-1.4/scripts/Bio-DB-GFF/process_sgd.PLS bioperl-1.4/scripts/Bio-DB-GFF/process_wormbase.PLS bioperl-1.4/scripts/install_bioperl_scripts.pl bioperl-1.4/scripts/DB/ bioperl-1.4/scripts/DB/TAG bioperl-1.4/scripts/DB/biofetch_genbank_proxy.PLS bioperl-1.4/scripts/DB/bioflat_index.PLS bioperl-1.4/scripts/DB/biogetseq.PLS bioperl-1.4/scripts/DB/flanks.PLS bioperl-1.4/scripts/biblio/ bioperl-1.4/scripts/biblio/TAG bioperl-1.4/scripts/biblio/biblio.PLS bioperl-1.4/scripts/das/ bioperl-1.4/scripts/das/README bioperl-1.4/scripts/das/TAG bioperl-1.4/scripts/graphics/ bioperl-1.4/scripts/graphics/frend.PLS bioperl-1.4/scripts/graphics/README bioperl-1.4/scripts/graphics/TAG bioperl-1.4/scripts/graphics/feature_draw.PLS bioperl-1.4/scripts/graphics/search_overview.PLS bioperl-1.4/scripts/index/ bioperl-1.4/scripts/index/TAG bioperl-1.4/scripts/index/bp_fetch.PLS bioperl-1.4/scripts/index/bp_index.PLS bioperl-1.4/scripts/popgen/ bioperl-1.4/scripts/popgen/composite_LD.PLS bioperl-1.4/scripts/popgen/heterogeneity_test.PLS bioperl-1.4/scripts/searchio/ bioperl-1.4/scripts/searchio/filter_search.PLS bioperl-1.4/scripts/seq/ bioperl-1.4/scripts/seq/TAG bioperl-1.4/scripts/seq/extract_feature_seq.PLS bioperl-1.4/scripts/seq/seqconvert.PLS bioperl-1.4/scripts/seq/split_seq.PLS bioperl-1.4/scripts/seq/translate_seq.PLS bioperl-1.4/scripts/seqstats/ bioperl-1.4/scripts/seqstats/TAG bioperl-1.4/scripts/seqstats/aacomp.PLS bioperl-1.4/scripts/seqstats/chaos_plot.PLS bioperl-1.4/scripts/seqstats/gccalc.PLS bioperl-1.4/scripts/seqstats/oligo_count.PLS bioperl-1.4/scripts/taxa/ bioperl-1.4/scripts/taxa/TAG bioperl-1.4/scripts/taxa/local_taxonomydb_query.PLS bioperl-1.4/scripts/taxa/taxid4species.PLS bioperl-1.4/scripts/tree/ bioperl-1.4/scripts/tree/TAG bioperl-1.4/scripts/tree/blast2tree.PLS bioperl-1.4/scripts/utilities/ bioperl-1.4/scripts/utilities/bp_nrdb.PLS bioperl-1.4/scripts/utilities/README bioperl-1.4/scripts/utilities/TAG bioperl-1.4/scripts/utilities/bp_mrtrans.PLS bioperl-1.4/scripts/utilities/bp_sreformat.PLS bioperl-1.4/scripts/utilities/dbsplit.PLS bioperl-1.4/scripts/utilities/mask_by_search.PLS bioperl-1.4/scripts/utilities/mutate.PLS bioperl-1.4/scripts/utilities/pairwise_kaks.PLS bioperl-1.4/scripts/utilities/remote_blast.PLS bioperl-1.4/scripts/utilities/search2BSML.PLS bioperl-1.4/scripts/utilities/search2alnblocks.PLS bioperl-1.4/scripts/utilities/search2gff.PLS bioperl-1.4/scripts/utilities/search2tribe.PLS bioperl-1.4/scripts/utilities/seq_length.PLS bioperl-1.4/t/ bioperl-1.4/t/data/ bioperl-1.4/t/data/biodbgff/ bioperl-1.4/t/data/biodbgff/test.gff bioperl-1.4/t/data/503384.MEGABLAST.0 bioperl-1.4/t/data/503384.MEGABLAST.2 bioperl-1.4/t/data/5X_1895.FASTXY bioperl-1.4/t/data/AAC12660.fa bioperl-1.4/t/data/AB077698.gb bioperl-1.4/t/data/AE003528_ecoli.bls bioperl-1.4/t/data/AE003644_Adh-genomic.gb bioperl-1.4/t/data/AF032047.gbk bioperl-1.4/t/data/AF165282.gb bioperl-1.4/t/data/AHCYL1.kegg bioperl-1.4/t/data/ATF14F8.gbk bioperl-1.4/t/data/AY095303S1.gbk bioperl-1.4/t/data/AnnIX-v003.gbk bioperl-1.4/t/data/BK000016-tpa.gbk bioperl-1.4/t/data/BLOSUM50 bioperl-1.4/t/data/BN000066-tpa.embl bioperl-1.4/t/data/D10483.gbk bioperl-1.4/t/data/D12555.gbk bioperl-1.4/t/data/ECAPAH02.embl bioperl-1.4/t/data/GO.defs.test bioperl-1.4/t/data/GO.defs.test2 bioperl-1.4/t/data/Genscan.FastA bioperl-1.4/t/data/HUMBETGLOA.FASTA bioperl-1.4/t/data/HUMBETGLOA.fa bioperl-1.4/t/data/HUMBETGLOA.gff bioperl-1.4/t/data/HUMBETGLOA.grail bioperl-1.4/t/data/HUMBETGLOA.grailexp bioperl-1.4/t/data/HUMBETGLOA.mzef bioperl-1.4/t/data/HUMBETGLOA.tblastx bioperl-1.4/t/data/L77119.hmmer bioperl-1.4/t/data/LL-sample.seq bioperl-1.4/t/data/LOAD_Ccd1.dnd bioperl-1.4/t/data/LittleChrY.dbsnp.xml bioperl-1.4/t/data/MmCT bioperl-1.4/t/data/NM_002254.gb bioperl-1.4/t/data/NT_021877.gbk bioperl-1.4/t/data/PAM250 bioperl-1.4/t/data/SwissProt.dat bioperl-1.4/t/data/U58726.gb bioperl-1.4/t/data/X98338_Adh-mRNA.gb bioperl-1.4/t/data/a_thaliana.blastn bioperl-1.4/t/data/aaml.mlc bioperl-1.4/t/data/aaml_pairwise.mlc bioperl-1.4/t/data/acefile.ace.1 bioperl-1.4/t/data/acefile.singlets bioperl-1.4/t/data/alnfile.fasta bioperl-1.4/t/data/amino.fa bioperl-1.4/t/data/ar.embl bioperl-1.4/t/data/bl2seq.blastn bioperl-1.4/t/data/bl2seq.blastn.rev bioperl-1.4/t/data/bl2seq.blastx.out bioperl-1.4/t/data/bl2seq.bug940.out bioperl-1.4/t/data/bl2seq.out bioperl-1.4/t/data/bl2seq.tblastx.out bioperl-1.4/t/data/blast.report bioperl-1.4/t/data/blat.psLayout3 bioperl-1.4/t/data/c200-vs-yeast.BLASTN bioperl-1.4/t/data/c200-vs-yeast.BLASTN.m8 bioperl-1.4/t/data/chad100.scf bioperl-1.4/t/data/codeml.mlc bioperl-1.4/t/data/codeml_nssites.mlc bioperl-1.4/t/data/compLD_missingtest.prettybase bioperl-1.4/t/data/compLD_test.prettybase bioperl-1.4/t/data/component.ontology.test bioperl-1.4/t/data/component.ontology.test2 bioperl-1.4/t/data/crab.dat.cn bioperl-1.4/t/data/crab.nj bioperl-1.4/t/data/crab.njb bioperl-1.4/t/data/crypto.sim4-0 bioperl-1.4/t/data/crypto.sim4-3 bioperl-1.4/t/data/crypto.sim4-4 bioperl-1.4/t/data/cys1_dicdi.water bioperl-1.4/t/data/cysprot.fa bioperl-1.4/t/data/cysprot.msf bioperl-1.4/t/data/cysprot.needle bioperl-1.4/t/data/cysprot.tblastn bioperl-1.4/t/data/cysprot.water bioperl-1.4/t/data/cysprot1.FASTA bioperl-1.4/t/data/cysprot1.fa bioperl-1.4/t/data/cysprot1a.fa bioperl-1.4/t/data/cysprot1a.msf bioperl-1.4/t/data/cysprot1b.fa bioperl-1.4/t/data/cysprot1b.hmmsearch bioperl-1.4/t/data/cysprot1b.msf bioperl-1.4/t/data/cysprot1b.newick bioperl-1.4/t/data/cysprot_vs_gadfly.FASTA bioperl-1.4/t/data/dmel_2Lchunk.gb bioperl-1.4/t/data/dna1.fa bioperl-1.4/t/data/dna2.fa bioperl-1.4/t/data/dnaE-bsub-prot.fa bioperl-1.4/t/data/dnaE-bsub.fa bioperl-1.4/t/data/dnaEbsub_ecoli.wublastx bioperl-1.4/t/data/dnaEbsub_ecoli.wutblastn bioperl-1.4/t/data/dnaEbsub_ecoli.wutblastx bioperl-1.4/t/data/ecoli-trna-qrna.out bioperl-1.4/t/data/ecoli_domains.rps.xml bioperl-1.4/t/data/ecoli_domains.rpsblast bioperl-1.4/t/data/ecolitst.bls bioperl-1.4/t/data/ecolitst.fa bioperl-1.4/t/data/ecolitst.wublastp bioperl-1.4/t/data/empty.bl2seq bioperl-1.4/t/data/expected.blast.out bioperl-1.4/t/data/factor7.embl bioperl-1.4/t/data/footprinter.out bioperl-1.4/t/data/geneid_1.0.out bioperl-1.4/t/data/genemark.out bioperl-1.4/t/data/genewise.out bioperl-1.4/t/data/genewise_output.paracel_btk bioperl-1.4/t/data/genomewise.out bioperl-1.4/t/data/genomic-seq.epcr bioperl-1.4/t/data/genomic-seq.fasta bioperl-1.4/t/data/genomic-seq.genscan bioperl-1.4/t/data/genomic-seq.mzef bioperl-1.4/t/data/gf-s71.needle bioperl-1.4/t/data/glimmer.out bioperl-1.4/t/data/hemoglobinA.meg bioperl-1.4/t/data/hg16_chroms.gff bioperl-1.4/t/data/hmmpfam.out bioperl-1.4/t/data/hmmsearch.out bioperl-1.4/t/data/hs_est.est2genome bioperl-1.4/t/data/hs_fugu.newick bioperl-1.4/t/data/hs_owlmonkey.fas bioperl-1.4/t/data/hs_owlmonkey.fasta bioperl-1.4/t/data/hsinsulin.blastcl3.blastn bioperl-1.4/t/data/humor.maf bioperl-1.4/t/data/humts1.pal bioperl-1.4/t/data/insulin.water bioperl-1.4/t/data/interpro_short.xml bioperl-1.4/t/data/lucy.info bioperl-1.4/t/data/lucy.qual bioperl-1.4/t/data/lucy.seq bioperl-1.4/t/data/lucy.stderr bioperl-1.4/t/data/lysozyme6.protml bioperl-1.4/t/data/lysozyme6.simple.protml bioperl-1.4/t/data/mapmaker.out bioperl-1.4/t/data/mast.dat bioperl-1.4/t/data/megablast_output.paracel_btk bioperl-1.4/t/data/meme.dat bioperl-1.4/t/data/mpath.ontology.test bioperl-1.4/t/data/multi_1.fa bioperl-1.4/t/data/multi_2.fa bioperl-1.4/t/data/multi_blast.bls bioperl-1.4/t/data/multifa.seq bioperl-1.4/t/data/multiseq.bls bioperl-1.4/t/data/mus.bls.xml bioperl-1.4/t/data/mutations.dat bioperl-1.4/t/data/mutations.xml bioperl-1.4/t/data/myco_sites.gff bioperl-1.4/t/data/nei_gojobori_test.aln bioperl-1.4/t/data/neighbor.dist bioperl-1.4/t/data/no-genes.genscan bioperl-1.4/t/data/no_hsps.blastp bioperl-1.4/t/data/noninterleaved.phy bioperl-1.4/t/data/omim_genemap_test bioperl-1.4/t/data/omim_text_test bioperl-1.4/t/data/pdb1bpt.ent bioperl-1.4/t/data/phi.out bioperl-1.4/t/data/phipsi.out bioperl-1.4/t/data/phredfile.phd bioperl-1.4/t/data/phylipdist-36.out bioperl-1.4/t/data/phylipdist.out bioperl-1.4/t/data/pictogram.fa bioperl-1.4/t/data/plague_yeast.bls.xml bioperl-1.4/t/data/polymorphism.dat bioperl-1.4/t/data/polymorphism.xml bioperl-1.4/t/data/popgen_saureus.dat bioperl-1.4/t/data/popgen_saureus.multidat bioperl-1.4/t/data/popstats.prettybase bioperl-1.4/t/data/roa1.dat bioperl-1.4/t/data/primedseq.fa bioperl-1.4/t/data/primer3_infile.txt bioperl-1.4/t/data/primer3_outfile.txt bioperl-1.4/t/data/primer3_output.txt bioperl-1.4/t/data/promoterwise.out bioperl-1.4/t/data/protpars.phy bioperl-1.4/t/data/psiblastreport.out bioperl-1.4/t/data/qrna-relloc.out bioperl-1.4/t/data/qualfile.qual bioperl-1.4/t/data/rebase.itype2 bioperl-1.4/t/data/rebase.withrefm bioperl-1.4/t/data/repeatmasker.fa.out bioperl-1.4/t/data/revcomp_mrna.gb bioperl-1.4/t/data/roa1.genbank bioperl-1.4/t/data/roa1.swiss bioperl-1.4/t/data/sbay_c545-yeast.BLASTZ.PSL bioperl-1.4/t/data/seqdatabase.ini bioperl-1.4/t/data/seqfile.pir bioperl-1.4/t/data/seqs.fas bioperl-1.4/t/data/sequencefamily.dat bioperl-1.4/t/data/short.blx bioperl-1.4/t/data/sim4.for.for bioperl-1.4/t/data/sim4.for.rev bioperl-1.4/t/data/sim4.rev bioperl-1.4/t/data/sofa.ontology bioperl-1.4/t/data/sparsealn.needle bioperl-1.4/t/data/stress_test_medline.xml bioperl-1.4/t/data/stress_test_pubmed.xml bioperl-1.4/t/data/swiss.dat bioperl-1.4/t/data/swisspfam.data bioperl-1.4/t/data/test.ace bioperl-1.4/t/data/test.embl bioperl-1.4/t/data/test.fasta bioperl-1.4/t/data/test.game bioperl-1.4/t/data/test.gcg bioperl-1.4/t/data/test.gcgblast bioperl-1.4/t/data/test.gcgfasta bioperl-1.4/t/data/test.genbank bioperl-1.4/t/data/test.genbank.noseq bioperl-1.4/t/data/test.mase bioperl-1.4/t/data/test.metafasta bioperl-1.4/t/data/test.nh bioperl-1.4/t/data/test.nhx bioperl-1.4/t/data/test.pfam bioperl-1.4/t/data/test.pir bioperl-1.4/t/data/test.raw bioperl-1.4/t/data/test.swiss bioperl-1.4/t/data/test.tab bioperl-1.4/t/data/test.txt bioperl-1.4/t/data/test.waba bioperl-1.4/t/data/test_badlf.gcg bioperl-1.4/t/data/testaln.aln bioperl-1.4/t/data/testaln.fasta bioperl-1.4/t/data/testaln.mase bioperl-1.4/t/data/testaln.metafasta bioperl-1.4/t/data/testaln.msf bioperl-1.4/t/data/testaln.nexus bioperl-1.4/t/data/testaln.pfam bioperl-1.4/t/data/testaln.phylip bioperl-1.4/t/data/testaln.prodom bioperl-1.4/t/data/testaln.selex bioperl-1.4/t/data/testaln.stockholm bioperl-1.4/t/data/testdat.exonerate bioperl-1.4/t/data/testdbaccnums.out bioperl-1.4/t/data/testfuzzy.genbank bioperl-1.4/t/data/transfac.dat bioperl-1.4/t/data/unigene.data bioperl-1.4/t/data/version2.scf bioperl-1.4/t/data/version3.scf bioperl-1.4/t/data/worm_fam_2785.cdna bioperl-1.4/t/data/yn00.mlc bioperl-1.4/t/data/biographics/ bioperl-1.4/t/data/biographics/t1/ bioperl-1.4/t/data/biographics/t1/version1.gif bioperl-1.4/t/data/biographics/t1/version1.png bioperl-1.4/t/data/biographics/t1/version2.gif bioperl-1.4/t/data/biographics/t1/version2.png bioperl-1.4/t/data/biographics/t1/version3.png bioperl-1.4/t/data/biographics/t1/version4.png bioperl-1.4/t/data/biographics/t1/version5.png bioperl-1.4/t/data/biographics/t1/version6.png bioperl-1.4/t/data/biographics/t1/version7.png bioperl-1.4/t/data/biographics/t1/version8.png bioperl-1.4/t/data/biographics/t2/ bioperl-1.4/t/data/biographics/t2/version1.gif bioperl-1.4/t/data/biographics/t2/version1.png bioperl-1.4/t/data/biographics/t2/version10.png bioperl-1.4/t/data/biographics/t2/version11.png bioperl-1.4/t/data/biographics/t2/version12.png bioperl-1.4/t/data/biographics/t2/version13.png bioperl-1.4/t/data/biographics/t2/version14.png bioperl-1.4/t/data/biographics/t2/version2.gif bioperl-1.4/t/data/biographics/t2/version2.png bioperl-1.4/t/data/biographics/t2/version3.png bioperl-1.4/t/data/biographics/t2/version4.png bioperl-1.4/t/data/biographics/t2/version5.png bioperl-1.4/t/data/biographics/t2/version6.png bioperl-1.4/t/data/biographics/t2/version7.png bioperl-1.4/t/data/biographics/t2/version8.png bioperl-1.4/t/data/biographics/t2/version9.png bioperl-1.4/t/data/biographics/feature_data.txt bioperl-1.4/t/data/biographics/t3/ bioperl-1.4/t/data/biographics/t3/version1.gif bioperl-1.4/t/data/biographics/t3/version1.png bioperl-1.4/t/data/biographics/t3/version2.gif bioperl-1.4/t/data/biographics/t3/version2.png bioperl-1.4/t/data/biographics/t3/version3.png bioperl-1.4/t/data/biographics/t3/version4.png bioperl-1.4/t/data/biographics/t3/version5.png bioperl-1.4/t/data/biographics/t3/version6.png bioperl-1.4/t/data/biographics/t3/version7.png bioperl-1.4/t/data/consed_project/ bioperl-1.4/t/data/consed_project/edit_dir/ bioperl-1.4/t/data/consed_project/edit_dir/test_project.contigs bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.log bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1 bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.log bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.problems bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.qual bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets bioperl-1.4/t/data/consed_project/edit_dir/test_project.fasta.screen.view bioperl-1.4/t/data/consed_project/edit_dir/test_project.newtags bioperl-1.4/t/data/consed_project/edit_dir/test_project.phrap.out bioperl-1.4/t/data/consed_project/edit_dir/test_project.screen.out bioperl-1.4/t/data/consed_project/edit_dir/test_projectNewChromats.fof bioperl-1.4/t/data/consed_project/edit_dir/test_project_to_alu.cross bioperl-1.4/t/data/consed_project/phd_dir/ bioperl-1.4/t/data/consed_project/phd_dir/ML4922R.phd.1 bioperl-1.4/t/data/consed_project/phd_dir/ML4924F.phd.1 bioperl-1.4/t/data/consed_project/phd_dir/ML4924R.phd.1 bioperl-1.4/t/data/consed_project/phd_dir/ML4947F.phd.1 bioperl-1.4/t/data/dbfa/ bioperl-1.4/t/data/dbfa/1.fa bioperl-1.4/t/data/dbfa/2.fa bioperl-1.4/t/data/dbfa/3.fa bioperl-1.4/t/data/dbfa/4.fa bioperl-1.4/t/data/dbfa/5.fa bioperl-1.4/t/data/dbfa/6.fa bioperl-1.4/t/data/dbfa/7.fa bioperl-1.4/t/data/registry/ bioperl-1.4/t/data/registry/bdb/ bioperl-1.4/t/data/registry/bdb/seqdatabase.ini bioperl-1.4/t/data/registry/flat/ bioperl-1.4/t/data/registry/flat/seqdatabase.ini bioperl-1.4/t/AAChange.t bioperl-1.4/t/AAReverseMutate.t bioperl-1.4/t/AlignIO.t bioperl-1.4/t/AlignStats.t bioperl-1.4/t/Allele.t bioperl-1.4/t/Alphabet.t bioperl-1.4/t/Annotation.t bioperl-1.4/t/AnnotationAdaptor.t bioperl-1.4/t/Assembly.t bioperl-1.4/t/BPbl2seq.t bioperl-1.4/t/BPlite.t bioperl-1.4/t/BPpsilite.t bioperl-1.4/t/Biblio.t bioperl-1.4/t/BiblioReferences.t bioperl-1.4/t/Biblio_biofetch.t bioperl-1.4/t/BioDBGFF.t bioperl-1.4/t/BioFetch_DB.t bioperl-1.4/t/BioGraphics.t bioperl-1.4/t/BlastIndex.t bioperl-1.4/t/Chain.t bioperl-1.4/t/ClusterIO.t bioperl-1.4/t/Coalescent.t bioperl-1.4/t/CodonTable.t bioperl-1.4/t/CoordinateGraph.t bioperl-1.4/t/CoordinateMapper.t bioperl-1.4/t/Correlate.t bioperl-1.4/t/CytoMap.t bioperl-1.4/t/DB.t bioperl-1.4/t/DBCUTG.t bioperl-1.4/t/DBFasta.t bioperl-1.4/t/DNAMutation.t bioperl-1.4/t/Domcut.t bioperl-1.4/t/ECnumber.t bioperl-1.4/t/ELM.t bioperl-1.4/t/EMBL_DB.t bioperl-1.4/t/EMBOSS_Tools.t bioperl-1.4/t/ESEfinder.t bioperl-1.4/t/EncodedSeq.t bioperl-1.4/t/Exception.t bioperl-1.4/t/Exonerate.t bioperl-1.4/t/FootPrinter.t bioperl-1.4/t/GDB.t bioperl-1.4/t/GFF.t bioperl-1.4/t/GOR4.t bioperl-1.4/t/GOterm.t bioperl-1.4/t/GeneCoordinateMapper.t bioperl-1.4/t/Geneid.t bioperl-1.4/t/Genewise.t bioperl-1.4/t/Genomewise.t bioperl-1.4/t/Genpred.t bioperl-1.4/t/GuessSeqFormat.t bioperl-1.4/t/HNN.t bioperl-1.4/t/IUPAC.t bioperl-1.4/t/Index.t bioperl-1.4/t/InstanceSite.t bioperl-1.4/t/InterProParser.t bioperl-1.4/t/LinkageMap.t bioperl-1.4/t/LiveSeq.t bioperl-1.4/t/LocatableSeq.t bioperl-1.4/t/Location.t bioperl-1.4/t/LocationFactory.t bioperl-1.4/t/LocusLink.t bioperl-1.4/t/Map.t bioperl-1.4/t/MapIO.t bioperl-1.4/t/Matrix.t bioperl-1.4/t/MeSH.t bioperl-1.4/t/Measure.t bioperl-1.4/t/MetaSeq.t bioperl-1.4/t/MicrosatelliteMarker.t bioperl-1.4/t/MiniMIMentry.t bioperl-1.4/t/MitoProt.t bioperl-1.4/t/Molphy.t bioperl-1.4/t/Mutation.t bioperl-1.4/t/Mutator.t bioperl-1.4/t/NetPhos.t bioperl-1.4/t/Node.t bioperl-1.4/t/OMIMentry.t bioperl-1.4/t/OMIMentryAllelicVariant.t bioperl-1.4/t/OMIMparser.t bioperl-1.4/t/OddCodes.t bioperl-1.4/t/Ontology.t bioperl-1.4/t/OntologyEngine.t bioperl-1.4/t/PAML.t bioperl-1.4/t/Perl.t bioperl-1.4/t/Phenotype.t bioperl-1.4/t/PhylipDist.t bioperl-1.4/t/Pictogram.t bioperl-1.4/t/PopGen.t bioperl-1.4/t/PopGenSims.t bioperl-1.4/t/PrimarySeq.t bioperl-1.4/t/Primer.t bioperl-1.4/t/Promoterwise.t bioperl-1.4/t/ProtDist.t bioperl-1.4/t/QRNA.t bioperl-1.4/t/RNAChange.t bioperl-1.4/t/RandDistFunctions.t bioperl-1.4/t/RandomTreeFactory.t bioperl-1.4/t/Range.t bioperl-1.4/t/RangeI.t bioperl-1.4/t/RefSeq.t bioperl-1.4/t/Registry.t bioperl-1.4/t/Relationship.t bioperl-1.4/t/RelationshipType.t bioperl-1.4/t/RemoteBlast.t bioperl-1.4/t/RepeatMasker.t bioperl-1.4/t/RestrictionAnalysis.t bioperl-1.4/t/RestrictionEnzyme.t bioperl-1.4/t/RestrictionIO.t bioperl-1.4/t/RootI.t bioperl-1.4/t/RootIO.t bioperl-1.4/t/RootStorable.t bioperl-1.4/t/SNP.t bioperl-1.4/t/Scansite.t bioperl-1.4/t/SearchDist.t bioperl-1.4/t/SearchIO.t bioperl-1.4/t/Seq.t bioperl-1.4/t/SeqAnalysisParser.t bioperl-1.4/t/SeqBuilder.t bioperl-1.4/t/SeqDiff.t bioperl-1.4/t/SeqFeatCollection.t bioperl-1.4/t/SeqFeature.t bioperl-1.4/t/SeqIO.t bioperl-1.4/t/SeqPattern.t bioperl-1.4/t/SeqStats.t bioperl-1.4/t/SeqUtils.t bioperl-1.4/t/SeqWords.t bioperl-1.4/t/SequenceFamily.t bioperl-1.4/t/Sigcleave.t bioperl-1.4/t/Sim4.t bioperl-1.4/t/SimilarityPair.t bioperl-1.4/t/SimpleAlign.t bioperl-1.4/t/SiteMatrix.t bioperl-1.4/t/Sopma.t bioperl-1.4/t/Species.t bioperl-1.4/t/StandAloneBlast.t bioperl-1.4/t/StructIO.t bioperl-1.4/t/Structure.t bioperl-1.4/t/Swiss.t bioperl-1.4/t/Symbol.t bioperl-1.4/t/Taxonomy.t bioperl-1.4/t/Tempfile.t bioperl-1.4/t/Term.t bioperl-1.4/t/Test.pm bioperl-1.4/t/Tools.t bioperl-1.4/t/Tree.t bioperl-1.4/t/TreeIO.t bioperl-1.4/t/UCSCParsers.t bioperl-1.4/t/Unflattener.t bioperl-1.4/t/Unflattener2.t bioperl-1.4/t/UniGene.t bioperl-1.4/t/Variation_IO.t bioperl-1.4/t/WABA.t bioperl-1.4/t/XEMBL_DB.t bioperl-1.4/t/cigarstring.t bioperl-1.4/t/consed.t bioperl-1.4/t/ePCR.t bioperl-1.4/t/est2genome.t bioperl-1.4/t/flat.t bioperl-1.4/t/game.t bioperl-1.4/t/hmmer.t bioperl-1.4/t/largefasta.t bioperl-1.4/t/largepseq.t bioperl-1.4/t/lucy.t bioperl-1.4/t/multiple_fasta.t bioperl-1.4/t/pICalculator.t bioperl-1.4/t/phd.t bioperl-1.4/t/primaryqual.t bioperl-1.4/t/primedseq.t bioperl-1.4/t/primer3.t bioperl-1.4/t/psm.t bioperl-1.4/t/qual.t bioperl-1.4/t/scf.t bioperl-1.4/t/seqfeaturePrimer.t bioperl-1.4/t/sequencetrace.t bioperl-1.4/t/seqwithquality.t bioperl-1.4/t/simpleGOparser.t bioperl-1.4/t/sirna.t bioperl-1.4/t/splicedseq.t bioperl-1.4/t/testformats.pl bioperl-1.4/t/trim.t bioperl-1.4/t/tutorial.t bioperl-1.4/MANIFEST bioperl-1.4/Makefile.old CPAN.pm: Going to build B/BI/BIRNEY/bioperl-1.4.tar.gz >>> C:\Perl-5.12\bin\perl.exe Makefile.PL Generated sub tests. go make show_tests to see available subtests *** Script Install Section **** Bioperl comes with a number of useful scripts which you may wish to install. Install [a]ll Bioperl scripts, [n]one, or choose groups [i]nteractively? [a] a defined(%hash) is deprecated at C:/cpanfly-5.12/var/megalib/SOAP/Lite.pm line 465. (Maybe you should just omit the defined()?) defined(%hash) is deprecated at C:/cpanfly-5.12/var/megalib/SOAP/Lite.pm line 2203. (Maybe you should just omit the defined()?) Warning: prerequisite DB_File 0 not found. * Script Directory biblio * These are scripts to manipulate bibliographic repositories using the Bio::Biblio modules. Activating bp_biblio.pl.... * Script Directory Bio-DB-GFF * These are scripts that go with the Bio::DB::GFF module, a basic seqfeature database. Install these scripts if you wish to use the LDAS distributed annotation server or the Generic Genome Browser. Activating bp_genbank2gff.pl.... Activating bp_bulk_load_gff.pl.... Activating bp_fast_load_gff.pl.... Activating bp_generate_histogram.pl.... Activating bp_load_gff.pl.... Activating bp_pg_bulk_load_gff.pl.... Activating bp_process_gadfly.pl.... Activating bp_process_ncbi_human.pl.... Activating bp_process_sgd.pl.... Activating bp_process_wormbase.pl.... * Script Directory das * This directory is currently empty. For the Lightweight Distributed Annotation System (LDAS) server, see http://www.biodas.org/servers/ * Script Directory DB * These are scripts to fetch sequence data from local and remote sequence repositories using the Open Bio Database Access registry protocol (http://obda.open-bio.org). Activating bp_biofetch_genbank_proxy.pl.... Activating bp_bioflat_index.pl.... Activating bp_biogetseq.pl.... Activating bp_flanks.pl.... * Script Directory graphics * These are scripts to generate graphical images from sequence data. Activating bp_feature_draw.pl.... Activating bp_frend.pl.... Activating bp_search_overview.pl.... * Script Directory index * These are scripts to create and maintain flatfile databases indexed with the Bio::Index modules. Activating bp_fetch.pl.... Activating bp_index.pl.... * Script Directory popgen * Activating bp_composite_LD.pl.... Activating bp_heterogeneity_test.pl.... * Script Directory searchio * Activating bp_filter_search.pl.... * Script Directory seq * These are scripts to interconvert sequence formats and to perform other common sequence manipulations. Activating bp_extract_feature_seq.pl.... Activating bp_seqconvert.pl.... Activating bp_split_seq.pl.... Activating bp_translate_seq.pl.... * Script Directory seqstats * These are scripts to generate common statistics on protein and nucleotide sequences. Activating bp_aacomp.pl.... Activating bp_chaos_plot.pl.... Activating bp_gccalc.pl.... Activating bp_oligo_count.pl.... * Script Directory taxa * These are scripts to create and query taxonomic trees. Activating bp_local_taxonomydb_query.pl.... Activating bp_taxid4species.pl.... * Script Directory tree * These are utilities to generate trees from sequence similarity data. Activating bp_blast2tree.pl.... * Script Directory utilities * These are various sequence-related scripts that were difficult to classify more specifically but are considered general purpose utilities. Activating bp_mrtrans.pl.... Activating bp_nrdb.pl.... Activating bp_sreformat.pl.... Activating bp_dbsplit.pl.... Activating bp_mask_by_search.pl.... Activating bp_mutate.pl.... Activating bp_pairwise_kaks.pl.... Activating bp_remote_blast.pl.... Activating bp_search2alnblocks.pl.... Activating bp_search2BSML.pl.... Activating bp_search2gff.pl.... Activating bp_search2tribe.pl.... Activating bp_seq_length.pl.... External Module DBD::mysql, Mysql driver, is not installed on this computer. The Bio::DB::GFF in Bioperl needs it for loading and querying of Mysql-based GFF feature databases Information: There are some external packages and perl modules, listed above, which bioperl uses. This only effects the functionality which is listed above: the rest of bioperl will work fine, which includes nearly all of the core packages. The installation of these external packages is very simple. You can read more about bioperl external dependencies in the INSTALL file or at: http://bioperl.org/Core/Latest/INSTALL Enjoy the rest of bioperl, which you can use after going 'make install' Checking if your kit is complete... Looks good Writing Makefile for Bio ---- Unsatisfied dependencies detected during ---- ---- BIRNEY/bioperl-1.4.tar.gz ---- DB_File [requires] Running make test Delayed until after prerequisites Running test for module 'DB_File' ______________________ D i s t r o P r e f s ______________________ DB_File.yml[0] Running make for P/PM/PMQS/DB_File-1.820.tar.gz Disabled via prefs file 'C:\cpanfly-5.12\etc\distroprefs\DB_File.yml' doc 0 PMQS/DB_File-1.820.tar.gz [disabled] -- NA Disabled via prefs file 'C:\cpanfly-5.12\etc\distroprefs\DB_File.yml' doc 0 Running make for B/BI/BIRNEY/bioperl-1.4.tar.gz Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0 CPAN.pm: Going to build B/BI/BIRNEY/bioperl-1.4.tar.gz Warning: Prerequisite 'DB_File => 0' for 'BIRNEY/bioperl-1.4.tar.gz' failed when processing 'PMQS/DB_File-1.820.tar.gz' with 'unwrapped => NO Disabled via prefs file 'C:\cpanfly-5.12\etc\distroprefs\DB_File.yml' doc 0'. Continuing, but chances to succeed are limited. >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. cp Bio/Biblio/PubmedBookArticle.pm blib\lib\Bio\Biblio\PubmedBookArticle.pm cp Bio/PopGen/MarkerI.pm blib\lib\Bio\PopGen\MarkerI.pm cp Bio/Matrix/PSM/Psm.pm blib\lib\Bio\Matrix\PSM\Psm.pm cp Bio/Search/HSP/WABAHSP.pm blib\lib\Bio\Search\HSP\WABAHSP.pm cp Bio/Tools/Blast/CHANGES blib\lib\Bio\Tools\Blast\CHANGES cp Bio/WebAgent.pm blib\lib\Bio\WebAgent.pm cp Bio/LiveSeq/ChainI.pm blib\lib\Bio\LiveSeq\ChainI.pm cp Bio/LiveSeq/Mutation.pm blib\lib\Bio\LiveSeq\Mutation.pm cp Bio/AlignIO/mega.pm blib\lib\Bio\AlignIO\mega.pm cp Bio/Tools/HMMER/Set.pm blib\lib\Bio\Tools\HMMER\Set.pm cp Bio/Factory/ObjectFactory.pm blib\lib\Bio\Factory\ObjectFactory.pm cp Bio/SearchIO/megablast.pm blib\lib\Bio\SearchIO\megablast.pm cp Bio/Factory/SeqAnalysisParserFactoryI.pm blib\lib\Bio\Factory\SeqAnalysisParserFactoryI.pm cp Bio/DB/GFF/Aggregator/ucsc_unigene.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_unigene.pm cp Bio/TreeIO.pm blib\lib\Bio\TreeIO.pm cp Bio/Search/HSP/PSLHSP.pm blib\lib\Bio\Search\HSP\PSLHSP.pm cp Bio/DB/GFF/Aggregator/ucsc_acembly.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_acembly.pm cp Bio/Cluster/UniGeneI.pm blib\lib\Bio\Cluster\UniGeneI.pm cp Bio/Tools/GuessSeqFormat.pm blib\lib\Bio\Tools\GuessSeqFormat.pm cp Bio/Align/Utilities.pm blib\lib\Bio\Align\Utilities.pm cp Bio/DB/Flat.pm blib\lib\Bio\DB\Flat.pm cp Bio/Tools/Run/README blib\lib\Bio\Tools\Run\README cp Bio/DB/SwissProt.pm blib\lib\Bio\DB\SwissProt.pm cp Bio/SearchIO/fasta.pm blib\lib\Bio\SearchIO\fasta.pm cp Bio/TreeIO/nexus.pm blib\lib\Bio\TreeIO\nexus.pm cp Bio/Biblio/Provider.pm blib\lib\Bio\Biblio\Provider.pm cp Bio/Coordinate/Graph.pm blib\lib\Bio\Coordinate\Graph.pm cp Bio/DB/GFF/Aggregator/ucsc_sanger22.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22.pm cp Bio/LocationI.pm blib\lib\Bio\LocationI.pm cp Bio/Root/RootI.pm blib\lib\Bio\Root\RootI.pm cp Bio/Taxonomy.pm blib\lib\Bio\Taxonomy.pm cp Bio/Matrix/PSM/PsmI.pm blib\lib\Bio\Matrix\PSM\PsmI.pm cp Bio/TreeIO/TreeEventBuilder.pm blib\lib\Bio\TreeIO\TreeEventBuilder.pm cp Bio/Location/Fuzzy.pm blib\lib\Bio\Location\Fuzzy.pm cp Bio/DBLinkContainerI.pm blib\lib\Bio\DBLinkContainerI.pm cp Bio/SeqIO.pm blib\lib\Bio\SeqIO.pm cp Bio/AnalysisI.pm blib\lib\Bio\AnalysisI.pm cp Bio/LiveSeq/AARange.pm blib\lib\Bio\LiveSeq\AARange.pm cp Bio/DB/Biblio/biofetch.pm blib\lib\Bio\DB\Biblio\biofetch.pm cp Bio/Index/Swissprot.pm blib\lib\Bio\Index\Swissprot.pm cp Bio/Map/MappableI.pm blib\lib\Bio\Map\MappableI.pm cp Bio/Seq/BaseSeqProcessor.pm blib\lib\Bio\Seq\BaseSeqProcessor.pm cp Bio/DB/BiblioI.pm blib\lib\Bio\DB\BiblioI.pm cp Bio/MapIO.pm blib\lib\Bio\MapIO.pm cp Bio/SearchIO/Writer/HSPTableWriter.pm blib\lib\Bio\SearchIO\Writer\HSPTableWriter.pm cp Bio/Graphics/Glyph/segmented_keyglyph.pm blib\lib\Bio\Graphics\Glyph\segmented_keyglyph.pm cp Bio/SearchIO/blasttable.pm blib\lib\Bio\SearchIO\blasttable.pm cp Bio/SeqIO/fastq.pm blib\lib\Bio\SeqIO\fastq.pm cp Bio/LiveSeq/SeqI.pm blib\lib\Bio\LiveSeq\SeqI.pm cp Bio/SeqFeature/Collection.pm blib\lib\Bio\SeqFeature\Collection.pm cp Bio/Annotation/OntologyTerm.pm blib\lib\Bio\Annotation\OntologyTerm.pm cp Bio/Map/SimpleMap.pm blib\lib\Bio\Map\SimpleMap.pm cp Bio/Graphics/Glyph/box.pm blib\lib\Bio\Graphics\Glyph\box.pm cp Bio/Coordinate/Result/Gap.pm blib\lib\Bio\Coordinate\Result\Gap.pm cp Bio/Graphics/Glyph/cds.pm blib\lib\Bio\Graphics\Glyph\cds.pm cp Bio/Tree/TreeI.pm blib\lib\Bio\Tree\TreeI.pm cp Bio/Tools/Run/RemoteBlast.pm blib\lib\Bio\Tools\Run\RemoteBlast.pm cp Bio/Seq/Meta/Array.pm blib\lib\Bio\Seq\Meta\Array.pm cp Bio/Graphics/Glyph/extending_arrow.pm blib\lib\Bio\Graphics\Glyph\extending_arrow.pm cp Bio/Search/Hit/PsiBlastHit.pm blib\lib\Bio\Search\Hit\PsiBlastHit.pm cp Bio/LiveSeq/Repeat_Unit.pm blib\lib\Bio\LiveSeq\Repeat_Unit.pm cp Bio/Restriction/Enzyme/MultiCut.pm blib\lib\Bio\Restriction\Enzyme\MultiCut.pm cp Bio/DB/GFF/Adaptor/memory.pm blib\lib\Bio\DB\GFF\Adaptor\memory.pm cp Bio/DB/UpdateableSeqI.pm blib\lib\Bio\DB\UpdateableSeqI.pm cp Bio/Restriction/IO/base.pm blib\lib\Bio\Restriction\IO\base.pm cp Bio/DB/RefSeq.pm blib\lib\Bio\DB\RefSeq.pm cp Bio/Tools/RepeatMasker.pm blib\lib\Bio\Tools\RepeatMasker.pm cp Bio/Coordinate/Result/Match.pm blib\lib\Bio\Coordinate\Result\Match.pm cp Bio/Search/Result/HMMERResult.pm blib\lib\Bio\Search\Result\HMMERResult.pm cp Bio/SearchIO/wise.pm blib\lib\Bio\SearchIO\wise.pm cp Bio/Tools/Analysis/Protein/ELM.pm blib\lib\Bio\Tools\Analysis\Protein\ELM.pm cp Bio/Phenotype/Phenotype.pm blib\lib\Bio\Phenotype\Phenotype.pm cp Bio/Seq/TraceI.pm blib\lib\Bio\Seq\TraceI.pm cp Bio/Seq/PrimaryQual.pm blib\lib\Bio\Seq\PrimaryQual.pm cp Bio/DB/Failover.pm blib\lib\Bio\DB\Failover.pm cp Bio/Map/CytoMap.pm blib\lib\Bio\Map\CytoMap.pm cp Bio/Variation/Allele.pm blib\lib\Bio\Variation\Allele.pm cp Bio/LiveSeq/IO/Loader.pm blib\lib\Bio\LiveSeq\IO\Loader.pm cp Bio/Biblio/IO.pm blib\lib\Bio\Biblio\IO.pm cp Bio/Biblio/BiblioBase.pm blib\lib\Bio\Biblio\BiblioBase.pm cp Bio/DB/NCBIHelper.pm blib\lib\Bio\DB\NCBIHelper.pm cp Bio/DB/GFF/Feature.pm blib\lib\Bio\DB\GFF\Feature.pm cp Bio/Phenotype/OMIM/MiniMIMentry.pm blib\lib\Bio\Phenotype\OMIM\MiniMIMentry.pm cp Bio/UpdateableSeqI.pm blib\lib\Bio\UpdateableSeqI.pm cp Bio/Tools/Phylo/PAML/ModelResult.pm blib\lib\Bio\Tools\Phylo\PAML\ModelResult.pm cp Bio/Biblio/Thesis.pm blib\lib\Bio\Biblio\Thesis.pm cp Bio/Event/EventHandlerI.pm blib\lib\Bio\Event\EventHandlerI.pm cp Bio/Seq/PrimedSeq.pm blib\lib\Bio\Seq\PrimedSeq.pm cp Bio/Structure/Chain.pm blib\lib\Bio\Structure\Chain.pm cp Bio/AlignIO/prodom.pm blib\lib\Bio\AlignIO\prodom.pm cp Bio/Assembly/ContigAnalysis.pm blib\lib\Bio\Assembly\ContigAnalysis.pm cp Bio/Coordinate/ExtrapolatingPair.pm blib\lib\Bio\Coordinate\ExtrapolatingPair.pm cp Bio/SimpleAnalysisI.pm blib\lib\Bio\SimpleAnalysisI.pm cp Bio/Graphics/Glyph/group.pm blib\lib\Bio\Graphics\Glyph\group.pm cp Bio/IdCollectionI.pm blib\lib\Bio\IdCollectionI.pm cp Bio/Tree/AlleleNode.pm blib\lib\Bio\Tree\AlleleNode.pm cp Bio/Tools/Gel.pm blib\lib\Bio\Tools\Gel.pm cp Bio/SeqIO/largefasta.pm blib\lib\Bio\SeqIO\largefasta.pm cp Bio/Annotation/SimpleValue.pm blib\lib\Bio\Annotation\SimpleValue.pm cp Bio/AlignIO/emboss.pm blib\lib\Bio\AlignIO\emboss.pm cp Bio/Align/AlignI.pm blib\lib\Bio\Align\AlignI.pm cp Bio/Graphics/Glyph/generic.pm blib\lib\Bio\Graphics\Glyph\generic.pm cp Bio/Graphics/Glyph/processed_transcript.pm blib\lib\Bio\Graphics\Glyph\processed_transcript.pm cp Bio/Graphics/ConfiguratorI.pm blib\lib\Bio\Graphics\ConfiguratorI.pm cp Bio/DB/Fasta.pm blib\lib\Bio\DB\Fasta.pm cp Bio/Graphics/Glyph/minmax.pm blib\lib\Bio\Graphics\Glyph\minmax.pm cp Bio/TreeIO/lintree.pm blib\lib\Bio\TreeIO\lintree.pm cp Bio/Biblio.pm blib\lib\Bio\Biblio.pm cp Bio/DB/GFF/Adaptor/memory_iterator.pm blib\lib\Bio\DB\GFF\Adaptor\memory_iterator.pm cp Bio/Phenotype/OMIM/OMIMparser.pm blib\lib\Bio\Phenotype\OMIM\OMIMparser.pm cp Bio/Restriction/Enzyme.pm blib\lib\Bio\Restriction\Enzyme.pm cp Bio/SeqIO/game/seqHandler.pm blib\lib\Bio\SeqIO\game\seqHandler.pm cp Bio/Matrix/PSM/InstanceSite.pm blib\lib\Bio\Matrix\PSM\InstanceSite.pm cp Bio/Tree/TreeFunctionsI.pm blib\lib\Bio\Tree\TreeFunctionsI.pm cp Bio/Matrix/MatrixI.pm blib\lib\Bio\Matrix\MatrixI.pm cp Bio/Matrix/PSM/IO.pm blib\lib\Bio\Matrix\PSM\IO.pm cp Bio/TreeIO/svggraph.pm blib\lib\Bio\TreeIO\svggraph.pm cp Bio/Taxonomy/Tree.pm blib\lib\Bio\Taxonomy\Tree.pm cp Bio/Ontology/RelationshipType.pm blib\lib\Bio\Ontology\RelationshipType.pm cp Bio/Cluster/UniGene.pm blib\lib\Bio\Cluster\UniGene.pm cp Bio/CodonUsage/Table.pm blib\lib\Bio\CodonUsage\Table.pm cp Bio/DB/Query/WebQuery.pm blib\lib\Bio\DB\Query\WebQuery.pm cp Bio/Ontology/OntologyI.pm blib\lib\Bio\Ontology\OntologyI.pm cp Bio/SeqFeature/Generic.pm blib\lib\Bio\SeqFeature\Generic.pm cp Bio/SearchIO/hmmer.pm blib\lib\Bio\SearchIO\hmmer.pm cp Bio/PopGen/PopulationI.pm blib\lib\Bio\PopGen\PopulationI.pm cp Bio/SeqIO/ctf.pm blib\lib\Bio\SeqIO\ctf.pm cp Bio/LiveSeq/IO/SRS.pm blib\lib\Bio\LiveSeq\IO\SRS.pm cp Bio/Tools/SeqPattern.pm blib\lib\Bio\Tools\SeqPattern.pm cp Bio/SearchIO/psl.pm blib\lib\Bio\SearchIO\psl.pm cp Bio/LiveSeq/DNA.pm blib\lib\Bio\LiveSeq\DNA.pm cp Bio/Index/AbstractSeq.pm blib\lib\Bio\Index\AbstractSeq.pm cp Bio/AlignIO.pm blib\lib\Bio\AlignIO.pm cp Bio/Tree/NodeI.pm blib\lib\Bio\Tree\NodeI.pm cp Bio/Tools/Prints.pm blib\lib\Bio\Tools\Prints.pm cp Bio/SeqFeature/Gene/Exon.pm blib\lib\Bio\SeqFeature\Gene\Exon.pm cp Bio/DescribableI.pm blib\lib\Bio\DescribableI.pm cp Bio/Structure/StructureI.pm blib\lib\Bio\Structure\StructureI.pm cp Bio/Search/Result/ResultI.pm blib\lib\Bio\Search\Result\ResultI.pm cp Bio/Symbol/AlphabetI.pm blib\lib\Bio\Symbol\AlphabetI.pm cp Bio/Graphics/Glyph/rndrect.pm blib\lib\Bio\Graphics\Glyph\rndrect.pm cp Bio/RangeI.pm blib\lib\Bio\RangeI.pm cp Bio/Matrix/PSM/InstanceSiteI.pm blib\lib\Bio\Matrix\PSM\InstanceSiteI.pm cp Bio/Root/Global.pm blib\lib\Bio\Root\Global.pm cp Bio/SeqFeature/SimilarityPair.pm blib\lib\Bio\SeqFeature\SimilarityPair.pm cp Bio/SeqIO/raw.pm blib\lib\Bio\SeqIO\raw.pm cp Bio/Tools/Analysis/Protein/GOR4.pm blib\lib\Bio\Tools\Analysis\Protein\GOR4.pm cp Bio/Search/Processor.pm blib\lib\Bio\Search\Processor.pm cp Bio/Seq.pm blib\lib\Bio\Seq.pm cp Bio/Biblio/Article.pm blib\lib\Bio\Biblio\Article.pm cp Bio/Tools/HMMER/Results.pm blib\lib\Bio\Tools\HMMER\Results.pm cp Bio/Search/BlastUtils.pm blib\lib\Bio\Search\BlastUtils.pm cp Bio/Biblio/Organisation.pm blib\lib\Bio\Biblio\Organisation.pm cp Bio/Tree/RandomFactory.pm blib\lib\Bio\Tree\RandomFactory.pm cp Bio/Tools/Phylo/PAML/Result.pm blib\lib\Bio\Tools\Phylo\PAML\Result.pm cp Bio/Structure/IO/pdb.pm blib\lib\Bio\Structure\IO\pdb.pm cp Bio/Graphics/Feature.pm blib\lib\Bio\Graphics\Feature.pm cp Bio/Search/HSP/PsiBlastHSP.pm blib\lib\Bio\Search\HSP\PsiBlastHSP.pm cp Bio/Index/GenBank.pm blib\lib\Bio\Index\GenBank.pm cp Bio/Biblio/MedlineJournalArticle.pm blib\lib\Bio\Biblio\MedlineJournalArticle.pm cp Bio/Restriction/IO/itype2.pm blib\lib\Bio\Restriction\IO\itype2.pm cp Bio/CodonUsage/IO.pm blib\lib\Bio\CodonUsage\IO.pm cp Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm cp Bio/Location/SplitLocationI.pm blib\lib\Bio\Location\SplitLocationI.pm cp Bio/Taxonomy/Node.pm blib\lib\Bio\Taxonomy\Node.pm cp Bio/Variation/IO/xml.pm blib\lib\Bio\Variation\IO\xml.pm cp Bio/DB/GFF/Aggregator/alignment.pm blib\lib\Bio\DB\GFF\Aggregator\alignment.pm cp Bio/SeqIO/metafasta.pm blib\lib\Bio\SeqIO\metafasta.pm cp Bio/SeqFeature/Gene/NC_Feature.pm blib\lib\Bio\SeqFeature\Gene\NC_Feature.pm cp Bio/Matrix/Generic.pm blib\lib\Bio\Matrix\Generic.pm cp Bio/FeatureHolderI.pm blib\lib\Bio\FeatureHolderI.pm cp Bio/Tools/dpAlign.pm blib\lib\Bio\Tools\dpAlign.pm cp Bio/OntologyIO.pm blib\lib\Bio\OntologyIO.pm cp Bio/Ontology/RelationshipI.pm blib\lib\Bio\Ontology\RelationshipI.pm cp Bio/Restriction/IO.pm blib\lib\Bio\Restriction\IO.pm cp Bio/SeqFeature/Gene/TranscriptI.pm blib\lib\Bio\SeqFeature\Gene\TranscriptI.pm cp Bio/DB/RandomAccessI.pm blib\lib\Bio\DB\RandomAccessI.pm cp Bio/Cluster/FamilyI.pm blib\lib\Bio\Cluster\FamilyI.pm cp Bio/SeqIO/kegg.pm blib\lib\Bio\SeqIO\kegg.pm cp Bio/SeqIO/qual.pm blib\lib\Bio\SeqIO\qual.pm cp Bio/SearchIO/axt.pm blib\lib\Bio\SearchIO\axt.pm cp Bio/Ontology/TermI.pm blib\lib\Bio\Ontology\TermI.pm cp Bio/SeqIO/pln.pm blib\lib\Bio\SeqIO\pln.pm cp Bio/AnalysisResultI.pm blib\lib\Bio\AnalysisResultI.pm cp Bio/Search/Result/BlastResult.pm blib\lib\Bio\Search\Result\BlastResult.pm cp Bio/PopGen/Simulation/Coalescent.pm blib\lib\Bio\PopGen\Simulation\Coalescent.pm cp Bio/Assembly/ScaffoldI.pm blib\lib\Bio\Assembly\ScaffoldI.pm cp Bio/Annotation/AnnotationFactory.pm blib\lib\Bio\Annotation\AnnotationFactory.pm cp Bio/SeqIO/locuslink.pm blib\lib\Bio\SeqIO\locuslink.pm cp Bio/Phenotype/MeSH/Twig.pm blib\lib\Bio\Phenotype\MeSH\Twig.pm cp Bio/Structure/Atom.pm blib\lib\Bio\Structure\Atom.pm cp Bio/Tools/Sim4/Exon.pm blib\lib\Bio\Tools\Sim4\Exon.pm cp Bio/PopGen/Genotype.pm blib\lib\Bio\PopGen\Genotype.pm cp Bio/Tools/pICalculator.pm blib\lib\Bio\Tools\pICalculator.pm cp Bio/DB/GFF/Aggregator/match.pm blib\lib\Bio\DB\GFF\Aggregator\match.pm cp Bio/DB/GFF/Aggregator/ucsc_softberry.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_softberry.pm cp Bio/Map/PositionI.pm blib\lib\Bio\Map\PositionI.pm cp Bio/Biblio/BookArticle.pm blib\lib\Bio\Biblio\BookArticle.pm cp Bio/Restriction/IO/withrefm.pm blib\lib\Bio\Restriction\IO\withrefm.pm cp Bio/DB/Flat/BDB/swiss.pm blib\lib\Bio\DB\Flat\BDB\swiss.pm cp Bio/Tools/SeqStats.pm blib\lib\Bio\Tools\SeqStats.pm cp Bio/LiveSeq/Transcript.pm blib\lib\Bio\LiveSeq\Transcript.pm cp Bio/Ontology/OntologyEngineI.pm blib\lib\Bio\Ontology\OntologyEngineI.pm cp Bio/Search/HSP/FastaHSP.pm blib\lib\Bio\Search\HSP\FastaHSP.pm cp Bio/Ontology/Term.pm blib\lib\Bio\Ontology\Term.pm cp Bio/Tools/Primer/Assessor/Base.pm blib\lib\Bio\Tools\Primer\Assessor\Base.pm cp Bio/Graphics/Util.pm blib\lib\Bio\Graphics\Util.pm cp Bio/DB/Flat/BDB.pm blib\lib\Bio\DB\Flat\BDB.pm cp Bio/AlignIO/mase.pm blib\lib\Bio\AlignIO\mase.pm cp Bio/Graphics/Glyph/ex.pm blib\lib\Bio\Graphics\Glyph\ex.pm cp Bio/Tools/Phylo/Molphy/Result.pm blib\lib\Bio\Tools\Phylo\Molphy\Result.pm cp Bio/Graphics/Glyph/diamond.pm blib\lib\Bio\Graphics\Glyph\diamond.pm cp Bio/Graphics/Glyph/ellipse.pm blib\lib\Bio\Graphics\Glyph\ellipse.pm cp Bio/SeqFeature/Tools/TypeMapper.pm blib\lib\Bio\SeqFeature\Tools\TypeMapper.pm cp Bio/SeqIO/scf.pm blib\lib\Bio\SeqIO\scf.pm cp Bio/MapIO/mapmaker.pm blib\lib\Bio\MapIO\mapmaker.pm cp Bio/Ontology/OntologyStore.pm blib\lib\Bio\Ontology\OntologyStore.pm cp Bio/OntologyIO/InterProParser.pm blib\lib\Bio\OntologyIO\InterProParser.pm cp Bio/Taxonomy/FactoryI.pm blib\lib\Bio\Taxonomy\FactoryI.pm cp Bio/DB/GFF/Adaptor/dbi/caching_handle.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm cp Bio/Tools/Analysis/Protein/HNN.pm blib\lib\Bio\Tools\Analysis\Protein\HNN.pm cp Bio/Location/Atomic.pm blib\lib\Bio\Location\Atomic.pm cp Bio/Ontology/Ontology.pm blib\lib\Bio\Ontology\Ontology.pm cp Bio/PopGen/IO/prettybase.pm blib\lib\Bio\PopGen\IO\prettybase.pm cp Bio/Tools/QRNA.pm blib\lib\Bio\Tools\QRNA.pm cp Bio/SeqIO/fasta.pm blib\lib\Bio\SeqIO\fasta.pm cp Bio/Root/Root.pm blib\lib\Bio\Root\Root.pm cp Bio/Graphics/Glyph/oval.pm blib\lib\Bio\Graphics\Glyph\oval.pm cp Bio/DB/GFF/Aggregator/ucsc_twinscan.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_twinscan.pm cp Bio/SeqFeature/Gene/Transcript.pm blib\lib\Bio\SeqFeature\Gene\Transcript.pm cp Bio/DB/BioFetch.pm blib\lib\Bio\DB\BioFetch.pm cp Bio/SeqIO/phd.pm blib\lib\Bio\SeqIO\phd.pm cp Bio/Factory/LocationFactoryI.pm blib\lib\Bio\Factory\LocationFactoryI.pm cp Bio/SeqFeature/AnnotationAdaptor.pm blib\lib\Bio\SeqFeature\AnnotationAdaptor.pm cp Bio/Graphics/Glyph/anchored_arrow.pm blib\lib\Bio\Graphics\Glyph\anchored_arrow.pm cp Bio/SeqFeature/Similarity.pm blib\lib\Bio\SeqFeature\Similarity.pm cp Bio/Tools/Sigcleave.pm blib\lib\Bio\Tools\Sigcleave.pm cp Bio/Tools/Alignment/Trim.pm blib\lib\Bio\Tools\Alignment\Trim.pm cp Bio/Tools/Alignment/Consed.pm blib\lib\Bio\Tools\Alignment\Consed.pm cp Bio/Restriction/EnzymeI.pm blib\lib\Bio\Restriction\EnzymeI.pm cp Bio/SearchIO/sim4.pm blib\lib\Bio\SearchIO\sim4.pm cp Bio/Phenotype/OMIM/OMIMentry.pm blib\lib\Bio\Phenotype\OMIM\OMIMentry.pm cp Bio/Map/MarkerI.pm blib\lib\Bio\Map\MarkerI.pm cp Bio/SearchIO/waba.pm blib\lib\Bio\SearchIO\waba.pm cp Bio/DB/Flat/BDB/genbank.pm blib\lib\Bio\DB\Flat\BDB\genbank.pm cp Bio/DB/Taxonomy/entrez.pm blib\lib\Bio\DB\Taxonomy\entrez.pm cp Bio/Tools/ESTScan.pm blib\lib\Bio\Tools\ESTScan.pm cp Bio/AlignIO/phylip.pm blib\lib\Bio\AlignIO\phylip.pm cp Bio/Variation/SeqDiff.pm blib\lib\Bio\Variation\SeqDiff.pm cp Bio/Factory/DriverFactory.pm blib\lib\Bio\Factory\DriverFactory.pm cp Bio/Coordinate/Result.pm blib\lib\Bio\Coordinate\Result.pm cp Bio/Biblio/PubmedJournalArticle.pm blib\lib\Bio\Biblio\PubmedJournalArticle.pm cp Bio/PopGen/IO.pm blib\lib\Bio\PopGen\IO.pm cp Bio/SeqAnalysisParserI.pm blib\lib\Bio\SeqAnalysisParserI.pm cp Bio/Variation/RNAChange.pm blib\lib\Bio\Variation\RNAChange.pm cp Bio/SearchIO.pm blib\lib\Bio\SearchIO.pm cp Bio/Search/Result/WABAResult.pm blib\lib\Bio\Search\Result\WABAResult.pm cp Bio/DB/MANIFEST blib\lib\Bio\DB\MANIFEST cp Bio/SeqIO/embl.pm blib\lib\Bio\SeqIO\embl.pm cp Bio/SeqIO/tigr.pm blib\lib\Bio\SeqIO\tigr.pm cp Bio/Biblio/IO/medline2ref.pm blib\lib\Bio\Biblio\IO\medline2ref.pm cp Bio/SeqIO/asciitree.pm blib\lib\Bio\SeqIO\asciitree.pm cp Bio/Graphics/Glyph/pinsertion.pm blib\lib\Bio\Graphics\Glyph\pinsertion.pm cp Bio/Tools/AnalysisResult.pm blib\lib\Bio\Tools\AnalysisResult.pm cp Bio/Graphics/Glyph/toomany.pm blib\lib\Bio\Graphics\Glyph\toomany.pm cp Bio/Biblio/Journal.pm blib\lib\Bio\Biblio\Journal.pm cp Bio/DB/GFF/Aggregator/transcript.pm blib\lib\Bio\DB\GFF\Aggregator\transcript.pm cp Bio/Search/HSP/GenericHSP.pm blib\lib\Bio\Search\HSP\GenericHSP.pm cp Bio/DB/GFF/Util/Rearrange.pm blib\lib\Bio\DB\GFF\Util\Rearrange.pm cp Bio/AnnotationCollectionI.pm blib\lib\Bio\AnnotationCollectionI.pm cp Bio/SeqFeatureI.pm blib\lib\Bio\SeqFeatureI.pm cp Bio/Factory/ObjectFactoryI.pm blib\lib\Bio\Factory\ObjectFactoryI.pm cp Bio/AnalysisParserI.pm blib\lib\Bio\AnalysisParserI.pm cp Bio/Matrix/PSM/IO/transfac.pm blib\lib\Bio\Matrix\PSM\IO\transfac.pm cp Bio/Tools/Analysis/Protein/Sopma.pm blib\lib\Bio\Tools\Analysis\Protein\Sopma.pm cp Bio/Matrix/PSM/PsmHeader.pm blib\lib\Bio\Matrix\PSM\PsmHeader.pm cp Bio/SearchDist.pm blib\lib\Bio\SearchDist.pm cp Bio/Expression/FeatureGroup/FeatureGroupMas50.pm blib\lib\Bio\Expression\FeatureGroup\FeatureGroupMas50.pm cp Bio/Tools/ECnumber.pm blib\lib\Bio\Tools\ECnumber.pm cp Bio/LiveSeq/Range.pm blib\lib\Bio\LiveSeq\Range.pm cp Bio/Restriction/EnzymeCollection.pm blib\lib\Bio\Restriction\EnzymeCollection.pm cp Bio/Tools/Pseudowise.pm blib\lib\Bio\Tools\Pseudowise.pm cp Bio/Matrix/IO/phylip.pm blib\lib\Bio\Matrix\IO\phylip.pm cp Bio/Tools/Genscan.pm blib\lib\Bio\Tools\Genscan.pm cp Bio/OntologyIO/soflat.pm blib\lib\Bio\OntologyIO\soflat.pm cp Bio/Tools/GFF.pm blib\lib\Bio\Tools\GFF.pm cp Bio/Tools/Blast.pm blib\lib\Bio\Tools\Blast.pm cp Bio/Das/SegmentI.pm blib\lib\Bio\Das\SegmentI.pm cp Bio/Das/FeatureTypeI.pm blib\lib\Bio\Das\FeatureTypeI.pm cp Bio/Graphics/Glyph/graded_segments.pm blib\lib\Bio\Graphics\Glyph\graded_segments.pm cp bptutorial.pl blib\lib\bptutorial.pl cp Bio/Structure/Model.pm blib\lib\Bio\Structure\Model.pm cp Bio/Graphics/Glyph/dna.pm blib\lib\Bio\Graphics\Glyph\dna.pm cp Bio/Restriction/Analysis.pm blib\lib\Bio\Restriction\Analysis.pm cp Bio/Tree/Node.pm blib\lib\Bio\Tree\Node.pm cp Bio/Seq/SeqFastaSpeedFactory.pm blib\lib\Bio\Seq\SeqFastaSpeedFactory.pm cp Bio/LiveSeq/Repeat_Region.pm blib\lib\Bio\LiveSeq\Repeat_Region.pm cp Bio/Tools/RandomDistFunctions.pm blib\lib\Bio\Tools\RandomDistFunctions.pm cp Bio/Annotation/Reference.pm blib\lib\Bio\Annotation\Reference.pm cp Bio/Phenotype/MeSH/Term.pm blib\lib\Bio\Phenotype\MeSH\Term.pm cp Bio/Coordinate/MapperI.pm blib\lib\Bio\Coordinate\MapperI.pm cp Bio/DB/WebDBSeqI.pm blib\lib\Bio\DB\WebDBSeqI.pm cp Bio/TreeIO/tabtree.pm blib\lib\Bio\TreeIO\tabtree.pm cp Bio/Tools/Primer3.pm blib\lib\Bio\Tools\Primer3.pm cp Bio/DB/GFF/Adaptor/dbi/pg.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\pg.pm cp Bio/Seq/SeqFactory.pm blib\lib\Bio\Seq\SeqFactory.pm cp Bio/Tools/Seg.pm blib\lib\Bio\Tools\Seg.pm cp Bio/SeqIO/genbank.pm blib\lib\Bio\SeqIO\genbank.pm cp Bio/PrimarySeq.pm blib\lib\Bio\PrimarySeq.pm cp Bio/AlignIO/pfam.pm blib\lib\Bio\AlignIO\pfam.pm cp Bio/AlignIO/nexus.pm blib\lib\Bio\AlignIO\nexus.pm cp Bio/DB/GFF/Aggregator/none.pm blib\lib\Bio\DB\GFF\Aggregator\none.pm cp Bio/DB/GFF/Adaptor/dbi.pm blib\lib\Bio\DB\GFF\Adaptor\dbi.pm cp Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm blib\lib\Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm cp Bio/Tools/Signalp.pm blib\lib\Bio\Tools\Signalp.pm cp Bio/Location/CoordinatePolicyI.pm blib\lib\Bio\Location\CoordinatePolicyI.pm cp biodesign.pod blib\lib\biodesign.pod cp Bio/SearchIO/Writer/GbrowseGFF.pm blib\lib\Bio\SearchIO\Writer\GbrowseGFF.pm cp Bio/PopGen/Population.pm blib\lib\Bio\PopGen\Population.pm cp Bio/Root/HTTPget.pm blib\lib\Bio\Root\HTTPget.pm cp Bio/AlignIO/maf.pm blib\lib\Bio\AlignIO\maf.pm cp Bio/Graphics/Pictogram.pm blib\lib\Bio\Graphics\Pictogram.pm cp Bio/Search/Result/ResultFactory.pm blib\lib\Bio\Search\Result\ResultFactory.pm cp Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm blib\lib\Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm cp Bio/Tools/Phylo/Phylip/ProtDist.pm blib\lib\Bio\Tools\Phylo\Phylip\ProtDist.pm cp Bio/Annotation/Collection.pm blib\lib\Bio\Annotation\Collection.pm cp Bio/Tools/IUPAC.pm blib\lib\Bio\Tools\IUPAC.pm cp Bio/DB/Taxonomy/flatfile.pm blib\lib\Bio\DB\Taxonomy\flatfile.pm cp Bio/Graphics/Glyph/triangle.pm blib\lib\Bio\Graphics\Glyph\triangle.pm cp Bio/Graphics.pm blib\lib\Bio\Graphics.pm cp Bio/DB/GFF/Aggregator/ucsc_refgene.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_refgene.pm cp Bio/SeqIO/abi.pm blib\lib\Bio\SeqIO\abi.pm cp Bio/AlignIO/msf.pm blib\lib\Bio\AlignIO\msf.pm cp Bio/AlignIO/bl2seq.pm blib\lib\Bio\AlignIO\bl2seq.pm cp Bio/Tools/BPbl2seq.pm blib\lib\Bio\Tools\BPbl2seq.pm cp Bio/Ontology/SimpleOntologyEngine.pm blib\lib\Bio\Ontology\SimpleOntologyEngine.pm cp Bio/Variation/IO.pm blib\lib\Bio\Variation\IO.pm cp Bio/Root/Storable.pm blib\lib\Bio\Root\Storable.pm cp Bio/Ontology/PathI.pm blib\lib\Bio\Ontology\PathI.pm cp Bio/AnnotationI.pm blib\lib\Bio\AnnotationI.pm cp Bio/Restriction/IO/bairoch.pm blib\lib\Bio\Restriction\IO\bairoch.pm cp Bio/Tools/WWW.pm blib\lib\Bio\Tools\WWW.pm cp Bio/SeqIO/game/gameSubs.pm blib\lib\Bio\SeqIO\game\gameSubs.pm cp Bio/Seq/LargePrimarySeq.pm blib\lib\Bio\Seq\LargePrimarySeq.pm cp Bio/SearchIO/Writer/BSMLResultWriter.pm blib\lib\Bio\SearchIO\Writer\BSMLResultWriter.pm cp Bio/SearchIO/exonerate.pm blib\lib\Bio\SearchIO\exonerate.pm cp Bio/Factory/HitFactoryI.pm blib\lib\Bio\Factory\HitFactoryI.pm cp Bio/SimpleAlign.pm blib\lib\Bio\SimpleAlign.pm cp Bio/Matrix/PSM/SiteMatrix.pm blib\lib\Bio\Matrix\PSM\SiteMatrix.pm cp Bio/Graphics/RendererI.pm blib\lib\Bio\Graphics\RendererI.pm cp Bio/Expression/FeatureSet/FeatureSetMas50.pm blib\lib\Bio\Expression\FeatureSet\FeatureSetMas50.pm cp Bio/Tools/Blast/Sbjct.pm blib\lib\Bio\Tools\Blast\Sbjct.pm cp Bio/Tools/Phylo/PAML.pm blib\lib\Bio\Tools\Phylo\PAML.pm cp Bio/Graphics/FeatureFile/Iterator.pm blib\lib\Bio\Graphics\FeatureFile\Iterator.pm cp Bio/LiveSeq/Intron.pm blib\lib\Bio\LiveSeq\Intron.pm cp Bio/DB/GFF/Aggregator/clone.pm blib\lib\Bio\DB\GFF\Aggregator\clone.pm cp Bio/Map/Position.pm blib\lib\Bio\Map\Position.pm cp Bio/PrimarySeqI.pm blib\lib\Bio\PrimarySeqI.pm cp Bio/Graphics/Glyph/alignment.pm blib\lib\Bio\Graphics\Glyph\alignment.pm cp Bio/Root/IOManager.pm blib\lib\Bio\Root\IOManager.pm cp Bio/LiveSeq/Gene.pm blib\lib\Bio\LiveSeq\Gene.pm cp Bio/Ontology/Relationship.pm blib\lib\Bio\Ontology\Relationship.pm cp Bio/Search/Hit/HitFactory.pm blib\lib\Bio\Search\Hit\HitFactory.pm cp Bio/DB/Flat/BDB/fasta.pm blib\lib\Bio\DB\Flat\BDB\fasta.pm cp Bio/Seq/SequenceTrace.pm blib\lib\Bio\Seq\SequenceTrace.pm cp Bio/Factory/ApplicationFactoryI.pm blib\lib\Bio\Factory\ApplicationFactoryI.pm cp Bio/DB/GFF/Typename.pm blib\lib\Bio\DB\GFF\Typename.pm cp Bio/Search/HSP/HSPFactory.pm blib\lib\Bio\Search\HSP\HSPFactory.pm cp Bio/DB/GFF/Homol.pm blib\lib\Bio\DB\GFF\Homol.pm cp Bio/Event/EventGeneratorI.pm blib\lib\Bio\Event\EventGeneratorI.pm cp Bio/AlignIO/psi.pm blib\lib\Bio\AlignIO\psi.pm cp Bio/Graphics/Glyph/redgreen_box.pm blib\lib\Bio\Graphics\Glyph\redgreen_box.pm cp Bio/Tools/BPlite/Sbjct.pm blib\lib\Bio\Tools\BPlite\Sbjct.pm cp biodatabases.pod blib\lib\biodatabases.pod cp Bio/Graphics/FeatureFile.pm blib\lib\Bio\Graphics\FeatureFile.pm cp Bio/Map/Microsatellite.pm blib\lib\Bio\Map\Microsatellite.pm cp Bio/LiveSeq/Translation.pm blib\lib\Bio\LiveSeq\Translation.pm cp Bio/Search/Hit/HitI.pm blib\lib\Bio\Search\Hit\HitI.pm cp Bio/DB/SeqI.pm blib\lib\Bio\DB\SeqI.pm cp Bio/Search/Iteration/GenericIteration.pm blib\lib\Bio\Search\Iteration\GenericIteration.pm cp Bio/Index/SwissPfam.pm blib\lib\Bio\Index\SwissPfam.pm cp Bio/DB/GenBank.pm blib\lib\Bio\DB\GenBank.pm cp Bio/Graphics/Glyph/Factory.pm blib\lib\Bio\Graphics\Glyph\Factory.pm cp Bio/Tools/BPlite/HSP.pm blib\lib\Bio\Tools\BPlite\HSP.pm cp Bio/SeqFeature/SiRNA/Oligo.pm blib\lib\Bio\SeqFeature\SiRNA\Oligo.pm cp Bio/Ontology/Path.pm blib\lib\Bio\Ontology\Path.pm cp Bio/Assembly/IO/phrap.pm blib\lib\Bio\Assembly\IO\phrap.pm cp Bio/PopGen/IndividualI.pm blib\lib\Bio\PopGen\IndividualI.pm cp Bio/DB/MeSH.pm blib\lib\Bio\DB\MeSH.pm cp Bio/DB/GFF/Aggregator/coding.pm blib\lib\Bio\DB\GFF\Aggregator\coding.pm cp Bio/Index/EMBL.pm blib\lib\Bio\Index\EMBL.pm cp Bio/SeqFeature/Gene/GeneStructureI.pm blib\lib\Bio\SeqFeature\Gene\GeneStructureI.pm cp Bio/ClusterIO.pm blib\lib\Bio\ClusterIO.pm cp Bio/DB/EMBL.pm blib\lib\Bio\DB\EMBL.pm cp Bio/DB/DBFetch.pm blib\lib\Bio\DB\DBFetch.pm cp Bio/DB/Taxonomy.pm blib\lib\Bio\DB\Taxonomy.pm cp Bio/Tools/Blast/README blib\lib\Bio\Tools\Blast\README cp Bio/Matrix/Scoring.pm blib\lib\Bio\Matrix\Scoring.pm cp Bio/Map/CytoPosition.pm blib\lib\Bio\Map\CytoPosition.pm cp Bio/Seq/Meta.pm blib\lib\Bio\Seq\Meta.pm cp Bio/Tools/SiRNA.pm blib\lib\Bio\Tools\SiRNA.pm cp Bio/Phenotype/Correlate.pm blib\lib\Bio\Phenotype\Correlate.pm cp Bio/Biblio/Ref.pm blib\lib\Bio\Biblio\Ref.pm cp Bio/DB/Query/GenBank.pm blib\lib\Bio\DB\Query\GenBank.pm cp Bio/Search/GenericDatabase.pm blib\lib\Bio\Search\GenericDatabase.pm cp Bio/SeqFeature/Tools/Unflattener.pm blib\lib\Bio\SeqFeature\Tools\Unflattener.pm cp Bio/LiveSeq/Prim_Transcript.pm blib\lib\Bio\LiveSeq\Prim_Transcript.pm cp Bio/Tools/Promoterwise.pm blib\lib\Bio\Tools\Promoterwise.pm cp Bio/Tools/Geneid.pm blib\lib\Bio\Tools\Geneid.pm cp Bio/Root/Version.pm blib\lib\Bio\Root\Version.pm cp Bio/Tree/NodeNHX.pm blib\lib\Bio\Tree\NodeNHX.pm cp Bio/AlignIO/clustalw.pm blib\lib\Bio\AlignIO\clustalw.pm cp Bio/Factory/FTLocationFactory.pm blib\lib\Bio\Factory\FTLocationFactory.pm cp Bio/DB/GFF/Adaptor/dbi/mysql.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\mysql.pm cp Bio/DB/Ace.pm blib\lib\Bio\DB\Ace.pm cp Bio/Align/DNAStatistics.pm blib\lib\Bio\Align\DNAStatistics.pm cp Bio/Coordinate/Utils.pm blib\lib\Bio\Coordinate\Utils.pm cp Bio/Root/Vector.pm blib\lib\Bio\Root\Vector.pm cp Bio/LiveSeq/IO/BioPerl.pm blib\lib\Bio\LiveSeq\IO\BioPerl.pm cp Bio/Variation/IO/flat.pm blib\lib\Bio\Variation\IO\flat.pm cp Bio/SeqIO/chadoxml.pm blib\lib\Bio\SeqIO\chadoxml.pm cp Bio/PopGen/PopStats.pm blib\lib\Bio\PopGen\PopStats.pm cp Bio/Factory/SequenceProcessorI.pm blib\lib\Bio\Factory\SequenceProcessorI.pm cp Bio/Location/AvWithinCoordPolicy.pm blib\lib\Bio\Location\AvWithinCoordPolicy.pm cp Bio/Structure/SecStr/DSSP/Res.pm blib\lib\Bio\Structure\SecStr\DSSP\Res.pm cp Bio/Biblio/TechReport.pm blib\lib\Bio\Biblio\TechReport.pm cp Bio/Graphics/Glyph/translation.pm blib\lib\Bio\Graphics\Glyph\translation.pm cp Bio/SearchIO/SearchResultEventBuilder.pm blib\lib\Bio\SearchIO\SearchResultEventBuilder.pm cp Bio/Location/Simple.pm blib\lib\Bio\Location\Simple.pm cp Bio/SeqIO/gcg.pm blib\lib\Bio\SeqIO\gcg.pm cp Bio/SeqIO/alf.pm blib\lib\Bio\SeqIO\alf.pm cp Bio/SeqI.pm blib\lib\Bio\SeqI.pm cp Bio/Seq/QualI.pm blib\lib\Bio\Seq\QualI.pm cp Bio/Map/LinkagePosition.pm blib\lib\Bio\Map\LinkagePosition.pm cp Bio/Ontology/SimpleGOEngine.pm blib\lib\Bio\Ontology\SimpleGOEngine.pm cp Bio/Cluster/ClusterFactory.pm blib\lib\Bio\Cluster\ClusterFactory.pm cp Bio/PopGen/IO/csv.pm blib\lib\Bio\PopGen\IO\csv.pm cp Bio/SeqFeature/Gene/Poly_A_site.pm blib\lib\Bio\SeqFeature\Gene\Poly_A_site.pm cp Bio/Matrix/PSM/SiteMatrixI.pm blib\lib\Bio\Matrix\PSM\SiteMatrixI.pm cp Bio/SeqFeature/Gene/ExonI.pm blib\lib\Bio\SeqFeature\Gene\ExonI.pm cp Bio/Tools/Hmmpfam.pm blib\lib\Bio\Tools\Hmmpfam.pm cp Bio/Graphics/Glyph/primers.pm blib\lib\Bio\Graphics\Glyph\primers.pm cp Bio/Expression/FeatureGroup.pm blib\lib\Bio\Expression\FeatureGroup.pm cp Bio/DB/GFF/Aggregator/ucsc_genscan.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_genscan.pm cp Bio/Ontology/InterProTerm.pm blib\lib\Bio\Ontology\InterProTerm.pm cp Bio/Graphics/Glyph/heterogeneous_segments.pm blib\lib\Bio\Graphics\Glyph\heterogeneous_segments.pm cp Bio/IdentifiableI.pm blib\lib\Bio\IdentifiableI.pm cp Bio/Graphics/Glyph/crossbox.pm blib\lib\Bio\Graphics\Glyph\crossbox.pm cp Bio/Coordinate/Chain.pm blib\lib\Bio\Coordinate\Chain.pm cp Bio/Tools/Grail.pm blib\lib\Bio\Tools\Grail.pm cp Bio/Tools/Blast/HTML.pm blib\lib\Bio\Tools\Blast\HTML.pm cp Bio/DB/InMemoryCache.pm blib\lib\Bio\DB\InMemoryCache.pm cp Bio/PopGen/GenotypeI.pm blib\lib\Bio\PopGen\GenotypeI.pm cp Bio/DB/GFF/Segment.pm blib\lib\Bio\DB\GFF\Segment.pm cp Bio/Symbol/DNAAlphabet.pm blib\lib\Bio\Symbol\DNAAlphabet.pm cp Bio/OntologyIO/goflat.pm blib\lib\Bio\OntologyIO\goflat.pm cp Bio/DB/FileCache.pm blib\lib\Bio\DB\FileCache.pm cp Bio/Tools/Blast/HSP.pm blib\lib\Bio\Tools\Blast\HSP.pm cp Bio/DB/GFF/Util/Binning.pm blib\lib\Bio\DB\GFF\Util\Binning.pm cp Bio/Biblio/Person.pm blib\lib\Bio\Biblio\Person.pm cp Bio/Map/Marker.pm blib\lib\Bio\Map\Marker.pm cp Bio/Matrix/PSM/PsmHeaderI.pm blib\lib\Bio\Matrix\PSM\PsmHeaderI.pm cp Bio/Tools/CodonTable.pm blib\lib\Bio\Tools\CodonTable.pm cp Bio/SeqIO/bsml.pm blib\lib\Bio\SeqIO\bsml.pm cp Bio/DB/QueryI.pm blib\lib\Bio\DB\QueryI.pm cp Bio/Tools/AlignFactory.pm blib\lib\Bio\Tools\AlignFactory.pm cp Bio/Graphics/Glyph/segments.pm blib\lib\Bio\Graphics\Glyph\segments.pm cp Bio/Seq/SeqWithQuality.pm blib\lib\Bio\Seq\SeqWithQuality.pm cp Bio/Annotation/DBLink.pm blib\lib\Bio\Annotation\DBLink.pm cp Bio/SearchIO/FastHitEventBuilder.pm blib\lib\Bio\SearchIO\FastHitEventBuilder.pm cp Bio/Search/Hit/BlastHit.pm blib\lib\Bio\Search\Hit\BlastHit.pm cp Bio/DB/XEMBL.pm blib\lib\Bio\DB\XEMBL.pm cp Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm cp Bio/Graphics/Glyph/redgreen_segment.pm blib\lib\Bio\Graphics\Glyph\redgreen_segment.pm cp Bio/SearchIO/blast.pm blib\lib\Bio\SearchIO\blast.pm cp Bio/DB/GFF/Adaptor/biofetch_oracle.pm blib\lib\Bio\DB\GFF\Adaptor\biofetch_oracle.pm cp Bio/Species.pm blib\lib\Bio\Species.pm cp Bio/Tools/Primer/AssessorI.pm blib\lib\Bio\Tools\Primer\AssessorI.pm cp Bio/Seq/RichSeqI.pm blib\lib\Bio\Seq\RichSeqI.pm cp Bio/Tools/Prediction/Exon.pm blib\lib\Bio\Tools\Prediction\Exon.pm cp Bio/SearchIO/Writer/HitTableWriter.pm blib\lib\Bio\SearchIO\Writer\HitTableWriter.pm cp Bio/SearchIO/EventHandlerI.pm blib\lib\Bio\SearchIO\EventHandlerI.pm cp Bio/Variation/AAReverseMutate.pm blib\lib\Bio\Variation\AAReverseMutate.pm cp Bio/Tools/Prediction/Gene.pm blib\lib\Bio\Tools\Prediction\Gene.pm cp Bio/SeqFeature/Primer.pm blib\lib\Bio\SeqFeature\Primer.pm cp Bio/Search/SearchUtils.pm blib\lib\Bio\Search\SearchUtils.pm cp Bio/Biblio/WebResource.pm blib\lib\Bio\Biblio\WebResource.pm cp Bio/AlignIO/fasta.pm blib\lib\Bio\AlignIO\fasta.pm cp Bio/Tools/Phylo/Molphy.pm blib\lib\Bio\Tools\Phylo\Molphy.pm cp Bio/Search/Hit/HMMERHit.pm blib\lib\Bio\Search\Hit\HMMERHit.pm cp Bio/Tools/Run/StandAloneBlast.pm blib\lib\Bio\Tools\Run\StandAloneBlast.pm cp Bio/Tools/MZEF.pm blib\lib\Bio\Tools\MZEF.pm cp Bio/Root/Err.pm blib\lib\Bio\Root\Err.pm cp Bio/SearchIO/Writer/ResultTableWriter.pm blib\lib\Bio\SearchIO\Writer\ResultTableWriter.pm cp Bio/Tools/Primer/Feature.pm blib\lib\Bio\Tools\Primer\Feature.pm cp Bio/Ontology/RelationshipFactory.pm blib\lib\Bio\Ontology\RelationshipFactory.pm cp Bio/DB/GFF/Adaptor/biofetch.pm blib\lib\Bio\DB\GFF\Adaptor\biofetch.pm cp Bio/Tools/Est2Genome.pm blib\lib\Bio\Tools\Est2Genome.pm cp Bio/Search/HSP/HMMERHSP.pm blib\lib\Bio\Search\HSP\HMMERHSP.pm cp Bio/Variation/DNAMutation.pm blib\lib\Bio\Variation\DNAMutation.pm cp Bio/Factory/MapFactoryI.pm blib\lib\Bio\Factory\MapFactoryI.pm cp Bio/Symbol/README.Symbol blib\lib\Bio\Symbol\README.Symbol cp Bio/Tree/Tree.pm blib\lib\Bio\Tree\Tree.pm cp Bio/Tools/EMBOSS/Palindrome.pm blib\lib\Bio\Tools\EMBOSS\Palindrome.pm cp Bio/Structure/IO.pm blib\lib\Bio\Structure\IO.pm cp Bio/SeqIO/game/gameWriter.pm blib\lib\Bio\SeqIO\game\gameWriter.pm cp bioperl.pod blib\lib\bioperl.pod cp Bio/Variation/SNP.pm blib\lib\Bio\Variation\SNP.pm cp Bio/Factory/AnalysisI.pm blib\lib\Bio\Factory\AnalysisI.pm cp Bio/SearchIO/SearchWriterI.pm blib\lib\Bio\SearchIO\SearchWriterI.pm cp Bio/SeqFeature/Gene/Promoter.pm blib\lib\Bio\SeqFeature\Gene\Promoter.pm cp Bio/SeqFeature/FeaturePair.pm blib\lib\Bio\SeqFeature\FeaturePair.pm cp Bio/Graphics/Glyph/transcript2.pm blib\lib\Bio\Graphics\Glyph\transcript2.pm cp Bio/Location/Split.pm blib\lib\Bio\Location\Split.pm cp Bio/SeqIO/exp.pm blib\lib\Bio\SeqIO\exp.pm cp Bio/Cluster/SequenceFamily.pm blib\lib\Bio\Cluster\SequenceFamily.pm cp Bio/SeqIO/swiss.pm blib\lib\Bio\SeqIO\swiss.pm cp Bio/Tools/Analysis/DNA/ESEfinder.pm blib\lib\Bio\Tools\Analysis\DNA\ESEfinder.pm cp Bio/DB/Makefile.PL blib\lib\Bio\DB\Makefile.PL cp Bio/ClusterIO/unigene.pm blib\lib\Bio\ClusterIO\unigene.pm cp Bio/DB/XEMBLService.pm blib\lib\Bio\DB\XEMBLService.pm cp Bio/Tools/PrositeScan.pm blib\lib\Bio\Tools\PrositeScan.pm cp Bio/Annotation/StructuredValue.pm blib\lib\Bio\Annotation\StructuredValue.pm cp Bio/DB/Flat/BinarySearch.pm blib\lib\Bio\DB\Flat\BinarySearch.pm cp Bio/Tools/FootPrinter.pm blib\lib\Bio\Tools\FootPrinter.pm cp Bio/SeqIO/FTHelper.pm blib\lib\Bio\SeqIO\FTHelper.pm cp Bio/Graphics/Glyph/dot.pm blib\lib\Bio\Graphics\Glyph\dot.pm cp Bio/Tools/Coil.pm blib\lib\Bio\Tools\Coil.pm cp Bio/Restriction/Enzyme/MultiSite.pm blib\lib\Bio\Restriction\Enzyme\MultiSite.pm cp Bio/Root/IO.pm blib\lib\Bio\Root\IO.pm cp Bio/Coordinate/Collection.pm blib\lib\Bio\Coordinate\Collection.pm cp Bio/Graphics/Glyph/transcript.pm blib\lib\Bio\Graphics\Glyph\transcript.pm cp Bio/Biblio/IO/pubmedxml.pm blib\lib\Bio\Biblio\IO\pubmedxml.pm cp Bio/Search/Result/GenericResult.pm blib\lib\Bio\Search\Result\GenericResult.pm cp Bio/Matrix/PSM/IO/mast.pm blib\lib\Bio\Matrix\PSM\IO\mast.pm cp Bio/Biblio/MedlineBook.pm blib\lib\Bio\Biblio\MedlineBook.pm cp Bio/Ontology/GOterm.pm blib\lib\Bio\Ontology\GOterm.pm cp Bio/Symbol/Symbol.pm blib\lib\Bio\Symbol\Symbol.pm cp Bio/DB/GFF/Featname.pm blib\lib\Bio\DB\GFF\Featname.pm cp Bio/Symbol/Alphabet.pm blib\lib\Bio\Symbol\Alphabet.pm cp Bio/Graphics/Glyph/xyplot.pm blib\lib\Bio\Graphics\Glyph\xyplot.pm cp Bio/LocatableSeq.pm blib\lib\Bio\LocatableSeq.pm cp Bio/DB/CUTG.pm blib\lib\Bio\DB\CUTG.pm cp Bio/Matrix/IO/scoring.pm blib\lib\Bio\Matrix\IO\scoring.pm cp Bio/Factory/ObjectBuilderI.pm blib\lib\Bio\Factory\ObjectBuilderI.pm cp Bio/DB/Universal.pm blib\lib\Bio\DB\Universal.pm cp Bio/SeqIO/ztr.pm blib\lib\Bio\SeqIO\ztr.pm cp Bio/Structure/Entry.pm blib\lib\Bio\Structure\Entry.pm cp Bio/Tools/OddCodes.pm blib\lib\Bio\Tools\OddCodes.pm cp Bio/Matrix/PSM/IO/meme.pm blib\lib\Bio\Matrix\PSM\IO\meme.pm cp Bio/Biblio/JournalArticle.pm blib\lib\Bio\Biblio\JournalArticle.pm cp Bio/Coordinate/Pair.pm blib\lib\Bio\Coordinate\Pair.pm cp Bio/DB/GFF/Aggregator/processed_transcript.pm blib\lib\Bio\DB\GFF\Aggregator\processed_transcript.pm cp Bio/Tools/Lucy.pm blib\lib\Bio\Tools\Lucy.pm cp Bio/Index/Fasta.pm blib\lib\Bio\Index\Fasta.pm cp Bio/Align/StatisticsI.pm blib\lib\Bio\Align\StatisticsI.pm cp Bio/SeqFeature/PositionProxy.pm blib\lib\Bio\SeqFeature\PositionProxy.pm cp Bio/Tools/SeqAnal.pm blib\lib\Bio\Tools\SeqAnal.pm cp Bio/LiveSeq/IO/README blib\lib\Bio\LiveSeq\IO\README cp Bio/DB/GFF/Adaptor/ace.pm blib\lib\Bio\DB\GFF\Adaptor\ace.pm cp Bio/Structure/SecStr/STRIDE/Res.pm blib\lib\Bio\Structure\SecStr\STRIDE\Res.pm cp Bio/Biblio/MedlineBookArticle.pm blib\lib\Bio\Biblio\MedlineBookArticle.pm cp Bio/Coordinate/ResultI.pm blib\lib\Bio\Coordinate\ResultI.pm cp Bio/Tools/Primer/Pair.pm blib\lib\Bio\Tools\Primer\Pair.pm cp Bio/PopGen/Statistics.pm blib\lib\Bio\PopGen\Statistics.pm cp Bio/Tools/Analysis/SimpleAnalysisBase.pm blib\lib\Bio\Tools\Analysis\SimpleAnalysisBase.pm cp Bio/Tools/Analysis/Protein/NetPhos.pm blib\lib\Bio\Tools\Analysis\Protein\NetPhos.pm cp Bio/Tools/Analysis/Protein/Scansite.pm blib\lib\Bio\Tools\Analysis\Protein\Scansite.pm cp Bio/Graphics/Glyph/arrow.pm blib\lib\Bio\Graphics\Glyph\arrow.pm cp Bio/DB/Flat/BDB/swissprot.pm blib\lib\Bio\DB\Flat\BDB\swissprot.pm cp Bio/Graphics/Panel.pm blib\lib\Bio\Graphics\Panel.pm cp Bio/ClusterI.pm blib\lib\Bio\ClusterI.pm cp Bio/SeqFeature/CollectionI.pm blib\lib\Bio\SeqFeature\CollectionI.pm cp Bio/Biblio/MedlineArticle.pm blib\lib\Bio\Biblio\MedlineArticle.pm cp Bio/Phenotype/PhenotypeI.pm blib\lib\Bio\Phenotype\PhenotypeI.pm cp Bio/AlignIO/metafasta.pm blib\lib\Bio\AlignIO\metafasta.pm cp Bio/Taxonomy/Taxon.pm blib\lib\Bio\Taxonomy\Taxon.pm cp Bio/Seq/LargeSeq.pm blib\lib\Bio\Seq\LargeSeq.pm cp Bio/DB/GDB.pm blib\lib\Bio\DB\GDB.pm cp Bio/Tools/Profile.pm blib\lib\Bio\Tools\Profile.pm cp Bio/Graphics/Glyph/ruler_arrow.pm blib\lib\Bio\Graphics\Glyph\ruler_arrow.pm cp Bio/Tools/Genemark.pm blib\lib\Bio\Tools\Genemark.pm cp Bio/Biblio/Patent.pm blib\lib\Bio\Biblio\Patent.pm cp Bio/Matrix/IO.pm blib\lib\Bio\Matrix\IO.pm cp Bio/DB/GFF/Aggregator.pm blib\lib\Bio\DB\GFF\Aggregator.pm cp Bio/Seq/RichSeq.pm blib\lib\Bio\Seq\RichSeq.pm cp Bio/SeqFeature/SiRNA/Pair.pm blib\lib\Bio\SeqFeature\SiRNA\Pair.pm cp Bio/DB/GFF.pm blib\lib\Bio\DB\GFF.pm cp Bio/Tools/BPpsilite.pm blib\lib\Bio\Tools\BPpsilite.pm cp Bio/Graphics/Glyph/track.pm blib\lib\Bio\Graphics\Glyph\track.pm cp Bio/PopGen/Simulation/GeneticDrift.pm blib\lib\Bio\PopGen\Simulation\GeneticDrift.pm cp Bio/Factory/ResultFactoryI.pm blib\lib\Bio\Factory\ResultFactoryI.pm cp Bio/Seq/MetaI.pm blib\lib\Bio\Seq\MetaI.pm cp Bio/SeqFeature/Computation.pm blib\lib\Bio\SeqFeature\Computation.pm cp Bio/Seq/EncodedSeq.pm blib\lib\Bio\Seq\EncodedSeq.pm cp Bio/Tools/Analysis/Protein/Domcut.pm blib\lib\Bio\Tools\Analysis\Protein\Domcut.pm cp Bio/Variation/README blib\lib\Bio\Variation\README cp Bio/DB/Registry.pm blib\lib\Bio\DB\Registry.pm cp bioscripts.pod blib\lib\bioscripts.pod cp Bio/Variation/VariantI.pm blib\lib\Bio\Variation\VariantI.pm cp Bio/Tools/Glimmer.pm blib\lib\Bio\Tools\Glimmer.pm cp Bio/Factory/SequenceFactoryI.pm blib\lib\Bio\Factory\SequenceFactoryI.pm cp Bio/Graphics/Glyph/line.pm blib\lib\Bio\Graphics\Glyph\line.pm cp Bio/Root/Utilities.pm blib\lib\Bio\Root\Utilities.pm cp Bio/Search/Hit/GenericHit.pm blib\lib\Bio\Search\Hit\GenericHit.pm cp Bio/Tools/RestrictionEnzyme.pm blib\lib\Bio\Tools\RestrictionEnzyme.pm cp Bio/Map/LinkageMap.pm blib\lib\Bio\Map\LinkageMap.pm cp Bio/AlignIO/stockholm.pm blib\lib\Bio\AlignIO\stockholm.pm cp Bio/OntologyIO/Handlers/InterProHandler.pm blib\lib\Bio\OntologyIO\Handlers\InterProHandler.pm cp Bio/DB/GFF/Adaptor/dbi/mysqlace.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlace.pm cp Bio/PopGen/Individual.pm blib\lib\Bio\PopGen\Individual.pm cp Bio/Graphics/Glyph/splice_site.pm blib\lib\Bio\Graphics\Glyph\splice_site.pm cp Bio/DasI.pm blib\lib\Bio\DasI.pm cp Bio/Tools/Analysis/Protein/Mitoprot.pm blib\lib\Bio\Tools\Analysis\Protein\Mitoprot.pm cp Bio/OntologyIO/simplehierarchy.pm blib\lib\Bio\OntologyIO\simplehierarchy.pm cp Bio/Assembly/Scaffold.pm blib\lib\Bio\Assembly\Scaffold.pm cp Bio/Assembly/Contig.pm blib\lib\Bio\Assembly\Contig.pm cp Bio/SeqUtils.pm blib\lib\Bio\SeqUtils.pm cp Bio/TreeIO/nhx.pm blib\lib\Bio\TreeIO\nhx.pm cp Bio/Structure/Residue.pm blib\lib\Bio\Structure\Residue.pm cp Bio/DB/GFF/Adaptor/dbi/iterator.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\iterator.pm cp Bio/Tools/Sim4/Results.pm blib\lib\Bio\Tools\Sim4\Results.pm cp Bio/OntologyIO/Handlers/BaseSAXHandler.pm blib\lib\Bio\OntologyIO\Handlers\BaseSAXHandler.pm cp Bio/Variation/AAChange.pm blib\lib\Bio\Variation\AAChange.pm cp Bio/Index/Fastq.pm blib\lib\Bio\Index\Fastq.pm cp Bio/SearchIO/Writer/TextResultWriter.pm blib\lib\Bio\SearchIO\Writer\TextResultWriter.pm cp Bio/Range.pm blib\lib\Bio\Range.pm cp Bio/OntologyIO/dagflat.pm blib\lib\Bio\OntologyIO\dagflat.pm cp Bio/SeqIO/pir.pm blib\lib\Bio\SeqIO\pir.pm cp Bio/Factory/SequenceStreamI.pm blib\lib\Bio\Factory\SequenceStreamI.pm cp Bio/ClusterIO/dbsnp.pm blib\lib\Bio\ClusterIO\dbsnp.pm cp Bio/SearchIO/IteratedSearchResultEventBuilder.pm blib\lib\Bio\SearchIO\IteratedSearchResultEventBuilder.pm cp Bio/Root/Xref.pm blib\lib\Bio\Root\Xref.pm cp Bio/AlignIO/meme.pm blib\lib\Bio\AlignIO\meme.pm cp Bio/Tools/Run/WrapperBase.pm blib\lib\Bio\Tools\Run\WrapperBase.pm cp Bio/Map/MapI.pm blib\lib\Bio\Map\MapI.pm cp Bio/PopGen/Marker.pm blib\lib\Bio\PopGen\Marker.pm cp Bio/Location/WidestCoordPolicy.pm blib\lib\Bio\Location\WidestCoordPolicy.pm cp Bio/Tools/Genomewise.pm blib\lib\Bio\Tools\Genomewise.pm cp Bio/Annotation/Comment.pm blib\lib\Bio\Annotation\Comment.pm cp Bio/Matrix/PhylipDist.pm blib\lib\Bio\Matrix\PhylipDist.pm cp Bio/Tools/BPlite.pm blib\lib\Bio\Tools\BPlite.pm cp Bio/Biblio/PubmedArticle.pm blib\lib\Bio\Biblio\PubmedArticle.pm cp Bio/Symbol/ProteinAlphabet.pm blib\lib\Bio\Symbol\ProteinAlphabet.pm cp Bio/Tools/Genewise.pm blib\lib\Bio\Tools\Genewise.pm cp Bio/Search/HSP/HSPI.pm blib\lib\Bio\Search\HSP\HSPI.pm cp Bio/Perl.pm blib\lib\Bio\Perl.pm cp Bio/LiveSeq/Exon.pm blib\lib\Bio\LiveSeq\Exon.pm cp Bio/SeqIO/game/gameHandler.pm blib\lib\Bio\SeqIO\game\gameHandler.pm cp Bio/LiveSeq/Chain.pm blib\lib\Bio\LiveSeq\Chain.pm cp Bio/Map/CytoMarker.pm blib\lib\Bio\Map\CytoMarker.pm cp Bio/AlignIO/selex.pm blib\lib\Bio\AlignIO\selex.pm cp Bio/SeqFeature/Gene/UTR.pm blib\lib\Bio\SeqFeature\Gene\UTR.pm cp Bio/Seq/SeqBuilder.pm blib\lib\Bio\Seq\SeqBuilder.pm cp Bio/Biblio/Service.pm blib\lib\Bio\Biblio\Service.pm cp Bio/Biblio/MedlineJournal.pm blib\lib\Bio\Biblio\MedlineJournal.pm cp Bio/DB/Flat/BDB/embl.pm blib\lib\Bio\DB\Flat\BDB\embl.pm cp Bio/Search/HSP/BlastHSP.pm blib\lib\Bio\Search\HSP\BlastHSP.pm cp Bio/LiveSeq/Mutator.pm blib\lib\Bio\LiveSeq\Mutator.pm cp Bio/Tools/Eponine.pm blib\lib\Bio\Tools\Eponine.pm cp Bio/SeqFeature/Gene/Intron.pm blib\lib\Bio\SeqFeature\Gene\Intron.pm cp Bio/DB/GFF/RelSegment.pm blib\lib\Bio\DB\GFF\RelSegment.pm cp Bio/Phenotype/Measure.pm blib\lib\Bio\Phenotype\Measure.pm cp Bio/DB/GFF/Aggregator/ucsc_ensgene.pm blib\lib\Bio\DB\GFF\Aggregator\ucsc_ensgene.pm cp Bio/Annotation/TypeManager.pm blib\lib\Bio\Annotation\TypeManager.pm cp Bio/Map/OrderedPosition.pm blib\lib\Bio\Map\OrderedPosition.pm cp Bio/SeqIO/MultiFile.pm blib\lib\Bio\SeqIO\MultiFile.pm cp Bio/Tools/Tmhmm.pm blib\lib\Bio\Tools\Tmhmm.pm cp Bio/Factory/SeqAnalysisParserFactory.pm blib\lib\Bio\Factory\SeqAnalysisParserFactory.pm cp Bio/DB/GenPept.pm blib\lib\Bio\DB\GenPept.pm cp Bio/SeqIO/game/featHandler.pm blib\lib\Bio\SeqIO\game\featHandler.pm cp Bio/Index/Blast.pm blib\lib\Bio\Index\Blast.pm cp Bio/Search/DatabaseI.pm blib\lib\Bio\Search\DatabaseI.pm cp Bio/Tools/Blat.pm blib\lib\Bio\Tools\Blat.pm cp Bio/Graphics/Glyph.pm blib\lib\Bio\Graphics\Glyph.pm cp Bio/Symbol/SymbolI.pm blib\lib\Bio\Symbol\SymbolI.pm cp Bio/Tools/EPCR.pm blib\lib\Bio\Tools\EPCR.pm cp Bio/Tools/pSW.pm blib\lib\Bio\Tools\pSW.pm cp Bio/Location/NarrowestCoordPolicy.pm blib\lib\Bio\Location\NarrowestCoordPolicy.pm cp Bio/AnnotatableI.pm blib\lib\Bio\AnnotatableI.pm cp Bio/Biblio/Proceeding.pm blib\lib\Bio\Biblio\Proceeding.pm cp Bio/TreeIO/newick.pm blib\lib\Bio\TreeIO\newick.pm cp Bio/SeqFeature/Gene/GeneStructure.pm blib\lib\Bio\SeqFeature\Gene\GeneStructure.pm cp Bio/Biblio/Book.pm blib\lib\Bio\Biblio\Book.pm cp Bio/SearchIO/Writer/HTMLResultWriter.pm blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm cp Bio/Tree/Statistics.pm blib\lib\Bio\Tree\Statistics.pm cp Bio/Tools/BPlite/Iteration.pm blib\lib\Bio\Tools\BPlite\Iteration.pm cp Bio/Align/PairwiseStatistics.pm blib\lib\Bio\Align\PairwiseStatistics.pm cp Bio/Assembly/IO.pm blib\lib\Bio\Assembly\IO.pm cp Bio/Ontology/TermFactory.pm blib\lib\Bio\Ontology\TermFactory.pm cp Bio/Tools/SeqWords.pm blib\lib\Bio\Tools\SeqWords.pm cp Bio/DB/GFF/Adaptor/dbi/oracleace.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\oracleace.pm cp Bio/Expression/FeatureI.pm blib\lib\Bio\Expression\FeatureI.pm cp Bio/Map/OrderedPositionWithDistance.pm blib\lib\Bio\Map\OrderedPositionWithDistance.pm cp Bio/Biblio/IO/pubmed2ref.pm blib\lib\Bio\Biblio\IO\pubmed2ref.pm cp Bio/SeqIO/game.pm blib\lib\Bio\SeqIO\game.pm cp Bio/Index/Abstract.pm blib\lib\Bio\Index\Abstract.pm cp Bio/SearchIO/blastxml.pm blib\lib\Bio\SearchIO\blastxml.pm cp Bio/Search/Iteration/IterationI.pm blib\lib\Bio\Search\Iteration\IterationI.pm cp Bio/Tools/HMMER/Domain.pm blib\lib\Bio\Tools\HMMER\Domain.pm cp Bio/DB/GFF/Adaptor/dbi/oracle.pm blib\lib\Bio\DB\GFF\Adaptor\dbi\oracle.pm cp Bio/Coordinate/GeneMapper.pm blib\lib\Bio\Coordinate\GeneMapper.pm cp Bio/Biblio/IO/medlinexml.pm blib\lib\Bio\Biblio\IO\medlinexml.pm cp Bio/Location/FuzzyLocationI.pm blib\lib\Bio\Location\FuzzyLocationI.pm cp Bio/SeqIO/ace.pm blib\lib\Bio\SeqIO\ace.pm cp Bio/Search/Hit/Fasta.pm blib\lib\Bio\Search\Hit\Fasta.pm cp Bio/Graphics/Glyph/span.pm blib\lib\Bio\Graphics\Glyph\span.pm cp Bio/Root/Exception.pm blib\lib\Bio\Root\Exception.pm cp Bio/DB/Biblio/soap.pm blib\lib\Bio\DB\Biblio\soap.pm cp Bio/Factory/TreeFactoryI.pm blib\lib\Bio\Factory\TreeFactoryI.pm cp Bio/Root/Object.pm blib\lib\Bio\Root\Object.pm cp Bio/SeqIO/tab.pm blib\lib\Bio\SeqIO\tab.pm cp Bio/Assembly/IO/ace.pm blib\lib\Bio\Assembly\IO\ace.pm C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_heterogeneity_test.pl blib\script\bp_heterogeneity_test.pl pl2bat.bat blib\script\bp_heterogeneity_test.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_biogetseq.pl blib\script\bp_biogetseq.pl pl2bat.bat blib\script\bp_biogetseq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_biblio.pl blib\script\bp_biblio.pl pl2bat.bat blib\script\bp_biblio.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_extract_feature_seq.pl blib\script\bp_extract_feature_seq.pl pl2bat.bat blib\script\bp_extract_feature_seq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_gadfly.pl blib\script\bp_process_gadfly.pl pl2bat.bat blib\script\bp_process_gadfly.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_aacomp.pl blib\script\bp_aacomp.pl pl2bat.bat blib\script\bp_aacomp.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_nrdb.pl blib\script\bp_nrdb.pl pl2bat.bat blib\script\bp_nrdb.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_mrtrans.pl blib\script\bp_mrtrans.pl pl2bat.bat blib\script\bp_mrtrans.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_load_gff.pl blib\script\bp_load_gff.pl pl2bat.bat blib\script\bp_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_sgd.pl blib\script\bp_process_sgd.pl pl2bat.bat blib\script\bp_process_sgd.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_gccalc.pl blib\script\bp_gccalc.pl pl2bat.bat blib\script\bp_gccalc.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_feature_draw.pl blib\script\bp_feature_draw.pl pl2bat.bat blib\script\bp_feature_draw.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_sreformat.pl blib\script\bp_sreformat.pl pl2bat.bat blib\script\bp_sreformat.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_oligo_count.pl blib\script\bp_oligo_count.pl pl2bat.bat blib\script\bp_oligo_count.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_translate_seq.pl blib\script\bp_translate_seq.pl pl2bat.bat blib\script\bp_translate_seq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_flanks.pl blib\script\bp_flanks.pl pl2bat.bat blib\script\bp_flanks.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_index.pl blib\script\bp_index.pl pl2bat.bat blib\script\bp_index.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_seq_length.pl blib\script\bp_seq_length.pl pl2bat.bat blib\script\bp_seq_length.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2alnblocks.pl blib\script\bp_search2alnblocks.pl pl2bat.bat blib\script\bp_search2alnblocks.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2tribe.pl blib\script\bp_search2tribe.pl pl2bat.bat blib\script\bp_search2tribe.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_generate_histogram.pl blib\script\bp_generate_histogram.pl pl2bat.bat blib\script\bp_generate_histogram.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_dbsplit.pl blib\script\bp_dbsplit.pl pl2bat.bat blib\script\bp_dbsplit.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_composite_LD.pl blib\script\bp_composite_LD.pl pl2bat.bat blib\script\bp_composite_LD.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_filter_search.pl blib\script\bp_filter_search.pl pl2bat.bat blib\script\bp_filter_search.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_mutate.pl blib\script\bp_mutate.pl pl2bat.bat blib\script\bp_mutate.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_bioflat_index.pl blib\script\bp_bioflat_index.pl pl2bat.bat blib\script\bp_bioflat_index.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_seqconvert.pl blib\script\bp_seqconvert.pl pl2bat.bat blib\script\bp_seqconvert.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_local_taxonomydb_query.pl blib\script\bp_local_taxonomydb_query.pl pl2bat.bat blib\script\bp_local_taxonomydb_query.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_ncbi_human.pl blib\script\bp_process_ncbi_human.pl pl2bat.bat blib\script\bp_process_ncbi_human.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_fetch.pl blib\script\bp_fetch.pl pl2bat.bat blib\script\bp_fetch.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2gff.pl blib\script\bp_search2gff.pl pl2bat.bat blib\script\bp_search2gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_wormbase.pl blib\script\bp_process_wormbase.pl pl2bat.bat blib\script\bp_process_wormbase.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_fast_load_gff.pl blib\script\bp_fast_load_gff.pl pl2bat.bat blib\script\bp_fast_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_split_seq.pl blib\script\bp_split_seq.pl pl2bat.bat blib\script\bp_split_seq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_bulk_load_gff.pl blib\script\bp_bulk_load_gff.pl pl2bat.bat blib\script\bp_bulk_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_pg_bulk_load_gff.pl blib\script\bp_pg_bulk_load_gff.pl pl2bat.bat blib\script\bp_pg_bulk_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_blast2tree.pl blib\script\bp_blast2tree.pl pl2bat.bat blib\script\bp_blast2tree.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_chaos_plot.pl blib\script\bp_chaos_plot.pl pl2bat.bat blib\script\bp_chaos_plot.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2BSML.pl blib\script\bp_search2BSML.pl pl2bat.bat blib\script\bp_search2BSML.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_remote_blast.pl blib\script\bp_remote_blast.pl pl2bat.bat blib\script\bp_remote_blast.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_frend.pl blib\script\bp_frend.pl pl2bat.bat blib\script\bp_frend.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_mask_by_search.pl blib\script\bp_mask_by_search.pl pl2bat.bat blib\script\bp_mask_by_search.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search_overview.pl blib\script\bp_search_overview.pl pl2bat.bat blib\script\bp_search_overview.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_genbank2gff.pl blib\script\bp_genbank2gff.pl pl2bat.bat blib\script\bp_genbank2gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_pairwise_kaks.pl blib\script\bp_pairwise_kaks.pl pl2bat.bat blib\script\bp_pairwise_kaks.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_biofetch_genbank_proxy.pl blib\script\bp_biofetch_genbank_proxy.pl pl2bat.bat blib\script\bp_biofetch_genbank_proxy.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_taxid4species.pl blib\script\bp_taxid4species.pl pl2bat.bat blib\script\bp_taxid4species.pl BIRNEY/bioperl-1.4.tar.gz nmake -- OK Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_heterogeneity_test.pl blib\script\bp_heterogeneity_test.pl pl2bat.bat blib\script\bp_heterogeneity_test.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_biogetseq.pl blib\script\bp_biogetseq.pl pl2bat.bat blib\script\bp_biogetseq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_biblio.pl blib\script\bp_biblio.pl pl2bat.bat blib\script\bp_biblio.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_extract_feature_seq.pl blib\script\bp_extract_feature_seq.pl pl2bat.bat blib\script\bp_extract_feature_seq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_gadfly.pl blib\script\bp_process_gadfly.pl pl2bat.bat blib\script\bp_process_gadfly.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_aacomp.pl blib\script\bp_aacomp.pl pl2bat.bat blib\script\bp_aacomp.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_nrdb.pl blib\script\bp_nrdb.pl pl2bat.bat blib\script\bp_nrdb.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_mrtrans.pl blib\script\bp_mrtrans.pl pl2bat.bat blib\script\bp_mrtrans.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_load_gff.pl blib\script\bp_load_gff.pl pl2bat.bat blib\script\bp_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_sgd.pl blib\script\bp_process_sgd.pl pl2bat.bat blib\script\bp_process_sgd.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_gccalc.pl blib\script\bp_gccalc.pl pl2bat.bat blib\script\bp_gccalc.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_feature_draw.pl blib\script\bp_feature_draw.pl pl2bat.bat blib\script\bp_feature_draw.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_sreformat.pl blib\script\bp_sreformat.pl pl2bat.bat blib\script\bp_sreformat.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_oligo_count.pl blib\script\bp_oligo_count.pl pl2bat.bat blib\script\bp_oligo_count.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_translate_seq.pl blib\script\bp_translate_seq.pl pl2bat.bat blib\script\bp_translate_seq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_flanks.pl blib\script\bp_flanks.pl pl2bat.bat blib\script\bp_flanks.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_index.pl blib\script\bp_index.pl pl2bat.bat blib\script\bp_index.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_seq_length.pl blib\script\bp_seq_length.pl pl2bat.bat blib\script\bp_seq_length.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2alnblocks.pl blib\script\bp_search2alnblocks.pl pl2bat.bat blib\script\bp_search2alnblocks.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2tribe.pl blib\script\bp_search2tribe.pl pl2bat.bat blib\script\bp_search2tribe.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_generate_histogram.pl blib\script\bp_generate_histogram.pl pl2bat.bat blib\script\bp_generate_histogram.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_dbsplit.pl blib\script\bp_dbsplit.pl pl2bat.bat blib\script\bp_dbsplit.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_composite_LD.pl blib\script\bp_composite_LD.pl pl2bat.bat blib\script\bp_composite_LD.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_filter_search.pl blib\script\bp_filter_search.pl pl2bat.bat blib\script\bp_filter_search.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_mutate.pl blib\script\bp_mutate.pl pl2bat.bat blib\script\bp_mutate.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_bioflat_index.pl blib\script\bp_bioflat_index.pl pl2bat.bat blib\script\bp_bioflat_index.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_seqconvert.pl blib\script\bp_seqconvert.pl pl2bat.bat blib\script\bp_seqconvert.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_local_taxonomydb_query.pl blib\script\bp_local_taxonomydb_query.pl pl2bat.bat blib\script\bp_local_taxonomydb_query.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_ncbi_human.pl blib\script\bp_process_ncbi_human.pl pl2bat.bat blib\script\bp_process_ncbi_human.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_fetch.pl blib\script\bp_fetch.pl pl2bat.bat blib\script\bp_fetch.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2gff.pl blib\script\bp_search2gff.pl pl2bat.bat blib\script\bp_search2gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_process_wormbase.pl blib\script\bp_process_wormbase.pl pl2bat.bat blib\script\bp_process_wormbase.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_fast_load_gff.pl blib\script\bp_fast_load_gff.pl pl2bat.bat blib\script\bp_fast_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_split_seq.pl blib\script\bp_split_seq.pl pl2bat.bat blib\script\bp_split_seq.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_bulk_load_gff.pl blib\script\bp_bulk_load_gff.pl pl2bat.bat blib\script\bp_bulk_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_pg_bulk_load_gff.pl blib\script\bp_pg_bulk_load_gff.pl pl2bat.bat blib\script\bp_pg_bulk_load_gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_blast2tree.pl blib\script\bp_blast2tree.pl pl2bat.bat blib\script\bp_blast2tree.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_chaos_plot.pl blib\script\bp_chaos_plot.pl pl2bat.bat blib\script\bp_chaos_plot.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search2BSML.pl blib\script\bp_search2BSML.pl pl2bat.bat blib\script\bp_search2BSML.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_remote_blast.pl blib\script\bp_remote_blast.pl pl2bat.bat blib\script\bp_remote_blast.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_frend.pl blib\script\bp_frend.pl pl2bat.bat blib\script\bp_frend.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_mask_by_search.pl blib\script\bp_mask_by_search.pl pl2bat.bat blib\script\bp_mask_by_search.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_search_overview.pl blib\script\bp_search_overview.pl pl2bat.bat blib\script\bp_search_overview.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_genbank2gff.pl blib\script\bp_genbank2gff.pl pl2bat.bat blib\script\bp_genbank2gff.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_pairwise_kaks.pl blib\script\bp_pairwise_kaks.pl pl2bat.bat blib\script\bp_pairwise_kaks.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_biofetch_genbank_proxy.pl blib\script\bp_biofetch_genbank_proxy.pl pl2bat.bat blib\script\bp_biofetch_genbank_proxy.pl C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- ./scripts_temp/bp_taxid4species.pl blib\script\bp_taxid4species.pl pl2bat.bat blib\script\bp_taxid4species.pl C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/AAChange.t ................. 1..25 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok t/AAReverseMutate.t .......... 1..16 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 160, line 88. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 239, line 88. Subroutine algorithm_version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 259, line 88. Subroutine next_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 286, line 88. Subroutine query_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 304, line 88. Subroutine query_accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 324, line 88. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 345, line 88. Subroutine query_description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 366, line 88. Subroutine database_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 388, line 88. Subroutine database_letters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 411, line 88. Subroutine database_entries redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 433, line 88. Subroutine get_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 454, line 88. Subroutine available_parameters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 469, line 88. Subroutine get_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 486, line 88. Subroutine available_statistics redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 501, line 88. Subroutine add_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 520, line 88. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 543, line 88. Subroutine _nexthitindex redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 556, line 88. Subroutine add_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 573, line 88. Subroutine add_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 590, line 88. Subroutine num_hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 608, line 88. Subroutine hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 628, line 88. Subroutine algorithm_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 649, line 88. Subroutine program_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 658, line 88. Subroutine no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 667, line 88. Subroutine set_no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 684, line 88. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 705, line 88. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 116, line 88. Subroutine add_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 175, line 88. Subroutine name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 202, line 88. Subroutine accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 222, line 88. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 242, line 88. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 262, line 88. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 287, line 88. Subroutine raw_score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 309, line 88. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 325, line 88. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 340, line 88. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 371, line 88. Subroutine next_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 399, line 88. Subroutine hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 425, line 88. Subroutine num_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 454, line 88. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 475, line 88. Subroutine ambiguous_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 502, line 88. Subroutine overlap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 516, line 88. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 547, line 88. Subroutine p redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 596, line 88. Subroutine hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 640, line 88. Subroutine logical_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 680, line 88. Subroutine length_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 733, line 88. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 791, line 88. Subroutine matches redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 825, line 88. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 883, line 88. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 941, line 88. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 985, line 88. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1032, line 88. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1092, line 88. Subroutine frac_aligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1141, line 88. Subroutine frac_aligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1177, line 88. Subroutine num_unaligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1226, line 88. Subroutine num_unaligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1258, line 88. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1296, line 88. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1329, line 88. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1387, line 88. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1421, line 88. Subroutine locus redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1437, line 88. Subroutine each_accession_number redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1465, line 88. Subroutine tiled_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1513, line 88. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1530, line 88. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1202, line 88. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 32. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 32. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 32. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 32. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 32. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 32. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 32. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 32. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 32. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 32. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 32. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 32. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 32. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 32. t/AlignIO.t .................. 1..75 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok t/AlignStats.t ............... 1..21 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Allele.t ................... 1..15 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/Alphabet.t ................. 1..90 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/Annotation.t ............... 1..63 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/AnnotationAdaptor.t ........ 1..21 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok DB_File not installed. This means the Assembly modules are not available. Skipping tests. t/Assembly.t ................. 1..13 ok 1 # DB_File not installed ok 2 # DB_File not installed ok 3 # DB_File not installed ok 4 # DB_File not installed ok 5 # DB_File not installed ok 6 # DB_File not installed ok 7 # DB_File not installed ok 8 # DB_File not installed ok 9 # DB_File not installed ok 10 # DB_File not installed ok 11 # DB_File not installed ok 12 # DB_File not installed ok 13 # DB_File not installed ok defined(%hash) is deprecated at C:/cpanfly-5.12/var/megalib/SOAP/Lite.pm line 465. (Maybe you should just omit the defined()?) defined(%hash) is deprecated at C:/cpanfly-5.12/var/megalib/SOAP/Lite.pm line 2203. (Maybe you should just omit the defined()?) t/Biblio.t ................... 1..24 ok 1 ok 2 ok 3 ok 4 Reading and parsing MEDLINE XML file... ok 5 ok 6 ok 7 Getting citations using callback... ok 8 ok 9 ok 10 ok 11 Reading and parsing XML string... ok 12 ok 13 Reading and parsing XML string handle... ok 14 ok 15 ok 16 Reading and parsing PUBMED XML file... ok 17 ok 18 ok 19 ok 20 Testing FH ok 21 ok 22 ok 23 ok 24 ok Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. t/Biblio_biofetch.t .......... 1..11 ok 1 ok 2 # No network access - could not connect to Medline ok 3 # No network access - could not connect to Medline ok 4 # No network access - could not connect to Medline ok 5 # No network access - could not connect to Medline ok 6 # No network access - could not connect to Medline ok 7 # No network access - could not connect to Medline ok 8 # No network access - could not connect to Medline ok 9 # No network access - could not connect to Medline ok 10 # No network access - could not connect to Medline ok 11 # No network access - could not connect to Medline ok t/BiblioReferences.t ......... 1..537 Testing 'use Bio::Biblio:: ...' ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 Testing 'new Bio::Biblio:: ...' ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 Testing Bio::Biblio::MedlineJournalArticle ... ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 Testing Bio::Biblio::MedlineBookArticle ... ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 Testing Bio::Biblio::MedlineBook ... ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 Testing Bio::Biblio::MedlineJournal ... ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 Testing Bio::Biblio::Patent ... ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 Testing Bio::Biblio::WebResource ... ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 Testing Bio::Biblio::Person ... ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 Testing Bio::Biblio::Organisation ... ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 Testing Bio::Biblio::Service ... ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 Testing Bio::Biblio::PubmedJournalArticle ... ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok t/BioDBGFF.t ................. 1..133 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 # fetch_feature_by_gid() not implemented by this adaptor ok 101 # fetch_feature_by_gid() not implemented by this adaptor ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 # delete_groups() not implemented by this adaptor ok 129 # delete_groups() not implemented by this adaptor ok 130 ok 131 ok 132 ok 133 ok Subroutine new redefined at Bio\Location\Simple.pm line 89, line 131. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 131. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 131. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 131. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 131. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 131. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 131. Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, line 43. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, line 43. Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, line 43. Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, line 43. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, line 43. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, line 43. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, line 43. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, line 43. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, line 43. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, line 43. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, line 43. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, line 43. t/BioFetch_DB.t .............. 1..27 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # Test 8 got: 'unknown id' (t/BioFetch_DB.t at line 79) # Expected: 'BUM' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 not ok 20 # Test 20 got: '1611' (t/BioFetch_DB.t at line 116) # Expected: '408' not ok 21 # Test 21 got: '408' (t/BioFetch_DB.t at line 117) # Expected: '1611' ok 22 ok 23 ok 24 ok 25 ok 26 not ok 27 # Test 27 got: '3776' (t/BioFetch_DB.t at line 138) # Expected: '3775' Failed 4/27 subtests t/BioGraphics.t .............. 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 160, line 533. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 239, line 533. Subroutine algorithm_version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 259, line 533. Subroutine next_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 286, line 533. Subroutine query_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 304, line 533. Subroutine query_accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 324, line 533. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 345, line 533. Subroutine query_description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 366, line 533. Subroutine database_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 388, line 533. Subroutine database_letters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 411, line 533. Subroutine database_entries redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 433, line 533. Subroutine get_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 454, line 533. Subroutine available_parameters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 469, line 533. Subroutine get_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 486, line 533. Subroutine available_statistics redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 501, line 533. Subroutine add_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 520, line 533. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 543, line 533. Subroutine _nexthitindex redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 556, line 533. Subroutine add_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 573, line 533. Subroutine add_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 590, line 533. Subroutine num_hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 608, line 533. Subroutine hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 628, line 533. Subroutine algorithm_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 649, line 533. Subroutine program_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 658, line 533. Subroutine no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 667, line 533. Subroutine set_no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 684, line 533. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 705, line 533. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 116, line 533. Subroutine add_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 175, line 533. Subroutine name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 202, line 533. Subroutine accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 222, line 533. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 242, line 533. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 262, line 533. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 287, line 533. Subroutine raw_score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 309, line 533. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 325, line 533. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 340, line 533. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 371, line 533. Subroutine next_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 399, line 533. Subroutine hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 425, line 533. Subroutine num_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 454, line 533. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 475, line 533. Subroutine ambiguous_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 502, line 533. Subroutine overlap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 516, line 533. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 547, line 533. Subroutine p redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 596, line 533. Subroutine hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 640, line 533. Subroutine logical_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 680, line 533. Subroutine length_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 733, line 533. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 791, line 533. Subroutine matches redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 825, line 533. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 883, line 533. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 941, line 533. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 985, line 533. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1032, line 533. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1092, line 533. Subroutine frac_aligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1141, line 533. Subroutine frac_aligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1177, line 533. Subroutine num_unaligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1226, line 533. Subroutine num_unaligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1258, line 533. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1296, line 533. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1329, line 533. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1387, line 533. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1421, line 533. Subroutine locus redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1437, line 533. Subroutine each_accession_number redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1465, line 533. Subroutine tiled_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1513, line 533. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1530, line 533. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1202, line 533. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 58. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 58. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 58. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 58. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 58. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 58. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 58. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 58. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 58. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 58. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 58. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 58. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 58. t/BlastIndex.t ............... 1..13 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 32. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 32. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 32. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 32. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 32. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 32. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 32. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 32. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 32. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 32. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 32. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 32. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 32. t/BPbl2seq.t ................. 1..108 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 165. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 165. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 165. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 165. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 165. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 165. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 165. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 165. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 165. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 165. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 165. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 165. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 165. t/BPlite.t ................... 1..97 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 263. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 263. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 263. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 263. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 263. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 263. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 263. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 263. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 263. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 263. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 263. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 263. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 263. t/BPpsilite.t ................ 1..11 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/Chain.t .................... 1..45 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 160. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 239. Subroutine algorithm_version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 259. Subroutine next_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 286. Subroutine query_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 304. Subroutine query_accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 324. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 345. Subroutine query_description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 366. Subroutine database_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 388. Subroutine database_letters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 411. Subroutine database_entries redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 433. Subroutine get_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 454. Subroutine available_parameters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 469. Subroutine get_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 486. Subroutine available_statistics redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 501. Subroutine add_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 520. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 543. Subroutine _nexthitindex redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 556. Subroutine add_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 573. Subroutine add_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 590. Subroutine num_hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 608. Subroutine hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 628. Subroutine algorithm_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 649. Subroutine program_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 658. Subroutine no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 667. Subroutine set_no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 684. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 705. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 116. Subroutine add_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 175. Subroutine name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 202. Subroutine accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 222. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 242. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 262. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 287. Subroutine raw_score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 309. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 325. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 340. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 371. Subroutine next_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 399. Subroutine hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 425. Subroutine num_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 454. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 475. Subroutine ambiguous_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 502. Subroutine overlap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 516. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 547. Subroutine p redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 596. Subroutine hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 640. Subroutine logical_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 680. Subroutine length_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 733. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 791. Subroutine matches redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 825. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 883. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 941. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 985. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1032. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1092. Subroutine frac_aligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1141. Subroutine frac_aligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1177. Subroutine num_unaligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1226. Subroutine num_unaligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1258. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1296. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1329. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1387. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1421. Subroutine locus redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1437. Subroutine each_accession_number redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1465. Subroutine tiled_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1513. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1530. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1202. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 165. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 165. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 165. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 165. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 165. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 165. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 165. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 165. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 165. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 165. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 165. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 165. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 165. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 165. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 192. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 219. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 247. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 278. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 305. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 329. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 341. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 368. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 397. t/cigarstring.t .............. 1..3 ok 1 ok 2 ok 3 ok t/ClusterIO.t ................ 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 93. Subroutine nodelete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 120. Subroutine get_nodes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 137. Subroutine get_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 173. Subroutine set_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 188. Subroutine total_branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 212. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 234. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 255. Subroutine cleanup_tree redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 292. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 101. Subroutine add_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 153. Subroutine each_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 189. Subroutine remove_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 225. Subroutine remove_all_Descendents redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 272. Subroutine ancestor redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 306. Subroutine branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 323. Subroutine bootstrap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 348. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 370. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 395. Subroutine internal_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 419. Subroutine _creation_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 435. Subroutine is_Leaf redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 456. Subroutine height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 482. Subroutine invalidate_height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 515. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 536. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 556. Subroutine remove_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 577. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 594. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 610. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 626. Subroutine node_cleanup redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 631. t/Coalescent.t ............... 1..11 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/CodonTable.t ............... 1..38 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/consed.t ................... 1..16 ok 1 # Cannot run consed module on windows ok 2 # Cannot run consed module on windows ok 3 # Cannot run consed module on windows ok 4 # Cannot run consed module on windows ok 5 # Cannot run consed module on windows ok 6 # Cannot run consed module on windows ok 7 # Cannot run consed module on windows ok 8 # Cannot run consed module on windows ok 9 # Cannot run consed module on windows ok 10 # Cannot run consed module on windows ok 11 # Cannot run consed module on windows ok 12 # Cannot run consed module on windows ok 13 # Cannot run consed module on windows ok 14 # Cannot run consed module on windows ok 15 # Cannot run consed module on windows ok 16 # Cannot run consed module on windows ok t/CoordinateGraph.t .......... 1..7 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 101. Subroutine add_result redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 127. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 151. Subroutine each_gap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 182. Subroutine each_match redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 207. Subroutine match redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 228. Subroutine gap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 251. Subroutine purge_gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 274. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. t/CoordinateMapper.t ......... 1..170 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/Correlate.t ................ 1..15 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. t/CytoMap.t .................. 1..109 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok Subroutine new redefined at Bio\Location\Simple.pm line 89, line 30. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 30. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 30. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 30. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 30. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 30. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 30. Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, line 38. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, line 38. Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, line 38. Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, line 38. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, line 38. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, line 38. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, line 38. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, line 38. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, line 38. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, line 38. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, line 38. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, line 38. Subroutine new redefined at Bio\Location\Split.pm line 90, line 41. Subroutine each_Location redefined at Bio\Location\Split.pm line 122, line 41. Subroutine sub_Location redefined at Bio\Location\Split.pm line 151, line 41. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 214, line 41. Subroutine splittype redefined at Bio\Location\Split.pm line 238, line 41. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 266, line 41. Subroutine strand redefined at Bio\Location\Split.pm line 301, line 41. Subroutine start redefined at Bio\Location\Split.pm line 341, line 41. Subroutine end redefined at Bio\Location\Split.pm line 359, line 41. Subroutine min_start redefined at Bio\Location\Split.pm line 377, line 41. Subroutine max_start redefined at Bio\Location\Split.pm line 398, line 41. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 420, line 41. Subroutine min_end redefined at Bio\Location\Split.pm line 440, line 41. Subroutine max_end redefined at Bio\Location\Split.pm line 462, line 41. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 485, line 41. Subroutine seq_id redefined at Bio\Location\Split.pm line 510, line 41. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 556, line 41. Use of uninitialized value $location in lc at Bio/DB/SwissProt.pm line 368. Use of uninitialized value $location in lc at Bio/DB/SwissProt.pm line 368. Use of uninitialized value $location in lc at Bio/DB/SwissProt.pm line 368. Use of uninitialized value $location in lc at Bio/DB/SwissProt.pm line 368. Use of uninitialized value $location in lc at Bio/DB/SwissProt.pm line 368. t/DB.t ....................... 1..78 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 not ok 30 # Test 30 got: 'Bio::Seq::RichSeq=HASH(0x3463d5c)' (t/DB.t at line 144) # Expected: 'O39869' not ok 31 # Test 31 got: '9PICO' (t/DB.t at line 145) # Expected: 'UNK' ok 32 ok 33 ok 34 # skip ok 35 ok 36 ok 37 ok 38 ok 39 # could not connect to swissprot ok 40 # could not connect to swissprot ok 41 # could not connect to swissprot ok 42 # could not connect to swissprot ok 43 # could not connect to swissprot ok 44 # could not connect to swissprot ok 45 # could not connect to swissprot ok 46 # could not connect to swissprot ok 47 # could not connect to swissprot ok 48 # could not connect to swissprot ok 49 # could not connect to swissprot ok 50 # could not connect to swissprot ok 51 # could not connect to swissprot ok 52 # could not connect to swissprot ok 53 # could not connect to swissprot ok 54 # could not connect to swissprot ok 55 # could not connect to swissprot ok 56 # could not connect to swissprot ok 57 # could not connect to swissprot ok 58 # could not connect to swissprot ok 59 # could not connect to swissprot ok 60 # could not connect to swissprot ok 61 # could not connect to swissprot ok 62 # could not connect to swissprot ok 63 # could not connect to swissprot ok 64 # could not connect to swissprot ok 65 # could not connect to swissprot ok 66 # could not connect to swissprot ok 67 # could not connect to swissprot ok 68 # could not connect to swissprot ok 69 # could not connect to swissprot ok 70 # could not connect to swissprot ok 71 # could not connect to swissprot ok 72 # could not connect to swissprot ok 73 # could not connect to swissprot ok 74 # could not connect to swissprot ok 75 # could not connect to swissprot ok 76 # could not connect to swissprot ok 77 # could not connect to swissprot ok 78 # could not connect to swissprot Failed 2/78 subtests (less 1 skipped subtest: 75 okay) t/DBCUTG.t ................... 1..22 ok 1 ok 2 ok 3 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 12 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 13 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 14 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 15 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 16 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 17 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 18 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 19 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 20 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 21 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 22 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok t/DBFasta.t .................. 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/DNAMutation.t .............. 1..36 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok t/Domcut.t ................... 1..25 ok 1 ok 2 ok 3 ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 12 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 13 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 14 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 15 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 16 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 17 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 18 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 19 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 20 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 21 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 22 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 23 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 24 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 25 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/ECnumber.t ................. 1..26 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 70. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 70. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 70. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 70. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 70. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 70. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 70. -------------------- WARNING --------------------- MSG: Bio::Tools::Analysis::Protein::ELM Request Error: 400 URL must be absolute Content-Type: text/plain Client-Date: Sat, 08 May 2010 03:12:01 GMT Client-Warning: Internal response 400 URL must be absolute --------------------------------------------------- t/ELM.t ...................... 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 # unable to run all of the tests depending on web access ok 12 # unable to run all of the tests depending on web access ok 13 # unable to run all of the tests depending on web access ok 14 # unable to run all of the tests depending on web access ok Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 41. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 41. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 41. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 41. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 41. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 41. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 41. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 43. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 43. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 43. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 43. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 43. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 43. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 43. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 43. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 43. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 43. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 43. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 43. Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. t/EMBL_DB.t .................. 1..15 ok 1 ok 2 ok 3 ok 4 ok 5 not ok 6 # Test 6 got: 'embl|J02231|J02231' (t/EMBL_DB.t at line 67) # Expected: qr/(?-xism:embl.+BUM)/ ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 not ok 13 # Test 13 got: '1611' (t/EMBL_DB.t at line 95) # Expected: '408' not ok 14 # Test 14 got: '408' (t/EMBL_DB.t at line 96) # Expected: '1611' ok 15 Failed 3/15 subtests Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147, line 13. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188, line 13. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253, line 13. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274, line 13. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304, line 13. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321, line 13. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338, line 13. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355, line 13. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372, line 13. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400, line 13. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428, line 13. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447, line 13. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465, line 13. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480, line 13. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500, line 13. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526, line 13. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542, line 13. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567, line 13. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596, line 13. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638, line 13. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661, line 13. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678, line 13. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702, line 13. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733, line 13. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757, line 13. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794, line 13. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826, line 13. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856, line 13. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879, line 13. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913, line 13. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935, line 13. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966, line 13. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983, line 13. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999, line 13. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005, line 13. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012, line 13. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013, line 13. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024, line 13. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017, line 13. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018, line 13. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019, line 13. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021, line 13. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 13. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 13. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 13. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 13. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 13. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 13. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 13. t/EMBOSS_Tools.t ............. 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/EncodedSeq.t ............... 1..37 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 1. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 1. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 1. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 1. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 1. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 1. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 1. t/ePCR.t ..................... 1..23 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/ESEfinder.t ................ 1..12 ok 1 ok 2 ok 3 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 12 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 2. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 2. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 2. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 2. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 2. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 2. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 2. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 2. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 2. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 2. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 2. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 2. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 2. t/est2genome.t ............... 1..60 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok t/Exception.t ................ 1..8 ok 1 ok 2 Setting test data (Eeny meeny miney moe.) ok 3 ok 4 Executing method bar() in TestObject Throwing a Bio::TestException ok 5 ok 6 ok 7 ok 8 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 77, line 42. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 114, line 42. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 130, line 42. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 146, line 42. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 162, line 42. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 182, line 42. Subroutine new redefined at Bio\Location\Simple.pm line 89, line 42. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 42. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 42. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 42. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 42. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 42. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 42. t/Exonerate.t ................ 1..45 ok 1 ok 2 ok 3 # no query length available in default output ok 4 ok 5 # no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # no query length available in default output ok 26 ok 27 # no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok DB_File not loaded. This means flat.t test cannot be executed. Skipping t/flat.t ..................... 1..16 ok 1 # DB_File not installed ok 2 # DB_File not installed ok 3 # DB_File not installed ok 4 # DB_File not installed ok 5 # DB_File not installed ok 6 # DB_File not installed ok 7 # DB_File not installed ok 8 # DB_File not installed ok 9 # DB_File not installed ok 10 # DB_File not installed ok 11 # DB_File not installed ok 12 # DB_File not installed ok 13 # DB_File not installed ok 14 # DB_File not installed ok 15 # DB_File not installed ok 16 # DB_File not installed ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, chunk 11. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, chunk 11. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, chunk 11. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, chunk 11. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, chunk 11. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, chunk 11. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, chunk 11. t/FootPrinter.t .............. 1..26 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\game.pm line 82. Subroutine next_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\game.pm line 97. Subroutine write_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\game.pm line 122. Subroutine _getseqs redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\game.pm line 140. Subroutine _hide_dna redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\game.pm line 169. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 934. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 934. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 934. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 934. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 934. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 934. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 934. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 934. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 934. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 934. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 934. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 934. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 934. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 934. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 934. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 934. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 934. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 934. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 934. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 934. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 934. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 934. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 934. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 974. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 974. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 974. t/game.t ..................... 1..25 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok t/GDB.t ...................... 1..11 ok 1 # GDB test skipped to avoid timeouts ok 2 # GDB test skipped to avoid timeouts ok 3 # GDB test skipped to avoid timeouts ok 4 # GDB test skipped to avoid timeouts ok 5 # GDB test skipped to avoid timeouts ok 6 # GDB test skipped to avoid timeouts ok 7 # GDB test skipped to avoid timeouts ok 8 # GDB test skipped to avoid timeouts ok 9 # GDB test skipped to avoid timeouts ok 10 # GDB test skipped to avoid timeouts ok 11 # GDB test skipped to avoid timeouts ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 101. Subroutine add_result redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 127. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 151. Subroutine each_gap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 182. Subroutine each_match redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 207. Subroutine match redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 228. Subroutine gap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 251. Subroutine purge_gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Coordinate\Result.pm line 274. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- -------------------- WARNING --------------------- MSG: sorted sublocation array requested but root location doesn't define seq_id (at least one sublocation does!) --------------------------------------------------- Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value in concatenation (.) or string at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Coordinate/GeneMapper.pm line 814. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. t/GeneCoordinateMapper.t ..... 1..113 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 5. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 5. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 5. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 5. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 5. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 5. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 5. t/Geneid.t ................... 1..26 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, chunk 2. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, chunk 2. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, chunk 2. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, chunk 2. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, chunk 2. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, chunk 2. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, chunk 2. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147, chunk 2. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188, chunk 2. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253, chunk 2. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274, chunk 2. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304, chunk 2. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321, chunk 2. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338, chunk 2. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355, chunk 2. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372, chunk 2. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400, chunk 2. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428, chunk 2. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447, chunk 2. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465, chunk 2. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480, chunk 2. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500, chunk 2. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526, chunk 2. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542, chunk 2. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567, chunk 2. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596, chunk 2. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638, chunk 2. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661, chunk 2. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678, chunk 2. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702, chunk 2. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733, chunk 2. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757, chunk 2. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794, chunk 2. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826, chunk 2. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856, chunk 2. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879, chunk 2. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913, chunk 2. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935, chunk 2. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966, chunk 2. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983, chunk 2. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999, chunk 2. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005, chunk 2. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012, chunk 2. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013, chunk 2. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024, chunk 2. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017, chunk 2. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021, chunk 2. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 3. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 3. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 3. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 3. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 3. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 3. t/Genewise.t ................. 1..51 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 # skip ok 34 # skip ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 1. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 1. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 1. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 1. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 1. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 1. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 1. t/Genomewise.t ............... 1..20 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 12. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 12. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 12. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 12. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 12. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 12. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 12. t/Genpred.t .................. 1..56 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Filehandle GEN0 opened only for output at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/IO.pm line 440. Filehandle GEN1 opened only for output at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/IO.pm line 440. t/GFF.t ...................... 1..32 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok t/GOR4.t ..................... 1..11 ok 1 ok 2 ok 3 ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/GOterm.t ................... 1..59 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok Use of uninitialized value $format in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqIO.pm line 374. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 87. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 87. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 87. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 87. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 87. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 87. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 87. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 92. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 92. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 92. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 92. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 92. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 92. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 92. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 92. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 92. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 92. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 92. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 92. Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 934. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 934. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 934. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 934. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 934. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 934. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 934. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 934. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 934. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 934. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 934. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 934. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 934. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 934. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 934. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 934. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104, line 934. Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqIO/gcg.pm line 78. Subroutine next_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqIO/gcg.pm line 98. Subroutine write_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqIO/gcg.pm line 171. Subroutine GCG_checksum redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqIO/gcg.pm line 242. Subroutine _validate_checksum redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqIO/gcg.pm line 277. t/GuessSeqFormat.t ........... 1..46 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 160. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 239. Subroutine algorithm_version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 259. Subroutine next_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 286. Subroutine query_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 304. Subroutine query_accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 324. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 345. Subroutine query_description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 366. Subroutine database_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 388. Subroutine database_letters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 411. Subroutine database_entries redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 433. Subroutine get_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 454. Subroutine available_parameters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 469. Subroutine get_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 486. Subroutine available_statistics redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 501. Subroutine add_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 520. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 543. Subroutine _nexthitindex redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 556. Subroutine add_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 573. Subroutine add_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 590. Subroutine num_hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 608. Subroutine hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 628. Subroutine algorithm_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 649. Subroutine program_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 658. Subroutine no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 667. Subroutine set_no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 684. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 705. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 116. Subroutine add_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 175. Subroutine name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 202. Subroutine accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 222. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 242. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 262. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 287. Subroutine raw_score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 309. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 325. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 340. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 371. Subroutine next_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 399. Subroutine hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 425. Subroutine num_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 454. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 475. Subroutine ambiguous_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 502. Subroutine overlap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 516. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 547. Subroutine p redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 596. Subroutine hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 640. Subroutine logical_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 680. Subroutine length_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 733. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 791. Subroutine matches redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 825. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 883. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 941. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 985. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1032. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1092. Subroutine frac_aligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1141. Subroutine frac_aligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1177. Subroutine num_unaligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1226. Subroutine num_unaligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1258. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1296. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1329. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1387. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1421. Subroutine locus redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1437. Subroutine each_accession_number redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1465. Subroutine tiled_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1513. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1530. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1202. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 162. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 374. Subroutine pvalue redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 396. Subroutine evalue redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 415. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 419. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 442. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 480. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 508. Subroutine query_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 533. Subroutine hit_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 557. Subroutine homology_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 583. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 613. Subroutine hsp_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 645. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 676. Subroutine get_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 744. Subroutine num_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 790. Subroutine num_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 809. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 827. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 865. Subroutine _calculate_seq_positions redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1000. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1102. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1115. Subroutine links redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1147. Subroutine cigar_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1204. Subroutine generate_cigar_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1226. Subroutine _sub_cigar_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1258. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 32. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 32. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 32. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 32. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 32. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 32. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 32. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 32. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 32. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 32. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 32. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 32. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 32. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147, line 177. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188, line 177. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253, line 177. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274, line 177. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304, line 177. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321, line 177. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338, line 177. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355, line 177. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372, line 177. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400, line 177. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428, line 177. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447, line 177. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465, line 177. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480, line 177. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500, line 177. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526, line 177. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542, line 177. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567, line 177. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596, line 177. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638, line 177. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661, line 177. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678, line 177. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702, line 177. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733, line 177. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757, line 177. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794, line 177. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826, line 177. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856, line 177. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879, line 177. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913, line 177. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935, line 177. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966, line 177. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983, line 177. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999, line 177. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005, line 177. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012, line 177. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013, line 177. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024, line 177. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017, line 177. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018, line 177. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019, line 177. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021, line 177. t/hmmer.t .................... 1..136 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok t/HNN.t ...................... 1..13 ok 1 ok 2 ok 3 ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 12 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 13 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok t/Index.t .................... 1..32 ok 1 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 2 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 3 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 4 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 5 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 6 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 7 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 8 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 9 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 10 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 11 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 12 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 13 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 14 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 15 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 16 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 17 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 18 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 19 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 20 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 21 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 22 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 23 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 24 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 25 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 26 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 27 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 28 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 29 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 30 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 31 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok 32 # DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed ok t/InstanceSite.t ............. 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok Useless localization of scalar assignment at Bio/Root/Object.pm line 699. t/InterProParser.t ........... 1..47 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/IUPAC.t .................... 1..1 ok 1 ok t/largefasta.t ............... 1..15 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537. t/largepseq.t ................ 1..22 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/LinkageMap.t ............... 1..16 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 48. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 48. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 48. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 48. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 48. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 48. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 48. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 57. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 57. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 57. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 57. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 57. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 57. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 57. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 57. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 57. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 57. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 57. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 57. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 74. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 74. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 74. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 74. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 74. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 74. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 74. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 74. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 74. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 74. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 74. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 74. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 74. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 74. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 74. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 74. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 74. t/LiveSeq.t .................. 1..48 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/LocatableSeq.t ............. 1..80 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. t/Location.t ................. 1..72 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556. t/LocationFactory.t .......... 1..177 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 1. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 1. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 1. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 1. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 1. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 1. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 1. t/LocusLink.t ................ 1..23 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/lucy.t ..................... 1..22 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Map.t ...................... 1..48 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok t/MapIO.t .................... 1..23 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Matrix.t ................... 1..64 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/Measure.t .................. 1..20 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok Use of uninitialized value $desc in substitution (s///) at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/MeSH.pm line 263. Use of uninitialized value $name in regexp compilation at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/MeSH.pm line 277. Use of uninitialized value $name in regexp compilation at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/MeSH.pm line 277. Use of uninitialized value $name in regexp compilation at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/MeSH.pm line 277. t/MeSH.t ..................... 1..26 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 not ok 26 # Test 26 got: '0' (t/MeSH.t at line 97) # Expected: '2' Failed 1/26 subtests Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/MetaSeq.t .................. 1..73 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok t/MicrosatelliteMarker.t ..... 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/MiniMIMentry.t ............. 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/MitoProt.t ................. 1..8 ok 1 ok 2 ok 3 ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 93, line 6. Subroutine nodelete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 120, line 6. Subroutine get_nodes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 137, line 6. Subroutine get_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 173, line 6. Subroutine set_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 188, line 6. Subroutine total_branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 212, line 6. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 234, line 6. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 255, line 6. Subroutine cleanup_tree redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 292, line 6. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 101, line 6. Subroutine add_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 153, line 6. Subroutine each_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 189, line 6. Subroutine remove_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 225, line 6. Subroutine remove_all_Descendents redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 272, line 6. Subroutine ancestor redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 306, line 6. Subroutine branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 323, line 6. Subroutine bootstrap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 348, line 6. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 370, line 6. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 395, line 6. Subroutine internal_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 419, line 6. Subroutine _creation_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 435, line 6. Subroutine is_Leaf redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 456, line 6. Subroutine height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 482, line 6. Subroutine invalidate_height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 515, line 6. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 536, line 6. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 556, line 6. Subroutine remove_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 577, line 6. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 594, line 6. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 610, line 6. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 626, line 6. Subroutine node_cleanup redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 631, line 6. t/Molphy.t ................... 1..17 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/multiple_fasta.t ........... 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Mutation.t ................. 1..18 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 40. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 40. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 40. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 40. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 40. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 40. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 40. t/Mutator.t .................. 1..13 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 24. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 24. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 24. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 24. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 24. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 24. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 24. t/NetPhos.t .................. 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Node.t ..................... 1..17 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/OddCodes.t ................. 1..10 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. t/OMIMentry.t ................ 1..145 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/OMIMentryAllelicVariant.t .. 1..26 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. t/OMIMparser.t ............... 1..173 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. set_attribute: not a compat02 graph at C:/cpanfly-5.12/var/megalib/Graph.pm line 2490, line 10. t/Ontology.t ................. 1..50 Dubious, test returned 255 (wstat 65280, 0xff00) Failed 50/50 subtests Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 132. Subroutine init redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 183. Subroutine identifier redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 208. Subroutine subject_term redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 238. Subroutine object_term redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 269. Subroutine predicate_term redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 300. Subroutine ontology redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 325. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 353. Subroutine _check_class redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 375. Subroutine Bio::Ontology::Relationship::child_term redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 401. Subroutine Bio::Ontology::Relationship::parent_term redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 402. Subroutine Bio::Ontology::Relationship::relationship_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Relationship.pm line 403. t/OntologyEngine.t ........... 1..22 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 93, line 54. Subroutine nodelete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 120, line 54. Subroutine get_nodes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 137, line 54. Subroutine get_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 173, line 54. Subroutine set_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 188, line 54. Subroutine total_branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 212, line 54. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 234, line 54. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 255, line 54. Subroutine cleanup_tree redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 292, line 54. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 101, line 54. Subroutine add_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 153, line 54. Subroutine each_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 189, line 54. Subroutine remove_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 225, line 54. Subroutine remove_all_Descendents redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 272, line 54. Subroutine ancestor redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 306, line 54. Subroutine branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 323, line 54. Subroutine bootstrap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 348, line 54. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 370, line 54. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 395, line 54. Subroutine internal_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 419, line 54. Subroutine _creation_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 435, line 54. Subroutine is_Leaf redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 456, line 54. Subroutine height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 482, line 54. Subroutine invalidate_height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 515, line 54. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 536, line 54. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 556, line 54. Subroutine remove_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 577, line 54. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 594, line 54. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 610, line 54. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 626, line 54. Subroutine node_cleanup redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 631, line 54. t/PAML.t ..................... 1..116 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Perl.pm line 548. Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Perl.pm line 615. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 31. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 31. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 31. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 31. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 31. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 31. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 31. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 42. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 42. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 42. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 42. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 42. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 42. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 42. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 42. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 42. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 42. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 42. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 42. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 42. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 42. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 42. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 42. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 42. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 42. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 42. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 42. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 42. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 42. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 42. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 42. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 42. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 42. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 42. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 42. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 42. Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/SwissProt.pm line 368. Use of uninitialized value $au in substitution (s///) at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\swiss.pm line 855, line 137. Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. Use of uninitialized value $location in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/DBFetch.pm line 282. t/Perl.t ..................... 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\phd.pm line 72. Subroutine next_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\phd.pm line 95. Subroutine write_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\phd.pm line 171. t/phd.t ...................... 1..5 ok 1 ok 2 ok 3 ok 4 ok 5 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. t/Phenotype.t ................ 1..109 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok t/PhylipDist.t ............... 1..19 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/pICalculator.t ............. 1..36 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok t/Pictogram.t ................ 1..3 ok 1 ok 2 ok 3 ok t/PopGen.t ................... 1..74 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 # -0.001 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 # Fst not calculated yet ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 # 0.16273 ok 55 # 0.16273 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 # 0.72985 ok 67 # 0.72985 ok 68 # 0.72985 ok 69 # 0.72985 ok 70 ok 71 ok 72 ok 73 ok 74 ok t/PopGenSims.t ............... 1..22 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/primaryqual.t .............. 1..31 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Location/Split.pm line 104. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537. t/PrimarySeq.t ............... 1..35 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 1. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 1. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 1. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 1. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 1. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 1. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 1. t/primedseq.t ................ 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/Primer.t ................... 1..16 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 103. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 103. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 103. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 103. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 103. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 103. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 103. t/primer3.t .................. 1..10 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 11. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 11. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 11. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 11. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 11. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 11. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 11. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147, line 11. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188, line 11. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253, line 11. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274, line 11. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304, line 11. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321, line 11. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338, line 11. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355, line 11. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372, line 11. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400, line 11. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428, line 11. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447, line 11. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465, line 11. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480, line 11. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500, line 11. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526, line 11. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542, line 11. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567, line 11. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596, line 11. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638, line 11. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661, line 11. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678, line 11. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702, line 11. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733, line 11. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757, line 11. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794, line 11. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826, line 11. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856, line 11. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879, line 11. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913, line 11. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935, line 11. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966, line 11. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983, line 11. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999, line 11. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005, line 11. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012, line 11. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013, line 11. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024, line 11. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017, line 11. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018, line 11. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019, line 11. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021, line 11. t/Promoterwise.t ............. 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok t/ProtDist.t ................. 1..46 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok t/psm.t ...................... 1..42 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147, line 30. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188, line 30. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253, line 30. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274, line 30. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304, line 30. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321, line 30. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338, line 30. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355, line 30. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372, line 30. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400, line 30. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428, line 30. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447, line 30. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465, line 30. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480, line 30. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500, line 30. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526, line 30. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542, line 30. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567, line 30. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596, line 30. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638, line 30. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661, line 30. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678, line 30. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702, line 30. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733, line 30. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757, line 30. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794, line 30. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826, line 30. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856, line 30. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879, line 30. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913, line 30. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935, line 30. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966, line 30. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983, line 30. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999, line 30. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005, line 30. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012, line 30. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013, line 30. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024, line 30. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017, line 30. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018, line 30. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019, line 30. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021, line 30. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 30. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 30. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 30. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 30. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 30. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 30. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 30. t/QRNA.t ..................... 1..29 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\qual.pm line 76. Subroutine next_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\qual.pm line 96. Subroutine _next_qual redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\qual.pm line 138. Subroutine next_primary_qual redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\qual.pm line 153. Subroutine write_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\qual.pm line 202. t/qual.t ..................... 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok t/RandDistFunctions.t ........ 1..4 ok 1 ok 2 ok 3 ok 4 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 93. Subroutine nodelete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 120. Subroutine get_nodes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 137. Subroutine get_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 173. Subroutine set_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 188. Subroutine total_branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 212. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 234. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 255. Subroutine cleanup_tree redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 292. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 101. Subroutine add_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 153. Subroutine each_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 189. Subroutine remove_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 225. Subroutine remove_all_Descendents redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 272. Subroutine ancestor redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 306. Subroutine branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 323. Subroutine bootstrap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 348. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 370. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 395. Subroutine internal_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 419. Subroutine _creation_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 435. Subroutine is_Leaf redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 456. Subroutine height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 482. Subroutine invalidate_height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 515. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 536. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 556. Subroutine remove_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 577. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 594. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 610. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 626. Subroutine node_cleanup redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 631. t/RandomTreeFactory.t ........ 1..3 ok 1 ok 2 ok 3 ok Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. t/Range.t .................... 1..32 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok t/RangeI.t ................... 1..19 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/RefSeq.t ................... 1..13 ok 1 ok 2 ok 3 ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 12 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 13 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok DB_File and BerkeleyDB not found. Skipping DB_File tests The getpwuid function is unimplemented at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/DB/Registry.pm line 116. t/Registry.t ................. 1..6 ok 1 Dubious, test returned 25 (wstat 6400, 0x1900) Failed 5/6 subtests Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/Relationship.t ............. 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. t/RelationshipType.t ......... 1..21 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/RemoteBlast.t .............. 1..6 ok 1 ok 2 ok 3 # Skip to avoid timeout ok 4 # Skip to avoid timeout ok 5 # Skip to avoid timeout ok 6 # Skip to avoid timeout ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 4. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 4. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 4. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 4. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 4. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 4. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 4. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147, line 4. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188, line 4. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253, line 4. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274, line 4. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304, line 4. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321, line 4. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338, line 4. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355, line 4. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372, line 4. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400, line 4. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428, line 4. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447, line 4. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465, line 4. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480, line 4. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500, line 4. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526, line 4. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542, line 4. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567, line 4. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596, line 4. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638, line 4. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661, line 4. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678, line 4. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702, line 4. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733, line 4. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757, line 4. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794, line 4. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826, line 4. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856, line 4. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879, line 4. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913, line 4. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935, line 4. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966, line 4. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983, line 4. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999, line 4. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005, line 4. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012, line 4. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013, line 4. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024, line 4. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017, line 4. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018, line 4. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019, line 4. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021, line 4. t/RepeatMasker.t ............. 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok Use of uninitialized value $opt in uc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/Analysis.pm line 359, line 1596. Use of uninitialized value $opt in uc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/Analysis.pm line 359, line 1596. t/RestrictionAnalysis.t ...... 1..150 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok t/RestrictionEnzyme.t ........ 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 78, line 532. Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 85, line 532. Subroutine read redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 102, line 532. Subroutine write redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 134, line 532. Subroutine _cuts_from_site redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 165, line 532. Subroutine _meth redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 186, line 532. Subroutine _coordinate_shift_to_cut redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 211, line 532. Subroutine _make_multisites redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 238, line 532. Subroutine _make_multicuts redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 308, line 532. Subroutine _companies redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Restriction/IO/base.pm line 344, line 532. t/RestrictionIO.t ............ 1..14 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/RNAChange.t ................ 1..29 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok t/RootI.t .................... 1..10 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok t/RootIO.t ................... 1..25 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok t/RootStorable.t ............. 1..34 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 70. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 70. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 70. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 70. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 70. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 70. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 70. t/Scansite.t ................. 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 # set env BIOPERLDEBUG to run tests over web ok 8 # set env BIOPERLDEBUG to run tests over web ok 9 # set env BIOPERLDEBUG to run tests over web ok 10 # set env BIOPERLDEBUG to run tests over web ok 11 # set env BIOPERLDEBUG to run tests over web ok 12 # set env BIOPERLDEBUG to run tests over web ok Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 86. Subroutine next_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 113. Subroutine _get_v3_quality redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 255. Subroutine _get_v3_peak_indices redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 282. Subroutine _get_v3_base_accuracies redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 301. Subroutine _get_comments redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 333. Subroutine _get_header redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 365. Subroutine _parse_v2_bases redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 399. Subroutine _parse_v2_traces redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 435. Subroutine get_trace_deprecated_use_the_sequencetrace_object_instead redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 455. Subroutine _deprecated_get_peak_indices_deprecated_use_the_sequencetrace_object_instead redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 466. Subroutine get_header redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 484. Subroutine _dump_traces_incoming_deprecated_use_the_sequencetrace_object redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 495. Subroutine _dump_traces_outgoing_deprecated_use_the_sequencetrace_object redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 513. Subroutine write_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 565. Subroutine _get_binary_header redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 736. Subroutine _get_binary_traces redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 771. Subroutine _get_binary_bases redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 828. Subroutine _make_trace_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 906. Subroutine _get_binary_comments redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 948. Subroutine _fill_missing_data redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 980. Subroutine _delta redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1009. Subroutine _unpack_magik redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1089. Subroutine read_from_buffer redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1113. Subroutine _dump_keys redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1141. Subroutine _dump_base_accuracies redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1164. Subroutine _dump_peak_indices_incoming redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1191. Subroutine _dump_base_accuracies_incoming redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1212. Subroutine _dump_comments redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqIO\scf.pm line 1239. t/scf.t ...................... 1..12 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 Now checking version3... ok 11 Now testing the _writing_ of scfs ok 12 Trying to write an scf with a subset of a real scf... The subtrace object is this: '_root_verbose' => 0 'accuracies' => HASH(0x34afad4) 'a' => 0..45 7 0 0 0 0 0 0 0 0 0 0 0 0 21 0 0 29 0 0 0 0 8 0 13 0 0 25 0 0 0 0 0 35 0 0 0 0 0 51 0 45 0 0 0 0 0 'c' => 0..45 0 0 0 6 6 0 0 4 0 0 6 0 0 0 24 0 0 19 0 7 0 0 0 0 0 0 0 0 29 34 32 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 'g' => 0..45 0 0 0 0 0 4 4 0 0 0 0 6 12 0 0 29 0 0 0 0 0 0 13 0 22 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 45 0 0 0 0 't' => 0..45 0 6 6 0 0 0 0 0 6 6 0 0 0 0 0 0 0 0 16 0 7 0 0 0 0 0 0 29 0 0 0 0 0 35 35 40 40 51 0 51 0 0 45 56 40 40 'peak_indices' => 0..45 0 6 19 28 46 53 68 73 92 110 112 123 135 146 162 171 182 191 204 220 227 238 245 262 267 279 294 302 317 329 341 353 361 371 385 397 409 421 431 442 452 464 477 491 503 515 'supress_warnings' => 1 'swq' => Bio::Seq::SeqWithQuality=HASH(0x34af8b4) '_root_verbose' => 0 'display_id' => 'IIABP1D4373' 'length' => 46 'qual_ref' => Bio::Seq::PrimaryQual=HASH(0x34af9f4) '_root_verbose' => 0 'display_id' => 'IIABP1D4373' 'qual' => 0..45 7 6 6 6 6 4 4 4 6 6 6 6 12 21 24 29 29 19 16 7 7 8 13 13 22 22 25 29 29 34 32 35 35 35 35 40 40 51 51 51 45 45 45 56 40 40 'seq_ref' => Bio::PrimarySeq=HASH(0x34af9c4) '_root_verbose' => 0, '_seq_length' => undef, 'alphabet' => 'dna', 'display_id' => 'IIABP1D4373', 'seq' => 'ATTCCGGCTTCGGACGACTCTAGAGGATCCCCATTTTTATAGTTTT' 'supress_warnings' => 1 'trace' => HASH(0x34af384) 'a' => 0..515 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1589 1216 915 680 502 366 265 191 138 98 68 43 26 12 9 27 67 131 221 330 446 556 646 705 729 717 672 601 514 420 328 244 174 121 85 64 55 54 59 67 78 92 111 134 163 196 227 252 269 271 258 230 190 142 94 55 25 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 23 75 151 241 338 412 440 418 351 255 165 90 35 4 0 0 9 34 73 124 190 261 331 396 458 517 575 632 687 740 789 834 876 915 949 977 994 994 973 927 856 765 661 555 457 376 317 279 258 248 238 224 200 166 123 82 48 22 5 0 0 23 74 156 270 419 576 725 845 925 951 920 834 705 547 380 237 127 52 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 7 11 14 15 13 10 6 2 0 0 0 0 0 0 0 0 0 0 16 65 148 267 425 603 774 919 1020 1064 1046 969 840 678 501 330 195 97 34 3 0 0 0 0 2 34 102 214 376 588 815 1030 1198 1289 1284 1179 988 741 491 286 132 36 0 0 0 0 3 8 16 22 23 21 17 10 3 0 0 35 124 269 469 723 990 1223 1392 1473 1457 1348 1164 931 680 441 257 125 43 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 9 19 30 41 48 47 39 29 17 8 2 0 3 12 22 29 32 30 24 14 4 0 11 66 164 306 490 702 896 1045 1127 1132 1057 915 724 514 325 179 76 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 60 182 369 619 931 1233 1479 1600 1600 1596 1414 1158 867 579 347 177 67 9 0 0 0 47 144 291 483 720 945 1124 1234 1262 1208 1082 905 700 494 309 172 78 23 0 0 0 3 4 4 4 4 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 8 15 23 33 40 43 41 34 25 15 7 2 0 0 0 3 9 15 'c' => 0..515 500 353 199 76 6 0 0 0 0 0 0 0 0 0 0 0 3 74 209 405 658 973 1280 1559 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1472 1195 1137 1351 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 812 236 0 0 0 0 0 236 813 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1479 1124 761 467 239 85 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 79 235 454 707 985 1189 1282 1261 1150 988 819 670 557 482 434 403 383 370 367 380 411 456 504 540 551 526 461 365 253 157 80 27 4 13 22 24 24 23 15 6 1 13 28 42 49 49 42 34 51 115 244 433 677 940 1182 1361 1442 1407 1260 1023 737 472 260 109 22 0 0 0 0 0 0 0 0 0 0 0 5 61 165 321 526 782 1035 1261 1431 1528 1535 1448 1273 1029 744 482 273 120 27 0 0 0 49 214 517 977 1596 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1262 850 519 287 130 37 0 0 16 45 77 104 127 128 105 75 43 18 3 0 0 0 0 0 0 1 10 26 48 74 101 122 130 128 116 99 78 58 38 23 12 4 0 0 0 2 5 7 8 9 8 5 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 68 230 486 821 1224 1598 1600 1600 1600 1600 1279 947 713 659 827 1208 1600 1600 1600 1600 1600 1600 1600 1600 1600 1300 1065 1044 1204 1467 1600 1600 1600 1600 1438 1101 818 672 705 912 1238 1598 1600 1600 1600 1600 1394 956 581 284 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 11 17 21 23 20 15 9 3 0 0 0 0 2 8 16 24 30 32 28 21 12 5 0 0 0 0 0 0 0 0 0 0 0 0 1 7 17 29 41 51 52 46 38 34 41 61 92 125 'g' => 0..515 1600 1600 1600 1342 929 571 304 138 50 12 0 0 0 0 0 38 115 229 378 562 729 855 919 908 824 679 498 324 183 79 18 0 0 0 0 0 0 0 0 0 0 0 0 0 1 24 70 147 260 415 595 786 973 1130 1239 1279 1240 1122 938 711 474 284 138 44 0 1 20 46 70 86 97 84 61 36 14 1 1 16 41 71 98 119 120 100 72 42 17 2 0 0 0 3 72 203 391 620 887 1109 1250 1290 1225 1070 851 604 382 208 87 24 44 109 193 291 398 483 541 580 612 655 721 818 945 1090 1234 1355 1430 1445 1400 1301 1171 1038 930 866 856 890 947 997 1008 955 831 648 445 269 129 37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 142 280 453 660 840 964 1011 974 860 689 487 307 164 64 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 26 89 185 308 453 586 677 711 683 599 473 326 202 103 36 1 0 0 0 0 0 0 50 156 319 533 795 1035 1212 1291 1261 1132 942 741 587 528 591 771 1033 1320 1569 1600 1600 1600 1365 1036 690 408 195 60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 35 133 295 516 795 1085 1329 1488 1537 1469 1295 1043 750 481 268 117 28 0 0 2 11 22 32 40 45 41 30 20 11 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 't' => 0..515 1340 1405 1585 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1520 1455 1395 1327 1236 1111 948 753 541 348 195 86 44 80 163 261 362 430 437 382 284 185 96 31 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 278 591 1036 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1600 1140 656 337 138 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 20 47 80 114 141 147 131 99 65 34 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 123 238 364 484 544 521 421 296 173 73 13 0 0 0 0 0 0 0 0 0 0 45 166 353 585 844 1062 1167 1135 972 718 471 258 100 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 56 133 240 373 519 642 722 747 713 623 490 337 209 105 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 18 31 46 64 84 103 124 146 169 189 205 217 226 238 261 305 384 504 666 862 1073 1266 1406 1459 1405 1245 1001 719 457 273 207 275 460 718 984 1196 1302 1277 1130 894 628 388 226 168 217 349 518 674 774 791 723 592 439 311 247 273 384 555 741 893 970 951 841 670 488 345 284 326 467 678 912 1117 1247 1273 1187 1007 764 509 301 143 43 0 0 0 0 32 103 226 405 648 913 1167 1368 1478 1472 1346 1116 823 538 304 133 31 0 0 0 0 0 0 0 0 0 0 0 7 17 28 38 45 43 35 28 32 58 115 204 319 443 556 636 665 633 544 415 279 163 90 94 179 327 514 709 867 953 950 857 698 508 327 195 137 160 251 378 504 589 609 557 448 314 196 132 146 241 397 576 732 'bases' => HASH(0x305e404) 'binary' => "\c@\c@\c@\cD\c@\c@\cG\c@g\c@\c@\c@\c@\c@\c@\cR\cG\c@\c@\c@a\c@\c@\c@\c@\c@\c@\cZ\c@\c@\c@\cGt\c@\c@\c@\c@\c@\c@'\c@\c@\cG\c@g\c@\c@\c@\c@\c@\c@5\cG\c@\c@\c@a\c@\c@\c@\c@\c@\c@;\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c@H\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c@Q\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c@c\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c@j\c@\c@\cD\c@g\c@\c@\c@\c@\c@\c@y\c@\c@\cD\c@g\c@\c@\c@\c@\c@\c@~\c@\cD\c@\c@c\c@\c@\c@\c@\c@\c@‘\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c@£\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c@¥\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c@°\c@\c@\cF\c@g\c@\c@\c@\c@\c@\c@¼\c@\c@\cL\c@g\c@\c@\c@\c@\c@\c@Ç\cU\c@\c@\c@a\c@\c@\c@\c@\c@\c@×\c@\cX\c@\c@c\c@\c@\c@\c@\c@\c@à\c@\c@\c]\c@g\c@\c@\c@\c@\c@\c@ë\c]\c@\c@\c@a\c@\c@\c@\c@\c@\c@ô\c@\cS\c@\c@c\c@\c@\c@\c@\c@\cA\cA\c@\c@\c@\cPt\c@\c@\c@\c@\c@\cA\cQ\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cA\cX\c@\c@\c@\cGt\c@\c@\c@\c@\c@\cA#\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cA*\c@\c@\cM\c@g\c@\c@\c@\c@\c@\cA;\cM\c@\c@\c@a\c@\c@\c@\c@\c@\cA\@\c@\c@\cV\c@g\c@\c@\c@\c@\c@\cAL\c@\c@\cV\c@g\c@\c@\c@\c@\c@\cA[\cY\c@\c@\c@a\c@\c@\c@\c@\c@\cAc\c@\c@\c@\c]t\c@\c@\c@\c@\c@\cAr\c@\c]\c@\c@c\c@\c@\c@\c@\c@\cA~\c@\"\c@\c@c\c@\c@\c@\c@\c@\cAŠ\c@ \c@\c@c\c@\c@\c@\c@\c@\cA–\c@#\c@\c@c\c@\c@\c@\c@\c@\cAž#\c@\c@\c@a\c@\c@\c@\c@\c@\cA¨\c@\c@\c@#t\c@\c@\c@\c@\c@\cA¶\c@\c@\c@#t\c@\c@\c@\c@\c@\cAÂ\c@\c@\c@(t\c@\c@\c@\c@\c@\cAÎ\c@\c@\c@(t\c@\c@\c@\c@\c@\cAÚ\c@\c@\c@3t\c@\c@\c@\c@\c@\cAä3\c@\c@\c@a\c@\c@\c@\c@\c@\cAï\c@\c@\c@3t\c@\c@\c@\c@\c@\cAù-\c@\c@\c@a\c@\c@\c@\c@\c@\cB\cE\c@\c@-\c@g\c@\c@\c@\c@\c@\cB\cR\c@\c@\c@-t\c@\c@\c@\c@\c@\cB \c@\c@\c@8t\c@\c@\c@\c@\c@\cB,\c@\c@\c@(t\c@\c@\c@\c@\c@\cB8\c@\c@\c@(t\c@\c@\c@\c@\c@\cBD\c@\c@\c@(t\c@\c@\c@\c@\c@\cBN(\c@\c@\c@a\c@\c@\c@\c@\c@\cBZ\c@\c@\c@(t\c@\c@\c@\c@\c@\cBh\c@(\c@\c@c\c@\c@\c@\c@\c@\cBt\c@\c@\c@.t\c@\c@\c@\c@\c@\cB\c@\c@\c@.t\c@\c@\c@\c@\c@\cB\c@\c@8\c@g\c@\c@\c@\c@\c@\cB˜\c@\c@\c@*t\c@\c@\c@\c@\c@\cB¤*\c@\c@\c@a\c@\c@\c@\c@\c@\cB±8\c@\c@\c@a\c@\c@\c@\c@\c@\cB¼\c@\c@\c@-t\c@\c@\c@\c@\c@\cBÇ(\c@\c@\c@a\c@\c@\c@\c@\c@\cBÔ\c@\c@(\c@g\c@\c@\c@\c@\c@\cBã(\c@\c@\c@a\c@\c@\c@\c@\c@\cBî\c@\c@\c@(t\c@\c@\c@\c@\c@\cBù\c@\c@(\c@g\c@\c@\c@\c@\c@\cC\cF\c@\c@\c@*t\c@\c@\c@\c@\c@\cC\cS\c@\c@\c@*t\c@\c@\c@\c@\c@\cC \c@\c@\c@#t\c@\c@\c@\c@\c@\cC+!\c@\c@\c@a\c@\c@\c@\c@\c@\cC7\c@\c@!\c@g\c@\c@\c@\c@\c@\cCG#\c@\c@\c@a\c@\c@\c@\c@\c@\cCQ\c@\c@\c@#t\c@\c@\c@\c@\c@\cC^\c@\c@\c@#t\c@\c@\c@\c@\c@\cCj\c@\c@\c@.t\c@\c@\c@\c@\c@\cCw\c@\c@\c@8t\c@\c@\c@\c@\c@\cC„\c@\c@\c@8t\c@\c@\c@\c@\c@\cC‘\c@(\c@\c@c\c@\c@\c@\c@\c@\cC\c@\c@(\c@g\c@\c@\c@\c@\c@\cC¨\c@\c@\c@(t\c@\c@\c@\c@\c@\cC¶\c@\c@\c@(t\c@\c@\c@\c@\c@\cCÂ\c@\c@\"\c@g\c@\c@\c@\c@\c@\cCÎ\c@\c@\c@!t\c@\c@\c@\c@\c@\cCÚ!\c@\c@\c@a\c@\c@\c@\c@\c@\cCç\cX\c@\c@\c@a\c@\c@\c@\c@\c@\cCó\c@\c@\c@\cXt\c@\c@\c@\c@\c@\cD\cA\c@\c@\c@\cLt\c@\c@\c@\c@\c@\cD\cK\cN\c@\c@\c@a\c@\c@\c@\c@\c@\cD\cY\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cD&\c@\c@\c@\cKt\c@\c@\c@\c@\c@\cD3\c@\c@\c@\cPt\c@\c@\c@\c@\c@\cD\@\c@\c@\c@\c_t\c@\c@\c@\c@\c@\cDM\c@\c_\c@\c@c\c@\c@\c@\c@\c@\cDY\c@\c@\c@0t\c@\c@\c@\c@\c@\cDf\c@\c@\c@0t\c@\c@\c@\c@\c@\cDr\c@\c@\c@0t\c@\c@\c@\c@\c@\cD~0\c@\c@\c@a\c@\c@\c@\c@\c@\cD‰\c@\c@\c@(t\c@\c@\c@\c@\c@\cD–\c@\c@\c@\cTt\c@\c@\c@\c@\c@\cD£\c@\c@\cS\c@g\c@\c@\c@\c@\c@\cD®\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cDÅ\c@\c@\c@\cFt\c@\c@\c@\c@\c@\cDÉ\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cDÖ\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cDã\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cDð\cU\c@\c@\c@a\c@\c@\c@\c@\c@\cDû\c@\c@\c@\cYt\c@\c@\c@\c@\c@\cE\cH\c@\c@\c@\c^t\c@\c@\c@\c@\c@\cE\cR \c@\c@\c@a\c@\c@\c@\c@\c@\cE\c_\c@\c@ \c@g\c@\c@\c@\c@\c@\cE-\c@\c@\c@!t\c@\c@\c@\c@\c@\cE8%\c@\c@\c@a\c@\c@\c@\c@\c@\cEE\c@\c@\c@(t\c@\c@\c@\c@\c@\cER\c@(\c@\c@c\c@\c@\c@\c@\c@\cE`\c@\c@\c@8t\c@\c@\c@\c@\c@\cEm\c@8\c@\c@c\c@\c@\c@\c@\c@\cEz\c@\c@\c@8t\c@\c@\c@\c@\c@\cE†\c@\c@8\c@g\c@\c@\c@\c@\c@\cE’\c@\c@*\c@g\c@\c@\c@\c@\c@\cEž\c@\c@!\c@g\c@\c@\c@\c@\c@\cE«\c@\c@\c@\et\c@\c@\c@\c@\c@\cE·\cO\c@\c@\c@a\c@\c@\c@\c@\c@\cEÄ\cO\c@\c@\c@a\c@\c@\c@\c@\c@\cEÐ\c@\c@\c@\cOt\c@\c@\c@\c@\c@\cEÞ\c@\c@\c@!t\c@\c@\c@\c@\c@\cEë\c@\c@\c@!t\c@\c@\c@\c@\c@\cEö*\c@\c@\c@a\c@\c@\c@\c@\c@\cF\cB\c@\c@\c@8t\c@\c@\c@\c@\c@\cF\cO\c@0\c@\c@c\c@\c@\c@\c@\c@\cF\cZ,\c@\c@\c@a\c@\c@\c@\c@\c@\cF'\c@\c@\c@*t\c@\c@\c@\c@\c@\cF3!\c@\c@\c@a\c@\c@\c@\c@\c@\cF\@\c@\c@\c@!t\c@\c@\c@\c@\c@\cFN\c@\c@\c@\cTt\c@\c@\c@\c@\c@\cFZ\c@\cV\c@\c@c\c@\c@\c@\c@\c@\cFg\c@\c@\c@\cMt\c@\c@\c@\c@\c@\cFt\c@\cM\c@\c@c\c@\c@\c@\c@\c@\cF€\c@\c@\c@\cMt\c@\c@\c@\c@\c@\cF\c@\c@\cV\c@g\c@\c@\c@\c@\c@\cF™\c@\c@\cV\c@g\c@\c@\c@\c@\c@\cF§*\c@\c@\c@a\c@\c@\c@\c@\c@\cF³,\c@\c@\c@a\c@\c@\c@\c@\c@\cFÀ*\c@\c@\c@a\c@\c@\c@\c@\c@\cFÍ*\c@\c@\c@a\c@\c@\c@\c@\c@\cFÙ\c@\c@\c@*t\c@\c@\c@\c@\c@\cFä\c@\c@*\c@g\c@\c@\c@\c@\c@\cFò*\c@\c@\c@a\c@\c@\c@\c@\c@\cFþ\c@\c@\c@*t\c@\c@\c@\c@\c@\cG\cK\c@\c@\c@*t\c@\c@\c@\c@\c@\cG\cX\c@\c@\c@&t\c@\c@\c@\c@\c@\cG#&\c@\c@\c@a\c@\c@\c@\c@\c@\cG.\c@-\c@\c@c\c@\c@\c@\c@\c@\cG=\c@\c@\c@-t\c@\c@\c@\c@\c@\cGH-\c@\c@\c@a\c@\c@\c@\c@\c@\cGU\c@\c@\c@(t\c@\c@\c@\c@\c@\cGc\c@%\c@\c@c\c@\c@\c@\c@\c@\cGn%\c@\c@\c@a\c@\c@\c@\c@\c@\cGz\c@\$\c@\c@c\c@\c@\c@\c@\c@\cG‰\c@\c@\c@(t\c@\c@\c@\c@\c@\cG”#\c@\c@\c@a\c@\c@\c@\c@\c@\cG¡\c@\c@%\c@g\c@\c@\c@\c@\c@\cG°&\c@\c@\c@a\c@\c@\c@\c@\c@\cG»\c@\c@\c@(t\c@\c@\c@\c@\c@\cGÆ(\c@\c@\c@a\c@\c@\c@\c@\c@\cGÓ\c@*\c@\c@c\c@\c@\c@\c@\c@\cGá\c@\c@\c@(t\c@\c@\c@\c@\c@\cGï\c@\c@\c@-t\c@\c@\c@\c@\c@\cGû\c@&\c@\c@c\c@\c@\c@\c@\c@\cH\cE(\c@\c@\c@a\c@\c@\c@\c@\c@\cH\cR\c@\c@\c@*t\c@\c@\c@\c@\c@\cH\c_%\c@\c@\c@a\c@\c@\c@\c@\c@\cH,(\c@\c@\c@a\c@\c@\c@\c@\c@\cH8\c@\c@(\c@g\c@\c@\c@\c@\c@\cHG(\c@\c@\c@a\c@\c@\c@\c@\c@\cHR\c@\c@\c@(t\c@\c@\c@\c@\c@\cH_\c@\c@\c@-t\c@\c@\c@\c@\c@\cHk\c@\c@\c@8t\c@\c@\c@\c@\c@\cHv.\c@\c@\c@a\c@\c@\c@\c@\c@\cHƒ\c@\c@\c@*t\c@\c@\c@\c@\c@\cHŽ*\c@\c@\c@a\c@\c@\c@\c@\c@\cHœ*\c@\c@\c@a\c@\c@\c@\c@\c@\cH©\c@\c@\c@+t\c@\c@\c@\c@\c@\cH·\c@8\c@\c@c\c@\c@\c@\c@\c@\cHÄ\c@\c@\c@8t\c@\c@\c@\c@\c@\cHÑ\c@\c@\c@+t\c@\c@\c@\c@\c@\cHÝ\c@\c@\c@3t\c@\c@\c@\c@\c@\cHé-\c@\c@\c@a\c@\c@\c@\c@\c@\cHô\c@\c@\c@(t\c@\c@\c@\c@\c@\cI\cB\c@\c@\c@(t\c@\c@\c@\c@\c@\cI\cL(\c@\c@\c@a\c@\c@\c@\c@\c@\cI\cZ\c@\c@\c@(t\c@\c@\c@\c@\c@\cI'\c@\c@(\c@g\c@\c@\c@\c@\c@\cI3,\c@\c@\c@a\c@\c@\c@\c@\c@\cI\@,\c@\c@\c@a\c@\c@\c@\c@\c@\cIM8\c@\c@\c@a\c@\c@\c@\c@\c@\cI['\c@\c@\c@a\c@\c@\c@\c@\c@\cIg\c@\c@\c@(t\c@\c@\c@\c@\c@\cIt\c@#\c@\c@c\c@\c@\c@\c@\c@\cI~\$\c@\c@\c@a\c@\c@\c@\c@\c@\cI‹\c@\c@\c@\$t\c@\c@\c@\c@\c@\cI˜\c@(\c@\c@c\c@\c@\c@\c@\c@\cI¦\c@\c@\c@*t\c@\c@\c@\c@\c@\cI³\c@*\c@\c@c\c@\c@\c@\c@\c@\cIÀ\c@\c@\c@*t\c@\c@\c@\c@\c@\cIË2\c@\c@\c@a\c@\c@\c@\c@\c@\cI×\c@\c@\c@2t\c@\c@\c@\c@\c@\cIä\c@\c@\c@,t\c@\c@\c@\c@\c@\cIñ\c@\c@\c@/t\c@\c@\c@\c@\c@\cIý\c@\c@\c@,t\c@\c@\c@\c@\c@\cJ\cJ\c@\c@\c@8t\c@\c@\c@\c@\c@\cJ\cV\c@8\c@\c@c\c@\c@\c@\c@\c@\cJ!,\c@\c@\c@a\c@\c@\c@\c@\c@\cJ.,\c@\c@\c@a\c@\c@\c@\c@\c@\cJ;*\c@\c@\c@a\c@\c@\c@\c@\c@\cJH\c@\c@\c@*t\c@\c@\c@\c@\c@\cJU\c@\c@\c@(t\c@\c@\c@\c@\c@\cJ_(\c@\c@\c@a\c@\c@\c@\c@\c@\cJl\c@\c@\c@(t\c@\c@\c@\c@\c@\cJz\c@\c@\c@%t\c@\c@\c@\c@\c@\cJ„%\c@\c@\c@a\c@\c@\c@\c@\c@\cJ‘\c@\c@\c@(t\c@\c@\c@\c@\c@\cJŸ\c@\c@\c@(t\c@\c@\c@\c@\c@\cJ©(\c@\c@\c@a\c@\c@\c@\c@\c@\cJ·\c@\c@\c@-t\c@\c@\c@\c@\c@\cJÂ%\c@\c@\c@a\c@\c@\c@\c@\c@\cJÏ\c@\c@\c@(t\c@\c@\c@\c@\c@\cJÜ\c@#\c@\c@c\c@\c@\c@\c@\c@\cJë\c@\c@\c@#t\c@\c@\c@\c@\c@\cJö#\c@\c@\c@a\c@\c@\c@\c@\c@\cK\cB\c@\c@\c@#t\c@\c@\c@\c@\c@\cK\cP\c@(\c@\c@c\c@\c@\c@\c@\c@\cK\cZ(\c@\c@\c@a\c@\c@\c@\c@\c@\cK((\c@\c@\c@a\c@\c@\c@\c@\c@\cK5(\c@\c@\c@a\c@\c@\c@\c@\c@\cKA\c@\c@,\c@g\c@\c@\c@\c@\c@\cKN\c@\c@\c@,t\c@\c@\c@\c@\c@\cK[\c@\c@\c@\$t\c@\c@\c@\c@\c@\cKh\c@\c@\c@\$t\c@\c@\c@\c@\c@\cKs\c@\cS\c@\c@c\c@\c@\c@\c@\c@\cK€\c@\c@\c@\cYt\c@\c@\c@\c@\c@\cKŽ\c@\c@\cN\c@g\c@\c@\c@\c@\c@\cK™\c@\c@\c@!t\c@\c@\c@\c@\c@\cK¦\c@!\c@\c@c\c@\c@\c@\c@\c@\cK³\c@\c@\c@#t\c@\c@\c@\c@\c@\cKÀ\c@\c@\c@#t\c@\c@\c@\c@\c@\cKÍ\c@#\c@\c@c\c@\c@\c@\c@\c@\cK×(\c@\c@\c@a\c@\c@\c@\c@\c@\cKã\c@\c@\c@\$t\c@\c@\c@\c@\c@\cKñ\c@\c@\c@&t\c@\c@\c@\c@\c@\cKü%\c@\c@\c@a\c@\c@\c@\c@\c@\cL\cI\c@\c@\c@%t\c@\c@\c@\c@\c@\cL\cT%\c@\c@\c@a\c@\c@\c@\c@\c@\cL\"\c@\c@\c@*t\c@\c@\c@\c@\c@\cL.\c@*\c@\c@c\c@\c@\c@\c@\c@\cL<\c@\c@\c@*t\c@\c@\c@\c@\c@\cLG*\c@\c@\c@a\c@\c@\c@\c@\c@\cLT\c@\c@\c@#t\c@\c@\c@\c@\c@\cLb\c@\c@\c@#t\c@\c@\c@\c@\c@\cLm#\c@\c@\c@a\c@\c@\c@\c@\c@\cL{\c@\c@*\c@g\c@\c@\c@\c@\c@\cLˆ\c@%\c@\c@c\c@\c@\c@\c@\c@\cL“*\c@\c@\c@a\c@\c@\c@\c@\c@\cL \c@\c@\c@\$t\c@\c@\c@\c@\c@\cL¬\$\c@\c@\c@a\c@\c@\c@\c@\c@\cL¸\c@\c@\c@\$t\c@\c@\c@\c@\c@\cLÇ\c@#\c@\c@c\c@\c@\c@\c@\c@\cLÔ\c@\c@\c@#t\c@\c@\c@\c@\c@\cLß#\c@\c@\c@a\c@\c@\c@\c@\c@\cLì\c@\c@\c@*t\c@\c@\c@\c@\c@\cLù\c@*\c@\c@c\c@\c@\c@\c@\c@\cM\cF\c@\c@\c@*t\c@\c@\c@\c@\c@\cM\cS\c@\c@\c@*t\c@\c@\c@\c@\c@\cM!\c@\c@\c@*t\c@\c@\c@\c@\c@\cM,*\c@\c@\c@a\c@\c@\c@\c@\c@\cM8\c@\c@\c@*t\c@\c@\c@\c@\c@\cME\c@8\c@\c@c\c@\c@\c@\c@\c@\cMR\c@\c@\c@*t\c@\c@\c@\c@\c@\cM_\c@\c@\c@*t\c@\c@\c@\c@\c@\cMl\c@\c@\c@*t\c@\c@\c@\c@\c@\cMw*\c@\c@\c@a\c@\c@\c@\c@\c@\cMƒ\c@\c@\c@*t\c@\c@\c@\c@\c@\cM\c@%\c@\c@c\c@\c@\c@\c@\c@\cM\c@%\c@\c@c\c@\c@\c@\c@\c@\cMª\c@*\c@\c@c\c@\c@\c@\c@\c@\cM·\c@\c@\c@*t\c@\c@\c@\c@\c@\cMÂ*\c@\c@\c@a\c@\c@\c@\c@\c@\cMÏ\c@\c@\c@*t\c@\c@\c@\c@\c@\cMÛ\c@*\c@\c@c\c@\c@\c@\c@\c@\cMæ*\c@\c@\c@a\c@\c@\c@\c@\c@\cMô\c@\"\c@\c@c\c@\c@\c@\c@\c@\cN\cB\c@\c@\c@\"t\c@\c@\c@\c@\c@\cN\cM\"\c@\c@\c@a\c@\c@\c@\c@\c@\cN\cZ\c@\c@\c@*t\c@\c@\c@\c@\c@\cN%\c_\c@\c@\c@a\c@\c@\c@\c@\c@\cN2\c@\c@\c@ t\c@\c@\c@\c@\c@\cN>\c@\c\\c@\c@c\c@\c@\c@\c@\c@\cNN\c@\c@\c@\c\t\c@\c@\c@\c@\c@\cNY\c\\c@\c@\c@a\c@\c@\c@\c@\c@\cNf\c@\c@\c@\c_t\c@\c@\c@\c@\c@\cNs\c@\c]\c@\c@c\c@\c@\c@\c@\c@\cN~!\c@\c@\c@a\c@\c@\c@\c@\c@\cN\c@\c@\c@\c]t\c@\c@\c@\c@\c@\cN—\cY\c@\c@\c@a\c@\c@\c@\c@\c@\cN¥\c@\c@\c@\cQt\c@\c@\c@\c@\c@\cN²\c@\c@\cX\c@g\c@\c@\c@\c@\c@\cNÀ\c@\c@\cU\c@g\c@\c@\c@\c@\c@\cNÍ\c@\c@\c@\cQt\c@\c@\c@\c@\c@\cN×\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cNä\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cNò\cJ\c@\c@\c@a\c@\c@\c@\c@\c@\cO\c@\c@\c@\c@\cMt\c@\c@\c@\c@\c@\cO\cM\c@\cL\c@\c@c\c@\c@\c@\c@\c@\cO\cY\c@\c@\c@\cQt\c@\c@\c@\c@\c@\cO(\c@\c@\c@\cJt\c@\c@\c@\c@\c@\cO4\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cO>\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cOL\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cOT\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cOe\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cOu\cK\c@\c@\c@a\c@\c@\c@\c@\c@\cOz\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cO‹\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cO˜\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cO¥\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cO³\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cOÅ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cOÒ\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cOÜ\c@\c@\cG\c@g\c@\c@\c@\c@\c@\cOì\cJ\c@\c@\c@a\c@\c@\c@\c@\c@\cOö\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cP\cE\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cP\cQ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cP\cR\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cP&\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cP3\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cPD\c@\c@\c@\cLt\c@\c@\c@\c@\c@\cPT\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cP[\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cPc\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cPn\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cPu\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cP‚\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cP\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cPž\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cP¥\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cPµ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cPÇ\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cPÕ\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cPß\c@\c@\c@\cJt\c@\c@\c@\c@\c@\cPê\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cP÷\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cPÿ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQ\cO\c@\c@\cM\c@g\c@\c@\c@\c@\c@\cQ\c]\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cQ,\cK\c@\c@\c@a\c@\c@\c@\c@\c@\cQ7\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cQE\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cQS\c@\c@\cG\c@g\c@\c@\c@\c@\c@\cQX\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cQf\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cQk\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cQx\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cQ‰\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cQ“\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQ¥\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQ°\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQ¼\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQÍ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQ×\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cQî\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cQ÷\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cR\cD\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cR\cM\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cR\"\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cR,\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cR=\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cRE\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cRR\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cR`\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cRl\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cR~\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cRˆ\c@\c@\c@\cGt\c@\c@\c@\c@\c@\cRš\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cR¡\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cR­\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cR¸\c@\cG\c@\c@c\c@\c@\c@\c@\c@\cRÁ\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cRÒ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cRÛ\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cRì\cJ\c@\c@\c@a\c@\c@\c@\c@\c@\cRõ\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cRú\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cS\cK\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cS\cX\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cS'\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cS2\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cS<\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cSI\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cSW\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cS`\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cSk\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cS|\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cSŠ\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cSŽ\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cS£\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cS¬\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cS¸\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cSÆ\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cSÑ\c@\cT\c@\c@c\c@\c@\c@\c@\c@\cSÚ\c@\cT\c@\c@c\c@\c@\c@\c@\c@\cSé\c@\c@\c@\cPt\c@\c@\c@\c@\c@\cS÷\cM\c@\c@\c@a\c@\c@\c@\c@\c@\cT\cA\c@\c@\c@\cFt\c@\c@\c@\c@\c@\cT\cB\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cT\cU\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cT\$\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cT2\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cTB\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cTR\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cT]\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cTi\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cTu\c@\c@\c@\cMt\c@\c@\c@\c@\c@\cT\c@\c@\c@\cJt\c@\c@\c@\c@\c@\cT‹\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cT”\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cT¡\c@\c@\c@\cKt\c@\c@\c@\c@\c@\cT±\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cTÁ\cO\c@\c@\c@a\c@\c@\c@\c@\c@\cTÎ\c@\cU\c@\c@c\c@\c@\c@\c@\c@\cTÙ\c@\cQ\c@\c@c\c@\c@\c@\c@\c@\cTâ\c@\cM\c@\c@c\c@\c@\c@\c@\c@\cTï\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cU\cC\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cU\cR\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cU\c\\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cU%\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cU6\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cUC\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cUR\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cUT\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cUc\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cUx\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cUƒ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cU†\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cU™\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cU§\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cU´\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cU¼\c@\c@\c@\cMt\c@\c@\c@\c@\c@\cUÍ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cUÛ\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cUã\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cUô\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cV\cC\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cV\cR\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cV\e\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cV+\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cV3\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cV;\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cVK\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cV\\\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cVh\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cVy\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cVƒ\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cV\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cV‘\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cV¦\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cV´\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cVÄ\c@\cM\c@\c@c\c@\c@\c@\c@\c@\cVÏ\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cVØ\cJ\c@\c@\c@a\c@\c@\c@\c@\c@\cVì\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cVô\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cW\c@\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cW\c@\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cW\cR\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cW)\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cW2\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cW\@\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cWP\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cW[\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cWi\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cWw\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cW‡\c@\c@\cJ\c@g\c@\c@\c@\c@\c@\cW˜\cJ\c@\c@\c@a\c@\c@\c@\c@\c@\cW£\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cW¯\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cW¾\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cWÀ\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cWÖ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cWÞ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cWí\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cWþ\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cX\cH\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cX\cV\cL\c@\c@\c@a\c@\c@\c@\c@\c@\cX\c_\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cX(\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cX9\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cXC\c@\cL\c@\c@c\c@\c@\c@\c@\c@\cXM\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cXS\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cXe\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cXx\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cX…\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cX\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cX¢\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cX¥\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cX­\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cX¾\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cXÍ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cXÛ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cXå\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cXö\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cY\cD\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cY\cR\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cY \c@\c@\c@\cIt\c@\c@\c@\c@\c@\cY(\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cY8\c@\cD\c@\c@c\c@\c@\c@\c@\c@\cY?\cD\c@\c@\c@a\c@\c@\c@\c@\c@\cYV\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cY_\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cYh\cI\c@\c@\c@a\c@\c@\c@\c@\c@\cYv\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cY\c@\cP\c@\c@c\c@\c@\c@\c@\c@\cYŒ\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cY”\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cYŸ\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cY¬\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cY½\c@\c@\cH\c@g\c@\c@\c@\c@\c@\cYÂ\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cYÎ\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cYÞ\c@\c@\cF\c@g\c@\c@\c@\c@\c@\cYñ\c@\c@\c@\cHt\c@\c@\c@\c@\c@\cYõ\cH\c@\c@\c@a\c@\c@\c@\c@\c@\cZ\cD\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cZ\cO\c@\cI\c@\c@c\c@\c@\c@\c@\c@\cZ\cZ\cK\c@\c@\c@a\c@\c@\c@\c@\c@\cZ&\c@\cK\c@\c@c\c@\c@\c@\c@\c@\cZ6\c@\c@\c@\cKt\c@\c@\c@\c@\c@\cZ?\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\cZL\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZZ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZ_\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cZt\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZ|\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZ\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cZ’\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZ\cF\c@\c@\c@a\c@\c@\c@\c@\c@\cZŸ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZ´\c@\cH\c@\c@c\c@\c@\c@\c@\c@\cZÇ\c@\cF\c@\c@c\c@\c@\c@\c@\c@\cZÑ\cG\c@\c@\c@a\c@\c@\c@\c@\c@\cZá\c@\c@\cI\c@g\c@\c@\c@\c@\c@\cZö\c@\c@\c@\cIt\c@\c@\c@\c@\c@\cZþ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\e\cR\c@\cI\c@\c@c\c@\c@\c@\c@\c@\e\c_\c@\c@\c@\cIt\c@\c@\c@\c@\c@\e/\cK\c@\c@\c@a\c@\c@\c@\c@\c@\e7\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\eA\c@\c@\c@\cNt\c@\c@\c@\c@\c@\eR\c@\c@\c@\cJt\c@\c@\c@\c@\c@\e]\c@\c@\c@\cMt\c@\c@\c@\c@\c@\ef\c@\cI\c@\c@c\c@\c@\c@\c@\c@\en\c@\c@\cI\c@g\c@\c@\c@\c@\c@\e‚\c@\cH\c@\c@c\c@\c@\c@\c@\c@\e“\c@\cH\c@\c@c\c@\c@\c@\c@\c@\e¨\c@\cH\c@\c@c\c@\c@\c@\c@\c@\e®\c@\c@\cH\c@g\c@\c@\c@\c@\c@\e¾\c@\cH\c@\c@c\c@\c@\c@\c@\c@\eÌ\cI\c@\c@\c@a\c@\c@\c@\c@\c@\eÚ\c@\cI\c@\c@c\c@\c@\c@\c@\c@\eá\cK\c@\c@\c@a\c@\c@\c@\c@\c@\eô\c@\c@\c@\cKt\c@\c@\c@\c@\c@\c\\cB\c@\cK\c@\c@c\c@\c@\c@\c@\c@\c\\cN\c@\c@\cH\c@g\c@\c@\c@\c@\c@\c\\cV\c@\c@\cG\c@g\c@\c@\c@\c@\c@\c\\"\c@\cM\c@\c@c\c@\c@\c@\c@\c@\c\1\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\c\C\c@\cL\c@\c@c\c@\c@\c@\c@\c@\c\S\c@\cI\c@\c@c\c@\c@\c@\c@\c@\c\_\c@\c@\cH\c@g\c@\c@\c@\c@\c@\c\o\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c\y\c@\c@\c@\cKt\c@\c@\c@\c@\c@\c\‰\c@\c@\c@\cKt\c@\c@\c@\c@\c@\c\™\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c\£\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c\°\c@\c@\cH\c@g\c@\c@\c@\c@\c@\c\Á\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c\Ä\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c\×\cI\c@\c@\c@a\c@\c@\c@\c@\c@\c\æ\c@\c@\cF\c@g\c@\c@\c@\c@\c@\c\é\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c\ò\c@\c@\c@\cIt\c@\c@\c@\c@\c@\c]\cA\c@\cM\c@\c@c\c@\c@\c@\c@\c@\c]\cR\c@\cJ\c@\c@c\c@\c@\c@\c@\c@\c]\$\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c]6\cH\c@\c@\c@a\c@\c@\c@\c@\c@\c]L\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c]R\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c]c\c@\c@\c@\cHt\c@\c@\c@\c@\c@\c]i\cI\c@\c@\c@a\c@\c@\c@\c@\c@\c]x\c@\cG\c@\c@c\c@\c@\c@\c@\c@\c]~\c@\c@\cG\c@g\c@\c@\c@\c@\c@\c]Š\c@\cL\c@\c@c\c@\c@\c@\c@\c@\c]™\cL\c@\c@\c@a\c@\c@\c@\c@\c@\c]«\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c]­\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c]¼\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c]Ñ\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c]ß\cI\c@\c@\c@a\c@\c@\c@\c@\c@\c]í\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c]ô\c@\c@\cH\c@g\c@\c@\c@\c@\c@\c]ÿ\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c^\cN\c@\c@\c@\cHt\c@\c@\c@\c@\c@\c^\c_\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c^\$\c@\c@\cF\c@g\c@\c@\c@\c@\c@\c^7\c@\c@\c@\cHt\c@\c@\c@\c@\c@\c^H\c@\c@\c@\cMt\c@\c@\c@\c@\c@\c^N\c@\cK\c@\c@c\c@\c@\c@\c@\c@\c^\\\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c^e\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c^€\c@\c@\cF\c@g\c@\c@\c@\c@\c@\c^ƒ\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c^Ž\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c^ž\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c^¦\cG\c@\c@\c@a\c@\c@\c@\c@\c@\c^´\c@\cG\c@\c@c\c@\c@\c@\c@\c@\c^À\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c^Í\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c^à\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c^â\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c^æ\c@\c@\cF\c@g\c@\c@\c@\c@\c@\c^ú\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c_\cJ\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c_\e\c@\c@\c@\cIt\c@\c@\c@\c@\c@\c_%\cI\c@\c@\c@a\c@\c@\c@\c@\c@\c_3\c@\cH\c@\c@c\c@\c@\c@\c@\c@\c_:\c@\c@\c@\cJt\c@\c@\c@\c@\c@\c_I\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c_M\c@\c@\cF\c@g\c@\c@\c@\c@\c@\c_]\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c_m\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c_w\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c_„\c@\cI\c@\c@c\c@\c@\c@\c@\c@\c_—\c@\c@\c@\cFt\c@\c@\c@\c@\c@\c_›\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c_ª\c@\c@\c@\cHt\c@\c@\c@\c@\c@\c_¾\c@\cF\c@\c@c\c@\c@\c@\c@\c@\c_À\cF\c@\c@\c@a\c@\c@\c@\c@\c@\c_Ð\c@\c@\c@\cHt\c@\c@\c@\c@\c@\c_á\c@\c@\c@\cHt\c@\c@\c@\c@\c@\c_é\cJ\c@\c@\c@a\c@\c@\c@\c@\c@\c_ÿ\c@\cD\c@\c@c\c@\c@\c@\c@\c@ \cH\c@\c@\c@\cDt\c@\c@\c@\c@\c@ \cV\c@\cD\c@\c@c\c@\c@\c@\c@\c@ \c_\c@\cH\c@\c@c\c@\c@\c@\c@\c@ -\c@\c@\cI\c@g\c@\c@\c@\c@\c@ :\c@\cI\c@\c@c\c@\c@\c@\c@\c@ C\c@\c@\cL\c@g\c@\c@\c@\c@\c@ U\c@\c@\cL\c@g\c@\c@\c@\c@\c@ ]\cJ\c@\c@\c@a\c@\c@\c@\c@\c@ l\c@\cI\c@\c@c\c@\c@\c@\c@\c@ u\c@\c@\c@\cHt\c@\c@\c@\c@\c@ €\c@\cH\c@\c@c\c@\c@\c@\c@\c@ ”\c@\cF\c@\c@c\c@\c@\c@\c@\c@ •\c@\c@\cF\c@g\c@\c@\c@\c@\c@ ¨\c@\cH\c@\c@c\c@\c@\c@\c@\c@ ¸\c@\cF\c@\c@c\c@\c@\c@\c@\c@ Á\c@\c@\cF\c@g\c@\c@\c@\c@\c@ Í\c@\cF\c@\c@c\c@\c@\c@\c@\c@ Î\cF\c@\c@\c@a\c@\c@\c@\c@\c@ á\c@\cH\c@\c@c\c@\c@\c@\c@\c@ ô\c@\cH\c@\c@c\c@\c@\c@\c@\c@ ú\c@\c@\c@\cDt\c@\c@\c@\c@\c@!\cN\c@\c@\cD\c@g\c@\c@\c@\c@\c@! \c@\c@\c@\cDt\c@\c@\c@\c@\c@!(\c@\c@\cF\c@g\c@\c@\c@\c@\c@!8\c@\cF\c@\c@c\c@\c@\c@\c@\c@!=\cF\c@\c@\c@a\c@\c@\c@\c@\c@!F\c@\cF\c@\c@c\c@\c@\c@\c@\c@!N\c@\cF\c@\c@c\c@\c@\c@\c@\c@!_\cI\c@\c@\c@a\c@\c@\c@\c@\c@!s\c@\c@\c@\cGt\c@\c@\c@\c@\c@!\c?\c@\c@\c@\cHt\c@\c@\c@\c@\c@!Ž\cI\c@\c@\c@a\c@\c@\c@\c@\c@!ž\cH\c@\c@\c@a\c@\c@\c@\c@\c@!®\c@\cH\c@\c@c\c@\c@\c@\c@\c@!»\c@\c@\c@\cHt\c@\c@\c@\c@\c@!Å\c@\c@\cJ\c@g\c@\c@\c@\c@\c@!Ð\c@\c@\c@\cJt\c@\c@\c@\c@\c@!Ú\c@\c@\cJ\c@g\c@\c@\c@\c@\c@!ç\c@\c@\c@\cHt\c@\c@\c@\c@\c@!ò\cF\c@\c@\c@a\c@\c@\c@\c@\c@\"\c@\c@\c@\cF\c@g\c@\c@\c@\c@\c@\"\cT\c@\cH\c@\c@c\c@\c@\c@\c@\c@\"\cX\c@\c@\cH\c@g\c@\c@\c@\c@\c@\"'\c@\cH\c@\c@c\c@\c@\c@\c@\c@\"5\c@\cI\c@\c@c\c@\c@\c@\c@\c@\"=\c@\c@\c@\cIt\c@\c@\c@\c@\c@\"Q\c@\c@\cF\c@g\c@\c@\c@\c@\c@\"W\cF\c@\c@\c@a\c@\c@\c@\c@\c@\"l\cL\c@\c@\c@a\c@\c@\c@\c@\c@\"r\c@\cF\c@\c@c\c@\c@\c@\c@\c@\"€\c@\cF\c@\c@c\c@\c@\c@\c@\c@\"Š\c@\c@\cH\c@g\c@\c@\c@\c@\c@\"˜\c@\c@\cI\c@g\c@\c@\c@\c@\c@\"¬\c@\cI\c@\c@c\c@\c@\c@\c@\c@\"¶\cG\c@\c@\c@a\c@\c@\c@\c@\c@\"½\c@\cG\c@\c@c\c@\c@\c@\c@\c@\"Ï\c@\cI\c@\c@c\c@\c@\c@\c@\c@\"ß\c@\c@\c@\cIt\c@\c@\c@\c@\c@\"ç\c@\cI\c@\c@c\c@\c@\c@\c@\c@\"ô\c@\c@\c@\cIt\c@\c@\c@\c@\c@#\cE\c@\c@\cG\c@g\c@\c@\c@\c@\c@#\cK\cG\c@\c@\c@a\c@\c@\c@\c@\c@#\cV\c@\c@\c@\cIt\c@\c@\c@\c@\c@#&\c@\c@\c@\cIt\c@\c@\c@\c@\c@#-\cI\c@\c@\c@a\c@\c@\c@\c@\c@#<\c@\cJ\c@\c@c\c@\c@\c@\c@\c@#H\c@\cH\c@\c@c\c@\c@\c@\c@\c@#P\cG\c@\c@\c@a\c@\c@\c@\c@\c@#\\\c@\cI\c@\c@c\c@\c@\c@\c@\c@#k\c@\c@\c@\cIt\c@\c@\c@\c@\c@#‚\c@\c@\c@\cGt\c@\c@\c@\c@\c@#Š\c@\cG\c@\c@c\c@\c@\c@\c@\c@#–\c@\cG\c@\c@c\c@\c@\c@\c@\c@#ž\c@\c@\c@\cGt\c@\c@\c@\c@\c@#§\c@\cI\c@\c@c\c@\c@\c@\c@\c@#¾\c@\cG\c@\c@c\c@\c@\c@\c@\c@#È\cF\c@\c@\c@a\c@\c@\c@\c@\c@#Ñ\c@\cF\c@\c@c\c@\c@\c@\c@\c@#ß\c@\cF\c@\c@c\c@\c@\c@\c@\c@#å\cF\c@\c@\c@a\c@\c@\c@\c@\c@#ù\c@\c@\cH\c@g\c@\c@\c@\c@\c@\$\cD\c@\cH\c@\c@c\c@\c@\c@\c@\c@\$\cW\cG\c@\c@\c@a\c@\c@\c@\c@\c@\$ \c@\cG\c@\c@c\c@\c@\c@\c@\c@\$4\cI\c@\c@\c@a\c@\c@\c@\c@\c@\$\@\c@\c@\cI\c@g\c@\c@\c@\c@\c@\$O\c@\c@\c@\cIt\c@\c@\c@\c@\c@\$X\c@\cM\c@\c@c\c@\c@\c@\c@\c@\$f\c@\cH\c@\c@c\c@\c@\c@\c@\c@\$u\c@\c@\c@\cHt\c@\c@\c@\c@\c@\$„\cF\c@\c@\c@a\c@\c@\c@\c@\c@\$‡\c@\c@\c@\cFt\c@\c@\c@\c@\c@\$\c@\c@\c@\cIt\c@\c@\c@\c@\c@\$¡\cF\c@\c@\c@a\c@\c@\c@\c@\c@\$«\c@\cG\c@\c@c\c@\c@\c@\c@\c@\$½\c@\cG\c@\c@c\c@\c@\c@\c@\c@\$É\c@\c@\cH\c@g\c@\c@\c@\c@\c@\$Ò\c@\cI\c@\c@c\c@\c@\c@\c@\c@\$Û\cH\c@\c@\c@a\c@\c@\c@\c@\c@\$æ\c@\c@\c@\cHt\c@\c@\c@\c@\c@\$û\c@\c@\cF\c@g\c@\c@\c@\c@\c@%\c@\c@\c@\c@\cFt\c@\c@\c@\c@\c@%\cQ\c@\cF\c@\c@c\c@\c@\c@\c@\c@%\cT\c@\c@\cF\c@g\c@\c@\c@\c@\c@%#\c@\cH\c@\c@c\c@\c@\c@\c@\c@%5\c@\c@\c@\cFt\c@\c@\c@\c@\c@%9\c@\cF\c@\c@c\c@\c@\c@\c@\c@%L\c@\c@\c@\cFt\c@\c@\c@\c@\c@%R\c@\c@\cF\c@g\c@\c@\c@\c@\c@%T\c@\cF\c@\c@c\c@\c@\c@\c@\c@%`\c@\c@\c@\cHt\c@\c@\c@\c@\c@%t\cF\c@\c@\c@a\c@\c@\c@\c@\c@%ƒ\cG\c@\c@\c@a\c@\c@\c@\c@\c@%—\c@\c@\cF\c@g\c@\c@\c@\c@\c@%ž\cF\c@\c@\c@a\c@\c@\c@\c@\c@%®\c@\cF\c@\c@c\c@\c@\c@\c@\c@%´\cG\c@\c@\c@a\c@\c@\c@\c@\c@%Â\c@\c@\cG\c@g\c@\c@\c@\c@\c@%Ò\c@\c@\c@\cGt\c@\c@\c@\c@\c@%á\c@\c@\cI\c@g\c@\c@\c@\c@\c@%í\c@\cI\c@\c@c\c@\c@\c@\c@\c@%ó\cJ\c@\c@\c@a\c@\c@\c@\c@\c@&\cC\cI\c@\c@\c@a\c@\c@\c@\c@\c@&\cS\c@\c@\cK\c@g\c@\c@\c@\c@\c@&\cY\cK\c@\c@\c@a\c@\c@\c@\c@\c@&\$\c@\cN\c@\c@c\c@\c@\c@\c@\c@&/\c@\c@\c@\cMt\c@\c@\c@\c@\c@&?\c@\cM\c@\c@c\c@\c@\c@\c@\c@&L\c@\c@\c@\cIt\c@\c@\c@\c@\c@&\\\c@\c@\cI\c@g\c@\c@\c@\c@\c@&c\c@\cI\c@\c@c\c@\c@\c@\c@\c@&w\c@\c@\cF\c@g\c@\c@\c@\c@\c@&€\c@\c@\cF\c@g\c@\c@\c@\c@\c@&–\c@\c@\c@\cHt\c@\c@\c@\c@\c@&›\c@\cH\c@\c@c\c@\c@\c@\c@\c@&¥\c@\c@\cH\c@g\c@\c@\c@\c@\c@&µ\c@\cH\c@\c@c\c@\c@\c@\c@\c@&Ç\c@\c@\c@\cIt\c@\c@\c@\c@\c@&Ð\c@\cN\c@\c@c\c@\c@\c@\c@\c@&Ø\c@\c@\c@\cJt\c@\c@\c@\c@\c@&æ\c@\c@\cI\c@g\c@\c@\c@\c@\c@&ú\cI\c@\c@\c@a\c@\c@\c@\c@\c@'\cB\c@\cG\c@\c@c\c@\c@\c@\c@\c@'\cJ\c@\cJ\c@\c@c\c@\c@\c@\c@\c@'\c\\c@\cI\c@\c@c\c@\c@\c@\c@\c@''\c@\c@\cK\c@g\c@\c@\c@\c@\c@'/\c@\cH\c@\c@c\c@\c@\c@\c@\c@'E\cH\c@\c@\c@a\c@\c@\c@\c@\c@'J\c@\c@\c@\cHt\c@\c@\c@\c@\c@'Y\c@\cH\c@\c@c\c@\c@\c@\c@\c@'f\c@\cJ\c@\c@c\c@\c@\c@\c@\c@'q\c@\c@\cJ\c@g\c@\c@\c@\c@\c@'x\c@\cJ\c@\c@c\c@\c@\c@\c@\c@'ˆ\c@\cI\c@\c@c\c@\c@\c@\c@\c@'–\cI\c@\c@\c@a\c@\c@\c@\c@\c@'¡\c@\c@\cH\c@g\c@\c@\c@\c@\c@'µ\c@\c@\cH\c@g\c@\c@\c@\c@\c@'Ä\c@\c@\cF\c@g\c@\c@\c@\c@\c@'Æ\c@\cG\c@\c@c\c@\c@\c@\c@\c@'Ê\cG\c@\c@\c@a\c@\c@\c@\c@\c@'Ý\c@\cI\c@\c@c\c@\c@\c@\c@\c@'ó\c@\cF\c@\c@c\c@\c@\c@\c@\c@'ü\c@\c@\c@\cFt\c@\c@\c@\c@\c@(\cU\c@\cI\c@\c@c\c@\c@\c@\c@\c@(\c_\c@\c@\c@\cJt\c@\c@\c@\c@\c@('\c@\cK\c@\c@c\c@\c@\c@\c@\c@(5\cK\c@\c@\c@a\c@\c@\c@\c@\c@(;\c@\cG\c@\c@c\c@\c@\c@\c@\c@(B\c@\cG\c@\c@c\c@\c@\c@\c@\c@(W\c@\cK\c@\c@c\c@\c@\c@\c@\c@(a\c@\c@\c@\cJt\c@\c@\c@\c@\c@(k\c@\cJ\c@\c@c\c@\c@\c@\c@\c@(z\c@\c@\cK\c@g\c@\c@\c@\c@\c@(Š\c@\cI\c@\c@c\c@\c@\c@\c@\c@(•\c@\c@\c@\cKt\c@\c@\c@\c@\c@(¥\c@\c@\cH\c@g\c@\c@\c@\c@\c@(­\c@\c@\cH\c@g\c@\c@\c@\c@\c@(¸\c@\cK\c@\c@c\c@\c@\c@\c@\c@(Á\c@\cI\c@\c@c\c@\c@\c@\c@\c@(Ì\cI\c@\c@\c@a\c@\c@\c@\c@\c@(Ý\c@\cG\c@\c@c\c@\c@\c@\c@\c@(ã\c@\cF\c@\c@c\c@\c@\c@\c@\c@(ó\c@\cF\c@\c@c\c@\c@\c@\c@\c@(ü\c@\cF\c@\c@c\c@\c@\c@\c@\c@)\cP\c@\c@\cN\c@g\c@\c@\c@\c@\c@)\e\c@\cH\c@\c@c\c@\c@\c@\c@\c@),\c@\cH\c@\c@c\c@\c@\c@\c@\c@)5\c@\cM\c@\c@c\c@\c@\c@\c@\c@)F\c@\cK\c@\c@c\c@\c@\c@\c@\c@)V\c@\cK\c@\c@c\c@\c@\c@\c@\c@)d\c@\cK\c@\c@c\c@\c@\c@\c@\c@)o\c@\c@\c@\cIt\c@\c@\c@\c@\c@)|\c@\cI\c@\c@c\c@\c@\c@\c@\c@)…\c@\c@\c@\cIt\c@\c@\c@\c@\c@)™\c@\cH\c@\c@c\c@\c@\c@\c@\c@)£\c@\cK\c@\c@c\c@\c@\c@\c@\c@)°\c@\cF\c@\c@c\c@\c@\c@\c@\c@)´\c@\c@\c@\cFt\c@\c@\c@\c@\c@)Ê\c@\c@\cH\c@g\c@\c@\c@\c@\c@)Ò\c@\cH\c@\c@c\c@\c@\c@\c@\c@)Þ\c@\cI\c@\c@c\c@\c@\c@\c@\c@)ó\c@\cI\c@\c@c\c@\c@\c@\c@\c@*\cD\c@\cH\c@\c@c\c@\c@\c@\c@\c@*\cR\c@\c@\c@\cHt\c@\c@\c@\c@\c@*!\c@\c@\c@\cHt\c@\c@\c@\c@\c@*&\c@\cH\c@\c@c\c@\c@\c@\c@\c@*9\cH\c@\c@\c@a\c@\c@\c@\c@\c@*G\c@\c@\c@\cFt\c@\c@\c@\c@\c@*T\c@\c@\c@\cIt\c@\c@\c@\c@\c@*e\c@\cS\c@\c@c\c@\c@\c@\c@\c@*v\c@\cU\c@\c@c\c@\c@\c@\c@\c@*‚\c@\cO\c@\c@c\c@\c@\c@\c@\c@*‘\c@\cM\c@\c@c\c@\c@\c@\c@\c@* \c@\cK\c@\c@c\c@\c@\c@\c@\c@*©\cI\c@\c@\c@a\c@\c@\c@\c@\c@*¸\cM\c@\c@\c@a\c@\c@\c@\c@\c@*Ê\cI\c@\c@\c@a\c@\c@\c@\c@\c@*Ù\c@\cJ\c@\c@c\c@\c@\c@\c@\c@*å\c@\cP\c@\c@c\c@\c@\c@\c@\c@*î\c@\c@\cP\c@g\c@\c@\c@\c@\c@*þ\c@\cI\c@\c@c\c@\c@\c@\c@\c@+\cR\c@\c@\c@\cIt\c@\c@\c@\c@\c@+ \c@\c@\c@\cIt\c@\c@\c@\c@\c@+1\c@\c@\c@\cIt\c@\c@\c@\c@\c@+9\c@\cJ\c@\c@c\c@\c@\c@\c@\c@+I\cI\c@\c@\c@a\c@\c@\c@\c@\c@+W\cI\c@\c@\c@a\c@\c@\c@\c@\c@+a\c@\cI\c@\c@c\c@\c@\c@\c@\c@+x\c@\c@\cF\c@g\c@\c@\c@\c@\c@+„\c@\c@\cF\c@g\c@\c@\c@\c@\c@+’\c@\c@\cH\c@g\c@\c@\c@\c@\c@+™\cH\c@\c@\c@a\c@\c@\c@\c@\c@+¬\c@\cF\c@\c@c\c@\c@\c@\c@\c@+±\cF\c@\c@\c@a\c@\c@\c@\c@\c@+º\c@\cJ\c@\c@c\c@\c@\c@\c@\c@+Ð\cH\c@\c@\c@a\c@\c@\c@\c@\c@+Þ\c@\cJ\c@\c@c\c@\c@\c@\c@\c@+ñ\c@\cI\c@\c@c\c@\c@\c@\c@\c@,\cA\c@\cI\c@\c@c\c@\c@\c@\c@\c@,\cR\c@\cF\c@\c@c\c@\c@\c@\c@\c@,\cW\c@\c@\c@\cFt\c@\c@\c@\c@\c@,!\c@\cH\c@\c@c\c@\c@\c@\c@\c@,:\c@\cH\c@\c@c\c@\c@\c@\c@\c@,\@\c@\c@\cH\c@g\c@\c@\c@\c@\c@,M\c@\cH\c@\c@c\c@\c@\c@\c@\c@,d\c@\c@\cH\c@g\c@\c@\c@\c@\c@,z\c@\c@\cF\c@g\c@\c@\c@\c@\c@,\c@\cF\c@\c@c\c@\c@\c@\c@\c@,Ž\c@\c@\cH\c@g\c@\c@\c@\c@\c@,›\c@\c@\cH\c@g\c@\c@\c@\c@\c@,±\cF\c@\c@\c@a\c@\c@\c@\c@\c@,³\c@\cF\c@\c@c\c@\c@\c@\c@\c@,È\c@\cH\c@\c@c\c@\c@\c@\c@\c@,Ñ\cH\c@\c@\c@a\c@\c@\c@\c@\c@,á\c@\cH\c@\c@c\c@\c@\c@\c@\c@,ì\cH\c@\c@\c@a\c@\c@\c@\c@\c@,ù\cF\c@\c@\c@a\c@\c@\c@\c@\c@,þ\c@\cF\c@\c@c\c@\c@\c@\c@\c@-\cT\c@\c@\c@\cHt\c@\c@\c@\c@\c@-'\c@\cF\c@\c@c\c@\c@\c@\c@\c@-(\c@\c@\cF\c@g\c@\c@\c@\c@\c@-=\c@\cH\c@\c@c\c@\c@\c@\c@\c@-K\c@\cH\c@\c@c\c@\c@\c@\c@\c@-P\c@\c@\cH\c@g\c@\c@\c@\c@\c@-f\c@\c@\c@\cHt\c@\c@\c@\c@\c@-x\c@\cI\c@\c@c\c@\c@\c@\c@\c@-{\c@\c@\cL\c@g\c@\c@\c@\c@\c@-‡\c@\c@\cL\c@g\c@\c@\c@\c@\c@-™\c@\cL\c@\c@c\c@\c@\c@\c@\c@-«\c@\cH\c@\c@c\c@\c@\c@\c@\c@-·\cH\c@\c@\c@a\c@\c@\c@\c@\c@-Â\c@\cI\c@\c@c\c@\c@\c@\c@\c@-Ë\c@\cU\c@\c@c\c@\c@\c@\c@\c@-Ô\cS\c@\c@\c@a\c@\c@\c@\c@\c@-Ý\c@\cO\c@\c@c\c@\c@\c@\c@\c@-è\c@\c@\c@\cLt\c@\c@\c@\c@\c@-ó\c@\cI\c@\c@c\c@\c@\c@\c@\c@-û\cI\c@\c@\c@a\c@\c@\c@\c@\c@.\cL\c@\cI\c@\c@c\c@\c@\c@\c@\c@. \cI\c@\c@\c@a\c@\c@\c@\c@\c@./\c@\cI\c@\c@c\c@\c@\c@\c@\c@.=\c@\cL\c@\c@c\c@\c@\c@\c@\c@.G\c@\c@\c@\cPt\c@\c@\c@\c@\c@.S\c@\c@\c@\cKt\c@\c@\c@\c@\c@.c\c@\cK\c@\c@c\c@\c@\c@\c@\c@.m\c@\cK\c@\c@c\c@\c@\c@\c@\c@.y\c@\cL\c@\c@c\c@\c@\c@\c@\c@.ˆ\c@\c@\c@\cLt\c@\c@\c@\c@\c@.–\c@\cI\c@\c@c\c@\c@\c@\c@\c@.¡\c@\cG\c@\c@c\c@\c@\c@\c@\c@.®\c@\c@\c@\cIt\c@\c@\c@\c@\c@.Á\c@\cI\c@\c@c\c@\c@\c@\c@\c@.É\c@\cJ\c@\c@c\c@\c@\c@\c@\c@.Ú\c@\c@\c@\cIt\c@\c@\c@\c@\c@.ë\c@\c@\c@\cHt\c@\c@\c@\c@\c@.ñ\c@\cH\c@\c@c\c@\c@\c@\c@\c@/\cA\c@\cK\c@\c@c\c@\c@\c@\c@\c@/\cW\c@\cM\c@\c@c\c@\c@\c@\c@\c@/\"\c@\cL\c@\c@c\c@\c@\c@\c@\c@/.\c@\cI\c@\c@c\c@\c@\c@\c@\c@/>\cI\c@\c@\c@a\c@\c@\c@\c@\c@/G\c@\cI\c@\c@c\c@\c@\c@\c@\c@/W\cI\c@\c@\c@a\c@\c@\c@\c@\c@/b\c@\c@\c@\cJt\c@\c@\c@\c@\c@/n\c@\cI\c@\c@c\c@\c@\c@\c@\c@/{\cH\c@\c@\c@a\c@\c@\c@\c@\c@/ˆ\c@\cH\c@\c@c\c@\c@\c@\c@\c@/\c@\c@\cF\c@g\c@\c@\c@\c@\c@/ \c@\cF\c@\c@c\c@\c@\c@\c@\c@/¸\c@\cI\c@\c@c\c@\c@\c@\c@\c@/Æ\cH\c@\c@\c@a\c@\c@\c@\c@\c@/Ø\cI\c@\c@\c@a\c@\c@\c@\c@\c@/â\c@\cI\c@\c@c\c@\c@\c@\c@\c@/î\c@\cK\c@\c@c\c@\c@\c@\c@\c@/þ\c@\cJ\c@\c@c\c@\c@\c@\c@\c@0\cK\c@\cJ\c@\c@c\c@\c@\c@\c@\c@0\cU\c@\c@\cK\c@g\c@\c@\c@\c@\c@0\c_\c@\c@\c@\cJt\c@\c@\c@\c@\c@0.\c@\c@\cH\c@g\c@\c@\c@\c@\c@09\c@\c@\cG\c@g\c@\c@\c@\c@\c@0F\c@\c@\cH\c@g\c@\c@\c@\c@\c@0[\cH\c@\c@\c@a\c@\c@\c@\c@\c@0c\c@\cF\c@\c@c\c@\c@\c@\c@\c@0h\c@\c@\cF\c@g\c@\c@\c@\c@\c@0y\c@\c@\cF\c@g\c@\c@\c@\c@\c@0‚\c@\cH\c@\c@c\c@\c@\c@\c@\c@0”\c@\c@\c@\cIt\c@\c@\c@\c@\c@0ž\c@\cI\c@\c@c\c@\c@\c@\c@\c@0®\c@\c@\c@\cKt\c@\c@\c@\c@\c@0½\c@\cK\c@\c@c\c@\c@\c@\c@\c@0Ë\c@\cP\c@\c@c\c@\c@\c@\c@\c@0Ö\c@\cI\c@\c@c\c@\c@\c@\c@\c@0å\c@\c@\cI\c@g\c@\c@\c@\c@\c@0ò\c@\cJ\c@\c@c\c@\c@\c@\c@\c@0û\c@\c@\cI\c@g\c@\c@\c@\c@\c@1\cJ\c@\c@\cI\c@g\c@\c@\c@\c@\c@1\cZ\c@\cI\c@\c@c\c@\c@\c@\c@\c@1,\c@\c@\c@\cIt\c@\c@\c@\c@\c@15\cI\c@\c@\c@a\c@\c@\c@\c@\c@1C\c@\cI\c@\c@c\c@\c@\c@\c@\c@1V\c@\c@\cI\c@g\c@\c@\c@\c@\c@1\\\cH\c@\c@\c@a\c@\c@\c@\c@\c@1h\c@\cH\c@\c@c\c@\c@\c@\c@\c@1x\c@\c@\cF\c@g\c@\c@\c@\c@\c@1y\c@\cF\c@\c@c\c@\c@\c@\c@\c@1†\c@\c@\cH\c@g\c@\c@\c@\c@\c@1–\c@\cH\c@\c@c\c@\c@\c@\c@\c@1«\cH\c@\c@\c@a\c@\c@\c@\c@\c@1¹\cF\c@\c@\c@a\c@\c@\c@\c@\c@1º\c@\cF\c@\c@c\c@\c@\c@\c@\c@1Ï\c@\cH\c@\c@c\c@\c@\c@\c@\c@1ä\c@\cH\c@\c@c\c@\c@\c@\c@\c@1î\c@\cI\c@\c@c\c@\c@\c@\c@\c@1þ\c@\cI\c@\c@c\c@\c@\c@\c@\c@2\cK\c@\cI\c@\c@c\c@\c@\c@\c@\c@2\cV\c@\cI\c@\c@c\c@\c@\c@\c@\c@2&\c@\c@\c@\cIt\c@\c@\c@\c@\c@2/\c@\cI\c@\c@c\c@\c@\c@\c@\c@2;\c@\c@\cI\c@g\c@\c@\c@\c@\c@2L\c@\cI\c@\c@c\c@\c@\c@\c@\c@2\\\c@\cJ\c@\c@c\c@\c@\c@\c@\c@2c\c@\c@\cI\c@g\c@\c@\c@\c@\c@2i\c@\cJ\c@\c@c\c@\c@\c@\c@\c@2s\c@\c@\c@\cJt\c@\c@\c@\c@\c@2\c@\c@\c@\cKt\c@\c@\c@\c@\c@2’\c@\cN\c@\c@c\c@\c@\c@\c@\c@2¥\c@\cU\c@\c@c\c@\c@\c@\c@\c@2²\c@\cT\c@\c@c\c@\c@\c@\c@\c@2Ã\c@\cR\c@\c@c\c@\c@\c@\c@\c@2Ò\c@\cN\c@\c@c\c@\c@\c@\c@\c@2à\c@\cK\c@\c@c\c@\c@\c@\c@\c@2í\c@\cI\c@\c@c\c@\c@\c@\c@\c@2ÿ\cF\c@\c@\c@a\c@\c@\c@\c@\c@3\cH\cF\c@\c@\c@a\c@\c@\c@\c@\c@3\cX\c@\cF\c@\c@c\c@\c@\c@\c@\c@3\c\\c@\c@\c@\cGt\c@\c@\c@\c@\c@32\c@\c@\c@\cFt\c@\c@\c@\c@\c@36\c@\cF\c@\c@c\c@\c@\c@\c@\c@3I\c@\cH\c@\c@c\c@\c@\c@\c@\c@3T\c@\cH\c@\c@c\c@\c@\c@\c@\c@3b\cI\c@\c@\c@a\c@\c@\c@\c@\c@3r\c@\cI\c@\c@c\c@\c@\c@\c@\c@3‚\c@\c@\cJ\c@g\c@\c@\c@\c@\c@3Œ\c@\c@\cJ\c@g\c@\c@\c@\c@\c@3—\c@\c@\cJ\c@g\c@\c@\c@\c@\c@3£\c@\cJ\c@\c@c\c@\c@\c@\c@\c@3®\c@\c@\c@\cIt\c@\c@\c@\c@\c@3¼\c@\cI\c@\c@c\c@\c@\c@\c@\c@3Ç\c@\cI\c@\c@c\c@\c@\c@\c@\c@3Ó\c@\cK\c@\c@c\c@\c@\c@\c@\c@3ç\c@\cK\c@\c@c\c@\c@\c@\c@\c@3ù\c@\c@\c@\cIt\c@\c@\c@\c@\c@4\cD\c@\cJ\c@\c@c\c@\c@\c@\c@\c@4\cP\c@\cF\c@\c@c\c@\c@\c@\c@\c@4\cT\c@\c@\cF\c@g\c@\c@\c@\c@\c@4 \c@\cH\c@\c@c\c@\c@\c@\c@\c@46\c@\cH\c@\c@c\c@\c@\c@\c@\c@4C\c@\cI\c@\c@c\c@\c@\c@\c@\c@4P\c@\cI\c@\c@c\c@\c@\c@\c@\c@4_\c@\c@\c@\cFt\c@\c@\c@\c@\c@4f\c@\c@\c@\cFt\c@\c@\c@\c@\c@4y\cF\c@\c@\c@a\c@\c@\c@\c@\c@4{\c@\cF\c@\c@c\c@\c@\c@\c@\c@4Œ\c@\cH\c@\c@c\c@\c@\c@\c@\c@4Ÿ\c@\cH\c@\c@c\c@\c@\c@\c@\c@4¨\c@\c@\cI\c@g\c@\c@\c@\c@\c@4·\c@\cI\c@\c@c\c@\c@\c@\c@\c@4Â\c@\c@\cI\c@g\c@\c@\c@\c@\c@4Ì\cI\c@\c@\c@a\c@\c@\c@\c@\c@4á\c@\c@\cI\c@g\c@\c@\c@\c@\c@4ñ\c@\c@\cG\c@g\c@\c@\c@\c@\c@4ù\cG\c@\c@\c@a\c@\c@\c@\c@\c@5\cC\c@\c@\cI\c@g\c@\c@\c@\c@\c@5\cL\c@\cI\c@\c@c\c@\c@\c@\c@\c@5\c_\c@\c@\c@\cIt\c@\c@\c@\c@\c@5(\c@\c@\c@\cIt\c@\c@\c@\c@\c@57\c@\cI\c@\c@c\c@\c@\c@\c@\c@5B\cI\c@\c@\c@a\c@\c@\c@\c@\c@5N\c@\cI\c@\c@c\c@\c@\c@\c@\c@5b\c@\cL\c@\c@c\c@\c@\c@\c@\c@5l\c@\cI\c@\c@c\c@\c@\c@\c@\c@5w\c@\c@\cI\c@g\c@\c@\c@\c@\c@5Š\c@\cI\c@\c@c\c@\c@\c@\c@\c@5˜\c@\c@\cI\c@g\c@\c@\c@\c@\c@5¡\cI\c@\c@\c@a\c@\c@\c@\c@\c@5¯\cI\c@\c@\c@a\c@\c@\c@\c@\c@5¾\c@\cJ\c@\c@c\c@\c@\c@\c@\c@5É\c@\cL\c@\c@c\c@\c@\c@\c@\c@5Ø\cI\c@\c@\c@a\c@\c@\c@\c@\c@5å\c@\cJ\c@\c@c\c@\c@\c@\c@\c@5ñ\c@\cJ\c@\c@c\c@\c@\c@\c@\c@5÷\c@\c@\c@\cKt\c@\c@\c@\c@\c@6\cE\c@\cK\c@\c@c\c@\c@\c@\c@\c@6\cY\c@\cK\c@\c@c\c@\c@\c@\c@\c@6'\c@\cL\c@\c@c\c@\c@\c@\c@\c@62\c@\cJ\c@\c@c\c@\c@\c@\c@\c@6;\c@\cG\c@\c@c\c@\c@\c@\c@\c@6J\c@\cG\c@\c@c\c@\c@\c@\c@\c@6Q\c@\c@\c@\cIt\c@\c@\c@\c@\c@6b\c@\c@\c@\cGt\c@\c@\c@\c@\c@6n\c@\c@\c@\cGt\c@\c@\c@\c@\c@6€\c@\cI\c@\c@c\c@\c@\c@\c@\c@6Ž\c@\cM\c@\c@c\c@\c@\c@\c@\c@6—\c@\cI\c@\c@c\c@\c@\c@\c@\c@6ž\cI\c@\c@\c@a\c@\c@\c@\c@\c@6³\cI\c@\c@\c@a\c@\c@\c@\c@\c@6½\c@\cF\c@\c@c\c@\c@\c@\c@\c@6Ê\cF\c@\c@\c@a\c@\c@\c@\c@\c@6Õ\c@\c@\cF\c@g\c@\c@\c@\c@\c@6è\c@\cH\c@\c@c\c@\c@\c@\c@\c@6í\cH\c@\c@\c@a\c@\c@\c@\c@\c@7\cD\c@\cH\c@\c@c\c@\c@\c@\c@\c@7\cM\c@\cF\c@\c@c\c@\c@\c@" 'string' => 0..9944 4 0 0 7 0 'g' 0 0 0 18 7 0 0 0 'a' 0 0 0 26 0 0 0 7 't' 0 0 0 39 0 0 7 0 'g' 0 0 0 53 7 0 0 0 'a' 0 0 0 59 0 0 0 6 't' 0 0 0 72 0 0 0 6 't' 0 0 0 81 0 6 0 0 'c' 0 0 0 99 0 6 0 0 'c' 0 0 0 106 0 0 4 0 'g' 0 0 0 121 0 0 4 0 'g' 0 0 0 126 0 4 0 0 'c' 0 0 0 145 0 0 0 6 't' 0 0 0 163 0 0 0 6 't' 0 0 0 165 0 6 0 0 'c' 0 0 0 176 0 0 6 0 'g' 0 0 0 188 0 0 12 0 'g' 0 0 0 199 21 0 0 0 'a' 0 0 0 215 0 24 0 0 'c' 0 0 0 224 0 0 29 0 'g' 0 0 0 235 29 0 0 0 'a' 0 0 0 244 0 19 0 0 'c' 0 0 0 257 0 0 0 16 't' 0 0 0 273 0 7 0 0 'c' 0 0 0 280 0 0 0 7 't' 0 0 0 291 8 0 0 0 'a' 0 0 0 298 0 0 13 0 'g' 0 0 0 315 13 0 0 0 'a' 0 0 0 320 0 0 22 0 'g' 0 0 0 332 0 0 22 0 'g' 0 0 0 347 25 0 0 0 'a' 0 0 0 355 0 0 0 29 't' 0 0 0 370 0 29 0 0 'c' 0 0 0 382 0 34 0 0 'c' 0 0 0 394 0 32 0 0 'c' 0 0 0 406 0 35 0 0 'c' 0 0 0 414 35 0 0 0 'a' 0 0 0 424 0 0 0 35 't' 0 0 0 438 0 0 0 35 't' 0 0 0 450 0 0 0 40 't' 0 0 0 462 0 0 0 40 't' 0 0 0 474 0 0 0 51 't' 0 0 0 484 51 0 0 0 'a' 0 0 0 495 0 0 0 51 't' 0 0 0 505 45 0 0 0 'a' 0 0 0 517 0 0 45 0 'g' 0 0 0 530 0 0 0 45 't' 0 0 0 544 0 0 0 56 't' 0 0 0 556 0 0 0 40 't' 0 0 0 568 0 0 0 40 't' 0 0 0 580 0 0 0 40 't' 0 0 0 590 40 0 0 0 'a' 0 0 0 602 0 0 0 40 't' 0 0 0 616 0 40 0 0 'c' 0 0 0 628 0 0 0 46 't' 0 0 0 641 0 0 0 46 't' 0 0 0 653 0 0 56 0 'g' 0 0 0 664 0 0 0 42 't' 0 0 0 676 42 0 0 0 'a' 0 0 0 689 56 0 0 0 'a' 0 0 0 700 0 0 0 45 't' 0 0 0 711 40 0 0 0 'a' 0 0 0 724 0 0 40 0 'g' 0 0 0 739 40 0 0 0 'a' 0 0 0 750 0 0 0 40 't' 0 0 0 761 0 0 40 0 'g' 0 0 0 774 0 0 0 42 't' 0 0 0 787 0 0 0 42 't' 0 0 0 800 0 0 0 35 't' 0 0 0 811 33 0 0 0 'a' 0 0 0 823 0 0 33 0 'g' 0 0 0 839 35 0 0 0 'a' 0 0 0 849 0 0 0 35 't' 0 0 0 862 0 0 0 35 't' 0 0 0 874 0 0 0 46 't' 0 0 0 887 0 0 0 56 't' 0 0 0 900 0 0 0 56 't' 0 0 0 913 0 40 0 0 'c' 0 0 0 925 0 0 40 0 'g' 0 0 0 936 0 0 0 40 't' 0 0 0 950 0 0 0 40 't' 0 0 0 962 0 0 34 0 'g' 0 0 0 974 0 0 0 33 't' 0 0 0 986 33 0 0 0 'a' 0 0 0 999 24 0 0 0 'a' 0 0 0 1011 0 0 0 24 't' 0 0 0 1025 0 0 0 12 't' 0 0 0 1035 14 0 0 0 'a' 0 0 0 1049 0 0 0 9 't' 0 0 0 1062 0 0 0 11 't' 0 0 0 1075 0 0 0 16 't' 0 0 0 1088 0 0 0 31 't' 0 0 0 1101 0 31 0 0 'c' 0 0 0 1113 0 0 0 48 't' 0 0 0 1126 0 0 0 48 't' 0 0 0 1138 0 0 0 48 't' 0 0 0 1150 48 0 0 0 'a' 0 0 0 1161 0 0 0 40 't' 0 0 0 1174 0 0 0 20 't' 0 0 0 1187 0 0 19 0 'g' 0 0 0 1198 0 0 0 8 't' 0 0 0 1221 0 0 0 6 't' 0 0 0 1225 0 0 6 0 'g' 0 0 0 1238 6 0 0 0 'a' 0 0 0 1251 8 0 0 0 'a' 0 0 0 1264 21 0 0 0 'a' 0 0 0 1275 0 0 0 25 't' 0 0 0 1288 0 0 0 30 't' 0 0 0 1298 32 0 0 0 'a' 0 0 0 1311 0 0 32 0 'g' 0 0 0 1325 0 0 0 33 't' 0 0 0 1336 37 0 0 0 'a' 0 0 0 1349 0 0 0 40 't' 0 0 0 1362 0 40 0 0 'c' 0 0 0 1376 0 0 0 56 't' 0 0 0 1389 0 56 0 0 'c' 0 0 0 1402 0 0 0 56 't' 0 0 0 1414 0 0 56 0 'g' 0 0 0 1426 0 0 42 0 'g' 0 0 0 1438 0 0 33 0 'g' 0 0 0 1451 0 0 0 27 't' 0 0 0 1463 15 0 0 0 'a' 0 0 0 1476 15 0 0 0 'a' 0 0 0 1488 0 0 0 15 't' 0 0 0 1502 0 0 0 33 't' 0 0 0 1515 0 0 0 33 't' 0 0 0 1526 42 0 0 0 'a' 0 0 0 1538 0 0 0 56 't' 0 0 0 1551 0 48 0 0 'c' 0 0 0 1562 44 0 0 0 'a' 0 0 0 1575 0 0 0 42 't' 0 0 0 1587 33 0 0 0 'a' 0 0 0 1600 0 0 0 33 't' 0 0 0 1614 0 0 0 20 't' 0 0 0 1626 0 22 0 0 'c' 0 0 0 1639 0 0 0 13 't' 0 0 0 1652 0 13 0 0 'c' 0 0 0 1664 0 0 0 13 't' 0 0 0 1677 0 0 22 0 'g' 0 0 0 1689 0 0 22 0 'g' 0 0 0 1703 42 0 0 0 'a' 0 0 0 1715 44 0 0 0 'a' 0 0 0 1728 42 0 0 0 'a' 0 0 0 1741 42 0 0 0 'a' 0 0 0 1753 0 0 0 42 't' 0 0 0 1764 0 0 42 0 'g' 0 0 0 1778 42 0 0 0 'a' 0 0 0 1790 0 0 0 42 't' 0 0 0 1803 0 0 0 42 't' 0 0 0 1816 0 0 0 38 't' 0 0 0 1827 38 0 0 0 'a' 0 0 0 1838 0 45 0 0 'c' 0 0 0 1853 0 0 0 45 't' 0 0 0 1864 45 0 0 0 'a' 0 0 0 1877 0 0 0 40 't' 0 0 0 1891 0 37 0 0 'c' 0 0 0 1902 37 0 0 0 'a' 0 0 0 1914 0 36 0 0 'c' 0 0 0 1929 0 0 0 40 't' 0 0 0 1940 35 0 0 0 'a' 0 0 0 1953 0 0 37 0 'g' 0 0 0 1968 38 0 0 0 'a' 0 0 0 1979 0 0 0 40 't' 0 0 0 1990 40 0 0 0 'a' 0 0 0 2003 0 42 0 0 'c' 0 0 0 2017 0 0 0 40 't' 0 0 0 2031 0 0 0 45 't' 0 0 0 2043 0 38 0 0 'c' 0 0 0 2053 40 0 0 0 'a' 0 0 0 2066 0 0 0 42 't' 0 0 0 2079 37 0 0 0 'a' 0 0 0 2092 40 0 0 0 'a' 0 0 0 2104 0 0 40 0 'g' 0 0 0 2119 40 0 0 0 'a' 0 0 0 2130 0 0 0 40 't' 0 0 0 2143 0 0 0 45 't' 0 0 0 2155 0 0 0 56 't' 0 0 0 2166 46 0 0 0 'a' 0 0 0 2179 0 0 0 42 't' 0 0 0 2190 42 0 0 0 'a' 0 0 0 2204 42 0 0 0 'a' 0 0 0 2217 0 0 0 43 't' 0 0 0 2231 0 56 0 0 'c' 0 0 0 2244 0 0 0 56 't' 0 0 0 2257 0 0 0 43 't' 0 0 0 2269 0 0 0 51 't' 0 0 0 2281 45 0 0 0 'a' 0 0 0 2292 0 0 0 40 't' 0 0 0 2306 0 0 0 40 't' 0 0 0 2316 40 0 0 0 'a' 0 0 0 2330 0 0 0 40 't' 0 0 0 2343 0 0 40 0 'g' 0 0 0 2355 44 0 0 0 'a' 0 0 0 2368 44 0 0 0 'a' 0 0 0 2381 56 0 0 0 'a' 0 0 0 2395 39 0 0 0 'a' 0 0 0 2407 0 0 0 40 't' 0 0 0 2420 0 35 0 0 'c' 0 0 0 2430 36 0 0 0 'a' 0 0 0 2443 0 0 0 36 't' 0 0 0 2456 0 40 0 0 'c' 0 0 0 2470 0 0 0 42 't' 0 0 0 2483 0 42 0 0 'c' 0 0 0 2496 0 0 0 42 't' 0 0 0 2507 50 0 0 0 'a' 0 0 0 2519 0 0 0 50 't' 0 0 0 2532 0 0 0 44 't' 0 0 0 2545 0 0 0 47 't' 0 0 0 2557 0 0 0 44 't' 0 0 0 2570 0 0 0 56 't' 0 0 0 2582 0 56 0 0 'c' 0 0 0 2593 44 0 0 0 'a' 0 0 0 2606 44 0 0 0 'a' 0 0 0 2619 42 0 0 0 'a' 0 0 0 2632 0 0 0 42 't' 0 0 0 2645 0 0 0 40 't' 0 0 0 2655 40 0 0 0 'a' 0 0 0 2668 0 0 0 40 't' 0 0 0 2682 0 0 0 37 't' 0 0 0 2692 37 0 0 0 'a' 0 0 0 2705 0 0 0 40 't' 0 0 0 2719 0 0 0 40 't' 0 0 0 2729 40 0 0 0 'a' 0 0 0 2743 0 0 0 45 't' 0 0 0 2754 37 0 0 0 'a' 0 0 0 2767 0 0 0 40 't' 0 0 0 2780 0 35 0 0 'c' 0 0 0 2795 0 0 0 35 't' 0 0 0 2806 35 0 0 0 'a' 0 0 0 2818 0 0 0 35 't' 0 0 0 2832 0 40 0 0 'c' 0 0 0 2842 40 0 0 0 'a' 0 0 0 2856 40 0 0 0 'a' 0 0 0 2869 40 0 0 0 'a' 0 0 0 2881 0 0 44 0 'g' 0 0 0 2894 0 0 0 44 't' 0 0 0 2907 0 0 0 36 't' 0 0 0 2920 0 0 0 36 't' 0 0 0 2931 0 19 0 0 'c' 0 0 0 2944 0 0 0 25 't' 0 0 0 2958 0 0 14 0 'g' 0 0 0 2969 0 0 0 33 't' 0 0 0 2982 0 33 0 0 'c' 0 0 0 2995 0 0 0 35 't' 0 0 0 3008 0 0 0 35 't' 0 0 0 3021 0 35 0 0 'c' 0 0 0 3031 40 0 0 0 'a' 0 0 0 3043 0 0 0 36 't' 0 0 0 3057 0 0 0 38 't' 0 0 0 3068 37 0 0 0 'a' 0 0 0 3081 0 0 0 37 't' 0 0 0 3092 37 0 0 0 'a' 0 0 0 3106 0 0 0 42 't' 0 0 0 3118 0 42 0 0 'c' 0 0 0 3132 0 0 0 42 't' 0 0 0 3143 42 0 0 0 'a' 0 0 0 3156 0 0 0 35 't' 0 0 0 3170 0 0 0 35 't' 0 0 0 3181 35 0 0 0 'a' 0 0 0 3195 0 0 42 0 'g' 0 0 0 3208 0 37 0 0 'c' 0 0 0 3219 42 0 0 0 'a' 0 0 0 3232 0 0 0 36 't' 0 0 0 3244 36 0 0 0 'a' 0 0 0 3256 0 0 0 36 't' 0 0 0 3271 0 35 0 0 'c' 0 0 0 3284 0 0 0 35 't' 0 0 0 3295 35 0 0 0 'a' 0 0 0 3308 0 0 0 42 't' 0 0 0 3321 0 42 0 0 'c' 0 0 0 3334 0 0 0 42 't' 0 0 0 3347 0 0 0 42 't' 0 0 0 3361 0 0 0 42 't' 0 0 0 3372 42 0 0 0 'a' 0 0 0 3384 0 0 0 42 't' 0 0 0 3397 0 56 0 0 'c' 0 0 0 3410 0 0 0 42 't' 0 0 0 3423 0 0 0 42 't' 0 0 0 3436 0 0 0 42 't' 0 0 0 3447 42 0 0 0 'a' 0 0 0 3459 0 0 0 42 't' 0 0 0 3471 0 37 0 0 'c' 0 0 0 3485 0 37 0 0 'c' 0 0 0 3498 0 42 0 0 'c' 0 0 0 3511 0 0 0 42 't' 0 0 0 3522 42 0 0 0 'a' 0 0 0 3535 0 0 0 42 't' 0 0 0 3547 0 42 0 0 'c' 0 0 0 3558 42 0 0 0 'a' 0 0 0 3572 0 34 0 0 'c' 0 0 0 3586 0 0 0 34 't' 0 0 0 3597 34 0 0 0 'a' 0 0 0 3610 0 0 0 42 't' 0 0 0 3621 31 0 0 0 'a' 0 0 0 3634 0 0 0 32 't' 0 0 0 3646 0 28 0 0 'c' 0 0 0 3662 0 0 0 28 't' 0 0 0 3673 28 0 0 0 'a' 0 0 0 3686 0 0 0 31 't' 0 0 0 3699 0 29 0 0 'c' 0 0 0 3710 33 0 0 0 'a' 0 0 0 3725 0 0 0 29 't' 0 0 0 3735 25 0 0 0 'a' 0 0 0 3749 0 0 0 17 't' 0 0 0 3762 0 0 24 0 'g' 0 0 0 3776 0 0 21 0 'g' 0 0 0 3789 0 0 0 17 't' 0 0 0 3799 0 0 0 9 't' 0 0 0 3812 0 8 0 0 'c' 0 0 0 3826 10 0 0 0 'a' 0 0 0 3840 0 0 0 13 't' 0 0 0 3853 0 12 0 0 'c' 0 0 0 3865 0 0 0 17 't' 0 0 0 3880 0 0 0 10 't' 0 0 0 3892 0 0 9 0 'g' 0 0 0 3902 0 0 0 9 't' 0 0 0 3916 0 0 0 9 't' 0 0 0 3924 0 10 0 0 'c' 0 0 0 3941 8 0 0 0 'a' 0 0 0 3957 11 0 0 0 'a' 0 0 0 3962 0 11 0 0 'c' 0 0 0 3979 0 11 0 0 'c' 0 0 0 3992 0 0 8 0 'g' 0 0 0 4005 9 0 0 0 'a' 0 0 0 4019 0 0 0 9 't' 0 0 0 4037 0 9 0 0 'c' 0 0 0 4050 8 0 0 0 'a' 0 0 0 4060 0 0 7 0 'g' 0 0 0 4076 10 0 0 0 'a' 0 0 0 4086 0 8 0 0 'c' 0 0 0 4101 0 0 0 8 't' 0 0 0 4113 0 6 0 0 'c' 0 0 0 4114 0 0 6 0 'g' 0 0 0 4134 8 0 0 0 'a' 0 0 0 4147 0 0 0 8 't' 0 0 0 4164 0 0 0 12 't' 0 0 0 4180 0 10 0 0 'c' 0 0 0 4187 0 0 9 0 'g' 0 0 0 4195 0 9 0 0 'c' 0 0 0 4206 0 9 0 0 'c' 0 0 0 4213 9 0 0 0 'a' 0 0 0 4226 0 0 0 9 't' 0 0 0 4237 0 9 0 0 'c' 0 0 0 4254 0 0 9 0 'g' 0 0 0 4261 0 9 0 0 'c' 0 0 0 4277 0 9 0 0 'c' 0 0 0 4295 0 0 0 9 't' 0 0 0 4309 0 11 0 0 'c' 0 0 0 4319 0 0 0 10 't' 0 0 0 4330 9 0 0 0 'a' 0 0 0 4343 9 0 0 0 'a' 0 0 0 4351 0 9 0 0 'c' 0 0 0 4367 0 0 13 0 'g' 0 0 0 4381 0 0 9 0 'g' 0 0 0 4396 11 0 0 0 'a' 0 0 0 4407 0 0 0 9 't' 0 0 0 4421 0 0 9 0 'g' 0 0 0 4435 0 0 7 0 'g' 0 0 0 4440 0 7 0 0 'c' 0 0 0 4454 0 10 0 0 'c' 0 0 0 4459 0 0 8 0 'g' 0 0 0 4472 0 8 0 0 'c' 0 0 0 4489 0 0 0 8 't' 0 0 0 4499 0 9 0 0 'c' 0 0 0 4517 0 9 0 0 'c' 0 0 0 4528 0 9 0 0 'c' 0 0 0 4540 0 9 0 0 'c' 0 0 0 4557 0 9 0 0 'c' 0 0 0 4567 0 0 0 9 't' 0 0 0 4590 0 9 0 0 'c' 0 0 0 4599 0 0 0 9 't' 0 0 0 4612 0 9 0 0 'c' 0 0 0 4621 9 0 0 0 'a' 0 0 0 4642 0 0 0 9 't' 0 0 0 4652 9 0 0 0 'a' 0 0 0 4669 0 7 0 0 'c' 0 0 0 4677 0 8 0 0 'c' 0 0 0 4690 0 0 0 9 't' 0 0 0 4704 0 9 0 0 'c' 0 0 0 4716 0 0 9 0 'g' 0 0 0 4734 0 7 0 0 'c' 0 0 0 4744 0 0 0 7 't' 0 0 0 4762 0 7 0 0 'c' 0 0 0 4769 0 7 0 0 'c' 0 0 0 4781 0 7 0 0 'c' 0 0 0 4792 0 7 0 0 'c' 0 0 0 4801 0 0 0 9 't' 0 0 0 4818 0 9 0 0 'c' 0 0 0 4827 0 0 8 0 'g' 0 0 0 4844 10 0 0 0 'a' 0 0 0 4853 0 8 0 0 'c' 0 0 0 4858 8 0 0 0 'a' 0 0 0 4875 0 0 0 8 't' 0 0 0 4888 0 11 0 0 'c' 0 0 0 4903 0 10 0 0 'c' 0 0 0 4914 0 11 0 0 'c' 0 0 0 4924 0 10 0 0 'c' 0 0 0 4937 0 11 0 0 'c' 0 0 0 4951 0 0 9 0 'g' 0 0 0 4960 0 0 0 8 't' 0 0 0 4971 0 6 0 0 'c' 0 0 0 4988 0 0 0 8 't' 0 0 0 5002 0 8 0 0 'c' 0 0 0 5006 0 0 8 0 'g' 0 0 0 5027 0 8 0 0 'c' 0 0 0 5036 0 8 0 0 'c' 0 0 0 5048 9 0 0 0 'a' 0 0 0 5062 0 11 0 0 'c' 0 0 0 5073 0 20 0 0 'c' 0 0 0 5082 0 20 0 0 'c' 0 0 0 5097 0 0 0 16 't' 0 0 0 5111 13 0 0 0 'a' 0 0 0 5121 0 0 0 6 't' 0 0 0 5122 0 6 0 0 'c' 0 0 0 5141 0 8 0 0 'c' 0 0 0 5156 0 0 8 0 'g' 0 0 0 5170 0 9 0 0 'c' 0 0 0 5186 0 10 0 0 'c' 0 0 0 5202 0 10 0 0 'c' 0 0 0 5213 0 10 0 0 'c' 0 0 0 5225 0 11 0 0 'c' 0 0 0 5237 0 0 0 13 't' 0 0 0 5249 0 0 0 10 't' 0 0 0 5259 0 9 0 0 'c' 0 0 0 5268 9 0 0 0 'a' 0 0 0 5281 0 0 0 11 't' 0 0 0 5297 0 11 0 0 'c' 0 0 0 5313 15 0 0 0 'a' 0 0 0 5326 0 21 0 0 'c' 0 0 0 5337 0 17 0 0 'c' 0 0 0 5346 0 13 0 0 'c' 0 0 0 5359 0 9 0 0 'c' 0 0 0 5379 0 9 0 0 'c' 0 0 0 5394 0 10 0 0 'c' 0 0 0 5404 0 9 0 0 'c' 0 0 0 5413 0 0 0 9 't' 0 0 0 5430 0 0 0 8 't' 0 0 0 5443 8 0 0 0 'a' 0 0 0 5458 0 0 0 8 't' 0 0 0 5460 0 9 0 0 'c' 0 0 0 5475 0 9 0 0 'c' 0 0 0 5496 9 0 0 0 'a' 0 0 0 5507 0 6 0 0 'c' 0 0 0 5510 6 0 0 0 'a' 0 0 0 5529 0 8 0 0 'c' 0 0 0 5543 0 8 0 0 'c' 0 0 0 5556 0 9 0 0 'c' 0 0 0 5564 0 0 0 13 't' 0 0 0 5581 0 9 0 0 'c' 0 0 0 5595 9 0 0 0 'a' 0 0 0 5603 0 9 0 0 'c' 0 0 0 5620 0 9 0 0 'c' 0 0 0 5635 0 9 0 0 'c' 0 0 0 5650 0 9 0 0 'c' 0 0 0 5659 0 9 0 0 'c' 0 0 0 5675 0 9 0 0 'c' 0 0 0 5683 0 0 9 0 'g' 0 0 0 5691 0 9 0 0 'c' 0 0 0 5707 9 0 0 0 'a' 0 0 0 5724 0 0 0 9 't' 0 0 0 5736 0 11 0 0 'c' 0 0 0 5753 0 0 8 0 'g' 0 0 0 5763 0 8 0 0 'c' 0 0 0 5775 0 0 6 0 'g' 0 0 0 5777 0 6 0 0 'c' 0 0 0 5798 6 0 0 0 'a' 0 0 0 5812 0 6 0 0 'c' 0 0 0 5828 0 13 0 0 'c' 0 0 0 5839 0 10 0 0 'c' 0 0 0 5848 10 0 0 0 'a' 0 0 0 5868 0 8 0 0 'c' 0 0 0 5876 0 0 8 0 'g' 0 0 0 5888 6 0 0 0 'a' 0 0 0 5888 0 6 0 0 'c' 0 0 0 5906 0 8 0 0 'c' 0 0 0 5929 9 0 0 0 'a' 0 0 0 5938 0 10 0 0 'c' 0 0 0 5952 0 10 0 0 'c' 0 0 0 5968 0 10 0 0 'c' 0 0 0 5979 0 0 9 0 'g' 0 0 0 5993 9 0 0 0 'a' 0 0 0 6007 9 0 0 0 'a' 0 0 0 6023 0 0 10 0 'g' 0 0 0 6040 10 0 0 0 'a' 0 0 0 6051 8 0 0 0 'a' 0 0 0 6063 0 8 0 0 'c' 0 0 0 6078 0 6 0 0 'c' 0 0 0 6080 0 0 6 0 'g' 0 0 0 6102 0 6 0 0 'c' 0 0 0 6110 0 6 0 0 'c' 0 0 0 6125 0 11 0 0 'c' 0 0 0 6142 0 0 0 9 't' 0 0 0 6152 0 0 0 8 't' 0 0 0 6166 12 0 0 0 'a' 0 0 0 6175 0 9 0 0 'c' 0 0 0 6184 0 0 0 9 't' 0 0 0 6201 0 9 0 0 'c' 0 0 0 6211 0 12 0 0 'c' 0 0 0 6221 0 10 0 0 'c' 0 0 0 6227 9 0 0 0 'a' 0 0 0 6245 9 0 0 0 'a' 0 0 0 6264 0 0 9 0 'g' 0 0 0 6277 0 0 0 8 't' 0 0 0 6287 8 0 0 0 'a' 0 0 0 6306 0 6 0 0 'c' 0 0 0 6309 0 0 6 0 'g' 0 0 0 6317 0 6 0 0 'c' 0 0 0 6334 0 8 0 0 'c' 0 0 0 6349 0 9 0 0 'c' 0 0 0 6363 0 9 0 0 'c' 0 0 0 6373 0 0 9 0 'g' 0 0 0 6390 9 0 0 0 'a' 0 0 0 6404 0 9 0 0 'c' 0 0 0 6418 0 9 0 0 'c' 0 0 0 6432 0 0 0 9 't' 0 0 0 6440 0 8 0 0 'c' 0 0 0 6456 0 4 0 0 'c' 0 0 0 6463 4 0 0 0 'a' 0 0 0 6486 0 0 0 8 't' 0 0 0 6495 0 8 0 0 'c' 0 0 0 6504 9 0 0 0 'a' 0 0 0 6518 0 11 0 0 'c' 0 0 0 6529 0 16 0 0 'c' 0 0 0 6540 0 11 0 0 'c' 0 0 0 6548 0 0 0 9 't' 0 0 0 6559 8 0 0 0 'a' 0 0 0 6572 0 0 0 8 't' 0 0 0 6589 0 0 8 0 'g' 0 0 0 6594 0 8 0 0 'c' 0 0 0 6606 0 0 6 0 'g' 0 0 0 6622 0 0 6 0 'g' 0 0 0 6641 0 0 0 8 't' 0 0 0 6645 8 0 0 0 'a' 0 0 0 6660 0 8 0 0 'c' 0 0 0 6671 0 9 0 0 'c' 0 0 0 6682 11 0 0 0 'a' 0 0 0 6694 0 11 0 0 'c' 0 0 0 6710 0 0 0 11 't' 0 0 0 6719 0 10 0 0 'c' 0 0 0 6732 0 6 0 0 'c' 0 0 0 6746 0 6 0 0 'c' 0 0 0 6751 6 0 0 0 'a' 0 0 0 6772 0 6 0 0 'c' 0 0 0 6780 0 6 0 0 'c' 0 0 0 6799 6 0 0 0 'a' 0 0 0 6802 0 6 0 0 'c' 0 0 0 6813 6 0 0 0 'a' 0 0 0 6815 0 6 0 0 'c' 0 0 0 6836 0 8 0 0 'c' 0 0 0 6855 0 6 0 0 'c' 0 0 0 6865 7 0 0 0 'a' 0 0 0 6881 0 0 9 0 'g' 0 0 0 6902 0 0 0 9 't' 0 0 0 6910 0 9 0 0 'c' 0 0 0 6930 0 9 0 0 'c' 0 0 0 6943 0 0 0 9 't' 0 0 0 6959 11 0 0 0 'a' 0 0 0 6967 0 10 0 0 'c' 0 0 0 6977 0 0 0 14 't' 0 0 0 6994 0 0 0 10 't' 0 0 0 7005 0 0 0 13 't' 0 0 0 7014 0 9 0 0 'c' 0 0 0 7022 0 0 9 0 'g' 0 0 0 7042 0 8 0 0 'c' 0 0 0 7059 0 8 0 0 'c' 0 0 0 7080 0 8 0 0 'c' 0 0 0 7086 0 0 8 0 'g' 0 0 0 7102 0 8 0 0 'c' 0 0 0 7116 9 0 0 0 'a' 0 0 0 7130 0 9 0 0 'c' 0 0 0 7137 11 0 0 0 'a' 0 0 0 7156 0 0 0 11 't' 0 0 0 7170 0 11 0 0 'c' 0 0 0 7182 0 0 8 0 'g' 0 0 0 7190 0 0 7 0 'g' 0 0 0 7202 0 13 0 0 'c' 0 0 0 7217 0 10 0 0 'c' 0 0 0 7235 0 12 0 0 'c' 0 0 0 7251 0 9 0 0 'c' 0 0 0 7263 0 0 8 0 'g' 0 0 0 7279 0 8 0 0 'c' 0 0 0 7289 0 0 0 11 't' 0 0 0 7305 0 0 0 11 't' 0 0 0 7321 0 8 0 0 'c' 0 0 0 7331 6 0 0 0 'a' 0 0 0 7344 0 0 8 0 'g' 0 0 0 7361 6 0 0 0 'a' 0 0 0 7364 0 6 0 0 'c' 0 0 0 7383 9 0 0 0 'a' 0 0 0 7398 0 0 6 0 'g' 0 0 0 7401 0 6 0 0 'c' 0 0 0 7410 0 0 0 9 't' 0 0 0 7425 0 13 0 0 'c' 0 0 0 7442 0 10 0 0 'c' 0 0 0 7460 0 8 0 0 'c' 0 0 0 7478 8 0 0 0 'a' 0 0 0 7500 6 0 0 0 'a' 0 0 0 7506 0 6 0 0 'c' 0 0 0 7523 0 0 0 8 't' 0 0 0 7529 9 0 0 0 'a' 0 0 0 7544 0 7 0 0 'c' 0 0 0 7550 0 0 7 0 'g' 0 0 0 7562 0 12 0 0 'c' 0 0 0 7577 12 0 0 0 'a' 0 0 0 7595 6 0 0 0 'a' 0 0 0 7597 0 6 0 0 'c' 0 0 0 7612 0 8 0 0 'c' 0 0 0 7633 0 8 0 0 'c' 0 0 0 7647 9 0 0 0 'a' 0 0 0 7661 0 6 0 0 'c' 0 0 0 7668 0 0 8 0 'g' 0 0 0 7679 0 8 0 0 'c' 0 0 0 7694 0 0 0 8 't' 0 0 0 7711 0 0 0 6 't' 0 0 0 7716 0 0 6 0 'g' 0 0 0 7735 0 0 0 8 't' 0 0 0 7752 0 0 0 13 't' 0 0 0 7758 0 11 0 0 'c' 0 0 0 7772 0 0 0 6 't' 0 0 0 7781 0 0 0 6 't' 0 0 0 7808 0 0 6 0 'g' 0 0 0 7811 0 0 0 6 't' 0 0 0 7822 0 0 0 6 't' 0 0 0 7838 0 6 0 0 'c' 0 0 0 7846 7 0 0 0 'a' 0 0 0 7860 0 7 0 0 'c' 0 0 0 7872 6 0 0 0 'a' 0 0 0 7885 0 6 0 0 'c' 0 0 0 7904 0 0 0 6 't' 0 0 0 7906 0 6 0 0 'c' 0 0 0 7910 0 0 6 0 'g' 0 0 0 7930 6 0 0 0 'a' 0 0 0 7946 6 0 0 0 'a' 0 0 0 7963 0 0 0 9 't' 0 0 0 7973 9 0 0 0 'a' 0 0 0 7987 0 8 0 0 'c' 0 0 0 7994 0 0 0 10 't' 0 0 0 8009 0 6 0 0 'c' 0 0 0 8013 0 0 6 0 'g' 0 0 0 8029 6 0 0 0 'a' 0 0 0 8045 6 0 0 0 'a' 0 0 0 8055 0 0 0 6 't' 0 0 0 8068 0 9 0 0 'c' 0 0 0 8087 0 0 0 6 't' 0 0 0 8091 0 6 0 0 'c' 0 0 0 8106 0 0 0 8 't' 0 0 0 8126 0 6 0 0 'c' 0 0 0 8128 6 0 0 0 'a' 0 0 0 8144 0 0 0 8 't' 0 0 0 8161 0 0 0 8 't' 0 0 0 8169 10 0 0 0 'a' 0 0 0 8191 0 4 0 0 'c' 0 0 0 8200 0 0 0 4 't' 0 0 0 8214 0 4 0 0 'c' 0 0 0 8223 0 8 0 0 'c' 0 0 0 8237 0 0 9 0 'g' 0 0 0 8250 0 9 0 0 'c' 0 0 0 8259 0 0 12 0 'g' 0 0 0 8277 0 0 12 0 'g' 0 0 0 8285 10 0 0 0 'a' 0 0 0 8300 0 9 0 0 'c' 0 0 0 8309 0 0 0 8 't' 0 0 0 8320 0 8 0 0 'c' 0 0 0 8340 0 6 0 0 'c' 0 0 0 8341 0 0 6 0 'g' 0 0 0 8360 0 8 0 0 'c' 0 0 0 8376 0 6 0 0 'c' 0 0 0 8385 0 0 6 0 'g' 0 0 0 8397 0 6 0 0 'c' 0 0 0 8398 6 0 0 0 'a' 0 0 0 8417 0 8 0 0 'c' 0 0 0 8436 0 8 0 0 'c' 0 0 0 8442 0 0 0 4 't' 0 0 0 8462 0 0 4 0 'g' 0 0 0 8480 0 0 0 4 't' 0 0 0 8488 0 0 6 0 'g' 0 0 0 8504 0 6 0 0 'c' 0 0 0 8509 6 0 0 0 'a' 0 0 0 8518 0 6 0 0 'c' 0 0 0 8526 0 6 0 0 'c' 0 0 0 8543 9 0 0 0 'a' 0 0 0 8563 0 0 0 7 't' 0 0 0 8575 0 0 0 8 't' 0 0 0 8590 9 0 0 0 'a' 0 0 0 8606 8 0 0 0 'a' 0 0 0 8622 0 8 0 0 'c' 0 0 0 8635 0 0 0 8 't' 0 0 0 8645 0 0 10 0 'g' 0 0 0 8656 0 0 0 10 't' 0 0 0 8666 0 0 10 0 'g' 0 0 0 8679 0 0 0 8 't' 0 0 0 8690 6 0 0 0 'a' 0 0 0 8704 0 0 6 0 'g' 0 0 0 8724 0 8 0 0 'c' 0 0 0 8728 0 0 8 0 'g' 0 0 0 8743 0 8 0 0 'c' 0 0 0 8757 0 9 0 0 'c' 0 0 0 8765 0 0 0 9 't' 0 0 0 8785 0 0 6 0 'g' 0 0 0 8791 6 0 0 0 'a' 0 0 0 8812 12 0 0 0 'a' 0 0 0 8818 0 6 0 0 'c' 0 0 0 8832 0 6 0 0 'c' 0 0 0 8842 0 0 8 0 'g' 0 0 0 8856 0 0 9 0 'g' 0 0 0 8876 0 9 0 0 'c' 0 0 0 8886 7 0 0 0 'a' 0 0 0 8893 0 7 0 0 'c' 0 0 0 8911 0 9 0 0 'c' 0 0 0 8927 0 0 0 9 't' 0 0 0 8935 0 9 0 0 'c' 0 0 0 8948 0 0 0 9 't' 0 0 0 8965 0 0 7 0 'g' 0 0 0 8971 7 0 0 0 'a' 0 0 0 8982 0 0 0 9 't' 0 0 0 8998 0 0 0 9 't' 0 0 0 9005 9 0 0 0 'a' 0 0 0 9020 0 10 0 0 'c' 0 0 0 9032 0 8 0 0 'c' 0 0 0 9040 7 0 0 0 'a' 0 0 0 9052 0 9 0 0 'c' 0 0 0 9067 0 0 0 9 't' 0 0 0 9090 0 0 0 7 't' 0 0 0 9098 0 7 0 0 'c' 0 0 0 9110 0 7 0 0 'c' 0 0 0 9118 0 0 0 7 't' 0 0 0 9127 0 9 0 0 'c' 0 0 0 9150 0 7 0 0 'c' 0 0 0 9160 6 0 0 0 'a' 0 0 0 9169 0 6 0 0 'c' 0 0 0 9183 0 6 0 0 'c' 0 0 0 9189 6 0 0 0 'a' 0 0 0 9209 0 0 8 0 'g' 0 0 0 9220 0 8 0 0 'c' 0 0 0 9239 7 0 0 0 'a' 0 0 0 9248 0 7 0 0 'c' 0 0 0 9268 9 0 0 0 'a' 0 0 0 9280 0 0 9 0 'g' 0 0 0 9295 0 0 0 9 't' 0 0 0 9304 0 13 0 0 'c' 0 0 0 9318 0 8 0 0 'c' 0 0 0 9333 0 0 0 8 't' 0 0 0 9348 6 0 0 0 'a' 0 0 0 9351 0 0 0 6 't' 0 0 0 9359 0 0 0 9 't' 0 0 0 9377 6 0 0 0 'a' 0 0 0 9387 0 7 0 0 'c' 0 0 0 9405 0 7 0 0 'c' 0 0 0 9417 0 0 8 0 'g' 0 0 0 9426 0 9 0 0 'c' 0 0 0 9435 8 0 0 0 'a' 0 0 0 9446 0 0 0 8 't' 0 0 0 9467 0 0 6 0 'g' 0 0 0 9472 0 0 0 6 't' 0 0 0 9489 0 6 0 0 'c' 0 0 0 9492 0 0 6 0 'g' 0 0 0 9507 0 8 0 0 'c' 0 0 0 9525 0 0 0 6 't' 0 0 0 9529 0 6 0 0 'c' 0 0 0 9548 0 0 0 6 't' 0 0 0 9554 0 0 6 0 'g' 0 0 0 9556 0 6 0 0 'c' 0 0 0 9568 0 0 0 8 't' 0 0 0 9588 6 0 0 0 'a' 0 0 0 9603 7 0 0 0 'a' 0 0 0 9623 0 0 6 0 'g' 0 0 0 9630 6 0 0 0 'a' 0 0 0 9646 0 6 0 0 'c' 0 0 0 9652 7 0 0 0 'a' 0 0 0 9666 0 0 7 0 'g' 0 0 0 9682 0 0 0 7 't' 0 0 0 9697 0 0 9 0 'g' 0 0 0 9709 0 9 0 0 'c' 0 0 0 9715 10 0 0 0 'a' 0 0 0 9731 9 0 0 0 'a' 0 0 0 9747 0 0 11 0 'g' 0 0 0 9753 11 0 0 0 'a' 0 0 0 9764 0 14 0 0 'c' 0 0 0 9775 0 0 0 13 't' 0 0 0 9791 0 13 0 0 'c' 0 0 0 9804 0 0 0 9 't' 0 0 0 9820 0 0 9 0 'g' 0 0 0 9827 0 9 0 0 'c' 0 0 0 9847 0 0 6 0 'g' 0 0 0 9856 0 0 6 0 'g' 0 0 0 9878 0 0 0 8 't' 0 0 0 9883 0 8 0 0 'c' 0 0 0 9893 0 0 8 0 'g' 0 0 0 9909 0 8 0 0 'c' 0 0 0 9927 0 0 0 9 't' 0 0 0 9936 0 14 0 0 'c' 0 0 0 9944 0 0 0 10 't' 0 0 0 9958 0 0 9 0 'g' 0 0 0 9978 9 0 0 0 'a' 0 0 0 9986 0 7 0 0 'c' 0 0 0 9994 0 10 0 0 'c' 0 0 0 10012 0 9 0 0 'c' 0 0 0 10023 0 0 11 0 'g' 0 0 0 10031 0 8 0 0 'c' 0 0 0 10053 8 0 0 0 'a' 0 0 0 10058 0 0 0 8 't' 0 0 0 10073 0 8 0 0 'c' 0 0 0 10086 0 10 0 0 'c' 0 0 0 10097 0 0 10 0 'g' 0 0 0 10104 0 10 0 0 'c' 0 0 0 10120 0 9 0 0 'c' 0 0 0 10134 9 0 0 0 'a' 0 0 0 10145 0 0 8 0 'g' 0 0 0 10165 0 0 8 0 'g' 0 0 0 10180 0 0 6 0 'g' 0 0 0 10182 0 7 0 0 'c' 0 0 0 10186 7 0 0 0 'a' 0 0 0 10205 0 9 0 0 'c' 0 0 0 10227 0 6 0 0 'c' 0 0 0 10236 0 0 0 6 't' 0 0 0 10261 0 9 0 0 'c' 0 0 0 10271 0 0 0 10 't' 0 0 0 10279 0 11 0 0 'c' 0 0 0 10293 11 0 0 0 'a' 0 0 0 10299 0 7 0 0 'c' 0 0 0 10306 0 7 0 0 'c' 0 0 0 10327 0 11 0 0 'c' 0 0 0 10337 0 0 0 10 't' 0 0 0 10347 0 10 0 0 'c' 0 0 0 10362 0 0 11 0 'g' 0 0 0 10378 0 9 0 0 'c' 0 0 0 10389 0 0 0 11 't' 0 0 0 10405 0 0 8 0 'g' 0 0 0 10413 0 0 8 0 'g' 0 0 0 10424 0 11 0 0 'c' 0 0 0 10433 0 9 0 0 'c' 0 0 0 10444 9 0 0 0 'a' 0 0 0 10461 0 7 0 0 'c' 0 0 0 10467 0 6 0 0 'c' 0 0 0 10483 0 6 0 0 'c' 0 0 0 10492 0 6 0 0 'c' 0 0 0 10512 0 0 14 0 'g' 0 0 0 10523 0 8 0 0 'c' 0 0 0 10540 0 8 0 0 'c' 0 0 0 10549 0 13 0 0 'c' 0 0 0 10566 0 11 0 0 'c' 0 0 0 10582 0 11 0 0 'c' 0 0 0 10596 0 11 0 0 'c' 0 0 0 10607 0 0 0 9 't' 0 0 0 10620 0 9 0 0 'c' 0 0 0 10629 0 0 0 9 't' 0 0 0 10649 0 8 0 0 'c' 0 0 0 10659 0 11 0 0 'c' 0 0 0 10672 0 6 0 0 'c' 0 0 0 10676 0 0 0 6 't' 0 0 0 10698 0 0 8 0 'g' 0 0 0 10706 0 8 0 0 'c' 0 0 0 10718 0 9 0 0 'c' 0 0 0 10739 0 9 0 0 'c' 0 0 0 10756 0 8 0 0 'c' 0 0 0 10770 0 0 0 8 't' 0 0 0 10785 0 0 0 8 't' 0 0 0 10790 0 8 0 0 'c' 0 0 0 10809 8 0 0 0 'a' 0 0 0 10823 0 0 0 6 't' 0 0 0 10836 0 0 0 9 't' 0 0 0 10853 0 19 0 0 'c' 0 0 0 10870 0 21 0 0 'c' 0 0 0 10882 0 15 0 0 'c' 0 0 0 10897 0 13 0 0 'c' 0 0 0 10912 0 11 0 0 'c' 0 0 0 10921 9 0 0 0 'a' 0 0 0 10936 13 0 0 0 'a' 0 0 0 10954 9 0 0 0 'a' 0 0 0 10969 0 10 0 0 'c' 0 0 0 10981 0 16 0 0 'c' 0 0 0 10990 0 0 16 0 'g' 0 0 0 11006 0 9 0 0 'c' 0 0 0 11026 0 0 0 9 't' 0 0 0 11040 0 0 0 9 't' 0 0 0 11057 0 0 0 9 't' 0 0 0 11065 0 10 0 0 'c' 0 0 0 11081 9 0 0 0 'a' 0 0 0 11095 9 0 0 0 'a' 0 0 0 11105 0 9 0 0 'c' 0 0 0 11128 0 0 6 0 'g' 0 0 0 11140 0 0 6 0 'g' 0 0 0 11154 0 0 8 0 'g' 0 0 0 11161 8 0 0 0 'a' 0 0 0 11180 0 6 0 0 'c' 0 0 0 11185 6 0 0 0 'a' 0 0 0 11194 0 10 0 0 'c' 0 0 0 11216 8 0 0 0 'a' 0 0 0 11230 0 10 0 0 'c' 0 0 0 11249 0 9 0 0 'c' 0 0 0 11265 0 9 0 0 'c' 0 0 0 11282 0 6 0 0 'c' 0 0 0 11287 0 0 0 6 't' 0 0 0 11297 0 8 0 0 'c' 0 0 0 11322 0 8 0 0 'c' 0 0 0 11328 0 0 8 0 'g' 0 0 0 11341 0 8 0 0 'c' 0 0 0 11364 0 0 8 0 'g' 0 0 0 11386 0 0 6 0 'g' 0 0 0 11393 0 6 0 0 'c' 0 0 0 11406 0 0 8 0 'g' 0 0 0 11419 0 0 8 0 'g' 0 0 0 11441 6 0 0 0 'a' 0 0 0 11443 0 6 0 0 'c' 0 0 0 11464 0 8 0 0 'c' 0 0 0 11473 8 0 0 0 'a' 0 0 0 11489 0 8 0 0 'c' 0 0 0 11500 8 0 0 0 'a' 0 0 0 11513 6 0 0 0 'a' 0 0 0 11518 0 6 0 0 'c' 0 0 0 11540 0 0 0 8 't' 0 0 0 11559 0 6 0 0 'c' 0 0 0 11560 0 0 6 0 'g' 0 0 0 11581 0 8 0 0 'c' 0 0 0 11595 0 8 0 0 'c' 0 0 0 11600 0 0 8 0 'g' 0 0 0 11622 0 0 0 8 't' 0 0 0 11640 0 9 0 0 'c' 0 0 0 11643 0 0 12 0 'g' 0 0 0 11655 0 0 12 0 'g' 0 0 0 11673 0 12 0 0 'c' 0 0 0 11691 0 8 0 0 'c' 0 0 0 11703 8 0 0 0 'a' 0 0 0 11714 0 9 0 0 'c' 0 0 0 11723 0 21 0 0 'c' 0 0 0 11732 19 0 0 0 'a' 0 0 0 11741 0 15 0 0 'c' 0 0 0 11752 0 0 0 12 't' 0 0 0 11763 0 9 0 0 'c' 0 0 0 11771 9 0 0 0 'a' 0 0 0 11788 0 9 0 0 'c' 0 0 0 11808 9 0 0 0 'a' 0 0 0 11823 0 9 0 0 'c' 0 0 0 11837 0 12 0 0 'c' 0 0 0 11847 0 0 0 16 't' 0 0 0 11859 0 0 0 11 't' 0 0 0 11875 0 11 0 0 'c' 0 0 0 11885 0 11 0 0 'c' 0 0 0 11897 0 12 0 0 'c' 0 0 0 11912 0 0 0 12 't' 0 0 0 11926 0 9 0 0 'c' 0 0 0 11937 0 7 0 0 'c' 0 0 0 11950 0 0 0 9 't' 0 0 0 11969 0 9 0 0 'c' 0 0 0 11977 0 10 0 0 'c' 0 0 0 11994 0 0 0 9 't' 0 0 0 12011 0 0 0 8 't' 0 0 0 12017 0 8 0 0 'c' 0 0 0 12033 0 11 0 0 'c' 0 0 0 12055 0 13 0 0 'c' 0 0 0 12066 0 12 0 0 'c' 0 0 0 12078 0 9 0 0 'c' 0 0 0 12094 9 0 0 0 'a' 0 0 0 12103 0 9 0 0 'c' 0 0 0 12119 9 0 0 0 'a' 0 0 0 12130 0 0 0 10 't' 0 0 0 12142 0 9 0 0 'c' 0 0 0 12155 8 0 0 0 'a' 0 0 0 12168 0 8 0 0 'c' 0 0 0 12189 0 0 6 0 'g' 0 0 0 12192 0 6 0 0 'c' 0 0 0 12216 0 9 0 0 'c' 0 0 0 12230 8 0 0 0 'a' 0 0 0 12248 9 0 0 0 'a' 0 0 0 12258 0 9 0 0 'c' 0 0 0 12270 0 11 0 0 'c' 0 0 0 12286 0 10 0 0 'c' 0 0 0 12299 0 10 0 0 'c' 0 0 0 12309 0 0 11 0 'g' 0 0 0 12319 0 0 0 10 't' 0 0 0 12334 0 0 8 0 'g' 0 0 0 12345 0 0 7 0 'g' 0 0 0 12358 0 0 8 0 'g' 0 0 0 12379 8 0 0 0 'a' 0 0 0 12387 0 6 0 0 'c' 0 0 0 12392 0 0 6 0 'g' 0 0 0 12409 0 0 6 0 'g' 0 0 0 12418 0 8 0 0 'c' 0 0 0 12436 0 0 0 9 't' 0 0 0 12446 0 9 0 0 'c' 0 0 0 12462 0 0 0 11 't' 0 0 0 12477 0 11 0 0 'c' 0 0 0 12491 0 16 0 0 'c' 0 0 0 12502 0 9 0 0 'c' 0 0 0 12517 0 0 9 0 'g' 0 0 0 12530 0 10 0 0 'c' 0 0 0 12539 0 0 9 0 'g' 0 0 0 12554 0 0 9 0 'g' 0 0 0 12570 0 9 0 0 'c' 0 0 0 12588 0 0 0 9 't' 0 0 0 12597 9 0 0 0 'a' 0 0 0 12611 0 9 0 0 'c' 0 0 0 12630 0 0 9 0 'g' 0 0 0 12636 8 0 0 0 'a' 0 0 0 12648 0 8 0 0 'c' 0 0 0 12664 0 0 6 0 'g' 0 0 0 12665 0 6 0 0 'c' 0 0 0 12678 0 0 8 0 'g' 0 0 0 12694 0 8 0 0 'c' 0 0 0 12715 8 0 0 0 'a' 0 0 0 12729 6 0 0 0 'a' 0 0 0 12730 0 6 0 0 'c' 0 0 0 12751 0 8 0 0 'c' 0 0 0 12772 0 8 0 0 'c' 0 0 0 12782 0 9 0 0 'c' 0 0 0 12798 0 9 0 0 'c' 0 0 0 12811 0 9 0 0 'c' 0 0 0 12822 0 9 0 0 'c' 0 0 0 12838 0 0 0 9 't' 0 0 0 12847 0 9 0 0 'c' 0 0 0 12859 0 0 9 0 'g' 0 0 0 12876 0 9 0 0 'c' 0 0 0 12892 0 10 0 0 'c' 0 0 0 12899 0 0 9 0 'g' 0 0 0 12905 0 10 0 0 'c' 0 0 0 12915 0 0 0 10 't' 0 0 0 12929 0 0 0 11 't' 0 0 0 12946 0 14 0 0 'c' 0 0 0 12965 0 21 0 0 'c' 0 0 0 12978 0 20 0 0 'c' 0 0 0 12995 0 18 0 0 'c' 0 0 0 13010 0 14 0 0 'c' 0 0 0 13024 0 11 0 0 'c' 0 0 0 13037 0 9 0 0 'c' 0 0 0 13055 6 0 0 0 'a' 0 0 0 13064 6 0 0 0 'a' 0 0 0 13080 0 6 0 0 'c' 0 0 0 13084 0 0 0 7 't' 0 0 0 13106 0 0 0 6 't' 0 0 0 13110 0 6 0 0 'c' 0 0 0 13129 0 8 0 0 'c' 0 0 0 13140 0 8 0 0 'c' 0 0 0 13154 9 0 0 0 'a' 0 0 0 13170 0 9 0 0 'c' 0 0 0 13186 0 0 10 0 'g' 0 0 0 13196 0 0 10 0 'g' 0 0 0 13207 0 0 10 0 'g' 0 0 0 13219 0 10 0 0 'c' 0 0 0 13230 0 0 0 9 't' 0 0 0 13244 0 9 0 0 'c' 0 0 0 13255 0 9 0 0 'c' 0 0 0 13267 0 11 0 0 'c' 0 0 0 13287 0 11 0 0 'c' 0 0 0 13305 0 0 0 9 't' 0 0 0 13316 0 10 0 0 'c' 0 0 0 13328 0 6 0 0 'c' 0 0 0 13332 0 0 6 0 'g' 0 0 0 13344 0 8 0 0 'c' 0 0 0 13366 0 8 0 0 'c' 0 0 0 13379 0 9 0 0 'c' 0 0 0 13392 0 9 0 0 'c' 0 0 0 13407 0 0 0 6 't' 0 0 0 13414 0 0 0 6 't' 0 0 0 13433 6 0 0 0 'a' 0 0 0 13435 0 6 0 0 'c' 0 0 0 13452 0 8 0 0 'c' 0 0 0 13471 0 8 0 0 'c' 0 0 0 13480 0 0 9 0 'g' 0 0 0 13495 0 9 0 0 'c' 0 0 0 13506 0 0 9 0 'g' 0 0 0 13516 9 0 0 0 'a' 0 0 0 13537 0 0 9 0 'g' 0 0 0 13553 0 0 7 0 'g' 0 0 0 13561 7 0 0 0 'a' 0 0 0 13571 0 0 9 0 'g' 0 0 0 13580 0 9 0 0 'c' 0 0 0 13599 0 0 0 9 't' 0 0 0 13608 0 0 0 9 't' 0 0 0 13623 0 9 0 0 'c' 0 0 0 13634 9 0 0 0 'a' 0 0 0 13646 0 9 0 0 'c' 0 0 0 13666 0 12 0 0 'c' 0 0 0 13676 0 9 0 0 'c' 0 0 0 13687 0 0 9 0 'g' 0 0 0 13706 0 9 0 0 'c' 0 0 0 13720 0 0 9 0 'g' 0 0 0 13729 9 0 0 0 'a' 0 0 0 13743 9 0 0 0 'a' 0 0 0 13758 0 10 0 0 'c' 0 0 0 13769 0 12 0 0 'c' 0 0 0 13784 9 0 0 0 'a' 0 0 0 13797 0 10 0 0 'c' 0 0 0 13809 0 10 0 0 'c' 0 0 0 13815 0 0 0 11 't' 0 0 0 13829 0 11 0 0 'c' 0 0 0 13849 0 11 0 0 'c' 0 0 0 13863 0 12 0 0 'c' 0 0 0 13874 0 10 0 0 'c' 0 0 0 13883 0 7 0 0 'c' 0 0 0 13898 0 7 0 0 'c' 0 0 0 13905 0 0 0 9 't' 0 0 0 13922 0 0 0 7 't' 0 0 0 13934 0 0 0 7 't' 0 0 0 13952 0 9 0 0 'c' 0 0 0 13966 0 13 0 0 'c' 0 0 0 13975 0 9 0 0 'c' 0 0 0 13982 9 0 0 0 'a' 0 0 0 14003 9 0 0 0 'a' 0 0 0 14013 0 6 0 0 'c' 0 0 0 14026 6 0 0 0 'a' 0 0 0 14037 0 0 6 0 'g' 0 0 0 14056 0 8 0 0 'c' 0 0 0 14061 8 0 0 0 'a' 0 0 0 14084 0 8 0 0 'c' 0 0 0 14093 0 6 0 0 'c' 0 0 0 'version' => 2 'comments' => 'binary' => "CONV=Bioperl-Chads Mighty SCF writer.\cJversion=2\cJ\cJ\c@", 'length' => 50, 'string' => "CONV=Bioperl-Chads Mighty SCF writer.\cJversion=2\cJ\cJ\c@" 'header' => HASH(0x3068834) 'bases' => 1106 'bases_left_clip' => 0 'bases_offset' => 112984 'bases_right_clip' => 0 'binary' => ".scf\c@\c@7\e\c@\c@\c@€\c@\c@\cDR\c@\c@\c@\c@\c@\c@\c@\c@\c@\cA¹X\c@\c@\c@2\c@\cAí\$2\c@\c@\c@\c@\c@\c@\cB\c@\c@\c@\cI\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@" 'code_set' => 9 'comments_offset' => 126244 'comments_size' => 50 'magic' => '.scf' 'private_offset' => 126294 'private_size' => 0 'sample_size' => 2 'samples' => 14107 'samples_offset' => 128 'spare' => 0..19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 'version' => 2 'traces' => HASH(0x30677ec) 'binary' => "\cAl\cE\c\\c@§\c@\cQ\cAH\cD´\cAî\c@-\c@ü\cD\cI\cD4\c@K\c@Æ\cD\$\cF\@\c@a\c@\c?\cD\cK\cF\@\c@m\c@2\cC­\cF\@\c@a\c@K\cC\cL\cF\@\c@L\cA”\cB;\cF\@\c@.\cC³\cAv\cF\@\c@\cQ\cF\@\c@Ð\cF\@\c@\c@\cF\@\c@U\cF\@\c@\c@\cF\@\c@\cN\cF\@\cA®\cF\@\c@\c@\cF\@\cDÎ\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cD¨\cF\@\c@,\cF\@\cA–\cF\@\c@Ã\cF\@\c@\c@\cF\@\cAÏ\cF\@\c@\c@\cF\@\cCF\cF\@\c@\c@\cF\@\cE\cQ\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\cA›\cF\@\cF\@\cF\@\cD±\cF\@\cF\@\cF\@\cF\@\cCá\cF\@\cF\@\cF\@\cAž\cF\@\cF\@\cF\@\c@>\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cD²\c@\@\cF\@\cF\@\cA›\c@Ç\cF\@\cF\@\c@\c@\cAª\cF\@\cF\@\c@\c@\cC\c@\cF\@\cF\@\c@\c@\cDé\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\c@\cF\@\cF\@\cF\@\c@\cR\cF\@\cF\@\cF\@\c@e\cF\@\cF\@\cF\@\c@ë\cF\@\cF\@\cF\@\cA‡\cF\@\cF\@\cF\@\cB\cU\cF\@\cF\@\cF\@\cBt\cF\@\cF\@\cE±\cBg\cF\@\cF\@\cE<\cAô\cF\@\cF\@\cE}\cAa\cF\@\cF\@\cF1\c@Ç\cF\@\cE>\cF\@\c@L\cF\@\cC¡\cF\@\c@\cF\cF\@\cB;\cF\@\c@\c@\cF\@\cA0\cF\@\c@\c@\cF\@\c@Š\cF\@\c@\c@\cF\@\c@2\cF\@\c@\c@\cF\@\c@\cL\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF\@\c@\c@\cF5\c@&\cF\@\c@\c@\cDÀ\c@s\cF\@\c@\cC\cC“\c@å\cF\@\c@J\cB¨\cAz\cF\@\c@Ñ\cAö\cB2\cF\@\cA•\cAn\cBÙ\cF\@\cB’\cA\cI\cCW\cF\@\cCÍ\c@¿\cC—\cF\@\cE\c@\c@Š\cCŒ\cF\@\cF\cW\c@b\cC8\cF\@\cF\@\c@D\cB§\cF\@\cF\@\c@+\cAò\cF\@\cF\@\c@\cZ\cAD\cEð\cF\@\c@\cL\c@·\cE¯\cF\@\c@\cI\c@O\cEs\cF\@\c@\e\c@\cR\cE/\cF\@\c@C\c@\c@\cDÔ\cF\@\c@ƒ\c@\c@\cDW\cF\@\c@Ý\c@\c@\cC´\cF\@\cAJ\c@\c@\cBñ\cF\@\cA¾\c@\c@\cB\c]\cF\@\cB,\c@\c@\cA\\\cF\@\cB†\c@\c@\c@Ã\cEÀ\cBÁ\c@\c@\c@V\cD«\cBÙ\c@\c@\c@,\cDq\cBÍ\c@\c@\c@P\cEG\cB \c@\c@\c@£\cF\@\cBY\c@\c@\cA\cE\cF\@\cB\cB\c@\c@\cAj\cF\@\cA¤\c@\cA\cA®\cF\@\cAH\c@\cX\cAµ\cF\@\c@ô\c@F\cA~\cF\@\c@®\c@“\cA\c\\cF\@\c@y\cA\cD\c@¹\cF\@\c@U\cAŸ\c@`\cF\@\c@\@\cBS\c@\c_\cF\@\c@7\cC\cR\c@\c@\cF\@\c@6\cCÍ\c@\c@\cF\@\c@;\cDj\c@\c@\cF\@\c@C\cD×\c@\c@\cF\@\c@N\cDÿ\c@\c@\cC,\c@\\\cDØ\c@\c@\c@ì\c@o\cDb\c@\c@\c@\c@\c@†\cCª\c@\c@\c@\c@\c@£\cBÇ\c@\c@\c@\c@\c@Ä\cAÚ\c@\c@\c@\c@\c@ã\cA\c\\c@\c@\c@\c@\c@ü\c@Š\c@\c@\c@ì\cA\cM\c@,\c@\c@\cC-\cA\cO\c@\c@\c@\c@\cF\@\cA\cB\c@\cA\c@\c@\cF\@\c@æ\c@\cT\c@\c@\cF\@\c@¾\c@.\c@\c@\cF\@\c@Ž\c@F\c@\c@\cF\@\c@^\c@V\c@\c@\cF\@\c@7\c@a\c@\c@\cF\@\c@\cY\c@T\c@\c@\cF\@\c@\cG\c@=\c@\c@\cF\@\c@\c@\c@\$\c@\c@\cF\@\c@\c@\c@\cN\c@\c@\cF\@\c@\c@\c@\cA\c@\c@\cF\@\c@\c@\c@\cA\c@\c@\cF\@\c@\c@\c@\cP\c@\c@\cF\@\c@\c@\c@)\c@\c@\cF\@\c@\c@\c@G\c@\c@\cF\@\c@\c@\c@b\c@\c@\cF\@\c@\c@\c@w\c@S\cF\@\c@\c@\c@x\cA\cV\cF\@\c@\c@\c@d\cBO\cF\@\c@\c@\c@H\cD\cL\cEÇ\c@\c@\c@*\cF\@\cDd\c@\c@\c@\cQ\cF\@\cBù\c@\c@\c@\cB\cF\@\cAÓ\c@\c@\c@\c@\cF\@\c@ï\c@\c@\c@\c@\cF\@\c@U\c@\c@\c@\c@\cF\@\c@\cD\c@\c@\c@\cC\cF\@\c@\c@\c@\c@\c@H\cF\@\c@\c@\c@\c@\c@Ë\cF\@\c@\c@\c@\c@\cA‡\cF\@\c@\c@\c@\c@\cBl\cF\@\c@\c@\c@\c@\cCw\cF\@\c@\c@\c@\c@\cDU\cF\@\c@\c@\c@\c@\cDâ\cF\@\c@\c@\c@\c@\cE\cJ\cF\@\c@\c@\c@\c@\cDÉ\cF\@\c@\c@\c@\c@\cD.\cF\@\c@\c@\c@\c@\cCS\cF\@\c@\c@\c@\c@\cB\\\cF\@\c@\c@\c@\c@\cA~\cF\@\c@\c@\c@\c@\c@Ð\cF\@\c@\c@\c@\c@\c@W\cF\@\c@\c@\c@\c@\c@\cX\cF\@\c@O\c@\c@\c@,\cF\@\c@ë\c@\c@\c@m\cF\@\cAÆ\c@\c@\c@Á\cF\@\cBÃ\c@\c@\cA#\cF\@\cCÙ\c@\c@\cAŽ\cF\@\cD¥\c@\c@\cAã\cF\@\cE\cB\c@\cW\cB\c]\cF\@\cDí\c@K\cBD\cF\@\cD~\c@—\cBd\cF\@\cCÜ\c@ñ\cB\cF\@\cC3\cAR\cBÑ\cF\@\cBž\cAœ\cC2\cF\@\cB-\cA¸\cC±\cDt\cAâ\cA¢\cDB\cB\cA²\cA_\cDÒ\cAQ\cA“\c@ÿ\cEK\c@Š\cA\c?\c@¥\cE–\c@\c]\cAr\c@Z\cE¥\c@\c@\cAo\c@#\cEx\c@\c@\cA|\c@\cD\cE\cU\c@\c@\cA›\c@\c@\cD“\c@\c@\cAÈ\c@\c@\cD\cN\c@\c@\cAø\c@\cI\cC¢\c@\c@\cB\c\\c@\"\cCb\c@\c@\cB'\c@I\cCX\c@\c@\cB\cN\c@|\cCz\c@\c@\cAÍ\c@¾\cC³\c@\c@\cAm\cA\cE\cCå\c@\c@\c@ý\cAK\cCð\c@\c@\c@\cAŒ\cC»\c@\c@\c@P\cAÊ\cC?\c@\c@\c@\e\cB\cE\cBˆ\c@\c@\c@\cD\cB?\cA½\c@\c@\c@\cM\cBx\cA\cM\c@\c@\c@\cV\cB¯\c@\c@\cD\c@\cX\cBä\c@%\c@\cT\c@\cX\cC\cU\c@\c@\c@/\c@\cW\cCB\c@\c@\c@P\c@\cO\cCl\c@\c@\c@r\c@\cF\cC“\c@\c@\c@\c@\cA\cCµ\c@\c@\c@“\c@\cM\cCÑ\c@\c@\c@ƒ\c@\c\\cCâ\c@\c@\c@c\c@*\cCâ\c@\c@\c@A\c@1\cCÍ\c@\c@\c@\"\c@1\cCŸ\c@\c@\c@\cK\c@*\cCX\c@\c@\c@\c@\c@\"\cBý\c@\c@\c@\c@\c@3\cB•\c@\c@\c@\c@\c@s\cB+\c@\c@\c@\c@\c@ô\cAÉ\c@\c@\c@\c@\cA±\cAx\c@\c@\c@\c@\cB¥\cA=\c@\c@\c@\c@\cC¬\cA\cW\c@\c@\c@\c@\cDž\cA\cB\c@\c@\c@\c@\cEQ\c@ø\c@\c@\c@\c@\cE¢\c@î\c@\c@\c@\c@\cE\c?\c@à\c@0\c@\c@\cDì\c@È\c@Ž\c@\c@\cCÿ\c@¦\cA\cX\c@\c@\cBá\c@{\cAÅ\c@\c@\cAØ\c@R\cB”\c@\c@\cA\cD\c@0\cCH\c@\c@\c@m\c@\cV\cCÄ\c@\c@\c@\cV\c@\cE\cCó\c@\c@\c@\c@\c@\c@\cCÎ\c@\c@\c@\c@\c@\c@\cC\\\c@\c@\c@\c@\c@\cW\cB±\c@\c@\c@\c@\c@J\cAç\c@\c@\c@\c@\c@œ\cA3\c@\c@\c@\c@\cA\cN\c@¤\c@\c@\c@\c@\cA£\c@\@\c@\c@\c@\c@\cB\@\c@\cI\c@\c@\c@\c@\cBÕ\c@\c@\c@\c@\c@\c@\cCM\c@\c@\c@\c@\c@\c@\cC\c@\c@\c@\c@\c@\cE\cC·\c@\c@\c@\c@\c@=\cC˜\c@\c@\c@\c@\c@¥\cCB\c@\c@\c@\c@\cAA\cBÁ\c@\c@\c@\c@\cB\cN\cB#\c@\c@\c@\c@\cC\cN\cA|\c@\c@\c@\c@\cD\cK\c@í\c@\c@\c@\c@\cDí\c@\c?\c@\c@\c@\c@\cE—\c@4\c@\c@\c@\c@\cEø\c@\cI\c@\c@\c@\c@\cEÿ\c@\c@\c@\c@\c@\c@\cE¨\c@\c@\c@\c@\c@\c@\cDù\c@\c@\c@\c@\c@\c@\cD\cE\c@\c@\c@\c@\c@\c@\cBè\c@\c@\c@\c@\c@\c@\cAâ\c@\c@\c@\c@\c@\c@\cA\cQ\c@\c@\c@\c@\c@(\c@x\c@\c@\c@\c@\c@{\c@\e\c@\c@\c@\c@\c@î\c@\c@\c@\c@\c@\c@\cAl\c@\c@\c@\c@\c@\c@\cAä\c@\c@\c@\c@\c@\c@\cB \c@1\c@\c@\c@\c@\cB\cI\c@Ö\c@\c@\c@\c@\cA¥\cB\cE\c@\c@\c@\c@\cA(\cCÑ\c@\c@\c@\c@\c@­\cF<\c@\c@\c@\c@\c@I\cF\@\c@\cC\c@\c@\c@\cM\cF\@\c@\cG\c@\c@\c@\c@\cF\@\c@\cK\c@\c@\c@\c@\cF\@\c@\cN\c@\c@\c@\c@\cF\@\c@\cO\c@\c@\c@\c@\cF\@\c@\cM\c@\c@\c@\c@\cF\@\c@\cJ\c@\c@\c@\c@\cF\@\c@\cF\c@\c@\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@-\cF\@\c@\c@\c@\c@\c@¦\cF\@\c@\c@\c@\c@\cAa\cF\@\c@\c@\c@\c@\cBI\cF\@\c@\c@\c@\c@\cCL\cF\@\c@\c@\c@\c@\cD&\cF\@\c@\c@\c@\c@\cD\cF\@\c@\c@\c@\c@\cDo\cF\@\c@\cP\c@\c@\cCÌ\cF\@\c@A\c@\c@\cBÎ\cF\@\c@”\c@\c@\cA×\cF\@\cA\cK\c@\c@\cA\cB\cF\@\cA©\c@\c@\c@d\cDî\cB[\c@\c@\c@\cL\cCR\cC\cF\c@\c@\c@\c@\cB\cG\cC—\c@\c@\c@\c@\cA\c_\cCü\c@\c@\c@\c@\c@‚\cD(\c@\cZ\c@\c@\c@%\cD\cV\c@Y\c@\c@\c@\c@\cCÉ\c@¹\c@\c@\c@\c@\cCH\cA4\c@\c@\c@\cP\cB¦\cAÅ\c@\c@\c@-\cAõ\cBJ\c@\c@\c@M\cAJ\cB¥\c@\c@\c@h\c@Ã\cBÇ\c@\c@\c@\c?\c@a\cB«\c@\c@\c@€\c@\"\cBW\c@\c@\c@i\c@\cC\cAÙ\c@\c@\c@K\c@\c@\cAF\c@\c@\c@+\c@\c@\c@Ê\c@\c@\c@\cR\c@\c@\c@g\c@\c@\c@\cC\c@\c@\c@\$\c@\c@\c@\c@\c@\cB\c@\cA\c@\c@\c@\c@\c@\"\c@\c@\c@\c@\c@\c@\c@f\c@\c@\c@\c@\c@\c@\c@Ö\c@\c@\c@\c@\c@\c@\cAx\c@\c@\c@\c@\c@\c@\cBL\c@\c@\c@\c@\c@\cA\cC/\c@\c@\c@\c@\c@\cJ\cD\cF\c@2\c@\c@\c@\cZ\cD®\c@œ\c@\c@\c@0\cE\cI\cA?\c@\c@\c@J\cE\cD\cB\cU\c@\c@\c@e\cD›\cC\e\c@\c@\c@z\cCÜ\cD\cK\c@\c@\c@‚\cBå\cD¼\c@\c@\c@€\cAë\cE\cK\c@\c@\c@t\cA\c^\cDí\c@\c@\c@c\c@„\cDl\c@\c@\c@N\c@\$\cC®\c@\c@\c@:\c@\c@\cBå\c@\c@\c@&\c@\c@\cBK\c@\c@\c@\cW\c@\c@\cB\cP\c@\c@\c@\cL\c@\c@\cBO\c@\c@\c@\cD\c@\cC\cC\cC\c@\c@\c@\c@\c@\cH\cD\cI\c@\c@\c@\c@\c@\cP\cE(\c@\c@\c@\c@\c@\cV\cF!\c@\c@\c@\cB\c@\cW\cF\@\c@\c@\c@\cE\c@\cU\cF\@\c@\c@\c@\cG\c@\cQ\cF\@\c@\c@\c@\cH\c@\cJ\cEU\c@\c@\c@\cI\c@\cC\cD\cL\c@\c@\c@\cH\c@\c@\cB²\c@\c@\c@\cE\c@\c@\cA˜\c@\c@\c@\cB\c@#\c@Ã\c@\c@\c@\c@\c@|\c@<\c@\c@\c@\c@\cA\cM\c@\c@\c@\c@\c@\c@\cAÕ\c@\c@\c@\c@\c@\c@\cBÓ\c@\c@\c@\c@\c@\c@\cCÞ\c@\c@\c@\c@\c@\c@\cDÇ\c@\c@\c@\c@\c@\c@\cEp\c@\c@\c@\c@\c@\c@\cEÁ\c@\c@\c@\c@\c@\c@\cE±\c@\c@\c@\cK\c@\c@\cED\c@\c@\c@8\c@\c@\cDŒ\c@\c@\c@…\c@\c@\cC£\c@\c@\c@ð\c@\c@\cB¨\c@\c@\cAu\c@\c@\cA¹\c@\c@\cB\cG\c@\c@\cA\cA\c@\c@\cB‚\c@\c@\c@}\c@\c@\cBÒ\c@\c@\c@+\c@\c@\cBë\c@\c@\c@\cC\c@\c@\cBÉ\c@\c@\c@\c@\c@\c@\cBo\c@\c@\c@\c@\c@\c@\cAê\c@\c@\c@\c@\c@\c@\cAQ\c@\c@\c@\c@\c@\c@\c@Ñ\c@\c@\c@\c@\c@\c@\c@i\c@\c@\c@\c@\c@\c@\c@#\c@D\c@\c@\c@\c@\c@\c@\c@æ\c@\c@\c@\c@\c@\c@\cAæ\c@\c@\c@\c@\c@\c@\cC5\c@\c@\c@\c@\c@\c@\cDÈ\c@\c@\c@\c@\c@\c@\cF>\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cDÿ\c@\c@\c@\c@\c@\c@\cC³\c@\c@\c@\c@\c@\c@\cBÉ\c@\c@\c@\c@\c@\c@\cB“\c@\c@\c@\c@\c@\c@\cC;\c@\c@\c@\c@\c@\c@\cD¸\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\cC\c@\c@\c@\c@\cF\@\c@\cI\c@\c@\c@\c@\cF\@\c@\cS\c@\c@\c@\c@\cF\@\c@\c^\c@\c@\c@\c@\cF\@\c@)\c@\c@\c@\c@\cF\@\c@0\c@\c@\c@\c@\cE\cT\c@/\c@\c@\c@\c@\cD)\c@'\c@\c@\c@\c@\cD\cT\c@\c]\c@\c@\c@\c@\cD´\c@\cQ\c@\c@\c@\c@\cE»\c@\cH\c@\c@\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\cC\c@\c@\c@\c@\cF\@\c@\cL\c@\c@\c@\c@\cEž\c@\cV\c@\c@\c@\c@\cDM\c@\c]\c@\c@\c@\c@\cC2\c@ \c@\c@\c@\cA\cB \c@\c^\c@\c@\c@\cG\cBÁ\c@\cX\c@\c@\c@\cR\cC\c@\cN\c@\c@\c@\c_\cDÖ\c@\cD\c@\c@\c@.\cF>\c@\c@\c@\c@\c@\@\cF\@\c@\cK\c@\c@\c@T\cF\@\c@B\c@\c@\c@g\cF\@\c@¤\c@\c@\c@|\cF\@\cA2\c@\c@\c@’\cEr\cAê\c@\c@\c@©\cC¼\cB¾\c@\c@\c@½\cBE\cC€\c@\c@\c@Í\cA\c\\cD\cU\c@\c@\c@Ù\c@X\cDg\c@\c@\c@â\c@\c@\cDl\c@\c@\c@î\c@\c@\cD!\c@\c@\cA\cE\c@\c@\cC“\c@\c@\cA1\c@\c@\cBÔ\c@\c@\cA€\c@\c@\cB\cB\c@\c@\cAø\c@\c@\cAE\c@\c@\cBš\c@\c@\c@³\c@\c@\cC^\c@\c@\c@L\c@\c@\cD1\c@\c@\c@\cQ\c@\c@\cDò\c@\c@\c@\c@\c@\c@\cE~\c@\c@\c@\c@\c@\c@\cE³\c@\c@\c@\c@\c@\c@\cE}\c@\c@\c@\c@\c@\c@\cDÝ\c@\c@\c@\c@\c@\c@\cCé\c@\c@\c@\c@\c@\c@\cBÏ\c@\c@\c@\c@\c@\c@\cAÉ\c@\c@\c@\c@\c@\c@\cA\cQ\c@\c@\c@\c@\c@\c@\c@Ï\c@\c@\c@\c@\c@\c@\cA\cS\c@\c@\c@\c@\c@\c@\cAÌ\c@\c@\c@\c@\c@\c@\cBÎ\c@\c@\c@\c@\c@\c@\cCØ\c@\c@\c@\c@\c@\c@\cD¬\c@\c@\c@\c@\c@\c@\cE\cV\c@\c@\c@\c@\c@\c@\cDý\c@\c@\c@\c@\c@\c@\cDj\c@\c@\c@\c@\c@\c@\cC~\c@\c@\c@\c@\c@\c@\cBt\c@\c@\c@\c@\c@\c@\cA„\c@\c@\c@\c@\c@\c@\c@â\c@\c@\c@\c@\c@\c@\c@¨\c@\c@\c@\c@\c@\c@\c@Ù\c@\c@\c@\c@\c@\c@\cA]\c@\c@\c@\c@\c@\c@\cB\cF\c@\c@\c@\c@\c@\c@\cB¢\c@\c@\c@\c@\c@\c@\cC\cF\c@\c@\c@\c@\c@\c@\cC\cW\c@\c@\c@\c@\c@\c@\cBÓ\c@\c@\c@\c@\c@\c@\cBP\c@\c@\c@\c@\c@\c@\cA·\c@\c@\c@\c@\c@\c@\cA7\c@\c@\c@\c@\c@\c@\c@÷\c@\c@\c@\c@\c@\c@\cA\cQ\c@\c@\c@\c@\c@\c@\cA€\c@\c@\c@\c@\c@\c@\cB+\c@\c@\c@\c@\c@\c@\cBå\c@\c@\c@\c@\c@\c@\cC}\c@\c@\c@\c@\c@\c@\cCÊ\c@\c@\c@\c@\c@\c@\cC·\c@\c@\c@\c@\c@\c@\cCI\c@\c@\c@\c@\c@\c@\cBž\c@\c@\c@\c@\c@\c@\cAè\c@\c@\c@\c@\c@\c@\cAY\c@\c@\c@\c@\c@\c@\cA\c\\c@\c@\c@\c@\c@\c@\cAF\c@\c@\c@\c@\c@\c@\cAÓ\c@\c@\c@\c@\c@\c@\cB¦\c@\c@\c@\c@\c@\c@\cC\c@\c@\c@\c@\c@\c@\cD]\c@\c@\c@\c@\c@\c@\cDß\c@\c@\c@\c@\c@\c@\cDù\c@\c@\c@\cA\c@\c@\cD£\c@\c@\c@<\c@\c@\cCï\c@\c@\c@¶\c@\c@\cBü\c@\c@\cAq\c@\c@\cAý\c@\c@\cBk\c@\c@\cA-\c@\c@\cC£\c@\c@\c@\c@\c@\cDÑ\c@\c@\c@+\c@\c@\cEÇ\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF<\c@\c@\c@\c@\c@\c@\cE†\c@\c@\c@ \c@\c@\cD†\c@\c@\c@g\c@\c@\cCc\c@\c@\c@â\c@\c@\cBC\c@\c@\cA•\c@\c@\cA[\c@\c@\cBˆ\c@\c@\c@±\c@\c@\cC‘\c@\c@\c@C\c@\c@\cD\c@\c@\c@\cI\c@\c@\cEX\c@\c@\c@\c@\c@\c@\cEÆ\c@\c@\c@\c@\c@\c@\cEÀ\c@\c@\c@\c@\c@\c@\cEB\c@\c@\c@/\c@\c@\cD\\\c@\c@\c@\c@\c@\cC7\c@\c@\cA#\c@\c@\cB\cZ\c@\c@\cAã\c@\c@\cA0\c@\c@\cBÐ\c@\c@\c@…\c@\c@\cC±\c@\c@\c@\c_\c@\c@\cDd\c@\c@\c@\c@\c@\c@\cDÒ\c@\c@\c@\c@\c@\c@\cDî\c@\c@\c@\c@\c@\c@\cD¸\c@\c@\c@\c@\c@\c@\cD:\c@\c@\c@\c@\c@\c@\cC‰\c@\c@\c@\c@\c@\c@\cB¼\c@#\c@\c@\c@\c@\cAî\c@…\c@\c@\c@\c@\cA5\cA'\c@\c@\c@\c@\c@¬\cB\cD\c@\c@\c@\c@\c@N\cC\e\c@\c@\c@\c@\c@\cW\cD=\c@\cG\c@\c@\c@\c@\cE1\c@\cQ\c@\c@\c@\c@\cEÐ\c@\c\\c@\c@\c@\c@\cF\cA\c@&\c@\cA\c@\cC\cE½\c@-\c@\cE\c@\cD\cE\cO\c@+\c@\cK\c@\cD\cD\cS\c@#\c@\cQ\c@\cD\cBî\c@\c\\c@\cU\c@\cD\cAá\c@ \c@\cW\c@\cB\cA\cL\c@:\c@\cT\c@\c@\c@u\c@s\c@\cO\c@\c@\c@\c\\c@Ì\c@\cI\c@\c@\c@\c@\cA?\c@\cC\c@\c@\c@\c@\cA»\c@\c@\c@\c@\c@\cB\cB,\c@\c@\c@\c@\c@\cK\cB|\c@\c@\c@\c@\c@\cV\cB™\c@\c@\c@\c@\c@ \cBy\c@\cB\c@\c@\c@(\cB \c@\cH\c@\c@\c@-\cAŸ\c@\cP\c@\c@\c@)\cA\cW\c@\cX\c@\c@\c@\c^\c@£\c@\c^\c@\c@\c@\cT\c@Z\c@ \c@\c@\c@\cK\c@^\c@\c\\c@\c@\c@\cD\c@³\c@\cU\c@\c@\c@\c@\cAG\c@\cL\c@\c@\c@\c@\cB\cB\c@\cE\c@\c@\c@\c@\cBÅ\c@\c@\c@\c@\c@\c@\cCc\c@\c@\c@\c@\c@\c@\cC¹\c@\c@\c@\c@\c@\c@\cC¶\c@\c@\c@\c@\c@\c@\cCY\c@\c@\c@\c@\c@\c@\cBº\c@\c@\c@\c@\c@\c@\cAü\c@\c@\c@\cC\c@\c@\cAG\c@\c@\c@\cH\c@\c@\c@Ã\c@\c@\c@\cO\c@\c@\c@‰\c@\c@\c@\cW\c@\c@\c@ \c@\c@\c@!\c@\c@\c@û\c@\c@\c@(\c@\c@\cAz\c@\cA\c@+\c@\c@\cAø\c@\cG\c@)\c@\c@\cBM\c@\cQ\c@\"\c@\c@\cBa\c@\c]\c@\cY\c@\c@\cB-\c@)\c@\cO\c@\c@\cAÀ\c@3\c@\cG\c@\c@\cA:\c@4\c@\cB\c@\c@\c@Ä\c@.\c@\c@\c@\c@\c@„\c@&\c@\c@\c@\c@\c@’\c@\"\c@\c@\c@\c@\c@ñ\c@)\c@\cC\c@\c@\cA\c@=\c@\cI\c@\c@\cB\@\c@\\\c@\cO\c@\c@\cBÜ\c@}\c@\cT\c@\c@\cC8\c@—\c@\cW\c@\c@\cC:\c@¢\c@\cV\c@\c@\cBå\c@œ\c@\cQ\c@\c@\cBP\c@‡\c@\cK\c@\c@\cA¥\c@k\c@\cE\c@\c@\cA\cY\c@Q\c@\cA\c@\c@\c@×\c@?\c@\c@\c@\c@\c@ú\c@8\c@\c@\c@\c@\cAƒ\c@;\c@\c@\c@\c@\cBZ\c@D\c@\c@\c@\c@\cCQ\c@L\c@\c@\c@\c@\cD5\c@P\c@\c@\c@\c@\cDÓ\c@M\c@\c@\c@\c@\cE\cK\c@D\c@\c@\c@\c@\cDÏ\c@8\c@9\c@\c@\cD,\c@0\c@Á\c@\c@\cCA\c@/\cAŸ\c@\c@\cB7\c@8\cBÎ\c@\c@\cAY\c@J\cDL\c@\c@\c@¬\c@^\cEÐ\c@\c@\c@:\c@o\cF\@\c@\c@\c@\cA\c@w\cF\@\c@\c@\c@\c@\c@t\cF\@\c@\c@\c@\c@\c@e\cF\@\c@\c@\c@\c@\c@N\cF\@\c@\c@\c@\c@\c@5\cEW\c@\c@\c@\c@\c@ \cCË\c@\c@\c@\c@\c@\cO\cBe\c@\c@\c@J\c@\cD\cAO\c@\c@\c@ã\c@\cC\c@\c@\c@\cAÆ\c@\cU\c@\c_\c@\c@\cBß\c@4\c@\c@\c@\c@\cD&\c@^\c@\c@\c@\c@\cE2\c@Œ\c@\c@\c@\c@\cEÍ\c@³\c@\c@\c@\c@\cEÕ\c@¾\c@\c@\c@\c@\cEL\c@¢\c@\c@\c@\c@\cDN\c@}\c@\c@\c@\c@\cC\cQ\c@R\c@\c@\c@\cC\cAñ\c@%\c@\c@\c@\cL\cA\cI\c@\cC\c@\c@\c@\cZ\c@f\c@\cM\c@\cB\c@*\c@\cN\c@{\c@\cD\c@=\c@\c@\cAL\c@\cH\c@M\c@\c@\cB\c@\cL\c@V\c@\c@\cD\cM\c@\cO\c@X\c@\c@\cEÚ\c@\cO\c@S\c@\c@\cF\@\c@\cM\c@K\c@\c@\cF\@\c@\cI\c@B\c@\c@\cF\@\c@\cF\c@:\c@\c@\cF\@\c@\cB\c@3\c@\c@\cF\@\c@\c@\c@-\c@\c@\cEd\c@\c@\c@'\c@\cM\cCš\c@\c@\c@ \c@b\cB\cY\c@\c@\c@\cW\c@ÿ\c@õ\c@\c@\c@\cO\cAß\c@\@\c@\c@\c@\cI\cBõ\c@\c@\c@\c@\c@\cD\cD*\c@\c@\c@\c@\c@\c@\cE%\c@\c@\c@\c@\c@\c@\cE³\c@\c@\c@\c@\c@\c@\cEº\c@\c@\c@\c@\c@\c@\cE6\c@\c@\c@\c@\c@\c@\cDD\c@\c@\c@\c@\c@\c@\cC\e\c@\c@\c@\c@\c@\c@\cAü\c@\c@\c@\c@\c@\c@\cA&\c@\c@\c@\c@\c@\c@\c@Ì\c@\c@\c@\c@\c@\c@\c@þ\c@\c@\c@\c@\c@\c@\cA¯\c@\c@\c@\c@\c@\c@\cB¯\c@\c@\c@\c@\c@\c@\cCÀ\c@\c@\c@\c@\c@\c@\cD\c@\cC\c@\c@\c@\c@\cE\cQ\c@\cK\c@\c@\c@\c@\cDþ\c@\cU\c@\c@\c@\c@\cDi\c@\c_\c@\c@\c@\c@\cCu\c@'\c@\c@\c@%\cB[\c@(\c@\c@\c@ª\cAk\c@#\c@\c@\cA‘\c@¯\c@\cZ\c@\c@\cBÙ\c@6\c@\cP\c@\c@\cD|\c@\c@\c@\cG\c@\c@\cF\@\c@\c@\c@\cA\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\cB\c@\c@\cF\@\c@\c@\c@\cE\c@\c@\cF\@\c@\c@\c@\cI\c@\c@\cF\@\c@\c@\c@\cL\c@\c@\cE2\c@\c@\c@\cN\c@\c@\cCy\c@\cT\c@\cL\c@\c@\cB\cQ\c@F\c@\cI\c@\c@\cA\cI\c@’\c@\cE\c@\c@\c@`\c@ñ\c@\cB\c@\c@\c@\cL\cA_\c@\c@\c@\c@\c@\cD\cA¿\c@\c@\c@\c@\c@\cR\cAù\c@\c@\c@\c@\c@ \cB\cC\c@\c@\c@\c@\c@*\cAÚ\c@\c@\c@\c@\c@0\cAˆ\c@\c@\c@\c@\c@4\cA\c^\c@\c@\c@\cI\c@,\c@¹\c@\c@\c@>\c@%\c@f\c@\cJ\c@¢\c@\"\c@+\c@ \cA3\c@'\c@\cI\c@>\cAì\c@/\c@\c@\c@b\cB¼\c@7\c@\c@\c@Š\cCl\c@:\c@\c@\c@ª\cCÜ\c@6\c@\c@\c@½\cCõ\c@,\c@\c@\c@¿\cC³\c@\c_\c@\c@\c@´\cC%\c@\cS\c@\c@\c@¡\cBn\c@\cI\c@\c@\c@Š\cAº\c@\cB\c@\c@\c@s\cA2\c@\c@\c@\c@\c@c\c@÷\c@\c@\c@\c@\c@Z\cA\cT\c@\c@\c@\c@\c@W\cA~\c@\c@\c@\cB\c@Y\cB\cU\c@\c@\c@\cD\c@Z\cB±\c@\c@\c@\cC\c@X\cC'\c@\c@\c@\cC\c@P\cCV\c@\c@\c@\cC\c@C\cC0\c@\c@\c@\cA\c@4\cB½\c@\c@\c@\c@\c@%\cB\cS\c@\c@\c@\c@\c@\cX\cAb\c@\c@\c@\cO\c@\cN\c@Í\c@\c@\c@^\c@\cH\c@]\c@\c@\c@ë\c@\cC\c@\cX\c@\cB\cA¯\c@\cA\c@\c@\c@\cJ\cB¡\c@\c@\c@\c@\c@\cX\cC¦\c@\c@\c@\c@\c@)\cDu\c@\c@\c@\c@\c@:\cDè\c@\cE\c@\c@\c@G\cDí\c@\cL\c@\c@\c@K\cD„\c@\cU\c@\cJ\c@D\cCÇ\c@\c\\c@N\c@4\cBØ\c@!\c@Î\c@#\cAâ\c@\c_\cAŒ\c@\cS\cA\e\c@\cY\cB\c@\cH\c@Š\c@\cP\cC\c@\cA\c@.\c@\cH\cD\c@\c@\c@\cB\c@\cB\cEU\c@\c@\c@\cG\c@\c@\cEª\c@\c@\c@\cT\c@\c@\cEŒ\c@\c@\c@!\c@\c@\cE\cC\c@\c@\c@.\c@\c@\cD)\c@\c@\c@<\c@\c@\cC \c@\c@\c@D\c@\c@\cB\cO\c@\c@\c@D\c@\c@\cA8\c@\cX\c@B\c@\c@\c@˜\c@U\c@>\c@\c@\c@1\c@¸\c@<\c@\cC\c@\c@\cA?\c@;\c@\cH\c@\c@\cAè\c@<\c@\cP\c@\cH\cB\c@=\c@\c\\c@\c]\cC\cQ\c@?\c@*\c@5\cCW\c@>\c@8\c@G\cCO\c@;\c@F\c@N\cBú\c@5\c@R\c@I\cBg\c@+\c@Z\c@;\cA±\c@ \c@]\c@\$\cA\cQ\c@\cU\c@\\\c@\cL\c@Ž\c@\cL\c@W\c@\c@\c@4\c@\cE\c@O\c@8\c@\cD\c@\cA\c@E\c@´\c@\c@\c@\c@\c@?\cAz\c@\c@\c@\c@\c@>\cB†\c@\c@\c@\c@\c@B\cCÜ\c@\c@\c@\c@\c@J\cE2\c@\c@\c@\c@\c@Q\cF\@\c@\c@\c@\c@\c@R\cF\@\c@\c@\c@\c@\c@J\cF\@\c@\c@\c@\c@\c@9\cF\@\c@\c@\c@\c@\c@(\cF0\c@\cB\c@\c@\c@\cV\cDþ\c@\cN\c@\c@\c@\cH\cCš\c@!\c@.\c@\c@\cBP\c@8\c@Œ\c@\c@\cAK\c@I\cA\cY\c@\c@\c@\c@M\cAÄ\c@\cI\c@\"\c@D\cBƒ\c@\e\c@\c@\c@5\cC\cT\c@5\c@\c@\c@ \cCQ\c@T\c@\c@\c@\cI\cC*\c@v\c@\cB\c@\c@\cB¨\c@\c@\cE\c@\c@\cAë\c@”\c@\cH\c@d\cA:\c@‹\c@\cJ\cA2\c@¤\c@w\c@\cO\cBk\c@:\c@^\c@\cU\cCþ\c@\cB\c@G\c@\c]\cEë\c@\c@\c@6\c@(\cF\@\c@\c@\c@,\c@5\cF\@\c@\c@\c@%\c@B\cF\@\c@\c@\c@\c^\c@L\cF\@\c@\c@\c@\cV\c@R\cF\@\c@\c@\c@\cO\c@S\cF\@\c@\c@\c@\cG\c@P\cEW\c@\c@\c@\cA\c@J\cC„\c@\c@\c@\c@\c@C\cB\cO\c@\cK\c@\c@\c@<\c@û\c@8\c@\c@\c@5\c@M\c@‡\c@\cB\c@.\c@\c@\c@ô\c@\cI\c@'\c@\c@\cAx\c@\cW\c@!\c@\c@\cB\cB\c@,\c@\c]\c@\c@\cBg\c@I\c@\e\c@\c@\cB\c@j\c@\cZ\c@\c@\cBp\c@‰\c@\cX\c@\c@\cB\cL\c@ \c@\cV\c@\c@\cA{\c@¨\c@\cQ\c@\c@\c@õ\c@›\c@\cL\c@\c@\c@€\c@{\c@\cH\c@\c@\c@+\c@W\c@\cC\c@\c@\c@5\c@5\c@\c@\c@\c@\c@£\c@\cW\c@\c@\c@\c@\cAC\c@\cC\c@\c@\c@\c@\cB\cH\c@\cF\c@\c@\c@\c@\cBç\c@ \c@\c@\c@\c@\cC–\c@F\c@\c@\c@\c@\cCî\c@t\c@\c@\c@\c@\cCÙ\c@¤\c@\c@\c@\c@\cC]\c@Ï\c@\c@\c@\c@\cB—\c@á\c@\c@\c@\cA\cAÀ\c@Û\c@\c@\c@\cB\cA\cF\c@Á\c@\c@\c@\cC\c@x\c@Ÿ\c@\c@\c@\cC\c@H\c@}\c@\c@\c@\cB\c@\c?\c@a\c@\c@\c@\cA\c@ÿ\c@N\c@\c@\c@\c@\cA›\c@C\c@\c@\c@\c@\cBL\c@;\c@\c@\c@\c@\cBÛ\c@5\c@\c@\c@\c@\cC\"\c@.\c@\c@\c@\c@\cC\cU\c@&\c@\c@\c@\c@\cB·\c@ \c@\cQ\c@\c@\cB\c\\c@\c]\c@i\c@\c@\cAo\c@\c_\cA\cI\c@\cA\c@Û\c@'\cAì\c@\cL\c@h\c@5\cC\cF\c@\c^\c@\c^\c@I\cD=\c@3\c@\c@\c@d\cEA\c@D\c@\c@\c@…\cEë\c@N\c@\c@\c@¬\cF(\c@D\c@\c@\c@Ò\cEû\c@7\c@\c@\c@î\cEu\c@#\c@\c@\c@ú\cD¯\c@\cO\c@\c@\c@ð\cCÁ\c@\cB\c@\c@\c@Î\cBÂ\c@(\c@\c@\c@\cAÐ\c@q\c@\c@\c@h\cA\cU\c@Þ\c@\c@\c@;\c@‡\cAk\c@\c@\c@\c^\c@*\cB\cS\c@\c@\c@\cT\c@\c@\cB¬\c@\c@\c@\cZ\c@\c@\cC\c]\c@\c@\c@'\c@\cP\cCR\c@\c@\c@2\c@\$\cCB\c@\c@\c@5\c@0\cBð\c@\c@\c@/\c@+\cBg\c@\c@\c@#\c@0\cA¿\c@\c@\c@\cV\c@&\cA!\c@\c@\c@\cJ\c@\cS\c@¡\c@\c@\c@\cB\c@\c@\c@D\c@\c@\c@\cC\c@\c@\c@\cN\c@\c@\c@\cM\c@K\c@\c@\c@\c@\c@\e\c@î\c@\c@\c@\c@\c@0\cAð\c@\c@\c@\c@\c@K\cCH\c@\c@\c@\c@\c@l\cDô\c@\c@\c@\c@\c@Ž\cF\@\c@\c@\c@\c@\c@°\cF\@\c@\c@\c@\c@\c@Î\cF\@\c@\c@\c@\c@\c@â\cF\@\c@\c@\c@\c@\c@å\cF\@\c@\c@\c@\c@\c@Ö\cF\@\c@\c@\c@\c@\c@±\cE)\c@\c@\c@\cV\c@€\cC…\c@\c@\c@q\c@R\cB#\c@\c@\cA\cK\c@+\cA\cY\c@\c@\cAÖ\c@\cN\c@j\c@\c@\cB¾\c@\cJ\c@\cO\c@\c@\cCš\c@\$\c@\c@\c@\c@\cD\cZ\c@I\c@\cG\c@\c@\cD\c\\c@v\c@\cR\c@\c@\cCž\c@§\c@\cZ\c@\c@\cB¼\c@Î\c@\c]\c@\c@\cA×\c@Ý\c@\c^\c@\c@\cA\cH\c@Ò\c@\cZ\c@\c@\c@k\c@®\c@\cP\c@\c@\c@1\c@|\c@\cG\c@\c@\c@”\c@O\c@\cA\c@\c@\cAD\c@(\c@\c@\c@\c@\cB\"\c@\cM\c@\c@\c@\c@\cC\e\c@\c@\c@\c@\c@\c@\cCü\c@\cD\c@\cB\c@\c@\cDt\c@\cN\c@\cF\c@\c@\cDm\c@\cW\c@\cK\c@\c@\cCê\c@\c]\c@\cO\c@\c@\cC\cN\c@ \c@\cT\c@\c@\cB\cT\c@\c]\c@\cU\c@\c@\cA<\c@\cV\c@\cR\c@\c@\c@¢\c@\cL\c@\cM\c@\c@\c@\c?\c@\cD\c@\cH\c@\c@\c@Ö\c@\c@\c@\cC\c@\c@\cAŠ\c@\c@\c@\c@\c@\c@\cB]\c@\c@\c@\c@\c@\c@\cC3\c@\c@\c@\c@\c@\c@\cCÃ\c@\c@\c@\c@\c@\c@\cCè\c@\cA\c@\c@\c@\c@\cC™\c@\cH\c@\c@\c@\c@\cBë\c@\cT\c@\c@\c@\c@\cB\cN\c@\"\c@\c@\c@\c@\cAE\c@-\c@\c@\c@\c@\c@´\c@3\c@\c@\c@\c@\c@“\c@.\c@\c@\c@\c@\c@ð\c@\$\c@\c@\c@\c@\cA¾\c@\cW\c@\c@\c@\c@\cBÄ\c@\cJ\c@\c@\c@\c@\cCß\c@\cA\c@\c@\c@\c@\cDÆ\c@\cA\c@\c@\c@\c@\cEC\c@\cM\c@\c@\c@\c@\cE;\c@!\c@\c@\c@\c@\cD¯\c@8\c@\c@\c@\c@\cCÀ\c@K\c@\c@\c@\c@\cB¥\c@Y\c@\c@\c@\c@\cA£\c@V\c@\c@\c@\c@\c@è\c@D\c@\c@\c@\c@\c@ž\c@/\c@\c@\c@\c@\c@É\c@\cY\c@\c@\c@\cA\cAU\c@\cH\c@\c@\c@\cC\cB\cQ\c@\c@\c@\c@\c@\cF\cBÓ\c@\c@\c@\c@\c@\cH\cCi\c@\c@\c@\c@\c@\cI\cC²\c@\c@\c@\c@\c@\cH\cC \c@\c@\c@\c@\c@\cF\cC<\c@\c@\c@\c@\c@\cC\cBœ\c@\c@\c@\c@\c@\cA\cAÞ\c@\c@\c@\c@\c@\c@\cA/\c@\c@\c@\c@\c@\c@\c@§\c@G\c@\c@\c@\c@\c@G\c@Ø\c@\c@\c@\c@\c@\cP\cA»\c@\c@\c@\c@\c@\c@\cBë\c@\c@\c@\c@\c@\c@\cDg\c@\c@\c@\c@\c@\c@\cEÏ\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cE³\c@\c@\c@\c@\c@\c@\cD_\c@\c@\c@)\c@\c@\cC\cS\c@\c@\c@”\c@\c@\cB\cC\c@\c@\cA\@\c@\c@\cAL\c@\c@\cB)\c@\c@\c@í\c@\cF\cCH\c@\c@\c@Ï\c@\cP\cDe\c@\c@\c@Ñ\c@\c\\cED\c@\c@\c@Ô\c@'\cE¾\c@\c@\c@É\c@/\cE½\c@\c@\c@ª\c@/\cEC\c@\c@\c@\c@&\cDg\c@\c@\c@Y\c@\e\cCO\c@\cI\c@;\c@\cO\cB/\c@+\c@)\c@\cE\cAH\c@g\c@ \c@\c@\c@œ\c@¼\c@\cY\c@\c@\c@/\cA)\c@\cS\c@\c@\c@\c@\cA \c@\cM\c@\c@\c@\c@\cB\cD\c@\cG\c@\c@\c@\cH\cBA\c@\cJ\c@\c@\c@\cU\cBK\c@\e\c@\c@\c@\c_\cB\cX\c@4\c@\c@\c@\$\cA²\c@Q\c@\c@\c@'\cA3\c@o\c@\c@\c@\"\c@Á\c@…\c@\c@\c@\cW\c@`\c@\c@\c@\c@\cK\c@+\c@†\c@\c@\c@\cB\c@R\c@r\c@\c@\c@\cB\c@Ë\c@V\c@\c@\c@\cG\cAq\c@:\c@\c@\c@\cL\cB9\c@&\c@\c@\c@\cK\cC\cI\c@\c^\c@\c@\c@\cL\cCž\c@%\c@\c@\c@\cK\cCÙ\c@:\c@\c@\c@\cG\cC®\c@W\c@\c@\c@\cA\cC%\c@s\c@\c@\c@\c@\cB\\\c@†\c@\c@\c@\c@\cA\c@‹\c@\c@\c@7\c@ä\c@ƒ\c@\c@\c@Ä\c@d\c@p\c@\cB\cA¥\c@\cW\c@Y\c@\cK\cBÑ\c@\c@\c@D\c@\cZ\cDB\c@\c@\c@5\c@,\cE¬\c@\c@\c@0\c@?\cF\@\c@\c@\c@4\c@N\cF\@\c@\c@\c@?\c@R\cF\@\c@\c@\c@P\c@L\cF\@\c@\c@\c@a\c@<\cEm\c@\c@\c@o\c@(\cD\c@\c@\c@\c@w\c@\cW\cB™\c@\c@\c@y\c@\cJ\cA{\c@\cV\c@w\c@\cB\c@ª\c@D\c@y\c@\cB\c@.\c@‰\c@ƒ\c@\cF\c@\c@\c@Ü\c@™\c@\cI\c@\c@\cA9\c@¸\c@\cJ\c@\c@\cA\c?\c@Ù\c@\cJ\c@\c@\cAœ\c@ñ\c@\cI\c@\cA\cAŒ\c@ö\c@\cF\c@\cA\cAO\c@â\c@\cB\c@\cA\c@õ\c@¸\c@\c@\c@\cB\c@Ÿ\c@‚\c@\cI\c@\cC\c@V\c@P\c@6\c@\cD\c@!\c@'\c@\c@\cE\c@\cD\c@\cK\cA\cN\c@\cD\c@\c@\c@\c@\cA¶\c@\cD\c@\c@\c@\cE\cBv\c@\cC\c@\c@\c@\cQ\cC\"\c@\cA\c@\c@\c@\c\\cC—\c@\c@\c@\c@\c@\$\cCÀ\c@\c@\c@\c@\c@&\cC’\c@\c@\c@\c@\c@#\cC\cX\c@\c@\c@\c@\c@\e\cBm\c@\c@\c@\c@\c@\cO\cAº\c@\c@\c@\c@\c@\cC\cA'\c@\c@\c@\c@\c@\cI\c@Ô\c@\c@\c@\c@\c@\c^\c@Ò\c@\c@\c@\c@\c@9\cA\c]\c@\c@\c@\c@\c@W\cAž\c@\c@\c@\c@\c@w\cB1\c@\c@\c@\c@\c@’\cB±\c@\cA\c@\c@\c@¢\cBÿ\c@\cD\c@\c@\c@®\cC\cH\c@\cI\c@\c@\c@¸\cBÊ\c@\cM\c@\c@\c@Á\cBR\c@\cP\c@\c@\c@Ç\cA¹\c@\cP\c@\c@\c@Ä\cA \c@\cM\c@\c@\c@´\c@¥\c@\cI\c@\cU\c@—\c@K\c@\cE\c@`\c@s\c@\cT\c@\cD\c@Ú\c@P\c@\c@\c@\cH\cAu\c@:\c@\c@\c@\cM\cB \c@6\c@\cG\c@\cQ\cB·\c@B\c@\cO\c@\cT\cC\c@\c@[\c@\cV\c@\cQ\cBæ\c@u\c@\cY\c@\cM\cBk\c@‰\c@\e\c@\cI\cA¾\c@\c@\cV\c@\cD\cA\e\c@‰\c@\cN\c@\c@\c@Ž\c@z\c@\cF\c@\c@\c@*\c@h\c@\cA\c@\cJ\c@\cR\c@W\c@\c@\c@\cZ\c@h\c@J\c@\c@\c@0\c@ó\c@?\c@\c@\c@H\cA§\c@4\c@\c@\c@b\cBv\c@+\c@\c@\c@r\cCF\c@#\c@\c@\c@v\cCÏ\c@\c^\c@\c@\c@m\cCý\c@\c_\c@\c@\c@Z\cCÔ\c@%\c@\c@\c@B\cCe\c@+\c@0\c@*\cBÖ\c@0\c@\c@\cW\cBL\c@-\cAJ\c@\cJ\cAé\c@\$\cB0\c@\cB\cAÀ\c@\cZ\cCL\c@\c@\cAÔ\c@\cN\cD`\c@\c@\cB\cU\c@\cE\cE5\c@\c@\cBf\c@\c@\cE©\c@\c@\cB«\c@\c@\cE¥\c@\c@\cBÑ\c@\c@\cE)\c@\c@\cBÕ\c@\c@\cDI\c@\c@\cBÌ\c@\c@\cC.\c@\c@\cBØ\c@\c@\cB\cV\c@\c@\cC \c@\c@\cA2\c@\c@\cCÁ\c@\c@\c@Š\c@\c@\cDÇ\c@\c@\c@\$\c@\c@\cF\c^\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\cB\c@\c@\cF\@\c@\c@\c@\cD\c@\c@\cF\@\c@\c@\c@\cD\c@\c@\cF\@\c@\c@\c@\cD\c@\c@\cF\@\c@\c@\c@\cD\c@\c@\cF\@\c@\c@\c@\cC\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\cB\c@\c@\cF\@\c@\c@\c@\cH\c@\c@\cF\@\c@\c@\c@\cQ\c@\c@\cF\@\c@\c@\c@\c\\c@\c@\cF'\c@M\c@'\c@\c@\cEõ\c@è\c@0\c@\c@\cEÝ\cAÉ\c@5\c@\c@\cEÑ\cBÝ\c@4\c@\c@\cEÈ\cD\c\\c@/\c@\c@\cE¹\cE\c]\c@%\c@\c@\cEŸ\cE¬\c@\cZ\c@\c@\cEr\cE¯\c@\cP\c@\c@\cE3\cE*\c@\cH\c@\c@\cDã\cD:\c@\cC\c@\c@\cD\cC\cQ\c@\cD\c@\c@\cDG\cA÷\c@\cL\c@\c@\cD \cA\cV\c@\cY\c@\c@\cD*\c@v\c@)\c@\c@\cDq\c@\e\c@;\c@\c@\cDî\c@\c@\c@H\c@\c@\cEŽ\c@\c@\c@O\c@\c@\cF0\c@\cB\c@N\c@\c@\cF\@\c@\cB\c@G\c@\c@\cF\@\c@\cB\c@<\c@\c@\cF\@\c@\cB\c@1\c@\c@\cE÷\c@\cB\c@&\c@\c@\cE\cC\c@\c@\c@ \c@\c@\cCê\c@\c@\c@\e\c@\c@\cBã\c@\c@\c@\cW\c@\c@\cB\$\c@\c@\c@\cS\c@\c@\cAÒ\c@\c@\c@\cN\c@\c@\cAø\c@\c@\c@\cI\c@\c@\cB„\c@\c@\c@\cE\c@\c@\cCL\c@\c@\c@\cC\c@\c@\cD\cZ\c@\c@\c@\cD\c@\c@\cD¹\c@\c@\c@\cH\c@\c@\cE\cB\c@\c@\c@\cJ\c@\c@\cDã\c@\c@\c@\cL\c@\c@\cDc\c@\c@\c@\cK\c@\c@\cCœ\c@\c@\c@\cH\c@\c@\cB²\c@\c@\c@\cE\c@\c@\cAÈ\c@\c@\c@\cB\c@\cB\cA\cM\c@9\c@\c@\c@\cF\c@…\c@µ\c@\cB\c@\cM\c@0\cA|\c@\cD\c@\cS\c@\cF\cBŽ\c@\cG\c@\cX\c@\c@\cCë\c@\cH\c@\cY\c@\c@\cEB\c@\cH\c@\cU\c@\c@\cF\@\c@\cF\c@\cP\c@\c@\cF\@\c@\cD\c@\cI\c@\c@\cF\@\c@\cB\c@\cD\c@\c@\cF\@\c@\cC\c@\c@\c@\c@\cEg\c@\cL\c@\c@\c@\c@\cCÿ\c@\cY\c@\c@\c@\cE\cB\c@*\c@\c@\c@G\cA|\c@=\c@\c@\c@Ç\c@¨\c@N\c@\c@\cA‚\c@)\c@X\c@\c@\cBk\c@\c@\c@Y\c@\c@\cCt\c@\c@\c@R\c@\c@\cDH\c@\c@\c@D\c@\c@\cD¹\c@\cD\c@0\c@\c@\cD¬\c@\cR\c@\c_\c@\c@\cD \c@\$\c@\cQ\c@\cB\cC1\c@6\c@\cF\c@\cJ\cB,\c@H\c@\c@\c@\cW\cAG\c@V\c@\c@\c@&\c@”\c@\\\c@\c@\c@6\c@Y\c@\\\c@\c@\c@D\c@²\c@\\\c@\c@\c@K\cAn\c@_\c@\c@\c@I\cBR\c@h\c@\c@\c@>\cCN\c@u\c@\c@\c@.\cD\cT\c@ƒ\c@\c@\c@\c^\cDe\c@\c@\c@\c@\cQ\cD,\c@Ž\c@\c@\c@\cF\cCv\c@„\c@\c@\c@\c@\cBy\c@l\c@\c@\c@\c@\cA\c@N\c@\c@\c@\cB\c@Ê\c@2\c@\c@\c@\cF\c@n\c@\cY\c@\c@\c@\cK\c@´\c@\cG\c@\c@\c@\cN\cAŽ\c@\c@\c@\c@\c@\cP\cB«\c@\c@\c@\c@\c@\cO\cCù\c@\cF\c@\c@\c@\cK\cE5\c@\cN\c@\c@\c@\cG\cF\cH\c@\cV\c@\c@\c@\cC\cF\@\c@\c_\c@\c@\c@\c@\cEç\c@'\c@\c@\c@\c@\cE\c@\c@*\c@\c@\c@\c@\cCÂ\c@+\c@\c^\c@\c@\cB|\c@,\c@~\c@\c@\cAp\c@/\cA\"\c@\c@\c@§\c@7\cB\cI\c@\c@\c@,\c@G\cC.\c@\c@\c@\c@\c@_\cDf\c@\c@\c@\c@\c@|\cEn\c@\c@\c@\c@\c@š\cF\cX\c@\cA\c@\c@\c@¯\cF\@\c@\cD\c@\c@\c@µ\cEò\c@\cH\c@\c@\c@¦\cE)\c@\cL\c@\c@\c@†\cD\cQ\c@\cQ\c@\c@\c@^\cBØ\c@\cS\c@\cY\c@9\cAÄ\c@\cS\c@ƒ\c@\cY\c@ð\c@\cO\cA6\c@\cK\c@`\c@\cK\cB\c_\c@\cM\c@\cQ\c@\cF\cC\$\c@\cU\c@\c@\c@\cB\cD\cX\c@\e\c@\cF\c@\c@\cDž\c@\c^\c@\cP\c@\c@\cD‘\c@\c^\c@\cZ\c@\c@\cCô\c@\c]\c@!\c@\c@\cBê\c@!\c@&\c@\c@\cAì\c@.\c@%\c@\c@\cA\cJ\c@C\c@\c\\c@\c@\c@b\c@\\\c@\cR\c@\c@\c@\cD\c@o\c@\cI\c@\c@\c@N\c@w\c@\cC\c@\c@\c@Ý\c@p\c@\c@\c@\c@\cA\c@`\c@\c@\c@\c@\cBu\c@M\c@\c@\c@\c@\cC]\c@>\c@\c@\c@\c@\cCî\c@7\c@\c@\c@\c@\cD\cE\c@6\c@\c@\c@\c@\cC¤\c@7\c@\c@\c@\c@\cBã\c@3\c@\c@\c@\c@\cAþ\c@)\c@\c@\c@\c@\cA3\c@\c^\c@\c@\c@H\c@’\c@\cR\c@\c@\c@÷\c@)\c@\cG\c@\c@\cB\cT\c@\c@\c@\c@\c@\c@\cC•\c@\c@\c@\c@\c@\cC\cEt\c@\c@\c@\cB\c@\cH\cF\@\c@\c@\c@\cF\c@\cN\cF\@\c@\c@\c@\cJ\c@\cS\cF\@\c@\c@\c@\cL\c@\cW\cF\@\c@\c@\c@\cL\c@\cX\cF\@\c@\c@\c@\cK\c@\cV\cF\@\c@\c@\c@\cH\c@\cS\cE¿\c@\c@\c@\cD\c@\cP\cCà\c@ \c@\c@\c@\cN\cBS\c@`\c@\cD\c@\cN\cA+\c@¾\c@\cL\c@\cO\c@l\cA3\c@\cV\c@\cO\c@\cM\cA¾\c@ \c@\cM\c@\cF\cB7\c@*\c@\cJ\c@\cZ\cBŒ\c@.\c@\cG\c@.\cBµ\c@*\c@\cC\c@\@\cB¶\c@!\c@\cA\c@P\cBž\c@\cW\c@\c@\c@Z\cB„\c@\cM\c@\c@\c@U\cB„\c@\cE\c@\cA\c@J\cB·\c@\c@\c@\cD\c@\@\cC,\c@\c@\c@\cI\c@:\cCæ\c@\c@\c@\cM\c@7\cD×\c@\c@\c@\cO\c@7\cEä\c@\c@\c@\cN\c@6\cF\@\c@\c@\c@\cL\c@2\cF\@\c@\c@\c@\cH\c@(\cF\@\c@\c@\c@\cC\c@\c]\cF\@\c@\c@\c@\c@\c@\cS\cF\@\c@\c@\c@\c@\c@\cI\cF\@\c@\c@\c@\c@\c@\cA\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\$\cF\@\c@\c@\c@\c@\c@}\cF\@\c@\c@\c@\c@\cA\cT\cF\@\c@\c@\c@\c@\cAë\cF\@\c@\c@\c@\c@\cC\cE\cF\@\c@\c@\c@\c@\cD0\cF\@\c@\c@\c@\c@\cE>\cF\@\c@\c@\c@\c@\cF\cC\cF\@\c@\c@\c@\c@\cF\@\cF\@\c@\c@\c@\c@\cF:\cF\@\c@\c@\c@\c@\cE£\cF\@\c@\c@\c@\c@\cD²\cF\@\c@\c@\c@\c@\cC\cF\@\c@\c@\c@\c@\cBl\cF\@\c@\c@\c@\c_\cAu\cF\@\c@\c@\c@l\c@Á\cF\@\c@\c@\c@æ\c@M\cF\@\c@\c@\cA‰\c@\cQ\cF\@\c@\c@\cBS\c@\cE\cF\@\c@\c@\cC\cY\c@\cN\cEÉ\c@\c@\cC±\c@\cX\cET\c@\c@\cD\c@\c@ \cDõ\c@\c@\cCö\c@)\cD®\c@\c@\cC”\c@.\cDz\c@\c@\cBí\c@-\cDM\c@\c@\cB&\c@,\cD\c]\c@\c@\cAl\c@*\cCá\c@\c@\c@ê\c@(\cC—\c@\c@\c@Á\c@'\cC>\c@\c@\c@ÿ\c@&\cBØ\c@\c@\cA•\c@\$\cBk\c@\c@\cB_\c@!\cAÿ\c@\c@\cC+\c@\c_\cA˜\c@\cD\cCÈ\c@\c]\cAA\c@\cJ\cD\cN\c@\cZ\c@ÿ\c@\cP\cCí\c@\cV\c@Ú\c@\cU\cCn\c@\cR\c@Ì\c@\cZ\cB±\c@\cN\c@Ñ\c@\c]\cAå\c@\cJ\c@Ü\c@!\cA;\c@\cG\c@â\c@)\c@Ù\c@\cE\c@Ù\c@6\c@Ó\c@\cC\c@¾\c@H\cA'\c@\cB\c@”\c@Z\cA½\c@\cA\c@e\c@g\cBn\c@\c@\c@<\c@j\cC\cR\c@\c@\c@\c]\c@`\cC…\c@\c@\c@\cI\c@K\cC¬\c@\c@\c@\c@\c@4\cCƒ\c@\c@\c@\c@\c@\c^\cC\cR\c@\c@\c@\c@\c@\cM\cBp\c@\c@\c@\c@\c@\cB\cAº\c@\c@\c@\c@\c@\cB\cA\cU\c@\c@\c@\e\c@\cE\c@–\c@\c@\c@Y\c@\cF\c@?\c@\c@\c@¹\c@\cG\c@\cN\c@\c@\cA1\c@\cH\c@\cI\c@\c@\cA¿\c@\cL\c@\cU\c@\c@\cB<\c@\cU\c@ \c@\c@\cBˆ\c@&\c@)\c@\c@\cB‘\c@=\c@2\c@\c@\cBT\c@W\c@1\c@\c@\cAÝ\c@j\c@(\c@\c@\cAM\c@r\c@\c]\c@\c@\c@Ì\c@l\c@\cR\c@\c@\c@c\c@[\c@\cK\c@\c@\c@1\c@E\c@\cF\c@\c@\c@Y\c@2\c@\cC\c@\c@\c@È\c@\$\c@\cA\c@\c@\cAV\c@\c^\c@\cA\c@\c@\cAù\c@\c\\c@\c@\c@\c@\cB“\c@\c\\c@\c@\c@\c@\cBó\c@\c\\c@\c@\c@\c@\cC\cE\c@\e\c@\c@\c@\c@\cBÈ\c@\cZ\c@\cW\c@\c@\cBK\c@\c^\c@`\c@\c@\cA©\c@\$\c@Ü\c@\c@\cA\cP\c@.\cA‡\c@\c@\c@•\c@8\cB^\c@\c@\c@<\c@\@\cC=\c@\c@\c@\cJ\c@B\cCñ\c@\c@\c@\c@\c@A\cDZ\c@\c@\c@\c@\c@=\cDe\c@\c@\c@\c@\c@=\cD\cP\c@\c@\c@\c@\c@C\cCm\c@\c@\c@\c@\c@O\cB›\c@\c@\c@\c@\c@]\cA¿\c@\c@\c@\c@\c@h\cA\cJ\c@\cH\c@\c@\c@j\c@ƒ\c@3\c@\c@\c@`\c@-\c@‚\c@\c@\c@L\c@\cD\c@ö\c@\c@\c@6\c@\c@\cAˆ\c@\c@\c@\$\c@\c@\cB,\c@\c@\c@\c]\c@\cA\cB¹\c@\c@\c@\"\c@\cD\cC\cT\c@\c@\c@4\c@\cH\cC/\c@\c@\c@K\c@\cN\cC\cG\c@\c@\c@c\c@\cW\cB¥\c@\c@\c@x\c@\c_\cB\c\\c@\c@\c@‡\c@'\cA…\c@\c@\c@\c@-\c@ö\c@\c@\c@’\c@1\c@Š\c@\cA\c@’\c@1\c@?\c@\cZ\c@\c@.\c@\cR\c@H\c@Š\c@&\c@\cE\c@‰\c@\c@\c\\c@\cP\c@Ö\c@q\c@\cS\c@\e\cA,\c@Y\c@\cK\c@\$\cAk\c@?\c@\cD\c@,\cA…\c@(\c@\c@\c@-\cAt\c@\cT\c@\c@\c@'\cA=\c@\cE\c@\cD\c@\c\\c@ê\c@\cB\c@+\c@\cQ\c@š\c@\cP\c@v\c@\cH\c@U\c@&\c@è\c@\cC\c@\"\c@C\cA\c?\c@\c@\c@\cD\c@f\cB5\c@\cB\c@\c@\c@Ž\cBà\c@\cE\c@\c@\c@°\cCe\c@\cG\c@\c@\c@É\cC¯\c@\cH\c@\c@\c@Ù\cC°\c@\cI\c@\c@\c@ß\cCi\c@\cH\c@\c@\c@Ø\cBä\c@\cE\c@\c@\c@Ä\cB8\c@\cB\c@\c@\c@§\cA€\c@\c@\c@\c@\c@…\c@è\c@\c@\c@\cG\c@d\c@u\c@\c@\c@A\c@O\c@)\c@\c@\c@©\c@K\c@\cC\c@\cA\cA8\c@\\\c@\c@\c@\cA\cAà\c@|\c@\c@\c@\cA\cB\c@¤\c@\c@\c@\cA\cC\cM\c@Æ\c@\c@\c@\cA\cC>\c@×\c@\c@\c@\cA\cC\cY\c@Î\c@\c@\c@\c@\cB«\c@«\c@\c@\c@\c@\cB\cM\c@|\c@\cF\c@\c@\cAa\c@N\c@\cR\c@\c@\c@Ò\c@(\c@\c_\c@\c@\c@e\c@3\c@,\c@\c@\c@ \c@‚\c@8\c@\c@\c@\c@\cA\cS\c@9\c@\c@\c@\c@\cAÝ\c@1\c@\c@\c@\c@\cBÜ\c@\$\c@\c@\c@\c@\cCß\c@\cV\c@\c@\c@\c@\cD¼\c@\cJ\c@\c@\c@\c@\cEN\c@\cB\c@\c@\c@\c@\cE}\c@\c@\c@\c@\c@\c@\cEC\c@\c@\c@\cA\c@\c@\cD®\c@\c@\c@\cF\c@\c@\cCÜ\c@\c@\c@\cK\c@\c@\cBð\c@\c@\c@\cQ\c@\c@\cB\cN\c@\c@\c@\cU\c@\cZ\cAP\c@\c@\c@\cV\c@k\c@Æ\c@\c@\c@\cR\c@î\c@q\c@\c@\c@\cM\cAœ\c@I\c@\c@\c@\cG\cBm\c@\@\c@\c@\c@\cB\cC;\c@F\c@\c@\c@\c@\cCÐ\c@O\c@\c@\c@\c@\cD\cR\c@P\c@\cB\c@\c@\cCö\c@E\c@\cG\c@\c@\cCƒ\c@5\c@\cO\c@\c@\cBÒ\c@#\c@\cX\c@\c@\cB\cA\c@\cW\c@!\c@\c@\cAD\c@'\c@'\c@\c@\c@¯\c@_\c@'\c@\c@\c@H\c@É\c@!\c@\c@\c@\cN\cAg\c@\cX\c@\cA\c@\c@\cB5\c@\cP\c@\cF\c@\c@\cC\cZ\c@\cL\c@\cN\c@\c@\cCô\c@\cM\c@\cY\c@\c@\cD›\c@\cS\c@%\c@\c@\cDì\c@\cY\c@0\c@\c@\cDÒ\c@\c]\c@6\c@\c@\cDN\c@\c]\c@8\c@\c@\cCv\c@\cW\c@4\c@\c@\cBt\c@\cP\c@,\c@\c@\cAŠ\c@\cH\c@%\c@#\c@Ð\c@\cC\c@ \c@\c@Q\c@\c@\c@!\cA\cX\c@\cM\c@\c@\c@*\cAÞ\c@\c@\c@\c@\c@7\cBË\c@\cF\c@\c@\c@C\cC¬\c@\cO\c@\c@\c@D\cDH\c@\c\\c@\c@\c@9\cD€\c@0\c@\c@\c@-\cDI\c@L\c@\c@\c@\c\\cC®\c@l\c@\c@\c@\cJ\cBÏ\c@Œ\c@\c@\c@\cT\cAá\c@©\c@\c@\c@m\cA\e\c@¼\c@\c@\cA\cW\c@„\c@Ã\c@\c@\cB\cY\c@%\c@½\c@\c@\cCo\c@\c@\c@¬\c@\c@\cDÿ\c@\c@\c@™\c@\c@\cF\@\c@\c@\c@†\c@\c@\cF\@\c@\c@\c@w\c@\c@\cF\@\c@\c@\c@n\c@\c@\cF\@\c@\c@\c@l\c@\c@\cF\@\c@\c@\c@s\c@\c@\cF\@\c@\c@\c@‚\c@\c@\cD÷\c@\c@\c@›\c@\c@\cC½\c@\c@\c@¹\c@\c@\cBß\c@\c@\c@Ø\c@\c@\cB„\c@\c@\c@ï\c@\c@\cB°\c@\c@\c@ù\c@\c@\cCB\c@\c@\c@ô\c@\c@\cD\cA\c@\c@\c@ã\c@\c@\cD­\c@\c@\c@Í\c@\c@\cE\cO\c@\c@\c@º\c@\c@\cE\cG\c@\c@\c@¯\c@\c@\cDš\c@\c@\c@­\c@\c@\cCä\c@\c@\c@°\c@\c@\cC\cW\c@\c@\c@³\c@\c@\cBf\c@\c@\c@°\c@\c@\cAü\c@\c@\c@§\c@\c@\cAí\c@\c@\c@™\c@\c@\cB3\c@\c@\c@Š\c@\c@\cBµ\c@\c@\c@~\c@\c@\cCK\c@\c@\c@v\c@\c@\cCË\c@\c@\c@p\c@\c@\cD\cU\c@\c@\c@h\c@\c@\cD\cW\c@\c@\c@[\c@\c@\cCÑ\c@\c@\c@K\c@\c@\cCR\c@\c@\c@;\c@\c@\cB·\c@\c@\c@1\c@\c@\cB\cY\c@\c@\c@3\c@\c@\cA\c@\cE\c@\@\c@\c@\cA'\c@.\c@W\c@\c@\c@ä\c@z\c@p\c@\c@\c@½\c@ä\c@†\c@\c@\c@ª\cAe\c@•\c@\c@\c@ \cAò\c@œ\c@\c@\c@–\cB_\c@™\c@\c@\c@Œ\cB•\c@‘\c@\c@\c@\c?\cB\c@\c@\c@\c@q\cBS\c@m\c@\c@\c@d\cAò\c@U\c@\cD\c@Y\cA†\c@<\c@+\c@N\cA\$\c@&\c@v\c@C\c@Þ\c@\cW\c@è\c@8\c@¹\c@\cO\cA}\c@/\c@³\c@\cO\cB-\c@'\c@Â\c@\cT\cBÍ\c@%\c@Û\c@\cX\cC\@\c@(\c@õ\c@\cY\cCn\c@0\cA\cM\c@\cV\cCN\c@;\cA!\c@\cQ\cBå\c@F\cA1\c@\cI\cBH\c@N\cAA\c@\cC\cA™\c@N\cAV\c@\cC\c@þ\c@F\cAm\c@\cE\c@š\c@7\cA‰\c@\cE\c@‚\c@&\cAª\c@\cE\c@¸\c@\cV\cAÏ\c@\cE\cA-\c@\cJ\cAö\c@\cC\cAÁ\c@\cB\cB\c^\c@\cB\cBR\c@\c@\cBB\c@\cF\cB¾\c@\c@\cB]\c@\cL\cBï\c@\c@\cBk\c@\cQ\cBÞ\c@\c@\cBh\c@\cS\cB\c@\c@\cBW\c@\cS\cB\cW\c@\c@\cB\@\c@\cP\cA‹\c@\c@\cB2\c@\cJ\cA\c@\c@\c@\cB=\c@\cD\c@”\c@\c@\cBp\c@\c@\c@F\c@\c@\cBÓ\c@\c@\c@\cW\c@\c@\cCb\c@\c@\c@\c@\c@\c@\cD\cM\c@\c@\c@\c@\c@\c@\cD½\c@\c@\c@\c@\c@\c@\cEU\c@\c@\c@\c@\c@\c@\cEº\c@\c@\c@\c@\c@\c@\cEÛ\c@\c@\c@\c@\c@\c@\cE±\c@\cB\c@\c@\c@\c@\cED\c@\cJ\c@\c@\c@\c@\cD¥\c@\cU\c@\c@\c@\c@\cCñ\c@!\c@\c@\c@\c@\cCH\c@)\c@\c@\c@\c@\cBÊ\c@,\c@\c@\c@\c@\cB‹\c@&\c@\c@\c@\c@\cB—\c@\c\\c@\c@\c@\c@\cBæ\c@\cP\c@\c@\c@\c@\cCc\c@\cF\c@\cD\c@\c@\cCï\c@\c@\c@\cM\c@\c@\cDh\c@\c@\c@\cX\c@\c@\cD°\c@\c@\c@#\c@\c@\cD³\c@\c@\c@-\c@\c@\cDp\c@\c@\c@/\c@\c@\cCò\c@\c@\c@)\c@\c@\cCR\c@\c@\c@\c_\c@\c@\cB±\c@\c@\c@\cT\c@\c@\cB.\c@\c@\c@\cI\c@\c@\cAÞ\c@\cA\c@\cB\c@\c@\cAÍ\c@\cL\c@\c@\c@\c@\cAö\c@!\c@\c@\c@\c@\cBE\c@>\c@\c@\c@\c@\cB¡\c@_\c@\c@\c@\c@\cBð\c@\c@\c@\c@\c@\cC\c]\c@˜\c@\c@\c@\c@\cC\cZ\c@¡\c@\c@\c@\c@\cBè\c@œ\c@\cJ\c@\c@\cB\c@Œ\c@M\c@\c@\cB\c^\c@w\c@È\c@\c@\cA¦\c@_\cA}\c@\c@\cA;\c@G\cBb\c@\c@\c@é\c@0\cCj\c@\c@\c@¸\c@\c^\cDO\c@\c@\c@¢\c@\cP\cDî\c@\c@\c@Ÿ\c@\cE\cE+\c@\c@\c@Ÿ\c@\c@\cDý\c@\c@\c@–\c@\c@\cDk\c@\c@\c@‚\c@\c@\cC‘\c@\c@\c@i\c@\c@\cB‘\c@\c@\c@^\c@\c@\cA¥\c@\c@\c@u\c@\c@\c@é\c@\c@\c@Á\c@\c@\c@d\c@\c@\cAE\c@\c@\c@\cW\c@\c@\cAù\c@\c@\c@\c@\c@\c@\cBÀ\c@\c@\c@\c@\c@\cG\cCz\c@\c@\c@\c@\c@\cV\cCÿ\c@\c@\c@\c@\c@*\cD9\c@\c@\c@\c@\c@\@\cD\cZ\c@\c@\c@\c@\c@U\cC­\c@\c@\c@\c@\c@b\cC\cF\c@\c@\c@\c@\c@a\cBF\c@\c@\c@\c@\c@S\cA‹\c@\c@\c@\c@\c@=\c@í\c@\cY\c@\c@\c@'\c@|\c@p\c@\cB\c@\cT\c@4\cA\cH\c@\cC\c@\cG\c@\cO\cAÞ\c@\cC\c@\c@\c@\c@\cBí\c@\cC\c@\cD\c@\c@\cD\cP\c@\cC\c@\cM\c@\c@\cE\cC\c@\cA\c@\e\c@\c@\cE›\c@\c@\c@,\c@\c@\cEº\c@\c@\c@\@\c@\c@\cEX\c@\cE\c@P\c@\c@\cD‡\c@4\c@Y\c@\cB\cCn\c@Ž\c@Y\c@\cE\cBH\cA\cW\c@P\c@\cI\cAV\cAÉ\c@B\c@\cM\c@ \cB\c@4\c@\cQ\c@.\cC`\c@*\c@\cR\c@\c@\cCò\c@(\c@\cO\c@\cU\cD;\c@/\c@\cL\c@.\cD1\c@=\c@\cH\c@C\cCØ\c@O\c@\cD\c@N\cCA\c@`\c@\c@\c@U\cBˆ\c@m\c@\c@\c@H\cAÊ\c@t\c@\c@\c@1\cA\"\c@v\c@\cQ\c@\cY\c@¢\c@w\c@Y\c@\cG\c@L\c@|\c@Ø\c@\c@\c@!\c@ˆ\cAˆ\c@\c@\c@\cW\c@œ\cB`\c@\c@\c@\c_\c@¶\cCG\c@\c@\c@'\c@Ð\cD\c@\c@\c@\c@(\c@ç\cDi\c@\c@\c@\$\c@ø\cDs\c@\c@\c@\e\cA\cB\cD\c_\c@\c@\c@\cO\cA\cI\cC\c?\c@\c@\c@\cC\cA\cN\cB³\c@\c@\c@'\cA\cV\cAÛ\c@\cA\c@\c?\cA!\cA#\c@\cC\cA\cN\cA.\c@™\c@\cD\cAÓ\cA:\c@=\c@\cD\cBÎ\cAC\c@\cL\c@\cD\cCÇ\cAI\c@\c@\c@\cC\cD˜\cAK\c@\c@\c@\cB\cE\cZ\cAK\c@\c@\c@\cG\cE7\cAM\c@\c@\c@\cS\cDé\cAP\c@\c@\c@ \cDB\cAT\c@\c@\c@*\cCa\cAX\c@\c@\c@.\cBm\cAZ\c@\c@\c@+\cAŠ\cAV\c@\cF\c@!\c@Ý\cAM\c@6\c@\cU\c@f\cA<\c@\c@\cI\c@!\cA&\cA\cL\c@\cA\c@\cB\cA\cK\cA¦\c@\c@\c@\c@\c@ð\cBP\c@\c@\c@\c@\c@×\cBÕ\c@\cC\c@\c@\c@Â\cC\cZ\c@\cI\c@\cG\c@±\cC\cQ\c@\cO\c@\cS\c@¦\cB»\c@\cT\c@#\c@ž\cB(\c@\cV\c@2\c@—\cA}\c@\cT\c@\@\c@‘\c@é\c@\cO\c@C\c@‹\c@t\c@\cI\c@<\c@„\c@O\c@\cC\c@-\c@}\c@€\c@\c@\c@\c]\c@u\c@ÿ\c@\c@\c@\cN\c@m\cAŸ\c@\c@\c@\cD\c@b\cBY\c@\c@\c@\c@\c@T\cBý\c@\c@\c@\c@\c@D\cCj\c@\c@\c@\cA\c@5\cC•\c@\c@\c@\cD\c@'\cC|\c@\c@\c@\cH\c@\c]\cC,\c@\c@\c@\cK\c@\cV\cBº\c@\c@\c@\cM\c@\cR\cB>\c@\c@\c@\cM\c@\cN\cAÌ\c@\c@\c@\cJ\c@\cK\cAu\c@;\c@\cF\c@\cI\cAB\c@´\c@\cC\c@\cG\cA4\cAn\c@\c@\c@\cJ\cAG\cB_\c@\c@\c@\cR\cAo\cCƒ\c@\c@\c@\c_\cAŸ\cDˆ\c@\c@\c@1\cAÈ\cE<\c@\c@\c@D\cAà\cEx\c@\c@\c@T\cAã\cE*\c@\c@\c@^\cA×\cD`\c@\c@\c@_\cAÌ\cC?\c@\c@\c@W\cAÕ\cB\$\c@\c@\c@G\cB\cI\cA2\c@\c@\c@3\cBv\c@\c?\c@\c@\c@!\cC \c@\cW\c@\c@\c@\cQ\cCù\c@\c@\c@\c@\c@\cG\cDç\c@\c@\c@\c@\c@\cA\cEÈ\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\@\c@\c@\c@\c@\c@\c@\cF\cX\c@\c@\c@\c@\c@\c@\cE^\c@\c@\c@\c@\c@\c@\cD–\c@\c@\c@\c@\c@\c@\cCÚ\c@\c@\c@\c@\c@\c@\cC\@\c@\cA\c@\c@\c@\c@\cBÐ\c@A\c@\c@\c@\c@\cB\c@À\c@\c@\c@\c@\cBt\cAx\c@\c@\c@\c@\cBt\cBV\c@\c@\c@\c@\cB~\cCG\c@\c@\c@\c@\cB„\cCò\c@\c@\c@\c@\cBy\cD+\c@\c@\c@\c@\cB[\cCâ\c@\c@\c@\c@\cB1\cC*\c@\c@\c@\c@\cB\cJ\cB9\c@\c@\c@\c@\cAû\cA_\c@\c@\c@\c@\cB\e\c@ª\c@\c@\c@\c@\cBz\c@4\c@\c@\c@\c@\cC\cY\c@\c@\c@\c@\c@\c@\cCé\c@\c@\c@\c@\c@\cD\cDÍ\c@\c@\c@\c@\c@\cM\cEš\c@\c@\c@\c@\c@\cR\cF(\c@\c@\c@\c@\c@\cP\cF\@\c@\c@\c@\c@\c@\cQ\cF\cZ\c@\c@\c@\c@\c@\cO\cE|\c@\c@\c@\c@\c@\cH\cD›\c@\c@\c@\c@\c@\c@\cC¡\c@\c@\c@\c@\c@\cX\cB¹\c@\c@\c@\c@\c@}\cB\cB\c@\c@\c@\c@\cA5\cA‹\c@\c@\c@\c@\cB:\cAO\c@\c@\c@\c@\cC\c?\cA<\c@\c@\c@\c@\cDÝ\cA>\c@\c@\c@\c@\cEô\cAA\c@\c@\c@\c@\cF\@\cA9\c@\c@\c@\c@\cF\@\cA'\c@\c@\c@\c@\cEà\cA\cN\c@\c@\c@\c@\cDÈ\c@ô\c@\c@\c@\c@\cC}\c@ß\c@\c@\c@\c@\cBG\c@Ð\c@\c@\c@\c@\cAg\c@Æ\c@\c@\c@\c@\cA\cA\c@Á\c@\c@\c@\c@\cA\cX\c@½\c@\c@\c@\c@\cAŒ\c@¸\c@\cG\c@\cE\cB,\c@°\c@\cS\c@\cM\cB¿\c@¦\c@!\c@\cT\cC\cY\c@˜\c@,\c@\cU\cC\"\c@‰\c@1\c@\cU\cBÜ\c@z\c@,\c@\cR\cB[\c@n\c@#\c@\cL\cA½\c@g\c@\cV\c@\cD\cA\"\c@c\c@\cH\c@\c@\c@¦\c@_\c@\cB\c@\cJ\c@P\c@Y\c@\cU\c@A\c@\c]\c@N\c@4\c@¢\c@\cL\c@>\c@Y\cA*\c@\cQ\c@+\c@z\cAÒ\c@\cX\c@\cZ\c@“\cB‰\c@\c\\c@\cM\c@‘\cC\e\c@\c\\c@\cD\c@x\cCl\c@\cW\c@\cB\c@U\cCo\c@\cO\c@\cC\c@1\cC#\c@\cG\c@\cD\c@\cS\cB\c@\cE\c@\cD\c@\cB\cAû\c@\cK\c@\cD\c@\c@\cAg\c@\cU\c@\cC\c@\c@\cA\cD\c@ \c@\cB\c@\cD\c@é\c@,\c@\c@\c@\cX\cA\c\\c@3\c@\c@\c@:\cA\c@4\c@\c@\c@c\cB\e\c@1\c@\c@\c@Š\cB \c@+\c@\c@\c@§\cB÷\c@\$\c@\c@\c@¨\cC\cI\c@\c^\c@\c@\c@\cBÍ\c@\cZ\c@\c@\c@g\cBU\c@\cZ\c@\c@\c@>\cA¼\c@\c]\c@\c@\c@\"\cA)\c@%\c@\c@\c@\c_\c@Á\c@2\c@\c@\c@5\c@œ\c@\@\c@\c@\c@N\c@Ä\c@P\c@\c@\c@a\cA.\c@\\\c@\c@\c@g\cAÅ\c@b\c@\c@\c@Y\cBd\c@_\c@\c@\c@B\cBë\c@V\c@\c@\c@'\cC:\c@G\c@\c@\c@\cQ\cCD\c@7\c@\c@\c@\cN\cC\cD\c@*\c@\c@\c@\c\\cBŒ\c@#\c@\c@\c@/\cAô\c@\$\c@\c@\c@A\cAc\c@-\c@\c@\c@N\c@ø\c@=\c@\c@\c@M\c@Î\c@Q\c@\c@\c@>\c@î\c@h\c@\c@\c@,\cAP\c@|\c@\c@\c@\cY\cAÚ\c@Š\c@\c@\c@\cI\cBm\c@\c@\c@\c@\c@\cBå\c@‰\c@\c@\c@\cG\cC)\c@{\c@\c@\c@\cR\cC,\c@f\c@\c@\c@\c]\cBï\c@O\c@\c@\c@\$\cB\c?\c@9\c@\c@\c@'\cAð\c@'\c@\c@\c@#\cAY\c@\cY\c@\c@\c@\cZ\c@Õ\c@\cP\c@\cR\c@\cN\c@r\c@\cJ\c@J\c@\cD\c@/\c@\cH\c@¢\c@\cC\c@\cJ\c@\cE\cA\cP\c@\cS\c@\c@\c@\cC\cA†\c@,\c@\cC\c@\cC\cAè\c@J\c@\cE\c@\cA\cB\cR\c@h\c@\cE\c@\c@\cA÷\c@€\c@\cE\c@\c@\cA£\c@ƒ\c@\cE\c@\c@\cA+\c@r\c@\cC\c@\c^\c@¼\c@T\c@\c@\c@„\c@`\c@6\c@\c@\cA4\c@!\c@\cZ\c@\c@\cB)\c@\cA\c@\cG\c@\c@\cCZ\c@\c@\c@\c@\c@\c@\cDœ\c@\cC\c@\c@\c@\c@\cE¥\c@\cG\c@\c@\c@\c@\cF\@\c@\cI\c@\c@\c@\c@\cF\@\c@\cJ\c@\c@\c@\c@\cF\cM\c@\cJ\c@\c@\c@\c@\cEB\c@\cH\c@\c@\c@\c@\cD.\c@\cE\c@\c@\c@\c@\cC\cA\c@\cA\c@\c@\c@\c@\cAç\c@\c@\c@\c@\c@0\cA\cQ\c@\c@\c@\c@\c@“\c@{\c@\c@\c@\c@\cA(\c@\$\c@\c@\c@\c@\cAç\c@\c@\c@\c@\c@\cA\cBÊ\c@\cA\c@\c@\c@\cO\cC’\c@\cD\c@\c@\c@&\cD\c\\c@\cF\c@\c@\c@B\cDN\c@\cG\c@\c@\c@]\cD!\c@\cG\c@\c@\c@q\cC \c@\cF\c@\c@\c@p\cBâ\c@\cC\c@\c@\c@\\\cB\cH\c@\cA\c@\c@\c@B\cAF\c@\c@\c@\cJ\c@&\c@¯\c@\c@\c@=\c@\cN\c@F\c@\c@\c@”\c@\c@\c@\cL\c@\c@\cA\cI\c@\cD\c@\c@\c@\c@\cA\c@\cP\c@\c@\c@\c@\cB\cS\c@\c_\c@\c@\c@\c@\cBl\c@-\c@\c@\c@\c@\cB…\c@6\c@\c@\c@\c@\cB\\\c@7\c@\c@\c@\c@\cAþ\c@.\c@\c@\c@\c@\cA\c?\c@ \c@\c@\c@\c@\c@ü\c@\cQ\c@\c@\c@\c@\c@’\c@\cE\c@\c@\c@\c@\c@J\c@\c@\c@\c@\c@\c@\c@;\c@\c@\c@\c@\c@\c@\c@h\c@\c@\c@\c@\c@\c@\c@Ä\c@\c@\c@\c@\c@\c@\cA6\c@\c@\c@\c@\c@\c@\cA²\c@\c@\c@\c@\c@\c@\cB\cU\c@\c@\c@\c@\c@\c@\cBJ\c@\c@\c@\c@\c@\c@\cBG\c@\c@\c@\c@\c@\c@\cB\cM\c@\c@\c@\c@\c@\c@\cA«\c@\c@\c@\c@\c@\c@\cA9\c@\c@\c@\c@\c@\c@\c@Ð\c@\cG\c@\c@\c@\c@\c@‰\c@\e\c@\c@\c@\c@\c@r\c@;\c@\c@\c@\c@\c@\c@b\c@\c@\c@\c@\c@Õ\c@ˆ\c@\c@\c@\c@\cA2\c@£\c@\c@\c@\c@\cA\c@¥\c@\c@\c@\c@\cAÑ\c@Ž\c@\c@\c@\c@\cAï\c@h\c@\c@\c@\c@\cAã\c@B\c@\c@\c@\c@\cA±\c@\c_\c@\c@\c@\c@\cAf\c@\cH\c@,\c@\c@\cA\cO\c@\cC\c@Ž\c@\c@\c@º\c@\cG\cA\$\c@\c@\c@s\c@\cG\cAâ\c@\c@\c@>\c@\cG\cBÃ\c@\c@\c@\c\\c@\cH\cC‹\c@\c@\c@\cJ\c@\cE\cD\cQ\c@\c@\c@\cC\c@\cB\cD\@\c@\c@\c@\cA\c@\c@\cD\cQ\c@\cA\c@\cA\c@\c@\cC“\c@\cC\c@\c@\c@\c@\cBß\c@\cG\c@\c@\c@\c@\cB\cU\c@\cK\c@\c@\c@\c@\cAT\c@\cM\c@\c@\c@a\c@À\c@\cM\c@\c@\cA*\c@X\c@\cK\c@\c@\cBV\c@\cZ\c@\cH\c@\c@\cCÏ\c@\c@\c@\cD\c@\c@\cE\c@\c@\c@\cA\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cF\@\c@\cB\c@\c@\c@\c@\cE>\c@\c@\c@\c@\c@\c@\cC–\c@\c@\c@\c@\c@\c@\cB2\c@\cA\c@\c@\c@\c@\cA!\c@\cG\c@\c@\c@ \c@j\c@\cQ\c@\c@\c@t\c@\cJ\c@\c\\c@\c@\c@ÿ\c@\c@\c@&\c@\c@\cA½\c@\c@\c@-\c@\c@\cB©\c@\c@\c@*\c@\c@\cC•\c@\c@\c@!\c@\c@\cDQ\c@\c@\c@\cW\c@\c@\cDº\c@\c@\c@\cL\c@\c@\cD¾\c@\c@\c@\cC\c@\c@\cD]\c@\c@\c@\cD\c@\c@\cC«\c@\c@\c@5\c@\c@\cBË\c@\c@\c@–\c@\c@\cAâ\c@\c@\cA*\c@\c@\cA \c@\c@\cAë\c@\c@\c@’\c@\c@\cBÑ\c@\c@\c@6\c@\c@\cC¥\c@\c@\c@\cH\c@\c@\cDC\c@\c@\c@\cH\c@\c@\cD’\c@\c@\c@\cP\c@\c@\cDˆ\c@\c@\c@\cM\c@\c@\cD+\c@\c@\c@\cM\c@\c@\cC\c@\c@\c@\cP\c@\c@\cBÎ\c@\c@\c@\cJ\c@\c@\cB\cF\c@\c@\c@\c@\c@\c@\cAQ\c@\c@\c@\c@\c@\c@\c@Ã\c@\c@\c@.\c@\cA\c@`\c@\c@\c@—\c@\cH\c@(\c@\c@\cA5\c@\cS\c@\cU\c@\c@\cAú\c@\c^\c@\e\c@\c@\cBÜ\c@'\c@)\c@\c@\cCœ\c@)\c@7\c@\c@\cD\cN\c@\$\c@A\c@\c@\cD!\c@\c\\c@B\c@\c@\cC×\c@\cQ\c@=\c@\c@\cCF\c@\cF\c@4\c@\c@\cB\c@\c@\c@-\c@\c@\cAÎ\c@\c@\c@(\c@\c@\cA \c@\c@\c@*\c@\cB\c@ \c@\$\c@.\c@\cQ\c@I\c@‰\c@5\c@,\c@\cV\cA/\c@9\c@P\c@\c@\cB\cP\c@;\c@x\c@\c@\cC\$\c@3\c@ž\c@\c@\cD:\c@'\c@´\c@\c@\cE\cU\c@\e\c@³\c@\c@\cE’\c@\cO\c@\c@\c@\cE¡\c@\cD\c@y\c@\c@\cEI\c@\cA\c@P\c@\c@\cD£\c@&\c@.\c@\c@\cCÕ\c@o\c@\cZ\c@\c@\cC\cE\c@Þ\c@\cS\c@\c@\cBS\cAk\c@\cW\c@\c@\cAÓ\cB\cT\c@\c_\c@\c@\cAˆ\cB©\c@\$\c@\c@\cAh\cC\cR\c@#\c@\c@\cA\\\cC:\c@\c\\c@\c@\cAO\cC\c\\c@\cS\c@\c@\cA.\cBÀ\c@\cJ\c@\c@\c@ô\cB6\c@\cC\c@\c@\c@±\cA˜\c@\c@\c@\c@\c@ƒ\cA\cD\c@\cA\c@\c@\c@\c@‘\c@\cD\c@\c@\c@ù\c@\@\c@\cH\c@\c@\cAË\c@\cQ\c@\cN\c@\c@\cBý\c@\c@\c@\cV\c@\c@\cDk\c@\c@\c@\c^\c@\c@\cEÝ\c@\cB\c@\$\c@\c@\cF\@\c@\cD\c@(\c@\c@\cF\@\c@\cE\c@(\c@\c@\cF\@\c@\cE\c@&\c@\c@\cF\@\c@\cE\c@\"\c@\c@\cF\@\c@\cD\c@\c^\c@\c@\cEª\c@\cA\c@\c\\c@\c@\cD<\c@\c@\c@\e\c@\c@\cBÖ\c@\c@\c@\c\\c@\c@\cA¯\c@\c@\c@\c]\c@!\c@Û\c@\c@\c@\c_\c@€\c@T\c@\c@\c@#\cA\c\\c@\c]\c@\c@\c@'\cAé\c@\c^\c@\c@\c@+\cBâ\c@,\c@\c@\c@,\cCÚ\c@0\c@\c@\c@)\cD—\c@1\c@\c@\c@#\cDú\c@+\c@\c@\c@\cZ\cDø\c@\e\c@\c@\c@\cP\cD•\c@\cJ\c@\c@\c@\cH\cCæ\c@\cN\c@\c@\c@\cB\cC\cG\c@0\c@+\c@\c@\cB\e\c@]\c@†\c@\c@\cAN\c@Ž\cA\cN\c@\c@\c@³\c@À\cA¶\c@\c@\c@I\c@á\cBy\c@\c@\c@\cO\c@é\cC\c\\c@\c@\c@\c@\c@ß\cC|\c@\c@\c@\c@\c@Ò\cCˆ\c@\c@\c@\c@\c@Ê\cCA\c@\c@\c@\c@\c@Î\cBµ\c@\c@\c@\c@\c@Õ\cB\cB\c@\c@\c@\c@\c@×\cAP\c@\c@\c@\c@\c@Ç\c@À\c@\c@\c@\c@\c@£\c@W\c@\cT\c@\cA\c@t\c@\cX\c@M\c@\cD\c@G\c@\c@\c@¨\c@\cF\c@%\c@\cF\cA\c^\c@\cG\c@\cX\c@\cN\cA§\c@\cG\c@\c^\c@\cS\cB&\c@\cF\c@*\c@\cU\cBw\c@\cD\c@3\c@\cV\cB‰\c@\cB\c@7\c@\cR\cBZ\c@\c@\c@4\c@\cK\cAö\c@\c@\c@.\c@\cD\cAs\c@\c@\c@'\c@\c@\c@ñ\c@\c@\c@!\c@\c@\c@ˆ\c@\c@\c@\e\c@\c@\c@;\c@\c@\c@\cU\c@\cZ\c@\cO\c@\cB\c@\cP\c@b\c@\cH\c@\cB\c@\cI\c@×\c@\cQ\c@\cB\c@\cF\cAr\c@\cX\c@\cB\c@\cQ\cB/\c@\cZ\c@\cA\c@%\cBí\c@\e\c@\c@\c@8\cC‚\c@\cV\c@\c@\c@C\cCÖ\c@\cM\c@\c@\c@C\cCÝ\c@\cD\c@\c@\c@:\cC–\c@\cA\c@\c@\c@)\cC\cO\c@\cK\c@\c@\c@\cU\cB\\\c@\cZ\c@\c@\c@\cE\cA˜\c@)\c@\e\c@\cT\c@ø\c@5\c@b\c@7\c@|\c@;\c@Ï\c@b\c@*\c@4\cAY\c@‹\c@\cA\c@(\cA÷\c@®\c@\c@\c@\cX\cB…\c@´\c@\c@\c@\cJ\cBÝ\c@™\c@\c@\c@\cB\cBò\c@q\c@\c@\c@\cE\cBÃ\c@F\c@\c@\c@\cJ\cB]\c@\c_\c@\c@\c@\cM\cAÖ\c@\cG\c@\$\c@\cN\cAF\c@\c@\c@l\c@\cN\c@É\c@\cA\c@×\c@\cK\c@j\c@\cN\cA\\\c@\cF\c@+\c@#\cAú\c@\cB\c@\cH\c@;\cB\c@\c@\c@\c@\c@L\cBÚ\c@\c@\c@\c@\c@O\cB÷\c@\c@\c@\c@\c@G\cBÒ\c@\c@\c@\c@\c@7\cBv\c@\c@\c@\c@\c@\c_\cAó\c@\c@\c@\c@\c@\cH\cA_\c@\c@\c@\c@\c@\cU\c@Ü\c@\c@\c@\c@\c@‰\c@v\c@\c@\c@\cA\cAd\c@0\c@\c@\c@\cJ\cB¦\c@\cI\c@\c@\c@\c\\cDG\c@\c@\c@\c@\c@1\cF)\c@\c@\c@\c@\c@G\cF\@\c@\c@\c@\c@\c@Z\cF\@\c@\c@\c@\c@\c@_\cF\@\c@\c@\c@\c@\c@Q\cF\@\c@\c@\c@\c@\c@=\cF\@\c@\c@\c@\c@\c@'\cF\@\c@\c@\c@\c@\c@\cR\cEp\c@\c@\c@\c@\c@\cB\cCš\c@\c@\c@\c@\c@\c@\cB!\c@\c@\c@\c@\c@\cT\cA\cH\c@\c@\c@\c@\c@]\c@V\c@\c@\c@\c@\c@Ý\c@\cA\c@\c@\c@\c@\cA\c@\cB\c@\c@\c@\c@\cBg\c@\cM\c@\c@\c@\c@\cCN\c@\cU\c@\c@\c@\c@\cD\cH\c@\cZ\c@\c@\c@\c@\cDu\c@\c]\c@\c@\c@\c@\cD\c@#\c@\c@\c@\c@\cD+\c@#\c@\c@\c@\c@\cC‚\c@&\c@\c@\c@\c@\cB¤\c@+\c@\c@\c@\c@\cAÀ\c@0\c@\c@\c@\c@\cA\cF\c@/\c@\c@\c@\cC\c@|\c@'\c@\c@\c@\cI\c@O\c@\c]\c@\c@\c@\cP\c@\c@\cQ\c@\c@\c@\cU\c@÷\c@\cF\c@\c@\c@\cX\cA€\c@\cA\c@\c@\c@\cU\cB\cR\c@\cJ\c@\c@\c@\cQ\cBz\c@\cS\c@\c@\c@\cJ\cBž\c@\cV\c@\cB\c@\cD\cB|\c@\cU\c@\cE\c@\c@\cB\c_\c@\cV\c@\cI\c@\cB\cA¢\c@\cP\c@\cK\c@\cE\cA\c^\c@\cF\c@\cK\c@\cG\c@«\c@\c@\c@\cJ\c@\cI\c@X\c@(\c@\cG\c@\cI\c@\$\c@Œ\c@\cD\c@\cH\c@\cI\cA(\c@\cA\c@\cE\c@\c@\cAê\c@\c@\c@\cB\c@\c@\cBÈ\c@\c@\c@\c@\c@\c@\cC‡\c@\c@\c@\c@\c@\c@\cCò\c@\c@\c@\c@\c@\c@\cC÷\c@\c@\c@\c@\c@\c@\cC›\c@\cH\c@\c@\c@\c@\cBù\c@0\c@\c@\c@\c@\cB9\c@w\c@\c@\c@\c@\cA…\c@Ù\c@\c@\c@\c@\c@ü\cAQ\c@\c@\c@\cA\c@¬\cAÒ\c@\c@\c@\cD\c@\cB8\c@\c@\c@\cG\c@•\cBp\c@\c@\c@\cF\c@¤\cBo\c@\c@\c@\cF\c@ª\cB7\c@\c@\c@\cF\c@ž\cAÑ\c@\c@\c@\cC\c@„\cAR\c@\c@\c@\c@\c@h\c@Ú\c@\c@\c@\c@\c@U\c@y\c@\c@\c@\cF\c@O\c@3\c@\c@\c@C\c@W\c@\cJ\c@\c@\c@¶\c@f\c@\c@\c@\c@\cA[\c@t\c@\c@\c@\c@\cB%\c@}\c@\c@\c@\c@\cC\cJ\c@€\c@\c@\c@\c@\cCÇ\c@~\c@\c@\c@\c@\cD>\c@y\c@\c@\c@\c@\cD]\c@r\c@\c@\c@\c@\cD%\c@l\c@\c@\c@\c@\cC¤\c@h\c@\c@\c@\c@\cBó\c@j\c@\c@\c@\c@\cB.\c@r\c@\c^\c@\c@\cAl\c@}\c@e\c@\c@\c@Õ\c@ˆ\c@Ó\c@\c@\c@h\c@Œ\cAc\c@\c@\c@#\c@‡\cB\cO\c@\c@\c@\cA\c@y\cB¯\c@\c@\c@\c@\c@f\cC \c@\c@\c@\c@\c@U\cCM\c@\cD\c@\c@\c@G\cC-\c@\cH\c@\c@\c@<\cBÆ\c@\cL\c@\c@\c@2\cB+\c@\cN\c@\c@\c@'\cA{\c@\cN\c@\c@\c@\c]\c@ç\c@\cL\c@\c@\c@\cW\c@r\c@\cH\c@\cA\c@\cX\c@0\c@\cC\c@\cA\c@ \c@8\c@\cC\c@\cA\c@,\c@\c?\c@\cH\c@\cA\c@5\c@Õ\c@\cP\c@\c@\c@3\cA1\c@\cW\c@\c@\c@,\cA~\c@\c]\c@\c@\c@\c_\cAœ\c@\e\c@\c@\c@\cP\cA„\c@\cW\c@\c@\c@\cG\cA>\c@\cP\c@\c@\c@\cT\c@à\c@\cH\c@\c@\c@/\c@Š\c@\cA\c@\c@\c@N\c@D\c@\cC\c@\c@\c@m\c@\cU\c@\$\c@\cC\c@‰\c@\c@\c@b\c@\cH\c@”\c@\c@\c@¼\c@\cM\c@\c@\c@\cA-\c@\cQ\c@x\c@\c@\cA°\c@\cR\c@\\\c@\c@\cB\c_\c@\cP\c@=\c@\c@\cBh\c@\cL\c@%\c@\c@\cB€\c@\cG\c@\cR\c@\c@\cBc\c@\cC\c@\cF\c@\c@\cB\cZ\c@\c@\c@\c@\c@\c@\cA´\c@\c@\c@\c@\c@\c@\cAE\c@\c@\c@\c@\c@\c@\c@á\c@\c@\c@\c@\c@\c@\c@–\c@\c@\c@\c@\c@*\c@j\c@\c@\c@\c@\c@š\c@Y\c@\c@\c@\c@\cAL\c@Z\c@\c@\c@\c@\cB6\c@a\c@\c@\c@\c@\cCL\c@a\c@\c@\c@\c@\cDV\c@W\c@\c@\c@\c@\cE\cU\c@C\c@\c@\c@\c@\cEk\c@-\c@\c@\c@\cB\cEN\c@\cX\c@\c@\c@\cF\cDÉ\c@\cI\c@\c@\c@\cK\cCû\c@\c@\c@\c@\c@\cN\cC\cI\c@\c@\c@\c@\c@\cP\cB\cW\c@\c@\c@\cE\c@\cN\cAF\c@\cA\c@+\c@\cK\c@¯\c@\cF\c@o\c@\cF\c@K\c@\cM\c@Í\c@\cB\c@\cU\c@\cT\cA;\c@\c@\c@\c@\c@\cY\cA®\c@\c@\c@\c@\c@\cZ\cAü\c@\c@\c@\c@\c@\cV\cB\cT\c@\c@\c@\c@\c@\cP\cAî\c@\c@\c@\c@\c@\cI\cA”\c@\c@\c@\c@\c@\cC\cA\c^\c@\c@\c@\c@\c@\c@\c@´\c@\c@\c@\c@\c@\c@\c@[\c@\c@\c@\c@\c@\c@\c@8\c@\c@\c@\c@\c@\c@\c@R\c@\c@\c@\c@\c@\c@\c@¤\c@\c@\c@\c@\c@\c@\cA\cI\c@\c@\c@\c@\c@\c@\cAz\c@\c@\c@\c@\c@\c@\cAÔ\c@\c@\c@\c@\c@\c@\cB\c@\c@\c@\c@\c@\c@\c@\cA÷\c@\c@\c@\c@\c@\c@\cA¼\c@\c@\c@\c@\c@\c@\cAa\c@\c@\c@\c@\c@\c@\c@ü\c@\c@\c@\c@\c@\c@\c@§\c@\c@\c@\c@\c@\c@\c@x\c@\c@\c@\c@\c@\c@\c@{\c@\c@\c@\c@\c@\c@\c@²\c@\c@\c@\c@\c@\c@\cA\cO\c@\c@\c@\c@\c@\c@\cA|\c@\c@\c@\c@\c@\c@\cAà\c@\c@\c@\c@\c@\c@\cB \c@\cB\c@\c@\c@\c@\cB/\c@\cK\c@\c@\c@\c@\cB\cG\c@\cV\c@\c@\c@\c@\cA³\c@!\c@\cR\c@\c@\cAE\c@'\c@W\c@\c@\c@Ô\c@(\c@Í\c@\c@\c@y\c@\"\cAm\c@\c@\c@8\c@\cX\cB1\c@\c@\c@\cP\c@\cL\cBÿ\c@\c@\c@\c@\c@\cC\cC¢\c@\c@\c@\c@\c@\c@\cD\cB\c@\c@\c@\c@\c@\c@\cD\cP\c@\c@\c@\c@\c@\c@\cCÍ\c@\c@\c@\c@\c@\c@\cCG\c@\c@\c@\c@\c@\c@\cB•\c@\c@\c@\c@\c@\c@\cAÒ\c@\c@\c@\c@\c@\c@\cA%\c@\c@\c@\cQ\c@\c@\c@ \c@\c@\c@S\c@\c@\c@C\c@\c@\c@Â\c@\c@\c@\cO\c@\c@\cAT\c@\c@\c@\c@\c@\c@\cB\c@\c@\c@\c@\c@\c@\c@\cB«\c@\c@\c@\c@\c@\c@\cC\$\c@\c@\c@\c@\c@\c@\cCV\c@\c@\c@\c@\c@\c@\cCA\c@\c@\c@\c@\c@\c@\cBï\c@\cC\c@\c@\c@\c@\cBs\c@\cN\c@\c@\c@\c@\cAã\c@\c]\c@\cR\c@\c@\cAS\c@0\c@J\c@\c@\c@Õ\c@G\c@¤\c@\c@\c@w\c@^\cA\e\c@\c@\c@7\c@r\cA§\c@\c@\c@\cP\c@\cB/\c@\c@\c@\c@\c@‡\cB‹\c@\c@\c@\c@\c@\cBª\c@\c@\c@\c@\c@p\cB„\c@\c@\c@\c@\c@S\cB\"\c@\c@\c@\c@\c@8\cA˜\c@\c@\c@\c@\c@\c^\cA\cM\c@\c@\c@\c@\c@\cJ\c@™\c@\c@\c@\c@\c@\c@\c@P\c@\c@\c@\c@\c@\c@\c@K\c@\c@\c@\c@\c@\c@\c@‡\c@\c@\c@\cB\c@\cB\c@æ\c@\c@\c@\cH\c@\cD\cAT\c@\c@\c@\cR\c@\cE\cA¼\c@\c@\c@\c\\c@\cG\cB\cA\c@\c@\c@&\c@\cG\cB\cY\c@\c@\c@*\c@\cE\cB\cD\c@\c@\c@\$\c@\cD\cAÊ\c@\c@\c@\c]\c@\cB\cAw\c@\c@\c@\cR\c@\c@\cA\e\c@\c@\c@\cG\c@\c@\c@Å\c@\c@\c@\c@\c@\cB\c@~\c@\c@\c@\c@\c@\cE\c@M\c@\c@\c@\c\\c@\cH\c@6\c@\c@\c@U\c@\cJ\c@2\c@\c@\c@¥\c@\cJ\c@:\c@\c@\cA\cE\c@\cH\c@B\c@\c@\cAs\c@\cF\c@D\c@\c@\cAÈ\c@\cB\c@;\c@\c@\cA÷\c@\c@\c@,\c@\c@\cA÷\c@\c@\c@\c\\c@\c@\cAÍ\c@\c@\c@\cM\c@\c@\cAƒ\c@\c@\c@\cC\c@\c@\cA)\c@\c@\c@\cB\c@\c@\c@Í\c@\c@\c@\cJ\c@\c@\c@}\c@\c@\c@\cV\c@\c@\c@C\c@(\c@&\c@\c@\c@\c\\c@\c@8\c@\c@\c@\cG\cA\cJ\c@I\c@\c@\c@\c@\cAº\c@Q\c@\c@\c@\c@\cB\c@O\c@\c@\c@\c@\cCR\c@C\c@\c@\c@\c@\cCà\c@1\c@\c@\c@\c@\cD!\c@\c_\c@\c@\c@\c@\cD\cK\c@\cO\c@\c@\c@\c@\cC¥\c@\cD\c@\c@\c@\c@\cC\cA\c@\c@\c@\c@\c@\c@\cB;\c@\c@\c@\c@\c@\c@\cAv\c@\c@\c@\c@\c@\cC\c@Ù\c@\c@\c@\c@\c@'\c@e\c@\c@\c@\c@\c@j\c@\c^\c@\c@\c@\c@\c@Ë\c@\cK\c@\c@\c@\c@\cAD\c@\cX\c@\c@\c@\c@\cAÏ\c@!\c@\c@\c@\c@\cB?\c@%\c@\c@\c@\c@\cB€\c@+\c@\c@\c@\c@\cBƒ\c@+\c@\c@\c@\c@\cBH\c@*\c@\c@\c@\c@\cAÙ\c@0\c@\cA\c@\c@\cAP\c@;\c@\cD\c@\c@\c@Ó\c@E\c@\cG\c@\c@\c@r\c@J\c@\cI\c@\c@\c@P\c@B\c@\cJ\c@\c@\c@x\c@3\c@\cI\c@\c@\c@á\c@\"\c@\cG\c@\c@\cAg\c@\cP\c@\cD\c@\c@\cAù\c@\cD\c@\cA\c@\c@\cBi\c@\c@\c@\c@\c@\c@\cBš\c@\cG\c@\c@\c@\c@\cB\c@\c]\c@\c@\c@\c@\cB\$\c@;\c@\c@\c@\c@\cAœ\c@[\c@\c@\c@\c@\cA\cR\c@v\c@\c@\c@\c@\c@¨\c@‚\c@\c@\c@\c@\c@€\c@v\c@\c@\c@\c@\c@£\c@[\c@\c@\c@\c@\cA\cL\c@;\c@\c@\c@\c@\cAŸ\c@\c]\c@\c@\c@\c@\cB<\c@\cG\c@\c@\c@\c@\cB¼\c@\c@\c@\c@\c@\c@\cC\cI\c@\cI\c@\c@\c@\c@\cC\cU\c@\e\c@\c@\c@\cB\cBâ\c@0\c@\c@\c@\cG\cB~\c@A\c@\c@\c@\cM\cAþ\c@L\c@#\c@\cS\cAw\c@I\c@s\c@\cX\c@ü\c@;\c@î\c@\cY\c@›\c@(\cAŒ\c@\cV\c@V\c@\c^\cBJ\c@\cP\c@+\c@!\cBú\c@\cJ\c@\cR\c@1\cCy\c@\cD\c@\cH\c@B\cC±\c@\cA\c@\cD\c@O\cC›\c@\c@\c@\cB\c@O\cC?\c@\c@\c@\c@\c@D\cB±\c@\c@\c@\c@\c@3\cB\cJ\c@\c@\c@\c@\c@\"\cAi\c@\c@\c@ \c@\cV\c@ä\c@\c@\c@i\c@\cP\c@‡\c@\c@\c@Ù\c@\cQ\c@P\c@\c@\cAc\c@\cV\c@4\c@\c@\cB\cC\c@\c^\c@&\c@\c@\cB\c@)\c@\c^\c@\c@\cBè\c@4\c@\cV\c@\c@\cBû\c@8\c@\cL\c@\c@\cBÈ\c@4\c@\cC\c@\c@\cBY\c@*\c@\c@\c@\c@\cAÆ\c@\c]\c@\cC\c@\cB\cA/\c@\cO\c@\cG\c@\cI\c@µ\c@\cD\c@\cJ\c@\cP\c@v\c@\c@\c@\cL\c@\cV\c@ƒ\c@\c@\c@\cM\c@\cZ\c@Ý\c@\c@\c@\cK\c@\cY\cAs\c@\c@\c@\cG\c@\cT\cB#\c@\c@\c@\cC\c@\cM\cBÊ\c@\c@\c@\c@\c@\cF\cCG\c@\c@\c@\c@\c@\cA\cC„\c@\c@\c@\c@\c@\c@\cCw\c@\cI\c@\c@\c@\c@\cC'\c@\e\c@\cO\c@\c@\cB§\c@3\c@D\c@\c@\cB\cL\c@N\c@Ÿ\c@\c@\cAn\c@m\cA\c]\c@\c@\c@ã\c@ƒ\cAº\c@\c@\c@|\c@\cBa\c@\c@\c@6\c@‰\cBí\c@\c@\c@\cO\c@x\cCF\c@\c@\c@\c@\c@_\cC`\c@\c@\c@\c@\c@A\cC9\c@\c@\c@\c@\c@)\cBÜ\c@\c@\c@\c@\c@\cT\cBZ\c@\c@\c@\c@\c@\cF\cAÉ\c@\c@\c@\c@\c@\c@\cA\@\c@\c@\c@\c@\c@\c@\c@Ï\c@\c@\c@\cO\c@\c@\c@€\c@\c@\c@C\c@\c@\c@O\c@\c@\c@›\c@\c@\c@6\c@\c@\cA\cR\c@\c@\c@)\c@\c@\cA¡\c@\c@\c@\c_\c@\c@\cB0\c@\c@\c@\cW\c@\c@\cB—\c@\c@\c@\cO\c@\c@\cBÂ\c@\c@\c@\cF\c@\c@\cB§\c@\c@\c@\c@\c@\c@\cBL\c@\c@\c@\c@\c@\c@\cAÄ\c@\cA\c@\cB\c@\c@\cA0\c@\cI\c@\cF\c@\c@\c@´\c@\c\\c@\cJ\c@)\c@U\c@9\c@\cM\c@{\c@\cY\c@Y\c@\cP\c@ñ\c@\c@\c@x\c@\cO\cA‚\c@\c@\c@Š\c@\cK\cB,\c@\c@\c@Š\c@\cG\cB»\c@\c@\c@{\c@\cC\cC\cW\c@\c@\c@f\c@\c@\cC7\c@\c@\c@V\c@\c@\cC\e\c@\c@\c@T\c@\c@\cBË\c@\c@\c@c\c@\c@\cBY\c@\c@\c@z\c@\c@\cAÔ\c@\c@\c@\c@!\cAQ\c@\c@\c@‘\c@j\c@Ü\c@\c@\c@\c?\c@Ü\c@€\c@\c@\c@`\cAs\c@A\c@\c@\c@?\cB.\c@\c]\c@\c@\c@\c_\cBã\c@\cO\c@\c@\c@\cH\cCs\c@\cO\c@\c@\c@\c@\cCÅ\c@\cT\c@\c@\c@\cQ\cCÍ\c@\cY\c@\c@\c@0\cC…\c@\e\c@\c@\c@X\cBü\c@\cY\c@\c@\c@€\cBI\c@\cT\c@\c@\c@¦\cA\c@\cO\c@\c@\c@´\c@ò\c@\cK\c@\c@\c@¨\c@\c@\cJ\c@\cA\c@‰\c@x\c@\cJ\c@\cB\c@f\c@§\c@\cJ\c@\cB\c@L\cA\cK\c@\cJ\c@\cB\c@D\cA†\c@\cH\c@\cB\c@N\cAø\c@\cF\c@\cA\c@c\cBE\c@\cC\c@\c@\c@y\cB]\c@\cA\c@\cA\c@…\cB>\c@\c@\c@\cD\c@†\cAì\c@\c@\c@\cF\c@\c?\cA}\c@\c@\c@\cG\c@u\cA\cI\c@\c@\c@\cH\c@p\c@©\c@\c@\c@\cG\c@t\c@s\c@\cA\c@\cE\c@}\c@r\c@\cB\c@\cB\c@‡\c@¦\c@\cB\c@\c@\c@Œ\cA\c@\c@\cB\c@\c@\c@…\cAk\c@\cB\c@\c@\c@r\cAÎ\c@\cA\c@\c@\c@W\cB\cS\c@\c@\c@\c@\c@=\cB,\c@\c@\c@\c@\c@,\cB\cQ\c@\cB\c@\c@\c@*\cAÌ\c@\cH\c@\c@\c@:\cAj\c@\cQ\c@\c@\c@U\cA\cD\c@\c]\c@\c@\c@q\c@²\c@)\c@\c@\c@ƒ\c@‹\c@5\c@\c@\c@ƒ\c@™\c@>\c@\c@\c@n\c@Ú\c@B\c@\c@\c@P\cA>\c@\@\c@\c@\c@1\cA¬\c@:\c@\c@\c@\cV\cB\cN\c@-\c@\c@\c@\cL\cBO\c@ \c@\c@\c@\cS\cBd\c@\cT\c@\c@\c@\c]\cBK\c@\cI\c@\c@\c@#\cB\cK\c@\cB\c@\c@\c@&\cA®\c@\cA\c@\c@\c@ \cAE\c@\cD\c@\c@\c@\cW\c@Û\c@\cF\c@\cA\c@\cL\c@„\c@\cF\c@\c_\c@\cC\c@C\c@\cG\c@V\c@\c@\c@\cZ\c@\cF\c@¢\c@\c@\c@\cD\c@\cC\c@û\c@\c@\c@\c@\c@\cA\cA]\c@\c@\c@\c@\c@\c@\cA¦\c@\c@\c@\c@\c@\c@\cAÉ\c@\cA\c@\c@\c@\c@\cAÂ\c@\cC\c@\c@\c@\cA\cA˜\c@\cB\c@\cB\c@\cC\cAS\c@\cB\c@\cE\c@\cF\cA\cB\c@\cB\c@\cH\c@\cH\c@²\c@\cE\c@\cL\c@\cI\c@m\c@,\c@\cQ\c@\cH\c@;\c@‰\c@\cT\c@\cF\c@\cY\cA!\c@\cU\c@\cC\c@\cG\cAð\c@\cP\c@\cA\c@\c@\cBë\c@\cM\c@\c@\c@\c@\cCÙ\c@\cI\c@\cB\c@\c@\cD‰\c@\cD\c@\cF\c@\c@\cDÓ\c@\c@\c@\cM\c@\c@\cD¥\c@\c@\c@\cR\c@\c@\cD\cI\c@\cX\c@\cX\c@\c@\cC!\c@V\c@\c\\c@\cA\cB\c_\c@·\c@\c\\c@\cB\cAD\cA2\c@\c\\c@\cB\c@ž\cAÃ\c@\e\c@\cB\c@9\cBI\c@\c\\c@\cB\c@\c^\cB¤\c@\c]\c@\cA\c@7\cBÆ\c@\c]\c@\c@\c@Q\cB­\c@\c\\c@\c@\c@b\cB`\c@\cZ\c@\c@\c@j\cAï\c@\cW\c@\c@\c@]\cAl\c@\cU\c@\c@\c@K\c@ì\c@\cU\c@\c@\c@H\c@‰\c@\cX\c@\c@\c@`\c@\@\c@\c\\c@*\c@–\c@\cS\c@!\c@€\c@Ø\c@\c@\c@&\c@ú\cA\cM\c@\c@\c@*\cAŽ\cA\c]\c@\c@\c@-\cB7\c@ý\c@\c@\c@0\cB¿\c@Â\c@\c@\c@2\cC\cO\c@}\c@\c@\c@2\cC\c\\c@<\c@\c@\c@0\cBé\c@\cM\c@\c@\c@,\cBƒ\c@\c@\c@\c@\c@(\cB\c@\c@\c@\c@\c@\c@%\cAs\c@\cM\c@\c@\c@#\c@í\c@)\c@\c@\c@#\c@‡\c@b\c@\c@\c@%\c@\@\c@Ã\c@\c@\c@'\c@\cT\cAU\c@\c@\c@*\c@\c@\cB\cK\c@\c@\c@+\c@\c@\cBÐ\c@\c@\c@,\c@\c@\cC€\c@\c@\c@)\c@\c@\cCô\c@\c@\c@\$\c@\c@\cD\cN\c@\c@\c@\c]\c@\c@\cCÃ\c@\c@\c@\cV\c@\c@\cC\$\c@\c@\c@\cQ\c@\c@\cBV\c@\c@\c@\cO\c@\c@\cAŒ\c@\c@\c@\cQ\c@\c@\c@ð\c@\c@\c@\cV\c@\c_\c@™\c@\c@\c@\cZ\c@\\\c@†\c@\c@\c@\c\\c@´\c@¤\c@\c@\c@\cY\cA!\c@Ô\c@\c@\c@\cS\cA¢\c@ù\c@\c@\c@\cM\cB\cO\cA\cB\c@\c@\c@\cF\cBV\c@í\c@\c@\c@\cA\cBn\c@¿\c@\c@\c@\c@\cBV\c@„\c@\cC\c@\cD\cB\cU\c@R\c@\cM\c@\cK\cA¹\c@+\c@\c^\c@\cT\cAP\c@\cQ\c@2\c@\c^\c@é\c@\cA\c@G\c@(\c@\c@\cB\c@U\c@,\c@N\c@6\c@U\c@)\c@\"\c@•\c@G\c@ \c@\cJ\cA\cZ\c@4\c@\cW\c@\c@\cAµ\c@\c_\c@\cM\c@\c@\cB\\\c@\cM\c@\cD\c@\c@\cBÐ\c@\cD\c@\cC\c@\c@\cBø\c@\cM\c@\cM\c@\c@\cBÎ\c@\e\c@\cZ\c@\c@\cB\\\c@)\c@(\c@\c@\cAÀ\c@5\c@4\c@\c@\cA\$\c@<\c@;\c@\c@\c@¤\c@6\c@8\c@3\c@F\c@)\c@/\c@—\c@\cU\c@\e\c@#\cA+\c@\cP\c@\cM\c@\cY\cAå\c@\cZ\c@\cD\c@\cT\cBÂ\c@\c\\c@\c@\c@\cS\cC€\c@\c\\c@\c@\c@\cU\cD\cA\c@\e\c@\c@\c@\cX\cD/\c@\cR\c@\c@\c@\cZ\cD\cF\c@\cF\c@\c@\c@\c\\cC‘\c@\cG\c@\c@\c@\c\\cBæ\c@\$\c@ \c@\c\\cB#\c@M\c@e\c@\c\\cAe\c@v\c@Ð\c@\c\\c@Ï\c@˜\cA]\c@\c\\c@c\c@¨\cB\cL\c@\c^\c@\"\c@—\cB³\c@&\c@\cB\c@s\cC9\c@5\c@\c@\c@I\cCˆ\c@J\c@\c@\c@\"\cC’\c@e\c@\c@\c@\cH\cCV\c@\c@\c@\c@\c@\cBÜ\c@™\c@\c@\c@\c@\cB8\c@ª\c@\c@\c@\c@\cAƒ\c@°\c@\cM\c@\c@\c@ì\c@«\c@R\c@\c@\c@w\c@œ\c@É\c@\c@\c@)\c@…\cAk\c@\c@\c@\cB\c@l\cB-\c@\cB\c@\c@\c@T\cBú\c@\cH\c@\c@\c@C\cC“\c@\cP\c@\c@\c@=\cCÝ\c@\cZ\c@\c@\c@E\cCÌ\c@'\c@\c@\c@Z\cCe\c@8\c@\c@\c@w\cB¿\c@N\c@\c@\c@—\cAù\c@f\c@\c@\c@±\cAA\c@~\c@\c@\c@¿\c@¯\c@\c@\c@\c@¿\c@d\c@’\c@\c@\c@±\c@l\c@€\c@\c@\c@˜\c@Ä\c@b\c@\c@\c@z\cAE\c@B\c@\c@\c@_\cAÙ\c@\"\c@\c@\c@I\cBY\c@\cJ\c@\c@\c@:\cB¤\c@\cB\c@\c@\c@1\cB«\c@\cH\c@\c@\c@+\cBo\c@\cP\c@\c@\c@&\cB\cA\c@\cX\c@\cE\c@ \cA}\c@!\c@\cL\c@\cZ\cA\c@\c@*\c@\cU\c@\cW\c@£\c@/\c@\c]\c@\cZ\c@y\c@.\c@\$\c@\"\c@…\c@)\c@\$\c@1\c@¾\c@ \c@\c^\c@\@\cA\cU\c@\cW\c@\cV\c@L\cAr\c@\cM\c@\cM\c@S\cAÁ\c@\cD\c@\cE\c@U\cAï\c@\c@\c@\c@\c@S\cAñ\c@\cG\c@\c@\c@S\cAÅ\c@\cR\c@\c@\c@V\cAr\c@\c\\c@\cA\c@]\cA\cL\c@%\c@\cB\c@c\c@­\c@/\c@\cB\c@e\c@n\c@6\c@\cB\c@^\c@e\c@=\c@\cB\c@P\c@—\c@G\c@\cA\c@;\c@ü\c@T\c@\c@\c@'\cAx\c@_\c@\c@\c@\cW\cAî\c@d\c@\c@\c@\cO\cB\@\c@^\c@\c@\c@\cM\cB[\c@L\c@\c@\c@\cP\cB9\c@6\c@\c@\c@\cU\cAå\c@ \c@\c@\c@\cY\cAt\c@\cO\c@\c@\c@\e\cA\cC\c@\cC\c@\c@\c@\c]\c@­\c@\c@\c@\c@\c@\c_\c@†\c@\c@\c@\c@\c@\"\c@•\c@\c@\c@\c@\c@'\c@Ø\c@\c@\c@\c@\c@*\cA<\c@\c@\c@\c@\c@+\cA§\c@\c@\c@\c@\c@'\cB\cB\c@\c@\c@\c@\c@\c_\cB9\c@\c@\c@\c@\c@\cV\cB?\c@\c@\c@\c@\c@\cM\cB\cX\c@\c@\c@\c@\c@\cE\cAÏ\c@\c@\c@\c@\c@\cA\cAr\c@\c@\c@\c@\c@\c@\cA\cP\c@\c@\c@\c@\c@\c@\c@¸\c@+\c@\c@\c@\c@\c@n\c@‹\c@\cA\c@\cA\c@<\cA\c]\c@\cB\c@\cG\c@\e\cAÒ\c@\cB\c@\cP\c@\cH\cB¤\c@\cB\c@\c\\c@\c@\cCX\c@\cB\c@'\c@\c@\cCÈ\c@\cB\c@1\c@\c@\cCä\c@\cA\c@7\c@\c@\cC¯\c@\cO\c@8\c@\c@\cC;\c@/\c@6\c@\c@\cB¢\c@f\c@3\c@\c@\cAþ\c@¶\c@2\c@\c@\cAd\cA\c_\c@4\c@\c@\c@â\cA\c@9\c@\c@\c@€\cAù\c@\@\c@\c@\c@?\cBK\c@H\c@\c@\c@\cX\cBw\c@N\c@\c@\c@\cD\cBq\c@S\c@\c@\c@\c@\cB8\c@W\c@\c@\c@\c@\cAÔ\c@Z\c@\cD\c@\c@\cAV\c@\\\c@\cK\c@\c@\c@Ý\c@]\c@\cR\c@\c@\c@z\c@[\c@\cX\c@\cE\c@I\c@W\c@\e\c@\cT\c@T\c@R\c@\cY\c@(\c@–\c@N\c@\cS\c@<\c@ô\c@O\c@\cL\c@N\cA^\c@V\c@\cE\c@[\cA²\c@c\c@\c@\c@^\cAÛ\c@r\c@\c@\c@Y\cAÍ\c@~\c@\c@\c@Q\cA‹\c@‚\c@\c@\c@F\cA%\c@}\c@\c@\c@9\c@Â\c@p\c@\cF\c@*\c@k\c@b\c@\cQ\c@\c^\c@8\c@W\c@\c^\c@\cQ\c@F\c@S\c@*\c@\cI\c@˜\c@V\c@3\c@\cS\cA\cM\c@\\\c@3\c@.\cA™\c@`\c@*\c@K\cB'\c@_\c@\c^\c@d\cB‘\c@X\c@\cQ\c@v\cBÇ\c@N\c@\cF\c@v\cBÃ\c@C\c@\c@\c@d\cB‹\c@;\c@\c@\c@J\cB.\c@5\c@\c@\c@.\cA¾\c@3\c@\c@\c@\cX\cAJ\c@3\c@\c@\c@\cJ\c@ß\c@5\c@\c@\c@\cD\c@‡\c@8\c@\cZ\c@\c@\c@I\c@=\c@L\c@\c@\c@ \c@B\c@•\c@\c@\c@\cI\c@F\c@ì\c@\c@\c@\c@\c@G\cAQ\c@\c@\c@\c@\c@F\cAŸ\c@\c@\c@\c@\c@C\cAÇ\c@\cE\c@\cA\c@\@\cA¼\c@\cY\c@\cE\c@=\cA‚\c@7\c@\cJ\c@<\cA#\c@W\c@\cN\c@<\c@Ä\c@r\c@\cQ\c@>\c@o\c@\c@\cR\c@A\c@3\c@z\c@\cO\c@C\c@2\c@_\c@\cK\c@D\c@n\c@?\c@\cG\c@B\c@É\c@!\c@\cC\c@<\cA2\c@\cL\c@\cA\c@3\cA \c@\cG\c@\c@\c@(\cAì\c@\cN\c@\c@\c@\c]\cB\cI\c@\cV\c@\c@\c@\cT\cAô\c@\c\\c@\c@\c@\cN\cA³\c@\c_\c@\"\c@\cI\cAT\c@\c\\c@k\c@\cF\c@é\c@\cU\c@Û\c@\cD\c@\c@\cM\cAl\c@\cB\c@J\c@\cJ\cB\cY\c@\c@\c@\cZ\c@\cO\cB³\c@\cB\c@\cB\c@\cZ\cC\c^\c@\cF\c@\c@\c@&\cCH\c@\cJ\c@\c@\c@/\cC+\c@\cL\c@\c@\c@1\cBÏ\c@\cM\c@\c@\c@.\cBI\c@\cK\c@\c@\c@*\cA°\c@\cH\c@\c@\c@1\cA\e\c@\cD\c@\c@\c@F\c@¥\c@\cA\c@\cR\c@j\c@Q\c@\c@\c@L\c@“\c@\c\\c@\c@\c@ª\c@µ\c@\cC\c@\c@\cA&\c@Â\c@\c@\c@\c@\cA¸\c@¶\c@\c@\c@\c@\cBH\c@“\c@\c@\c@\cD\cB®\c@f\c@\c@\c@\cJ\cBÙ\c@<\c@\c@\c@\cP\cBÂ\c@ \c@\cB\c@\cW\cBo\c@\cY\c@\cH\c@\c]\cAñ\c@&\c@\cO\c@ \cA`\c@=\c@\cU\c@!\c@Ý\c@Z\c@\cY\c@\"\c@v\c@w\c@\cZ\c@%\c@?\c@\c@\cU\c@,\c@C\c@™\c@\cO\c@4\c@€\c@™\c@\cH\c@>\c@Ý\c@Œ\c@\cB\c@F\cAL\c@v\c@\c@\c@L\cA¶\c@_\c@\c@\c@P\cB\cA\c@M\c@\c@\c@S\cB \c@E\c@\c@\c@R\cB\cM\c@F\c@\c@\c@Q\cAÎ\c@I\c@\cO\c@M\cAn\c@I\c@J\c@H\cA\cA\c@A\c@ª\c@B\c@ \c@3\cA+\c@=\c@U\c@\$\cAÄ\c@8\c@!\c@\c\\cBa\c@5\c@\cE\c@\cY\cB×\c@2\c@\c@\c@\e\cC\cX\c@/\c@\c@\c@\c_\cC\cZ\c@,\c@\c@\c@\$\cBã\c@+\c@\c@\c@.\cB{\c@+\c@\c@\c@D\cAò\c@0\c@\c@\c@i\cA[\c@6\c@\c@\c@™\c@Ú\c@<\c@\c@\c@É\c@t\c@\@\c@\e\c@ì\c@-\c@A\c@b\c@ø\c@\cF\c@>\c@Î\c@ì\c@\c@\c@8\cAS\c@Ï\c@\c@\c@1\cAé\c@ª\c@\c@\c@(\cBj\c@‡\c@\c@\c@ \cB¯\c@l\c@\c@\c@\cW\cB­\c@W\c@\c@\c@\cQ\cBi\c@E\c@\c@\c@\cO\cAó\c@2\c@\c@\c@\cT\cAd\c@!\c@\c@\c@\"\c@á\c@\cR\c@\c@\c@8\c@z\c@\cJ\c@\c@\c@T\c@G\c@\cL\c@\c@\c@q\c@P\c@\cY\c@\c@\c@‰\c@‘\c@,\c@\c@\c@˜\c@ô\c@B\c@\c@\c@˜\cAk\c@S\c@\c@\c@Š\cAÛ\c@[\c@\c@\c@q\cB,\c@T\c@\c@\c@R\cBR\c@B\c@\c@\c@4\cBH\c@.\c@\c@\c@\c^\cB\cQ\c@\cZ\c@\cN\c@\cR\cA·\c@\cI\c@I\c@\cP\cAK\c@\c@\c@®\c@\cS\c@Û\c@\c@\cA6\c@\cW\c@‚\c@\c@\cAÛ\c@\cX\c@?\c@\c@\cB‰\c@\cT\c@\cU\c@\c@\cC\cS\c@\cN\c@\c@\c@\c@\cCa\c@\cH\c@\c@\c@\c@\cCj\c@\cB\c@\c@\c@\c@\cC0\c@\c@\c@\c@\c@\cA\cB¾\c@\c@\c@\c@\c@\cD\cB+\c@\c@\c@\c@\c@\cJ\cA\c@\c@\c@\c@\c@\cV\cA\cB\c@\cA\c@\cD\c@%\c@“\c@\cA\c@#\c@7\c@I\c@\cA\c@]\c@E\c@\c^\c@\c@\c@´\c@M\c@\cJ\c@\c@\cA&\c@H\c@\cE\c@\c@\cA¬\c@:\c@\cC\c@\c@\cB'\c@)\c@\cB\c@\c@\cB\c@\cW\c@\c@\c@\c@\cBª\c@\cI\c@\c@\c@\cB\cBš\c@\c@\c@\c@\c@\cF\cBT\c@\c@\c@\c@\c@\cI\cAè\c@\c@\c@\cV\c@\cL\cAj\c@\cB\c@D\c@\cL\c@ð\c@\cC\c@\c@\cK\c@Œ\c@\cD\c@ñ\c@\cH\c@G\c@\cD\cAm\c@\cD\c@!\c@\cD\cAæ\c@\cA\c@\cR\c@\cC\cBI\c@\c@\c@\cN\c@\cB\cB„\c@\c@\c@\cM\c@\c@\cBŒ\c@\c@\c@\cL\c@\c@\cB`\c@\c@\c@\cJ\c@\c@\cB\cG\c@\c@\c@\cD\c@\c@\cA’\c@\c@\c@\c@\c@\c@\cA\cR\c@\cC\c@\c@\c@\cD\c@§\c@\cH\c@\cC\c@\cY\c@U\c@\cN\c@%\c@9\c@\c_\c@\cR\c@e\c@_\c@\cC\c@\cU\c@À\c@‚\c@\c@\c@\cU\cA0\c@–\c@\c@\c@\cT\cA±\c@\c@\c@\c@\cS\cB\c]\c@t\c@\c@\c@\cV\cBb\c@P\c@\c@\c@\c\\cBx\c@*\c@\c@\c@'\cB]\c@\cM\c@\c@\c@2\cB\cV\c@\c@\c@\c@\c@<\cA°\c@\c@\c@\c@\c@B\cA<\c@\cQ\c@\c@\c@C\c@Ì\c@H\c@\c@\c@\@\c@u\c@¥\c@\c@\c@:\c@6\cA&\c@\c@\c@2\c@\cO\cAÆ\c@\c@\c@+\c@\c@\cBn\c@\c@\c@#\c@\c@\cBý\c@\c@\c@\c^\c@\c@\cCa\c@\c@\c@\cZ\c@\c@\cC“\c@\c@\c@\cY\c@\c@\cC’\c@\c@\c@\e\c@\c@\cCb\c@\cD\c@\c^\c@\c@\cC\cK\c@\cN\c@\"\c@\c@\cB•\c@\c]\c@%\c@\c@\cB\cK\c@-\c@%\c@\c@\cAz\c@>\c@!\c@\c@\c@ò\c@H\c@\c\\c@\e\c@Š\c@H\c@\cU\c@S\c@\@\c@>\c@\cO\c@§\c@\cS\c@-\c@\cK\cA\cV\c@\c@\c@\c]\c@\cK\cAœ\c@\c@\c@\cO\c@\cN\cB\cU\c@\c@\c@\cD\c@\cR\cBm\c@\c@\c@\c@\c@\cV\cB•\c@\cC\c@\c@\c@\cY\cB†\c@\c^\c@\c@\c@\c\\cBA\c@N\c@\c@\c@!\cAÕ\c@\c@&\c@&\cAS\c@Ô\c@s\c@+\c@Ú\cA\cU\c@æ\c@/\c@y\cA4\cAw\c@/\c@4\cA*\cB'\c@+\c@\cL\c@ù\cBÄ\c@\$\c@\c@\c@²\cC6\c@\c]\c@\c@\c@n\cCl\c@\cX\c@\c@\c@7\cC`\c@\cV\c@\c@\c@\cR\cC\cV\c@\cX\c@\c@\c@\c@\cB›\c@\e\c@\c@\c@\c@\cB\cA\c@\c]\c@\c@\c@\c@\cAb\c@\c\\c@\cW\c@\c@\c@Ú\c@\cX\c@V\c@\c@\c@r\c@\cS\c@»\c@\c@\c@.\c@\cM\cAB\c@\c@\c@\cI\c@\cH\cAä\c@\c@\c@\c@\c@\cD\cB‚\c@\c@\c@\c@\c@\cB\cBø\c@\c@\c@\c@\c@\c@\cC5\c@\c@\c@\c@\c@\c@\cC2\c@\c@\c@\cE\c@\cB\cBó\c@\c@\c@\cQ\c@\cG\cBˆ\c@\c@\c@!\c@\cM\cB\cD\c@\c@\c@3\c@\cQ\cAz\c@\c@\c@H\c@\cT\c@ú\c@\c@\c@X\c@\cS\c@“\c@#\c@a\c@\cO\c@L\c@p\c@b\c@\cI\c@\c^\c@ì\c@[\c@\cD\c@\cF\cA\c@K\c@\c@\c@\c@\cB[\c@6\c@\c@\c@\c@\cC\c_\c@%\c@\c@\c@\c@\cC¹\c@\cU\c@\c@\c@\c@\cD\cR\c@\cH\c@\c@\c@\c@\cD\c^\c@\c@\c@\c@\c@\c@\cCß\c@\cH\c@\cA\c@\c@\cCe\c@.\c@\cE\c@\c@\cBÊ\c@r\c@\cK\c@\c@\cB,\c@Ð\c@\cQ\c@\c@\cA¡\cAC\c@\cW\c@\c@\cA8\cAÂ\c@\e\c@\c@\c@ð\cB)\c@\e\c@\c@\c@Â\cBj\c@\cX\c@\c@\c@\cB{\c@\cR\c@\c@\c@u\cB[\c@\cK\c@\c@\c@S\cB\cQ\c@\cF\c@\c@\c@3\cA§\c@\cB\c@\c@\c@\cV\cA1\c@\c@\c@\c@\c@\cG\c@Ã\c@\c@\c@\c@\c@\cQ\c@p\c@\c@\c@\c@\c@ \c@F\c@\c@\c@\c@\c@)\c@L\c@\c@\c@\c@\c@+\c@|\c@\cA\c@\c@\c@*\c@É\c@\cG\c@\c@\c@!\cA\c]\c@\cP\c@\c@\c@\cR\cAe\c@\c\\c@\c@\c@\cN\cA\c@*\c@\c@\c@\c\\cAŠ\c@8\c@\c@\c@0\cA\\\c@C\c@\c@\c@\@\cA\cK\c@L\c@\c@\c@M\c@·\c@S\c@\c@\c@N\c@k\c@Z\c@\c@\c@D\c@/\c@`\c@\c@\c@8\c@-\c@f\c@\c@\c@1\c@h\c@h\c@\c@\c@2\c@Ç\c@f\c@\c@\c@>\cA6\c@]\c@\c@\c@P\cA¯\c@N\c@\c@\c@e\cB\cD\c@9\c@\c@\c@z\cB\$\c@&\c@\c@\c@\cB\cK\c@\cU\c@\c@\c@›\cAÅ\c@\cI\c@\c@\c@ž\cAc\c@\c@\c@\c@\c@’\c@ü\c@\c@\c@\c@\c@w\c@ \c@\cW\c@\c@\c@V\c@Y\c@P\c@\c@\c@6\c@+\c@­\c@\c@\c@\cY\c@\cQ\cA(\c@\c@\c@\cE\c@\cD\cA¾\c@\c@\c@\cC\c@\c@\cBO\c@\c@\c@\cP\c@\c@\cB½\c@\c@\c@\"\c@\c@\cBõ\c@\c@\c@5\c@\c@\cBñ\c@\c@\c@E\c@\c@\cB³\c@\c@\c@N\c@\c@\cBJ\c@\c@\c@H\c@\c@\cAÈ\c@\c@\c@7\c@\c@\cAA\c@\cD\c@%\c@\c@\c@È\c@\cS\c@\cS\c@\c@\c@n\c@.\c@\cF\c@\c@\c@1\c@V\c@\c@\c@\c@\c@\cM\c@Š\c@\c@\c@\c@\c@\c@\c@Ä\c@\c@\c@\c@\c@\c@\c@ø\c@\c@\c@\c@\c@\c@\cA\c]\c@\c@\c@\c@\c@\cA\cA+\c@\c@\c@\c@\c@\cC\cA\"\c@\c@\c@\c@\c@\cD\cA\cB\c@\c@\c@\cB\c@\cD\c@Ò\c@\c@\c@\cD\c@\cD\c@\c@\cF\c@\cF\c@\cC\c@n\c@\cR\c@\cF\c@\cB\c@S\c@!\c@\cF\c@\c@\c@T\c@2\c@\cD\c@\c@\c@t\c@C\c@\cB\c@\c@\c@¯\c@N\c@\c@\c@\cB\c@ý\c@Q\c@\c@\c@\cD\cAL\c@O\c@\c@\c@\cE\cAŽ\c@K\c@\c@\c@\cE\cA³\c@G\c@\c@\c@\cE\cA´\c@C\c@\c@\c@\cD\cA\c@?\c@\c@\c@\cB\cAO\c@6\c@\c@\c@\c@\cA\cB\c@)\c@\c@\c@\c@\c@¼\c@\c]\c@\c@\c@\c@\c@Ž\c@\cQ\c@\c@\c@\c@\c@€\c@\cF\c@\c@\c@\c@\c@“\c@\c@\c@\c@\c@\c@\c@À\c@\c@\c@\c@\c@\c@\c@ø\c@\cA\c@\c@\c@\c@\cA,\c@\cA\c@\c@\c@\c@\cAR\c@\cA\c@\cB\c@\c@\cA`\c@\cA\c@\cJ\c@\c@\cAU\c@\c@\c@\cT\c@\c@\cA1\c@\c@\c@ \c@\c@\c@ú\c@\cJ\c@+\c@\c@\c@¶\c@0\c@2\c@\c@\c@w\c@p\c@1\c@\c@\c@C\c@È\c@(\c@\c@\c@\c]\cA=\c@\c\\c@\c@\c@\cF\cAÆ\c@\cQ\c@\cC\c@\c@\cBK\c@\cG\c@\cI\c@\c@\cB¼\c@\cA\c@\cP\c@\c@\cC\cH\c@\c@\c@\cV\c@\c@\cC#\c@\c@\c@\cZ\c@\c@\cC\cB\c@\c@\c@\cY\c@\c@\cBª\c@\c@\c@\cT\c@\c@\cB\$\c@\c@\c@\cN\c@\c@\cA‰\c@\c@\c@\cH\c@\cH\c@ù\c@\c@\c@\cB\c@,\c@‰\c@\c@\c@\c@\c@j\c@:\c@\c@\c@\c@\c@À\c@\cM\c@\c@\c@\c@\cA*\c@\c@\c@\c@\c@\cA\cAž\c@\c@\c@\c@\c@\cA\cAý\c@\c@\c@\c@\c@\cA\cB9\c@\c@\c@\c@\c@\cA\cBI\c@\cA\c@\c@\c@\cA\cB)\c@\cY\c@\c@\c@\c@\cAÞ\c@F\c@\c@\c@\c@\cAv\c@†\c@\c@\c@\c@\c@ÿ\c@Ó\c@\c@\c@\c@\c@œ\cA&\c@\c@\c@)\c@N\cA_\c@\c@\c@†\c@\cZ\cAq\c@\c@\cA\cU\c@\c@\cAY\c@\c@\cAÌ\c@\cB\cA\c]\c@\c@\cB¦\c@\cD\c@Ï\c@\c@\cCj\c@\cC\c@ƒ\c@\c@\cCð\c@\cC\c@I\c@\cE\cD\"\c@\cD\c@%\c@\cO\cCù\c@\cB\c@\cX\c@\cZ\cC€\c@\c@\c@\cX\c@\$\cBÒ\c@\cD\c@\c^\c@,\cB\cP\c@\cN\c@\$\c@,\cAX\c@ \c@&\c@#\c@Å\c@:\c@#\c@\cY\c@`\c@]\c@\c\\c@\cN\c@#\c@…\c@\cV\c@\cE\c@\cF\c@®\c@\cO\c@\cC\c@\c@\c@Ñ\c@\cG\c@\cJ\c@\c@\c@é\c@\cA\c@\cQ\c@\c@\c@ï\c@\c@\c@\cX\c@\c@\c@â\c@\c@\c@ \c@\c@\c@Ä\c@\c@\c@%\c@\c@\c@˜\c@\c@\c@'\c@\c@\c@g\c@\c@\c@)\c@\c@\c@>\c@\c@\c@,\c@\c@\c@\c_\c@\cW\c@.\c@\c@\c@\cJ\c@Y\c@/\c@\c@\c@\c@\c@À\c@-\c@\c@\c@\c@\cA?\c@*\c@\c@\c@\c@\cAÍ\c@%\c@\c@\c@\c@\cBK\c@\"\c@\c@\c@\c@\cB”\c@#\c@\c@\c@\c@\cB›\c@(\c@\c@\c@\c@\cBa\c@.\c@\c@\c@\c@\cAø\c@6\c@\c@\c@\c@\cAv\c@:\c@\c@\c@\c@\c@õ\c@8\c@\c@\c@\c@\c@\c@1\c@\c@\c@\cU\c@J\c@%\c@\c@\c@B\c@1\c@\cY\c@\c@\c@„\c@6\c@\cN\c@\c@\c@Õ\c@H\c@\cF\c@\c@\cA4\c@R\c@\c@\c@\c@\cAƒ\c@L\c@\c@\c@\c@\cA´\c@>\c@\c@\c@\c@\cAÀ\c@'\c@\cA\c@\c@\cA¤\c@\cO\c@\cB\c@\c@\cAg\c@\cF\c@\cC\c@\c@\cA\cY\c@\cM\c@\cC\c@\c@\c@Ì\c@\cS\c@\cC\c@\c@\c@\c@\cS\c@\cC\c@\c@\c@w\c@\cT\c@\cA\c@\c@\c@‰\c@\cQ\c@\c@\c@\c@\c@À\c@\cJ\c@\c@\c@\c@\cA\cN\c@\cC\c@\c@\c@\c@\cA_\c@\c@\c@\c@\c@\cI\cA\c@\c@\c@\c@\c@\c\\cA¼\c@\c@\c@\c@\c@8\cA³\c@\c@\c@\c@\c@[\cA†\c@\c@\c@\c@\c@€\cA\@\c@\c@\c@\c@\c@\c@í\c@\c@\c@\cA\c@¨\c@š\c@\cD\c@\cC\c@Ÿ\c@Z\c@ \c@\cC\c@†\c@*\c@W\c@\cC\c@b\c@\cM\c@«\c@\cC\c@?\c@\c@\cA\c\\c@\cB\c@\"\c@\c@\cA¢\c@\cA\c@\cM\c@\c@\cB\c_\c@\c@\c@\cB\c@\cD\cB|\c@\c@\c@\c@\c@\cG\cB§\c@\c@\c@\c@\c@\cJ\cB–\c@\c@\c@\cB\c@\cL\cBN\c@\cO\c@\cG\c@\cL\cAÝ\c@1\c@\cL\c@\cI\cAY\c@f\c@\cP\c@\cF\c@Ü\c@ª\c@\cS\c@\cB\c@z\c@ü\c@\cQ\c@\c@\c@8\cAE\c@\cM\c@\c@\c@\e\cAw\c@\cI\c@\c@\c@\cZ\cA‰\c@\cD\c@\c@\c@)\cAy\c@\c@\c@\c@\c@6\cAM\c@\c@\c@\c@\c@?\cA\cM\c@\c@\c@\c@\c@;\c@Æ\c@\c@\c@\cA\c@/\c@€\c@\c@\c@\cS\c@\c_\c@K\c@\c@\c@9\c@\cP\c@\$\c@\c@\c@v\c@\cD\c@\cL\c@\c@\c@Ê\c@\c@\c@\c@\c@\c@\cA1\c@\c@\c@\c@\c@\c@\cA—\c@\c@\c@\c@\c@\c@\cAë\c@\c@\c@\c@\c@\c@\cB\c_\c@\c@\c@\c@\c@\c@\cB(\c@\c@\c@\c@\c@\cF\cB\cB\c@\c@\c@\c@\c@\cP\cA²\c@\c@\c@\c@\c@\c\\cAF\c@\c@\c@\c@\c@(\c@Ú\c@\c@\c@\c@\c@3\c@~\c@\c@\c@\cA\c@6\c@E\c@\c@\c@\cD\c@2\c@D\c@\cD\c@\cH\c@'\c@}\c@\cU\c@\cJ\c@\cZ\c@Ø\c@0\c@\cI\c@\cO\cAB\c@M\c@\cI\c@\cF\cA©\c@h\c@\cG\c@\cA\cAõ\c@|\c@\cC\c@\c@\cB\cY\c@€\c@\c@\c@\c@\cB\cS\c@}\c@\c@\c@\c@\cAé\c@z\c@\cE\c@\c@\cA¤\c@}\c@!\c@\c@\cAJ\c@ƒ\c@Q\c@\c@\c@ë\c@‡\c@“\c@\c@\c@–\c@{\c@ä\c@\c@\c@S\c@c\cA=\c@\c@\c@#\c@G\cAŠ\c@\c@\c@\cG\c@'\cA½\c@\c@\c@\c@\c@\cL\cAÑ\c@\c@\c@\c@\c@\cC\cAÃ\c@\c@\c@\c@\c@\cW\cA—\c@\c@\c@\c@\c@7\cAQ\c@\c@\c@\c@\c@Z\c@þ\c@\c@\c@\c@\c@\c?\c@ª\c@\c@\c@\c@\c@¥\c@e\c@\c@\c@\cL\c@¾\c@1\c@\c@\c@1\c@Ì\c@\cU\c@\c@\c@j\c@Õ\c@\cL\c@\c@\c@³\c@Û\c@\cN\c@\c@\cA\cI\c@Ü\c@\cP\c@\c@\cA[\c@Ô\c@\cR\c@\c@\cA”\c@¾\c@\cO\c@\c@\cA¯\c@™\c@\cJ\c@\c@\cA§\c@m\c@\cH\c@\c@\cA€\c@D\c@\cM\c@\c@\cA?\c@#\c@\c^\c@\c@\c@î\c@\cR\c@>\c@\c@\c@ž\c@\cM\c@p\c@\c@\c@\\\c@\cN\c@±\c@\c@\c@*\c@\cM\c@û\c@\cB\c@\cK\c@\cM\cAD\c@\cF\c@\c@\c@\cI\cA\c@\cJ\c@\cD\c@\cE\cA§\c@\cL\c@\cH\c@\cJ\cA¯\c@\cM\c@\cG\c@\cU\cA˜\c@\cK\c@\cG\c@\c]\cAf\c@\cH\c@\cH\c@\c^\cA#\c@\cD\c@\cF\c@\c^\c@Ø\c@\cA\c@\c@\c@\cY\c@\c@\c@\c@\c@\c@\cN\c@V\c@\c@\c@\cV\c@\cJ\c@,\c@\c@\c@A\c@\cX\c@\cQ\c@\c@\c@{\c@0\c@\cF\c@\c@\c@À\c@G\c@\cG\c@\c@\cA\cO\c@\\\c@\cJ\c@\cE\cAL\c@h\c@\cK\c@\cL\cAo\c@e\c@\cL\c@\cT\cAv\c@W\c@\cJ\c@\e\cAb\c@G\c@\cF\c@ \cA:\c@;\c@\cB\c@\c^\cA\cD\c@<\c@\c@\c@\cX\c@Ç\c@K\c@\c@\c@\cP\c@Š\c@m\c@\cA\c@\cI\c@V\c@¢\c@\cA\c@\cH\c@.\c@ç\c@\cA\c@\cK\c@\cS\cA7\c@\cA\c@\cO\c@\cD\cA‹\c@\c@\c@\cQ\c@\c@\cAØ\c@\c@\c@\cQ\c@\c@\cB\cW\c@\c@\c@\cP\c@\c@\cB=\c@\c@\c@\cR\c@\c@\cBE\c@\c@\c@\c]\c@\c@\cB,\c@\c@\c@1\c@\c@\cAñ\c@\cB\c@L\c@\c@\cA˜\c@\cE\c@i\c@\c@\cA+\c@\cJ\c@~\c@\c@\c@Å\c@\cN\c@…\c@\c@\c@p\c@\cQ\c@{\c@\cT\c@0\c@\cO\c@b\c@:\c@\cJ\c@\cM\c@D\c@v\c@\c@\c@\cH\c@(\c@À\c@\c@\c@\cC\c@\cR\cA\cY\c@\c@\c@\c@\c@\cD\cAe\c@\c@\c@\c@\c@\c@\cA™\c@\c@\c@\c@\c@\c@\cAª\c@\cA\c@\cI\c@\c@\cA“\c@\cQ\c@\c\\c@\c@\cAZ\c@)\c@<\c@\c@\cA\cI\c@F\c@l\c@\c@\c@³\c@e\c@´\c@\c@\c@j\c@…\cA\cH\c@\c@\c@2\c@›\cAd\c@\c@\c@\cN\c@¨\cA¾\c@\c@\c@\c@\c@ª\cB\cJ\c@\c@\c@\c@\c@¢\cB;\c@\c@\c@\c@\c@\cBL\c@\c@\c@\c@\c@s\cB8\c@\c@\c@\c@\c@S\cB\cD\c@\c@\c@\c@\c@4\cA¹\c@\c@\c@\c@\c@\cY\cAa\c@\c@\c@\c@\c@\cG\cA\cI\c@\c@\c@\cD\c@\c@\c@¹\c@\c@\c@\$\c@\cC\c@x\c@\c@\c@\\\c@\cX\c@G\c@\c@\c@¨\c@;\c@&\c@\c@\cA\cA\c@c\c@\cR\c@\c@\cA`\c@…\c@\cG\c@\c@\cA§\c@\c@\cB\c@\c@\cAÍ\c@˜\c@\c@\c@\c@\cAÎ\c@y\c@\c@\c@\c@\cA­\c@T\c@\cE\c@\c@\cAp\c@-\c@\cK\c@\cB\cA\"\c@\cO\c@\cP\c@\cC\c@Ð\c@\c@\c@\cR\c@\cC\c@ˆ\c@\c@\c@\cS\c@\cC\c@V\c@\cM\c@\cP\c@\cC\c@G\c@!\c@\cK\c@\cB\c@]\c@8\c@\cE\c@\c@\c@‘\c@K\c@\cA\c@\c@\c@Ó\c@\\\c@\c@\c@\c@\cA\cU\c@^\c@\c@\c@\c@\cAE\c@W\c@\c@\c@\c@\cAX\c@M\c@\c@\c@\cB\cAL\c@G\c@\c@\c@\cC\cA%\c@F\c@\cA\c@\cC\c@í\c@F\c@\cT\c@\cC\c@­\c@D\c@;\c@\cC\c@s\c@;\c@s\c@\cB\c@D\c@0\c@º\c@\cA\c@\$\c@(\cA\cM\c@\cD\c@\cT\c@'\cAU\c@\cH\c@\cO\c@.\cAˆ\c@\cN\c@\cQ\c@8\cAž\c@\cS\c@\cS\c@\@\cA—\c@\cX\c@\cU\c@?\cAw\c@\cX\c@\cS\c@8\cAE\c@\cU\c@\cO\c@0\cA\cL\c@\cO\c@\cJ\c@+\c@Ó\c@\cJ\c@\cE\c@,\c@ \c@\cH\c@\cB\c@0\c@u\c@\cQ\c@\c@\c@0\c@Q\c@'\c@\c@\c@+\c@4\c@K\c@\c@\c@!\c@\c_\c@x\c@\c@\c@\cU\c@\cO\c@©\c@\c@\c@\cJ\c@\cD\c@Ó\c@\c@\c@\cE\c@\c@\c@ï\c@\c@\c@\cC\c@\c@\c@ø\c@\c@\c@\cC\c@\c@\c@î\c@\c@\c@\cC\c@\cC\c@Ö\c@\c@\c@\cB\c@\cJ\c@¶\c@\c@\c@\c@\c@\cT\c@”\c@\c@\c@\c@\c@\c]\c@u\c@\c@\c@\cI\c@&\c@[\c@\c@\c@?\c@*\c@E\c@\c@\c@Ÿ\c@'\c@3\c@\c@\cA\"\c@\c^\c@\"\c@\c@\cA»\c@\cT\c@\cV\c@\c@\cB]\c@\cK\c@\cO\c@\c@\cB×\c@\cC\c@\cO\c@\cA\cC\c\\c@\c@\c@\cU\c@\cE\cC*\c@\c@\c@ \c@\cH\cC\cN\c@\c@\c@)\c@\cK\cBØ\c@\c@\c@-\c@\cM\cB“\c@\cP\c@,\c@\cL\cBC\c@2\c@%\c@\cI\cAë\c@g\c@\c]\c@\cF\cA\c@ª\c@\cW\c@\cB\cA5\c@ý\c@\cS\c@\c@\c@ç\cAF\c@\cQ\c@\c@\c@¬\cA{\c@\cO\c@\c@\c@‡\cA’\c@\cL\c@\c@\c@u\cA‡\c@\cH\c@\c@\c@k\cA_\c@\cD\c@\c@\c@`\cA\"\c@\cA\c@\c@\c@N\c@Û\c@\cA\c@\c@\c@8\c@”\c@\cC\c@\cF\c@#\c@Y\c@\cD\c@\cY\c@\cQ\c@/\c@\cD\c@:\c@\cD\c@\cT\c@\cE\c@h\c@\c@\c@\cE\c@\cD\c@£\c@\c@\c@\c@\c@\cB\c@ä\c@\c@\c@\c@\c@\c@\cA\c^\c@\c@\c@\c@\c@\c@\cAJ\c@\c@\c@\c@\c@\c@\cAb\c@\c@\c@\c@\c@\c@\cAb\c@\c@\c@\c@\c@\c@\cAI\c@\c@\c@\c@\c@\c@\cA\c]\c@\c@\c@\cC\c@\c@\c@â\c@\cH\c@\c^\c@\c@\c@ \c@\cY\c@O\c@\c@\c@f\c@2\c@–\c@\c@\c@8\c@M\c@ñ\c@\c@\c@\cX\c@e\cAW\c@\c@\c@\cE\c@p\cA¯\c@\c@\c@\c@\c@i\cAé\c@\c@\c@\c@\c@R\cAü\c@\c@\c@\c@\c@7\cAæ\c@\c@\c@\c@\c@\c^\cA­\c@\c@\c@\c@\c@\cJ\cA]\c@\c@\c@\c@\c@\c@\cA\cC\c@\c@\c@\cD\c@\c@\c@¬\c@\c@\c@\cT\c@\c@\c@e\c@\c@\c@/\c@\c@\c@3\c@\c@\c@W\c@\c@\c@\cS\c@\c@\c@Œ\c@\c@\c@\cC\c@\c@\c@É\c@\c@\c@\c@\c@\c@\cA\cB\c@\c@\c@\c@\c@\cB\cA1\c@\c@\c@\c@\c@\cI\cAM\c@\c@\c@\cB\c@\cU\cAT\c@\c@\c@\cF\c@#\cAD\c@\c@\c@\cL\c@2\cA!\c@\c@\c@\cT\c@;\c@î\c@\c@\c@\c^\c@:\c@´\c@\cN\c@&\c@0\c@y\c@-\c@,\c@#\c@J\c@\\\c@.\c@\cT\c@'\c@›\c@*\c@\cH\c@\cO\c@í\c@\"\c@\cK\c@\cB\cAA\c@\cX\c@\cY\c@\c@\cA\c@\cN\c@'\c@\c@\cA×\c@\cF\c@3\c@\c@\cB\cQ\c@\cA\c@;\c@\c@\cB>\c@\c@\c@;\c@\c@\cBZ\c@\c@\c@7\c@\c@\cB`\c@\c@\c@3\c@\c@\cBJ\c@\c@\c@5\c@\c@\cB\cR\c@\c@\c@<\c@\c@\cA»\c@\c@\c@E\c@\c@\cAL\c@\c@\c@J\c@\cM\c@Ý\c@\c@\c@J\c@0\c@€\c@\c@\c@C\c@b\c@:\c@\c@\c@9\c@¡\c@\cO\c@\c@\c@/\c@ë\c@\c@\c@\c@\c@)\cA1\c@\c@\c@\c@\c@&\cAc\c@\c@\c@\c@\c@%\cA|\c@\cG\c@\c@\c@&\cAy\c@%\c@\c@\c@%\cA^\c@Q\c@\c@\c@\"\cA.\c@ƒ\c@\cP\c@\c]\c@î\c@³\c@>\c@\cV\c@©\c@Õ\c@…\c@\cO\c@k\c@×\c@à\c@\cH\c@;\c@½\cAM\c@\cD\c@\cX\c@“\cAµ\c@\cE\c@\cE\c@g\cB\cA\c@\cI\c@\c@\c@G\cB)\c@\cL\c@\c@\c@5\cB*\c@\cM\c@\c@\c@,\cB\cK\c@\cL\c@\c@\c@&\cAÑ\c@\cJ\c@\c@\c@\c_\cA†\c@\cF\c@\c@\c@\cW\cA1\c@\cB\c@\c@\c@\cM\c@Û\c@\c@\c@\cM\c@\cD\c@Œ\c@\c@\c@6\c@\cI\c@P\c@\c@\c@v\c@\cW\c@%\c@\c@\c@É\c@\$\c@\cJ\c@\c@\cA*\c@,\c@\c@\c@\cC\cA„\c@1\c@\c@\c@\cJ\cA¿\c@,\c@\cB\c@\cT\cAÒ\c@!\c@\cG\c@!\cA»\c@\cS\c@\cO\c@1\cA\c@\cG\c@\cV\c@\@\cA2\c@\cA\c@\c\\c@J\c@Ü\c@\c@\c@\c^\c@M\c@\c@\c@\c@\cY\c@J\c@O\c@\cQ\c@\cR\c@\@\c@%\c@G\c@\cK\c@1\c@\cL\c@ž\c@\cD\c@!\c@\cB\cA\cI\c@\c@\c@\cT\c@\cB\cA\c@\cC\c@\cJ\c@\cB\cAñ\c@\cN\c@\cC\c@\cB\cB=\c@\c^\c@\c@\c@\cB\cB]\c@3\c@\c@\c@\cB\cBX\c@K\c@\c@\c@\c@\cB1\c@`\c@\c@\c@\c@\cAî\c@k\c@\c@\c@\c@\cA”\c@h\c@\cA\c@\c@\cA&\c@Y\c@\cA\c@\cC\c@Ä\c@A\c@\cA\c@ \c@p\c@*\c@\cA\c@V\c@.\c@\cU\c@\cA\c@Ÿ\c@\cE\c@\cG\c@\c@\c@÷\c@\c@\c@\c@\c@\c@\cAX\c@\cR\c@\c@\c@\cE\cA¥\c@5\c@\c@\c@\cK\cAÑ\c@^\c@\c@\c@\cP\cAÙ\c@‚\c@\c@\c@\cT\cAÀ\c@Ÿ\c@\c@\c@\cW\cA‹\c@¡\c@\c@\c@\cX\cAF\c@‡\c@\c@\c@\cZ\c@ü\c@`\c@\c@\c@\"\c@º\c@8\c@\c@\c@.\c@‹\c@\cW\c@\c@\c@;\c@z\c@\cD\c@\c@\c@E\c@‰\c@\c@\c@\c@\c@E\c@·\c@\c@\c@\c@\c@<\c@ø\c@\c@\c@\c@\c@/\cA;\c@\cE\c@\c@\c@\"\cAn\c@\c]\c@\c@\c@\c\\cA\c?\c@B\c@\c@\c@\c_\cAg\c@j\c@\c@\c@)\cA*\c@\c@\c@\c@3\c@×\c@¤\c@\c@\c@7\c@ˆ\c@¡\c@\c@\c@4\c@P\c@‹\c@\c@\c@*\c@B\c@p\c@\c@\c@\c^\c@c\c@[\c@\c@\c@\cS\c@«\c@P\c@\c@\c@\cM\cA\c@\c@M\c@\c@\c@\cL\cAT\c@I\c@\c@\c@\cM\cA”\c@=\c@\c@\c@\cO\cAµ\c@.\c@\c@\c@\cQ\cA¹\c@\e\c@\c@\c@\cU\cA£\c@\cJ\c@\c@\c@\cZ\cA|\c@\c@\c@\cJ\c@ \cAH\c@\c@\c@+\c@'\cA\cL\c@\c@\c@c\c@+\c@Ê\c@\c@\c@«\c@*\c@ˆ\c@\c@\cA\cC\c@\"\c@S\c@\c@\cA^\c@\cY\c@+\c@\c@\cA§\c@\cO\c@\cO\c@\c@\cA×\c@\cG\c@\c@\c@\c@\cAé\c@\cG\c@\c@\c@\cJ\cAá\c@\cN\c@\c@\c@&\cAÀ\c@\cU\c@\c@\c@K\cA\c@\cZ\c@\c@\c@p\cAN\c@\e\c@\c@\c@Œ\cA\cK\c@\cW\c@\cI\c@“\c@É\c@\cQ\c@'\c@~\c@Ž\c@\cL\c@W\c@]\c@]\c@\cM\c@™\c@7\c@7\c@\cS\c@è\c@\cU\c@\c]\c@\cY\cA9\c@\cA\c@\cM\c@\c]\cAx\c@\c@\c@\cD\c@\cZ\cAœ\c@\c@\c@\cB\c@\cU\cAŸ\c@\c@\c@\cG\c@\cM\cAƒ\c@\c@\c@\cM\c@\cE\cAP\c@\c@\c@\cT\c@\cC\cA\cN\c@\c@\c@\c\\c@\cI\c@Æ\c@\c@\c@!\c@\cO\c@ƒ\c@\cH\c@\"\c@\cS\c@M\c@4\c@\c^\c@\cV\c@(\c@ƒ\c@\cW\c@\cV\c@\cP\c@ð\c@\cO\c@\cR\c@\cD\cAq\c@\cI\c@\cM\c@\c@\cAõ\c@\cD\c@\cI\c@\c@\cBS\c@\cD\c@\cG\c@\c@\cBw\c@\cH\c@\cE\c@\c@\cB]\c@\cM\c@\cC\c@\c@\cB\cQ\c@\cT\c@\cB\c@\c@\cA©\c@\cY\c@\cA\c@\c@\cA8\c@\c^\c@\c@\c@\c@\c@Ò\c@ \c@\c@\c@\cM\c@\c?\c@ \c@\c@\c@+\c@F\c@\c_\c@\c@\c@Y\c@\"\c@\c^\c@\c@\c@–\c@\cL\c@\c]\c@\c@\c@â\c@\cA\c@\c]\c@\c@\cA+\c@\c@\c@!\c@\c@\cAc\c@\c@\c@(\c@\c@\cA‚\c@\c@\c@2\c@\c@\cA€\c@\c@\c@=\c@\c@\cA\\\c@\c@\c@E\c@\c@\cA\c\\c@\c@\c@H\c@\c@\c@Ï\c@\c@\c@A\c@\c@\c@…\c@\cF\c@3\c@\c@\c@P\c@\cU\c@\$\c@\c@\c@?\c@'\c@\cT\c@\c@\c@S\c@:\c@\cH\c@\c@\c@‰\c@G\c@\c@\c@\c@\c@Ô\c@F\c@\c@\c@\cB\cA!\c@;\c@\c@\c@\cH\cA_\c@+\c@\c@\c@\cM\cAƒ\c@\cW\c@\c@\c@\cR\cA„\c@\cL\c@\c@\c@\cW\cAc\c@\c^\c@\c@\c@\e\cA'\c@C\c@\c@\c@ \c@á\c@i\c@\c@\c@'\c@¡\c@ˆ\c@\c@\c@2\c@y\c@˜\c@\c@\c@<\c@s\c@Œ\c@\c@\c@\@\c@\c@l\c@\c@\c@>\c@Ç\c@F\c@\c@\c@4\cA\cI\c@\"\c@\c@\c@'\cAH\c@\cI\c@\c@\c@\c^\cAy\c@\cB\c@\c@\c@\c\\cA–\c@\cE\c@\c@\c@\"\cA›\c@\cL\c@\c@\c@-\cA‰\c@\cX\c@\cD\c@6\cA`\c@+\c@\$\c@:\cA#\c@?\c@Z\c@8\c@Ú\c@R\c@¥\c@3\c@\c@]\c@þ\c@0\c@S\c@]\cA_\c@4\c@&\c@Q\cAª\c@?\c@\cJ\c@>\cA×\c@P\c@\c@\c@+\cAà\c@b\c@\c@\c@\cZ\cAÈ\c@p\c@\c@\c@\cO\cA”\c@y\c@\c@\c@\cH\cAM\c@{\c@\c@\c@\cF\c@þ\c@z\c@\c@\c@\cD\c@­\c@v\c@\cR\c@\cB\c@j\c@q\c@6\c@\cG\c@8\c@h\c@k\c@\cU\c@\cV\c@[\c@«\c@&\c@\cD\c@I\c@ö\c@5\c@\c@\c@4\cA7\c@>\c@\c@\c@ \cAd\c@:\c@\c@\c@\cS\cAy\c@/\c@\cC\c@\cN\cAu\c@ \c@\cH\c@\cR\cA\\\c@\cO\c@\cN\c@\e\cA2\c@\cA\c@\cT\c@!\c@ý\c@\c@\c@\cY\c@\"\c@Â\c@\cO\c@\e\c@\c]\c@ˆ\c@5\c@\cY\c@\cU\c@U\c@l\c@\cW\c@\cK\c@/\c@µ\c@\cV\c@\cD\c@\cU\cA\cO\c@\cY\c@\c@\c@\cF\cAi\c@\c]\c@\c@\c@\c@\cA³\c@#\c@\c@\c@\c@\cAä\c@\$\c@\c@\c@\c@\cAñ\c@\c_\c@\c@\c@\c@\cAÙ\c@\cX\c@\c@\c@\cA\cAš\c@\cP\c@\c@\c@\cD\cA>\c@\cG\c@\c@\c@\cG\c@Ù\c@\cE\c@\c@\c@\cH\c@ƒ\c@\cM\c@\c@\c@\cI\c@Q\c@\cW\c@\cA\c@\cH\c@]\c@\c^\c@\cD\c@\cF\c@­\c@#\c@\cH\c@\cB\cA4\c@!\c@\cJ\c@\c@\cAÛ\c@\e\c@\cM\c@\c@\cB†\c@\cQ\c@\cQ\c@\c@\cC\cR\c@\cH\c@\cW\c@\c@\cCi\c@\cC\c@%\c@\c@\cC€\c@\cC\c@:\c@\c@\cCV\c@\cD\c@V\c@\c@\cBõ\c@\cD\c@s\c@\c@\cBp\c@\cD\c@ˆ\c@\c@\cAá\c@\cD\c@\c@\c@\cAh\c@\cB\c@ˆ\c@\c@\cA\"\c@\c@\c@t\c@\c@\cA#\c@\c@\c@[\c@\c@\cAm\c@\c@\c@E\c@\c@\cAë\c@\c@\c@:\c@\c@\cBy\c@\c@\c@:\c@\c@\cBé\c@\c@\c@D\c@\c@\cC\e\c@\c@\c@S\c@\c@\cBû\c@\c@\c@b\c@\c@\cB\c@\c@\c@m\c@\c@\cAï\c@\c@\c@t\c@\c@\cAI\c@\c@\c@u\c@\cG\c@¾\c@\c@\c@r\c@)\c@V\c@\c@\c@k\c@d\c@\cU\c@\c@\c@`\c@´\c@\cF\c@\c@\c@R\cA\cS\c@\cX\c@\c@\c@C\cAw\c@+\c@\c@\c@5\cAÇ\c@3\c@\c@\c@+\cAø\c@3\c@\c@\c@\$\cB\cJ\c@2\c@\c@\c@\"\cAþ\c@%\c@\c@\c@#\cAÜ\c@\cQ\c@\c@\c@%\cA¦\c@\cO\c@\cR\c@)\cAa\c@\$\c@7\c@,\cA\cR\c@<\c@q\c@1\c@¿\c@Q\c@½\c@6\c@w\c@f\cA\e\c@<\c@?\c@r\cAt\c@\@\c@\cY\c@w\cA»\c@C\c@\cC\c@{\cAæ\c@F\c@\c@\c@\c?\cAò\c@J\c@\c@\c@\c?\cAÞ\c@N\c@\c@\c@u\cA®\c@T\c@\c@\c@]\cAj\c@X\c@\c@\c@D\cA\c\\c@X\c@\cC\c@'\c@Ì\c@R\c@\cV\c@\cO\c@…\c@G\c@7\c@\cJ\c@L\c@9\c@d\c@\cV\c@%\c@+\c@\c@\c_\c@\cN\c@!\c@Û\c@#\c@\cC\c@\c_\cA\cO\c@\$\c@\c@\c@#\cA3\c@\c_\c@\c@\c@,\cAA\c@\cT\c@\c@\c@8\cA8\c@\cI\c@\c@\c@D\cA\c\\c@\cA\c@\cB\c@O\c@ï\c@\c@\c@\cD\c@V\c@¸\c@\c@\c@\cG\c@Y\c@\c?\c@\cE\c@\cH\c@T\c@N\c@)\c@\cJ\c@I\c@)\c@i\c@\cL\c@6\c@\cP\c@Â\c@\cQ\c@\$\c@\cC\cA-\c@\cY\c@\cS\c@\c@\cA¥\c@%\c@\cG\c@\c@\cB\cG\c@3\c@\cA\c@\c@\cBE\c@\@\c@\cE\c@\c@\cBV\c@L\c@\cK\c@\c@\cB5\c@X\c@\cO\c@\c@\cAç\c@g\c@\cQ\c@\c@\cAw\c@~\c@\cQ\c@\c@\cA\c@\c@Ÿ\c@\cM\c@\c@\c@š\c@Ê\c@\cI\c@\c@\c@I\c@û\c@\cD\c@\c@\c@\cT\cA+\c@\c@\c@\c@\c@\c@\cAR\c@\c@\c@\c@\c@\c@\cAh\c@\c@\c@\c@\c@\c@\cAk\c@\c@\c@\c@\c@\c@\cAY\c@\c@\c@\cC\c@\c@\cA6\c@\c@\c@\cF\c@\c@\cA\cG\c@\c@\c@\cI\c@\cL\c@Ñ\c@\c@\c@\cK\c@.\c@š\c@\c@\c@\cK\c@e\c@d\c@\cA\c@\cI\c@¬\c@<\c@\cB\c@\cF\cA\cE\c@\c^\c@\cB\c@\cC\cAd\c@\cJ\c@\cB\c@\c@\cAÀ\c@\c@\c@\cC\c@\c@\cB\cZ\c@\c@\c@\cH\c@\c@\cBr\c@\c@\c@\cU\c@\c@\cBÃ\c@\c@\c@(\c@\c@\cBÿ\c@\c@\c@\@\c@\c@\cC\cR\c@\c@\c@Y\c@\c@\cBì\c@\c@\c@p\c@\c@\cB‰\c@\c@\c@€\c@\c@\cAû\c@\c@\c@‰\c@\c@\cAc\c@\c@\c@Š\c@\cK\c@ä\c@\c@\c@„\c@-\c@˜\c@\c@\c@u\c@c\c@‚\c@\c@\c@a\c@¬\c@•\c@\cB\c@J\cA\cE\c@²\c@\cD\c@4\cAc\c@Á\c@\cC\c@#\cA±\c@³\c@\cC\c@\cY\cAç\c@Š\c@\cC\c@\cU\cB\cA\c@\\\c@\cB\c@\cT\cAü\c@1\c@\c@\c@\cS\cAÚ\c@\cP\c@\cB\c@\cP\cA \c@\c@\c@\cU\c@\cK\cAT\c@\c@\c@7\c@\cE\c@ÿ\c@\c@\c@e\c@\cA\c@®\c@\cG\c@›\c@\c@\c@h\c@\cS\c@Ø\c@\cA\c@6\c@!\cA\cJ\c@\cB\c@\cV\c@,\cA+\c@\cD\c@\cE\c@4\cA:\c@\cH\c@\c@\c@2\cA6\c@\cN\c@\c@\c@)\cA \c@\cV\c@\c@\c@\c\\c@ü\c@\c]\c@\c@\c@\cQ\c@Î\c@ \c@\c@\c@\cK\c@\c@\c^\c@\c@\c@\cH\c@m\c@\cX\c@\cR\c@\cG\c@C\c@\cQ\c@9\c@\cF\c@\$\c@\cI\c@u\c@\cE\c@\cQ\c@\cB\c@¿\c@\cB\c@\cE\c@\cA\cA\cW\c@\c@\c@\c@\c@\cE\cAc\c@\c@\c@\c@\c@\cJ\cA˜\c@\c@\c@\c@\c@\cR\cA«\c@\cF\c@\cD\c@\c]\cAœ\c@\cZ\c@\cN\c@)\cAp\c@7\c@\c_\c@5\cA3\c@W\c@:\c@<\c@ì\c@w\c@_\c@<\c@©\c@Œ\c@‹\c@4\c@o\c@‘\c@¹\c@'\c@B\c@†\c@ä\c@\cZ\c@#\c@u\cA\cH\c@\cN\c@\cQ\c@e\cA\c^\c@\cK\c@\cF\c@\\\cA&\c@\cP\c@\cA\c@Y\cA!\c@\cW\c@\c@\c@W\cA\cP\c@\c\\c@\c@\c@Q\c@÷\c@\c]\c@\c@\c@E\c@Ú\c@\cY\c@\c@\c@4\c@½\c@\cR\c@\c@\c@#\c@¡\c@\cI\c@\c@\c@\cU\c@…\c@\cB\c@\cI\c@\cL\c@k\c@\c@\c@\"\c@\cG\c@Q\c@\c@\c@J\c@\cE\c@9\c@\c@\c@~\c@\cD\c@\$\c@\c@\c@º\c@\cB\c@\cT\c@\c@\c@ï\c@\c@\c@\cH\c@\c@\cA\cP\c@\cF\c@\cC\c@\c@\cA\cV\c@\cV\c@\cE\c@\c@\cA\cC\c@*\c@\cJ\c@\c@\c@Ý\c@=\c@\cQ\c@\c@\c@±\c@P\c@\cY\c@\c@\c@„\c@b\c@!\c@\c@\c@]\c@s\c@%\c@\c@\c@>\c@Ž\c@&\c@\c@\c@&\c@·\c@#\c@\c@\c@\cV\c@í\c@\e\c@\cE\c@\cL\cA'\c@\cS\c@\cP\c@\cD\cAW\c@\cK\c@ \c@\c@\cAq\c@\cE\c@2\c@\c@\cAs\c@\c@\c@F\c@\c@\cAe\c@\cA\c@V\c@\c@\cAS\c@\cC\c@_\c@\c@\cAH\c@\cD\c@`\c@\c@\cAF\c@\cD\c@[\c@\c@\cAH\c@\cE\c@P\c@\c@\cAF\c@\cD\c@B\c@\cC\cA7\c@\cB\c@3\c@\cQ\cA\e\c@\c@\c@'\c@)\c@õ\c@\c@\c@\"\c@K\c@Ñ\c@\c@\c@%\c@t\c@µ\c@\c@\c@2\c@¡\c@¦\c@\c@\c@G\c@È\c@£\c@\c@\c@a\c@å\c@§\c@\c@\c@y\c@õ\c@¨\c@\c@\c@\c@ø\c@¡\c@\c@\c@™\c@î\c@Ž\c@\cJ\c@ž\c@Õ\c@n\c@\$\c@›\c@¯\c@M\c@L\c@‘\c@€\c@/\c@\c@‚\c@T\c@\cU\c@Á\c@o\c@/\c@\cD\cA\c@\c@Z\c@\cS\c@\c@\cA3\c@G\c@\cC\c@\cC\cAV\c@7\c@\cD\c@\cP\cAf\c@,\c@\cC\c@#\cAe\c@%\c@\cC\c@:\cAS\c@\c_\c@\cC\c@Q\cA4\c@\e\c@\cD\c@b\cA\cI\c@\cX\c@\c@\c@f\c@Ù\c@\cV\c@\cH\c@[\c@¦\c@\cX\c@\"\c@F\c@x\c@\c\\c@K\c@1\c@Q\c@ \c@}\c@\c_\c@4\c@!\c@¹\c@\cX\c@#\c@\c_\c@ö\c@\c_\c@\cY\c@\cX\cA\$\c@0\c@\cU\c@\cP\cA\@\c@H\c@\cS\c@\cH\cAH\c@c\c@\cQ\c@\cD\cA<\c@{\c@\cM\c@\cH\cA\c_\c@‰\c@\cI\c@\cQ\c@ô\c@‰\c@\cE\c@\c\\c@¾\c@~\c@\cB\c@&\c@‡\c@n\c@\cA\c@,\c@T\c@d\c@\cE\c@,\c@.\c@m\c@\cL\c@&\c@\cT\c@Ž\c@\cW\c@\c\\c@\cE\c@Ì\c@#\c@\cR\c@\c@\cA\e\c@.\c@\cI\c@\c@\cAl\c@4\c@\cD\c@\c@\cA­\c@7\c@\cA\c@\c@\cAÏ\c@8\c@\c@\c@\c@\cAÈ\c@=\c@\c@\c@\c@\cA›\c@K\c@\c@\c@\c@\cAT\c@g\c@\c@\c@\c@\cA\cC\c@‘\c@\c@\c@\c@\c@¸\c@Å\c@\c@\c@\c@\c@|\c@þ\c@\c@\c@\c@\c@Q\cA0\c@\c@\c@\c@\c@5\cAW\c@\c@\c@\c@\c@#\cAm\c@\c@\c@\c@\c@\cX\cAq\c@\c@\c@\c@\c@\cU\cAe\c@\c@\c@\c@\c@\c\\cAM\c@\c@\c@\c@\c@,\cA,\c@\c@\c@\c@\c@\@\cA\cC\c@\c@\c@\c@\c@R\c@Ø\c@\c@\c@\c@\c@[\c@¬\c@\c@\c@\c@\c@Z\c@‚\c@\c@\c@\cN\c@V\c@]\c@\c@\c@'\c@S\c@\@\c@\cB\c@J\c@R\c@+\c@\cH\c@u\c@Q\c@\c]\c@\cM\c@©\c@L\c@\cS\c@\cQ\c@Ø\c@>\c@\cL\c@\cR\c@ý\c@/\c@\cH\c@\cQ\cA\cW\c@\c\\c@\cE\c@\cM\cA\$\c@\cK\c@\cJ\c@\cI\cA \c@\c@\c@\c\\c@\cL\cA\cK\c@\c@\c@:\c@\cY\c@ä\c@\c@\c@c\c@)\c@°\c@\cG\c@–\c@7\c@w\c@\cU\c@Ê\c@>\c@H\c@'\c@ø\c@8\c@\"\c@8\cA\e\c@-\c@\cI\c@G\cA0\c@\c]\c@\c@\c@K\cA8\c@\cM\c@\c@\c@E\cA2\c@\cB\c@\c@\c@9\cA \c@\cE\c@\c@\c@/\cA\cE\c@\cK\c@\cA\c@.\c@ä\c@\cR\c@\cE\c@:\c@À\c@\cY\c@\cJ\c@Q\c@\c@\c_\c@\cS\c@o\c@{\c@!\c@\"\c@Š\c@[\c@\c]\c@6\c@\c@?\c@\cW\c@Q\c@¡\c@'\c@\cP\c@r\c@•\c@\cV\c@\cL\c@–\c@}\c@\cI\c@\cK\c@¶\c@_\c@\cB\c@\cN\c@Í\c@D\c@\c@\c@\cQ\c@×\c@2\c@\c@\c@\cR\c@Ó\c@*\c@\c@\c@\cQ\c@Á\c@)\c@\c@\c@\cP\c@§\c@*\c@\c@\c@\cS\c@‰\c@*\c@\c@\c@#\c@l\c@&\c@\c@\c@E\c@Q\c@\"\c@\c@\c@y\c@:\c@ \c@\c@\c@¹\c@'\c@&\c@\c@\c@ü\c@\cX\c@0\c@\c@\cA7\c@\cM\c@<\c@\c@\cAd\c@\cG\c@B\c@\c@\cA\c@\cG\c@\@\c@\c@\cA\c@\cM\c@3\c@\c@\cAŠ\c@\cV\c@\$\c@\c@\cAz\c@\c_\c@\cT\c@\c@\cA[\c@&\c@\cG\c@\c@\cA0\c@(\c@\c@\c@\c@\c@þ\c@\$\c@\c@\c@\cB\c@Ï\c@\e\c@\c@\c@\cG\c@¯\c@\cR\c@\c@\c@\cK\c@¥\c@\cJ\c@\cB\c@\cO\c@³\c@\cC\c@\cC\c@\cQ\c@Ó\c@\c@\c@\cC\c@\cP\c@ú\c@\c@\c@\cC\c@\cL\cA\c\\c@\c@\c@\cC\c@\cG\cA2\c@\c@\c@\cB\c@\cC\cA9\c@\c@\c@\c@\c@\c@\cA1\c@\c@\c@\cC\c@\c@\cA\c_\c@\c@\c@\cK\c@\cB\cA\cF\c@\c@\c@\cW\c@\cH\c@é\c@\c@\c@\$\c@\cS\c@É\c@\c@\c@1\c@ \c@¨\c@\c@\c@<\c@+\c@ˆ\c@\cD\c@A\c@2\c@i\c@\cM\c@>\c@1\c@M\c@\e\c@4\c@'\c@3\c@-\c@'\c@\e\c@\c_\c@B\c@\cZ\c@\cO\c@\cP\c@S\c@\cN\c@\cE\c@\cF\c@^\c@\cE\c@\c@\c@\c@\c@^\c@\c@\c@\c@\c@\cB\c@V\c@\cA\c@\c@\c@\cE\c@H\c@\cC\c@\c@\c@\cF\c@;\c@\cF\c@\c@\c@\cG\c@3\c@\cH\c@\c@\c@\cG\c@5\c@\cJ\c@\cB\c@\cF\c@A\c@\cJ\c@\cJ\c@\cC\c@S\c@\cI\c@\cU\c@\cA\c@f\c@\cI\c@!\c@\c@\c@s\c@\cM\c@,\c@\c@\c@v\c@\cV\c@2\c@\c@\c@o\c@\"\c@.\c@\c@\c@b\c@.\c@\$\c@\c@\c@T\c@4\c@\cX\c@\c@\c@I\c@0\c@\cL\c@\c@\c@D\c@'\c@\cC\c@\c@\c@F\c@\e\c@\c@\c@\cC\c@J\c@\cN\c@\c@\c@\cK\c@N\c@\cI\c@\cB\c@\cU\c@O\c@\cZ\c@\cF\c@\c_\c@M\c@5\c@\cJ\c@(\c@H\c@O\c@\cM\c@-\c@A\c@f\c@\cQ\c@+\c@;\c@s\c@\cS\c@&\c@7\c@o\c@\cU\c@\c^\c@5\c@_\c@\cY\c@\cW\c@1\c@I\c@#\c@\cQ\c@-\c@6\c@5\c@\cN\c@)\c@)\c@P\c@\cL\c@#\c@#\c@q\c@\cK\c@\c\\c@(\c@˜\c@\cK\c@\cU\c@9\c@¿\c@\cL\c@\cN\c@T\c@á\c@\cO\c@\cI\c@x\c@ù\c@\cS\c@\cF\c@œ\cA\cF\c@\cY\c@\cB\c@·\cA\cI\c@\c]\c@\c@\c@¿\cA\cB\c@\"\c@\c@\c@¯\c@ö\c@%\c@\c@\c@\c@ç\c@%\c@\cC\c@c\c@Ø\c@\"\c@\cI\c@\@\c@Å\c@\c\\c@\cQ\c@1\c@¯\c@\cT\c@\c\\c@9\c@”\c@\cL\c@+\c@T\c@u\c@\cF\c@=\c@x\c@V\c@\cB\c@R\c@–\c@:\c@\c@\c@i\c@¥\c@\$\c@\c@\c@\c?\c@Ÿ\c@\cU\c@\c@\c@‘\c@†\c@\cL\c@\c@\c@š\c@`\c@\cF\c@\c@\c@œ\c@=\c@\cD\c@\c@\c@—\c@ \c@\cB\c@\cA\c@\c@\cK\c@\c@\c@\cA\c@‚\c@\c@\c@\c@\c@\cA\c@w\c@\cF\c@\cB\c@\c@\c@j\c@\cS\c@\cG\c@\c@\c@\\\c@(\c@\cL\c@\c@\c@K\c@G\c@\cS\c@\c@\c@8\c@p\c@\cY\c@\c@\c@&\c@œ\c@\c]\c@\c@\c@\cX\c@Å\c@\e\c@\c@\c@\cN\c@é\c@\cW\c@\c@\c@\cI\cA\cC\c@\cQ\c@\c@\c@\cF\cA\cT\c@\cJ\c@\c@\c@\cD\cA\e\c@\cE\c@\c@\c@\cC\cA\cW\c@\cD\c@\c@\c@\cD\cA\cH\c@\cH\c@\c@\c@\cG\c@í\c@\cS\c@\c@\c@\cO\c@É\c@\c_\c@\cD\c@\e\c@¢\c@)\c@\cH\c@*\c@~\c@.\c@\cM\c@<\c@b\c@+\c@\cP\c@O\c@O\c@\"\c@\cR\c@a\c@C\c@\cW\c@\cQ\c@q\c@8\c@\cK\c@\cO\c@}\c@+\c@\cC\c@\cP\c@„\c@\c^\c@\c@\c@\cW\c@„\c@\cQ\c@\c@\c@#\c@}\c@\cF\c@\c@\c@4\c@r\c@\c@\c@\c@\c@E\c@e\c@\c@\c@\c@\c@R\c@[\c@\c@\c@\cB\c@W\c@U\c@\c@\c@\cD\c@T\c@T\c@\c@\c@\cD\c@I\c@X\c@\c@\c@\cD\c@:\c@^\c@\c@\c@\cD\c@+\c@e\c@\c@\c@\cC\c@\c^\c@l\c@\c@\c@\cA\c@\cT\c@q\c@\c@\c@\c@\c@\cP\c@v\c@\c@\c@\c@\c@\cQ\c@z\c@\cC\c@\c@\c@\cY\c@{\c@\cL\c@\c@\c@(\c@y\c@\cW\c@\c@\c@?\c@r\c@ \c@\c@\c@`\c@d\c@&\c@\c@\c@ˆ\c@O\c@'\c@\c@\c@µ\c@8\c@\$\c@\c@\c@â\c@#\c@'\c@\c@\cA\cJ\c@\cS\c@7\c@\cB\cA)\c@\cG\c@W\c@\cE\cA=\c@\c@\c@\c@\cJ\cAF\c@\c@\c@¦\c@\cP\cAH\c@\c@\c@º\c@\cV\cAD\c@\c@\c@¯\c@\cY\cA;\c@\c@\c@Š\c@\e\cA,\c@\c@\c@`\c@\cX\cA\cW\c@\c@\c@5\c@\cT\c@ù\c@\cB\c@\cR\c@\cN\c@Ò\c@\cJ\c@\cC\c@\cI\c@¥\c@\cU\c@\cN\c@\cD\c@x\c@\$\c@\cZ\c@\cB\c@Q\c@3\c@!\c@\c@\c@6\c@\@\c@&\c@\c@\c@(\c@G\c@(\c@\c@\c@(\c@J\c@%\c@\c@\c@0\c@G\c@\$\c@\c@\c@:\c@C\c@)\c@\c@\c@?\c@\@\c@1\c@\c@\c@;\c@>\c@:\c@\c@\c@0\c@>\c@;\c@\c@\c@\"\c@A\c@6\c@\cA\c@\cS\c@K\c@-\c@\cA\c@\cH\c@Z\c@(\c@\cB\c@\cA\c@o\c@/\c@\cB\c@\c@\c@„\c@C\c@\cB\c@\c@\c@–\c@]\c@\cA\c@\c@\c@\c@u\c@\c@\c@\c@\c@š\c@ƒ\c@\c@\c@\c@\c@Œ\c@…\c@\cA\c@\cB\c@y\c@†\c@\cF\c@\cF\c@d\c@’\c@\cN\c@\cK\c@T\c@±\c@\cX\c@\cO\c@D\c@ß\c@\"\c@\cQ\c@7\cA\cK\c@,\c@\cP\c@-\cA\c_\c@0\c@\cM\c@&\cA\cL\c@.\c@\cI\c@#\c@Ô\c@+\c@\cD\c@)\c@”\c@)\c@\c@\c@5\c@P\c@/\c@\c@\c@E\c@\e\c@=\c@\c@\c@R\c@\c@\c@Q\c@\c@\c@W\c@\c@\c@f\c@\c@\c@T\c@\c@\c@w\c@\c@\c@H\c@\c@\c@\c?\c@\c@\c@8\c@\c@\c@\c@\c@\c@*\c@\c@\c@ƒ\c@\c@\c@ \c@\c@\c@ˆ\c@\c@\c@\cZ\c@\c@\c@•\c@\c@\c@\cX\c@\c@\c@§\c@\c@\c@\cT\c@\cB\c@¹\c@\c@\c@\cP\c@\cF\c@Ã\c@\c@\c@\cK\c@\cI\c@Ä\c@\c@\c@\cH\c@\cK\c@¼\c@\c@\c@\cJ\c@\cK\c@°\c@\c@\c@\cQ\c@\cJ\c@¤\c@\c@\c@\cY\c@\cK\c@œ\c@\cC\c@\c_\c@\cS\c@™\c@\cF\c@!\c@!\c@˜\c@\cJ\c@\c\\c@4\c@”\c@\cL\c@\cU\c@E\c@\c@\cL\c@\cL\c@K\c@‡\c@\cK\c@\cD\c@C\c@\c?\c@\cH\c@\c@\c@5\c@z\c@\cC\c@\c@\c@!\c@y\c@\c@\c@\c@\c@\cO\c@|\c@\cD\c@\c@\c@\cB\c@€\c@\cK\c@\c@\c@\c@\c@ƒ\c@\cS\c@\c@\c@\cM\c@\c@\e\c@\c@\c@.\c@{\c@#\c@\c@\c@\\\c@q\c@%\c@\cB\c@‘\c@f\c@\"\c@\cG\c@Ä\c@\\\c@\cZ\c@\cL\c@à\c@U\c@\cR\c@\cO\c@Ø\c@Q\c@\cM\c@\cQ\c@°\c@N\c@\cN\c@\cO\c@}\c@L\c@\cS\c@\cL\c@I\c@L\c@\c]\c@\cG\c@\c^\c@L\c@)\c@\cD\c@\cD\c@M\c@3\c@\cF\c@\c@\c@M\c@;\c@\cL\c@\cA\c@I\c@\@\c@\cR\c@\cB\c@B\c@A\c@\cW\c@\cH\c@7\c@?\c@\e\c@\cV\c@)\c@:\c@\c]\c@/\c@\cZ\c@6\c@\c_\c@Q\c@\cO\c@2\c@ \c@x\c@\cG\c@/\c@#\c@ž\c@\cB\c@,\c@%\c@»\c@\c@\c@(\c@(\c@Ì\c@\c@\c@#\c@+\c@Î\c@\c@\c@\c\\c@.\c@Å\c@\c@\c@\cX\c@1\c@±\c@\c@\c@\c\\c@3\c@”\c@\c@\c@-\c@4\c@p\c@\c@\c@L\c@4\c@N\c@\c@\c@w\c@4\c@0\c@\c@\c@¦\c@4\c@!\c@\c@\c@Ò\c@4\c@(\c@\c@\c@ó\c@3\c@A\c@\c@\cA\cG\c@0\c@^\c@\cA\cA\cN\c@'\c@u\c@\cG\cA\cN\c@\c]\c@z\c@\cQ\cA\cJ\c@\cR\c@i\c@\c^\cA\cF\c@\cH\c@M\c@,\c@ÿ\c@\cA\c@.\c@9\c@ó\c@\c@\c@\cT\c@C\c@Û\c@\c@\c@\cD\c@L\c@·\c@\c@\c@\c@\c@X\c@ˆ\c@\c@\c@\cH\c@k\c@Z\c@\c@\c@\"\c@Š\c@3\c@\c@\c@M\c@²\c@\cV\c@\c@\c@…\c@Ü\c@\cD\c@\c@\c@Å\cA\cB\c@\cA\c@\c@\c@ý\cA\cY\c@\cC\c@\c@\cA\c^\cA\c]\c@\cB\c@\c@\cA \cA\cM\c@\cB\c@\c@\cA\cG\c@î\c@\cC\c@\c@\c@Ú\c@Ç\c@\cB\c@\c@\c@¥\c@œ\c@\c@\c@\c@\c@u\c@t\c@\c@\c@\c@\c@P\c@Q\c@\c@\c@\cB\c@8\c@5\c@\cA\c@\cK\c@.\c@\"\c@\cE\c@\cV\c@-\c@\cV\c@\cJ\c@\$\c@1\c@\cR\c@\cN\c@2\c@8\c@\cQ\c@\cS\c@?\c@\@\c@\cR\c@\cT\c@H\c@K\c@\cR\c@\cR\c@O\c@[\c@\cP\c@\cN\c@Q\c@p\c@\cN\c@\cI\c@Q\c@…\c@\cL\c@\cD\c@J\c@”\c@\cN\c@\cA\c@>\c@”\c@\cR\c@\c@\c@0\c@ƒ\c@\cX\c@\c@\c@!\c@c\c@\c\\c@\cB\c@\cU\c@B\c@\c^\c@\cF\c@\cQ\c@\"\c@\e\c@\cI\c@\cT\c@\cK\c@\cU\c@\cL\c@\e\c@\c@\c@\cN\c@\cN\c@\$\c@\c@\c@\cG\c@\cO\c@,\c@\c@\c@\cB\c@\cQ\c@3\c@\cC\c@\c@\c@\cU\c@9\c@\c]\c@\c@\c@\c_\c@?\c@I\c@\c@\c@/\c@G\c@‚\c@\c@\c@D\c@N\c@¹\c@\c@\c@Z\c@R\c@æ\c@\c@\c@k\c@S\c@ì\c@\c@\c@s\c@L\c@Ë\c@\c@\c@r\c@\@\c@—\c@\c@\c@i\c@1\c@]\c@\c@\c@Z\c@!\c@,\c@\cB\c@K\c@\cT\c@\c\\c@\cF\c@>\c@\cN\c@)\c@\cN\c@5\c@\cN\c@8\c@\cU\c@.\c@\cR\c@<\c@\c]\c@-\c@\cW\c@<\c@\"\c@.\c@\c\\c@1\c@&\c@3\c@\c^\c@\c]\c@'\c@=\c@\e\c@\cI\c@'\c@J\c@\cU\c@\cI\c@&\c@Y\c@\cO\c@\c\\c@#\c@g\c@\cH\c@2\c@\c]\c@v\c@\cC\c@F\c@\cV\c@„\c@\c@\c@Z\c@\cN\c@”\c@\c@\c@g\c@\cG\c@§\c@\c@\c@i\c@\cB\c@¼\c@\c@\c@d\c@\c@\c@Ï\c@\cC\c@Y\c@\c@\c@Û\c@\cH\c@J\c@\c@\c@Ý\c@\cP\c@:\c@\c@\c@Ñ\c@\cY\c@)\c@\c@\c@º\c@%\c@\c]\c@\c@\c@›\c@/\c@\c\\c@\c@\c@z\c@6\c@+\c@\c@\c@]\c@:\c@H\c@\c@\c@E\c@<\c@k\c@\c@\c@2\c@:\c@‰\c@\cD\c@\$\c@8\c@˜\c@\cK\c@\e\c@4\c@“\c@\cT\c@\cT\c@3\c@|\c@ \c@\cQ\c@3\c@]\c@/\c@\cN\c@5\c@C\c@=\c@\cK\c@4\c@8\c@I\c@\cH\c@.\c@=\c@P\c@\cE\c@\$\c@K\c@Q\c@\cB\c@\cZ\c@W\c@L\c@\c@\c@\cO\c@V\c@E\c@\c@\c@\cE\c@I\c@>\c@\c@\c@\c@\c@5\c@=\c@\c@\c@\c@\c@(\c@C\c@\c@\c@\c@\c@.\c@O\c@\cA\c@\c@\c@N\c@\\\c@\cH\c@\c@\c@|\c@f\c@\cS\c@\c@\c@ª\c@i\c@ \c@\c@\c@Ì\c@d\c@+\c@\c@\c@Ø\c@Y\c@1\c@\c@\c@Ð\c@L\c@/\c@\c@\c@½\c@\@\c@&\c@\c@\c@¦\c@7\c@\c\\c@\c@\c@‘\c@1\c@\cW\c@\c@\c@|\c@-\c@\c\\c@\c@\c@b\c@(\c@)\c@\c@\c@G\c@#\c@;\c@\cD\c@/\c@\c]\c@K\c@\cN\c@\cW\c@\cX\c@S\c@\c_\c@\cF\c@\cS\c@R\c@4\c@\cC\c@\cQ\c@H\c@K\c@\cP\c@\cO\c@8\c@]\c@!\c@\cM\c@%\c@c\c@3\c@\cJ\c@\cW\c@]\c@?\c@\cG\c@\cL\c@K\c@E\c@\cE\c@\cE\c@4\c@?\c@\cB\c@\c@\c@ \c@2\c@\c@\c@\c@\c@\cR\c@%\c@\c@\c@\cI\c@\cM\c@!\c@\c@\c@\cY\c@\cL\c@'\c@\c@\c@/\c@\cL\c@6\c@\c@\c@I\c@\cK\c@K\c@\c@\c@e\c@\cJ\c@d\c@\c@\c@y\c@\cF\c@{\c@\cB\c@…\c@\cF\c@Ž\c@\cE\c@†\c@\cK\c@—\c@\cG\c@\c?\c@\cS\c@“\c@\cH\c@q\c@\cY\c@€\c@\cH\c@`\c@\c^\c@`\c@\cF\c@L\c@\c_\c@A\c@\cD\c@6\c@\c_\c@#\c@\cB\c@#\c@\c_\c@\cM\c@\c@\c@\cV\c@!\c@\c@\c@\c@\c@\cR\c@)\c@\c@\c@\c@\c@\cX\c@4\c@\c@\c@\c@\c@%\c@?\c@\c@\c@\c@\c@2\c@H\c@\cD\c@\c@\c@;\c@L\c@\cX\c@\cC\c@;\c@J\c@8\c@\cK\c@4\c@A\c@_\c@\cX\c@)\c@2\c@…\c@)\c@\c_\c@#\c@¡\c@>\c@\e\c@\cU\c@¦\c@R\c@\c_\c@\cJ\c@—\c@a\c@)\c@\cF\c@\c@k\c@5\c@\cK\c@q\c@m\c@?\c@\cU\c@r\c@h\c@C\c@\c^\c@\c@\\\c@\@\c@\$\c@’\c@L\c@8\c@%\c@™\c@9\c@,\c@!\c@Š\c@&\c@\c_\c@\c\\c@k\c@\cV\c@\cT\c@\e\c@G\c@\cK\c@\cM\c@\"\c@\$\c@\cC\c@\cG\c@2\c@\cJ\c@\c@\c@\cE\c@G\c@\cA\c@\c@\c@\cC\c@^\c@\cD\c@\c@\c@\cB\c@q\c@\cJ\c@\c@\c@\c@\c@~\c@\cU\c@\c@\c@\cA\c@ƒ\c@#\c@\c@\c@\cC\c@€\c@1\c@\cA\c@\cF\c@x\c@:\c@\cC\c@\cI\c@n\c@:\c@\cC\c@\cJ\c@e\c@1\c@\cC\c@\cI\c@`\c@\$\c@\cB\c@\cG\c@^\c@\cV\c@\cB\c@\cD\c@^\c@\cH\c@\c@\c@\cA\c@_\c@\cA\c@\c@\c@\c@\c@`\c@\c@\c@\cC\c@\c@\c@_\c@\c@\c@\cG\c@\c@\c@a\c@\c@\c@\cL\c@\c@\c@f\c@\cE\c@\cT\c@\c@\c@m\c@\cT\c@\c\\c@\c@\c@v\c@+\c@\"\c@\c@\c@|\c@C\c@%\c@\c@\c@|\c@Z\c@\$\c@\c@\c@s\c@i\c@\c_\c@\c@\c@b\c@j\c@\cV\c@\c@\c@L\c@^\c@\cN\c@\c@\c@3\c@K\c@\cG\c@\c@\c@\c_\c@8\c@\cB\c@\c@\c@\cQ\c@,\c@\cA\c@\c@\c@\cJ\c@*\c@\cF\c@\c@\c@\cI\c@2\c@\cM\c@\cB\c@\cL\c@\@\c@\cV\c@\cD\c@\cQ\c@S\c@\c]\c@\cE\c@\cS\c@g\c@\$\c@\cE\c@\cS\c@z\c@\$\c@\cE\c@\cP\c@Œ\c@ \c@\cD\c@\cM\c@ž\c@\e\c@\cA\c@\cH\c@®\c@\cU\c@\c@\c@\cD\c@¼\c@\cS\c@\cD\c@\cA\c@Ä\c@\cT\c@\cP\c@\c@\c@Â\c@\cY\c@!\c@\c@\c@·\c@\c_\c@8\c@\c@\c@¤\c@'\c@R\c@\c@\c@Œ\c@-\c@j\c@\c@\c@r\c@4\c@y\c@\cA\c@Z\c@;\c@~\c@\cF\c@D\c@B\c@y\c@\cM\c@1\c@J\c@n\c@\cV\c@\$\c@Q\c@a\c@\c]\c@\$\c@T\c@U\c@!\c@2\c@Q\c@J\c@ \c@N\c@J\c@>\c@\cY\c@r\c@<\c@.\c@\cQ\c@\c@-\c@!\c@\cJ\c@—\c@\"\c@\cT\c@\cK\c@†\c@\c_\c@\cH\c@\cT\c@g\c@&\c@\cA\c@#\c@B\c@6\c@\cB\c@3\c@ \c@H\c@\cM\c@\@\c@\cW\c@V\c@\c_\c@E\c@+\c@\\\c@2\c@B\c@M\c@W\c@B\c@7\c@s\c@K\c@L\c@'\c@˜\c@>\c@H\c@\cX\c@ª\c@4\c@9\c@\cL\c@¤\c@1\c@'\c@\cE\c@‹\c@5\c@\cW\c@\cB\c@g\c@<\c@\cO\c@\cK\c@E\c@D\c@\cL\c@\cZ\c@-\c@I\c@\cM\c@,\c@%\c@L\c@\cL\c@>\c@)\c@J\c@\cK\c@L\c@0\c@C\c@\cH\c@N\c@6\c@8\c@\cI\c@E\c@7\c@+\c@\cP\c@4\c@4\c@!\c@\e\c@\$\c@/\c@\c\\c@%\c@\cZ\c@*\c@!\c@-\c@\cY\c@\$\c@-\c@-\c@\"\c@\c\\c@<\c@%\c@2\c@\cU\c@J\c@\cZ\c@F\c@\cM\c@Q\c@\cO\c@Y\c@\cD\c@R\c@\cF\c@i\c@\cI\c@N\c@\cA\c@q\c@\cZ\c@I\c@\c@\c@o\c@,\c@A\c@\c@\c@c\c@6\c@:\c@\c@\c@O\c@:\c@0\c@\c@\c@8\c@4\c@%\c@\c@\c@%\c@'\c@\cY\c@\c@\c@\e\c@\cW\c@\cN\c@\c@\c@\cY\c@\c\\c@\cG\c@\c@\c@\c^\c@:\c@\cE\c@\c@\c@%\c@c\c@\cM\c@\c@\c@)\c@Š\c@\cZ\c@\c@\c@(\c@¨\c@,\c@\c@\c@%\c@«\c@B\c@\cB\c@\c_\c@\c@W\c@\cH\c@\cY\c@h\c@e\c@\cM\c@\cR\c@>\c@k\c@\cR\c@\cM\c@\e\c@d\c@\cT\c@\cH\c@\cF\c@R\c@\cS\c@\cE\c@\c@\c@;\c@\cO\c@\cF\c@\c@\c@%\c@\cN\c@\cJ\c@\c@\c@\cR\c@\cR\c@\cQ\c@\cD\c@\cE\c@\c^\c@\cZ\c@\cT\c@\cB\c@1\c@\"\c@-\c@\cH\c@G\c@)\c@J\c@\cO\c@]\c@-\c@e\c@\cV\c@q\c@,\c@u\c@\c\\c@\c?\c@&\c@p\c@\c^\c@ˆ\c@\c\\c@\\\c@\e\c@ˆ\c@\cS\c@D\c@\cT\c@\c?\c@\cJ\c@9\c@\cL\c@l\c@\cC\c@F\c@\cF\c@Q\c@\c@\c@n\c@\cA\c@7\c@\c@\c@¥\c@\c@\c@\c_\c@\c@\c@Û\c@\c@\c@\cL\c@\cC\c@ý\c@\c@\c@\cA\c@\cJ\cA\cD\c@\c@\c@\cD\c@\cT\c@ð\c@\c@\c@\cM\c@\c^\c@Ë\c@\c@\c@\cY\c@)\c@ \c@\c@\c@&\c@.\c@w\c@\cB\c@5\c@,\c@S\c@\cE\c@>\c@#\c@6\c@\cH\c@A\c@\cY\c@\"\c@\cL\c@<\c@\cN\c@\cS\c@\cP\c@2\c@\cE\c@\cM\c@\cU\c@\$\c@\c@\c@\cW\c@\e\c@\cW\c@\c@\c@,\c@\$\c@\cM\c@\c@\c@C\c@/\c@\cH\c@\c@\c@Z\c@:\c@\cJ\c@\c@\c@j\c@B\c@\cR\c@\c@\c@q\c@D\c@\c]\c@\c@\c@n\c@>\c@)\c@\c@\c@f\c@0\c@4\c@\cC\c@V\c@!\c@<\c@\cI\c@B\c@\cR\c@A\c@\cR\c@/\c@\cG\c@\@\c@\c]\c@\c^\c@\c@\c@<\c@(\c@\cN\c@\cA\c@4\c@.\c@\cB\c@\cE\c@*\c@+\c@\cM\c@\cK\c@ \c@#\c@'\c@\cS\c@\cW\c@\cY\c@G\c@\c]\c@\cS\c@\cN\c@e\c@'\c@\cT\c@\cM\c@€\c@.\c@\e\c@\cZ\c@Œ\c@2\c@\$\c@0\c@†\c@2\c@,\c@H\c@x\c@+\c@0\c@]\c@m\c@\"\c@+\c@i\c@h\c@\cW\c@\"\c@e\c@j\c@\cN\c@\cW\c@X\c@o\c@\cF\c@\cL\c@E\c@n\c@\cA\c@\cC\c@4\c@b\c@\c@\c@\c@\c@(\c@O\c@\c@\c@\cD\c@\"\c@:\c@\cA\c@\cL\c@ \c@+\c@\cA\c@\cV\c@!\c@(\c@\cA\c@\c^\c@ \c@3\c@\cA\c@'\c@\c]\c@M\c@\c@\c@*\c@\cY\c@p\c@\c@\c@(\c@\cS\c@™\c@\c@\c@%\c@\cM\c@½\c@\c@\c@#\c@\cG\c@Ó\c@\c@\c@\$\c@\cF\c@Ô\c@\cC\c@(\c@\cF\c@¾\c@\cH\c@-\c@\cI\c@˜\c@\cO\c@1\c@\cQ\c@o\c@\cU\c@0\c@!\c@L\c@\cY\c@*\c@6\c@9\c@\cY\c@ \c@Q\c@1\c@\cT\c@\cV\c@n\c@/\c@\cO\c@\cL\c@ˆ\c@)\c@\cI\c@\cE\c@™\c@#\c@\cF\c@\cA\c@\c@\cW\c@\cE\c@\c@\c@“\c@\cI\c@\cH\c@\c@\c@}\c@\cD\c@\cM\c@\c@\c@^\c@\cS\c@\cU\c@\c@\c@>\c@)\c@!\c@\c@\c@%\c@E\c@2\c@\c@\c@\cQ\c@b\c@E\c@\c@\c@\cE\c@z\c@X\c@\cA\c@\c@\c@€\c@f\c@\cC\c@\c@\c@s\c@l\c@\cE\c@\c@\c@X\c@h\c@\cF\c@\cA\c@<\c@\\\c@\cG\c@\cC\c@ \c@K\c@\cF\c@\cD\c@\cJ\c@9\c@\cE\c@\cE\c@\cF\c@*\c@\cB\c@\cE\c@\cX\c@ \c@\c@\c@\cD\c@.\c@\e\c@\c@\c@\cC\c@A\c@\c^\c@\cA\c@\cB\c@O\c@&\c@\cD\c@\c@\c@R\c@2\c@\cI\c@\c@\c@F\c@=\c@\cO\c@\c@\c@6\c@F\c@\cS\c@\c@\c@-\c@J\c@\cV\c@\c@\c@7\c@G\c@\cU\c@\c@\c@R\c@\@\c@\cR\c@\c@\c@x\c@3\c@\cO\c@\c@\c@ž\c@%\c@\cM\c@\c@\c@½\c@\cX\c@\cK\c@\c@\c@Ñ\c@\cM\c@\cJ\c@\c@\c@Ü\c@\cE\c@\cH\c@\cA\c@ä\c@\cA\c@\cG\c@\cI\c@ê\c@\c@\c@\cI\c@\cS\c@ï\c@\cB\c@\cQ\c@ \c@ï\c@\cF\c@\c^\c@-\c@ç\c@\cJ\c@0\c@:\c@Ð\c@\cL\c@B\c@B\c@®\c@\cL\c@M\c@G\c@‚\c@\cK\c@O\c@H\c@W\c@\cH\c@F\c@H\c@3\c@\cD\c@:\c@F\c@\cW\c@\c@\c@1\c@\@\c@\cF\c@\cE\c@4\c@7\c@\c@\c@\cP\c@F\c@)\c@\c@\c@\c^\c@d\c@\c\\c@\c@\c@-\c@‡\c@\cP\c@\c@\c@>\c@¥\c@\cF\c@\c@\c@I\c@·\c@\c@\c@\c@\c@N\c@¸\c@\c@\c@\c@\c@K\c@¬\c@\c@\c@\c@\c@B\c@—\c@\c@\c@\c@\c@4\c@\c@\c@\c@\cB\c@\$\c@m\c@\c@\c@\cI\c@\cW\c@a\c@\c@\c@\cU\c@\cL\c@\\\c@\c@\c@\$\c@\cC\c@a\c@\c@\c@5\c@\c@\c@o\c@\c@\c@F\c@\c@\c@†\c@\c@\c@O\c@\c@\c@£\c@\c@\c@Q\c@\c@\c@Á\c@\c@\c@L\c@\c@\c@Ù\c@\c@\c@\@\c@\cA\c@ç\c@\c@\c@2\c@\cB\c@æ\c@\c@\c@\$\c@\cD\c@×\c@\c@\c@\cX\c@\cE\c@½\c@\c@\c@\cP\c@\cE\c@\c@\cB\c@\cK\c@\cD\c@|\c@\cE\c@\cI\c@\cC\c@^\c@\cK\c@\cH\c@\cD\c@G\c@\cR\c@\cH\c@\cG\c@:\c@\cX\c@\cF\c@\cO\c@9\c@\c^\c@\cE\c@\cX\c@?\c@!\c@\cD\c@\$\c@J\c@!\c@\cB\c@1\c@T\c@\c^\c@\cA\c@\@\c@X\c@\cY\c@\cG\c@N\c@U\c@\cR\c@\cO\c@Y\c@K\c@\cL\c@\cW\c@_\c@\@\c@\cG\c@\c\\c@[\c@6\c@\cC\c@\c\\c@K\c@.\c@\c@\c@\cX\c@7\c@*\c@\cA\c@\cQ\c@#\c@&\c@\cL\c@\cI\c@\cP\c@!\c@\c]\c@\cD\c@\cJ\c@\c\\c@0\c@\cH\c@\cU\c@\cV\c@B\c@\cO\c@%\c@\cQ\c@S\c@\cQ\c@3\c@\cM\c@[\c@\cQ\c@?\c@\cK\c@[\c@\cP\c@A\c@\cJ\c@W\c@\cL\c@:\c@\cG\c@R\c@\cD\c@-\c@\cF\c@L\c@\cL\c@ \c@\cD\c@D\c@)\c@\cU\c@\cA\c@9\c@M\c@\cQ\c@\cC\c@*\c@o\c@\cN\c@\cQ\c@\c\\c@Š\c@\cM\c@+\c@\cO\c@‘\c@\cJ\c@N\c@\cE\c@ƒ\c@\cH\c@x\c@\c@\c@h\c@\cE\c@¥\c@\c@\c@K\c@\cB\c@É\c@\c@\c@5\c@\c@\c@à\c@\c@\c@&\c@\c@\c@ê\c@\c@\c@\c\\c@\c@\c@è\c@\c@\c@\cW\c@\c@\c@Ý\c@\c@\c@\cP\c@\c@\c@Í\c@\cA\c@\cI\c@\c@\c@¸\c@\cD\c@\cQ\c@\c@\c@ \c@\cJ\c@%\c@\c@\c@†\c@\cN\c@4\c@\c@\c@o\c@\cS\c@:\c@\c@\c@\\\c@\cT\c@;\c@\c@\c@R\c@\cS\c@3\c@\c@\c@R\c@\cN\c@*\c@\c@\c@Y\c@\cI\c@.\c@\cA\c@f\c@\cD\c@B\c@\cB\c@r\c@\cA\c@d\c@\cD\c@{\c@\c@\c@\c@\cD\c@|\c@\c@\c@º\c@\cD\c@u\c@\c@\c@é\c@\cD\c@e\c@\c@\cA\cX\c@\cB\c@P\c@\c@\cA?\c@\cA\c@=\c@\c@\cAR\c@\c@\c@/\c@\c@\cAE\c@\cF\c@+\c@\cA\cA\cR\c@\cR\c@1\c@\cD\c@Ë\c@#\c@>\c@\cF\c@\c@5\c@M\c@\cG\c@D\c@F\c@Y\c@\cG\c@*\c@N\c@\\\c@\cF\c@2\c@J\c@U\c@\cD\c@I\c@=\c@F\c@\cB\c@^\c@+\c@1\c@\c@\c@r\c@\cZ\c@\c_\c@\c@\c@\c?\c@\cM\c@\cP\c@\c@\c@Š\c@\cE\c@\cL\c@\c@\c@—\c@\cC\c@\cU\c@\c@\c@¡\c@\cC\c@*\c@\cA\c@Ÿ\c@\cC\c@D\c@\cD\c@Œ\c@\cD\c@`\c@\cG\c@l\c@\cE\c@u\c@\cI\c@H\c@\cG\c@€\c@\cI\c@%\c@\cI\c@€\c@\cH\c@\cJ\c@\cJ\c@x\c@\cF\c@\c@\c@\cI\c@l\c@\cC\c@\c@\c@\cH\c@a\c@\c@\c@\c@\c@\cE\c@X\c@\c@\c@\c@\c@\cB\c@R\c@\cF\c@\c@\c@\cC\c@L\c@\cR\c@\cA\c@\cO\c@E\c@ \c@\cJ\c@!\c@<\c@-\c@\cY\c@4\c@2\c@8\c@0\c@G\c@&\c@9\c@K\c@U\c@\e\c@0\c@f\c@Z\c@\cQ\c@\"\c@w\c@X\c@\cJ\c@\cT\c@w\c@S\c@\cE\c@\cM\c@g\c@O\c@\cA\c@\cM\c@M\c@M\c@\c@\c@\cT\c@1\c@J\c@\c@\c@\c]\c@\cX\c@F\c@\cA\c@'\c@\cF\c@<\c@\cB\c@-\c@\cA\c@1\c@\cB\c@/\c@\cE\c@%\c@\cB\c@.\c@\cK\c@\c]\c@\cB\c@*\c@\cV\c@\cY\c@\cC\c@'\c@#\c@\cY\c@\cC\c@%\c@2\c@\cX\c@\cE\c@&\c@<\c@\cW\c@\cD\c@+\c@>\c@\cT\c@\cE\c@4\c@4\c@\cO\c@\cC\c@>\c@)\c@\cJ\c@\cB\c@G\c@\cZ\c@\cF\c@\cC\c@I\c@\cK\c@\cD\c@\cH\c@D\c@\cA\c@\cB\c@\cK\c@9\c@\c@\c@\cA\c@\cK\c@(\c@\cR\c@\cA\c@\cK\c@\cY\c@4\c@\cD\c@\cJ\c@\cK\c@`\c@\cG\c@\cE\c@\cC\c@‘\c@\cI\c@\cD\c@\c@\c@Ä\c@\cI\c@\cI\c@\c@\c@å\c@\cH\c@\cP\c@\c@\c@î\c@\cF\c@\cW\c@\c@\c@å\c@\cE\c@\c]\c@\c@\c@Ñ\c@\cG\c@!\c@\c@\c@¼\c@\cM\c@\"\c@\c@\c@«\c@\cT\c@ \c@\c@\c@Ÿ\c@\cZ\c@\c]\c@\c@\c@–\c@\c]\c@\cY\c@\c@\c@‹\c@\e\c@\cS\c@\c@\c@{\c@\cX\c@\cN\c@\c@\c@g\c@\cU\c@\cI\c@\cA\c@Q\c@\cU\c@\cC\c@\cB\c@>\c@\cX\c@\c@\c@\cC\c@2\c@\c\\c@\cC\c@\cD\c@1\c@\c^\c@\cH\c@\cF\c@7\c@\e\c@\cM\c@\cG\c@D\c@\cU\c@\cS\c@\cI\c@S\c@\cN\c@\e\c@\cM\c@`\c@\cF\c@!\c@\cP\c@g\c@\cA\c@'\c@\cR\c@h\c@\c@\c@1\c@\cR\c@a\c@\c@\c@<\c@\cR\c@R\c@\c@\c@G\c@\cQ\c@?\c@\cC\c@M\c@\cR\c@+\c@\cH\c@J\c@\cS\c@\c]\c@\cO\c@\@\c@\cU\c@\c\\c@\cW\c@0\c@\cT\c@)\c@ \c@ \c@\cQ\c@?\c@%\c@\cX\c@\cL\c@X\c@&\c@\cY\c@\cG\c@j\c@\$\c@\$\c@\cC\c@l\c@ \c@4\c@\c@\c@_\c@\c]\c@A\c@\c@\c@F\c@\c\\c@I\c@\c@\c@-\c@\c^\c@I\c@\c@\c@\cX\c@#\c@C\c@\cD\c@\cT\c@+\c@:\c@\cK\c@\$\c@5\c@2\c@\cQ\c@L\c@\@\c@,\c@\cV\c@ƒ\c@L\c@+\c@\cX\c@Á\c@V\c@,\c@\cU\c@ö\c@[\c@/\c@\cP\cA\cP\c@W\c@1\c@\cI\cA\cC\c@H\c@1\c@\cF\c@Ò\c@5\c@-\c@\cK\c@—\c@\"\c@&\c@\cU\c@Z\c@\cP\c@\c]\c@!\c@&\c@\cD\c@\cV\c@.\c@\cF\c@\cG\c@\cQ\c@:\c@\cH\c@\cQ\c@\cQ\c@\@\c@\c\\c@\cY\c@\cS\c@A\c@2\c@\c^\c@\cV\c@>\c@E\c@ \c@\cU\c@8\c@Y\c@\c\\c@\cR\c@0\c@f\c@\cT\c@\cM\c@&\c@m\c@\cJ\c@\cG\c@\c\\c@x\c@\cG\c@\cB\c@\cS\c@‹\c@\cJ\c@\c@\c@\cK\c@¤\c@\cS\c@\cD\c@\cF\c@¹\c@\c\\c@\cG\c@\cB\c@¾\c@#\c@\cI\c@\cA\c@¬\c@%\c@\cJ\c@\c@\c@…\c@!\c@\cJ\c@\cD\c@Z\c@\cX\c@\cH\c@\cP\c@0\c@\cP\c@\cD\c@#\c@\cP\c@\cH\c@\cA\c@:\c@\c@\c@\cB\c@\c@\c@S\c@\c@\c@\cC\c@\c@\c@g\c@\cB\c@\cJ\c@\c@\c@q\c@\cQ\c@\cS\c@\c@\c@p\c@+\c@\c\\c@\c@\c@f\c@K\c@\$\c@\c@\c@V\c@l\c@)\c@\c@\c@E\c@ˆ\c@'\c@\c@\c@5\c@’\c@!\c@\c@\c@%\c@ˆ\c@\cZ\c@\c@\c@\cW\c@p\c@\cS\c@\c@\c@\cN\c@S\c@\cN\c@\c@\c@\cF\c@=\c@\cJ\c@\c@\c@\cA\c@5\c@\cG\c@\cB\c@\c@\c@;\c@\cF\c@\cE\c@\cA\c@J\c@\cE\c@\cI\c@\cD\c@[\c@\cE\c@\cN\c@\cF\c@h\c@\cF\c@\cS\c@\cI\c@j\c@\cG\c@\cU\c@\cO\c@h\c@\cH\c@\cU\c@\cU\c@e\c@\cL\c@\cS\c@\e\c@j\c@\cT\c@\cN\c@\c_\c@y\c@\c_\c@\cI\c@ \c@’\c@.\c@\cE\c@\c\\c@­\c@<\c@\cB\c@\cV\c@Á\c@E\c@\cB\c@\cN\c@Æ\c@F\c@\cB\c@\cG\c@¹\c@<\c@\cD\c@\cA\c@\c@-\c@\cG\c@\cB\c@y\c@\c]\c@\cL\c@\cM\c@T\c@\cN\c@\cS\c@\c]\c@4\c@\cD\c@\cY\c@/\c@\c\\c@\c@\c@ \c@C\c@\cN\c@\c@\c@\$\c@U\c@\cN\c@\cA\c@'\c@[\c@\cZ\c@\cE\c@'\c@X\c@4\c@\cK\c@'\c@I\c@S\c@\cQ\c@'\c@6\c@q\c@\cW\c@&\c@#\c@‚\c@\c\\c@&\c@\cS\c@\c@\c^\c@&\c@\cH\c@u\c@\c]\c@&\c@\cF\c@f\c@\e\c@'\c@\cI\c@`\c@\cY\c@(\c@\cO\c@m\c@\cV\c@)\c@\cT\c@Œ\c@\cT\c@'\c@\cW\c@³\c@\cP\c@\"\c@\cT\c@Ö\c@\cN\c@\cZ\c@\cO\c@é\c@\cL\c@\cR\c@\cI\c@é\c@\cM\c@\cM\c@\cD\c@×\c@\cQ\c@\cO\c@\c@\c@º\c@\cY\c@\cU\c@\c@\c@›\c@#\c@ \c@\c@\c@€\c@/\c@)\c@\c@\c@l\c@:\c@-\c@\c@\c@[\c@A\c@+\c@\cA\c@J\c@E\c@\$\c@\cG\c@6\c@E\c@\e\c@\cS\c@&\c@\@\c@\cU\c@ \c@\cV\c@9\c@\cS\c@.\c@\cH\c@1\c@\cT\c@9\c@\cH\c@)\c@\cV\c@;\c@\cT\c@&\c@\cW\c@2\c@\c]\c@'\c@\cS\c@%\c@!\c@,\c@\cN\c@\cW\c@#\c@4\c@\cH\c@\cJ\c@\c_\c@=\c@\cD\c@\cA\c@\cT\c@C\c@\cB\c@\cA\c@\cN\c@D\c@\cB\c@\cD\c@\cM\c@A\c@\cB\c@\cF\c@\cQ\c@;\c@\cB\c@\cG\c@\cS\c@3\c@\cB\c@\cH\c@\cR\c@,\c@\cA\c@\cJ\c@\cP\c@'\c@\cB\c@\cO\c@\cJ\c@\"\c@\cF\c@\cX\c@\cC\c@\c]\c@\cK\c@\$\c@\c@\c@\cX\c@\cO\c@/\c@\c@\c@\cS\c@\cP\c@5\c@\c@\c@\cO\c@\cO\c@2\c@\c@\c@\cO\c@\cL\c@(\c@\c@\c@\cR\c@\cG\c@\e\c@\c@\c@\cX\c@\cB\c@\cN\c@\c@\c@!\c@\cD\c@\cD\c@\c@\c@+\c@\cL\c@\cD\c@\c@\c@4\c@\cU\c@\cI\c@\c@\c@<\c@\c]\c@\cL\c@\c@\c@B\c@#\c@\cL\c@\c@\c@E\c@%\c@\cM\c@\c@\c@F\c@!\c@\cK\c@\c@\c@C\c@\cY\c@\cJ\c@\c@\c@=\c@\cP\c@\cM\c@\cB\c@3\c@\cI\c@\cT\c@\cN\c@'\c@\cD\c@\c^\c@\c]\c@\cZ\c@\cA\c@)\c@,\c@\cR\c@\c@\c@/\c@5\c@\cP\c@\c@\c@3\c@7\c@\cT\c@\cB\c@2\c@/\c@\c\\c@\cD\c@.\c@\"\c@\$\c@\cF\c@'\c@\cR\c@(\c@\cG\c@\c^\c@\cO\c@&\c@\cH\c@\cU\c@ \c@\c_\c@\cI\c@\cN\c@=\c@\cW\c@\cM\c@\cF\c@\\\c@\cR\c@\cR\c@\cA\c@\c?\c@\cS\c@\e\c@\c@\c@š\c@\cW\c@\$\c@\c@\c@©\c@\c]\c@*\c@\c@\c@°\c@\c_\c@)\c@\c@\c@µ\c@\e\c@\"\c@\c@\c@¼\c@\cT\c@\cY\c@\cA\c@Ç\c@\cL\c@\cN\c@\cB\c@×\c@\cF\c@\cF\c@\cD\c@ä\c@\cF\c@\c@\c@\cE\c@ê\c@\cJ\c@\cH\c@\cF\c@å\c@\cN\c@\cU\c@\cF\c@Õ\c@\cQ\c@\$\c@\cF\c@¼\c@\cR\c@4\c@\cI\c@ \c@\cO\c@B\c@\cK\c@ˆ\c@\cK\c@E\c@\cN\c@s\c@\cF\c@?\c@\cR\c@`\c@\cB\c@1\c@\cV\c@K\c@\c@\c@\"\c@\e\c@6\c@\c@\c@\cV\c@ \c@\$\c@\cA\c@\cR\c@(\c@\cR\c@\cE\c@\cV\c@.\c@\cD\c@\cK\c@\c_\c@1\c@\c@\c@\cP\c@)\c@-\c@\c@\c@\cU\c@.\c@\$\c@\cG\c@\cU\c@-\c@\cZ\c@\cS\c@\cR\c@)\c@\cN\c@\"\c@\cM\c@&\c@\cM\c@3\c@\cG\c@*\c@\cW\c@G\c@\cB\c@9\c@)\c@Z\c@\c@\c@Q\c@7\c@m\c@\cA\c@l\c@A\c@\c@\cC\c@†\c@>\c@˜\c@\cD\c@—\c@2\c@¯\c@\cF\c@\c@!\c@Á\c@\cG\c@™\c@\cT\c@Ë\c@\cF\c@\c@\cN\c@Ê\c@\cE\c@\c@\cQ\c@À\c@\cC\c@t\c@\cV\c@²\c@\cB\c@h\c@\cX\c@¤\c@\cC\c@\\\c@\cV\c@–\c@\cF\c@S\c@\cQ\c@‡\c@\cJ\c@J\c@\cJ\c@u\c@\cP\c@F\c@\cC\c@_\c@\cV\c@G\c@\c@\c@J\c@\cY\c@O\c@\c@\c@\@\c@\c\\c@\\\c@\c@\c@C\c@\cZ\c@i\c@\c@\c@S\c@\cV\c@r\c@\c@\c@g\c@\cP\c@o\c@\c@\c@s\c@\cJ\c@`\c@\c@\c@m\c@\cE\c@G\c@\c@\c@X\c@\cB\c@/\c@\c@\c@=\c@\c@\c@\cX\c@\cC\c@ \c@\c@\c@\cH\c@\cI\c@\cI\c@\c@\c@\c@\c@\cR\c@\c@\c@\c@\c@\c@\c@\c\\c@\cB\c@\cA\c@\c@\c@%\c@\cP\c@\cA\c@\c@\c@*\c@#\c@\cA\c@\c@\c@'\c@:\c@\cA\c@\c@\c@ \c@V\c@\c@\c@\c@\c@\cU\c@{\c@\c@\c@\c@\c@\cL\c@¢\c@\cB\c@\c@\c@\cF\c@Ì\c@\cF\c@\c@\c@\cE\c@ö\c@\cK\c@\c@\c@\cG\cA\cV\c@\cN\c@\cB\c@\cJ\cA#\c@\cP\c@\cH\c@\cN\cA\cY\c@\cN\c@\cO\c@\cR\c@ù\c@\cL\c@\cV\c@\cY\c@Î\c@\cJ\c@\c\\c@ \c@§\c@\cJ\c@\c^\c@)\c@\c@\cM\c@\e\c@3\c@…\c@\cQ\c@\cV\c@;\c@ˆ\c@\cT\c@\cP\c@?\c@\c@\cS\c@\cL\c@\@\c@\c@\cO\c@\cI\c@?\c@Š\c@\cJ\c@\cH\c@<\c@|\c@\cE\c@\cG\c@9\c@j\c@\cA\c@\cF\c@3\c@X\c@\cC\c@\cD\c@+\c@G\c@\cG\c@\cC\c@\"\c@;\c@\cJ\c@\cA\c@\cX\c@5\c@\cN\c@\c@\c@\cO\c@5\c@\cR\c@\c@\c@\cL\c@8\c@\cW\c@\c@\c@\cO\c@<\c@\c]\c@\c@\c@\cW\c@:\c@(\c@\c@\c@ \c@1\c@5\c@\cA\c@'\c@&\c@B\c@\cE\c@)\c@\c^\c@I\c@\cK\c@&\c@\$\c@I\c@\cP\c@\c]\c@;\c@?\c@\cU\c@\cT\c@a\c@/\c@\cV\c@\cK\c@Œ\c@\c^\c@\cS\c@\cG\c@´\c@\cP\c@\cN\c@\cK\c@Ô\c@\cE\c@\cH\c@\cU\c@í\c@\c@\c@\cC\c@\c^\cA\cH\c@\c@\c@\cA\c@%\cA(\c@\c@\c@\cF\c@%\cAK\c@\cA\c@\cO\c@\c_\cAi\c@\cC\c@\cZ\c@\cV\cAs\c@\cD\c@'\c@\cL\cAb\c@\cD\c@3\c@\cC\cA6\c@\cE\c@8\c@\cC\c@ø\c@\cC\c@6\c@\cK\c@¶\c@\cB\c@-\c@\cS\c@~\c@\c@\c@!\c@\e\c@Y\c@\c@\c@\cT\c@#\c@H\c@\c@\c@\cJ\c@)\c@J\c@\c@\c@\cD\c@-\c@\\\c@\cA\c@\cE\c@2\c@u\c@\cB\c@\cL\c@<\c@\c@\cC\c@\cR\c@J\c@œ\c@\cC\c@\cW\c@Y\c@›\c@\cC\c@\cY\c@h\c@ˆ\c@\cC\c@\cW\c@r\c@i\c@\cA\c@\cQ\c@v\c@H\c@\c@\c@\cL\c@t\c@2\c@\c@\c@\cI\c@p\c@1\c@\c@\c@\cM\c@l\c@G\c@\c@\c@\cU\c@i\c@o\c@\cC\c@\c_\c@g\c@\c@\cJ\c@(\c@c\c@Ã\c@\cQ\c@.\c@X\c@Ô\c@\cX\c@-\c@G\c@È\c@\c]\c@)\c@4\c@ \c@\c]\c@!\c@\"\c@s\c@\cW\c@\cZ\c@\e\c@E\c@\cP\c@\cS\c@\c_\c@\c^\c@\cH\c@\cM\c@/\c@\cD\c@\cC\c@\cH\c@C\c@\c@\c@\c@\c@\cE\c@T\c@\cO\c@\c@\c@\cB\c@Z\c@&\c@\c@\c@\c@\c@U\c@D\c@\c@\c@\c@\c@G\c@e\c@\c@\c@\c@\c@7\c@†\c@\c@\c@\cF\c@+\c@”\c@\cD\c@\cP\c@#\c@\c@\cJ\c@\e\c@ \c@s\c@\cR\c@&\c@\c_\c@R\c@\cY\c@.\c@\c^\c@2\c@\c^\c@/\c@\c^\c@\cV\c@\c_\c@'\c@!\c@\cK\c@\e\c@\c\\c@'\c@\cR\c@\cV\c@\cP\c@1\c@ \c@\cR\c@\cF\c@=\c@0\c@\cR\c@\c@\c@F\c@E\c@\cU\c@\c@\c@G\c@X\c@\cY\c@\c@\c@B\c@f\c@\c\\c@\c@\c@7\c@p\c@\c\\c@\c@\c@*\c@p\c@\cY\c@\cB\c@\c^\c@g\c@\cS\c@\cH\c@\cU\c@T\c@\cL\c@\cS\c@\cM\c@<\c@\cG\c@\"\c@\cI\c@%\c@\cD\c@7\c@\cF\c@\cQ\c@\cB\c@M\c@\cB\c@\cD\c@\cA\c@a\c@\cD\c@\c@\c@\cA\c@n\c@\cN\c@\c@\c@\c@\c@q\c@\cZ\c@\c@\c@\c@\c@k\c@%\c@\cB\c@\cB\c@[\c@-\c@\cK\c@\cH\c@F\c@-\c@\cW\c@\cP\c@2\c@%\c@\$\c@\cW\c@\"\c@\cY\c@-\c@\c_\c@\cZ\c@\cN\c@.\c@\$\c@\cV\c@\cD\c@'\c@'\c@\cU\c@\c@\c@\c]\c@+\c@\cS\c@\c@\c@\cP\c@2\c@\cO\c@\c@\c@\cD\c@=\c@\cJ\c@\c@\c@\c@\c@L\c@\cH\c@\c@\c@\cL\c@Y\c@\cI\c@\c@\c@!\c@b\c@\cM\c@\c@\c@:\c@e\c@\cQ\c@\c@\c@P\c@e\c@\cS\c@\c@\c@c\c@c\c@\cQ\c@\c@\c@d\c@a\c@\cN\c@\c@\c@W\c@_\c@\cH\c@\c@\c@E\c@[\c@\cC\c@\c@\c@<\c@Q\c@\c@\c@\c@\c@F\c@A\c@\c@\c@\cC\c@d\c@.\c@\c@\c@\cI\c@’\c@\c^\c@\c@\c@\cQ\c@½\c@\cU\c@\c@\c@\cW\c@Ö\c@\cW\c@\c@\c@\e\c@Ò\c@\"\c@\c@\c@\cX\c@¯\c@2\c@\cC\c@\cS\c@\c?\c@?\c@\cI\c@\cL\c@M\c@H\c@\cS\c@\cE\c@#\c@I\c@\c^\c@\c@\c@\cG\c@C\c@*\c@\cF\c@\c@\c@8\c@0\c@\cQ\c@\c@\c@+\c@0\c@\c_\c@\c@\c@\c^\c@(\c@.\c@\cM\c@\cS\c@\c]\c@?\c@%\c@\cJ\c@\cR\c@H\c@B\c@\cD\c@\cH\c@I\c@\\\c@\c@\c@\cA\c@E\c@p\c@\c@\c@\c@\c@>\c@n\c@\cE\c@\cE\c@7\c@Z\c@\cL\c@\cN\c@4\c@\@\c@\cT\c@\cX\c@7\c@#\c@\c\\c@!\c@=\c@\cK\c@\"\c@(\c@F\c@\c@\c@#\c@'\c@N\c@\c@\c@ \c@\c_\c@S\c@\cF\c@\cZ\c@\cU\c@R\c@\cQ\c@\cW\c@\cK\c@J\c@ \c@\cW\c@\cC\c@;\c@.\c@\cZ\c@\c@\c@)\c@>\c@\c_\c@\c@\c@\cZ\c@H\c@#\c@\cB\c@\cM\c@N\c@\$\c@\cI\c@\cD\c@V\c@ \c@\cR\c@\cA\c@f\c@\cZ\c@\c\\c@\cB\c@‚\c@\cV\c@\$\c@\cB\c@¬\c@\cV\c@'\c@\cB\c@Ú\c@\c]\c@\$\c@\cB\cA\c@\c@'\c@\c\\c@\cB\cA\cQ\c@0\c@\cR\c@\cC\cA\cF\c@6\c@\cI\c@\cD\c@Þ\c@3\c@\cB\c@\cF\c@£\c@*\c@\c@\c@\cG\c@i\c@\c^\c@\c@\c@\cG\c@:\c@\cS\c@\c@\c@\cE\c@&\c@\cO\c@\c@\c@\cC\c@-\c@\cQ\c@\c@\c@\cA\c@H\c@\cW\c@\cC\c@\c@\c@f\c@\c^\c@\cF\c@\c@\c@ƒ\c@ \c@\cJ\c@\cB\c@—\c@\c^\c@\cL\c@\cD\c@£\c@\cW\c@\cL\c@\cH\c@ª\c@\cO\c@\cK\c@\cI\c@±\c@\cG\c@\cJ\c@\cK\c@µ\c@\cD\c@\cM\c@\cI\c@±\c@\cD\c@\cU\c@\cH\c@Ÿ\c@\cF\c@!\c@\cF\c@€\c@\cF\c@/\c@\cF\c@[\c@\cF\c@;\c@\cG\c@8\c@\cD\c@E\c@\cL\c@*\c@\cB\c@M\c@\cQ\c@?\c@\c@\c@T\c@\cU\c@v\c@\cB\c@^\c@\cW\c@Á\c@\cG\c@j\c@\cU\cA\cQ\c@\cL\c@x\c@\cQ\cAM\c@\cP\c@†\c@\cL\cAb\c@\cS\c@\c@\cG\cAK\c@\cS\c@’\c@\cB\cA\cQ\c@\cP\c@Ž\c@\c@\c@Ê\c@\cM\c@„\c@\c@\c@Ž\c@\cK\c@u\c@\cA\c@o\c@\cJ\c@e\c@\cD\c@q\c@\cL\c@V\c@\cG\c@\c@\cN\c@K\c@\cI\c@°\c@\cO\c@B\c@\cJ\c@É\c@\cO\c@:\c@\cI\c@Í\c@\cL\c@1\c@\cG\c@»\c@\cI\c@\$\c@\cC\c@œ\c@\cG\c@\cY\c@\cA\c@z\c@\cF\c@\cO\c@\c@\c@]\c@\cG\c@\cF\c@\c@\c@I\c@\cI\c@\c@\c@\cA\c@<\c@\cK\c@\c@\c@\cC\c@5\c@\cK\c@\cC\c@\cD\c@5\c@\cH\c@\cG\c@\cH\c@;\c@\cF\c@\cL\c@\cK\c@H\c@\cC\c@\cS\c@\cM\c@Z\c@\cC\c@\e\c@\cN\c@j\c@\cG\c@!\c@\cN\c@q\c@\cM\c@%\c@\cJ\c@h\c@\cU\c@&\c@\cG\c@Q\c@\c]\c@%\c@\cE\c@8\c@#\c@!\c@\cE\c@\c_\c@'\c@\c\\c@\cI\c@\cJ\c@)\c@\cV\c@\cQ\c@\c@\c@*\c@\cT\c@\e\c@\cB\c@,\c@\cX\c@\$\c@\cK\c@1\c@!\c@*\c@\cX\c@7\c@/\c@-\c@'\c@>\c@?\c@(\c@5\c@C\c@L\c@\c^\c@=\c@A\c@R\c@\cT\c@;\c@9\c@O\c@\cK\c@0\c@,\c@F\c@\cD\c@\"\c@\c]\c@<\c@\c@\c@\cS\c@\cP\c@7\c@\cB\c@\cG\c@\cF\c@8\c@\cK\c@\cA\c@\c@\c@A\c@\cW\c@\c@\c@\c@\c@M\c@%\c@\c@\c@\c@\c@Y\c@2\c@\c@\c@\c@\c@`\c@;\c@\c@\c@\c@\c@c\c@<\c@\c@\c@\c@\c@c\c@6\c@\c@\c@\cC\c@d\c@,\c@\cB\c@\cH\c@e\c@\"\c@\cP\c@\cM\c@f\c@\cX\c@'\c@\cP\c@d\c@\cR\c@F\c@\cR\c@Z\c@\cN\c@h\c@\cR\c@H\c@\cL\c@Ž\c@\cP\c@3\c@\cN\c@«\c@\cP\c@ \c@\cR\c@¾\c@\cR\c@\cO\c@\cX\c@È\c@\cX\c@\cF\c@\c]\c@É\c@\c^\c@\cG\c@ \c@Â\c@\"\c@\cJ\c@\c\\c@²\c@ \c@\cK\c@\cW\c@™\c@\cZ\c@\cK\c@\cO\c@y\c@\cR\c@\cJ\c@\cG\c@W\c@\cJ\c@\cF\c@\cA\c@9\c@\cC\c@\cB\c@\c@\c@\$\c@\c@\c@\cF\c@\cE\c@\cY\c@\cA\c@\cQ\c@\cP\c@\cX\c@\cC\c@\c_\c@\c_\c@\cY\c@\cD\c@)\c@.\c@\cY\c@\cG\c@1\c@>\c@\cU\c@\cI\c@/\c@K\c@\cP\c@\cJ\c@&\c@Q\c@\cI\c@\cJ\c@\cZ\c@T\c@\cC\c@\cH\c@\cM\c@V\c@\c@\c@\cF\c@\cC\c@W\c@\c@\c@\cD\c@\c@\c@W\c@\c@\c@\cB\c@\cA\c@T\c@\cD\c@\c@\c@\cG\c@L\c@\cH\c@\c@\c@\cR\c@A\c@\cJ\c@\c@\c@\"\c@7\c@\cI\c@\c@\c@6\c@2\c@\cJ\c@\c@\c@K\c@5\c@\cH\c@\c@\c@Z\c@>\c@\cC\c@\c@\c@b\c@G\c@\cQ\c@\cC\c@c\c@K\c@6\c@\cJ\c@`\c@D\c@f\c@\cS\c@`\c@5\c@•\c@\e\c@i\c@\$\c@¼\c@#\c@|\c@\cS\c@Ç\c@%\c@–\c@\cE\c@¯\c@\"\c@­\c@\c@\c@ƒ\c@\e\c@¹\c@\c@\c@Q\c@\cR\c@³\c@\c@\c@,\c@\cJ\c@œ\c@\c@\c@\"\c@\cE\c@x\c@\c@\c@2\c@\cD\c@R\c@\cA\c@P\c@\cF\c@2\c@\cE\c@r\c@\cN\c@\c]\c@\cJ\c@\c@\e\c@\cR\c@\cP\c@ \c@.\c@\cQ\c@\cU\c@¥\c@C\c@\cT\c@\cV\c@œ\c@V\c@\cW\c@\cR\c@‡\c@c\c@\cY\c@\cN\c@i\c@g\c@\cX\c@\cH\c@I\c@c\c@\cU\c@\cC\c@-\c@Y\c@\cP\c@\c@\c@\cV\c@L\c@\cK\c@\cD\c@\cF\c@>\c@\cG\c@\cI\c@\cB\c@1\c@\cE\c@\cO\c@\cU\c@&\c@\cF\c@\cR\c@2\c@\e\c@\cL\c@\cS\c@P\c@\cR\c@\cU\c@\cP\c@i\c@\cJ\c@ \c@\cL\c@x\c@\cE\c@+\c@\cF\c@m\c@\cE\c@2\c@\cB\c@U\c@\cI\c@6\c@\cC\c@7\c@\cS\c@6\c@\cF\c@\c_\c@ \c@2\c@\cI\c@\c_\c@2\c@,\c@\cJ\c@<\c@D\c@&\c@\cJ\c@c\c@Q\c@\"\c@\cI\c@Š\c@V\c@#\c@\cF\c@©\c@R\c@)\c@\cB\c@²\c@D\c@2\c@\c@\c@¤\c@0\c@:\c@\cB\c@…\c@\c^\c@\@\c@\cJ\c@]\c@\cO\c@B\c@\cW\c@9\c@\cI\c@\@\c@%\c@\c^\c@\cL\c@<\c@3\c@\cL\c@\cV\c@7\c@>\c@\cB\c@#\c@4\c@?\c@\c@\c@2\c@0\c@6\c@\c@\c@?\c@*\c@(\c@\c@\c@G\c@ \c@\cZ\c@\c@\c@I\c@\cV\c@\cM\c@\c@\c@D\c@\cM\c@\cD\c@\cB\c@8\c@\cE\c@\c@\c@\cG\c@)\c@\c@\c@\c@\c@\cN\c@\cZ\c@\cA\c@\cF\c@\cU\c@\cN\c@\cE\c@\cQ\c@\c_\c@\cF\c@\cJ\c@\c\\c@*\c@\cG\c@\cP\c@&\c@9\c@\cQ\c@\cU\c@-\c@Q\c@\e\c@\cZ\c@*\c@q\c@&\c@\c\\c@!\c@š\c@-\c@\c]\c@\cV\c@Ç\c@/\c@\c\\c@\cK\c@ñ\c@*\c@\cZ\c@\cC\cA\cN\c@ \c@\cV\c@\c@\cA\cX\c@\cU\c@\cQ\c@\c@\cA\cL\c@\cL\c@\cK\c@\cA\c@í\c@\cF\c@\cF\c@\cC\c@Ä\c@\cF\c@\cB\c@\cE\c@\c@\cK\c@\c@\c@\cG\c@„\c@\cV\c@\c@\c@\cH\c@€\c@#\c@\c@\c@\cG\c@\c@1\c@\c@\c@\cE\c@­\c@<\c@\c@\c@\cC\c@Ê\c@\@\c@\c@\c@\cA\c@Ü\c@=\c@\c@\c@\c@\c@Þ\c@5\c@\c@\c@\c@\c@Õ\c@)\c@\c@\c@\c@\c@Ê\c@\c^\c@\cA\c@\c@\c@Ê\c@\cW\c@\cC\c@\c@\c@Ý\c@\cR\c@\cE\c@\c@\c@ÿ\c@\cQ\c@\cF\c@\cD\cA&\c@\cP\c@\cG\c@\cJ\cAE\c@\cN\c@\cF\c@\cS\cAP\c@\cK\c@\cE\c@\c\\cAG\c@\cH\c@\cC\c@&\cA,\c@\cD\c@\cA\c@,\cA\cJ\c@\cA\c@\c@\c@.\c@ç\c@\c@\c@\c@\c@-\c@Ç\c@\c@\c@\c@\c@+\c@¨\c@\c@\c@\cD\c@*\c@ˆ\c@\cD\c@\cL\c@-\c@e\c@\cI\c@\cV\c@5\c@D\c@\cO\c@\c_\c@C\c@)\c@\cS\c@'\c@S\c@\e\c@\cU\c@(\c@d\c@\cX\c@\cR\c@#\c@u\c@\c\\c@\cM\c@\cZ\c@‚\c@ \c@\cH\c@\cO\c@‹\c@\c_\c@\cC\c@\cG\c@‹\c@\cZ\c@\c@\c@\cA\c@‚\c@\cQ\c@\c@\c@\c@\c@q\c@\cH\c@\c@\c@\c@\c@X\c@\cA\c@\c@\c@\c@\c@;\c@\c@\c@\c@\c@\c@\c@\$\c@\c@\c@\cB\c@\c@\c@\cQ\c@\c@\c@\cK\c@\c@\c@\cG\c@\c@\c@\c\\c@\cA\c@\cF\c@\c@\c@5\c@\cD\c@\cI\c@\c@\c@T\c@\cI\c@\cJ\c@\c@\c@u\c@\cO\c@\cJ\c@\cB\c@’\c@\cT\c@\cI\c@\cI\c@£\c@\cX\c@\cF\c@\cQ\c@¥\c@\cY\c@\cB\c@\cZ\c@™\c@\cX\c@\c@\c@#\c@€\c@\cV\c@\c@\c@+\c@^\c@\cS\c@\cF\c@1\c@=\c@\cR\c@\cR\c@9\c@\"\c@\cR\c@\"\c@G\c@\cO\c@\cR\c@5\c@Z\c@\cC\c@\cT\c@I\c@q\c@\cA\c@\cW\c@X\c@Š\c@\cE\c@\c\\c@`\c@œ\c@\cJ\c@#\c@a\c@¥\c@\cM\c@+\c@]\c@¡\c@\cO\c@2\c@Y\c@“\c@\cN\c@4\c@U\c@~\c@\cK\c@1\c@T\c@e\c@\cF\c@(\c@Q\c@L\c@\cB\c@\c]\c@L\c@4\c@\c@\c@\cQ\c@B\c@!\c@\cB\c@\cH\c@4\c@\cS\c@\cF\c@\cF\c@\$\c@\cH\c@\cK\c@\cQ\c@\cU\c@\cA\c@\cN\c@!\c@\cJ\c@\c@\c@\cO\c@0\c@\cC\c@\c@\c@\cN\c@<\c@\cB\c@\cE\c@\cK\c@>\c@\cC\c@\cX\c@\cF\c@3\c@\cD\c@6\c@\cB\c@&\c@\cD\c@[\c@\cB\c@\cU\c@\cD\c@€\c@\cE\c@\cG\c@\cC\c@Ÿ\c@\cI\c@\cD\c@\cE\c@ª\c@\cL\c@\cJ\c@\cJ\c@¡\c@\cN\c@\cN\c@\cU\c@Š\c@\cO\c@\cM\c@ \c@p\c@\cO\c@\cN\c@,\c@]\c@\cO\c@\cL\c@2\c@X\c@\cO\c@\cG\c@2\c@`\c@\cO\c@\cA\c@+\c@o\c@\cM\c@\cG\c@#\c@|\c@\cK\c@\cU\c@\c\\c@€\c@\cH\c@(\c@\cY\c@y\c@\cD\c@>\c@\cX\c@k\c@\cC\c@Y\c@\cY\c@]\c@\cK\c@o\c@\cY\c@Y\c@\cZ\c@}\c@\cU\c@c\c@,\c@ƒ\c@\cO\c@|\c@=\c@ƒ\c@\cI\c@ž\c@J\c@|\c@\cD\c@¿\c@J\c@q\c@\c@\c@Ö\c@\@\c@c\c@\c@\c@Ú\c@/\c@U\c@\c@\c@É\c@\c_\c@F\c@\c@\c@§\c@\cT\c@8\c@\c@\c@~\c@\cS\c@-\c@\cA\c@[\c@\cW\c@\"\c@\cE\c@I\c@\c^\c@\cZ\c@\cL\c@M\c@!\c@\cT\c@\cV\c@b\c@\c^\c@\cP\c@#\c@‚\c@\cW\c@\cL\c@.\c@ \c@\cO\c@\cJ\c@5\c@¯\c@\cG\c@\cK\c@5\c@¨\c@\cA\c@\cQ\c@,\c@Ž\c@\c@\c@\e\c@!\c@f\c@\c@\c@*\c@\cT\c@A\c@\c@\c@9\c@\cI\c@!\c@\c@\c@G\c@\cB\c@\cJ\c@\c@\c@M\c@\cD\c@\c@\c@\c@\c@L\c@\cH\c@\cB\c@\c@\c@B\c@\cL\c@\cL\c@\c@\c@3\c@\cO\c@\e\c@\cC\c@\$\c@\cS\c@,\c@\cJ\c@\cY\c@\cQ\c@>\c@\cU\c@\cT\c@\cL\c@Q\c@\"\c@\cU\c@\cH\c@a\c@/\c@\cZ\c@\cE\c@l\c@8\c@\c^\c@\cA\c@t\c@9\c@\c_\c@\c@\c@x\c@2\c@\cZ\c@\c@\c@x\c@%\c@\cT\c@\c@\c@s\c@\cX\c@\cL\c@\c@\c@k\c@\cL\c@\cE\c@\c@\c@b\c@\cD\c@\cA\c@\c@\c@Z\c@\c@\c@\c@\c@\cA\c@Q\c@\c@\c@\cC\c@\cD\c@F\c@\c@\c@\cH\c@\cI\c@7\c@\c@\c@\cN\c@\cN\c@(\c@\c@\c@\cR\c@\cT\c@\cY\c@\c@\c@\cW\c@\e\c@\cQ\c@\c@\c@\cZ\c@\c_\c@\cV\c@\cA\c@\c\\c@#\c@(\c@\cB\c@ \c@&\c@>\c@\cB\c@'\c@)\c@O\c@\cB\c@-\c@,\c@Q\c@\cA\c@3\c@0\c@F\c@\c@\c@5\c@4\c@5\c@\c@\c@6\c@9\c@\c_\c@\c@\c@7\c@<\c@\cJ\c@\cA\c@<\c@=\c@\cV\c@\cF\c@E\c@;\c@?\c@\cM\c@R\c@4\c@r\c@\cT\c@\\\c@)\c@¦\c@\e\c@a\c@\c]\c@Ø\c@\c^\c@^\c@\cQ\c@í\c@\e\c@U\c@\cH\c@Ý\c@\cU\c@H\c@\cB\c@¯\c@\cN\c@;\c@\c@\c@y\c@\cF\c@1\c@\cC\c@F\c@\cA\c@*\c@\cI\c@\c^\c@\cB\c@&\c@\cP\c@\cE\c@\cJ\c@#\c@\cU\c@\cD\c@\cW\c@\"\c@\cY\c@\cV\c@\$\c@\"\c@\cV\c@/\c@1\c@\$\c@\cR\c@I\c@:\c@%\c@\cL\c@a\c@9\c@\$\c@\cE\c@r\c@/\c@\c]\c@\c@\c@s\c@\"\c@\cV\c@\c@\c@h\c@\cT\c@\cN\c@\cD\c@[\c@\cI\c@\cF\c@\cM\c@R\c@\cF\c@\c@\c@\e\c@P\c@\cI\c@\cH\c@.\c@T\c@\cN\c@\cW\c@F\c@W\c@\cR\c@)\c@^\c@T\c@\cU\c@;\c@u\c@H\c@\cS\c@K\c@‡\c@5\c@\cO\c@P\c@•\c@\"\c@\cI\c@I\c@œ\c@\cQ\c@\cD\c@7\c@š\c@\cE\c@\cA\c@%\c@‘\c@\c@\c@\c@\c@\cT\c@€\c@\c@\c@\c@\c@\cH\c@j\c@\c@\c@\cA\c@\cF\c@S\c@\c@\c@\cE\c@\cP\c@\@\c@\c@\c@\cI\c@\c\\c@6\c@\c@\c@\cM\c@(\c@6\c@\c@\c@\cP\c@2\c@>\c@\cB\c@\cQ\c@4\c@L\c@\cH\c@\cN\c@,\c@[\c@\cM\c@\cK\c@!\c@d\c@\cO\c@\cI\c@\cU\c@f\c@\cO\c@\cK\c@\cJ\c@a\c@\cN\c@\cQ\c@\cB\c@V\c@\cJ\c@\cX\c@\c@\c@J\c@\cD\c@\c_\c@\c@\c@?\c@\cB\c@\"\c@\c@\c@5\c@\cJ\c@!\c@\c@\c@,\c@\cZ\c@\c\\c@\c@\c@%\c@+\c@\cW\c@\c@\c@\c]\c@:\c@\cT\c@\c@\c@\cT\c@E\c@\cW\c@\c@\c@\cM\c@F\c@\"\c@\c@\c@\cG\c@<\c@4\c@\cA\c@\cD\c@0\c@L\c@\cG\c@\cD\c@(\c@f\c@\cO\c@\cG\c@*\c@€\c@\cX\c@\cH\c@5\c@”\c@\"\c@\cK\c@D\c@Ÿ\c@+\c@\cK\c@P\c@¡\c@0\c@\cK\c@V\c@™\c@1\c@\cK\c@R\c@Š\c@/\c@\cL\c@G\c@u\c@+\c@\cM\c@9\c@`\c@\$\c@\cM\c@,\c@J\c@\e\c@\cN\c@!\c@5\c@\cS\c@\cO\c@\cW\c@#\c@\cK\c@\cV\c@\cP\c@\cU\c@\cE\c@#\c@\cJ\c@\cK\c@\cA\c@8\c@\cE\c@\cD\c@\cA\c@R\c@\cA\c@\c@\c@\cB\c@m\c@\c@\c@\c@\c@\cA\c@ƒ\c@\c@\c@\c@\c@\cA\c@\c@\c@\c@\c@\c@\cB\c@‘\c@\c@\c@\c@\c@\cA\c@ˆ\c@\c@\c@\cB\c@\cB\c@w\c@\c@\c@\cD\c@\cI\c@d\c@\c@\c@\cF\c@\cU\c@R\c@\cC\c@\cH\c@ \c@B\c@\cL\c@\cH\c@*\c@6\c@\cW\c@\cG\c@/\c@.\c@\"\c@\cD\c@,\c@)\c@,\c@\cB\c@\"\c@&\c@5\c@\c@\c@\cV\c@&\c@>\c@\cC\c@\cO\c@)\c@J\c@\cG\c@\cN\c@-\c@]\c@\cL\c@\cS\c@2\c@s\c@\cP\c@\cZ\c@6\c@‡\c@\cS\c@ \c@9\c@‘\c@\cP\c@ \c@:\c@‹\c@\cL\c@\cZ\c@;\c@t\c@\cG\c@\cS\c@;\c@V\c@\cC\c@\cM\c@>\c@:\c@\c@\c@\cL\c@B\c@)\c@\c@\c@\cR\c@G\c@%\c@\cC\c@\c^\c@J\c@+\c@\cK\c@-\c@J\c@1\c@\cY\c@;\c@C\c@0\c@+\c@D\c@6\c@)\c@\@\c@E\c@&\c@\c]\c@S\c@?\c@\cX\c@\cO\c@c\c@3\c@\cL\c@\cE\c@m\c@'\c@\cD\c@\cO\c@r\c@\c]\c@\c@\c@!\c@s\c@\cZ\c@\c@\c@2\c@p\c@\c^\c@\c@\c@<\c@l\c@)\c@\c@\c@>\c@d\c@7\c@\c@\c@6\c@Y\c@E\c@\c@\c@&\c@K\c@L\c@\c@\c@\cS\c@=\c@K\c@\c@\c@\cL\c@0\c@B\c@\c@\c@ \c@%\c@4\c@\c@\c@I\c@\c]\c@%\c@\c@\c@\c@\cW\c@\cY\c@\c@\c@Å\c@\cS\c@\cS\c@\c@\cA\cG\c@\cQ\c@\cR\c@\c@\cA6\c@\cO\c@\cT\c@\c@\cAH\c@\cM\c@\cX\c@\c@\cA:\c@\cL\c@\cZ\c@\c@\cA\cM\c@\cL\c@\cZ\c@\cA\c@Î\c@\cL\c@\cY\c@\cD\c@Œ\c@\cL\c@\cW\c@\cG\c@X\c@\cN\c@\cV\c@\cJ\c@>\c@\cR\c@\cU\c@\cM\c@D\c@\cX\c@\cV\c@\cO\c@e\c@\c_\c@\cX\c@\cP\c@•\c@&\c@\cY\c@\cQ\c@Å\c@)\c@\cY\c@\cR\c@æ\c@%\c@\cX\c@\cS\c@ò\c@\c]\c@\cU\c@\cR\c@ì\c@\cT\c@\cQ\c@\cQ\c@ã\c@\cL\c@\cL\c@\cP\c@ç\c@\cD\c@\cG\c@\cN\cA\cE\c@\c@\c@\cD\c@\cL\cA?\c@\c@\c@\cE\c@\cJ\cA‹\c@\c@\c@\cL\c@\cH\cAÖ\c@\cB\c@\cU\c@\cF\cB\cE\c@\cF\c@\c^\c@\cC\cB\cE\c@\cJ\c@&\c@\cB\cAÐ\c@\cP\c@&\c@\c@\cAk\c@\cX\c@ \c@\c@\c@û\c@\c_\c@\cX\c@\c@\c@•\c@%\c@\cN\c@\c@\c@D\c@*\c@\cE\c@\cB\c@\cP\c@,\c@\c@\c@\cF\c@\cH\c@+\c@\c@\c@\cK\c@\$\c@'\c@\c@\c@\cN\c@K\c@#\c@\c@\c@\cP\c@u\c@\c^\c@\c@\c@\cN\c@ž\c@\c\\c@\c@\c@\cJ\c@¾\c@\c]\c@\cA\c@\cF\c@Á\c@\$\c@\cE\c@\cB\c@ª\c@/\c@\cL\c@\c@\c@ƒ\c@;\c@\cT\c@\cA\c@Y\c@G\c@\c\\c@\cB\c@3\c@M\c@#\c@\cD\c@\cY\c@J\c@\$\c@\cC\c@\cQ\c@\@\c@\c^\c@\cD\c@\cY\c@2\c@\cW\c@\cC\c@*\c@\$\c@\cN\c@\cC\c@<\c@\e\c@\cF\c@\cD\c@N\c@\e\c@\cA\c@\cG\c@Z\c@\"\c@\cA\c@\cI\c@_\c@-\c@\cB\c@\cJ\c@^\c@7\c@\cC\c@\cI\c@Z\c@;\c@\cD\c@\cH\c@X\c@8\c@\cG\c@\cD\c@X\c@-\c@\cL\c@\cA\c@\\\c@\c_\c@\cR\c@\c@\c@a\c@\cR\c@\cZ\c@\cB\c@d\c@\cJ\c@\"\c@\cF\c@]\c@\cH\c@'\c@\cJ\c@L\c@\cK\c@(\c@\cK\c@8\c@\cN\c@\$\c@\cL\c@#\c@\cQ\c@\c]\c@\cJ\c@\cP\c@\cP\c@\cT\c@\cG\c@\cC\c@\cM\c@\cK\c@\cC\c@\c@\c@\cH\c@\cF\c@\c@\c@\cA\c@\cC\c@\cD\c@\c@\c@\cK\c@\c@\c@\cF\c@\c@\c@\c_\c@\c@\c@\cJ\c@\c@\c@\@\c@\c@\c@\cP\c@\c@\c@n\c@\c@\c@\cU\c@\c@\c@¥\c@\c@\c@\cZ\c@\c@\c@Ù\c@\cB\c@\c\\c@\c@\c@þ\c@\cG\c@\c\\c@\c@\cA\cN\c@\cL\c@\e\c@\c@\cA\cH\c@\cP\c@\cZ\c@\c@\c@ï\c@\cS\c@\cX\c@\c@\c@Ñ\c@\cR\c@\cV\c@\cC\c@¹\c@\cN\c@\cU\c@\cJ\c@°\c@\cI\c@\cS\c@\cT\c@·\c@\cD\c@\cR\c@\c_\c@Ë\c@\c@\c@\cQ\c@*\c@á\c@\cC\c@\cS\c@/\c@ñ\c@\cG\c@\cW\c@/\c@ñ\c@\cL\c@\c_\c@+\c@á\c@\cP\c@(\c@'\c@Å\c@\cT\c@2\c@&\c@¢\c@\cU\c@8\c@(\c@€\c@\cT\c@8\c@/\c@c\c@\cU\c@1\c@7\c@L\c@\cW\c@%\c@>\c@8\c@\e\c@\cY\c@B\c@&\c@\c^\c@\cM\c@A\c@\cY\c@\c]\c@\cD\c@<\c@\cP\c@\cY\c@\c@\c@3\c@\cS\c@\cS\c@\c@\c@'\c@\"\c@\cK\c@\cA\c@\cZ\c@>\c@\cE\c@\cC\c@\cP\c@^\c@\c@\c@\cE\c@\cG\c@y\c@\c@\c@\cG\c@\cD\c@„\c@\c@\c@\cJ\c@\cH\c@z\c@\c@\c@\cL\c@\cR\c@`\c@\c@\c@\cO\c@!\c@B\c@\c@\c@\cS\c@4\c@\$\c@\cB\c@\cY\c@J\c@\e\c@\cF\c@!\c@_\c@.\c@\cI\c@+\c@r\c@V\c@\cK\c@4\c@\c?\c@{\c@\cK\c@9\c@†\c@\c@\cJ\c@8\c@‡\c@¨\c@\cG\c@1\c@ƒ\c@—\c@\cC\c@\$\c@y\c@q\c@\c@\c@\cX\c@j\c@J\c@\cC\c@\cL\c@Y\c@&\c@\cK\c@\cC\c@F\c@\cM\c@\cW\c@\cA\c@3\c@\c@\c@&\c@\cF\c@#\c@\c@\c@8\c@\cL\c@\cZ\c@\c@\c@H\c@\cP\c@\cV\c@\c@\c@U\c@\cS\c@\cY\c@\cD\c@\\\c@\cT\c@\c_\c@\cT\c@`\c@\cP\c@(\c@-\c@^\c@\cK\c@,\c@I\c@[\c@\cF\c@-\c@c\c@V\c@\cD\c@)\c@u\c@O\c@\cG\c@!\c@v\c@F\c@\cN\c@\cW\c@e\c@<\c@\cU\c@\cN\c@I\c@1\c@\c]\c@\cG\c@-\c@'\c@\$\c@\cD\c@\cW\c@\c]\c@(\c@\cH\c@\cG\c@\cW\c@+\c@\cS\c@\c@\c@\cR\c@+\c@\"\c@\c@\c@\cP\c@)\c@4\c@\c@\c@\cR\c@&\c@D\c@\cL\c@\cV\c@\"\c@R\c@\$\c@\cY\c@\c\\c@W\c@D\c@\c\\c@\cU\c@U\c@e\c@\c\\c@\cN\c@L\c@\c@\cX\c@\cH\c@=\c@‡\c@\cR\c@\cD\c@,\c@s\c@\cL\c@\cA\c@\c^\c@W\c@\cF\c@\c@\c@\cR\c@6\c@\cB\c@\c@\c@\cK\c@\cV\c@\c@\c@\c@\c@\cH\c@\cB\c@\c@\c@\c@\c@\cE\c@\cA\c@\c@\c@\c@\c@\cD\c@\cN\c@\c@\c@\cB\c@\cC\c@\"\c@\cB\c@\cH\c@\cA\c@;\c@\cC\c@\cQ\c@\c@\c@X\c@\cE\c@\cZ\c@\c@\c@x\c@\cH\c@!\c@\c@\c@‘\c@\cJ\c@#\c@\cA\c@¤\c@\cL\c@\c_\c@\cC\c@°\c@\cN\c@\cX\c@\cG\c@³\c@\cO\c@\cQ\c@\cK\c@®\c@\cN\c@\cN\c@\cP\c@œ\c@\cM\c@\cQ\c@\cV\c@~\c@\cL\c@\cX\c@\c\\c@Y\c@\cL\c@ \c@!\c@9\c@\cO\c@\$\c@\$\c@\c\\c@\cT\c@\"\c@\$\c@\cS\c@\e\c@\cZ\c@!\c@!\c@ \c@\cR\c@\cZ\c@;\c@\$\c@\cI\c@\cS\c@P\c@%\c@\cB\c@\cM\c@`\c@%\c@\c@\c@\cK\c@]\c@%\c@\c@\c@\cK\c@K\c@(\c@\c@\c@\cN\c@3\c@/\c@\c@\c@\cP\c@\cZ\c@:\c@\cC\c@\cP\c@\cG\c@G\c@\cG\c@\cM\c@\c@\c@T\c@\cL\c@\cJ\c@\cH\c@^\c@\cR\c@\cF\c@\cU\c@b\c@\cX\c@\cB\c@\$\c@a\c@\e\c@\c@\c@1\c@Z\c@\e\c@\c@\c@=\c@N\c@\cW\c@\c@\c@A\c@\@\c@\cQ\c@\c@\c@B\c@1\c@\cK\c@\c@\c@E\c@#\c@\cF\c@\c@\c@T\c@\cW\c@\cB\c@\c@\c@q\c@\cQ\c@\c@\c@\c@\c@™\c@\cP\c@\c@\c@\c@\c@Å\c@\cW\c@\cD\c@\c@\c@ì\c@#\c@\cL\c@\c@\cA\cC\c@2\c@\cX\c@\c@\cA\cD\c@\@\c@&\c@\c@\c@î\c@J\c@5\c@\c@\c@Ä\c@K\c@A\c@\c@\c@\c@E\c@G\c@\c@\c@[\c@:\c@F\c@\c@\c@2\c@,\c@\@\c@\c@\c@\cT\c@\c_\c@7\c@\c@\c@\cM\c@\cU\c@.\c@\c@\c@\cZ\c@\cM\c@(\c@\c@\c@/\c@\cG\c@%\c@\c@\c@F\c@\cE\c@'\c@\c@\c@^\c@\cF\c@+\c@\c@\c@o\c@\cK\c@/\c@\cA\c@y\c@\cT\c@0\c@\cC\c@\c?\c@\c^\c@.\c@\cD\c@‰\c@(\c@)\c@\cD\c@š\c@.\c@ \c@\cD\c@´\c@-\c@\cV\c@\cC\c@Ô\c@(\c@\cN\c@\cB\c@õ\c@ \c@\cG\c@\c@\cA\cO\c@\cV\c@\cB\c@\c@\cA\c^\c@\cN\c@\c@\c@\c@\cA\c^\c@\cG\c@\c@\c@\c@\cA\cP\c@\cC\c@\c@\c@\c@\c@ö\c@\cA\c@\c@\c@\c@\c@Ô\c@\c@\c@\c@\c@\cB\c@±\c@\c@\c@\cA\c@\cH\c@’\c@\c@\c@\cD\c@\cN\c@}\c@\c@\c@\cF\c@\cU\c@t\c@\cF\c@\cG\c@\c\\c@y\c@\cS\c@\cH\c@ \c@‡\c@'\c@\cH\c@!\c@—\c@?\c@\cH\c@\c]\c@¤\c@Z\c@\cJ\c@\cZ\c@©\c@o\c@\cN\c@\cW\c@¨\c@y\c@\cU\c@\cV\c@¡\c@x\c@\c\\c@\cU\c@–\c@m\c@ \c@\cW\c@Š\c@[\c@\c_\c@\cV\c@{\c@I\c@\cY\c@\cR\c@k\c@9\c@\cR\c@\cN\c@[\c@-\c@\cJ\c@\cI\c@P\c@'\c@\cC\c@\cD\c@N\c@%\c@\cD\c@\c@\c@Y\c@&\c@\cK\c@\c@\c@q\c@(\c@\cS\c@\cD\c@‘\c@,\c@\cZ\c@\cL\c@°\c@0\c@\c_\c@\cU\c@Å\c@4\c@\c^\c@\c_\c@É\c@4\c@\cX\c@,\c@º\c@1\c@\cP\c@9\c@œ\c@)\c@\cI\c@F\c@x\c@\c^\c@\cB\c@S\c@X\c@\cS\c@\c@\c@`\c@C\c@\cJ\c@\c@\c@j\c@;\c@\cC\c@\c@\c@n\c@>\c@\c@\c@\c@\c@k\c@D\c@\c@\c@\c@\c@c\c@F\c@\cB\c@\c@\c@X\c@?\c@\cG\c@\cA\c@N\c@0\c@\cM\c@\cE\c@G\c@ \c@\cS\c@\cM\c@D\c@\cQ\c@\cW\c@\cV\c@C\c@\cE\c@\cX\c@\c^\c@B\c@\c@\c@\cU\c@\"\c@\@\c@\cB\c@\cO\c@ \c@<\c@\cN\c@\cI\c@\cZ\c@7\c@\"\c@\cD\c@\cR\c@2\c@?\c@\c@\c@\cI\c@.\c@c\c@\c@\c@\cB\c@+\c@‰\c@\c@\c@\cA\c@+\c@¦\c@\c@\c@\cG\c@)\c@¶\c@\cB\c@\cR\c@'\c@¹\c@\cC\c@\c_\c@#\c@°\c@\cD\c@,\c@\e\c@œ\c@\cD\c@7\c@\cS\c@ƒ\c@\cD\c@;\c@\cL\c@d\c@\cC\c@6\c@\cF\c@E\c@\cA\c@+\c@\cE\c@,\c@\c@\c@\c^\c@\cL\c@\cW\c@\c@\c@\cQ\c@\cV\c@\cG\c@\cC\c@\cH\c@!\c@\c@\c@\cM\c@\cD\c@,\c@\c@\c@\cZ\c@\cH\c@0\c@\cE\c@)\c@\cP\c@,\c@\cM\c@8\c@\cY\c@#\c@\cV\c@C\c@\"\c@\cX\c@\c_\c@E\c@)\c@\cM\c@)\c@?\c@+\c@\cD\c@/\c@5\c@(\c@\c@\c@5\c@*\c@!\c@\cA\c@=\c@!\c@\cX\c@\cC\c@I\c@\c\\c@\cO\c@\cD\c@W\c@\c\\c@\cH\c@\cD\c@f\c@!\c@\cE\c@\cD\c@p\c@'\c@\cH\c@\cC\c@s\c@-\c@\cQ\c@\cA\c@j\c@2\c@\c]\c@\c@\c@X\c@3\c@*\c@\c@\c@?\c@2\c@4\c@\c@\c@(\c@,\c@8\c@\cC\c@\cU\c@%\c@4\c@\cK\c@\cG\c@\c]\c@)\c@\cU\c@\c@\c@\cV\c@\c\\c@ \c@\c@\c@\cP\c@\cQ\c@,\c@\c@\c@\cO\c@\cG\c@4\c@\c@\c@\cS\c@\cA\c@8\c@\cG\c@\c^\c@\c@\c@5\c@\c^\c@.\c@\cB\c@0\c@E\c@A\c@\cH\c@&\c@v\c@R\c@\cO\c@\e\c@¨\c@\\\c@\cU\c@\cQ\c@Ë\c@Z\c@\cZ\c@\cI\c@Ñ\c@L\c@\cZ\c@\cB\c@´\c@8\c@\cU\c@\c@\c@†\c@#\c@\cO\c@\cG\c@T\c@\cR\c@\cH\c@\cU\c@'\c@\cE\c@\cB\c@'\c@\cI\c@\c@\c@\c@\c@9\c@\c@\c@\cC\c@\c@\c@K\c@\c@\c@\cK\c@\c@\c@R\c@\cN\c@\cX\c@\c@\c@L\c@*\c@(\c@\c@\c@<\c@P\c@9\c@\c@\c@)\c@z\c@F\c@\cD\c@\cX\c@©\c@K\c@\cL\c@\cJ\c@È\c@G\c@\cV\c@\cA\c@Ò\c@:\c@ \c@\c@\c@Ç\c@)\c@+\c@\c@\c@ª\c@\cY\c@1\c@\c@\c@\c@\cL\c@2\c@\c@\c@V\c@\cC\c@.\c@\c@\c@3\c@\c@\c@&\c@\cA\c@\cY\c@\c@\c@\e\c@\cC\c@\cG\c@\c@\c@\cR\c@\cG\c@\c@\c@\c@\c@\cJ\c@\cK\c@\cG\c@\cE\c@\cG\c@\cO\c@\cX\c@\cO\c@\cK\c@\cR\c@/\c@\c\\c@\cT\c@\cS\c@J\c@*\c@\c^\c@\cS\c@f\c@8\c@'\c@\cS\c@{\c@?\c@)\c@\cT\c@‚\c@>\c@%\c@\cU\c@{\c@6\c@\c\\c@\cW\c@j\c@+\c@\cQ\c@\cY\c@U\c@ \c@\cH\c@\e\c@B\c@\cY\c@\cB\c@\cY\c@7\c@\cU\c@\c@\c@\cV\c@6\c@\cU\c@\c@\c@\cR\c@;\c@\cX\c@\c@\c@\cL\c@C\c@\c\\c@\c@\c@\cG\c@I\c@\c^\c@\c@\c@\cC\c@K\c@\c_\c@\c@\c@\cA\c@H\c@\c_\c@\c@\c@\c@\c@D\c@\c_\c@\c@\c@\c@\c@B\c@\c^\c@\c@\c@\c@\c@D\c@\c^\c@\c@\c@\c@\c@F\c@\c_\c@\c@\c@\c@\c@G\c@\c_\c@\c@\c@\c@\c@E\c@\c_\c@\c@\c@\c@\c@?\c@\c^\c@\cD\c@\c@\c@7\c@\c^\c@\cI\c@\c@\c@1\c@\c^\c@\cQ\c@\c@\c@3\c@\c_\c@\cZ\c@\cB\c@<\c@\c^\c@#\c@\cH\c@I\c@\e\c@*\c@\cP\c@U\c@\cV\c@/\c@\cX\c@Z\c@\cP\c@1\c@!\c@S\c@\cJ\c@4\c@'\c@A\c@\cG\c@5\c@*\c@.\c@\cH\c@9\c@(\c@\cY\c@\cM\c@=\c@&\c@\cI\c@\cT\c@C\c@#\c@\c@\c@\cY\c@G\c@\"\c@\c@\c@\e\c@H\c@#\c@\c@\c@\cW\c@G\c@(\c@\c@\c@\cQ\c@A\c@/\c@\c@\c@\cK\c@9\c@4\c@\cM\c@\cE\c@.\c@5\c@,\c@\cA\c@\$\c@0\c@Y\c@\c@\c@\c^\c@%\c@Š\c@\c@\c@\e\c@\cY\c@»\c@\c@\c@\c_\c@\cO\c@Ø\c@\c@\c@'\c@\cE\c@Ô\c@\cC\c@0\c@\c@\c@²\c@\cJ\c@8\c@\c@\c@€\c@\cT\c@<\c@\c@\c@O\c@\c_\c@:\c@\c@\c@%\c@-\c@3\c@\c@\c@\cN\c@8\c@(\c@\c@\c@\cM\c@?\c@\c^\c@\c@\c@\cX\c@F\c@\cU\c@\c@\c@\c^\c@J\c@\cO\c@\c@\c@\c_\c@M\c@\cK\c@\c@\c@\c]\c@Q\c@\cH\c@\cD\c@\cV\c@W\c@\cE\c@\cK\c@\cK\c@]\c@\cC\c@\cR\c@\cB\c@b\c@\cA\c@\cZ\c@\cL\c@f\c@\c@\c@ \c@%\c@f\c@\c@\c@\"\c@E\c@a\c@\cA\c@\c^\c@e\c@Y\c@\cF\c@\cW\c@€\c@O\c@\cO\c@\cO\c@†\c@C\c@\cZ\c@\cJ\c@s\c@8\c@&\c@\cH\c@V\c@,\c@1\c@\cM\c@5\c@!\c@8\c@\cV\c@\cW\c@\cV\c@9\c@\"\c@\cD\c@\cN\c@5\c@.\c@\cH\c@\cG\c@/\c@:\c@\c_\c@\cB\c@(\c@E\c@=\c@\c@\c@!\c@N\c@Z\c@\c@\c@\e\c@X\c@r\c@\c@\c@\cW\c@b\c@y\c@\c@\c@\cT\c@i\c@i\c@\c@\c@\cS\c@l\c@N\c@\c@\c@\cU\c@j\c@0\c@\c@\c@\cY\c@a\c@\cT\c@\c@\c@\c]\c@R\c@\cC\c@\c@\c@!\c@C\c@\c@\c@\c@\c@\$\c@5\c@\c@\c@\c@\c@&\c@+\c@\cI\c@\c@\c@&\c@(\c@\c_\c@\c@\c@%\c@*\c@?\c@\cA\c@%\c@0\c@i\c@\cF\c@\$\c@8\c@š\c@\cL\c@\$\c@\@\c@Æ\c@\cR\c@%\c@E\c@â\c@\cW\c@%\c@F\c@é\c@\cX\c@&\c@E\c@Ù\c@\cT\c@&\c@\@\c@´\c@\cN\c@\$\c@9\c@‚\c@\cH\c@ \c@2\c@T\c@\cC\c@\cZ\c@+\c@-\c@\c@\c@\cS\c@%\c@\cQ\c@\c@\c@\cL\c@ \c@\cA\c@\cC\c@\cI\c@\c]\c@\c@\c@\cG\c@\cK\c@\e\c@\c@\c@\cI\c@\cU\c@\c\\c@\c@\c@\cK\c@&\c@ \c@\c@\c@\cJ\c@=\c@&\c@\c@\c@\cH\c@U\c@/\c@\c@\c@\cE\c@l\c@:\c@\c@\c@\cB\c@}\c@D\c@\c@\c@\c@\c@ˆ\c@J\c@\c@\c@\c@\c@Œ\c@K\c@\c@\c@\c@\c@Œ\c@H\c@\c@\c@\cC\c@ˆ\c@\@\c@\c@\c@\cG\c@ƒ\c@6\c@\cG\c@\cK\c@~\c@-\c@\cZ\c@\cN\c@y\c@%\c@9\c@\cP\c@r\c@\c_\c@_\c@\cN\c@i\c@\cZ\c@Š\c@\cK\c@\\\c@\cV\c@³\c@\cG\c@K\c@\cR\c@Î\c@\cE\c@9\c@\cO\c@Ö\c@\cE\c@(\c@\cM\c@Ç\c@\cH\c@\cZ\c@\cM\c@¢\c@\cM\c@\cQ\c@\cP\c@u\c@\cQ\c@\cM\c@\cV\c@K\c@\cU\c@\cN\c@\c_\c@&\c@\cW\c@\cT\c@)\c@\cN\c@\cW\c@\c]\c@2\c@ \c@\cW\c@)\c@6\c@R\c@\cW\c@4\c@4\c@“\c@\cW\c@>\c@+\c@á\c@\cW\c@D\c@\c_\cA6\c@\cT\c@E\c@\cS\cAv\c@\cQ\c@\@\c@\cI\cA–\c@\cL\c@6\c@\cB\cA‘\c@\cG\c@'\c@\c@\cAf\c@\cD\c@\cZ\c@\c@\cA\c]\c@\cA\c@\cO\c@\cE\c@Ç\c@\c@\c@\cJ\c@\cM\c@|\c@\c@\c@\cJ\c@\cW\c@=\c@\cA\c@\cN\c@ \c@\cS\c@\cD\c@\cR\c@&\c@\c@\c@\cH\c@\cU\c@\$\c@\c@\c@\cL\c@\cT\c@\c]\c@\c@\c@\cP\c@\cQ\c@\cT\c@\c@\c@\cQ\c@\cN\c@\cJ\c@\c@\c@\cP\c@\cM\c@\cB\c@\c@\c@\cN\c@\cM\c@\cA\c@\c@\c@\cN\c@\cO\c@\cH\c@\c@\c@\cR\c@\cR\c@\cR\c@\c@\c@\cY\c@\cT\c@\c_\c@\c@\c@%\c@\cU\c@,\c@\c@\c@1\c@\cW\c@6\c@\cK\c@;\c@\cY\c@9\c@!\c@A\c@\c^\c@5\c@>\c@\@\c@\$\c@*\c@[\c@:\c@+\c@\c\\c@y\c@0\c@0\c@\cQ\c@ˆ\c@#\c@2\c@\cG\c@ˆ\c@\cV\c@1\c@\cB\c@z\c@\cM\c@,\c@\cF\c@h\c@\cF\c@%\c@\cN\c@[\c@\cA\c@\c\\c@\cX\c@\\\c@\cC\c@\cS\c@\"\c@q\c@\cI\c@\cL\c@+\c@—\c@\cQ\c@\cF\c@.\c@Ê\c@\cW\c@\cB\c@)\c@ÿ\c@\cZ\c@\c@\c@!\cA,\c@\cW\c@\c@\c@\cV\cAE\c@\cR\c@\c@\c@\cN\cAE\c@\cK\c@\c@\c@\cK\cA-\c@\cD\c@\c@\c@\cM\c@ÿ\c@\c@\c@\cB\c@\cT\c@Ã\c@\cE\c@\cI\c@\e\c@ƒ\c@\cO\c@\cS\c@!\c@O\c@\e\c@!\c@!\c@'\c@'\c@0\c@\c]\c@\cN\c@2\c@>\c@\cU\c@\cO\c@6\c@E\c@\cM\c@+\c@3\c@C\c@\cF\c@T\c@(\c@8\c@\cC\c@Ž\c@\e\c@)\c@\cC\c@Ö\c@\cP\c@\cZ\c@\cD\cA\c_\c@\cG\c@\cM\c@\cD\cA^\c@\cA\c@\cC\c@\cD\cAˆ\c@\c@\c@\cC\c@\cC\cA•\c@\cC\c@\cI\c@\cB\cA„\c@\cG\c@\cR\c@\c@\cAZ\c@\cJ\c@\cY\c@\c@\cA!\c@\cL\c@ \c@\c@\c@ç\c@\cK\c@!\c@\c@\c@¹\c@\cJ\c@\e\c@\cC\c@\c@\cF\c@\cT\c@\cK\c@”\c@\cC\c@\cL\c@\cU\c@—\c@\c@\c@\cD\c@\c_\c@ \c@\c@\c@\c@\c@)\c@¦\c@\c@\c@\cG\c@,\c@¢\c@\cC\c@\cS\c@*\c@•\c@\cM\c@\"\c@!\c@\c@\c^\c@1\c@\cW\c@k\c@5\c@\@\c@\cM\c@X\c@O\c@G\c@\cF\c@N\c@i\c@F\c@\cA\c@M\c@z\c@=\c@\c@\c@T\c@\c@/\c@\c@\c@_\c@{\c@ \c@\cC\c@h\c@m\c@\cS\c@\cF\c@k\c@Y\c@\cL\c@\cJ\c@d\c@B\c@\cJ\c@\cO\c@Q\c@*\c@\cN\c@\cU\c@:\c@\cY\c@\cU\c@\e\c@%\c@\cM\c@\c\\c@#\c@\cR\c@\cD\c@\"\c@-\c@\cD\c@\c@\c@%\c@7\c@\c@\c@\c@\c@'\c@>\c@\c@\c@\cA\c@&\c@B\c@\c@\c@\cF\c@%\c@?\c@\c@\c@\cL\c@#\c@5\c@\cC\c@\cU\c@!\c@&\c@\cM\c@\c_\c@\c\\c@\cX\c@\c_\c@(\c@\cV\c@\cL\c@6\c@/\c@\cO\c@\cD\c@Q\c@2\c@\cI\c@\c@\c@l\c@1\c@\cD\c@\c@\c@\c?\c@-\c@\cA\c@\c@\c@…\c@(\c@\c@\c@\c@\c@\c?\c@\"\c@\cC\c@\c@\c@p\c@\c^\c@\cL\c@\c@\c@[\c@\c]\c@\cX\c@\c@\c@H\c@\c]\c@'\c@\c@\c@<\c@\c^\c@8\c@\c@\c@6\c@\c^\c@G\c@\c@\c@5\c@\c]\c@P\c@\c@\c@5\c@\cZ\c@Q\c@\c@\c@1\c@\cS\c@L\c@\c@\c@&\c@\cM\c@\@\c@\cB\c@\e\c@\cH\c@2\c@\cF\c@\cO\c@\cC\c@!\c@\cK\c@\cE\c@\cB\c@\cT\c@\cR\c@\c@\c@\cF\c@\cJ\c@\cZ\c@\cC\c@\cO\c@\cC\c@!\c@\cQ\c@\e\c@\c@\c@&\c@(\c@*\c@\c@\c@%\c@D\c@8\c@\c@\c@ \c@a\c@A\c@\c@\c@\cX\c@w\c@D\c@\c@\c@\cP\c@|\c@A\c@\cA\c@\cH\c@n\c@8\c@\cD\c@\cB\c@R\c@.\c@\cJ\c@\cD\c@5\c@%\c@\cR\c@\cK\c@ \c@!\c@\c^\c@\cU\c@\c\\c@!\c@+\c@\c^\c@(\c@&\c@8\c@'\c@?\c@,\c@B\c@+\c@X\c@2\c@E\c@'\c@l\c@4\c@\@\c@\c_\c@u\c@0\c@3\c@\cU\c@v\c@'\c@\$\c@\cM\c@x\c@\c\\c@\cV\c@\cI\c@ƒ\c@\cQ\c@\cJ\c@\cK\c@\c@\cH\c@\cB\c@\cR\c@Å\c@\cB\c@\c@\c@\cY\c@ñ\c@\c@\c@\c@\c@\c^\cA\cU\c@\c@\c@\c@\c@ \cA#\c@\c@\c@\c@\c@\c^\cA\cR\c@\c@\c@\c@\c@\cX\c@ã\c@\c@\c@\cF\c@\cT\c@¢\c@\c@\c@\cR\c@\cS\c@g\c@\c@\c@!\c@\cU\c@4\c@\cB\c@1\c@\cW\c@\cQ\c@\cF\c@?\c@\cZ\c@\c@\c@\cK\c@C\c@\cZ\c@\cI\c@\cQ\c@=\c@\cT\c@\cX\c@\cX\c@.\c@\cO\c@&\c@\e\c@\c^\c@\cI\c@/\c@\e\c@\cO\c@\cC\c@4\c@\cX\c@\cD\c@\cB\c@.\c@\cR\c@\cB\c@\cJ\c@\"\c@\cM\c@\cH\c@\cV\c@\cS\c@\cM\c@\cN\c@#\c@\cG\c@\cR\c@\cT\c@0\c@\cC\c@\c]\c@\cY\c@8\c@\cO\c@.\c@\cZ\c@8\c@\c_\c@\@\c@\cU\c@0\c@2\c@M\c@\cO\c@#\c@F\c@T\c@\cH\c@\cU\c@Z\c@R\c@\cC\c@\cJ\c@h\c@I\c@\c@\c@\cB\c@s\c@:\c@\c@\c@\c@\c@~\c@+\c@\c@\c@\c@\c@Œ\c@\c^\c@\cA\c@\c@\c@ž\c@\cV\c@\cG\c@\c@\c@±\c@\cS\c@\cQ\c@\c@\c@Å\c@\cR\c@\c]\c@\c@\c@Õ\c@\cS\c@,\c@\c@\c@Þ\c@\cT\c@:\c@\c@\c@Û\c@\cU\c@D\c@\c@\c@Ê\c@\cV\c@G\c@\c@\c@ª\c@\cY\c@F\c@\cB\c@|\c@\c_\c@\@\c@\cC\c@S\c@(\c@8\c@\cD\c@.\c@3\c@/\c@\cD\c@\cQ\c@=\c@&\c@\cD\c@\cA\c@B\c@\c_\c@\cC\c@\cC\c@?\c@\cZ\c@\cB\c@\cX\c@4\c@\cV\c@\c@\c@9\c@%\c@\cT\c@\c@\c@c\c@\cW\c@\cR\c@\c@\c@Ž\c@\cJ\c@\cQ\c@\c@\c@³\c@\cB\c@\cQ\c@\c@\c@¾\c@\c@\c@\cQ\c@\c@\c@«\c@\c@\c@\cR\c@\c@\c@ƒ\c@\c@\c@\cT\c@\c@\c@X\c@\c@\c@\cW\c@\c@\c@/\c@\c@\c@\cZ\c@\c@\c@\cO\c@\c@\c@\c\\c@\cB\c@\c@\c@\cE\c@\e\c@\cF\c@\c@\c@\cM\c@\cZ\c@\cI\c@\cA\c@\cY\c@\cY\c@\cL\c@\cU\c@)\c@\e\c@\cM\c@7\c@=\c@\c_\c@\cK\c@e\c@O\c@%\c@\cH\c@—\c@[\c@+\c@\cD\c@Ê\c@a\c@0\c@\cA\c@ì\c@]\c@1\c@\cD\c@õ\c@Q\c@.\c@\cI\c@è\c@?\c@(\c@\cP\c@É\c@-\c@\$\c@\cV\c@¡\c@\c]\c@#\c@\c\\c@w\c@\cR\c@(\c@\c\\c@V\c@\cN\c@3\c@\cX\c@A\c@\cM\c@D\c@\cR\c@;\c@\cO\c@W\c@\cK\c@C\c@\cQ\c@i\c@\cE\c@S\c@\cQ\c@v\c@\cA\c@c\c@\cO\c@|\c@\c@\c@l\c@\cL\c@{\c@\c@\c@k\c@\cH\c@t\c@\cA\c@`\c@\cD\c@h\c@\cB\c@R\c@\cA\c@Y\c@\cD\c@E\c@\c@\c@L\c@\cG\c@=\c@\c@\c@\@\c@\cL\c@;\c@\c@\c@7\c@\cO\c@?\c@\cA\c@0\c@\cQ\c@D\c@\cF\c@+\c@\cS\c@G\c@\cN\c@'\c@\cQ\c@D\c@\cW\c@\"\c@\cM\c@9\c@ \c@\c\\c@\cI\c@*\c@(\c@\cW\c@\cE\c@\c\\c@+\c@\cR\c@\cA\c@\cO\c@)\c@\cM\c@\c@\c@\cD\c@\"\c@\cJ\c@\c@\c@\c@\c@\e\c@\cG\c@\c@\c@\c@\c@\cT\c@\cD\c@\cA\c@\c@\c@\cP\c@\cC\c@\cD\c@\c@\c@\cQ\c@\cA\c@\cG\c@\c@\c@\cY\c@\c@\c@\cK\c@\c@\c@'\c@\c@\c@\cO\c@\c@\c@<\c@\c@\c@\cQ\c@\cE\c@S\c@\c@\c@\cR\c@\cU\c@l\c@\c@\c@\cQ\c@-\c@\c@\cD\c@\cP\c@I\c@\c@\cK\c@\cN\c@f\c@”\c@\cS\c@\cN\c@|\c@’\c@\c]\c@\cP\c@„\c@ˆ\c@&\c@\cS\c@}\c@x\c@-\c@\cX\c@m\c@f\c@2\c@\c]\c@Z\c@U\c@4\c@\"\c@N\c@E\c@6\c@\$\c@H\c@8\c@8\c@%\c@I\c@0\c@;\c@#\c@N\c@*\c@?\c@!\c@O\c@'\c@C\c@\c^\c@H\c@#\c@G\c@\c\\c@:\c@ \c@K\c@\e\c@)\c@\c]\c@O\c@\cZ\c@\cY\c@\e\c@S\c@\cY\c@\cJ\c@\cZ\c@U\c@\cU\c@\cB\c@\e\c@U\c@\cP\c@\c@\c@\c]\c@Q\c@\cK\c@\c@\c@\c_\c@J\c@\cF\c@\cC\c@\c_\c@A\c@\cB\c@\cH\c@\c]\c@7\c@\c@\c@\cN\c@\cY\c@-\c@\c@\c@\cR\c@\cR\c@%\c@\c@\c@\cT\c@\cL\c@\c]\c@\c@\c@\cR\c@\cG\c@\cV\c@\cA\c@\cN\c@\cB\c@\cO\c@\cC\c@\cH\c@\c@\c@\cI\c@\cE\c@\cC\c@\cC\c@\cD\c@\cF\c@\c@\c@\cK\c@\cA\c@\cF\c@\c@\c@\cU\c@\c@\c@\cE\c@\c@\c@!\c@\c@\c@\cD\c@\c@\c@/\c@\c@\c@\cB\c@\c@\c@;\c@\c@\c@\cA\c@\cB\c@B\c@\c@\c@\c@\c@\cH\c@E\c@\c@\c@\c@\c@\cN\c@E\c@\c@\c@\c@\c@\cS\c@C\c@\c@\c@\c@\c@\cT\c@A\c@\c@\c@\c@\c@\cS\c@B\c@\c@\c@\c@\c@\cO\c@D\c@\cC\c@\cA\c@\cH\c@K\c@\cH\c@\cE\c@\cD\c@S\c@\cN\c@\cI\c@\cN\c@[\c@\cU\c@\cL\c@#\c@_\c@\cZ\c@\cN\c@;\c@_\c@\c\\c@\cN\c@R\c@Z\c@\cY\c@\cK\c@g\c@P\c@\cS\c@\cG\c@m\c@B\c@\cL\c@\cG\c@c\c@3\c@\cH\c@\cN\c@R\c@\$\c@\cI\c@\c\\c@B\c@\cV\c@\cO\c@0\c@?\c@\cL\c@\cX\c@H\c@R\c@\cE\c@!\c@]\c@~\c@\cA\c@'\c@k\c@À\c@\c@\c@(\c@o\cA\cJ\c@\cD\c@%\c@i\cAM\c@\cI\c@\c_\c@Z\cAy\c@\cP\c@\e\c@D\cA‚\c@\cW\c@\cY\c@-\cAe\c@\c\\c@\cZ\c@\e\cA)\c@\c]\c@\c^\c@\cM\c@Ù\c@\cY\c@\"\c@\cC\c@Œ\c@\cR\c@&\c@\c@\c@N\c@\cK\c@'\c@\c@\c@!\c@\cE\c@)\c@\cB\c@\cG\c@\cA\c@,\c@\cG\c@\cK\c@\c@\c@4\c@\cN\c@'\c@\c@\c@B\c@\cV\c@S\c@\c@\c@V\c@\c_\c@‰\c@\c@\c@o\c@&\c@È\c@\c@\c@‹\c@)\cA\c@\c@\c@\c@¥\c@(\cA\$\c@\c@\c@¹\c@&\cA.\c@\c@\c@Å\c@#\cA\c^\c@\c@\c@Æ\c@ \c@ø\c@\c@\c@¾\c@\c]\c@Â\c@\cA\c@°\c@\cX\c@‡\c@\cB\c@ \c@\cS\c@T\c@\cE\c@\c@\cM\c@,\c@\cI\c@{\c@\cH\c@\cQ\c@\cK\c@h\c@\cC\c@\cB\c@\cL\c@S\c@\c@\c@\c@\c@\cJ\c@=\c@\c@\c@\c@\c@\cH\c@(\c@\c@\c@\cC\c@\cE\c@\cW\c@\c@\c@\cK\c@\cB\c@\cJ\c@\c@\c@\cS\c@\c@\c@\cB\c@\c@\c@\cZ\c@\c@\c@\c@\c@\cB\c@ \c@\cB\c@\c@\c@\cG\c@#\c@\cE\c@\c@\c@\cM\c@%\c@\cI\c@\c@\c@\cS\c@.\c@\cM\c@\c@\c@\cX\c@A\c@\cO\c@\c@\c@\cY\c@`\c@\cN\c@\cA\c@\cU\c@†\c@\cK\c@\cD\c@\cO\c@­\c@\cG\c@\cI\c@\cI\c@Î\c@\cC\c@\cN\c@\cD\c@å\c@\c@\c@\cR\c@\c@\c@ò\c@\c@\c@\cT\c@\c@\c@û\c@\c@\c@\cR\c@\c@\cA\cE\c@\cD\c@\cN\c@\c@\cA\cR\c@\cL\c@\cJ\c@\c@\cA \c@\cV\c@\cF\c@\c@\cA+\c@ \c@\cD\c@\c@\cA/\c@)\c@\cF\c@\c@\cA#\c@+\c@\cK\c@\c@\cA\cF\c@&\c@\cR\c@\c@\c@×\c@\c\\c@\cY\c@\c@\c@ž\c@\cR\c@\c^\c@\cD\c@g\c@\cH\c@\c_\c@\cN\c@9\c@\cB\c@\c]\c@\c\\c@\c_\c@\c@\c@\cV\c@,\c@\"\c@\cC\c@\cO\c@=\c@A\c@\cH\c@\cH\c@H\c@s\c@\cP\c@\cC\c@K\c@®\c@\cX\c@\c@\c@D\c@î\c@\c_\c@\c@\c@6\cA\"\c@!\c@\c@\c@%\cAH\c@\c^\c@\c@\c@\cV\cAZ\c@\cW\c@\c@\c@\cK\cA]\c@\cO\c@\c@\c@\cC\cAP\c@\cH\c@\c@\c@\c@\cA9\c@\cB\c@\cE\c@\c@\cA\e\c@\c@\c@\cN\c@\c@\c@û\c@\c@\c@\cZ\c@\c@\c@Ú\c@\cB\c@)\c@\cA\c@º\c@\cD\c@9\c@\cA\c@›\c@\cE\c@D\c@\cC\c@}\c@\cF\c@I\c@\cG\c@_\c@\cF\c@E\c@\cP\c@A\c@\cD\c@;\c@\c^\c@(\c@\cD\c@,\c@1\c@\cU\c@\cD\c@\c]\c@I\c@\cG\c@\cE\c@\cP\c@a\c@\c@\c@\cH\c@\cG\c@u\c@\cC\c@\cL\c@\cA\c@ƒ\c@\cG\c@\cN\c@\c@\c@‰\c@\cK\c@\cO\c@\cA\c@ˆ\c@\cM\c@\cN\c@\cC\c@€\c@\cN\c@\cJ\c@\cF\c@v\c@\cL\c@\cG\c@\cJ\c@m\c@\cI\c@\cD\c@\cM\c@e\c@\cD\c@\cA\c@\cO\c@_\c@\cA\c@\cC\c@\cN\c@]\c@\c@\c@\cI\c@\cK\c@Y\c@\c@\c@\cT\c@\cH\c@T\c@\c@\c@ \c@\cD\c@L\c@\c@\c@-\c@\cB\c@\@\c@\c@\c@8\c@\c@\c@2\c@\c@\c@\@\c@\c@\c@#\c@\c@\c@C\c@\c@\c@\cX\c@\c@\c@D\c@\c@\c@\cQ\c@\c@\c@F\c@\c@\c@\cO\c@\c@\c@K\c@\c@\c@\cQ\c@\c@\c@S\c@\c@\c@\cU\c@\c@\c@]\c@\c@\c@\cY\c@\c@\c@h\c@\c@\c@\e\c@\c@\c@q\c@\c@\c@\cY\c@\c@\c@w\c@\c@\c@\cU\c@\c@\c@x\c@\c@\c@\cO\c@\c@\c@t\c@\c@\c@\cJ\c@\cG\c@l\c@\c@\c@\cE\c@\cW\c@_\c@\c@\c@\cB\c@,\c@O\c@\c@\c@\c@\c@H\c@?\c@\c@\c@\c@\c@j\c@2\c@\c@\c@\c@\c@Œ\c@)\c@\c@\c@\cB\c@ª\c@\$\c@\cC\c@\cE\c@À\c@#\c@\cK\c@\cH\c@Ê\c@\$\c@\cW\c@\cL\c@Ç\c@#\c@#\c@\cS\c@³\c@ \c@.\c@\e\c@\c@\cZ\c@3\c@'\c@d\c@\cR\c@0\c@6\c@>\c@\cL\c@'\c@F\c@\c_\c@\cH\c@\e\c@S\c@\cI\c@\cG\c@\cO\c@\\\c@\c@\c@\cI\c@\cF\c@_\c@\cL\c@\cK\c@\cA\c@Z\c@&\c@\cL\c@\c@\c@N\c@J\c@\cL\c@\c@\c@?\c@r\c@\cK\c@\c@\c@/\c@œ\c@\cK\c@\c@\c@\c_\c@µ\c@\cM\c@\c@\c@\cT\c@µ\c@\cQ\c@\cA\c@\cM\c@ž\c@\cV\c@\cF\c@\cI\c@v\c@\cY\c@\cM\c@\cI\c@L\c@\e\c@\cV\c@\cJ\c@,\c@\cX\c@\c_\c@\cK\c@#\c@\cR\c@&\c@\cK\c@4\c@\cL\c@)\c@\cK\c@^\c@\cF\c@'\c@\cJ\c@‘\c@\cB\c@\"\c@\cG\c@Æ\c@\c@\c@\c\\c@\cE\c@í\c@\c@\c@\cW\c@\cD\c@ü\c@\c@\c@\cV\c@\cB\c@ô\c@\c@\c@\cZ\c@\c@\c@Ø\c@\c@\c@!\c@\c@\c@²\c@\c@\c@*\c@\c@\c@\c@\c@\c@3\c@\c@\c@q\c@\c@\c@8\c@\c@\c@e\c@\c@\c@9\c@\c@\c@h\c@\c@\c@5\c@\c@\c@u\c@\c@\c@-\c@\c@\c@†\c@\cB\c@\"\c@\c@\c@“\c@\cD\c@\cW\c@\c@\c@—\c@\cH\c@\cN\c@\c@\c@\c@\cL\c@\cG\c@\c@\c@\c@\cP\c@\cE\c@\cC\c@r\c@\cT\c@\cD\c@\cJ\c@i\c@\cY\c@\cE\c@\cS\c@i\c@\c^\c@\cE\c@\c^\c@t\c@\$\c@\cE\c@)\c@†\c@+\c@\cE\c@1\c@š\c@2\c@\cF\c@3\c@§\c@:\c@\cK\c@/\c@©\c@B\c@\cR\c@&\c@\c@J\c@\c\\c@\e\c@ƒ\c@S\c@&\c@\cP\c@^\c@[\c@,\c@\cH\c@>\c@_\c@.\c@\cC\c@!\c@_\c@(\c@\c@\c@\cL\c@Y\c@\c_\c@\c@\c@\c@\c@M\c@\cT\c@\c@\c@\c@\c@<\c@\cK\c@\c@\c@\cK\c@)\c@\cC\c@\c@\c@\c]\c@\cY\c@\c@\c@\c@\c@3\c@\cL\c@\c@\c@\c@\c@J\c@\cD\c@\c@\c@\c@\c@a\c@\c@\c@\c@\c@\c@\c@k\c@\cD\c@\c@\c@\c@\c@g\c@\cL\c@\cC\c@\c@\c@X\c@\cW\c@\cH\c@\c@\c@B\c@%\c@\cO\c@\c@\c@+\c@5\c@\cV\c@\c@\c@\cX\c@C\c@\c]\c@\c@\c@\cK\c@L\c@ \c@\cA\c@\cG\c@Q\c@\c]\c@\cE\c@\cM\c@Q\c@\cV\c@\cG\c@\c_\c@M\c@\cO\c@\cI\c@7\c@G\c@\cH\c@\cJ\c@U\c@?\c@\cB\c@\cJ\c@q\c@6\c@\c@\c@\cH\c@„\c@+\c@\c@\c@\cH\c@‡\c@ \c@\c@\c@\cK\c@w\c@\cU\c@\cD\c@\cR\c@Z\c@\cL\c@\cL\c@\c\\c@=\c@\cE\c@\cX\c@&\c@ \c@\cA\c@%\c@.\c@\cJ\c@\c@\c@5\c@0\c@\c@\c@\c@\c@E\c@-\c@\cH\c@\c@\c@T\c@\$\c@\cY\c@\c@\c@b\c@\cY\c@2\c@\c@\c@r\c@\cN\c@L\c@\c@\c@€\c@\cF\c@e\c@\c@\c@Ž\c@\cA\c@t\c@\cA\c@—\c@\cA\c@t\c@\cD\c@›\c@\cD\c@d\c@\cI\c@–\c@\cE\c@K\c@\cP\c@Š\c@\cF\c@1\c@\cW\c@y\c@\cF\c@\e\c@\e\c@d\c@\cE\c@\cK\c@\c\\c@O\c@\cC\c@\cB\c@\cX\c@=\c@\cB\c@\c@\c@\cR\c@0\c@\cE\c@\c@\c@\cK\c@'\c@\cL\c@\c@\c@\cE\c@\"\c@\cW\c@\c@\c@\cA\c@\c^\c@\$\c@\c@\c@\c@\c@\cZ\c@2\c@\cA\c@\c@\c@\cV\c@<\c@\cB\c@\c@\c@\cR\c@A\c@\cD\c@\cD\c@\cM\c@>\c@\cI\c@\cM\c@\cJ\c@4\c@\cP\c@\e\c@\cJ\c@&\c@\cZ\c@,\c@\cM\c@\cY\c@\$\c@A\c@\cR\c@\cL\c@-\c@T\c@\cX\c@\cD\c@3\c@b\c@\c\\c@\c@\c@3\c@l\c@\c]\c@\c@\c@.\c@p\c@\cZ\c@\cA\c@%\c@p\c@\cS\c@\cF\c@\cZ\c@o\c@\cM\c@\cN\c@\cP\c@m\c@\cG\c@\cW\c@\cH\c@j\c@\cB\c@\"\c@\cB\c@f\c@\c@\c@.\c@\c@\c@a\c@\c@\c@6\c@\c@\c@\\\c@\cF\c@<\c@\c@\c@W\c@\cN\c@=\c@\c@\c@T\c@\cY\c@;\c@\c@\c@R\c@'\c@3\c@\cA\c@R\c@6\c@'\c@\cB\c@Q\c@B\c@\e\c@\cC\c@O\c@J\c@\cP\c@\cE\c@I\c@O\c@\cG\c@\cL\c@\@\c@P\c@\cA\c@\cX\c@6\c@O\c@\c@\c@,\c@*\c@N\c@\c@\c@H\c@ \c@O\c@\c@\c@i\c@\cY\c@T\c@\cA\c@Š\c@\cT\c@[\c@\cA\c@¤\c@\cQ\c@e\c@\cA\c@³\c@\cO\c@n\c@\cA\c@µ\c@\cL\c@r\c@\c@\c@­\c@\cI\c@n\c@\c@\c@ \c@\cF\c@d\c@\c@\c@•\c@\cC\c@S\c@\c@\c@“\c@\c@\c@>\c@\c@\c@œ\c@\c@\c@*\c@\cB\c@±\c@\cB\c@\c]\c@\cF\c@Ê\c@\cF\c@\cV\c@\cH\c@à\c@\cM\c@\cY\c@\cJ\c@ê\c@\cT\c@!\c@\cK\c@ß\c@\e\c@+\c@\cK\c@¿\c@ \c@2\c@\cK\c@\c@ \c@5\c@\cL\c@_\c@\c]\c@0\c@\cR\c@5\c@\cU\c@%\c@\e\c@\cT\c@\cN\c@\cZ\c@&\c@\cB\c@\cG\c@\cO\c@2\c@\c@\c@\cB\c@\cF\c@>\c@\c@\c@\c@\c@\cA\c@G\c@\c@\c@\c@\c@\c@\c@L\c@\c@\c@\c@\c@\c@\c@L\c@\cK\c@\c@\c@\c@\c@F\c@ \c@\c@\c@\cA\c@;\c@=\c@\cC\c@\cG\c@-\c@]\c@\cJ\c@\cO\c@\c^\c@~\c@\cR\c@\cX\c@\cQ\c@“\c@\cY\c@\"\c@\cH\c@–\c@\c^\c@)\c@\cB\c@…\c@\c]\c@+\c@\c@\c@e\c@\cX\c@'\c@\c@\c@E\c@\cQ\c@\c^\c@\cE\c@'\c@\cI\c@\cT\c@\cL\c@\cP\c@\cC\c@\cK\c@\cU\c@\cA\c@\c@\c@\cD\c@ \c@\c@\c@\c@\c@\c@\c@+\c@\cG\c@\c@\c@\c@\c@2\c@\cY\c@\c@\c@\c@\c@5\c@5\c@\c@\c@\cB\c@7\c@X\c@\c@\c@\cE\c@7\c@€\c@\c@\c@\cI\c@9\c@¤\c@\c@\c@\cK\c@>\c@¼\c@\c@\c@\cL\c@F\c@Á\c@\cB\c@\cK\c@O\c@±\c@\cE\c@\cH\c@Y\c@Ž\c@\cI\c@\cE\c@`\c@f\c@\cN\c@\cA\c@c\c@\@\c@\cS\c@\c@\c@b\c@\c_\c@\cV\c@\cA\c@[\c@\cJ\c@\cX\c@\cD\c@P\c@\c\\c@\cV\c@\cG\c@B\c@M\c@\cS\c@\cJ\c@1\c@‘\c@\cP\c@\cN\c@ \c@â\c@\cL\c@\cR\c@\cS\cA<\c@\cH\c@\cW\c@\cI\cA\c?\c@\cE\c@\c^\c@\cB\cAŸ\c@\cC\c@'\c@\c@\cA•\c@\cA\c@3\c@\c@\cAe\c@\cA\c@\@\c@\c@\cA\c\\c@\cB\c@N\c@\c@\c@È\c@\cE\c@Y\c@\cB\c@{\c@\cG\c@b\c@\cF\c@A\c@\cH\c@i\c@\cJ\c@\"\c@\cI\c@n\c@\cP\c@!\c@\cI\c@p\c@\cU\c@:\c@\cI\c@q\c@\cZ\c@c\c@\cJ\c@q\c@\c^\c@”\c@\cM\c@p\c@!\c@¿\c@\cQ\c@m\c@#\c@Ü\c@\cV\c@g\c@%\c@ã\c@\cX\c@]\c@'\c@Ó\c@\cZ\c@O\c@)\c@²\c@\e\c@<\c@)\c@†\c@\c\\c@)\c@(\c@X\c@\c]\c@\cY\c@\$\c@3\c@ \c@\cK\c@\c\\c@\cX\c@\$\c@\cB\c@\cT\c@\cH\c@*\c@\c@\c@\cL\c@\c@\c@0\c@\c@\c@\cF\c@\c@\c@8\c@\cE\c@\cA\c@\c@\c@\@\c@\cL\c@\c@\c@\c@\c@F\c@\cT\c@\c@\c@\c@\c@I\c@\c]\c@\c@\c@\c@\c@G\c@'\c@\c@\c@\c@\c@A\c@,\c@\c@\c@\c@\c@7\c@-\c@\c@\c@\c@\c@)\c@+\c@\c@\c@\cA\c@\e\c@'\c@\cA\c@\cJ\c@\cP\c@ \c@\cB\c@\cX\c@\cG\c@\cY\c@\cD\c@,\c@\cB\c@\cR\c@\cG\c@E\c@\c@\c@\cM\c@\cK\c@e\c@\c@\c@\cI\c@\cP\c@‡\c@\cA\c@\cG\c@\cV\c@¬\c@\cG\c@\cG\c@\e\c@Ñ\c@\cQ\c@\cG\c@\c_\c@ó\c@\c_\c@\cH\c@!\cA\cM\c@/\c@\cI\c@\c_\cA\cU\c@\@\c@\cJ\c@\cZ\cA\cF\c@N\c@\cK\c@\cT\c@à\c@U\c@\cL\c@\cM\c@§\c@U\c@\cM\c@\cG\c@o\c@M\c@\cL\c@\cD\c@?\c@\@\c@\cK\c@\cF\c@\cZ\c@/\c@\cI\c@\cM\c@\cC\c@\c_\c@\cG\c@\cX\c@\cL\c@\cQ\c@\cD\c@&\c@'\c@\cH\c@\cB\c@5\c@J\c@\cF\c@\c@\c@A\c@o\c@\cG\c@\c@\c@I\c@•\c@\cL\c@\c@\c@I\c@­\c@\cR\c@\c@\c@B\c@­\c@\cV\c@\c@\c@4\c@š\c@\cW\c@\cB\c@\$\c@y\c@\cU\c@\cF\c@\cV\c@S\c@\cQ\c@\cI\c@\cJ\c@2\c@\cL\c@\cL\c@\cB\c@\cY\c@\cG\c@\cM\c@\cA\c@\cI\c@\cC\c@\cK\c@\cG\c@\c@\c@\c@\c@\cI\c@\cP\c@\c@\c@\c@\c@\cE\c@\e\c@\c@\c@\c@\c@\cB\c@'\c@\c@\c@\c@\c@\c@\c@4\c@\c@\c@\c@\c@\c@\c@<\c@\c@\c@\c@\c@\cB\c@\@\c@\cI\c@\c@\c@\cD\c@>\c@!\c@\c@\c@\cF\c@8\c@J\c@\c@\c@\cH\c@-\c@…\c@\c@\c@\cI\c@\"\c@Ñ\c@\c@\c@\cJ\c@\cU\cA\"\c@\cA\c@\cL\c@\cL\cAi\c@\cE\c@\cO\c@\cE\cAš\c@\cK\c@\cR\c@\cA\cA­\c@\cS\c@\cW\c@\c@\cAŸ\c@\c\\c@\cZ\c@\c@\cAs\c@&\c@\cZ\c@\c@\cA4\c@+\c@\cX\c@\c@\c@í\c@.\c@\cS\c@\c@\c@ª\c@+\c@\cM\c@\c@\c@s\c@&\c@\cG\c@\c@\c@M\c@\c\\c@\cC\c@\c@\c@8\c@\cS\c@\c@\c@\c@\c@0\c@\cK\c@\c@\c@\cA\c@2\c@\cE\c@\c@\c@\cF\c@9\c@\cA\c@\c@\c@\cN\c@C\c@\c@\c@\c@\c@\cX\c@N\c@\c@\c@\c@\c@\$\c@W\c@\c@\c@\c@\c@1\c@^\c@\c@\c@\cE\c@;\c@b\c@\c@\c@\cK\c@D\c@a\c@\cB\c@\cS\c@K\c@Y\c@\cF\c@\e\c@Q\c@M\c@\cL\c@!\c@V\c@;\c@\cR\c@#\c@Y\c@)\c@\cX\c@!\c@[\c@\cZ\c@\c\\c@\e\c@Z\c@\cM\c@\cZ\c@\cT\c@W\c@\cE\c@\cU\c@\cO\c@S\c@\cB\c@\cO\c@\cI\c@M\c@\c@\c@\cI\c@\cF\c@E\c@\c@\c@\cC\c@\cC\c@=\c@\c@\c@\c@\c@\cB\c@4\c@\c@\c@\c@\c@\c@\c@)\c@\c@\c@\c@\c@\c@\c@\c^\c@\c@\c@\c@\c@\c@\c@\cV\c@\c@\c@\c@\c@\cF\c@\cP\c@\c@\c@\c@\c@\cP\c@\cO\c@\c@\c@\c@\c@\e\c@\cR\c@\cL\c@\c@\c@'\c@\cX\c@%\c@\c@\c@4\c@\"\c@I\c@\c@\c@<\c@,\c@s\c@\c@\c@?\c@8\c@¡\c@\c@\c@=\c@F\c@À\c@\c@\c@9\c@W\c@É\c@\c@\c@2\c@j\c@·\c@\c@\c@,\c@~\c@\c@\c@\c@&\c@‘\c@c\c@\c@\c@#\c@¡\c@:\c@\c@\c@ \c@«\c@\cY\c@\cC\c@\c_\c@¬\c@\cC\c@\cK\c@\c]\c@£\c@\c@\c@\cV\c@\cY\c@\c@\cV\c@#\c@\cR\c@t\c@G\c@3\c@\cL\c@Q\c@\c@B\c@\cG\c@4\c@à\c@L\c@\cB\c@\e\cA;\c@Q\c@\c@\c@\cI\cAƒ\c@T\c@\c@\c@\c@\cA¦\c@V\c@\c@\c@\c@\cA\c@X\c@\c@\c@\c@\cAo\c@^\c@\c@\c@\cA\cA%\c@g\c@\c@\c@\cD\c@Ð\c@r\c@\c@\c@\cH\c@ƒ\c@~\c@\c@\c@\cM\c@F\c@ˆ\c@\c@\c@\cR\c@#\c@\c@\c@\c@\cV\c@\c^\c@‘\c@\c@\c@\cX\c@3\c@\c@\c@\c@\cX\c@T\c@Š\c@\c@\c@\cT\c@y\c@\c@\c@\c@\cP\c@š\c@w\c@\c@\c@\cK\c@­\c@m\c@\c@\c@\cG\c@³\c@b\c@\cB\c@\cB\c@°\c@X\c@\cD\c@\c@\c@ª\c@M\c@\cG\c@\c@\c@¤\c@C\c@\cK\c@\c@\c@¦\c@7\c@\cP\c@\c@\c@¯\c@,\c@\cU\c@\c@\c@½\c@\"\c@\e\c@\c@\c@Í\c@\e\c@ \c@\c@\c@Û\c@\cV\c@%\c@\c@\c@ß\c@\cT\c@'\c@\c@\c@Ó\c@\cR\c@%\c@\c@\c@¸\c@\cS\c@\c_\c@\cC\c@‘\c@\cS\c@\cW\c@\cH\c@f\c@\cS\c@\cN\c@\cM\c@D\c@\cQ\c@\cG\c@\cR\c@3\c@\cO\c@\cB\c@\cV\c@8\c@\cL\c@\c@\c@\cV\c@N\c@\cI\c@\c@\c@\cQ\c@n\c@\cE\c@\c@\c@\cL\c@\c@\cC\c@\c@\c@\cG\c@¢\c@\cA\c@\c@\c@\cC\c@¦\c@\c@\c@\c@\c@\c@\c@›\c@\c@\c@\cB\c@\c@\c@‚\c@\cD\c@\cG\c@\c@\c@f\c@\cM\c@\cM\c@\cA\c@N\c@\cX\c@\cT\c@\cD\c@B\c@%\c@\e\c@\cH\c@G\c@2\c@ \c@\cM\c@\\\c@;\c@!\c@\cU\c@|\c@>\c@ \c@\c_\c@›\c@:\c@\e\c@,\c@°\c@2\c@\cT\c@=\c@²\c@(\c@\cM\c@R\c@¢\c@\c\\c@\cG\c@k\c@„\c@\cQ\c@\cB\c@„\c@a\c@\cI\c@\c@\c@\c@B\c@\cD\c@\c@\c@¯\c@0\c@\c@\c@\c@\c@º\c@/\c@\c@\c@\c@\c@¾\c@<\c@\c@\c@\c@\c@¸\c@R\c@\cB\c@\cD\c@«\c@h\c@\cD\c@\cI\c@š\c@u\c@\cH\c@\cP\c@‡\c@q\c@\cL\c@\cU\c@s\c@_\c@\cS\c@\cY\c@a\c@E\c@\cY\c@\cY\c@Q\c@*\c@ \c@\cV\c@C\c@\cS\c@'\c@\cP\c@5\c@\cD\c@-\c@\cJ\c@(\c@\c@\c@/\c@\cE\c@\c]\c@\c@\c@/\c@\cB\c@\cR\c@\c@\c@,\c@\c@\c@\cL\c@\c@\c@&\c@\cA\c@\cJ\c@\c@\c@\c]\c@\cC\c@\cN\c@\c@\c@\cS\c@\cE\c@\cW\c@\cB\c@\cL\c@\cG\c@%\c@\cD\c@\cE\c@\cH\c@8\c@\cE\c@\cA\c@\cG\c@N\c@\cF\c@\c@\c@\cF\c@e\c@\cE\c@\c@\c@\cF\c@y\c@\cD\c@\c@\c@\cI\c@‰\c@\cB\c@\c@\c@\cP\c@“\c@\c@\c@\c@\c@\c]\c@–\c@\c@\c@\cD\c@,\c@“\c@\c@\c@\cL\c@;\c@‰\c@\c@\c@\cV\c@E\c@{\c@\c@\c@\c^\c@F\c@i\c@\c@\c@&\c@=\c@V\c@\c@\c@&\c@.\c@B\c@\c@\c@\c_\c@\c^\c@1\c@\c@\c@\cV\c@\cO\c@#\c@\c@\c@\cM\c@\cD\c@\cZ\c@\cC\c@\cE\c@\c@\c@\cW\c@\cF\c@\c@\c@\cC\c@\cX\c@\cH\c@\c@\c@\cL\c@\c\\c@\cI\c@\c@\c@\cZ\c@#\c@\cK\c@\cD\c@,\c@+\c@\cN\c@\cM\c@?\c@3\c@\cW\c@\cY\c@P\c@9\c@(\c@&\c@Y\c@>\c@B\c@3\c@W\c@A\c@d\c@:\c@M\c@B\c@‹\c@9\c@<\c@B\c@³\c@0\c@)\c@D\c@Ö\c@\"\c@\cX\c@H\c@ï\c@\cU\c@\cL\c@N\c@ø\c@\cJ\c@\cC\c@U\c@í\c@\cC\c@\c@\c@]\c@Ð\c@\c@\c@\c@\c@d\c@©\c@\c@\c@\cF\c@f\c@€\c@\c@\c@\cS\c@e\c@b\c@\c@\c@'\c@]\c@X\c@\c@\c@A\c@P\c@d\c@\c@\c@b\c@?\c@‚\c@\c@\c@\c@-\c@¨\c@\cC\c@›\c@\c\\c@É\c@\cH\c@¬\c@\cO\c@Ú\c@\cO\c@¶\c@\cF\c@Õ\c@\cV\c@·\c@\cA\c@¸\c@\c\\c@´\c@\c@\c@Š\c@\c_\c@®\c@\cB\c@\\\c@\c^\c@§\c@\cG\c@4\c@\cY\c@ \c@\cM\c@\cU\c@\cR\c@™\c@\cW\c@\cC\c@\cK\c@‘\c@!\c@\cD\c@\cF\c@‰\c@+\c@\cM\c@\cB\c@‚\c@3\c@\cT\c@\c@\c@|\c@7\c@\cZ\c@\cB\c@x\c@7\c@\c^\c@\cE\c@u\c@2\c@\e\c@\cJ\c@r\c@*\c@\cU\c@\cN\c@n\c@!\c@\cM\c@\cS\c@f\c@\cU\c@\cE\c@\cS\c@\\\c@\cM\c@\cA\c@\cQ\c@P\c@\cF\c@\c@\c@\cM\c@C\c@\cB\c@\c@\c@\cH\c@5\c@\c@\c@\c@\c@\cC\c@*\c@\cD\c@\cB\c@\cA\c@ \c@\cK\c@\cH\c@\c@\c@\cX\c@\cS\c@\cP\c@\c@\c@\cS\c@\c]\c@\cV\c@\c@\c@\cQ\c@'\c@\e\c@\c@\c@\cQ\c@/\c@\e\c@\c@\c@\cT\c@3\c@\cV\c@\c@\c@\cZ\c@7\c@\cP\c@\c@\c@ \c@9\c@\cH\c@\c@\c@&\c@;\c@\cB\c@\c@\c@*\c@>\c@\c@\c@\cB\c@,\c@D\c@\c@\c@\cI\c@*\c@I\c@\c@\c@\cU\c@%\c@M\c@\c@\c@\$\c@\c_\c@N\c@\c@\c@7\c@\cW\c@O\c@\cI\c@J\c@\cP\c@K\c@\e\c@X\c@\cI\c@E\c@4\c@\\\c@\cE\c@<\c@M\c@X\c@\cB\c@2\c@d\c@L\c@\c@\c@&\c@n\c@:\c@\c@\c@\e\c@g\c@&\c@\c@\c@\cR\c@R\c@\cV\c@\c@\c@\cJ\c@7\c@\cK\c@\c@\c@\cF\c@\c_\c@\cH\c@\c@\c@\cC\c@\cS\c@\cL\c@\c@\c@\cB\c@\cW\c@\cV\c@\c@\c@\cA\c@/\c@#\c@\c@\c@\c@\c@T\c@2\c@\c@\c@\c@\c@†\c@>\c@\cA\c@\c@\c@½\c@F\c@\cD\c@\c@\c@ï\c@I\c@\cH\c@\c@\cA\cT\c@H\c@\cN\c@\c@\cA'\c@B\c@\cU\c@\c@\cA#\c@:\c@\c]\c@\c@\cA\cL\c@3\c@%\c@\c@\c@è\c@-\c@-\c@\c@\c@À\c@)\c@4\c@\c@\c@œ\c@(\c@9\c@\cA\c@‚\c@)\c@;\c@\cC\c@s\c@)\c@8\c@\cE\c@o\c@)\c@1\c@\cF\c@q\c@'\c@\$\c@\cF\c@s\c@!\c@\cY\c@\cE\c@s\c@\cY\c@\cN\c@\cC\c@k\c@\cR\c@\cF\c@\cA\c@]\c@\cL\c@\c@\c@\c@\c@L\c@\cL\c@\c@\c@\c@\c@<\c@\cR\c@\cB\c@\c@\c@0\c@\c]\c@\cH\c@\c@\c@,\c@*\c@\cO\c@\c@\c@.\c@9\c@\cV\c@\c@\c@2\c@D\c@\c]\c@\c@\c@4\c@L\c@ \c@\c@\c@2\c@P\c@\c_\c@\c@\c@(\c@P\c@\cY\c@\c@\c@\c]\c@L\c@\cR\c@\c@\c@\cQ\c@E\c@\cK\c@\c@\c@\cG\c@>\c@\cE\c@\c@\c@\cA\c@5\c@\cA\c@\cB\c@\c@\c@/\c@\c@\c@\cG\c@\cD\c@-\c@\c@\c@\cL\c@\cW\c@0\c@\cB\c@\cR\c@6\c@7\c@\cG\c@\cW\c@^\c@A\c@\cN\c@\cY\c@‹\c@J\c@\cS\c@\cY\c@·\c@P\c@\cX\c@\cV\c@Ñ\c@Q\c@\cX\c@\cS\c@Õ\c@M\c@\cT\c@\cP\c@Æ\c@C\c@\cN\c@\cN\c@§\c@5\c@\cH\c@\cN\c@\c@'\c@\cB\c@\cO\c@^\c@\cY\c@\c@\c@\cO\c@F\c@\cN\c@\c@\c@\cR\c@9\c@\cF\c@\c@\c@\cU\c@4\c@\cB\c@\c@\c@\cY\c@3\c@\c@\c@\c@\c@!\c@.\c@\c@\c@\c@\c@*\c@%\c@\c@\c@\cB\c@4\c@\cZ\c@\c@\c@\cD\c@>\c@\cO\c@\c@\c@\cH\c@H\c@\cD\c@\c@\c@\cO\c@O\c@\c@\c@\c@\c@\cX\c@T\c@\c@\c@\c@\c@#\c@T\c@\c@\c@\c@\c@0\c@P\c@\c@\c@\c@\c@;\c@E\c@\cB\c@\cB\c@C\c@6\c@\cL\c@\cD\c@E\c@%\c@\c]\c@\cH\c@B\c@\cV\c@4\c@\cL\c@8\c@\cJ\c@N\c@\cO\c@)\c@\cB\c@h\c@\cP\c@\e\c@\cB\c@w\c@\cM\c@\cO\c@\cG\c@x\c@\cJ\c@\cF\c@\cP\c@j\c@\cF\c@\c@\c@\cZ\c@S\c@\cC\c@\c@\c@'\c@8\c@\c@\c@\c@\c@0\c@%\c@\c@\c@\c@\c@5\c@!\c@\c@\c@\cA\c@2\c@0\c@\c@\c@\cC\c@)\c@Q\c@\cD\c@\cD\c@\c]\c@~\c@\cJ\c@\cG\c@\cQ\c@­\c@\cS\c@\cJ\c@\cH\c@Ô\c@\c^\c@\cN\c@\cB\c@ð\c@*\c@\cQ\c@\c@\c@ý\c@4\c@\cU\c@\c@\c@ý\c@9\c@\cX\c@\cC\c@õ\c@9\c@\e\c@\cH\c@é\c@4\c@\c]\c@\cM\c@Û\c@+\c@\c]\c@\cS\c@Ï\c@\c_\c@\c]\c@\cZ\c@Ä\c@\cT\c@\e\c@\c_\c@¼\c@\cK\c@\cW\c@!\c@¶\c@\cD\c@\cQ\c@\$\c@³\c@\c@\c@\cL\c@%\c@²\c@\c@\c@\cG\c@%\c@²\c@\cB\c@\cE\c@%\c@±\c@\cD\c@\cG\c@%\c@¯\c@\cH\c@\cL\c@\$\c@«\c@\cN\c@\cS\c@\"\c@£\c@\cU\c@\c\\c@\c^\c@˜\c@\c^\c@#\c@\cY\c@‰\c@&\c@*\c@\cR\c@w\c@.\c@.\c@\cL\c@c\c@3\c@/\c@\cG\c@O\c@7\c@-\c@\cB\c@>\c@7\c@(\c@\c@\c@0\c@6\c@!\c@\c@\c@&\c@6\c@\cY\c@\c@\c@\c^\c@6\c@\cQ\c@\c@\c@\cW\c@7\c@\cJ\c@\c@\c@\cP\c@8\c@\cF\c@\c@\c@\cK\c@8\c@\cE\c@\c@\c@\cF\c@5\c@\cF\c@\c@\c@\cB\c@.\c@\cF\c@\c@\c@\c@\c@\$\c@\cF\c@\c@\c@\c@\c@\cY\c@\cE\c@\cA\c@\c@\c@\cO\c@\cD\c@\cC\c@\c@\c@\cG\c@\cC\c@\cE\c@\cH\c@\cB\c@\cD\c@\cG\c@\cZ\c@\c@\c@\cJ\c@\cJ\c@3\c@\c@\c@\cS\c@\cN\c@Q\c@\c@\c@!\c@\cQ\c@r\c@\c@\c@0\c@\cS\c@Œ\c@\cA\c@?\c@\cS\c@ž\c@\cE\c@K\c@\cQ\c@¥\c@\cL\c@O\c@\cM\c@¦\c@\cS\c@K\c@\cI\c@¤\c@\e\c@\@\c@\cE\c@£\c@!\c@0\c@\cA\c@£\c@#\c@ \c@\c@\c@¦\c@!\c@\cR\c@\c@\c@¨\c@\e\c@\cJ\c@\c@\c@¦\c@\cU\c@\cI\c@\c@\c@œ\c@\cO\c@\cP\c@\c@\c@ˆ\c@\cL\c@\c\\c@\c@\c@j\c@\cM\c@+\c@\c@\c@I\c@\cQ\c@9\c@\cC\c@-\c@\cW\c@D\c@\cH\c@\cU\c@\c\\c@K\c@\cN\c@\cF\c@!\c@L\c@\cU\c@\c@\c@#\c@G\c@\e\c@\c@\c@%\c@?\c@\c]\c@\c@\c@'\c@4\c@\c\\c@\c@\c@-\c@)\c@\cW\c@\c@\c@5\c@ \c@\cP\c@\cD\c@\@\c@\cZ\c@\cJ\c@\cR\c@N\c@\cT\c@\cD\c@'\c@Z\c@\cO\c@\cA\c@B\c@f\c@\cJ\c@\c@\c@d\c@n\c@\cG\c@\c@\c@‰\c@s\c@\cC\c@\c@\c@­\c@u\c@\c@\c@\c@\c@Ð\c@t\c@\c@\c@\c@\c@ï\c@o\c@\c@\c@\c@\cA\cJ\c@i\c@\c@\c@\c@\cA\cZ\c@b\c@\c@\c@\cD\cA\cZ\c@[\c@\c@\c@\cK\cA\cI\c@W\c@\cC\c@\cU\c@è\c@V\c@\cH\c@!\c@¿\c@Z\c@\cP\c@/\c@˜\c@b\c@\cY\c@;\c@~\c@m\c@#\c@A\c@v\c@z\c@)\c@\@\c@ƒ\c@„\c@+\c@9\c@ž\c@ˆ\c@)\c@+\c@¿\c@†\c@#\c@\c]\c@Û\c@{\c@\cZ\c@\cQ\c@é\c@i\c@\cR\c@\cG\c@â\c@R\c@\cJ\c@\cA\c@Å\c@8\c@\cE\c@\cA\c@—\c@\"\c@\cB\c@\cI\c@g\c@\cQ\c@\c@\c@\cT\c@=\c@\cF\c@\c@\c@\$\c@\e\c@\c@\c@\c@\c@6\c@\cF\c@\c@\c@\c@\c@H\c@\c@\c@\c@\c@\c@\c@T\c@\c@\c@\c@\c@\c@\c@X\c@\c@\c@\cA\c@\c@\c@T\c@\c@\c@\cD\c@\c@\c@J\c@\cB\c@\cI\c@\c@\c@<\c@\cJ\c@\cO\c@\c@\c@.\c@\cV\c@\cU\c@\cB\c@#\c@#\c@\cZ\c@\cH\c@\e\c@2\c@\c]\c@\cS\c@\cW\c@?\c@\c\\c@\c_\c@\cW\c@H\c@\cW\c@,\c@\cX\c@N\c@\cQ\c@7\c@\cX\c@T\c@\cK\c@:\c@\cX\c@Y\c@\cF\c@5\c@\cW\c@\\\c@\cB\c@)\c@\cS\c@\\\c@\c@\c@\c\\c@\cO\c@X\c@\c@\c@\cP\c@\cJ\c@N\c@\c@\c@\cF\c@\cF\c@\@\c@\c@\c@\c@\c@\cC\c@1\c@\c@\c@\c@\c@\cA\c@%\c@\c@\c@\cC\c@\c@\c@ \c@\c@\c@\cM\c@\c@\c@\$\c@\cA\c@\cZ\c@\c@\c@4\c@\cB\c@)\c@\c@\c@M\c@\cE\c@8\c@\c@\c@k\c@\cG\c@D\c@\c@\c@Œ\c@\cH\c@I\c@\c@\c@¬\c@\cI\c@F\c@\c@\c@È\c@\cG\c@?\c@\c@\c@ß\c@\cE\c@4\c@\c@\c@ñ\c@\cC\c@*\c@\c@\c@þ\c@\cA\c@!\c@\c@\cA\cF\c@\cB\c@\cZ\c@\c@\cA\cI\c@\cF\c@\cV\c@\c@\cA\cE\c@\cM\c@\cT\c@\c@\c@ü\c@\cU\c@\cS\c@\c@\c@í\c@\c]\c@\cS\c@\c@\c@Ú\c@%\c@\cT\c@\cA\c@Å\c@+\c@\cV\c@\cB\c@®\c@.\c@\cZ\c@\cC\c@–\c@0\c@\c_\c@\cC\c@€\c@2\c@\$\c@\cB\c@j\c@2\c@)\c@\cA\c@W\c@0\c@+\c@\c@\c@F\c@-\c@)\c@\c@\c@7\c@(\c@\$\c@\c@\c@)\c@!\c@\e\c@\c@\c@\c]\c@\cZ\c@\cR\c@\c@\c@\cU\c@\cT\c@\cJ\c@\c@\c@\cS\c@\cP\c@\cD\c@\cA\c@\cW\c@\cM\c@\cD\c@\cB\c@!\c@\cN\c@\cI\c@\cC\c@.\c@\cQ\c@\cR\c@\cC\c@8\c@\cV\c@\c\\c@\cB\c@>\c@\c]\c@)\c@\cA\c@;\c@\$\c@5\c@\c@\c@2\c@*\c@>\c@\c@\c@\$\c@.\c@E\c@\c@\c@\cV\c@-\c@I\c@\c@\c@\cM\c@)\c@J\c@\c@\c@\cL\c@!\c@G\c@\c@\c@\cU\c@\cX\c@D\c@\c@\c@(\c@\cN\c@?\c@\cD\c@\@\c@\cG\c@:\c@\cK\c@X\c@\cC\c@5\c@\cS\c@h\c@\cB\c@1\c@\c\\c@j\c@\cD\c@-\c@'\c@\\\c@\cF\c@(\c@1\c@E\c@\cG\c@#\c@9\c@,\c@\cH\c@\e\c@A\c@\cV\c@\cF\c@\cS\c@H\c@\cF\c@\cD\c@\cL\c@P\c@\c@\c@\cB\c@\cG\c@W\c@\c@\c@\cA\c@\cB\c@]\c@\c@\c@\c@\c@\c@\c@e\c@\c@\c@\c@\c@\c@\c@m\c@\c@\c@\c@\c@\cA\c@t\c@\c@\c@\c@\c@\cD\c@w\c@\c@\c@\c@\c@\cJ\c@y\c@\c@\c@\c@\c@\cP\c@v\c@\cB\c@\c@\c@\cW\c@o\c@\cJ\c@\c@\c@\c\\c@e\c@\cT\c@\cC\c@\c_\c@Z\c@!\c@\cH\c@\c^\c@M\c@2\c@\cM\c@\cZ\c@A\c@C\c@\cR\c@\cT\c@5\c@O\c@\cW\c@\cO\c@)\c@W\c@\cX\c@\cK\c@ \c@W\c@\cW\c@\cK\c@\cY\c@Q\c@\cR\c@\cM\c@\cW\c@D\c@\cM\c@\cQ\c@\cX\c@4\c@\cH\c@\cS\c@\c^\c@#\c@\cC\c@\cS\c@%\c@\cT\c@\c@\c@\cP\c@,\c@\cJ\c@\c@\c@\cK\c@4\c@\cD\c@\c@\c@\cF\c@;\c@\c@\c@\c@\c@\cB\c@B\c@\c@\c@\cA\c@\c@\c@I\c@\c@\c@\cE\c@\c@\c@R\c@\cB\c@\cL\c@\c@\c@\\\c@\cK\c@\cW\c@\c@\c@d\c@\cZ\c@#\c@\c@\c@k\c@0\c@/\c@\c@\c@m\c@M\c@7\c@\c@\c@j\c@n\c@8\c@\c@\c@b\c@Ž\c@3\c@\c@\c@W\c@§\c@(\c@\c@\c@I\c@·\c@\e\c@\c@\c@<\c@»\c@\cO\c@\c@\c@2\c@µ\c@\cG\c@\c@\c@+\c@¥\c@\cA\c@\c@\c@(\c@‘\c@\c@\c@\c@\c@'\c@y\c@\c@\c@\c@\c@*\c@a\c@\c@\c@\c@\c@.\c@K\c@\c@\c@\cB\c@1\c@9\c@\cA\c@\cE\c@5\c@*\c@\cB\c@\cH\c@9\c@\c_\c@\cD\c@\cL\c@<\c@\cX\c@\cF\c@\cN\c@>\c@\cS\c@\cI\c@\cN\c@?\c@\cN\c@\cK\c@\cL\c@?\c@\cJ\c@\cM\c@\cH\c@<\c@\cG\c@\cN\c@\cE\c@8\c@\cC\c@\cN\c@\cB\c@3\c@\c@\c@\cN\c@\c@\c@.\c@\c@\c@\cP\c@\c@\c@*\c@\c@\c@\cT\c@\c@\c@'\c@\c@\c@\e\c@\cA\c@&\c@\c@\c@%\c@\cE\c@&\c@\c@\c@0\c@\cK\c@%\c@\c@\c@9\c@\cR\c@\$\c@\c@\c@\@\c@\cY\c@#\c@\c@\c@D\c@\c_\c@!\c@\c@\c@E\c@!\c@\c_\c@\c@\c@E\c@\c_\c@\c^\c@\c@\c@D\c@\cY\c@\c]\c@\cD\c@C\c@\cR\c@\cZ\c@\cQ\c@A\c@\cK\c@\cW\c@'\c@>\c@\cE\c@\cQ\c@H\c@9\c@\cA\c@\cK\c@s\c@4\c@\c@\c@\cF\c@¤\c@.\c@\c@\c@\cB\c@Ò\c@(\c@\c@\c@\c@\c@÷\c@ \c@\c@\c@\c@\cA\cN\c@\cY\c@\c@\c@\c@\cA\cV\c@\cQ\c@\cA\c@\c@\cA\cM\c@\cK\c@\cD\c@\cA\c@õ\c@\cE\c@\cJ\c@\cE\c@Ð\c@\cB\c@\cO\c@\cJ\c@¢\c@\c@\c@\cV\c@\cR\c@o\c@\c@\c@\cZ\c@\c\\c@G\c@\c@\c@\c]\c@\$\c@%\c@\cA\c@\c]\c@+\c@\cM\c@\cB\c@\c\\c@/\c@\c@\c@\cD\c@\cZ\c@/\c@\cB\c@\cF\c@\cX\c@,\c@\cG\c@\cG\c@\cW\c@&\c@\cL\c@\cG\c@\cX\c@ \c@\cN\c@\cF\c@\cZ\c@\cY\c@\cP\c@\cF\c@\c^\c@\cS\c@\cP\c@\cF\c@#\c@\cP\c@\cM\c@\cH\c@'\c@\cN\c@\cI\c@\cJ\c@+\c@\cN\c@\cH\c@\cN\c@-\c@\cQ\c@\cI\c@\cP\c@.\c@\cV\c@\cM\c@\cR\c@+\c@\c]\c@\cS\c@\cR\c@&\c@'\c@\cY\c@\cS\c@\c_\c@2\c@ \c@\cT\c@\cV\c@=\c@#\c@\cV\c@\cN\c@E\c@!\c@\cZ\c@\cG\c@J\c@\e\c@\c\\c@\cC\c@J\c@\cT\c@\c^\c@\c@\c@G\c@\cL\c@\c]\c@\c@\c@\@\c@\cE\c@\cX\c@\c@\c@8\c@\cA\c@\cQ\c@\c@\c@4\c@\c@\c@\cK\c@\c@\c@1\c@\c@\c@\cF\c@\c@\c@1\c@\c@\c@\cB\c@\c@\c@5\c@\c@\c@\c@\c@\c@\c@;\c@\c@\c@\c@\c@\c@\c@\@\c@\c@\c@\cB\c@\cB\c@B\c@\c@\c@\cD\c@\cD\c@B\c@\c@\c@\cH\c@\cH\c@=\c@\c@\c@\cK\c@\cL\c@5\c@\cD\c@\cN\c@\cP\c@-\c@\cR\c@\cP\c@\cS\c@%\c@)\c@\cQ\c@\cV\c@ \c@H\c@\cP\c@\cV\c@\c]\c@l\c@\cO\c@\cX\c@\c_\c@‹\c@\cN\c@\cZ\c@ \c@Ÿ\c@\cL\c@\c]\c@!\c@£\c@\cI\c@#\c@!\c@—\c@\cF\c@,\c@!\c@\c?\c@\cC\c@8\c@\c^\c@a\c@\cA\c@F\c@\cY\c@B\c@\c@\c@T\c@\cT\c@(\c@\c@\c@a\c@\cN\c@\cV\c@\c@\c@k\c@\cH\c@\cI\c@\c@\c@o\c@\cC\c@\cB\c@\c@\c@n\c@\c@\c@\c@\c@\c@\c@h\c@\c@\c@\c@\c@\c@\c@a\c@\c@\c@\c@\c@\c@\c@Z\c@\c@\c@\c@\c@\c@\c@V\c@\c@\c@\c@\c@\c@\c@V\c@\c@\c@\c@\c@\c@\c@Y\c@\c@\c@\c@\c@\c@\c@_\c@\cA\c@\c@\c@\c@\c@e\c@\cD\c@\c@\c@\c@\c@h\c@\cG\c@\c@\c@\c@\c@h\c@\cK\c@\c@\c@\c@\c@b\c@\cO\c@\cC\c@\cB\c@W\c@\cR\c@\cT\c@\cF\c@I\c@\cP\c@3\c@\cI\c@7\c@\cM\c@^\c@\cN\c@%\c@\cI\c@\c@\cS\c@\cV\c@\cE\c@Å\c@\cW\c@\cK\c@\cA\c@ì\c@\cZ\c@\cD\c@\c@\cA\cB\c@\c\\c@\c@\c@\c@\cA\cC\c@\c\\c@\c@\c@\c@\c@ô\c@\cZ\c@\c@\c@\c@\c@Ù\c@\cW\c@\c@\c@\c@\c@¹\c@\cT\c@\c@\c@\c@\c@–\c@\cQ\c@\cB\c@\cA\c@u\c@\cQ\c@\cD\c@\cD\c@Z\c@\cV\c@\cG\c@\cG\c@J\c@\c^\c@\cK\c@\cK\c@I\c@(\c@\cP\c@\cQ\c@Z\c@4\c@\cV\c@\cU\c@y\c@\@\c@\c]\c@\cW\c@£\c@J\c@\"\c@\cX\c@Ð\c@P\c@&\c@\cW\c@ø\c@R\c@'\c@\cU\cA\cU\c@Q\c@\$\c@\cR\cA'\c@M\c@\c_\c@\cO\cA-\c@G\c@\cZ\c@\cK\cA(\c@A\c@\cT\c@\cH\cA\e\c@:\c@\cQ\c@\cD\cA\cG\c@2\c@\cP\c@\cB\c@ê\c@)\c@\cS\c@\c@\c@Ä\c@ \c@\cZ\c@\c@\c@—\c@\cX\c@%\c@\c@\c@g\c@\cQ\c@1\c@\cA\c@?\c@\cK\c@?\c@\cB\c@\c_\c@\cG\c@H\c@\cE\c@\cI\c@\cD\c@M\c@\cH\c@\c@\c@\cB\c@L\c@\cL\c@\c@\c@\cA\c@E\c@\cN\c@\c@\c@\c@\c@:\c@\cO\c@\cC\c@\c@\c@0\c@\cN\c@\cK\c@\c@\c@'\c@\cM\c@\cX\c@\c@\c@\"\c@\cK\c@%\c@\c@\c@!\c@\cH\c@4\c@\c@\c@\$\c@\cF\c@A\c@\c@\c@)\c@\cD\c@J\c@\c@\c@0\c@\cC\c@L\c@\c@\c@7\c@\cA\c@J\c@\cA\c@=\c@\c@\c@A\c@\cC\c@C\c@\c@\c@4\c@\cG\c@H\c@\c@\c@%\c@\cK\c@K\c@\c@\c@\cX\c@\cQ\c@L\c@\c@\c@\cK\c@\cW\c@I\c@\c@\c@\cC\c@\c\\c@B\c@\c@\c@\c@\c@\c]\c@9\c@\c@\c@\c@\c@\c^\c@.\c@\c@\c@\c@\c@\c]\c@#\c@\c@\c@\c@\c@\e\c@\cZ\c@\c@\c@\c@\c@\cZ\c@\cR\c@\c@\c@\c@\c@\c\\c@\cL\c@\c@\c@\c@\c@\c^\c@\cH\c@\c@\c@\c@\c@#\c@\cE\c@\c@\c@\cB\c@'\c@\cC\c@\c@\c@\cK\c@,\c@\cA\c@\c@\c@\e\c@0\c@\c@\c@\c@\c@/\c@4\c@\c@\c@\c@\c@D\c@7\c@\c@\c@\c@\c@X\c@;\c@\c@\c@\cA\c@a\c@?\c@\c@\c@\cF\c@`\c@B\c@\c@\c@\cM\c@T\c@F\c@\c@\c@\cV\c@B\c@J\c@\c@\c@!\c@/\c@O\c@\c@\c@*\c@\c^\c@U\c@\c@\c@0\c@\cQ\c@]\c@\cB\c@1\c@\cK\c@e\c@\cD\c@-\c@\cK\c@m\c@\cF\c@\$\c@\cR\c@t\c@\cJ\c@\cY\c@ \c@{\c@\cN\c@\cP\c@2\c@€\c@\cR\c@\cH\c@F\c@„\c@\cW\c@\cB\c@W\c@†\c@\c\\c@\c@\c@a\c@†\c@\c^\c@\c@\c@d\c@‚\c@\c_\c@\c@\c@_\c@{\c@\c\\c@\c@\c@U\c@s\c@\cY\c@\cC\c@I\c@h\c@\cS\c@\cG\c@=\c@]\c@\cN\c@\cO\c@4\c@Q\c@\cI\c@\cV\c@/\c@C\c@\cE\c@\c_\c@/\c@5\c@\cB\c@&\c@2\c@'\c@\c@\c@+\c@:\c@\c]\c@\c@\c@-\c@F\c@\cY\c@\c@\c@+\c@R\c@\cZ\c@\c@\c@(\c@^\c@ \c@\c@\c@!\c@g\c@*\c@\c@\c@\cZ\c@k\c@4\c@\c@\c@\cP\c@g\c@?\c@\c@\c@\cI\c@[\c@I\c@\c@\c@\cD\c@H\c@Q\c@\c@\c@\cA\c@2\c@Y\c@\c@\c@\c@\c@\c_\c@^\c@\c@\c@\c@\c@\cO\c@^\c@\c@\c@\c@\c@\cD\c@Y\c@\c@\c@\c@\c@\c@\c@Q\c@\c@\c@\c@\c@\c@\c@D\c@\cB\c@\c@\c@\c@\c@5\c@\cF\c@\c@\c@\c@\c@(\c@\cJ\c@\c@\c@\c@\c@\c]\c@\cP\c@\c@\c@\cG\c@\cU\c@\cY\c@\c@\c@\cR\c@\cO\c@\"\c@\c@\c@\c_\c@\cK\c@+\c@\c@\c@*\c@\cG\c@4\c@\c@\c@3\c@\cD\c@:\c@\cA\c@2\c@\cB\c@<\c@\cF\c@*\c@\c@\c@9\c@\cO\c@\c_\c@\c@\c@2\c@\cZ\c@\cT\c@\c@\c@(\c@(\c@\cK\c@\c@\c@\c^\c@5\c@\cF\c@\c@\c@\cT\c@\@\c@\cD\c@\cA\c@\cM\c@F\c@\cC\c@\cC\c@\cG\c@I\c@\cB\c@\cE\c@\cC\c@H\c@\c@\c@\cG\c@\cA\c@E\c@\c@\c@\cI\c@\cA\c@A\c@\c@\c@\cI\c@\cB\c@<\c@\cD\c@\cG\c@\cC\c@8\c@\cR\c@\cE\c@\cE\c@4\c@+\c@\cC\c@\cF\c@2\c@P\c@\cB\c@\cG\c@/\c@\c@\cC\c@\cG\c@-\c@º\c@\cF\c@\cI\c@*\c@ó\c@\cJ\c@\cK\c@%\cA\$\c@\cO\c@\cP\c@\c^\cAF\c@\cS\c@\cV\c@\cU\cAU\c@\cW\c@\c\\c@\cN\cAP\c@\cY\c@\$\c@\cG\cA:\c@\cY\c@,\c@\cB\cA\cX\c@\cV\c@6\c@\c@\c@ð\c@\cQ\c@C\c@\c@\c@Æ\c@\cL\c@Q\c@\c@\c@œ\c@\cH\c@_\c@\c@\c@u\c@\cC\c@n\c@\c@\c@R\c@\c@\c@{\c@\cA\c@4\c@\c@\c@†\c@\cB\c@\c^\c@\c@\c@Ž\c@\cE\c@\cP\c@\c@\c@”\c@\cG\c@\cK\c@\cC\c@™\c@\cI\c@\cM\c@\cF\c@œ\c@\cI\c@\cR\c@\cI\c@ž\c@\cH\c@\cW\c@\cK\c@ \c@\cE\c@\cY\c@\cL\c@¡\c@\cC\c@\cV\c@\cI\c@¢\c@\cA\c@\cQ\c@\cG\c@ \c@\c@\c@\cK\c@\cD\c@›\c@\c@\c@\cE\c@\cA\c@“\c@\c@\c@\cA\c@\c@\c@‡\c@\c@\c@\c@\c@\cA\c@v\c@\cA\c@\c@\c@\cB\c@c\c@\cC\c@\c@\c@\cB\c@N\c@\cE\c@\cB\c@\cB\c@8\c@\cF\c@\cO\c@\cB\c@\$\c@\cF\c@%\c@\cA\c@\cU\c@\cE\c@C\c@\c@\c@\cI\c@\cC\c@g\c@\c@\c@\cB\c@\cA\c@\c@\c@\c@\c@\c@\c@\c@¯\c@\c@\c@\c@\c@\c@\c@Ä\c@\c@\c@\cC\c@\c@\c@É\c@\c@\c@\cJ\c@\c@\c@Á\c@\c@\c@\cT\c@\c@\c@­\c@\c@\c@ \c@\c@\c@‘\c@\c@\c@1\c@\cC\c@q\c@\c@\c@\@\c@\cF\c@S\c@\c@\c@M\c@\cL\c@<\c@\c@\c@V\c@\cR\c@1\c@\c@\c@Y\c@\cY\c@2\c@\c@\c@U\c@\c]\c@\@\c@\c@\c@I\c@ \c@V\c@\c@\c@8\c@\c_\c@r\c@\c@\c@&\c@\c\\c@\c@\c@\c@\cW\c@\cX\c@§\c@\c@\c@\cJ\c@\cS\c@´\c@\c@\c@\cB\c@\cO\c@³\c@\c@\c@\c@\c@\cN\c@¤\c@\c@\c@\c@\c@\cO\c@‡\c@\c@\c@\c@\c@\cR\c@`\c@\c@\c@\c@\c@\cV\c@>\c@\c@\c@\c@\c@\e\c@!\c@\c@\c@\cB\c@\c]\c@\cK\c@\c@\c@\cD\c@\c^\c@\c@\c@\cA\c@\cG\c@\c^\c@\c@\c@\cD\c@\cJ\c@\c\\c@\cB\c@\cI\c@\cN\c@\cY\c@\cP\c@\cN\c@\cO\c@\cV\c@'\c@\cS\c@\cO\c@\cR\c@E\c@\cV\c@\cN\c@\cN\c@h\c@\cT\c@\cJ\c@\cI\c@\c@\cP\c@\cG\c@\cF\c@¨\c@\cJ\c@\cD\c@\cC\c@·\c@\cE\c@\cB\c@\cB\c@¹\c@\cA\c@\c@\c@\cE\c@±\c@\c@\c@\c@\c@\cK\c@¡\c@\c@\c@\c@\c@\cS\c@‹\c@\c@\c@\c@\c@\c^\c@s\c@\c@\c@\cA\c@,\c@Z\c@\c@\c@\cG\c@:\c@D\c@\c@\c@\cP\c@F\c@3\c@\c@\c@\cZ\c@O\c@*\c@\c@\c@&\c@U\c@)\c@\c@\c@0\c@U\c@1\c@\cD\c@5\c@O\c@?\c@\cH\c@6\c@D\c@P\c@\cN\c@2\c@5\c@c\c@\cS\c@-\c@\$\c@u\c@\cW\c@'\c@\cW\c@„\c@\cX\c@#\c@\cL\c@\c@\cV\c@!\c@\cD\c@”\c@\cR\c@!\c@\c@\c@”\c@\cM\c@\$\c@\c@\c@\c@\cI\c@)\c@\c@\c@Œ\c@\cF\c@/\c@\c@\c@†\c@\cE\c@6\c@\c@\c@\c@\cE\c@=\c@\c@\c@z\c@\cF\c@D\c@\cA\c@p\c@\cH\c@H\c@\cB\c@d\c@\cI\c@M\c@\cE\c@V\c@\cI\c@P\c@\cH\c@H\c@\cH\c@R\c@\cM\c@;\c@\cF\c@S\c@\cQ\c@0\c@\cD\c@T\c@\cT\c@'\c@\cB\c@S\c@\cV\c@\e\c@\cA\c@S\c@\cV\c@\cR\c@\c@\c@R\c@\cT\c@\cJ\c@\c@\c@R\c@\cQ\c@\cD\c@\c@\c@R\c@\cM\c@\cD\c@\c@\c@R\c@\cH\c@\cP\c@\cB\c@S\c@\cE\c@\c_\c@\cG\c@T\c@\cB\c@1\c@\cO\c@V\c@\cA\c@F\c@\cY\c@V\c@\c@\c@^\c@%\c@U\c@\c@\c@v\c@1\c@S\c@\c@\c@\c@9\c@O\c@\c@\c@¦\c@>\c@G\c@\c@\c@·\c@\@\c@>\c@\c@\c@¼\c@=\c@2\c@\c@\c@³\c@7\c@\$\c@\cD\c@š\c@.\c@\cX\c@\cM\c@w\c@#\c@\cN\c@\e\c@O\c@\cW\c@\cF\c@,\c@.\c@\cN\c@\cA\c@\@\c@\cV\c@\cF\c@\c@\c@R\c@\cG\c@\cB\c@\c@\c@^\c@\c@\c@\c@\c@\c@\c@b\c@\cL\c@\c@\c@\c@\c@_\c@!\c@\c@\c@\c@\c@U\c@=\c@\c@\c@\c@\c@F\c@Y\c@\c@\c@\cD\c@4\c@y\c@\c@\c@\cJ\c@#\c@Œ\c@\c@\c@\cR\c@\cV\c@‘\c@\c@\c@\e\c@\cP\c@Š\c@\cA\c@\$\c@\cR\c@z\c@\cC\c@)\c@\cZ\c@d\c@\cE\c@*\c@(\c@L\c@\cH\c@'\c@9\c@3\c@\cK\c@\c_\c@J\c@ \c@\cO\c@\cV\c@[\c@\cP\c@\cQ\c@\cM\c@k\c@\cF\c@\cQ\c@\cF\c@x\c@\c@\c@\cP\c@\cB\c@\c?\c@\c@\c@\cN\c@\c@\c@\c@\c@\c@\cK\c@\c@\c@{\c@\c@\c@\cI\c@\c@\c@o\c@\c@\c@\cG\c@\c@\c@]\c@\c@\c@\cE\c@\c@\c@J\c@\c@\c@\cD\c@\c@\c@7\c@\c@\c@\cC\c@\c@\c@'\c@\c@\c@\cA\c@\c@\c@\c\\c@\c@\c@\c@\c@\c@\c@\cV\c@\c@\c@\c@\c@\cB\c@\cU\c@\cO\c@\c@\c@\cG\c@\cX\c@,\c@\c@\c@\cL\c@\c\\c@R\c@\cA\c@\cQ\c@\c_\c@}\c@\cE\c@\cV\c@!\c@«\c@\cJ\c@\cX\c@ \c@Í\c@\cQ\c@\cV\c@\c]\c@Þ\c@\cX\c@\cR\c@\cW\c@Þ\c@\c]\c@\cL\c@\cP\c@Ò\c@\"\c@\cG\c@\cJ\c@À\c@&\c@\cC\c@\cE\c@«\c@*\c@\cA\c@\cA\c@˜\c@.\c@\c@\c@\c@\c@ˆ\c@4\c@\cA\c@\c@\c@|\c@8\c@\cB\c@\c@\c@s\c@:\c@\cD\c@\c@\c@m\c@9\c@\cD\c@\c@\c@g\c@6\c@\cD\c@\c@\c@a\c@0\c@\cD\c@\c@\c@W\c@)\c@\cB\c@\c@\c@K\c@ \c@\c@\c@\c@\c@<\c@\cW\c@\cA\c@\c@\c@-\c@\cO\c@\cE\c@\c@\c@\c^\c@\cH\c@\cK\c@\cC\c@\cS\c@\cB\c@\cQ\c@\cF\c@\cO\c@\c@\c@\cW\c@\cI\c@\cP\c@\c@\c@\c\\c@\cN\c@\cV\c@\c@\c@\c_\c@\cR\c@\c_\c@\c@\c@\c_\c@\cV\c@)\c@\c@\c@\c_\c@\cX\c@0\c@\c@\c@\c_\c@\cZ\c@2\c@\c@\c@\c_\c@\cZ\c@0\c@\c@\c@\c^\c@\cW\c@'\c@\c@\c@\e\c@\cS\c@\c\\c@\c@\c@\cV\c@\cO\c@\cQ\c@\c@\c@\cP\c@\cK\c@\cI\c@\c@\c@\cJ\c@\cI\c@\cB\c@\cB\c@\cD\c@\cJ\c@\c@\c@\cD\c@\cA\c@\cL\c@\c@\c@\cG\c@\c@\c@\cO\c@\c@\c@\cL\c@\c@\c@\cS\c@\c@\c@\cQ\c@\c@\c@\cW\c@\c@\c@\cV\c@\cC\c@\cZ\c@\cB\c@\e\c@\cH\c@\e\c@\cI\c@\c^\c@\cO\c@\cZ\c@\cV\c@ \c@\cW\c@\cW\c@'\c@!\c@\c_\c@\cQ\c@<\c@!\c@&\c@\cK\c@P\c@ \c@*\c@\cF\c@^\c@\c_\c@,\c@\cB\c@c\c@\c^\c@,\c@\c@\c@`\c@\c\\c@+\c@\c@\c@V\c@\cX\c@)\c@\c@\c@H\c@\cU\c@)\c@\c@\c@8\c@\cQ\c@(\c@\c@\c@+\c@\cO\c@'\c@\c@\c@\c_\c@\cL\c@&\c@\c@\c@\cV\c@\cL\c@\$\c@\cB\c@\cP\c@\cM\c@#\c@\cF\c@\cO\c@\cP\c@#\c@\cJ\c@\cR\c@\cU\c@%\c@\cM\c@\cZ\c@\c]\c@(\c@\cO\c@\$\c@(\c@*\c@\cO\c@0\c@3\c@,\c@\cL\c@<\c@>\c@+\c@\cH\c@F\c@G\c@'\c@\cD\c@K\c@L\c@ \c@\cB\c@L\c@N\c@\cW\c@\c@\c@E\c@M\c@\cO\c@\c@\c@7\c@I\c@\cH\c@\c@\c@(\c@D\c@\cC\c@\c@\c@\cY\c@=\c@\c@\c@\c@\c@\cL\c@5\c@\c@\c@\c@\c@\cC\c@+\c@\c@\c@\c@\c@\c@\c@\c_\c@\c@\c@\cC\c@\c@\c@\cT\c@\cB\c@\cI\c@\c@\c@\cK\c@\cH\c@\cP\c@\c@\c@\cD\c@\cR\c@\cW\c@\c@\c@\c@\c@!\c@\c^\c@\c@\c@\c@\c@3\c@\"\c@\cJ\c@\c@\c@F\c@!\c@\c\\c@\c@\c@U\c@\c]\c@4\c@\c@\c@`\c@\cU\c@O\c@\c@\c@c\c@\cM\c@m\c@\c@\c@_\c@\cG\c@†\c@\c@\c@V\c@\cB\c@–\c@\c@\c@I\c@\cB\c@¡\c@\c@\c@:\c@\cG\c@¤\c@\c@\c@.\c@\cN\c@¡\c@\c@\c@#\c@\cY\c@•\c@\c@\c@\e\c@'\c@‚\c@\c@\c@\cW\c@4\c@k\c@\c@\c@\cU\c@\@\c@U\c@\c@\c@\cT\c@J\c@D\c@\c@\c@\cU\c@P\c@>\c@\c@\c@\cV\c@S\c@A\c@\c@\c@\cX\c@T\c@J\c@\c@\c@\cY\c@R\c@T\c@\c@\c@\cY\c@O\c@Z\c@\c@\c@\cY\c@K\c@\\\c@\c@\c@\cZ\c@G\c@\\\c@\c@\c@\cZ\c@D\c@Y\c@\c@\c@\cZ\c@B\c@T\c@\c@\c@\cZ\c@A\c@Q\c@\c@\c@\cZ\c@\@\c@P\c@\c@\c@\cZ\c@\@\c@S\c@\c@\c@\cZ\c@\@\c@[\c@\c@\c@\cZ\c@>\c@l\c@\c@\c@\cZ\c@;\c@€\c@\c@\c@\cZ\c@7\c@•\c@\c@\c@\cZ\c@3\c@¢\c@\c@\c@\cZ\c@/\c@£\c@\c@\c@\cZ\c@+\c@”\c@\c@\c@\e\c@(\c@w\c@\cB\c@\c\\c@&\c@S\c@\cE\c@\c\\c@%\c@3\c@\cI\c@\c]\c@%\c@\cY\c@\cM\c@\c\\c@%\c@\cG\c@\cP\c@\cZ\c@\$\c@\c@\c@\cP\c@\cW\c@\"\c@\cB\c@\cM\c@\cS\c@ \c@\cK\c@\cI\c@\cM\c@\c^\c@\cX\c@\cE\c@\cI\c@\e\c@)\c@\cB\c@\cE\c@\cX\c@A\c@\c@\c@\cB\c@\cV\c@[\c@\c@\c@\c@\c@\cT\c@s\c@\c@\c@\c@\c@\cQ\c@…\c@\c@\c@\c@\c@\cO\c@‘\c@\c@\c@\c@\c@\cM\c@”\c@\c@\c@\c@\c@\cK\c@Ž\c@\c@\c@\c@\c@\cI\c@~\c@\c@\c@\c@\c@\cG\c@h\c@\c@\c@\c@\c@\cE\c@N\c@\c@\c@\c@\c@\cC\c@5\c@\cA\c@\c@\c@\cB\c@ \c@\cC\c@\c@\c@\cA\c@\cT\c@\cE\c@\c@\c@\c@\c@\cR\c@\cI\c@\c@\c@\c@\c@\e\c@\cM\c@\c@\c@\c@\c@/\c@\cP\c@\cB\c@\c@\c@I\c@\cQ\c@\cD\c@\c@\c@f\c@\cQ\c@\cG\c@\c@\c@\c@\cP\c@\cJ\c@\cA\c@–\c@\cO\c@\cM\c@\cD\c@¤\c@\cQ\c@\cN\c@\cH\c@¬\c@\cV\c@\cN\c@\cL\c@¯\c@\c\\c@\cM\c@\cO\c@®\c@\$\c@\cL\c@\cO\c@©\c@,\c@\cK\c@\cM\c@¡\c@2\c@\cJ\c@\cI\c@”\c@7\c@\cI\c@\cE\c@†\c@;\c@\cG\c@\cA\c@v\c@\@\c@\cG\c@\c@\c@h\c@E\c@\cH\c@\c@\c@\\\c@I\c@\cK\c@\c@\c@T\c@K\c@\cQ\c@\c@\c@L\c@K\c@\cY\c@\c@\c@G\c@J\c@!\c@\c@\c@\@\c@H\c@'\c@\c@\c@;\c@F\c@)\c@\c@\c@6\c@F\c@'\c@\c@\c@5\c@F\c@ \c@\c@\c@5\c@H\c@\cX\c@\c@\c@7\c@H\c@\cP\c@\c@\c@9\c@H\c@\cI\c@\c@\c@;\c@F\c@\cD\c@\c@\c@<\c@D\c@\cA\c@\c@\c@=\c@\@\c@\c@\c@\c@\c@>\c@=\c@\c@\c@\c@\c@\@\c@8\c@\c@\c@\c@\c@A\c@4\c@\c@\c@\c@\c@B\c@/\c@\c@\c@\c@\c@A\c@*\c@\c@\c@\c@\c@<\c@%\c@\c@\c@\c@\c@3\c@!\c@\c@\c@\c@\c@(\c@\c]\c@\c@\c@\c@\c@\e\c@\cX\c@\c@\c@\c@\c@\cP\c@\cT\c@\c@\c@\c@\c@\cH\c@\cQ\c@\c@\c@\c@\c@\cB\c@\cN\c@\c@\c@\c@\c@\cB\c@\cM\c@\c@\c@\c@\c@\cF\c@\cN\c@\cA\c@\c@\c@\cM\c@\cR\c@\cC\c@\cA\c@\cU\c@\cX\c@\cG\c@\cC\c@!\c@\c_\c@\cJ\c@\cF\c@.\c@%\c@\cK\c@\cH\c@:\c@*\c@\cK\c@\cI\c@G\c@/\c@\cJ\c@\cH\c@T\c@2\c@\cG\c@\cF\c@a\c@6\c@\cC\c@\cC\c@n\c@9\c@\cA\c@\cA\c@y\c@<\c@\c@\c@\c@\c@}\c@<\c@\c@\c@\c@\c@{\c@9\c@\c@\c@\c@\c@q\c@2\c@\c@\c@\c@\c@`\c@'\c@\c@\c@\c@\c@L\c@\e\c@\c@\c@\c@\c@7\c@\cP\c@\c@\c@\c@\c@#\c@\cH\c@\c@\c@\c@\c@\cT\c@\cB\c@\cA\c@\c@\c@\cJ\c@\c@\c@\cD\c@\c@\c@\cD\c@\c@\c@\cI\c@\cA\c@\c@\c@\c@\c@\cN\c@\cE\c@\c@\c@\c@\c@\cT\c@\cJ\c@\c@\c@\c@\c@\cX\c@\cP\c@\c@\c@\cA\c@\e\c@\cW\c@\c@\c@\cD\c@\c]\c@\c]\c@\c@\c@\cI\c@\c_\c@!\c@\c@\c@\cP\c@\"\c@#\c@\c@\c@\cX\c@&\c@\"\c@\c@\c@\"\c@,\c@\c_\c@\c@\c@+\c@2\c@\e\c@\c@\c@3\c@8\c@\cW\c@\c@\c@:\c@<\c@\cU\c@\c@\c@?\c@=\c@\cS\c@\c@\c@\@\c@;\c@\cR\c@\c@\c@?\c@4\c@\cQ\c@\c@\c@;\c@*\c@\cO\c@\c@\c@5\c@\c]\c@\cK\c@\c@\c@/\c@\cR\c@\cH\c@\c@\c@)\c@\cI\c@\cF\c@\c@\c@%\c@\cC\c@\cF\c@\cD\c@\"\c@\c@\c@\cI\c@\cZ\c@\c_\c@\c@\c@\cM\c@?\c@\c\\c@\cD\c@\cR\c@o\c@\cZ\c@\cK\c@\cV\c@§\c@\cW\c@\cU\c@\cX\c@ä\c@\cW\c@\"\c@\cX\cA\cU\c@\cX\c@3\c@\cU\cA7\c@\c\\c@D\c@\cQ\cAH\c@ \c@W\c@\cL\cAL\c@%\c@i\c@\cG\cAC\c@)\c@{\c@\cC\cA/\c@,\c@ˆ\c@\c@\cA\cS\c@,\c@\c@\c@\c@ò\c@+\c@\c@\c@\c@Ï\c@(\c@‰\c@\c@\c@¯\c@\$\c@\c?\c@\c@\c@”\c@\c_\c@s\c@\c@\c@\c@\cZ\c@g\c@\cB\c@u\c@\cU\c@Z\c@\cC\c@p\c@\cR\c@L\c@\cD\c@o\c@\cP\c@=\c@\cE\c@r\c@\cN\c@-\c@\cG\c@w\c@\cL\c@ \c@\cH\c@~\c@\cJ\c@\cW\c@\cK\c@…\c@\cI\c@\cR\c@\cM\c@‡\c@\cG\c@\cQ\c@\cO\c@„\c@\cF\c@\cR\c@\cP\c@z\c@\cD\c@\cU\c@\cO\c@k\c@\cD\c@\cW\c@\cK\c@W\c@\cB\c@\cY\c@\cG\c@C\c@\cA\c@\cZ\c@\cD\c@1\c@\c@\c@\e\c@\cC\c@%\c@\c@\c@\c\\c@\cD\c@\c\\c@\c@\c@\c\\c@\cH\c@\cZ\c@\cC\c@\c\\c@\cL\c@\cY\c@\cI\c@\c\\c@\cO\c@\cZ\c@\cP\c@\cY\c@\cR\c@\cY\c@\cY\c@\cU\c@\cT\c@\cV\c@#\c@\cQ\c@\cV\c@\cP\c@+\c@\cM\c@\cW\c@\cK\c@1\c@\cJ\c@\cX\c@\cE\c@5\c@\cJ\c@\cY\c@\cA\c@5\c@\cK\c@\cY\c@\c@\c@3\c@\cL\c@\cY\c@\c@\c@1\c@\cK\c@\cX\c@\c@\c@0\c@\cJ\c@\cV\c@\c@\c@0\c@\cG\c@\cU\c@\c@\c@3\c@\cD\c@\cS\c@\c@\c@7\c@\cB\c@\cO\c@\c@\c@>\c@\c@\c@\cK\c@\cB\c@H\c@\c@\c@\cG\c@\cI\c@T\c@\c@\c@\cC\c@\cU\c@b\c@\c@\c@\c@\c@'\c@s\c@\c@\c@\c@\c@B\c@„\c@\c@\c@\c@\c@c\c@”\c@\c@\c@\c@\c@…\c@£\c@\cB\c@\c@\c@£\c@®\c@\cF\c@\c@\c@¼\c@µ\c@\cK\c@\c@\c@Ì\c@¸\c@\cQ\c@\c@\c@Ó\c@µ\c@\cV\c@\c@\c@Ô\c@¯\c@\cW\c@\c@\c@Ñ\c@¦\c@\cV\c@\c@\c@Ê\c@™\c@\cS\c@\c@\c@À\c@Œ\c@\cN\c@\c@\c@±\c@€\c@\cI\c@\c@\c@Ÿ\c@u\c@\cE\c@\c@\c@Š\c@l\c@\cC\c@\cB\c@w\c@e\c@\cA\c@\cC\c@l\c@`\c@\c@\c@\cD\c@k\c@\\\c@\c@\c@\cE\c@w\c@[\c@\c@\c@\cD\c@‹\c@[\c@\c@\c@\cC\c@¤\c@^\c@\c@\c@\cB\c@»\c@b\c@\c@\c@\c@\c@Í\c@i\c@\c@\c@\c@\c@Õ\c@n\c@\c@\c@\c@\c@Ò\c@q\c@\c@\c@\c@\c@Ç\c@p\c@\c@\c@\c@\c@´\c@i\c@\c@\c@\c@\c@œ\c@]\c@\c@\c@\c@\c@\c@N\c@\c@\c@\cA\c@g\c@>\c@\c@\c@\cH\c@O\c@0\c@\c@\c@\cS\c@<\c@&\c@\c@\c@ \c@/\c@!\c@\c@\c@.\c@)\c@ \c@\c@\c@;\c@'\c@\$\c@\cE\c@B\c@*\c@+\c@\cM\c@C\c@1\c@3\c@\cW\c@\@\c@:\c@:\c@!\c@9\c@E\c@A\c@*\c@1\c@P\c@F\c@/\c@*\c@Y\c@I\c@-\c@ \c@_\c@K\c@&\c@\cX\c@c\c@J\c@\e\c@\cP\c@f\c@H\c@\cQ\c@\cI\c@g\c@C\c@\cI\c@\cC\c@h\c@=\c@\cC\c@\c@\c@h\c@6\c@\c@\c@\c@\c@c\c@0\c@\c@\c@\c@\c@Y\c@*\c@\c@\c@\c@\c@J\c@%\c@\c@\c@\c@\c@6\c@\$\c@\cA\c@\c@\c@#\c@\$\c@\cD\c@\cB\c@\cT\c@&\c@\cJ\c@\cG\c@\cH\c@*\c@\cP\c@\cM\c@\cA\c@/\c@\cV\c@\cU\c@\c@\c@5\c@\c\\c@\c^\c@\c@\c@9\c@ \c@\$\c@\c@\c@:\c@\"\c@(\c@\c@\c@8\c@\"\c@)\c@\c@\c@1\c@ \c@*\c@\c@\c@'\c@\e\c@*\c@\c@\c@\e\c@\cT\c@,\c@\c@\c@\cQ\c@\cN\c@0\c@\cC\c@\cH\c@\cH\c@5\c@\cQ\c@\cC\c@\cC\c@:\c@&\c@\c@\c@\cC\c@;\c@E\c@\c@\c@\cH\c@;\c@o\c@\c@\c@\cM\c@7\c@¤\c@\c@\c@\cT\c@0\c@Ù\c@\c@\c@\c\\c@'\cA\cL\c@\c@\c@\$\c@\c_\cA6\c@\c@\c@+\c@\cW\cAP\c@\c@\c@4\c@\cR\cAW\c@\c@\c@=\c@\cN\cAK\c@\c@\c@E\c@\cL\cA/\c@\c@\c@M\c@\cM\cA\cG\c@\c@\c@S\c@\cM\c@Ú\c@\c@\c@X\c@\cM\c@¯\c@\c@\c@[\c@\cL\c@‰\c@\c@\c@[\c@\cK\c@l\c@\cA\c@[\c@\cI\c@[\c@\cD\c@Y\c@\cH\c@Z\c@\cH\c@T\c@\cG\c@f\c@\cL\c@M\c@\cE\c@}\c@\cP\c@E\c@\cD\c@›\c@\cQ\c@:\c@\cC\c@»\c@\cP\c@/\c@\cB\c@Ø\c@\cN\c@\$\c@\c@\c@ñ\c@\cJ\c@\e\c@\c@\cA\cC\c@\cF\c@\cV\c@\c@\cA\cO\c@\cD\c@\cT\c@\c@\cA\cS\c@\cB\c@\cS\c@\c@\cA\cN\c@\c@\c@\cU\c@\c@\c@ÿ\c@\c@\c@\cX\c@\c@\c@é\c@\c@\c@\cY\c@\c@\c@É\c@\c@\c@\cZ\c@\c@\c@§\c@\c@\c@\e\c@\c@\c@\c@\c@\c@\c\\c@\cB\c@\\\c@\c@\c@\c\\c@\cG\c@:\c@\c@\c@\c\\c@\cN\c@\"\c@\c@\c@\e\c@\cW\c@\cP\c@\c@\c@\cY\c@\"\c@\cG\c@\c@\c@\cV\c@,\c@\cJ\c@\c@\c@\cS\c@3\c@\cU\c@\c@\c@\cQ\c@6\c@\$\c@\c@\c@\cQ\c@5\c@5\c@\c@\c@\cS\c@2\c@F\c@\c@\c@\cV\c@,\c@R\c@\c@\c@\cY\c@&\c@[\c@\c@\c@\c]\c@\c_\c@_\c@\c@\c@\c^\c@\c]\c@c\c@\c@\c@\c^\c@\c]\c@h\c@\c@\c@\c\\c@!\c@n\c@\c@\c@\cY\c@)\c@u\c@\c@\c@\cT\c@3\c@~\c@\c@\c@\cN\c@>\c@ƒ\c@\c@\c@\cI\c@I\c@ƒ\c@\c@\c@\cE\c@Q\c@|\c@\c@\c@\cB\c@X\c@m\c@\c@\c@\cD\c@^\c@X\c@\c@\c@\cJ\c@c\c@\@\c@\c@\c@\cS\c@e\c@)\c@\c@\c@\c_\c@d\c@\cW\c@\c@\c@-\c@a\c@\cJ\c@\c@\c@8\c@Z\c@\cC\c@\c@\c@?\c@P\c@\c@\c@\cA\c@B\c@D\c@\c@\c@\cD\c@\@\c@8\c@\c@\c@\cI\c@;\c@+\c@\c@\c@\cO\c@3\c@\c^\c@\c@\c@\cS\c@)\c@\cS\c@\c@\c@\cV\c@\c_\c@\cJ\c@\c@\c@\cV\c@\cT\c@\cD\c@\cB\c@\cS\c@\cL\c@\c@\c@\cJ\c@\cN\c@\cF\c@\c@\c@\cX\c@\cJ\c@\cB\c@\cA\c@*\c@\cE\c@\c@\c@\cF\c@<\c@\cC\c@\c@\c@\cL\c@H\c@\cA\c@\cA\c@\cV\c@I\c@\c@\c@\cC\c@\$\c@>\c@\cA\c@\cF\c@4\c@.\c@\cD\c@\cH\c@F\c@\c\\c@\cI\c@\cJ\c@W\c@\cL\c@\cO\c@\cM\c@f\c@\cB\c@\cU\c@\cO\c@q\c@\c@\c@\e\c@\cQ\c@v\c@\c@\c@\c^\c@\cS\c@v\c@\c@\c@\c_\c@\cT\c@q\c@\c@\c@ \c@\cT\c@i\c@\c@\c@!\c@\cR\c@a\c@\c@\c@#\c@\cP\c@Y\c@\c@\c@%\c@\cM\c@S\c@\c@\c@(\c@\cL\c@P\c@\c@\c@)\c@\cK\c@O\c@\c@\c@(\c@\cJ\c@P\c@\c@\c@\$\c@\cI\c@S\c@\c@\c@\c]\c@\cG\c@Y\c@\c@\c@\cU\c@\cE\c@c\c@\c@\c@\cM\c@\cC\c@n\c@\c@\c@\cG\c@\cB\c@{\c@\cA\c@\cB\c@\cB\c@‡\c@\cL\c@\c@\c@\cC\c@\c@!\c@\c@\c@\cF\c@’\c@?\c@\c@\c@\cJ\c@\c@f\c@\c@\c@\cP\c@…\c@”\c@\c@\c@\cV\c@u\c@À\c@\c@\c@\c\\c@c\c@ç\c@\c@\c@\"\c@P\cA\cD\c@\c@\c@'\c@>\cA\cU\c@\c@\c@*\c@.\cA\cW\c@\c@\c@.\c@\"\cA\cK\c@\c@\c@0\c@\e\c@ñ\c@\c@\c@3\c@\cX\c@Ë\c@\c@\c@7\c@\e\c@ž\c@\c@\c@:\c@\$\c@m\c@\cA\c@<\c@0\c@C\c@\cB\c@=\c@?\c@\$\c@\cD\c@>\c@O\c@\cN\c@\cF\c@>\c@^\c@\cB\c@\cH\c@=\c@k\c@\c@\c@\cI\c@8\c@u\c@\c@\c@\cI\c@0\c@}\c@\c@\c@\cI\c@\$\c@„\c@\cF\c@\cI\c@\cX\c@ˆ\c@\cT\c@\cI\c@\cN\c@Š\c@(\c@\cH\c@\cF\c@Œ\c@?\c@\cF\c@\cA\c@\c@W\c@\cD\c@\c@\c@\c@i\c@\cC\c@\c@\c@\c@p\c@\cA\c@\c@\c@Ž\c@m\c@\cA\c@\c@\c@\c@b\c@\cB\c@\c@\c@‹\c@S\c@\cD\c@\c@\c@ˆ\c@E\c@\cD\c@\cB\c@ƒ\c@6\c@\cF\c@\cD\c@|\c@*\c@\cG\c@\cG\c@u\c@\c_\c@\cH\c@\cJ\c@n\c@\cV\c@\cJ\c@\cM\c@h\c@\cQ\c@\cN\c@\cO\c@b\c@\cQ\c@\cR\c@\cP\c@^\c@\cV\c@\cV\c@\cO\c@X\c@ \c@\e\c@\cM\c@S\c@+\c@\c_\c@\cJ\c@N\c@5\c@!\c@\cG\c@I\c@;\c@!\c@\cD\c@C\c@:\c@\c^\c@\cB\c@>\c@3\c@\cZ\c@\c@\c@8\c@(\c@\cT\c@\c@\c@4\c@\cZ\c@\cN\c@\c@\c@2\c@\cO\c@\cH\c@\c@\c@1\c@\cH\c@\cD\c@\c@\c@1\c@\cB\c@\cB\c@\c@\c@4\c@\c@\c@\cA\c@\cC\c@6\c@\c@\c@\cC\c@\cI\c@:\c@\c@\c@\cH\c@\cQ\c@=\c@\c@\c@\cN\c@\e\c@?\c@\c@\c@\cT\c@%\c@C\c@\cA\c@\cZ\c@,\c@H\c@\cF\c@\c^\c@/\c@N\c@\cO\c@!\c@,\c@S\c@\c\\c@#\c@%\c@W\c@.\c@&\c@\e\c@Y\c@B\c@)\c@\cQ\c@Y\c@T\c@*\c@\cI\c@V\c@`\c@(\c@\cC\c@S\c@b\c@#\c@\c@\c@O\c@[\c@\cZ\c@\c@\c@L\c@I\c@\cQ\c@\c@\c@I\c@4\c@\cI\c@\c@\c@H\c@ \c@\cD\c@\c@\c@G\c@\cP\c@\c@\c@\c@\c@E\c@\cE\c@\c@\c@\c@\c@D\c@\c@\c@\c@\c@\c@\c@D\c@\c@\c@\c@\c@\c@\c@B\c@\c@\c@\c@\c@\c@\c@\@\c@\c@\c@\c@\c@\c@\c@=\c@\c@\c@\c@\c@\c@\c@;\c@\c@\c@\c@\c@\c@\c@9\c@\c@\c@\c@\c@\c@\c@:\c@\cD\c@\c@\c@\c@\c@:\c@\cS\c@\c@\c@\cA\c@;\c@,\c@\c@\c@\cD\c@:\c@L\c@\c@\c@\cJ\c@5\c@t\c@\c@\c@\cQ\c@/\c@ \c@\c@\c@\e\c@%\c@È\c@\c@\c@'\c@\cZ\c@è\c@\c@\c@2\c@\cP\cA\c@\c@\cC\c@>\c@\cI\cA\cN\c@\cH\c@G\c@\cC\cA\cV\c@\cP\c@M\c@\c@\cA\cY\c@\cX\c@N\c@\c@\cA\cX\c@\"\c@J\c@\c@\cA\cS\c@(\c@A\c@\c@\cA\cI\c@,\c@4\c@\c@\c@ú\c@+\c@&\c@\c@\c@è\c@'\c@\cY\c@\c@\c@Õ\c@#\c@\cO\c@\c@\c@Ä\c@\c^\c@\cG\c@\c@\c@¹\c@\cY\c@\cC\c@\c@\c@±\c@\cT\c@\c@\c@\c@\c@®\c@\cQ\c@\c@\c@\c@\c@«\c@\cO\c@\c@\c@\c@\c@©\c@\cN\c@\c@\c@\c@\c@§\c@\cN\c@\cA\c@\c@\c@§\c@\cP\c@\cB\c@\c@\c@ª\c@\cS\c@\cD\c@\c@\c@²\c@\cW\c@\cE\c@\c@\c@¼\c@\e\c@\cI\c@\c@\c@Ç\c@\c_\c@\cM\c@\c@\c@Ñ\c@\"\c@\cQ\c@\c@\c@Ø\c@'\c@\cX\c@\c@\c@Ù\c@,\c@\c_\c@\c@\c@Ø\c@3\c@'\c@\c@\c@Ñ\c@:\c@-\c@\c@\c@Å\c@B\c@1\c@\c@\c@´\c@I\c@2\c@\c@\c@¢\c@M\c@0\c@\c@\c@\c@P\c@*\c@\c@\c@\c?\c@O\c@!\c@\c@\c@u\c@M\c@\cW\c@\cC\c@p\c@L\c@\cN\c@\cF\c@o\c@I\c@\cF\c@\cJ\c@q\c@F\c@\cA\c@\cN\c@s\c@B\c@\c@\c@\cS\c@u\c@<\c@\c@\c@\cV\c@x\c@2\c@\cB\c@\cX\c@~\c@&\c@\cE\c@\cY\c@…\c@\cY\c@\cJ\c@\cZ\c@\c@\cO\c@\cQ\c@\cZ\c@–\c@\cG\c@\e\c@\e\c@ž\c@\cB\c@&\c@\c]\c@¦\c@\c@\c@3\c@\c^\c@¯\c@\cB\c@?\c@\c^\c@¸\c@\cF\c@I\c@\c\\c@À\c@\cJ\c@P\c@\cW\c@Ç\c@\cQ\c@Q\c@\cQ\c@Ê\c@\cY\c@N\c@\cK\c@È\c@\"\c@G\c@\cF\c@Â\c@*\c@=\c@\cA\c@º\c@2\c@4\c@\c@\c@¯\c@6\c@,\c@\c@\c@£\c@7\c@&\c@\c@\c@—\c@6\c@\$\c@\c@\c@‹\c@2\c@#\c@\c@\c@\c?\c@/\c@\$\c@\c@\c@u\c@,\c@&\c@\c@\c@m\c@+\c@'\c@\c@\c@h\c@)\c@'\c@\cA\c@i\c@(\c@'\c@\cD\c@q\c@%\c@'\c@\cI\c@€\c@!\c@&\c@\cP\c@•\c@\c]\c@%\c@\cY\c@±\c@\cZ\c@&\c@\"\c@Í\c@\cY\c@'\c@)\c@è\c@\cY\c@)\c@-\c@þ\c@\c\\c@-\c@,\cA\cK\c@\c_\c@2\c@)\cA\cP\c@\$\c@6\c@\"\cA\cK\c@)\c@9\c@\e\c@ü\c@-\c@;\c@\cR\c@æ\c@1\c@<\c@\cK\c@Ê\c@3\c@<\c@\cF\c@«\c@4\c@;\c@\cC\c@ˆ\c@3\c@9\c@\c@\c@f\c@2\c@5\c@\c@\c@E\c@0\c@0\c@\c@\c@+\c@-\c@*\c@\c@\c@\cW\c@*\c@%\c@\c@\c@\cI\c@'\c@\c_\c@\c@\c@\cA\c@%\c@\e\c@\c@\c@\c@\c@%\c@\cV\c@\c@\c@\c@\c@(\c@\cR\c@\cA\c@\c@\c@0\c@\cO\c@\cD\c@\c@\c@:\c@\cM\c@\cG\c@\c@\c@G\c@\cK\c@\cK\c@\c@\c@U\c@\cJ\c@\cM\c@\c@\c@d\c@\cH\c@\cM\c@\cC\c@q\c@\cF\c@\cK\c@\cL\c@|\c@\cD\c@\cH\c@\cY\c@…\c@\cB\c@\cD\c@(\c@‹\c@\cA\c@\cA\c@9\c@Ž\c@\cC\c@\c@\c@H\c@Ž\c@\cF\c@\c@\c@Q\c@‹\c@\cH\c@\c@\c@R\c@‡\c@\cK\c@\c@\c@J\c@\c@\cM\c@\c@\c@<\c@z\c@\cM\c@\c@\c@+\c@s\c@\cM\c@\c@\c@\e\c@m\c@\cL\c@\cC\c@\cM\c@e\c@\cL\c@\cG\c@\cC\c@_\c@\cK\c@\cL\c@\c@\c@X\c@\cJ\c@\cQ\c@\c@\c@R\c@\cI\c@\cU\c@\c@\c@L\c@\cH\c@\cX\c@\cA\c@H\c@\cF\c@\cX\c@\cE\c@F\c@\cF\c@\cV\c@\cK\c@C\c@\cH\c@\cR\c@\cR\c@\@\c@\cL\c@\cN\c@\cY\c@=\c@\cS\c@\cH\c@ \c@7\c@\c\\c@\cE\c@#\c@0\c@%\c@\cD\c@%\c@)\c@.\c@\cE\c@%\c@\$\c@4\c@\cF\c@#\c@\c_\c@9\c@\cI\c@ \c@\c]\c@=\c@\cK\c@\cY\c@\cZ\c@A\c@\cM\c@\cR\c@\cY\c@D\c@\cQ\c@\cK\c@\cW\c@E\c@\cU\c@\cE\c@\cT\c@F\c@\c]\c@\cA\c@\cQ\c@D\c@&\c@\c@\c@\cO\c@?\c@0\c@\c@\c@\cN\c@7\c@9\c@\c@\c@\cN\c@.\c@\@\c@\c@\c@\cO\c@\$\c@C\c@\c@\c@\cQ\c@\c\\c@C\c@\c@\c@\cU\c@\cT\c@\@\c@\cB\c@\cZ\c@\cN\c@9\c@\cI\c@ \c@\cJ\c@/\c@\cT\c@'\c@\cG\c@#\c@!\c@.\c@\cE\c@\cW\c@3\c@4\c@\cD\c@\cM\c@F\c@8\c@\cB\c@\cF\c@V\c@:\c@\cA\c@\cA\c@a\c@;\c@\c@\c@\c@\c@d\c@;\c@\c@\c@\c@\c@`\c@:\c@\c@\c@\cA\c@V\c@8\c@\c@\c@\cD\c@H\c@4\c@\c@\c@\cG\c@=\c@.\c@\c@\c@\cK\c@7\c@'\c@\c@\c@\cO\c@7\c@!\c@\c@\c@\cS\c@>\c@\e\c@\c@\c@\cV\c@G\c@\cW\c@\c@\c@\cZ\c@R\c@\cU\c@\c@\c@ \c@^\c@\cT\c@\c@\c@&\c@i\c@\cR\c@\c@\c@,\c@u\c@\cO\c@\c@\c@4\c@\c?\c@\cK\c@\c@\c@;\c@†\c@\cH\c@\c@\c@A\c@†\c@\cD\c@\c@\c@G\c@\c?\c@\cC\c@\c@\c@N\c@r\c@\cD\c@\c@\c@U\c@`\c@\cH\c@\c@\c@[\c@O\c@\cM\c@\c@\c@a\c@\@\c@\cT\c@\c@\c@d\c@5\c@\e\c@\c@\c@d\c@.\c@ \c@\c@\c@a\c@-\c@\$\c@\c@\c@]\c@/\c@'\c@\c@\c@X\c@4\c@'\c@\c@\c@R\c@;\c@%\c@\c@\c@L\c@D\c@#\c@\c@\c@F\c@P\c@\c_\c@\c@\c@?\c@_\c@\c]\c@\c@\c@6\c@q\c@\c^\c@\c@\c@+\c@ƒ\c@!\c@\cA\c@ \c@–\c@\$\c@\cE\c@\cU\c@¥\c@'\c@\cK\c@\cL\c@±\c@*\c@\cT\c@\cE\c@·\c@,\c@\c^\c@\cA\c@·\c@-\c@)\c@\c@\c@±\c@/\c@2\c@\c@\c@¥\c@1\c@9\c@\c@\c@“\c@3\c@>\c@\c@\c@}\c@4\c@\@\c@\c@\c@f\c@4\c@?\c@\c@\c@O\c@2\c@=\c@\cA\c@;\c@-\c@9\c@\cF\c@,\c@(\c@3\c@\cK\c@\"\c@#\c@/\c@\cO\c@\cZ\c@ \c@*\c@\cS\c@\cU\c@\c^\c@&\c@\cV\c@\cP\c@ \c@#\c@\cW\c@\cK\c@#\c@!\c@\cV\c@\cG\c@'\c@\c_\c@\cU\c@\cC\c@*\c@ \c@\cS\c@\c@\c@,\c@\"\c@\cS\c@\c@\c@,\c@&\c@\cR\c@\c@\c@,\c@,\c@\cQ\c@\c@\c@,\c@2\c@\cP\c@\cC\c@,\c@7\c@\cQ\c@\cJ\c@,\c@9\c@\cR\c@\cU\c@,\c@:\c@\cT\c@\$\c@,\c@:\c@\cW\c@8\c@*\c@9\c@\e\c@J\c@&\c@8\c@\c^\c@X\c@!\c@7\c@\c_\c@`\c@\c]\c@5\c@\c^\c@e\c@\e\c@4\c@\e\c@h\c@\c]\c@5\c@\cW\c@l\c@#\c@7\c@\cT\c@o\c@,\c@<\c@\cR\c@s\c@6\c@B\c@\cO\c@u\c@>\c@H\c@\cM\c@w\c@C\c@J\c@\cK\c@x\c@D\c@H\c@\cJ\c@x\c@A\c@A\c@\cJ\c@y\c@<\c@6\c@\cO\c@z\c@4\c@*\c@\cW\c@y\c@+\c@\c_\c@\"\c@u\c@\"\c@\cW\c@/\c@l\c@\cX\c@\cT\c@=\c@`\c@\cO\c@\cV\c@I\c@P\c@\cI\c@\e\c@S\c@?\c@\cE\c@!\c@Z\c@.\c@\cB\c@'\c@_\c@\c_\c@\cA\c@+\c@b\c@\cS\c@\cA\c@-\c@b\c@\cM\c@\c@\c@,\c@`\c@\cJ\c@\c@\c@(\c@\\\c@\cM\c@\c@\c@\"\c@V\c@\cT\c@\c@\c@\c]\c@N\c@\c_\c@\c@\c@\cX\c@G\c@-\c@\c@\c@\cW\c@\@\c@<\c@\c@\c@\cX\c@9\c@K\c@\c@\c@\cZ\c@3\c@X\c@\c@\c@\c^\c@.\c@c\c@\c@\c@!\c@*\c@l\c@\c@\c@&\c@(\c@s\c@\c@\c@+\c@'\c@u\c@\c@\c@2\c@%\c@q\c@\c@\c@9\c@%\c@c\c@\c@\c@A\c@\$\c@M\c@\c@\c@F\c@\"\c@6\c@\c@\c@H\c@ \c@!\c@\c@\c@F\c@\c_\c@\cN\c@\c@\c@A\c@\c_\c@\cB\c@\c@\c@9\c@!\c@\c@\c@\c@\c@0\c@\$\c@\c@\c@\c@\c@&\c@'\c@\cA\c@\c@\c@\c]\c@,\c@\cH\c@\c@\c@\cS\c@3\c@\cT\c@\c@\c@\cL\c@9\c@#\c@\c@\c@\cF\c@D\c@4\c@\c@\c@\cB\c@P\c@I\c@\c@\c@\c@\c@[\c@\\\c@\c@\c@\cA\c@e\c@p\c@\c@\c@\cD\c@k\c@„\c@\c@\c@\cI\c@k\c@™\c@\c@\c@\cP\c@e\c@«\c@\c@\c@\cZ\c@\\\c@¸\c@\c@\c@&\c@Q\c@»\c@\c@\c@2\c@G\c@µ\c@\c@\c@<\c@=\c@¥\c@\c@\c@E\c@6\c@\c@\c@\c@K\c@0\c@s\c@\c@\c@N\c@+\c@Y\c@\c@\c@O\c@&\c@B\c@\c@\c@O\c@\$\c@.\c@\c@\c@N\c@%\c@\c^\c@\c@\c@L\c@)\c@\cR\c@\c@\c@I\c@/\c@\cJ\c@\c@\c@C\c@7\c@\cD\c@\c@\c@;\c@?\c@\cA\c@\cB\c@3\c@E\c@\c@\c@\cE\c@,\c@I\c@\c@\c@\cJ\c@&\c@J\c@\c@\c@\cP\c@\$\c@I\c@\c@\c@\cY\c@#\c@E\c@\c@\c@\$\c@%\c@=\c@\c@\c@1\c@'\c@3\c@\c@\c@>\c@)\c@(\c@\c@\c@K\c@+\c@\c\\c@\c@\c@X\c@+\c@\cQ\c@\c@\c@c\c@*\c@\cI\c@\c@\c@m\c@'\c@\cD\c@\cC\c@v\c@\$\c@\c@\c@\cK\c@|\c@ \c@\c@\c@\cX\c@€\c@\c^\c@\c@\c@(\c@‚\c@\c]\c@\c@\c@=\c@ƒ\c@\c]\c@\cA\c@R\c@ƒ\c@\c\\c@\cD\c@d\c@„\c@\cY\c@\cG\c@t\c@†\c@\cS\c@\cH\c@€\c@ˆ\c@\cM\c@\cJ\c@‡\c@Š\c@\cG\c@\cH\c@‹\c@‰\c@\cB\c@\cG\c@Ž\c@…\c@\c@\c@\cD\c@‘\c@\c?\c@\c@\c@\cA\c@“\c@x\c@\c@\c@\c@\c@’\c@o\c@\c@\c@\c@\c@Œ\c@f\c@\c@\c@\c@\c@\c?\c@\\\c@\c@\c@\c@\c@j\c@P\c@\c@\c@\c@\c@P\c@D\c@\c@\c@\c@\c@4\c@6\c@\cB\c@\cA\c@\c^\c@(\c@\cF\c@\cE\c@\cM\c@\e\c@\cN\c@\cJ\c@\cC\c@\cP\c@\cX\c@\cT\c@\c@\c@\cI\c@%\c@\"\c@\c@\c@\cF\c@3\c@3\c@\c@\c@\cF\c@>\c@F\c@\c@\c@\cK\c@D\c@Y\c@\c@\c@\cS\c@D\c@h\c@\c@\c@\c^\c@<\c@r\c@\c@\c@(\c@.\c@t\c@\c@\c@2\c@ \c@p\c@\c@\c@9\c@\cR\c@g\c@\c@\c@?\c@\cH\c@\\\c@\c@\c@\@\c@\cA\c@O\c@\c@\c@?\c@\c@\c@F\c@\c@\c@9\c@\c@\c@=\c@\c@\c@2\c@\c@\c@7\c@\c@\c@)\c@\c@\c@3\c@\c@\c@\c_\c@\c@\c@3\c@\c@\c@\cT\c@\c@\c@4\c@\cB\c@\cL\c@\c@\c@8\c@\cH\c@\cF\c@\c@\c@=\c@\cO\c@\cB\c@\c@\c@C\c@\cV\c@\c@\c@\c@\c@H\c@\e\c@\cA\c@\c@\c@K\c@\e\c@\cE\c@\cA\c@M\c@\cW\c@\cK\c@\cC\c@K\c@\cP\c@\cS\c@\cE\c@G\c@\cJ\c@\c^\c@\cF\c@>\c@\cG\c@)\c@\cF\c@3\c@\cG\c@4\c@\cE\c@%\c@\cH\c@>\c@\cC\c@\cX\c@\cH\c@F\c@\cA\c@\cM\c@\cH\c@I\c@\c@\c@\cF\c@\cF\c@I\c@\c@\c@\cA\c@\cB\c@F\c@\c@\c@\c@\c@\c@\c@?\c@\c@\c@\c@\c@\cB\c@6\c@\c@\c@\c@\c@\cJ\c@-\c@\c@\c@\c@\c@\cW\c@#\c@\c@\c@\cA\c@)\c@\cZ\c@\c@\c@\cA\c@>\c@\cR\c@\c@\c@\cA\c@R\c@\cL\c@\c@\c@\cA\c@c\c@\cH\c@\c@\c@\cB\c@r\c@\cH\c@\c@\c@\cC\c@…\c@\cK\c@\c@\c@\cE\c@ž\c@\cP\c@\cA\c@\cF\c@¿\c@\cW\c@\cE\c@\cF\c@è\c@\c]\c@\cK\c@\cE\cA\cU\c@\"\c@\cT\c@\cD\cAD\c@%\c@\c_\c@\cA\cAr\c@'\c@*\c@\c@\cAž\c@(\c@4\c@\c@\cAÊ\c@(\c@;\c@\c@\cAó\c@'\c@>\c@\c@\cB\cT\c@%\c@>\c@\c@\cB'\c@#\c@;\c@\c@\cB*\c@\c_\c@6\c@\c@\cB\c\\c@\e\c@/\c@\cC\cAÿ\c@\cV\c@*\c@\cF\cA×\c@\cP\c@&\c@\cJ\cA¦\c@\cK\c@\$\c@\cN\cAn\c@\cF\c@#\c@\cS\cA.\c@\cB\c@#\c@\cV\c@é\c@\c@\c@\$\c@\cW\c@¤\c@\c@\c@%\c@\cW\c@g\c@\c@\c@'\c@\cU\c@8\c@\c@\c@+\c@\cQ\c@\cX\c@\c@\c@0\c@\cL\c@\cI\c@\c@\c@6\c@\cG\c@\cI\c@\c@\c@\@\c@\cC\c@\cW\c@\cB\c@K\c@\c@\c@.\c@\cD\c@X\c@\c@\c@O\c@\cF\c@f\c@\c@\c@z\c@\cJ\c@r\c@\c@\c@«\c@\cN\c@|\c@\c@\c@Þ\c@\cR\c@‚\c@\c@\cA\cK\c@\cX\c@„\c@\c@\cA/\c@\c_\c@ƒ\c@\c@\cAE\c@&\c@€\c@\c@\cAJ\c@,\c@}\c@\c@\cA\@\c@1\c@z\c@\cB\cA)\c@3\c@u\c@\cH\cA\cK\c@2\c@p\c@\cP\c@ë\c@.\c@i\c@\cZ\c@Í\c@(\c@a\c@%\c@µ\c@\c_\c@X\c@,\c@Ÿ\c@\cW\c@P\c@/\c@Š\c@\cO\c@J\c@-\c@r\c@\cH\c@F\c@&\c@Y\c@\cC\c@C\c@\e\c@\@\c@\cA\c@A\c@\cQ\c@+\c@\c@\c@>\c@\cI\c@\c\\c@\c@\c@;\c@\cC\c@\cT\c@\c@\c@8\c@\c@\c@\cP\c@\c@\c@6\c@\c@\c@\cM\c@\c@\c@6\c@\c@\c@\cJ\c@\cB\c@7\c@\c@\c@\cG\c@\cE\c@9\c@\c@\c@\cC\c@\cJ\c@;\c@\c@\c@\cA\c@\cO\c@<\c@\c@\c@\c@\c@\cU\c@;\c@\c@\c@\c@\c@\cZ\c@7\c@\c@\c@\c@\c@\c_\c@1\c@\c@\c@\c@\c@#\c@(\c@\c@\c@\c@\c@'\c@\c_\c@\c@\c@\cE\c@,\c@\cV\c@\c@\c@\cP\c@0\c@\cM\c@\c@\c@\"\c@3\c@\cG\c@\c@\c@=\c@4\c@\cC\c@\c@\c@_\c@4\c@\cA\c@\c@\c@„\c@2\c@\c@\c@\c@\c@§\c@0\c@\c@\c@\c@\c@Ç\c@.\c@\cB\c@\c@\c@Ü\c@+\c@\cF\c@\c@\c@å\c@'\c@\cM\c@\c@\c@à\c@!\c@\cV\c@\c@\c@Î\c@\e\c@!\c@\c@\c@±\c@\cU\c@-\c@\c@\c@Œ\c@\cQ\c@:\c@\c@\c@f\c@\cO\c@F\c@\c@\c@D\c@\cO\c@Q\c@\c@\c@(\c@\cO\c@Y\c@\c@\c@\cT\c@\cQ\c@^\c@\c@\c@\cI\c@\cT\c@^\c@\c@\c@\cB\c@\cY\c@Z\c@\c@\c@\cB\c@\c\\c@Q\c@\c@\c@\cL\c@\c^\c@F\c@\c@\c@\cZ\c@\c]\c@;\c@\c@\c@*\c@\cY\c@0\c@\c@\c@7\c@\cS\c@'\c@\cB\c@?\c@\cL\c@\"\c@\cE\c@<\c@\cE\c@\"\c@\cJ\c@/\c@\cA\c@(\c@\cP\c@ \c@\c@\c@2\c@\cV\c@\cQ\c@\c@\c@B\c@\c]\c@\cF\c@\c@\c@T\c@#\c@\c@\c@\c@\c@f\c@'\c@\c@\c@\c@\c@w\c@)\c@\c@\c@\c@\c@„\c@*\c@\c@\c@\c@\c@Œ\c@)\c@\c@\c@\cB\c@\c@'\c@\c@\c@\cH\c@Ž\c@%\c@\c@\c@\cQ\c@ˆ\c@!\c@\c@\c@\c\\c@~\c@\c]\c@\c@\c@(\c@r\c@\cW\c@\c@\c@4\c@f\c@\cQ\c@\c@\c@<\c@Z\c@\cK\c@\c@\c@\@\c@N\c@\cF\c@\c@\c@B\c@C\c@\cA\c@\c@\c@A\c@9\c@\c@\c@\c@\c@>\c@1\c@\c@\c@\c@\c@8\c@*\c@\c@\c@\c@\c@0\c@%\c@\cA\c@\c@\c@&\c@!\c@\cF\c@\c@\c@\e\c@\c^\c@\cN\c@\cA\c@\cP\c@\c\\c@\cV\c@\cM\c@\cI\c@\cZ\c@\c^\c@\c_\c@\cD\c@\cY\c@&\c@8\c@\cB\c@\cX\c@(\c@V\c@\cA\c@\cX\c@(\c@x\c@\cA\c@\cY\c@&\c@—\c@\c@\c@\cZ\c@%\c@±\c@\c@\c@\cZ\c@\"\c@Æ\c@\c@\c@\e\c@!\c@Ö\c@\c@\c@\c\\c@ \c@á\c@\cA\c@\c\\c@\c_\c@ä\c@\cD\c@\c^\c@\c^\c@Û\c@\cI\c@\c_\c@\c_\c@Å\c@\cO\c@ \c@!\c@¡\c@\cV\c@\c_\c@%\c@t\c@\e\c@\e\c@)\c@K\c@\c^\c@\cT\c@,\c@)\c@\c^\c@\cN\c@.\c@\cO\c@\c]\c@\cH\c@.\c@\cA\c@\c]\c@\cB\c@-\c@\c@\c@\c]\c@\c@\c@+\c@\c@\c@\c\\c@\c@\c@(\c@\c@\c@\e\c@\c@\c@&\c@\cB\c@\cZ\c@\c@\c@\$\c@\cN\c@\cW\c@\c@\c@!\c@#\c@\cV\c@\cA\c@\c]\c@\@\c@\cW\c@\cF\c@\cU\c@b\c@\cY\c@\cO\c@\cO\c@…\c@\c\\c@\cZ\c@\cI\c@\c@\c_\c@*\c@\cC\c@£\c@!\c@:\c@\c@\c@˜\c@\"\c@H\c@\c@\c@|\c@\"\c@S\c@\c@\c@W\c@ \c@Z\c@\cA\c@6\c@\c^\c@]\c@\cE\c@\e\c@\e\c@]\c@\cH\c@\cH\c@\cX\c@\\\c@\cM\c@\c@\c@\cU\c@Y\c@\cT\c@\c@\c@\cS\c@W\c@\e\c@\c@\c@\cR\c@U\c@\"\c@\c@\c@\cR\c@S\c@*\c@\c@\c@\cR\c@S\c@2\c@\cG\c@\cR\c@T\c@;\c@\c\\c@\cR\c@W\c@B\c@=\c@\cR\c@[\c@D\c@f\c@\cS\c@`\c@C\c@—\c@\cU\c@f\c@=\c@Æ\c@\cY\c@j\c@3\c@ç\c@\c]\c@m\c@&\c@÷\c@ \c@m\c@\cZ\c@ô\c@\"\c@k\c@\cO\c@Ý\c@!\c@f\c@\cH\c@·\c@\c_\c@_\c@\cF\c@†\c@\e\c@V\c@\cH\c@Y\c@\cU\c@M\c@\cP\c@2\c@\cP\c@C\c@\e\c@\cU\c@\cL\c@:\c@'\c@\cC\c@\cJ\c@2\c@4\c@\c@\c@\cJ\c@*\c@>\c@\c@\c@\cM\c@%\c@C\c@\c@\c@\cO\c@\"\c@D\c@\cE\c@\cQ\c@\"\c@>\c@\cY\c@\cQ\c@\$\c@5\c@8\c@\cP\c@(\c@'\c@b\c@\cL\c@/\c@\cZ\c@–\c@\cH\c@7\c@\cO\c@Ï\c@\cD\c@A\c@\cG\c@þ\c@\cB\c@M\c@\cA\cA \c@\c@\c@[\c@\c@\cA/\c@\c@\c@g\c@\c@\cA+\c@\c@\c@r\c@\c@\cA\cU\c@\c@\c@y\c@\c@\c@ñ\c@\c@\c@|\c@\c@\c@Æ\c@\c@\c@}\c@\c@\c@š\c@\c@\c@{\c@\c@\c@u\c@\c@\c@z\c@\c@\c@Z\c@\c@\c@x\c@\cB\c@L\c@\cA\c@v\c@\cC\c@L\c@\cB\c@t\c@\cD\c@W\c@\cD\c@p\c@\cE\c@j\c@\cG\c@m\c@\cD\c@\c@\cI\c@i\c@\cC\c@–\c@\cK\c@d\c@\cB\c@§\c@\cK\c@a\c@\c@\c@³\c@\cK\c@]\c@\c@\c@¸\c@\cI\c@Y\c@\c@\c@¹\c@\cG\c@V\c@\c@\c@´\c@\cD\c@U\c@\c@\c@ª\c@\cB\c@U\c@\c@\c@™\c@\cA\c@W\c@\cA\c@\c@\c@\c@Y\c@\cD\c@b\c@\c@\c@Z\c@\cH\c@C\c@\c@\c@X\c@\cP\c@)\c@\c@\c@U\c@\cY\c@\cS\c@\c@\c@P\c@\"\c@\cE\c@\c@\c@J\c@,\c@\c@\c@\c@\c@C\c@2\c@\c@\c@\c@\c@;\c@4\c@\c@\c@\cC\c@3\c@1\c@\cG\c@\cI\c@)\c@(\c@\cT\c@\cR\c@\c]\c@\c]\c@)\c@\c]\c@\cS\c@\cR\c@B\c@*\c@\cK\c@\cI\c@`\c@4\c@\cD\c@\cB\c@y\c@;\c@\c@\c@\c@\c@‰\c@?\c@\c@\c@\c@\c@Ž\c@A\c@\c@\c@\c@\c@‹\c@\@\c@\c@\c@\c@\c@€\c@>\c@\c@\c@\c@\c@q\c@9\c@\c@\c@\c@\c@a\c@2\c@\c@\c@\c@\c@O\c@(\c@\c@\c@\c@\c@=\c@\c]\c@\c@\c@\c@\c@+\c@\cR\c@\c@\c@\cD\c@\c\\c@\cJ\c@\c@\c@\cK\c@\cU\c@\cD\c@\c@\c@\cR\c@\cY\c@\cB\c@\c@\c@\cZ\c@(\c@\cD\c@\c@\c@\"\c@\@\c@\cI\c@\c@\c@%\c@]\c@\cN\c@\c@\c@#\c@z\c@\cV\c@\c@\c@\c_\c@•\c@\c^\c@\c@\c@\cX\c@«\c@&\c@\c@\c@\cP\c@½\c@-\c@\c@\c@\cI\c@Ê\c@2\c@\c@\c@\cE\c@Ò\c@4\c@\c@\c@\cA\c@Ó\c@2\c@\c@\c@\c@\c@Ï\c@,\c@\c@\c@\c@\c@Æ\c@#\c@\c@\c@\c@\c@º\c@\cX\c@\c@\c@\c@\c@­\c@\cO\c@\cB\c@\c@\c@ \c@\cG\c@\cE\c@\c@\c@“\c@\cC\c@\cJ\c@\c@\c@…\c@\cC\c@\cQ\c@\c@\c@w\c@\cD\c@\cY\c@\c@\c@k\c@\cF\c@!\c@\c@\c@b\c@\cF\c@(\c@\c@\c@_\c@\cF\c@,\c@\cB\c@a\c@\cD\c@.\c@\cH\c@g\c@\cB\c@.\c@\cQ\c@p\c@\cA\c@-\c@\c\\c@{\c@\c@\c@+\c@*\c@†\c@\c@\c@)\c@7\c@\c@\c@\c@(\c@C\c@™\c@\c@\c@'\c@K\c@Ÿ\c@\c@\c@&\c@U\c@ \c@\c@\c@&\c@]\c@š\c@\c@\c@(\c@i\c@\c@\c@\c@+\c@t\c@{\c@\c@\c@/\c@\c?\c@f\c@\c@\c@3\c@†\c@Q\c@\c@\c@8\c@Š\c@\@\c@\c@\c@;\c@‡\c@3\c@\c@\c@=\c@\c@,\c@\c@\c@>\c@y\c@*\c@\c@\c@>\c@p\c@-\c@\c@\c@=\c@h\c@2\c@\cA\c@;\c@c\c@:\c@\cB\c@8\c@^\c@D\c@\cC\c@3\c@X\c@P\c@\cE\c@,\c@S\c@_\c@\cI\c@\$\c@N\c@t\c@\cN\c@\e\c@G\c@\c@\cT\c@\cR\c@A\c@°\c@\cZ\c@\cK\c@:\c@Ð\c@\c_\c@\cH\c@1\c@è\c@!\c@\cH\c@*\c@ô\c@!\c@\cK\c@\$\c@ò\c@\c^\c@\cO\c@\c^\c@á\c@\cY\c@\cS\c@\e\c@Ç\c@\cT\c@\cU\c@\cZ\c@ª\c@\cO\c@\cU\c@\cY\c@Œ\c@\cK\c@\cR\c@\cZ\c@k\c@\cH\c@\cN\c@\cZ\c@K\c@\cF\c@\cI\c@\cY\c@1\c@\cD\c@\cF\c@\cZ\c@\cZ\c@\cB\c@\cC\c@\c\\c@\cI\c@\cA\c@\cA\c@ \c@\c@\c@\c@\c@\c@\c@&\c@\c@\c@\c@\c@\c@\c@,\c@\c@\c@\c@\c@\c@\c@3\c@\c@\c@\c@\c@\c@\c@8\c@\c@\c@\c@\c@\cB\c@<\c@\c@\c@\c@\c@\cF\c@\@\c@\c@\c@\c@\c@\cJ\c@F\c@\c@\c@\c@\c@\cO\c@K\c@\cB\c@\c@\c@\cV\c@Q\c@\cH\c@\c@\c@\c^\c@V\c@\cT\c@\c@\c@(\c@X\c@&\c@\c@\c@5\c@V\c@>\c@\c@\c@B\c@R\c@Z\c@\c@\c@N\c@K\c@t\c@\c@\c@X\c@B\c@‰\c@\c@\c@^\c@:\c@˜\c@\c@\c@`\c@2\c@ž\c@\cA\c@`\c@+\c@š\c@\cC\c@^\c@'\c@\c@\cF\c@[\c@%\c@}\c@\cJ\c@W\c@%\c@h\c@\cO\c@S\c@&\c@Q\c@\cR\c@M\c@'\c@<\c@\cT\c@E\c@(\c@,\c@\cS\c@=\c@*\c@%\c@\cP\c@3\c@+\c@'\c@\cM\c@)\c@,\c@2\c@\cK\c@\c_\c@-\c@G\c@\cM\c@\cX\c@,\c@a\c@\cQ\c@\cT\c@+\c@}\c@\cX\c@\cS\c@'\c@˜\c@\c_\c@\cV\c@\"\c@¯\c@(\c@\c\\c@\c\\c@Á\c@0\c@#\c@\cX\c@Ï\c@7\c@)\c@\cU\c@Û\c@=\c@.\c@\cU\c@â\c@B\c@0\c@\cW\c@æ\c@F\c@0\c@\cZ\c@æ\c@H\c@.\c@\c\\c@à\c@I\c@)\c@\c]\c@Ö\c@H\c@\"\c@\c]\c@Ì\c@F\c@\cY\c@\c\\c@Ã\c@D\c@\cQ\c@\c]\c@¾\c@A\c@\cJ\c@ \c@½\c@<\c@\cD\c@\$\c@¿\c@5\c@\cA\c@'\c@Á\c@-\c@\c@\c@+\c@Ã\c@\"\c@\c@\c@,\c@Ä\c@\cW\c@\cB\c@-\c@Ä\c@\cM\c@\cD\c@+\c@Ä\c@\cF\c@\cG\c@(\c@Ä\c@\cA\c@\cJ\c@%\c@Ä\c@\c@\c@\cO\c@\"\c@Å\c@\c@\c@\cT\c@\c^\c@Æ\c@\cA\c@\cX\c@\cZ\c@È\c@\cC\c@\c]\c@\cU\c@É\c@\cD\c@ \c@\cQ\c@Ê\c@\cF\c@!\c@\cN\c@É\c@\cG\c@ \c@\cN\c@Å\c@\cG\c@\c]\c@\cO\c@¿\c@\cF\c@\cX\c@\cR\c@¸\c@\cD\c@\cT\c@\cW\c@±\c@\cB\c@\cO\c@\c\\c@«\c@\cC\c@\cL\c@\c_\c@¢\c@\cE\c@\cH\c@\"\c@“\c@\cJ\c@\cE\c@\"\c@\c?\c@\cR\c@\cC\c@\c_\c@c\c@\e\c@\cA\c@\c]\c@D\c@\$\c@\c@\c@\e\c@*\c@+\c@\c@\c@\cX\c@\cV\c@/\c@\c@\c@\cV\c@\cO\c@1\c@\c@\c@\cT\c@\cV\c@2\c@\c@\c@\cO\c@&\c@1\c@\c@\c@\cK\c@:\c@0\c@\cC\c@\cG\c@O\c@/\c@\cG\c@\cC\c@d\c@.\c@\cL\c@\c@\c@u\c@,\c@\cS\c@\c@\c@\c@)\c@\cY\c@\c@\c@‡\c@#\c@\c_\c@\c@\c@‚\c@\c\\c@#\c@\c@\c@q\c@\cT\c@\$\c@\c@\c@U\c@\cM\c@#\c@\c@\c@:\c@\cG\c@\c_\c@\c@\c@ \c@\cB\c@\cX\c@\cF\c@\cK\c@\c@\c@\cQ\c@\cO\c@\c@\c@\c@\c@\cJ\c@\c]\c@\c@\c@\c@\c@\cE\c@-\c@\c@\c@\c@\c@\cA\c@?\c@\c@\c@\c@\c@\c@\c@O\c@\c@\c@\c@\c@\c@\c@[\c@\c@\c@\c@\c@\c@\c@e\c@\c@\c@\c@\c@\c@\c@k\c@\c@\c@\cB\c@\c@\c@o\c@\c@\c@\cF\c@\c@\c@r\c@\cG\c@\cK\c@\c@\c@s\c@\cW\c@\cR\c@\c@\c@s\c@-\c@\e\c@\c@\c@s\c@C\c@#\c@\c@\c@s\c@V\c@*\c@\c@\c@t\c@\\\c@.\c@\c@\c@v\c@R\c@.\c@\c@\c@{\c@>\c@,\c@\c@\c@‚\c@(\c@(\c@\cC\c@‹\c@\cR\c@\"\c@\cG\c@“\c@\cD\c@\c^\c@\cJ\c@—\c@\c@\c@\c]\c@\cN\c@˜\c@\c@\c@\c^\c@\cO\c@“\c@\c@\c@\"\c@\cN\c@‡\c@\c@\c@(\c@\cJ\c@w\c@\c@\c@.\c@\cG\c@g\c@\c@\c@2\c@\cC\c@X\c@\cA\c@4\c@\c@\c@M\c@\cE\c@5\c@\c@\c@D\c@\cL\c@7\c@\c@\c@?\c@\cS\c@:\c@\c@\c@;\c@\e\c@>\c@\cB\c@7\c@\"\c@B\c@\cF\c@3\c@'\c@H\c@\cJ\c@0\c@(\c@N\c@\cP\c@-\c@'\c@S\c@\cV\c@*\c@\"\c@X\c@\e\c@&\c@\e\c@[\c@!\c@!\c@\cS\c@]\c@&\c@\cZ\c@\cL\c@_\c@+\c@\cR\c@\cE\c@b\c@/\c@\cK\c@\cA\c@f\c@1\c@\cF\c@\c@\c@l\c@0\c@\cC\c@\c@\c@u\c@,\c@\cA\c@\c@\c@€\c@\$\c@\cA\c@\c@\c@\c@\cZ\c@\c@\c@\c@\c@š\c@\cQ\c@\c@\c@\cF\c@¦\c@\cI\c@\c@\c@\cT\c@±\c@\cC\c@\c@\c@(\c@¸\c@\c@\c@\c@\c@>\c@½\c@\c@\c@\c@\c@W\c@¾\c@\c@\c@\c@\c@k\c@¼\c@\c@\c@\c@\c@x\c@·\c@\c@\c@\c@\c@z\c@°\c@\c@\c@\cB\c@w\c@¤\c@\c@\c@\cC\c@k\c@˜\c@\c@\c@\cF\c@[\c@‡\c@\c@\c@\cK\c@E\c@u\c@\c@\c@\cQ\c@/\c@b\c@\c@\c@\cW\c@\c\\c@R\c@\c@\c@\c]\c@\cM\c@C\c@\c@\c@!\c@\cF\c@9\c@\c@\c@#\c@\cI\c@2\c@\c@\c@%\c@\cR\c@0\c@\cD\c@%\c@ \c@0\c@\cH\c@%\c@1\c@2\c@\cO\c@&\c@\@\c@6\c@\cV\c@'\c@I\c@9\c@\c_\c@'\c@J\c@<\c@&\c@'\c@\@\c@<\c@-\c@'\c@0\c@<\c@1\c@)\c@\c_\c@9\c@2\c@,\c@\cO\c@5\c@1\c@1\c@\cD\c@/\c@,\c@8\c@\c@\c@'\c@#\c@A\c@\c@\c@\c]\c@\cX\c@J\c@\c@\c@\cT\c@\cP\c@S\c@\c@\c@\cL\c@\cH\c@Z\c@\c@\c@\cE\c@\cB\c@`\c@\c@\c@\cA\c@\c@\c@a\c@\cD\c@\c@\c@\c@\c@`\c@\cP\c@\c@\c@\cC\c@]\c@!\c@\c@\c@\cI\c@Y\c@8\c@\c@\c@\cQ\c@S\c@R\c@\c@\c@\e\c@L\c@j\c@\c@\c@)\c@F\c@y\c@\c@\c@7\c@>\c@~\c@\cC\c@C\c@7\c@t\c@\cH\c@N\c@2\c@^\c@\cL\c@U\c@/\c@C\c@\cQ\c@W\c@/\c@+\c@\cU\c@S\c@2\c@\cU\c@\cU\c@I\c@7\c@\cF\c@\cR\c@;\c@\@\c@\c@\c@\cM\c@*\c@K\c@\c@\c@\cI\c@\e\c@U\c@\c@\c@\cD\c@\cO\c@_\c@\c@\c@\cB\c@\cF\c@f\c@\c@\c@\c@\c@\c@\c@i\c@\c@\c@\c@\c@\c@\c@j\c@\c@\c@\c@\c@\c@\c@i\c@\c@\c@\c@\c@\c@\c@f\c@\cC\c@\c@\c@\cA\c@b\c@\cO\c@\c@\c@\cE\c@]\c@ \c@\c@\c@\cN\c@V\c@6\c@\c@\c@\e\c@M\c@L\c@\c@\c@,\c@C\c@a\c@\c@\c@?\c@9\c@m\c@\c@\c@P\c@0\c@q\c@\c@\c@]\c@)\c@o\c@\c@\c@c\c@\$\c@k\c@\c@\c@c\c@\"\c@i\c@\c@\c@_\c@\"\c@h\c@\c@\c@X\c@\"\c@g\c@\c@\c@O\c@%\c@c\c@\c@\c@D\c@*\c@]\c@\c@\c@:\c@2\c@T\c@\c@\c@0\c@;\c@J\c@\c@\c@(\c@E\c@A\c@\c@\c@\"\c@N\c@:\c@\c@\c@\c_\c@T\c@5\c@\c@\c@ \c@V\c@3\c@\c@\c@%\c@V\c@5\c@\c@\c@,\c@S\c@:\c@\c@\c@5\c@O\c@B\c@\c@\c@\@\c@K\c@N\c@\c@\c@K\c@E\c@Z\c@\cD\c@V\c@>\c@c\c@\cL\c@a\c@6\c@f\c@\cW\c@l\c@,\c@c\c@\$\c@v\c@\"\c@Z\c@2\c@€\c@\cW\c@N\c@=\c@‰\c@\cO\c@C\c@D\c@\c@\cH\c@<\c@F\c@“\c@\cD\c@:\c@C\c@“\c@\c@\c@;\c@=\c@‘\c@\c@\c@>\c@3\c@\c@\c@\c@\@\c@'\c@‹\c@\cA\c@\@\c@\cZ\c@‹\c@\cE\c@<\c@\cP\c@\c@\cJ\c@5\c@\cH\c@’\c@\cQ\c@/\c@\cB\c@š\c@\cX\c@-\c@\c@\c@¢\c@\c_\c@-\c@\c@\c@¨\c@#\c@2\c@\c@\c@­\c@#\c@9\c@\c@\c@¯\c@ \c@A\c@\c@\c@®\c@\cZ\c@E\c@\c@\c@¬\c@\cR\c@F\c@\c@\c@¨\c@\cK\c@C\c@\c@\c@£\c@\cF\c@:\c@\cB\c@\c@\cA\c@,\c@\cG\c@–\c@\c@\c@\c_\c@\cN\c@\c@\c@\c@\cS\c@\cV\c@‚\c@\c@\c@\cH\c@\c_\c@w\c@\c@\c@\cA\c@&\c@k\c@\c@\c@\c@\c@)\c@^\c@\c@\c@\c@\c@'\c@R\c@\c@\c@\c@\c@!\c@G\c@\c@\c@\c@\c@\cZ\c@=\c@\c@\c@\c@\c@\cR\c@6\c@\c@\c@\cA\c@\cK\c@2\c@\c@\c@\cG\c@\cF\c@0\c@\c@\c@\cQ\c@\cB\c@0\c@\c@\c@\c_\c@\c@\c@2\c@\c@\c@0\c@\c@\c@5\c@\c@\c@B\c@\c@\c@9\c@\c@\c@P\c@\c@\c@>\c@\cA\c@X\c@\cA\c@D\c@\cF\c@Z\c@\cB\c@I\c@\cL\c@U\c@\cE\c@M\c@\cS\c@H\c@\cH\c@O\c@\cZ\c@6\c@\cL\c@O\c@#\c@%\c@\cN\c@M\c@)\c@\cV\c@\cO\c@I\c@-\c@\cJ\c@\cO\c@D\c@1\c@\cA\c@\cO\c@=\c@4\c@\c@\c@\cN\c@6\c@5\c@\cC\c@\cN\c@-\c@2\c@\cJ\c@\cM\c@\$\c@,\c@\cU\c@\cK\c@\cZ\c@\"\c@\"\c@\cI\c@\cQ\c@\cX\c@3\c@\cG\c@\cJ\c@\cN\c@D\c@\cF\c@\cD\c@\cF\c@V\c@\cG\c@\cC\c@\cA\c@h\c@\cK\c@\cF\c@\c@\c@y\c@\cP\c@\cL\c@\c@\c@ˆ\c@\cT\c@\cS\c@\c@\c@‘\c@\cW\c@\c\\c@\c@\c@”\c@\cW\c@#\c@\cA\c@‘\c@\cV\c@)\c@\cE\c@Š\c@\cT\c@-\c@\cH\c@„\c@\cT\c@1\c@\cN\c@\c@\cV\c@5\c@\cU\c@…\c@\cX\c@:\c@\cY\c@\c@\e\c@>\c@\c\\c@—\c@\c]\c@A\c@\c^\c@¢\c@\c^\c@\@\c@\c^\c@¬\c@\c]\c@;\c@\c^\c@³\c@\c\\c@3\c@\c_\c@¸\c@\c]\c@)\c@\"\c@¸\c@\c^\c@\c_\c@&\c@µ\c@ \c@\cV\c@+\c@ª\c@!\c@\cO\c@0\c@›\c@\"\c@\cK\c@6\c@ƒ\c@\$\c@\cG\c@=\c@i\c@%\c@\cE\c@D\c@N\c@&\c@\cD\c@I\c@5\c@(\c@\cB\c@L\c@!\c@)\c@\cA\c@K\c@\cR\c@(\c@\c@\c@E\c@\cI\c@\$\c@\c@\c@:\c@\cD\c@!\c@\c@\c@-\c@\cB\c@\c^\c@\c@\c@ \c@\cC\c@\c\\c@\c@\c@\cT\c@\cF\c@\c\\c@\c@\c@\cK\c@\cJ\c@\c^\c@\c@\c@\cE\c@\cP\c@ \c@\c@\c@\cB\c@\cX\c@\"\c@\c@\c@\c@\c@\c_\c@\"\c@\c@\c@\c@\c@\$\c@\"\c@\c@\c@\c@\c@'\c@!\c@\cB\c@\c@\c@'\c@!\c@\cH\c@\c@\c@\"\c@!\c@\cQ\c@\cD\c@\cZ\c@\$\c@\c\\c@\cH\c@\cR\c@(\c@*\c@\cO\c@\cK\c@0\c@6\c@\cV\c@\cD\c@:\c@?\c@\c^\c@\c@\c@E\c@E\c@#\c@\cD\c@P\c@F\c@'\c@\cK\c@[\c@B\c@(\c@\cR\c@c\c@9\c@(\c@\cZ\c@j\c@,\c@&\c@\"\c@n\c@\c^\c@\$\c@'\c@q\c@\cS\c@\"\c@(\c@q\c@\cI\c@ \c@%\c@o\c@\cB\c@\c]\c@\c_\c@j\c@\c@\c@\e\c@\cW\c@a\c@\c@\c@\cY\c@\cO\c@W\c@\c@\c@\cX\c@\cI\c@L\c@\c@\c@\cW\c@\cH\c@\@\c@\c@\c@\cW\c@\cL\c@5\c@\c@\c@\cX\c@\cT\c@,\c@\c@\c@\cX\c@\cX\c@#\c@\c@\c@\cW\c@\cZ\c@\c\\c@\cA\c@\cU\c@\cW\c@\cW\c@\cC\c@\cT\c@\cQ\c@\cW\c@\cG\c@\cT\c@\cI\c@\e\c@\cJ\c@\cT\c@\cB\c@#\c@\cL\c@\cT\c@\c@\c@/\c@\cL\c@\cT\c@\c@\c@<\c@\cJ\c@\cQ\c@\cA\c@I\c@\cG\c@\cM\c@\cE\c@S\c@\cC\c@\cH\c@\cK\c@Z\c@\cA\c@\cE\c@\cU\c@_\c@\c@\c@\cA\c@#\c@_\c@\c@\c@\c@\c@5\c@[\c@\c@\c@\c@\c@I\c@S\c@\c@\c@\c@\c@]\c@H\c@\c@\c@\c@\c@m\c@=\c@\c@\c@\cA\c@{\c@4\c@\cC\c@\cF\c@„\c@/\c@\cG\c@\cL\c@‹\c@/\c@\cN\c@\cR\c@\c@3\c@\cV\c@\cY\c@“\c@9\c@\c_\c@!\c@–\c@A\c@(\c@&\c@š\c@I\c@/\c@(\c@Ÿ\c@P\c@5\c@(\c@¦\c@W\c@8\c@'\c@²\c@_\c@:\c@!\c@Á\c@d\c@:\c@\cY\c@Ó\c@h\c@8\c@\cQ\c@æ\c@i\c@7\c@\cJ\c@ö\c@g\c@8\c@\cD\cA\cB\c@b\c@;\c@\c@\cA\cF\c@Y\c@A\c@\c@\cA\c@\c@P\c@I\c@\c@\c@ò\c@H\c@R\c@\c@\c@Ý\c@B\c@Z\c@\c@\c@Ä\c@?\c@c\c@\c@\c@©\c@>\c@j\c@\c@\c@’\c@<\c@s\c@\c@\c@|\c@:\c@z\c@\c@\c@k\c@7\c@€\c@\c@\c@]\c@2\c@ƒ\c@\c@\c@P\c@-\c@ƒ\c@\cB\c@D\c@)\c@\c@\cC\c@:\c@%\c@}\c@\cC\c@2\c@ \c@y\c@\cC\c@*\c@\cX\c@v\c@\cC\c@&\c@\cQ\c@u\c@\cB\c@#\c@\cJ\c@u\c@\c@\c@#\c@\cE\c@v\c@\c@\c@&\c@\cA\c@w\c@\c@\c@+\c@\c@\c@y\c@\c@\c@3\c@\c@\c@z\c@\c@\c@=\c@\c@\c@{\c@\c@\c@K\c@\c@\c@|\c@\c@\c@[\c@\cC\c@|\c@\c@\c@l\c@\cH\c@z\c@\c@\c@|\c@\cO\c@u\c@\c@\c@Š\c@\cW\c@o\c@\c@\c@“\c@\c_\c@f\c@\c@\c@˜\c@\$\c@[\c@\c@\c@š\c@%\c@N\c@\c@\c@™\c@\$\c@\@\c@\c@\c@’\c@\c_\c@0\c@\c@\c@‚\c@\cZ\c@!\c@\c@\c@m\c@\cU\c@\cU\c@\c@\c@R\c@\cO\c@\cK\c@\c@\c@7\c@\cJ\c@\cD\c@\c@\c@ \c@\cF\c@\cA\c@\cD\c@\cU\c@\cC\c@\cA\c@\cI\c@\cW\c@\c@\c@\cD\c@\cQ\c@&\c@\c@\c@\cG\c@\cZ\c@>\c@\cC\c@\cM\c@\$\c@Z\c@\cK\c@\cT\c@,\c@s\c@\cV\c@\e\c@/\c@…\c@\$\c@#\c@/\c@‹\c@5\c@*\c@+\c@‡\c@E\c@/\c@\"\c@x\c@T\c@3\c@\cX\c@d\c@a\c@3\c@\cO\c@P\c@k\c@0\c@\cH\c@A\c@v\c@*\c@\cC\c@:\c@\c@!\c@\c@\c@=\c@Œ\c@\cW\c@\c@\c@G\c@–\c@\cO\c@\c@\c@Z\c@ \c@\cI\c@\c@\c@s\c@ª\c@\cG\c@\c@\c@“\c@´\c@\cF\c@\c@\c@»\c@½\c@\cG\c@\c@\c@ê\c@È\c@\cG\c@\c@\cA\e\c@Ó\c@\cG\c@\c@\cAI\c@Ý\c@\cH\c@\c@\cAm\c@ä\c@\cI\c@\c@\cA\c@ç\c@\cK\c@\c@\cA\c@ä\c@\cM\c@\c@\cAm\c@Û\c@\cO\c@\c@\cAI\c@Í\c@\cO\c@\c@\cA\e\c@½\c@\cL\c@\c@\c@é\c@«\c@\cI\c@\cA\c@¸\c@›\c@\cE\c@\cF\c@\c@Ž\c@\cB\c@\cN\c@l\c@„\c@\c@\c@\cX\c@U\c@{\c@\c@\c@#\c@J\c@t\c@\c@\c@.\c@J\c@m\c@\c@\c@8\c@U\c@d\c@\c@\c@\@\c@i\c@Z\c@\c@\c@E\c@„\c@O\c@\c@\c@H\c@¡\c@B\c@\c@\c@J\c@¹\c@7\c@\cA\c@J\c@É\c@,\c@\cD\c@J\c@Ð\c@#\c@\cI\c@I\c@Í\c@\c\\c@\cN\c@H\c@Ã\c@\cX\c@\cU\c@G\c@´\c@\cV\c@\c\\c@G\c@¥\c@\cW\c@!\c@G\c@–\c@\cY\c@%\c@F\c@‹\c@\c]\c@)\c@E\c@ƒ\c@\"\c@+\c@B\c@\c?\c@&\c@-\c@\@\c@\c?\c@,\c@-\c@>\c@ƒ\c@0\c@-\c@A\c@‡\c@2\c@-\c@D\c@‰\c@4\c@-\c@I\c@‡\c@4\c@-\c@O\c@\c@1\c@.\c@T\c@v\c@+\c@.\c@V\c@h\c@\$\c@+\c@U\c@\\\c@\cZ\c@(\c@Q\c@V\c@\cQ\c@\"\c@M\c@W\c@\cI\c@\e\c@G\c@^\c@\cD\c@\cS\c@A\c@m\c@\cA\c@\cM\c@=\c@\c?\c@\c@\c@\cG\c@9\c@Ž\c@\c@\c@\cD\c@6\c@˜\c@\c@\c@\cD\c@3\c@™\c@\c@\c@\cG\c@0\c@Ž\c@\c@\c@\cL\c@.\c@y\c@\c@\c@\cR\c@/\c@[\c@\c@\c@\cY\c@2\c@=\c@\c@\c@ \c@:\c@\$\c@\c@\c@&\c@G\c@\cP\c@\c@\c@,\c@W\c@\cC\c@\c@\c@3\c@j\c@\c@\c@\c@\c@9\c@~\c@\c@\c@\c@\c@=\c@\c@\c@\c@\c@\c@>\c@Ÿ\c@\c@\c@\c@\c@;\c@©\c@\c@\c@\c@\c@4\c@«\c@\c@\c@\c@\c@*\c@¦\c@\c@\c@\c@\c@\c_\c@™\c@\cD\c@\c@\c@\cT\c@ˆ\c@\cP\c@\c@\c@\cL\c@u\c@\c^\c@\c@\c@\cF\c@d\c@*\c@\c@\c@\cB\c@T\c@3\c@\c@\c@\cA\c@H\c@3\c@\c@\c@\cB\c@?\c@*\c@\c@\c@\cE\c@8\c@\c^\c@\c@\c@\cL\c@1\c@\cP\c@\c@\c@\cU\c@,\c@\cD\c@\c@\c@!\c@)\c@\c@\c@\c@\c@.\c@+\c@\c@\c@\c@\c@:\c@/\c@\c@\c@\cE\c@C\c@5\c@\c@\c@\cM\c@I\c@=\c@\c@\c@\cW\c@I\c@D\c@\c@\c@%\c@E\c@H\c@\c@\c@3\c@;\c@H\c@\c@\c@\@\c@,\c@G\c@\c@\c@F\c@\c^\c@C\c@\c@\c@H\c@\cQ\c@?\c@\c@\c@E\c@\cG\c@<\c@\c@\c@>\c@\cA\c@<\c@\c@\c@5\c@\c@\c@\@\c@\c@\c@+\c@\c@\c@I\c@\c@\c@!\c@\c@\c@U\c@\c@\c@\cX\c@\c@\c@d\c@\c@\c@\cP\c@\c@\c@s\c@\c@\c@\cJ\c@\cA\c@\c@\c@\c@\cE\c@\cD\c@\c@\c@\c@\cB\c@\cI\c@–\c@\c@\c@\cC\c@\cP\c@›\c@\c@\c@\cG\c@\cW\c@š\c@\c@\c@\cM\c@\c^\c@–\c@\c@\c@\cU\c@\"\c@‹\c@\cG\c@\c]\c@!\c@{\c@\cR\c@#\c@\c\\c@i\c@\c^\c@'\c@\cT\c@V\c@+\c@'\c@\cM\c@E\c@7\c@\$\c@\cF\c@8\c@<\c@!\c@\cA\c@3\c@9\c@\c_\c@\c@\c@3\c@2\c@ \c@\c@\c@9\c@'\c@%\c@\c@\c@A\c@\e\c@,\c@\c@\c@J\c@\cP\c@6\c@\c@\c@P\c@\cI\c@?\c@\c@\c@T\c@\cD\c@I\c@\c@\c@V\c@\c@\c@R\c@\c@\c@T\c@\c@\c@]\c@\c@\c@N\c@\cB\c@g\c@\c@\c@G\c@\cK\c@s\c@\c@\c@<\c@\cW\c@~\c@\c@\c@/\c@#\c@ˆ\c@\c@\c@\"\c@/\c@\c@\c@\c@\cV\c@;\c@”\c@\c@\c@\cL\c@E\c@”\c@\c@\c@\cE\c@N\c@‘\c@\c@\c@\cC\c@[\c@\c@\c@\c@\cC\c@l\c@‡\c@\c@\c@\cE\c@~\c@ƒ\c@\c@\c@\cE\c@\c@\c?\c@\c@\c@\cE\c@\c@}\c@\c@\c@\cD\c@¤\c@|\c@\c@\c@\cB\c@©\c@z\c@\c@\c@\c@\c@­\c@w\c@\c@\c@\c@\c@¶\c@s\c@\c@\c@\c@\c@Ã\c@m\c@\c@\c@\c@\c@Ó\c@g\c@\c@\c@\c@\c@â\c@b\c@\cB\c@\c@\c@î\c@]\c@\cF\c@\c@\c@ò\c@Z\c@\cM\c@\c@\c@ñ\c@X\c@\cV\c@\c@\c@í\c@U\c@\"\c@\c@\c@ê\c@Q\c@.\c@\c@\c@ë\c@L\c@7\c@\c@\c@ñ\c@H\c@\@\c@\c@\c@ü\c@E\c@E\c@\c@\cA\cJ\c@D\c@H\c@\c@\cA\cW\c@E\c@I\c@\c@\cA\c^\c@G\c@I\c@\c@\cA\c_\c@J\c@G\c@\c@\cA\cY\c@L\c@F\c@\c@\cA\cK\c@N\c@B\c@\c@\c@ø\c@O\c@>\c@\c@\c@à\c@Q\c@7\c@\c@\c@Å\c@Q\c@.\c@\c@\c@¦\c@R\c@!\c@\c@\c@…\c@R\c@\cV\c@\c@\c@c\c@P\c@\cL\c@\c@\c@C\c@M\c@\cE\c@\c@\c@)\c@I\c@\c@\c@\c@\c@\cU\c@D\c@\c@\c@\c@\c@\cH\c@?\c@\c@\c@\c@\c@\cC\c@;\c@\c@\c@\c@\c@\cG\c@8\c@\c@\c@\c@\c@\cS\c@6\c@\c@\c@\c@\c@%\c@5\c@\c@\c@\c@\c@A\c@3\c@\cA\c@\cB\c@c\c@0\c@\cE\c@\cC\c@ˆ\c@.\c@\cJ\c@\cC\c@©\c@*\c@\cO\c@\cC\c@Â\c@'\c@\cV\c@\cC\c@Ì\c@&\c@\c\\c@\cB\c@À\c@%\c@\"\c@\cC\c@£\c@\$\c@'\c@\cG\c@x\c@\$\c@*\c@\cN\c@O\c@#\c@+\c@\cW\c@+\c@!\c@*\c@!\c@\cP\c@\c^\c@\$\c@*\c@\cA\c@\cX\c@\e\c@4\c@\c@\c@\cQ\c@\cS\c@<\c@\c@\c@\cK\c@\cJ\c@B\c@\c@\c@\cF\c@\cD\c@I\c@\c@\c@\cB\c@\c@\c@M\c@\c@\c@\c@\c@\c@\c@O\c@\c@\c@\c@\c@\c@\c@N\c@\cA\c@\c@\c@\c@\c@K\c@\cJ\c@\c@\c@\c@\c@G\c@\e\c@\c@\c@\cB\c@B\c@0\c@\c@\c@\cD\c@<\c@F\c@\c@\c@\cI\c@6\c@]\c@\c@\c@\cO\c@1\c@l\c@\c@\c@\cX\c@+\c@r\c@\c@\c@!\c@'\c@q\c@\c@\c@+\c@'\c@o\c@\c@\c@3\c@*\c@l\c@\c@\c@;\c@/\c@m\c@\c@\c@\@\c@4\c@o\c@\c@\c@C\c@8\c@o\c@\c@\c@C\c@8\c@h\c@\c@\c@B\c@7\c@Z\c@\c@\c@>\c@4\c@F\c@\c@\c@9\c@3\c@/\c@\c@\c@2\c@5\c@\c\\c@\c@\c@+\c@9\c@\cP\c@\c@\c@\$\c@?\c@\cO\c@\c@\c@\c^\c@E\c@\cU\c@\c@\c@\cZ\c@J\c@!\c@\c@\c@\cX\c@M\c@.\c@\c@\c@\cY\c@P\c@;\c@\c@\c@\cZ\c@R\c@J\c@\c@\c@\c\\c@T\c@Y\c@\c@\c@\c^\c@U\c@h\c@\c@\c@\c^\c@V\c@y\c@\c@\c@\c]\c@V\c@ˆ\c@\c@\c@\e\c@V\c@•\c@\c@\c@\cX\c@U\c@ \c@\cA\c@\cS\c@S\c@©\c@\cD\c@\cM\c@P\c@°\c@\cI\c@\cI\c@L\c@·\c@\cN\c@\cE\c@H\c@¾\c@\cU\c@\cB\c@D\c@Ä\c@\e\c@\c@\c@A\c@Ì\c@ \c@\cB\c@>\c@Õ\c@#\c@\cF\c@9\c@à\c@&\c@\cL\c@4\c@ì\c@&\c@\cT\c@,\c@ö\c@#\c@\c]\c@\$\c@ü\c@ \c@%\c@\c\\c@ú\c@\c]\c@+\c@\cY\c@ó\c@\cY\c@/\c@\cZ\c@æ\c@\cU\c@2\c@ \c@Õ\c@\cS\c@3\c@'\c@À\c@\cQ\c@2\c@/\c@¨\c@\cQ\c@.\c@5\c@Œ\c@\cQ\c@(\c@8\c@m\c@\cT\c@ \c@7\c@O\c@\cX\c@\cW\c@5\c@7\c@\c]\c@\cP\c@3\c@)\c@ \c@\cJ\c@/\c@%\c@ \c@\cG\c@(\c@+\c@\c]\c@\cG\c@ \c@7\c@\cY\c@\cH\c@\cY\c@G\c@\cS\c@\cI\c@\cP\c@V\c@\cN\c@\cK\c@\cH\c@c\c@\cK\c@\cM\c@\cD\c@k\c@\cJ\c@\cN\c@\cA\c@o\c@\cI\c@\cO\c@\c@\c@l\c@\cH\c@\cO\c@\c@\c@d\c@\cF\c@\cN\c@\c@\c@Y\c@\cD\c@\cK\c@\c@\c@O\c@\cD\c@\cH\c@\cB\c@F\c@\cG\c@\cE\c@\cE\c@\@\c@\cM\c@\cB\c@\cH\c@;\c@\cU\c@\c@\c@\cK\c@6\c@\c_\c@\c@\c@\cN\c@0\c@'\c@\c@\c@\cO\c@)\c@.\c@\c@\c@\cO\c@\"\c@3\c@\c@\c@\cO\c@\c^\c@6\c@\c@\c@\cO\c@ \c@5\c@\c@\c@\cO\c@(\c@1\c@\c@\c@\cP\c@9\c@*\c@\c@\c@\cP\c@Q\c@ \c@\c@\c@\cQ\c@n\c@\cV\c@\c@\c@\cS\c@\c@\cM\c@\c@\c@\cW\c@®\c@\cF\c@\c@\c@\c]\c@Ê\c@\cB\c@\c@\c@#\c@Þ\c@\c@\c@\c@\c@+\c@è\c@\c@\c@\c@\c@/\c@æ\c@\cB\c@\c@\c@1\c@Ú\c@\cG\c@\c@\c@/\c@Å\c@\cN\c@\c@\c@,\c@®\c@\cV\c@\c@\c@(\c@—\c@!\c@\c@\c@\$\c@…\c@*\c@\c@\c@ \c@|\c@3\c@\c@\c@\c]\c@|\c@8\c@\c@\c@\cZ\c@„\c@;\c@\c@\c@\cV\c@“\c@:\c@\c@\c@\cQ\c@©\c@7\c@\c@\c@\cM\c@Ã\c@1\c@\c@\c@\cK\c@ã\c@*\c@\c@\c@\cJ\cA\cE\c@\"\c@\c@\c@\cL\cA&\c@\e\c@\c@\c@\cO\cAC\c@\cT\c@\c@\c@\cS\cAY\c@\cN\c@\c@\c@\cX\cAg\c@\cH\c@\c@\c@\c_\cAm\c@\cD\c@\c@\c@%\cAl\c@\cB\c@\c@\c@.\cAf\c@\cA\c@\cA\c@8\cA\\\c@\cB\c@\cC\c@?\cAO\c@\cD\c@\cD\c@A\cA\@\c@\cG\c@\cE\c@?\cA1\c@\cJ\c@\cD\c@8\cA%\c@\cN\c@\cD\c@+\cA\c_\c@\cR\c@\cB\c@\c^\cA\c_\c@\cV\c@\c@\c@\cR\cA%\c@\c]\c@\cA\c@\cI\cA-\c@\$\c@\cE\c@\cC\cA4\c@,\c@\cH\c@\c@\cA6\c@5\c@\cL\c@\c@\cA/\c@?\c@\cP\c@\c@\cA\c^\c@J\c@\cR\c@\c@\cA\cG\c@T\c@\cQ\c@\c@\c@ê\c@]\c@\cM\c@\c@\c@È\c@d\c@\cI\c@\c@\c@£\c@i\c@\cE\c@\c@\c@}\c@k\c@\cB\c@\c@\c@T\c@j\c@\c@\c@\c@\c@4\c@e\c@\c@\c@\c@\c@\e\c@]\c@\c@\c@\cC\c@\cI\c@Q\c@\c@\c@\cJ\c@\c@\c@B\c@\c@\c@\cS\c@\c@\c@3\c@\c@\c@\e\c@\c@\c@%\c@\c@\c@%\c@\c@\c@\cZ\c@\c@\c@)\c@\c@\c@\cR\c@\c@\c@)\c@\c@\c@\cL\c@\cC\c@%\c@\c@\c@\cH\c@\cK\c@ \c@\c@\c@\cF\c@\cV\c@\e\c@\c@\c@\cC\c@%\c@\cY\c@\c@\c@\cD\c@7\c@\cZ\c@\c@\c@\cH\c@G\c@\c\\c@\c@\c@\cP\c@U\c@\c^\c@\c@\c@\cX\c@b\c@!\c@\c@\c@#\c@k\c@!\c@\c@\c@+\c@r\c@\c_\c@\c@\c@0\c@v\c@\c]\c@\c@\c@4\c@u\c@\cZ\c@\cD\c@7\c@p\c@\cV\c@\cO\c@9\c@d\c@\cQ\c@\c^\c@<\c@V\c@\cM\c@/\c@?\c@H\c@\cI\c@C\c@\@\c@=\c@\cE\c@X\c@?\c@6\c@\cA\c@m\c@;\c@3\c@\c@\c@\c@5\c@4\c@\c@\c@’\c@+\c@6\c@\c@\c@\c@\"\c@7\c@\c@\c@ \c@\cW\c@6\c@\c@\c@˜\c@\cO\c@4\c@\c@\c@‰\c@\cH\c@3\c@\c@\c@u\c@\cD\c@4\c@\c@\c@d\c@\cA\c@7\c@\c@\c@Y\c@\c@\c@=\c@\c@\c@W\c@\c@\c@C\c@\c@\c@\\\c@\c@\c@I\c@\c@\c@f\c@\c@\c@M\c@\c@\c@p\c@\cA\c@O\c@\c@\c@u\c@\cE\c@O\c@\c@\c@u\c@\cK\c@O\c@\c@\c@p\c@\cT\c@P\c@\c@\c@f\c@ \c@P\c@\c@\c@\\\c@,\c@Q\c@\c@\c@T\c@6\c@P\c@\c@\c@Q\c@>\c@M\c@\c@\c@T\c@B\c@G\c@\c@\c@\\\c@A\c@>\c@\c@\c@l\c@;\c@2\c@\c@\c@€\c@1\c@#\c@\c@\c@›\c@&\c@\cV\c@\c@\c@·\c@\c]\c@\cL\c@\c@\c@Ö\c@\cU\c@\cE\c@\c@\c@ó\c@\cO\c@\cA\c@\c@\cA\cM\c@\cM\c@\cB\c@\c@\cA\"\c@\cL\c@\cD\c@\c@\cA0\c@\cM\c@\cD\c@\c@\cA5\c@\cO\c@\cD\c@\c@\cA.\c@\cU\c@\cD\c@\c@\cA\c\\c@\c\\c@\cB\c@\c@\c@ÿ\c@%\c@\cA\c@\c@\c@Ù\c@-\c@\c@\c@\c@\c@¯\c@2\c@\c@\c@\c@\c@„\c@4\c@\c@\c@\c@\c@Z\c@3\c@\c@\c@\c@\c@8\c@0\c@\c@\c@\c@\c@ \c@.\c@\c@\c@\cB\c@\cN\c@/\c@\c@\c@\cF\c@\cB\c@2\c@\c@\c@\cJ\c@\c@\c@7\c@\cB\c@\cO\c@\c@\c@>\c@\cE\c@\cT\c@\c@\c@F\c@\cH\c@\cW\c@\c@\c@O\c@\cK\c@\cW\c@\c@\c@W\c@\cN\c@\cT\c@\c@\c@_\c@\cN\c@\cO\c@\c@\c@f\c@\cN\c@\cJ\c@\cD\c@j\c@\cM\c@\cF\c@\cM\c@k\c@\cK\c@\cB\c@\cZ\c@h\c@\cH\c@\c@\c@)\c@b\c@\cG\c@\c@\c@:\c@Z\c@\cF\c@\c@\c@H\c@R\c@\cI\c@\c@\c@Q\c@H\c@\cN\c@\c@\c@Q\c@\@\c@\cV\c@\c@\c@M\c@8\c@!\c@\cB\c@D\c@1\c@-\c@\cF\c@;\c@+\c@7\c@\cK\c@1\c@&\c@>\c@\cS\c@(\c@\"\c@\@\c@\cZ\c@\c_\c@\c^\c@=\c@\"\c@\cV\c@\cY\c@6\c@)\c@\cO\c@\cU\c@,\c@/\c@\cI\c@\cQ\c@%\c@3\c@\cD\c@\cL\c@\c^\c@6\c@\cA\c@\cG\c@\cY\c@8\c@\c@\c@\cD\c@\cV\c@8\c@\c@\c@\cB\c@\cS\c@:\c@\c@\c@\c@\c@\cP\c@>\c@\c@\c@\c@\c@\cM\c@E\c@\c@\c@\c@\c@\cJ\c@N\c@\c@\c@\c@\c@\cI\c@W\c@\c@\c@\c@\c@\cI\c@^\c@\c@\c@\c@\c@\cJ\c@a\c@\c@\c@\c@\c@\cK\c@`\c@\c@\c@\c@\c@\cL\c@\\\c@\c@\c@\c@\c@\cL\c@V\c@\cH\c@\c@\c@\cM\c@P\c@\cX\c@\c@\c@\cM\c@M\c@/\c@\c@\c@\cM\c@J\c@J\c@\c@\c@\cM\c@H\c@h\c@\c@\c@\cM\c@F\c@~\c@\c@\c@\cM\c@A\c@‰\c@\c@\c@\cM\c@8\c@‰\c@\c@\c@\cM\c@,\c@\c?\c@\c@\c@\cM\c@ \c@p\c@\c@\c@\cM\c@\cU\c@_\c@\c@\c@\cM\c@\cN\c@Q\c@\c@\c@\cN\c@\cM\c@J\c@\c@\c@\cN\c@\cP\c@L\c@\c@\c@\cO\c@\cU\c@V\c@\c@\c@\cO\c@\c\\c@f\c@\c@\c@\cN\c@!\c@z\c@\c@\c@\cK\c@\$\c@Ž\c@\c@\c@\cH\c@%\c@ž\c@\c@\c@\cE\c@&\c@©\c@\c@\c@\cB\c@(\c@¬\c@\c@\c@\c@\c@*\c@©\c@\cA\c@\c@\c@,\c@ž\c@\cC\c@\c@\c@-\c@\c@\cF\c@\c@\c@-\c@~\c@\cH\c@\c@\c@-\c@l\c@\cK\c@\c@\c@+\c@Y\c@\cL\c@\c@\c@)\c@E\c@\cK\c@\c@\c@'\c@2\c@\cH\c@\c@\c@&\c@!\c@\cF\c@\c@\c@(\c@\cS\c@\cC\c@\c@\c@.\c@\cH\c@\cA\c@\c@\c@5\c@\cA\c@\c@\c@\c@\c@>\c@\c@\c@\c@\c@\c@\c@F\c@\c@\c@\c@\c@\c@\c@K\c@\c@\c@\c@\c@\c@\c@K\c@\cD\c@\c@\c@\c@\c@H\c@\cI\c@\c@\c@\c@\c@D\c@\cO\c@\c@\c@\c@\c@A\c@\cV\c@\c@\c@\c@\c@?\c@\c_\c@\c@\c@\cA\c@\@\c@)\c@\cB\c@\cE\c@A\c@5\c@\cH\c@\cK\c@C\c@B\c@\cQ\c@\cS\c@A\c@M\c@\e\c@\e\c@?\c@R\c@'\c@\"\c@;\c@O\c@2\c@&\c@9\c@B\c@:\c@&\c@9\c@0\c@?\c@ \c@;\c@\c^\c@B\c@\cX\c@?\c@\cO\c@D\c@\cP\c@C\c@\cC\c@B\c@\cH\c@G\c@\c@\c@=\c@\cC\c@G\c@\c@\c@4\c@\c@\c@G\c@\c@\c@)\c@\c@\c@E\c@\c@\c@\e\c@\c@\c@C\c@\c@\c@\cP\c@\c@\c@C\c@\c@\c@\cH\c@\c@\c@E\c@\c@\c@\cB\c@\c@\c@G\c@\c@\c@\c@\c@\c@\c@H\c@\c@\c@\c@\c@\cC\c@H\c@\cG\c@\c@\c@\cI\c@G\c@\cS\c@\c@\c@\cR\c@D\c@\"\c@\c@\c@\cZ\c@\@\c@0\c@\c@\c@\"\c@;\c@<\c@\c@\c@%\c@4\c@?\c@\cB\c@\$\c@.\c@7\c@\cD\c@\c]\c@'\c@)\c@\cH\c@\cU\c@\"\c@\cZ\c@\cM\c@\cL\c@\c_\c@\cM\c@\cS\c@\cF\c@\c^\c@\cD\c@\cZ\c@\cA\c@\c]\c@\c@\c@#\c@\c@\c@\c]\c@\c@\c@,\c@\c@\c@\c]\c@\c@\c@7\c@\c@\c@\e\c@\c@\c@A\c@\c@\c@\cY\c@\c@\c@J\c@\c@\c@\cX\c@\c@\c@R\c@\c@\c@\cV\c@\c@\c@W\c@\c@\c@\cU\c@\c@\c@Z\c@\c@\c@\cU\c@\c@\c@\\\c@\c@\c@\cU\c@\cH\c@^\c@\c@\c@\cU\c@ \c@`\c@\c@\c@\cU\c@H\c@b\c@\cC\c@\cU\c@|\c@e\c@\cI\c@\cT\c@½\c@i\c@\cP\c@\cR\c@ÿ\c@m\c@\cY\c@\cN\cA5\c@n\c@#\c@\cJ\cAX\c@m\c@*\c@\cF\cAf\c@i\c@/\c@\cC\cA_\c@c\c@1\c@\cC\cAH\c@[\c@0\c@\cF\cA'\c@T\c@/\c@\cJ\cA\cC\c@O\c@.\c@\cO\c@à\c@K\c@.\c@\cS\c@¿\c@G\c@.\c@\cW\c@£\c@F\c@.\c@\cY\c@\c@D\c@.\c@\cZ\c@\c?\c@C\c@,\c@\cY\c@{\c@C\c@)\c@\cW\c@…\c@F\c@%\c@\cT\c@\c@K\c@\c_\c@\cQ\c@Ã\c@Q\c@\cZ\c@\cM\c@ï\c@U\c@\cT\c@\cI\cA\c\\c@U\c@\cO\c@\cF\cAD\c@P\c@\cK\c@\cD\cA^\c@D\c@\cH\c@\cB\cAi\c@5\c@\cF\c@\c@\cAf\c@#\c@\cE\c@\c@\cAV\c@\cU\c@\cE\c@\cA\cA:\c@\cJ\c@\cF\c@\cE\cA\cY\c@\cC\c@\cJ\c@\cJ\c@ó\c@\c@\c@\cP\c@\cQ\c@Î\c@\c@\c@\cW\c@\cX\c@ª\c@\c@\c@ \c@ \c@‰\c@\c@\c@'\c@%\c@l\c@\c@\c@,\c@'\c@T\c@\cA\c@0\c@&\c@?\c@\cC\c@1\c@%\c@0\c@\cG\c@1\c@\"\c@'\c@\cM\c@0\c@\c\\c@\$\c@\cT\c@.\c@\cW\c@,\c@\cZ\c@+\c@\cP\c@>\c@\c_\c@'\c@\cJ\c@W\c@\"\c@\$\c@\cE\c@v\c@#\c@ \c@\cB\c@”\c@\"\c@\c\\c@\c@\c@¬\c@ \c@\cX\c@\c@\c@»\c@\c]\c@\cT\c@\c@\c@¿\c@\c\\c@\cP\c@\c@\c@·\c@\c]\c@\cM\c@\c@\c@¦\c@!\c@\cK\c@\c@\c@\c@(\c@\cJ\c@\c@\c@v\c@1\c@\cJ\c@\c@\c@]\c@;\c@\cL\c@\c@\c@E\c@D\c@\cM\c@\c@\c@/\c@K\c@\cM\c@\c@\c@\c]\c@M\c@\cJ\c@\c@\c@\cP\c@I\c@\cH\c@\c@\c@\cG\c@A\c@\cE\c@\c@\c@\cC\c@5\c@\cB\c@\cB\c@\cF\c@(\c@\c@\c@\cH\c@\cK\c@\c]\c@\cA\c@\cP\c@\cQ\c@\cT\c@\cE\c@\cZ\c@\cW\c@\cO\c@\cN\c@&\c@\c_\c@\cM\c@\cZ\c@2\c@'\c@\cN\c@)\c@;\c@0\c@\cQ\c@9\c@\@\c@6\c@\cU\c@G\c@A\c@:\c@\cZ\c@O\c@<\c@6\c@\c^\c@Q\c@5\c@+\c@!\c@N\c@-\c@\c_\c@\"\c@F\c@%\c@\cR\c@!\c@;\c@\c_\c@\cG\c@\c_\c@0\c@\c\\c@\c@\c@\c\\c@&\c@\c\\c@\c@\c@\cW\c@\c^\c@\c]\c@\c@\c@\cQ\c@\cY\c@\c]\c@\cC\c@\cL\c@\cW\c@\c]\c@\cI\c@\cG\c@\cU\c@\e\c@\cO\c@\cC\c@\cU\c@\cZ\c@\cU\c@\c@\c@\cU\c@\cZ\c@\c\\c@\c@\c@\cW\c@\c]\c@ \c@\c@\c@\cZ\c@\"\c@#\c@\c@\c@ \c@+\c@%\c@\c@\c@(\c@7\c@,\c@\c@\c@2\c@F\c@8\c@\cC\c@:\c@T\c@M\c@\cG\c@\@\c@c\c@l\c@\cN\c@B\c@n\c@“\c@\cV\c@A\c@w\c@»\c@\c]\c@<\c@{\c@à\c@\"\c@5\c@~\c@ú\c@#\c@/\c@~\cA\cD\c@ \c@'\c@~\cA\cA\c@\cZ\c@ \c@z\c@ô\c@\cQ\c@\cZ\c@u\c@à\c@\cJ\c@\cV\c@m\c@Ì\c@\cE\c@\cS\c@b\c@´\c@\cA\c@\cT\c@R\c@\c@\c@\c@\cV\c@B\c@‡\c@\c@\c@\c\\c@1\c@t\c@\c@\c@#\c@#\c@k\c@\c@\c@.\c@\cX\c@n\c@\c@\c@:\c@\cR\c@|\c@\c@\c@I\c@\cQ\c@“\c@\c@\c@Y\c@\cV\c@®\c@\c@\c@k\c@\c_\c@É\c@\c@\c@}\c@*\c@à\c@\c@\c@Ž\c@6\c@ó\c@\c@\c@\c@\@\cA\c@\c@\c@\c@ª\c@F\cA\cE\c@\c@\c@³\c@J\cA\c@\c@\c@\c@»\c@J\c@î\c@\cC\c@¿\c@D\c@Ò\c@\cH\c@À\c@<\c@®\c@\cN\c@¼\c@0\c@‰\c@\cU\c@µ\c@\"\c@f\c@\e\c@ª\c@\cV\c@J\c@\c_\c@œ\c@\cL\c@7\c@\c_\c@Ž\c@\cD\c@,\c@\c]\c@\c?\c@\c@\c@'\c@\cZ\c@r\c@\c@\c@(\c@\cX\c@f\c@\cA\c@/\c@\cW\c@^\c@\cE\c@<\c@\cW\c@X\c@\cJ\c@N\c@\cX\c@U\c@\cO\c@d\c@\cW\c@T\c@\cV\c@x\c@\cV\c@U\c@\c]\c@ˆ\c@\cR\c@X\c@\"\c@\c@\cM\c@Z\c@&\c@‡\c@\cH\c@\\\c@)\c@x\c@\cE\c@]\c@+\c@`\c@\cB\c@\\\c@*\c@F\c@\c@\c@Y\c@(\c@-\c@\c@\c@U\c@\$\c@\cZ\c@\c@\c@Q\c@!\c@\cL\c@\c@\c@M\c@ \c@\cD\c@\c@\c@I\c@!\c@\c@\c@\c@\c@G\c@#\c@\c@\c@\c@\c@F\c@'\c@\c@\c@\c@\c@G\c@-\c@\c@\c@\c@\c@I\c@3\c@\c@\c@\c@\c@M\c@8\c@\cJ\c@\c@\c@Q\c@?\c@\c]\c@\c@\c@U\c@C\c@5\c@\c@\c@Z\c@D\c@S\c@\c@\c@]\c@\@\c@u\c@\c@\c@_\c@7\c@‘\c@\c@\c@a\c@+\c@¤\c@\c@\c@a\c@\c]\c@­\c@\c@\c@`\c@\cQ\c@¬\c@\c@\c@^\c@\cH\c@¢\c@\c@\c@Z\c@\cB\c@\c@\c@\c@S\c@\c@\c@o\c@\c@\c@L\c@\c@\c@N\c@\c@\c@D\c@\c@\c@1\c@\c@\c@<\c@\c@\c@\cX\c@\c@\c@3\c@\c@\c@\cG\c@\c@\c@+\c@\c@\c@\c@\c@\c@\c@#\c@\cB\c@\c@\c@\c@\c@\c\\c@\cD\c@\c@\c@\c@\c@\cW\c@\cF\c@\c@\c@\c@\c@\cS\c@\cG\c@\c@\c@\c@\c@\cQ\c@\cI\c@\c@\c@\c@\c@\cR\c@\cJ\c@\c@\c@\c@\c@\cV\c@\cK\c@\c@\c@\c@\c@\e\c@\cM\c@\c@\c@\c@\c@\$\c@\cP\c@\cB\c@\c@\c@.\c@\cR\c@\cM\c@\c@\c@9\c@\cS\c@!\c@\c@\c@B\c@\cR\c@>\c@\c@\c@K\c@\cO\c@d\c@\cB\c@Q\c@\cM\c@‘\c@\cD\c@U\c@\cJ\c@½\c@\cG\c@V\c@\cI\c@ä\c@\cH\c@U\c@\cI\cA\c@\c@\cH\c@R\c@\cK\cA\cO\c@\cG\c@L\c@\cN\cA\cP\c@\cD\c@E\c@\cQ\cA\cB\c@\cB\c@;\c@\cT\c@æ\c@\c@\c@1\c@\cW\c@½\c@\c@\c@'\c@\c]\c@Ž\c@\c@\c@\c]\c@\$\c@^\c@\c@\c@\cU\c@-\c@8\c@\c@\c@\cO\c@8\c@\e\c@\c@\c@\cK\c@C\c@\cH\c@\c@\c@\cH\c@L\c@\c@\c@\c@\c@\cF\c@R\c@\c@\c@\c@\c@\cD\c@T\c@\c@\c@\c@\c@\cC\c@R\c@\c@\c@\c@\c@\cA\c@M\c@\c@\c@\c@\c@\c@\c@F\c@\c@\c@\c@\c@\c@\c@<\c@\c@\c@\c@\c@\c@\c@2\c@\c@\c@\cD\c@\c@\c@&\c@\c@\c@\cH\c@\c@\c@\e\c@\c@\c@\cM\c@\cB\c@\cS\c@\c@\c@\cR\c@\cE\c@\cN\c@\c@\c@\cV\c@\cH\c@\cL\c@\c@\c@\cW\c@\cL\c@\cM\c@\c@\c@\cX\c@\cP\c@\cN\c@\c@\c@\cX\c@\cR\c@\cO\c@\c@\c@\cX\c@\cR\c@\cQ\c@\c@\c@\cZ\c@\cP\c@\cS\c@\c@\c@\c^\c@\cL\c@\cV\c@\c@\c@\"\c@\cH\c@\cY\c@\c@\c@'\c@\cE\c@\e\c@\c@\c@+\c@\cB\c@\c]\c@\c@\c@.\c@\c@\c@\c]\c@\c@\c@0\c@\c@\c@\cY\c@\c@\c@0\c@\c@\c@\cT\c@\c@\c@0\c@\c@\c@\cO\c@\c@\c@/\c@\c@\c@\cJ\c@\c@\c@/\c@\c@\c@\cF\c@\cA\c@.\c@\c@\c@\cD\c@\cF\c@.\c@\c@\c@\cB\c@\cM\c@.\c@\c@\c@\cA\c@\cU\c@.\c@\c@\c@\c@\c@\c\\c@/\c@\c@\c@\c@\c@\"\c@/\c@\c@\c@\c@\c@%\c@0\c@\cB\c@\c@\c@%\c@0\c@\cE\c@\c@\c@\$\c@0\c@\cH\c@\c@\c@#\c@0\c@\cK\c@\c@\c@\$\c@-\c@\cM\c@\c@\c@%\c@(\c@\cM\c@\c@\c@%\c@\"\c@\cL\c@\c@\c@\"\c@\e\c@\cK\c@\c@\c@\c\\c@\cT\c@\cL\c@\c@\c@\cU\c@\cO\c@\cO\c@\c@\c@\cM\c@\cM\c@\cR\c@\cA\c@\cF\c@\cL\c@\cW\c@\cA\c@\cA\c@\cM\c@\e\c@\cA\c@\c@\c@\cO\c@\c]\c@\cA\c@\c@\c@\cQ\c@\c]\c@\c@\c@\cA\c@\cR\c@\c\\c@\c@\c@\cB\c@\cT\c@\cZ\c@\cA\c@\cD\c@\cX\c@\cZ\c@\cA\c@\cI\c@\c]\c@\c]\c@\cB\c@\cQ\c@#\c@#\c@\cB\c@\c^\c@'\c@+\c@\cB\c@,\c@+\c@3\c@\cA\c@;\c@-\c@9\c@\cA\c@G\c@.\c@;\c@\c@\c@O\c@0\c@:\c@\c@\c@R\c@5\c@6\c@\c@\c@Q\c@<\c@1\c@\c@\c@L\c@E\c@+\c@\c@\c@D\c@P\c@\$\c@\c@\c@9\c@[\c@\c\\c@\c@\c@-\c@a\c@\cT\c@\c@\c@\c_\c@b\c@\cL\c@\c@\c@\cS\c@]\c@\cF\c@\c@\c@\cI\c@T\c@\cB\c@\c@\c@\cD\c@F\c@\c@\c@\cC\c@\cD\c@8\c@\c@\c@\cI\c@\cJ\c@+\c@\c@\c@\cN\c@\cR\c@#\c@\c@\c@\cT\c@\c\\c@\c]\c@\c@\c@\cZ\c@%\c@\cZ\c@\c@\c@\c]\c@,\c@\cZ\c@\c@\c@\cZ\c@0\c@\cZ\c@\c@\c@\cT\c@2\c@\cZ\c@\c@\c@\cN\c@3\c@\c\\c@\cB\c@\cI\c@7\c@\c^\c@\cF\c@\cC\c@=\c@\"\c@\cK\c@\c@\c@G\c@(\c@\cQ\c@\c@\c@N\c@.\c@\cX\c@\c@\c@R\c@4\c@\c]\c@\c@\c@N\c@9\c@\c_\c@\c@\c@\@\c@>\c@\c]\c@\c@\c@.\c@\@\c@\cX\c@\c@\c@\c^\c@\@\c@\cQ\c@\c@\c@\cN\c@>\c@\cK\c@\c@\c@\cC\c@:\c@\cF\c@\c@\c@\c@\c@4\c@\cE\c@\c@\c@\c@\c@.\c@\cH\c@\c@\c@\c@\c@(\c@\cO\c@\c@\c@\c@\c@\"\c@\cX\c@\c@\c@\cA\c@\c\\c@#\c@\c@\c@\cG\c@\cV\c@/\c@\c@\c@\cR\c@\cO\c@<\c@\c@\c@!\c@\cJ\c@I\c@\c@\c@7\c@\cE\c@T\c@\c@\c@R\c@\cB\c@]\c@\c@\c@n\c@\c@\c@d\c@\c@\c@†\c@\c@\c@h\c@\c@\c@–\c@\c@\c@j\c@\c@\c@›\c@\c@\c@j\c@\c@\c@”\c@\c@\c@g\c@\c@\c@…\c@\c@\c@d\c@\c@\c@p\c@\c@\c@_\c@\c@\c@Z\c@\c@\c@Z\c@\c@\c@D\c@\c@\c@W\c@\cC\c@0\c@\c@\c@U\c@\cI\c@ \c@\cB\c@V\c@\cQ\c@\cT\c@\cD\c@X\c@\e\c@\cI\c@\cG\c@[\c@%\c@\cB\c@\cH\c@^\c@-\c@\c@\c@\cH\c@_\c@3\c@\c@\c@\cG\c@^\c@6\c@\c@\c@\cD\c@]\c@6\c@\c@\c@\cB\c@Y\c@5\c@\c@\c@\c@\c@U\c@3\c@\c@\c@\c@\c@O\c@1\c@\c@\c@\c@\c@H\c@-\c@\c@\c@\c@\c@B\c@(\c@\c@\c@\c@\c@<\c@!\c@\c@\c@\cA\c@8\c@\cY\c@\cB\c@\cC\c@7\c@\cP\c@\cH\c@\cE\c@9\c@\cJ\c@\cO\c@\cG\c@>\c@\cE\c@\cZ\c@\cI\c@D\c@\cA\c@(\c@\cJ\c@K\c@\c@\c@5\c@\cI\c@O\c@\c@\c@\@\c@\cH\c@R\c@\c@\c@E\c@\cF\c@S\c@\c@\c@D\c@\cE\c@R\c@\c@\c@<\c@\cE\c@O\c@\cB\c@2\c@\cG\c@J\c@\cF\c@)\c@\cJ\c@D\c@\cK\c@(\c@\cM\c@<\c@\cO\c@/\c@\cP\c@4\c@\cV\c@=\c@\cS\c@,\c@\cZ\c@Q\c@\cU\c@'\c@ \c@g\c@\cW\c@\$\c@\$\c@{\c@\e\c@%\c@*\c@‹\c@!\c@'\c@1\c@–\c@)\c@,\c@7\c@›\c@3\c@2\c@<\c@š\c@A\c@8\c@\@\c@”\c@P\c@\@\c@C\c@‹\c@_\c@G\c@C\c@\c@m\c@M\c@A\c@u\c@x\c@R\c@<\c@f\c@€\c@U\c@5\c@U\c@ƒ\c@T\c@+\c@B\c@\c@O\c@!\c@-\c@}\c@H\c@\cY\c@\c\\c@w\c@=\c@\cS\c@\cN\c@q\c@2\c@\cO\c@\cD\c@l\c@&\c@\cM\c@\c@\c@i\c@\c\\c@\cJ\c@\c@\c@h\c@\cS\c@\cG\c@\c@\c@h\c@\cM\c@\cD\c@\c@\c@j\c@\cI\c@\cA\c@\c@\c@k\c@\cH\c@\c@\c@\c@\c@n\c@\cI\c@\c@\c@\c@\c@p\c@\cK\c@\c@\c@\c@\c@p\c@\cM\c@\cC\c@\c@\c@p\c@\cM\c@\cH\c@\c@\c@m\c@\cK\c@\cP\c@\c@\c@h\c@\cH\c@\cY\c@\c@\c@b\c@\cE\c@\"\c@\c@\c@Z\c@\cB\c@(\c@\c@\c@O\c@\c@\c@*\c@\c@\c@D\c@\c@\c@(\c@\c@\c@8\c@\c@\c@\"\c@\c@\c@*\c@\cA\c@\e\c@\c@\c@\c^\c@\cC\c@\cR\c@\c@\c@\cT\c@\cG\c@\cL\c@\c@\c@\cM\c@\cM\c@\cF\c@\cH\c@\cL\c@\cV\c@\cB\c@\cW\c@\cO\c@!\c@\c@\c@'\c@\cU\c@0\c@\c@\c@6\c@\c]\c@?\c@\c@\c@A\c@\$\c@M\c@\cA\c@C\c@*\c@W\c@\cF\c@<\c@2\c@Z\c@\cM\c@.\c@9\c@U\c@\cU\c@ \c@A\c@J\c@\c]\c@\cU\c@I\c@<\c@#\c@\cL\c@P\c@-\c@#\c@\cG\c@S\c@\c_\c@\c]\c@\cF\c@R\c@\cR\c@\cU\c@\cK\c@N\c@\cJ\c@\cM\c@\cX\c@H\c@\cE\c@\cF\c@/\c@A\c@\cB\c@\cA\c@P\c@<\c@\c@\c@\c@\c@w\c@8\c@\c@\c@\c@\c@¢\c@6\c@\c@\c@\c@\c@Ê\c@5\c@\c@\c@\c@\c@î\c@4\c@\c@\c@\cB\cA\cJ\c@2\c@\c@\c@\cH\cA \c@/\c@\c@\c@\cQ\cA/\c@+\c@\c@\c@\c]\cA5\c@&\c@\c@\c@,\cA.\c@\c_\c@\c@\c@<\cA\c\\c@\cW\c@\c@\c@J\c@û\c@\cO\c@\c@\c@U\c@Ï\c@\cI\c@\c@\c@_\c@›\c@\cD\c@\cA\c@g\c@g\c@\cA\c@\cD\c@n\c@=\c@\c@\c@\cG\c@s\c@\c^\c@\cA\c@\cK\c@w\c@\cI\c@\cD\c@\cM\c@y\c@\c@\c@\cG\c@\cM\c@y\c@\c@\c@\cJ\c@\cK\c@w\c@\c@\c@\cM\c@\cG\c@t\c@\c@\c@\cN\c@\cD\c@o\c@\c@\c@\cN\c@\cA\c@i\c@\c@\c@\cN\c@\c@\c@c\c@\cA\c@\cO\c@\c@\c@\\\c@\cG\c@\cR\c@\c@\c@T\c@\cR\c@\cV\c@\c@\c@K\c@!\c@\e\c@\c@\c@B\c@6\c@\c^\c@\c@\c@6\c@N\c@!\c@\c@\c@-\c@f\c@\$\c@\cE\c@%\c@|\c@'\c@\cM\c@\c_\c@\c@*\c@\cX\c@\e\c@Ÿ\c@,\c@%\c@\cZ\c@ª\c@.\c@4\c@\cZ\c@¯\c@.\c@?\c@\cZ\c@¨\c@,\c@E\c@\cZ\c@”\c@(\c@F\c@\cZ\c@t\c@#\c@C\c@\e\c@R\c@\c^\c@<\c@\c^\c@1\c@\cX\c@3\c@\$\c@\cV\c@\cQ\c@)\c@-\c@\cE\c@\cK\c@ \c@:\c@\c@\c@\cF\c@\cX\c@I\c@\c@\c@\cB\c@\cQ\c@X\c@\c@\c@\c@\c@\cK\c@d\c@\c@\c@\c@\c@\cF\c@l\c@\c@\c@\c@\c@\cC\c@m\c@\c@\c@\c@\c@\cA\c@g\c@\c@\c@\cB\c@\c@\c@Y\c@\cA\c@\cD\c@\c@\c@F\c@\cN\c@\cD\c@\cB\c@0\c@#\c@\cD\c@\cE\c@\c^\c@\@\c@\cD\c@\cI\c@\cO\c@`\c@\cB\c@\cO\c@\cE\c@€\c@\c@\c@\cY\c@\c@\c@“\c@\c@\c@#\c@\c@\c@•\c@\c@\c@0\c@\c@\c@‡\c@\c@\c@>\c@\c@\c@m\c@\c@\c@M\c@\cC\c@N\c@\c@\c@Z\c@\cJ\c@1\c@\c@\c@d\c@\cS\c@\c]\c@\c@\c@h\c@\c^\c@\cS\c@\c@\c@f\c@)\c@\cS\c@\c@\c@_\c@0\c@\c\\c@\c@\c@W\c@2\c@)\c@\c@\c@M\c@0\c@9\c@\c@\c@C\c@*\c@H\c@\c@\c@:\c@\$\c@U\c@\cC\c@3\c@\c_\c@]\c@\cH\c@.\c@\c^\c@]\c@\cO\c@*\c@\c]\c@V\c@\cW\c@*\c@ \c@I\c@\c^\c@+\c@#\c@;\c@\"\c@0\c@&\c@/\c@\"\c@5\c@(\c@)\c@\c^\c@;\c@'\c@*\c@\cX\c@\@\c@#\c@/\c@\cQ\c@D\c@\c^\c@7\c@\cJ\c@H\c@\cY\c@\@\c@\cE\c@K\c@\cT\c@I\c@\cB\c@O\c@\cQ\c@R\c@\c@\c@U\c@\cP\c@[\c@\c@\c@\\\c@\cQ\c@b\c@\c@\c@e\c@\cR\c@f\c@\c@\c@o\c@\cT\c@e\c@\c@\c@y\c@\cU\c@c\c@\c@\c@ƒ\c@\cX\c@a\c@\c@\c@Œ\c@\cY\c@d\c@\c@\c@“\c@\cY\c@l\c@\c@\c@™\c@\cX\c@y\c@\c@\c@\c@\cU\c@‰\c@\c@\c@¡\c@\cO\c@—\c@\c@\c@¥\c@\cK\c@¡\c@\c@\c@©\c@\cF\c@¤\c@\c@\c@®\c@\cB\c@¢\c@\c@\c@³\c@\c@\c@˜\c@\c@\c@µ\c@\c@\c@‹\c@\c@\c@³\c@\c@\c@y\c@\c@\c@­\c@\c@\c@g\c@\c@\c@£\c@\c@\c@T\c@\c@\c@“\c@\c@\c@A\c@\c@\c@\c@\c@\c@/\c@\c@\c@l\c@\c@\c@ \c@\c@\c@W\c@\cC\c@\cT\c@\c@\c@C\c@\cH\c@\cI\c@\c@\c@1\c@\cN\c@\cB\c@\c@\c@#\c@\cU\c@\c@\c@\c@\c@\c\\c@\c\\c@\c@\c@\c@\c@\e\c@!\c@\c@\c@\c@\c@\c^\c@#\c@\c@\c@\c@\c@'\c@#\c@\c@\c@\c@\c@2\c@%\c@\cB\c@\c@\c@?\c@'\c@\cE\c@\c@\c@L\c@-\c@\cJ\c@\c@\c@X\c@7\c@\cP\c@\c@\c@a\c@B\c@\cZ\c@\c@\c@f\c@N\c@'\c@\c@\c@f\c@Y\c@8\c@\c@\c@a\c@a\c@L\c@\c@\c@X\c@e\c@c\c@\c@\c@L\c@d\c@x\c@\c@\c@\@\c@`\c@Š\c@\c@\c@5\c@Y\c@˜\c@\c@\c@-\c@R\c@ž\c@\c@\c@(\c@K\c@Ÿ\c@\c@\c@'\c@G\c@š\c@\c@\c@'\c@A\c@’\c@\c@\c@(\c@<\c@‰\c@\c@\c@*\c@5\c@~\c@\c@\c@+\c@.\c@r\c@\c@\c@,\c@&\c@e\c@\c@\c@-\c@!\c@V\c@\c@\c@/\c@ \c@D\c@\c@\c@0\c@\"\c@2\c@\c@\c@1\c@'\c@ \c@\c@\c@1\c@*\c@\cR\c@\c@\c@/\c@,\c@\cI\c@\cB\c@+\c@+\c@\cH\c@\cD\c@\$\c@'\c@\cM\c@\cE\c@\cZ\c@ \c@\cY\c@\cF\c@\cQ\c@\cZ\c@+\c@\cF\c@\cI\c@\cT\c@\@\c@\cE\c@\cC\c@\cP\c@Y\c@\cC\c@\c@\c@\cO\c@r\c@\cB\c@\c@\c@\cS\c@Š\c@\cA\c@\c@\c@\c\\c@ž\c@\cA\c@\c@\c@(\c@®\c@\cA\c@\c@\c@9\c@¸\c@\c@\c@\c@\c@K\c@½\c@\c@\c@\c@\c@]\c@¾\c@\c@\c@\c@\c@l\c@½\c@\cA\c@\c@\c@w\c@º\c@\cE\c@\c@\c@|\c@¶\c@\cJ\c@\c@\c@|\c@±\c@\cP\c@\c@\c@u\c@«\c@\cV\c@\c@\c@j\c@¥\c@\cZ\c@\c@\c@\\\c@\c@\cZ\c@\c@\c@O\c@”\c@\cV\c@\c@\c@C\c@ˆ\c@\cP\c@\c@\c@<\c@w\c@\cJ\c@\c@\c@:\c@_\c@\cE\c@\c@\c@<\c@C\c@\cA\c@\c@\c@\@\c@+\c@\c@\c@\cB\c@F\c@\cW\c@\c@\c@\cE\c@L\c@\cH\c@\c@\c@\cH\c@P\c@\c@\c@\c@\c@\cK\c@U\c@\c@\c@\c@\c@\cN\c@V\c@\c@\c@\c@\c@\cO\c@U\c@\c@\c@\c@\c@\cO\c@O\c@\cG\c@\c@\c@\cN\c@G\c@\cZ\c@\c@\c@\cL\c@9\c@9\c@\c@\c@\cK\c@*\c@a\c@\c@\c@\cJ\c@\e\c@‘\c@\c@\c@\cJ\c@\cQ\c@À\c@\cA\c@\cK\c@\cK\c@å\c@\cD\c@\cN\c@\cM\c@û\c@\cG\c@\cR\c@\cS\cA\cB\c@\cL\c@\cV\c@\c_\c@ú\c@\cR\c@\cZ\c@-\c@å\c@\cW\c@\c^\c@<\c@Æ\c@\cY\c@!\c@G\c@ž\c@\cX\c@\$\c@Q\c@p\c@\cU\c@%\c@Y\c@H\c@\cO\c@%\c@_\c@(\c@\cI\c@\$\c@b\c@\cP\c@\cD\c@!\c@d\c@\cB\c@\cA\c@\c_\c@b\c@\c@\c@\c@\c@\c_\c@\\\c@\c@\c@\c@\c@ \c@R\c@\cE\c@\c@\c@#\c@D\c@\cL\c@\c@\c@&\c@4\c@\cT\c@\c@\c@*\c@\$\c@\e\c@\c@\c@-\c@\cV\c@\"\c@\c@\c@0\c@\cK\c@%\c@\c@\c@4\c@\cE\c@%\c@\cE\c@9\c@\cA\c@\$\c@\cL\c@\@\c@\c@\c@\"\c@\cU\c@E\c@\c@\c@\"\c@\c_\c@J\c@\c@\c@#\c@)\c@J\c@\c@\c@#\c@/\c@E\c@\c@\c@\"\c@1\c@:\c@\c@\c@\c_\c@1\c@+\c@\c@\c@\cZ\c@/\c@\c\\c@\cB\c@\cU\c@-\c@\cP\c@\cE\c@\cR\c@,\c@\cE\c@\cI\c@\cO\c@*\c@\c@\c@\cP\c@\cL\c@(\c@\c@\c@\cZ\c@\cJ\c@'\c@\c@\c@\$\c@\cH\c@(\c@\c@\c@0\c@\cE\c@,\c@\c@\c@:\c@\cB\c@4\c@\c@\c@B\c@\c@\c@A\c@\c@\c@G\c@\c@\c@O\c@\c@\c@F\c@\c@\c@]\c@\c@\c@\@\c@\c@\c@f\c@\c@\c@8\c@\cG\c@m\c@\c@\c@,\c@\cS\c@o\c@\c@\c@ \c@\$\c@n\c@\c@\c@\cU\c@9\c@j\c@\c@\c@\cL\c@W\c@c\c@\c@\c@\cE\c@w\c@X\c@\c@\c@\cA\c@œ\c@I\c@\c@\c@\c@\c@Æ\c@8\c@\c@\c@\c@\c@ó\c@%\c@\c@\c@\c@\cA\c_\c@\cV\c@\c@\c@\c@\cAF\c@\cK\c@\c@\c@\cB\cAb\c@\cC\c@\c@\c@\cE\cAr\c@\c@\c@\c@\c@\cG\cAx\c@\c@\c@\cD\c@\cI\cAx\c@\c@\c@\cK\c@\cK\cAu\c@\c@\c@\cS\c@\cJ\cAr\c@\c@\c@\c]\c@\cI\cAp\c@\c@\c@'\c@\cG\cAp\c@\c@\c@/\c@\cF\cAm\c@\c@\c@5\c@\cE\cAe\c@\c@\c@:\c@\cG\cAV\c@\c@\c@>\c@\cH\cAB\c@\c@\c@A\c@\cM\cA-\c@\c@\c@C\c@\cR\cA\e\c@\cC\c@B\c@\cV\cA\cP\c@\cH\c@?\c@\cX\cA\cQ\c@\cL\c@:\c@\cX\cA\cZ\c@\cQ\c@5\c@\cV\cA'\c@\cU\c@0\c@\cR\cA4\c@\cW\c@-\c@\cO\cA>\c@\cW\c@+\c@\cL\cAD\c@\cV\c@(\c@\cJ\cAH\c@\cW\c@%\c@\cG\cAJ\c@\cX\c@\"\c@\cE\cAL\c@\e\c@\c_\c@\cD\cAL\c@\c]\c@\c]\c@\cB\cAK\c@\c_\c@\c\\c@\c@\cAE\c@ \c@\cZ\c@\c@\cA=\c@\c_\c@\cX\c@\c@\cA0\c@\c^\c@\cT\c@\c@\cA\c\\c@\c^\c@\cP\c@\c@\c@þ\c@\c]\c@\cN\c@\c@\c@Ô\c@\c]\c@\cQ\c@\c@\c@œ\c@\c\\c@\cZ\c@\c@\c@j\c@\c\\c@'\c@\c@\c@=\c@\e\c@4\c@\cA\c@\cZ\c@\e\c@>\c@\cC\c@\cC\c@\cZ\c@B\c@\cG\c@\c@\c@\cX\c@A\c@\cK\c@\cP\c@\cS\c@;\c@\cP\c@/\c@\cN\c@4\c@\cT\c@^\c@\cI\c@-\c@\cW\c@š\c@\cD\c@(\c@\cY\c@å\c@\c@\c@%\c@\cY\cA(\c@\c@\c@\$\c@\cW\cAY\c@\c@\c@\$\c@\cT\cAs\c@\c@\c@\$\c@\cP\cAs\c@\cC\c@#\c@\cK\cAY\c@\cG\c@\"\c@\cG\cA(\c@\cK\c@ \c@\cC\c@é\c@\cN\c@\c^\c@\cA\c@¤\c@\cP\c@\c]\c@\c@\c@i\c@\cP\c@\e\c@\c@\c@9\c@\cO\c@\cY\c@\c@\c@\cW\c@\cK\c@\cW\c@\cA\c@\cC\c@\cG\c@\cV\c@\cD\c@\c@\c@\cD\c@\cX\c@\cI\c@\c@\c@\cB\c@\e\c@\cP\c@\c@\c@\c@\c@\c^\c@\cX\c@\c@\c@\cB\c@!\c@\c]\c@\c@\c@\cE\c@\$\c@!\c@\c@\c@\cI\c@#\c@\c_\c@\cB\c@\cM\c@\"\c@\cZ\c@\cJ\c@\cT\c@!\c@\cR\c@\cR\c@\cZ\c@ \c@\cL\c@\cY\c@ \c@\c^\c@\cF\c@\c]\c@\$\c@\c\\c@\cE\c@\c\\c@'\c@\cX\c@\cI\c@\cW\c@(\c@\cT\c@\cP\c@\cO\c@%\c@\cP\c@\cX\c@\cF\c@\"\c@\cM\c@\c_\c@\cC\c@\c_\c@\cK\c@#\c@\cF\c@\c\\c@\cH\c@%\c@\cJ\c@\c\\c@\cF\c@#\c@\cM\c@\c^\c@\cD\c@\c_\c@\cS\c@!\c@\cB\c@\cZ\c@\e\c@%\c@\c@\c@\cT\c@&\c@)\c@\c@\c@\cN\c@6\c@+\c@\c@\c@\cI\c@H\c@,\c@\c@\c@\cE\c@\\\c@+\c@\c@\c@\cA\c@l\c@)\c@\c@\c@\c@\c@z\c@\$\c@\c@\c@\cC\c@…\c@\c^\c@\c@\c@\cI\c@\c@\cX\c@\c@\c@\cP\c@œ\c@\cQ\c@\c@\c@\cZ\c@©\c@\cJ\c@\c@\c@\$\c@µ\c@\cF\c@\c@\c@,\c@»\c@\cD\c@\c@\c@/\c@º\c@\cD\c@\c@\c@/\c@¯\c@\cF\c@\c@\c@*\c@œ\c@\cH\c@\c@\c@#\c@„\c@\cI\c@\c@\c@\cZ\c@n\c@\cJ\c@\c@\c@\cT\c@]\c@\cJ\c@\cD\c@\cN\c@T\c@\cG\c@\cJ\c@\cM\c@V\c@\cE\c@\cQ\c@\cM\c@`\c@\cC\c@\cY\c@\cO\c@p\c@\cA\c@!\c@\cU\c@‚\c@\c@\c@&\c@\c]\c@“\c@\c@\c@)\c@&\c@ \c@\c@\c@*\c@1\c@§\c@\c@\c@+\c@;\c@£\c@\c@\c@-\c@A\c@•\c@\c@\c@0\c@B\c@z\c@\c@\c@7\c@=\c@X\c@\c@\c@?\c@2\c@:\c@\c@\c@K\c@#\c@\c_\c@\c@\c@X\c@\cW\c@\cJ\c@\c@\c@c\c@\cK\c@\c@\c@\c@\c@k\c@\cD\c@\c@\c@\c@\c@p\c@\c@\c@\cE\c@\c@\c@o\c@\c@\c@\cV\c@\c@\c@j\c@\c@\c@1\c@\c@\c@a\c@\c@\c@W\c@\c@\c@X\c@\c@\c@†\c@\c@\c@P\c@\c@\c@¶\c@\c@\c@I\c@\c@\c@Þ\c@\c@\c@C\c@\c@\c@ö\c@\c@\c@?\c@\cC\c@ú\c@\c@\c@=\c@\cG\c@é\c@\c@\c@<\c@\cK\c@Ä\c@\c@\c@>\c@\cO\c@’\c@\c@\c@\@\c@\cS\c@a\c@\c@\c@B\c@\cU\c@8\c@\c@\c@B\c@\cZ\c@\cX\c@\c@\c@?\c@\c^\c@\cN\c@\c@\c@6\c@#\c@\"\c@\c@\c@)\c@*\c@L\c@\c@\c@\c\\c@-\c@ƒ\c@\c@\c@\cP\c@,\c@Æ\c@\cC\c@\cG\c@'\cA\cK\c@\cH\c@\cA\c@\c]\cAD\c@\cO\c@\c@\c@\cS\cAj\c@\cX\c@\c@\c@\cJ\cAy\c@#\c@\c@\c@\cD\cAr\c@-\c@\c@\c@\c@\cAV\c@6\c@\c@\c@\c@\cA+\c@>\c@\c@\c@\c@\c@ø\c@D\c@\cB\c@\c@\c@Ç\c@J\c@\cE\c@\c@\c@Ÿ\c@P\c@\cH\c@\c@\c@ƒ\c@W\c@\cK\c@\c@\c@v\c@_\c@\cN\c@\c@\c@t\c@f\c@\cN\c@\c@\c@y\c@m\c@\cM\c@\c@\c@\c?\c@s\c@\cL\c@\c@\c@†\c@y\c@\cJ\c@\c@\c@‹\c@|\c@\cJ\c@\c@\c@\c@}\c@\cL\c@\c@\c@–\c@z\c@\cN\c@\c@\c@œ\c@u\c@\cR\c@\c@\c@Ÿ\c@m\c@\cU\c@\c@\c@\c@c\c@\cY\c@\c@\c@‘\c@X\c@\c_\c@\c@\c@}\c@N\c@'\c@\cB\c@`\c@E\c@2\c@\cI\c@A\c@<\c@\@\c@\cT\c@&\c@6\c@M\c@!\c@\cR\c@3\c@W\c@/\c@\cD\c@3\c@]\c@;\c@\c@\c@6\c@^\c@\@\c@\cD\c@8\c@Z\c@>\c@\cP\c@7\c@R\c@6\c@\c^\c@1\c@K\c@+\c@,\c@'\c@E\c@\c^\c@9\c@\e\c@\@\c@\cR\c@\@\c@\cP\c@=\c@\cJ\c@=\c@\cG\c@:\c@\cE\c@2\c@\cB\c@7\c@\cA\c@\"\c@\c@\c@1\c@\c@\c@\cU\c@\c@\c@,\c@\c@\c@\cJ\c@\c@\c@)\c@\c@\c@\cC\c@\c@\c@)\c@\cB\c@\c@\c@\c@\c@-\c@\cF\c@\cA\c@\c@\c@6\c@\cK\c@\cH\c@\c@\c@?\c@\cP\c@\cQ\c@\c@\c@I\c@\cU\c@\e\c@\c@\c@O\c@\cV\c@#\c@\c@\c@R\c@\cU\c@'\c@\c@\c@S\c@\cP\c@%\c@\c@\c@Q\c@\cK\c@\c\\c@\c@\c@N\c@\cF\c@\cR\c@\c@\c@L\c@\cC\c@\cI\c@\c@\c@K\c@\cC\c@\cB\c@\c@\c@K\c@\cG\c@\c@\c@\c@\c@M\c@\cL\c@\c@\c@\c@\c@Q\c@\cS\c@\c@\c@\c@\c@W\c@\cZ\c@\c@\c@\c@\c@]\c@ \c@\cF\c@\c@\c@d\c@%\c@\cW\c@\c@\c@i\c@&\c@2\c@\c@\c@l\c@#\c@T\c@\cC\c@n\c@\c]\c@{\c@\cH\c@n\c@\cU\c@ž\c@\cQ\c@l\c@\cM\c@³\c@\c^\c@g\c@\cG\c@¹\c@.\c@^\c@\cB\c@°\c@>\c@S\c@\c@\c@ \c@M\c@C\c@\c@\c@Š\c@W\c@3\c@\c@\c@r\c@]\c@#\c@\c@\c@Y\c@^\c@\cV\c@\c@\c@\@\c@Z\c@\cM\c@\c@\c@*\c@T\c@\cG\c@\cA\c@\cX\c@N\c@\cC\c@\cE\c@\cI\c@H\c@\cC\c@\cI\c@\cA\c@C\c@\cD\c@\cM\c@\c@\c@?\c@\cH\c@\cP\c@\c@\c@<\c@\cM\c@\cQ\c@\c@\c@;\c@\cS\c@\cP\c@\c@\c@:\c@\cZ\c@\cN\c@\cD\c@9\c@ \c@\cK\c@\cS\c@7\c@&\c@\cG\c@,\c@4\c@*\c@\cE\c@N\c@1\c@-\c@\cC\c@v\c@,\c@/\c@\cA\c@¡\c@'\c@1\c@\c@\c@Å\c@#\c@2\c@\c@\c@Ý\c@ \c@2\c@\cA\c@æ\c@\c^\c@3\c@\cA\c@á\c@\c^\c@3\c@\cA\c@Ï\c@\c^\c@1\c@\cA\c@³\c@\c_\c@+\c@\c@\c@‘\c@!\c@\$\c@\c@\c@q\c@\"\c@\cZ\c@\cB\c@W\c@\"\c@\cQ\c@\cD\c@E\c@#\c@\cI\c@\cE\c@=\c@\$\c@\cD\c@\cD\c@<\c@%\c@\c@\c@\cD\c@:\c@&\c@\c@\c@\cC\c@7\c@'\c@\c@\c@\cD\c@1\c@%\c@\c@\c@\cG\c@'\c@!\c@\c@\c@\cN\c@\c\\c@\e\c@\cB\c@\cW\c@\cS\c@\cS\c@\cG\c@!\c@\cN\c@\cL\c@\cL\c@*\c@\cQ\c@\cG\c@\cQ\c@2\c@\c]\c@\cB\c@\cW\c@9\c@/\c@\c@\c@\e\c@>\c@E\c@\c@\c@\e\c@B\c@Z\c@\c@\c@\e\c@F\c@g\c@\c@\c@\cW\c@H\c@i\c@\c@\c@\cT\c@K\c@]\c@\c@\c@\cO\c@L\c@F\c@\c@\c@\cL\c@N\c@/\c@\c@\c@\cK\c@Q\c@\cZ\c@\c@\c@\cM\c@U\c@\cJ\c@\c@\c@\cQ\c@X\c@\c@\c@\c@\c@\cX\c@[\c@\c@\c@\c@\c@\c^\c@\\\c@\cD\c@\c@\c@!\c@[\c@\cR\c@\c@\c@!\c@Y\c@)\c@\c@\c@\c]\c@U\c@G\c@\c@\c@\cV\c@P\c@i\c@\c@\c@\cP\c@H\c@Š\c@\c@\c@\cL\c@A\c@ \c@\c@\c@\cJ\c@9\c@§\c@\cA\c@\cM\c@2\c@ \c@\cF\c@\cR\c@,\c@\c@\cM\c@\cY\c@(\c@r\c@\cV\c@\c_\c@\$\c@U\c@!\c@%\c@\c_\c@9\c@,\c@*\c@\cZ\c@\"\c@5\c@-\c@\cT\c@\cR\c@:\c@/\c@\cM\c@\cG\c@=\c@0\c@\cG\c@\cA\c@=\c@0\c@\cD\c@\c@\c@:\c@/\c@\cA\c@\c@\c@5\c@/\c@\c@\c@\cD\c@-\c@0\c@\c@\c@\cR\c@&\c@0\c@\c@\c@&\c@ \c@0\c@\c@\c@>\c@\c]\c@.\c@\c@\c@X\c@\c\\c@+\c@\c@\c@n\c@\c_\c@%\c@\c@\c@{\c@#\c@\c]\c@\c@\c@}\c@'\c@\cV\c@\cC\c@u\c@*\c@\cO\c@\cH\c@f\c@+\c@\cJ\c@\cO\c@P\c@)\c@\cG\c@\cY\c@7\c@%\c@\cF\c@'\c@\$\c@ \c@\cG\c@6\c@\cS\c@\e\c@\cJ\c@C\c@\cF\c@\cX\c@\cO\c@N\c@\c@\c@\cV\c@\cU\c@U\c@\cH\c@\cW\c@\cZ\c@V\c@ \c@\cY\c@\c^\c@O\c@F\c@\c^\c@\c^\c@B\c@x\c@\$\c@\c\\c@1\c@¸\c@)\c@\cW\c@ \c@ü\c@.\c@\cS\c@\cR\cA5\c@1\c@\cO\c@\cG\cA]\c@1\c@\cK\c@\cA\cAo\c@0\c@\cH\c@\c@\cAg\c@/\c@\cF\c@\c@\cAG\c@/\c@\cD\c@\c@\cA\cS\c@/\c@\cB\c@\c@\c@Ó\c@2\c@\c@\c@\c@\c@\c@5\c@\c@\c@\c@\c@X\c@7\c@\c@\c@\c@\c@.\c@:\c@\c@\c@\c@\c@\cR\c@=\c@\c@\c@\c@\c@\cB\c@\@\c@\c@\c@\c@\c@\c@\c@D\c@\c@\c@\c@\c@\cD\c@I\c@\c@\c@\c@\c@\cQ\c@L\c@\c@\c@\c@\c@!\c@N\c@\c@\c@\c@\c@4\c@M\c@\c@\c@\c@\c@J\c@G\c@\c@\c@\c@\c@d\c@?\c@\c@\c@\c@\c@~\c@4\c@\c@\c@\c@\c@™\c@(\c@\c@\c@\c@\c@³\c@\cZ\c@\c@\c@\c@\c@Ë\c@\cP\c@\c@\c@\c@\c@Ù\c@\cH\c@\c@\c@\c@\c@ß\c@\cC\c@\cA\c@\c@\c@ß\c@\c@\c@\cF\c@\c@\c@Ú\c@\cA\c@\cM\c@\c@\c@Ö\c@\cC\c@\cV\c@\c@\c@Ó\c@\cE\c@\c_\c@\c@\c@Í\c@\cH\c@&\c@\c@\c@Â\c@\cJ\c@(\c@\c@\c@¯\c@\cL\c@%\c@\c@\c@—\c@\cL\c@\c]\c@\c@\c@~\c@\cJ\c@\cT\c@\c@\c@k\c@\cH\c@\cL\c@\c@\c@a\c@\cE\c@\cE\c@\c@\c@^\c@\cC\c@\cA\c@\c@\c@`\c@\cA\c@\c@\c@\cB\c@b\c@\c@\c@\cA\c@\cG\c@^\c@\c@\c@\cE\c@\cM\c@U\c@\c@\c@\cK\c@\cU\c@I\c@\c@\c@\cR\c@\c]\c@?\c@\c@\c@\cY\c@\$\c@:\c@\c@\c@ \c@&\c@=\c@\cB\c@\$\c@%\c@F\c@\cD\c@&\c@\c_\c@Q\c@\cG\c@&\c@\cW\c@\\\c@\cI\c@\$\c@\cO\c@e\c@\cK\c@ \c@\cH\c@m\c@\cI\c@\cZ\c@\cC\c@s\c@\cG\c@\cR\c@\cE\c@w\c@\cD\c@\cK\c@\cN\c@x\c@\cB\c@\cE\c@\cZ\c@s\c@\c@\c@\cA\c@(\c@h\c@\c@\c@\c@\c@:\c@X\c@\c@\c@\c@\c@J\c@I\c@\c@\c@\c@\c@W\c@>\c@\c@\c@\c@\c@a\c@:\c@\c@\c@\cB\c@h\c@<\c@\c@\c@\cF\c@j\c@D\c@\c@\c@\cJ\c@i\c@O\c@\cB\c@\cP\c@e\c@^\c@\cG\c@\cW\c@]\c@r\c@\cL\c@\c]\c@T\c@‹\c@\cT\c@\"\c@J\c@§\c@\c\\c@\$\c@\@\c@Â\c@#\c@\$\c@6\c@Ø\c@'\c@\"\c@-\c@ç\c@)\c@\c]\c@&\c@ï\c@*\c@\cV\c@ \c@ò\c@)\c@\cO\c@\c\\c@ò\c@'\c@\cI\c@\cZ\c@î\c@\$\c@\cD\c@\cZ\c@å\c@\c_\c@\cA\c@\e\c@Ó\c@\cY\c@\c@\c@\c^\c@º\c@\cQ\c@\cA\c@!\c@›\c@\cJ\c@\cD\c@'\c@z\c@\cE\c@\cK\c@-\c@Y\c@\cB\c@\cT\c@2\c@<\c@\c@\c@ \c@6\c@%\c@\cC\c@/\c@6\c@\cU\c@\cI\c@?\c@1\c@\cJ\c@\cP\c@M\c@)\c@\cD\c@\e\c@W\c@\c]\c@\cG\c@)\c@]\c@\cS\c@\cO\c@7\c@]\c@\cJ\c@\cZ\c@C\c@W\c@\cC\c@&\c@L\c@M\c@\c@\c@2\c@O\c@A\c@\c@\c@<\c@I\c@5\c@\c@\c@D\c@<\c@)\c@\c@\c@K\c@+\c@\c^\c@\cD\c@R\c@\e\c@\cT\c@\cK\c@Y\c@\cM\c@\cL\c@\cS\c@_\c@\cD\c@\cG\c@\c^\c@f\c@\cD\c@\cB\c@)\c@n\c@\cK\c@\c@\c@2\c@y\c@\cS\c@\cA\c@6\c@ˆ\c@\c\\c@\cD\c@7\c@—\c@&\c@\cG\c@4\c@¤\c@+\c@\cJ\c@/\c@­\c@+\c@\cM\c@+\c@¯\c@&\c@\cO\c@)\c@ª\c@\c]\c@\cN\c@,\c@ \c@\cS\c@\cL\c@4\c@”\c@\cK\c@\cJ\c@>\c@ˆ\c@\cD\c@\cI\c@L\c@|\c@\c@\c@\cJ\c@\\\c@q\c@\c@\c@\cL\c@l\c@c\c@\c@\c@\cP\c@}\c@S\c@\c@\c@\cU\c@‹\c@C\c@\cB\c@\cZ\c@’\c@4\c@\cH\c@\c_\c@‘\c@+\c@\cQ\c@#\c@†\c@)\c@\e\c@'\c@q\c@,\c@\$\c@,\c@V\c@0\c@)\c@/\c@9\c@0\c@&\c@2\c@!\c@(\c@\c^\c@3\c@\cO\c@\c^\c@\cT\c@3\c@\cI\c@\cR\c@\cK\c@5\c@\cL\c@\cG\c@\cC\c@8\c@\cW\c@\c@\c@\c@\c@A\c@%\c@\c@\c@\c@\c@P\c@6\c@\c@\c@\c@\c@c\c@E\c@\c@\c@\c@\c@v\c@Q\c@\c@\c@\c@\c@‡\c@Y\c@\c@\c@\c@\c@”\c@\\\c@\c@\c@\c@\c@š\c@Y\c@\c@\c@\c@\c@›\c@O\c@\c@\c@\c@\c@›\c@\@\c@\c@\c@\c@\c@š\c@-\c@\c@\c@\c@\c@š\c@\c]\c@\c@\c@\c@\c@š\c@\cN\c@\c@\c@\c@\c@˜\c@\cD\c@\c@\c@\c@\c@“\c@\c@\c@\c@\c@\c@\c@‹\c@\c@\c@\c@\c@\cB\c@\c?\c@\c@\c@\c@\c@\cE\c@o\c@\c@\c@\c@\c@\cG\c@^\c@\cC\c@\cC\c@\cI\c@K\c@\cH\c@\cV\c@\cI\c@9\c@\cP\c@7\c@\cG\c@'\c@\cX\c@a\c@\cE\c@\cY\c@!\c@\c@\cB\c@\cN\c@&\c@À\c@\c@\c@\cF\c@%\c@â\c@\c@\c@\cF\c@\"\c@ñ\c@\c@\c@\cL\c@\c\\c@ï\c@\c@\c@\cY\c@\cU\c@ã\c@\c@\c@*\c@\cR\c@Õ\c@\cC\c@>\c@\cQ\c@Ê\c@\cH\c@Q\c@\cS\c@È\c@\cP\c@`\c@\cV\c@Î\c@\cX\c@j\c@\e\c@Ú\c@\c_\c@m\c@!\c@ä\c@\$\c@i\c@(\c@ç\c@%\c@^\c@1\c@à\c@#\c@O\c@9\c@Î\c@!\c@>\c@C\c@µ\c@ \c@-\c@H\c@œ\c@#\c@ \c@H\c@„\c@(\c@\cX\c@B\c@r\c@0\c@\cW\c@6\c@d\c@:\c@\cY\c@&\c@[\c@B\c@\c]\c@\cX\c@S\c@I\c@ \c@\cL\c@M\c@L\c@ \c@\cD\c@J\c@J\c@\cZ\c@\c@\c@H\c@E\c@\cT\c@\c@\c@F\c@=\c@\cL\c@\c@\c@B\c@1\c@\cF\c@\c@\c@7\c@#\c@\cA\c@\c@\c@)\c@\cW\c@\c@\c@\c@\c@\e\c@\cN\c@\c@\c@\c@\c@\cN\c@\cF\c@\c@\c@\cB\c@\cD\c@\cA\c@\c@\c@\cF\c@\c@\c@\c@\c@\c@\c@\cJ\c@\c@\c@\c@\c@\c@\c@\cO\c@\cB\c@\c@\c@\cC\c@\cT\c@\cQ\c@\c@\c@\cI\c@\cX\c@*\c@\c@\c@\cP\c@\cX\c@K\c@\c@\c@\cW\c@\cX\c@o\c@\c@\c@\c\\c@\cT\c@“\c@\c@\c@\c\\c@\cQ\c@«\c@\cC\c@\cW\c@\cM\c@·\c@\cG\c@\cP\c@\cL\c@¼\c@\cK\c@\cI\c@\cK\c@½\c@\cO\c@\cC\c@\cM\c@¿\c@\cT\c@\c@\c@\cN\c@Â\c@\cV\c@\c@\c@\cO\c@Ä\c@\cW\c@\c@\c@\cN\c@¿\c@\cV\c@\c@\c@\cN\c@­\c@\cU\c@\cB\c@\cN\c@\c@\cT\c@\cH\c@\cP\c@g\c@\cU\c@\cR\c@\cT\c@D\c@\cY\c@\c]\c@\cY\c@%\c@ \c@)\c@\cZ\c@\cN\c@'\c@3\c@\cY\c@\cA\c@-\c@7\c@\cT\c@\c@\c@0\c@3\c@\cO\c@\cD\c@/\c@)\c@\cH\c@\cT\c@'\c@\c]\c@\cC\c@,\c@\c]\c@\cR\c@\c@\c@I\c@\cR\c@\cH\c@\c@\c@j\c@\cJ\c@\cB\c@\c@\c@‹\c@\cD\c@\c@\c@\cC\c@¥\c@\c@\c@\c@\c@\cK\c@·\c@\c@\c@\cA\c@\cX\c@Ã\c@\c@\c@\cD\c@'\c@Ë\c@\c@\c@\cJ\c@8\c@Ô\c@\c@\c@\cP\c@E\c@Þ\c@\c@\c@\cV\c@L\c@é\c@\cA\c@\c\\c@I\c@õ\c@\cE\c@!\c@\@\c@ÿ\c@\cJ\c@\$\c@1\cA\cD\c@\cQ\c@&\c@!\c@ý\c@\cZ\c@*\c@\cS\c@ë\c@#\c@0\c@\cI\c@Î\c@)\c@8\c@\cB\c@¨\c@.\c@B\c@\c@\c@~\c@0\c@K\c@\c@\c@W\c@0\c@Q\c@\c@\c@6\c@.\c@S\c@\c@\c@\c^\c@+\c@Q\c@\c@\c@\cQ\c@&\c@L\c@\c@\c@\cN\c@ \c@F\c@\c@\c@\cR\c@\cZ\c@D\c@\c@\c@\cY\c@\cR\c@F\c@\c@\c@\c_\c@\cK\c@L\c@\c@\c@ \c@\cF\c@W\c@\c@\c@\c\\c@\cB\c@c\c@\c@\c@\cU\c@\c@\c@p\c@\c@\c@\cM\c@\c@\c@{\c@\cB\c@\cF\c@\c@\c@„\c@\cF\c@\cA\c@\c@\c@Š\c@\cJ\c@\c@\c@\c@\c@Œ\c@\cO\c@\c@\c@\c@\c@Š\c@\cT\c@\c@\c@\c@\c@ƒ\c@\cX\c@\cI\c@\c@\c@y\c@\cY\c@\c]\c@\c@\c@n\c@\cX\c@<\c@\c@\c@b\c@\cU\c@f\c@\c@\c@W\c@\cQ\c@™\c@\cA\c@P\c@\cM\c@Ì\c@\cD\c@M\c@\cI\c@ô\c@\cH\c@M\c@\cF\cA\cO\c@\cN\c@O\c@\cD\cA\cY\c@\cV\c@Q\c@\cE\cA\cU\c@\e\c@Q\c@\cH\cA\cD\c@\c]\c@M\c@\cM\c@í\c@\e\c@F\c@\cS\c@Ò\c@\cV\c@;\c@\e\c@¸\c@\cO\c@0\c@!\c@¤\c@\cI\c@&\c@&\c@•\c@\cD\c@\c^\c@)\c@‹\c@\cB\c@\cZ\c@*\c@‡\c@\cA\c@\cX\c@)\c@†\c@\cA\c@\cW\c@&\c@…\c@\cA\c@\cX\c@!\c@ƒ\c@\c@\c@\cY\c@\cZ\c@\c@\c@\c@\cZ\c@\cR\c@\c@\c@\c@\c\\c@\cK\c@€\c@\c@\c@\c_\c@\cF\c@€\c@\c@\c@\$\c@\cA\c@}\c@\cB\c@(\c@\c@\c@t\c@\cE\c@-\c@\c@\c@f\c@\cF\c@0\c@\c@\c@V\c@\cG\c@3\c@\c@\c@H\c@\cF\c@3\c@\c@\c@\@\c@\cE\c@3\c@\c@\c@D\c@\cB\c@1\c@\c@\c@R\c@\c@\c@-\c@\c@\c@c\c@\c@\c@(\c@\c@\c@s\c@\c@\c@\"\c@\c@\c@x\c@\c@\c@\c\\c@\c@\c@p\c@\c@\c@\cZ\c@\c@\c@Y\c@\c@\c@\cZ\c@\c@\c@?\c@\c@\c@\c\\c@\c@\c@%\c@\c@\c@\"\c@\cA\c@\cP\c@\c@\c@(\c@\cF\c@\cC\c@\c@\c@,\c@\cO\c@\c@\c@\c@\c@0\c@\cX\c@\c@\c@\c@\c@2\c@#\c@\cJ\c@\cA\c@3\c@+\c@!\c@\cC\c@3\c@.\c@A\c@\cF\c@2\c@*\c@k\c@\cH\c@1\c@ \c@Ÿ\c@\cJ\c@.\c@\cV\c@Ï\c@\cK\c@+\c@\cL\c@ñ\c@\cK\c@'\c@\cD\cA\cC\c@\cJ\c@#\c@\c@\cA\c@\c@\cI\c@\c]\c@\c@\c@ê\c@\cJ\c@\cX\c@\c@\c@Ä\c@\cK\c@\cQ\c@\c@\c@”\c@\cL\c@\cL\c@\c@\c@b\c@\cK\c@\cG\c@\c@\c@;\c@\cI\c@\cC\c@\cE\c@\c\\c@\cG\c@\c@\c@\cM\c@\cI\c@\cE\c@\c@\c@\cW\c@\cH\c@\cB\c@\c@\c@\$\c@\e\c@\cD\c@\c@\c@2\c@:\c@\cK\c@\c@\c@=\c@`\c@\cS\c@\cB\c@C\c@Ž\c@\c\\c@\cH\c@D\c@¸\c@%\c@\cQ\c@C\c@Ô\c@+\c@\c\\c@A\c@Ý\c@,\c@)\c@?\c@Õ\c@+\c@4\c@A\c@¾\c@(\c@9\c@F\c@œ\c@\"\c@8\c@P\c@y\c@\cZ\c@0\c@Y\c@\\\c@\cR\c@#\c@c\c@M\c@\cK\c@\cW\c@k\c@N\c@\cF\c@\cM\c@n\c@b\c@\cB\c@\cD\c@k\c@…\c@\c@\c@\c@\c@d\c@³\c@\cB\c@\c@\c@Y\c@á\c@\cG\c@\c@\c@K\cA\cH\c@\cP\c@\c@\c@=\cA\"\c@\e\c@\cC\c@3\cA-\c@*\c@\cI\c@+\cA\$\c@7\c@\cP\c@*\cA\cN\c@B\c@\cW\c@-\c@é\c@F\c@\c\\c@4\c@¼\c@C\c@\c\\c@>\c@‰\c@<\c@\cW\c@L\c@Y\c@1\c@\cP\c@Z\c@4\c@%\c@\cI\c@h\c@\cW\c@\cZ\c@\cC\c@s\c@\cF\c@\cQ\c@\c@\c@|\c@\c@\c@\cL\c@\c@\c@€\c@\c@\c@\cJ\c@\cA\c@\c?\c@\c@\c@\cM\c@\cD\c@x\c@\c@\c@\cR\c@\cG\c@l\c@\c@\c@\cX\c@\cI\c@\\\c@\c@\c@\c^\c@\cJ\c@J\c@\c@\c@\$\c@\cI\c@:\c@\c@\c@(\c@\cG\c@/\c@\cK\c@*\c@\cD\c@)\c@\c^\c@)\c@\cA\c@)\c@:\c@(\c@\c@\c@/\c@[\c@\"\c@\c@\c@7\c@‚\c@\e\c@\c@\c@>\c@ \c@\cS\c@\c@\c@D\c@²\c@\cL\c@\c@\c@I\c@³\c@\cE\c@\c@\c@O\c@¤\c@\cA\c@\c@\c@V\c@†\c@\c@\c@\cB\c@b\c@_\c@\c@\c@\cF\c@o\c@=\c@\c@\c@\cL\c@~\c@ \c@\c@\c@\cS\c@\c@\cK\c@\c@\c@\c]\c@š\c@\c@\c@\cB\c@&\c@¡\c@\cK\c@\cF\c@-\c@£\c@\$\c@\cL\c@3\c@œ\c@H\c@\cS\c@6\c@\c@t\c@\c\\c@6\c@\c?\c@§\c@\"\c@4\c@m\c@Ñ\c@&\c@/\c@\\\c@ë\c@(\c@*\c@P\c@ñ\c@(\c@%\c@G\c@æ\c@&\c@\"\c@E\c@Í\c@\$\c@\c_\c@G\c@±\c@#\c@\c^\c@J\c@—\c@!\c@\c]\c@N\c@…\c@!\c@\e\c@Q\c@}\c@ \c@\cW\c@P\c@\c?\c@\c_\c@\cR\c@K\c@Š\c@\c^\c@\cL\c@C\c@š\c@\c\\c@\cI\c@7\c@­\c@\cX\c@\cG\c@+\c@À\c@\cQ\c@\cI\c@\c_\c@Ð\c@\cL\c@\cL\c@\cX\c@Ú\c@\cG\c@\cS\c@\cT\c@Þ\c@\cC\c@\cX\c@\cU\c@Ü\c@\c@\c@\c]\c@\cY\c@×\c@\cC\c@ \c@ \c@Õ\c@\cJ\c@\"\c@&\c@Ù\c@\cV\c@\"\c@(\c@æ\c@#\c@!\c@%\c@ù\c@2\c@ \c@\c]\cA\cL\c@?\c@ \c@\cU\cA\e\c@E\c@ \c@\cL\cA \c@F\c@ \c@\cD\cA\cY\c@?\c@\c_\c@\c@\cA\cE\c@4\c@\c\\c@\c@\c@è\c@'\c@\cX\c@\c@\c@Ç\c@\cZ\c@\cT\c@\c@\c@©\c@\cO\c@\cR\c@\c@\c@”\c@\cG\c@\cS\c@\c@\c@\c@\cB\c@\cW\c@\cA\c@¡\c@\c@\c@\c_\c@\cJ\c@È\c@\c@\c@&\c@\cW\cA\cA\c@\c@\c@.\c@'\cAC\c@\cB\c@3\c@;\cA\c@\cD\c@7\c@P\cA¬\c@\cG\c@8\c@b\cA»\c@\cI\c@7\c@o\cAª\c@\cK\c@2\c@x\cA{\c@\cJ\c@,\c@}\cA5\c@\cG\c@\$\c@\c?\c@ä\c@\cD\c@\e\c@{\c@”\c@\cB\c@\cU\c@s\c@V\c@\c@\c@\cS\c@d\c@)\c@\c@\c@\cT\c@P\c@\cM\c@\c@\c@\cZ\c@;\c@\cG\c@\c@\c@\$\c@&\c@\cZ\c@\c@\c@0\c@\cU\c@5\c@\c@\c@>\c@\cJ\c@V\c@\c@\c@M\c@\cF\c@{\c@\c@\c@\\\c@\cI\c@š\c@\c@\c@i\c@\cP\c@«\c@\c@\c@t\c@\cY\c@«\c@\c@\c@}\c@\$\c@›\c@\c@\c@…\c@-\c@\c?\c@\c@\c@‹\c@2\c@\\\c@\c@\c@“\c@4\c@:\c@\c@\c@œ\c@2\c@ \c@\c@\c@¦\c@.\c@\cM\c@\c@\c@±\c@+\c@\cB\c@\c@\c@¹\c@'\c@\c@\c@\c@\c@½\c@%\c@\c@\c@\c@\c@¼\c@\$\c@\c@\c@\c@\c@´\c@\"\c@\cI\c@\c@\c@¥\c@\c^\c@\c^\c@\c@\c@“\c@\cY\c@>\c@\c@\c@€\c@\cS\c@h\c@\c@\c@n\c@\cK\c@ž\c@\c@\c@`\c@\cF\c@Ò\c@\c@\c@X\c@\cB\c@ù\c@\c@\c@V\c@\c@\cA\cN\c@\cG\c@X\c@\c@\cA\cL\c@\cS\c@]\c@\c@\c@ù\c@#\c@c\c@\c@\c@Û\c@5\c@g\c@\c@\c@¾\c@H\c@h\c@\c@\c@ª\c@W\c@e\c@\c@\c@¨\c@`\c@]\c@\c@\c@·\c@a\c@O\c@\c@\c@Ð\c@`\c@=\c@\c@\c@î\c@\\\c@*\c@\c@\cA\cD\c@X\c@\cY\c@\c@\cA\cL\c@V\c@\cL\c@\c@\cA\cC\c@V\c@\cC\c@\c@\c@ë\c@V\c@\c@\c@\c@\c@È\c@W\c@\c@\c@\c@\c@¤\c@Y\c@\cA\c@\c@\c@‡\c@[\c@\cF\c@\cA\c@w\c@]\c@\cM\c@\cB\c@x\c@_\c@\cT\c@\cD\c@†\c@_\c@\c\\c@\cF\c@ž\c@_\c@&\c@\cH\c@·\c@^\c@,\c@\cK\c@È\c@\\\c@2\c@\cM\c@Î\c@Z\c@6\c@\cQ\c@È\c@X\c@8\c@\cU\c@¹\c@S\c@6\c@\cW\c@§\c@N\c@0\c@\e\c@œ\c@H\c@%\c@\c^\c@œ\c@B\c@\cZ\c@!\c@©\c@<\c@\cO\c@&\c@¿\c@8\c@\cG\c@-\c@Ö\c@5\c@\cA\c@6\c@æ\c@2\c@\cA\c@>\c@æ\c@.\c@\cD\c@G\c@Ò\c@)\c@\cH\c@N\c@«\c@\"\c@\cL\c@S\c@y\c@\e\c@\cP\c@S\c@M\c@\cV\c@\cR\c@N\c@'\c@\cS\c@\cQ\c@F\c@\cL\c@\cT\c@\cN\c@;\c@\c@\c@\cY\c@\cJ\c@,\c@\c@\c@\c_\c@\cF\c@\c]\c@\c@\c@&\c@\cC\c@\cQ\c@\cB\c@+\c@\cA\c@\cH\c@\cP\c@-\c@\c@\c@\cB\c@'\c@0\c@\c@\c@\c@\c@G\c@2\c@\c@\c@\c@\c@n\c@6\c@\c@\c@\c@\c@–\c@;\c@\c@\c@\cB\c@²\c@A\c@\c@\c@\cD\c@¹\c@F\c@\c@\c@\cE\c@«\c@H\c@\c@\c@\cH\c@ˆ\c@F\c@\c@\c@\cL\c@_\c@B\c@\c@\c@\cP\c@9\c@;\c@\cB\c@\cU\c@\cY\c@4\c@\cF\c@\e\c@\cF\c@,\c@\cJ\c@\"\c@\c@\c@'\c@\cN\c@'\c@\c@\c@\"\c@\cP\c@-\c@\c@\c@\c_\c@\cN\c@1\c@\c@\c@\c^\c@\cK\c@5\c@\c@\c@\c^\c@\cG\c@9\c@\c@\c@ \c@\cD\c@;\c@\c@\c@!\c@\cG\c@<\c@\cC\c@\$\c@\cO\c@:\c@\cQ\c@&\c@\cX\c@5\c@+\c@)\c@\c_\c@/\c@L\c@)\c@\"\c@'\c@q\c@'\c@\c_\c@ \c@‘\c@ \c@\cX\c@\e\c@ \c@\cX\c@\cO\c@\cY\c@˜\c@\cP\c@\cF\c@\cZ\c@}\c@\cH\c@\c@\c@!\c@Y\c@\cB\c@\c@\c@,\c@6\c@\c@\c@\cB\c@:\c@\e\c@\cC\c@\cI\c@G\c@\cS\c@\cI\c@\cS\c@R\c@\c^\c@\cR\c@ \c@W\c@7\c@\c\\c@3\c@X\c@X\c@)\c@D\c@Q\c@~\c@3\c@S\c@H\c@¡\c@8\c@Z\c@<\c@¾\c@9\c@Y\c@0\c@Ï\c@4\c@N\c@'\c@Ò\c@-\c@=\c@\"\c@È\c@\$\c@)\c@\c_\c@°\c@\c\\c@\cX\c@ \c@\c@\cW\c@\cM\c@!\c@m\c@\cV\c@\cK\c@!\c@I\c@\cY\c@\cQ\c@\c_\c@,\c@\c^\c@\c\\c@\cZ\c@\cW\c@&\c@)\c@\cR\c@\cI\c@0\c@4\c@\cK\c@\cF\c@>\c@<\c@\cF\c@\cL\c@M\c@>\c@\cB\c@\e\c@_\c@;\c@\c@\c@1\c@r\c@5\c@\c@\c@O\c@…\c@*\c@\c@\c@o\c@•\c@\c^\c@\c@\c@\c@¤\c@\cT\c@\c@\c@£\c@®\c@\cK\c@\c@\c@ª\c@´\c@\cD\c@\c@\c@ž\c@¶\c@\c@\c@\c@\c@‚\c@±\c@\c@\c@\c@\c@]\c@¨\c@\c@\c@\c@\c@:\c@™\c@\c@\c@\c@\c@\c\\c@ˆ\c@\c@\c@\c@\c@\cH\c@v\c@\c@\c@\cB\c@\c@\c@f\c@\c@\c@\cF\c@\c@\c@Y\c@\c@\c@\cM\c@\c@\c@P\c@\c@\c@\cU\c@\c@\c@J\c@\c@\c@\c_\c@\c@\c@F\c@\c@\c@)\c@\c@\c@B\c@\c@\c@3\c@\c@\c@\@\c@\c@\c@:\c@\c@\c@=\c@\c@\c@A\c@\cA\c@:\c@\cB\c@F\c@\cG\c@6\c@\cE\c@G\c@\cT\c@4\c@\cI\c@G\c@%\c@0\c@\cL\c@G\c@;\c@+\c@\cO\c@E\c@S\c@&\c@\cQ\c@F\c@h\c@ \c@\cP\c@K\c@v\c@\c\\c@\cP\c@V\c@}\c@\cY\c@\cO\c@e\c@}\c@\cW\c@\cN\c@v\c@u\c@\cV\c@\cM\c@†\c@j\c@\cV\c@\cL\c@“\c@]\c@\cT\c@\cJ\c@™\c@R\c@\cQ\c@\cI\c@—\c@J\c@\cM\c@\cH\c@\c@F\c@\cI\c@\cH\c@|\c@E\c@\cD\c@\cK\c@f\c@E\c@\cB\c@\cQ\c@M\c@C\c@\c@\c@\cY\c@6\c@\@\c@\c@\c@\"\c@#\c@=\c@\c@\c@*\c@\cU\c@<\c@\c@\c@0\c@\cM\c@\@\c@\c@\c@2\c@\cJ\c@J\c@\c@\c@3\c@\cI\c@[\c@\c@\c@2\c@\cI\c@s\c@\c@\c@0\c@\cH\c@’\c@\c@\c@/\c@\cF\c@³\c@\c@\c@/\c@\cD\c@Ð\c@\c@\c@.\c@\cC\c@å\c@\c@\c@.\c@\cB\c@ð\c@\c@\c@.\c@\c@\c@î\c@\c@\c@.\c@\c@\c@ä\c@\c@\c@.\c@\c@\c@Ó\c@\c@\c@.\c@\c@\c@Á\c@\c@\c@.\c@\c@\c@°\c@\c@\c@.\c@\c@\c@¡\c@\c@\c@.\c@\c@\c@”\c@\c@\c@/\c@\c@\c@Š\c@\c@\c@/\c@\c@\c@‚\c@\c@\c@0\c@\c@\c@\c?\c@\c@\c@1\c@\cA\c@‚\c@\cB\c@1\c@\cD\c@‹\c@\cD\c@1\c@\cH\c@™\c@\cG\c@/\c@\cL\c@«\c@\cJ\c@+\c@\cQ\c@¾\c@\cJ\c@'\c@\cS\c@Í\c@\cI\c@!\c@\cS\c@Õ\c@\cG\c@\cZ\c@\cQ\c@Ó\c@\cD\c@\cS\c@\cN\c@Æ\c@\cB\c@\cM\c@\cL\c@µ\c@\cA\c@\cI\c@\cK\c@£\c@\cA\c@\cG\c@\cL\c@˜\c@\cA\c@\cI\c@\cO\c@•\c@\cA\c@\cM\c@\cS\c@\c@\c@\c@\cS\c@\cX\c@­\c@\c@\c@\cX\c@\c\\c@¿\c@\c@\c@\c^\c@\c_\c@Ò\c@\c@\c@#\c@#\c@á\c@\c@\c@)\c@'\c@ë\c@\c@\c@.\c@)\c@î\c@\cB\c@3\c@*\c@ë\c@\cE\c@4\c@)\c@à\c@\cJ\c@1\c@%\c@Ï\c@\cO\c@)\c@\c^\c@¸\c@\cT\c@\c^\c@\cV\c@¢\c@\cV\c@\cS\c@\cN\c@‘\c@\cT\c@\cJ\c@\cG\c@‹\c@\cP\c@\cF\c@\cC\c@\c@\cK\c@\cJ\c@\cC\c@\c@\cF\c@\cW\c@\cF\c@¯\c@\cB\c@'\c@\cJ\c@Á\c@\c@\c@;\c@\cP\c@Ï\c@\c@\c@O\c@\cW\c@Ù\c@\cA\c@`\c@\c_\c@Ý\c@\cD\c@k\c@#\c@Þ\c@\cG\c@q\c@&\c@Ø\c@\cI\c@q\c@%\c@Ë\c@\cM\c@k\c@\"\c@´\c@\cN\c@c\c@\c]\c@—\c@\cM\c@Z\c@\cX\c@y\c@\cI\c@P\c@\cT\c@`\c@\cG\c@I\c@\cR\c@S\c@\cD\c@D\c@\cQ\c@V\c@\cA\c@B\c@\cR\c@k\c@\c@\c@C\c@\cT\c@\c@\c@\c@H\c@\cW\c@¼\c@\c@\c@O\c@\e\c@ê\c@\c@\c@[\c@!\cA\cN\c@\cD\c@h\c@&\cA!\c@\cM\c@u\c@(\cA\c^\c@\cX\c@}\c@)\cA\cG\c@&\c@€\c@&\c@à\c@9\c@{\c@\c_\c@²\c@K\c@n\c@\cV\c@†\c@[\c@\\\c@\cN\c@b\c@i\c@F\c@\cG\c@L\c@t\c@/\c@\cB\c@A\c@z\c@\c]\c@\c@\c@>\c@|\c@\cO\c@\c@\c@=\c@y\c@\cE\c@\c@\c@8\c@r\c@\c@\c@\c@\c@.\c@h\c@\c@\c@\c@\c@\"\c@[\c@\c@\c@\c@\c@\cT\c@N\c@\c@\c@\c@\c@\cH\c@B\c@\cA\c@\c@\c@\c@\c@8\c@\cC\c@\c@\c@\c@\c@5\c@\cF\c@\c@\c@\c@\c@7\c@\cK\c@\c@\c@\c@\c@?\c@\cQ\c@\c@\c@\c@\c@J\c@\cV\c@\c@\c@\c@\c@U\c@\cZ\c@\c@\c@\c@\c@^\c@\c\\c@\c@\c@\c@\c@c\c@\cY\c@\c@\c@\c@\c@c\c@\cS\c@\c@\c@\c@\c@a\c@\cN\c@\c@\c@\cC\c@^\c@\cG\c@\c@\c@\cJ\c@[\c@\cB\c@\c@\c@\cT\c@Y\c@\c@\c@\c@\c@\c\\c@X\c@\cA\c@\c@\c@\"\c@V\c@\cG\c@\c@\c@\"\c@R\c@\cP\c@\c@\c@\c\\c@M\c@\cZ\c@\c@\c@\cT\c@G\c@&\c@\cB\c@\cJ\c@C\c@0\c@\cE\c@\cC\c@\@\c@6\c@\cG\c@\c@\c@\@\c@8\c@\cI\c@\c@\c@C\c@5\c@\cK\c@\c@\c@G\c@0\c@\cK\c@\cC\c@M\c@*\c@\cK\c@\cJ\c@P\c@#\c@\cK\c@\cU\c@R\c@\c\\c@\cK\c@\"\c@Q\c@\cV\c@\cI\c@1\c@L\c@\cQ\c@\cG\c@<\c@E\c@\cK\c@\cE\c@A\c@<\c@\cF\c@\cB\c@?\c@2\c@\cC\c@\c@\c@8\c@*\c@\cA\c@\c@\c@2\c@\$\c@\c@\c@\c@\c@3\c@!\c@\cE\c@\c@\c@\@\c@ \c@\cO\c@\c@\c@[\c@ \c@\c^\c@\c@\c@ƒ\c@!\c@0\c@\c@\c@µ\c@!\c@C\c@\c@\c@ê\c@\c_\c@T\c@\c@\cA\cY\c@\c]\c@^\c@\c@\cA=\c@\cZ\c@`\c@\c@\cAR\c@\cX\c@[\c@\c@\cAS\c@\cU\c@Q\c@\cC\cAC\c@\cR\c@D\c@\cH\cA'\c@\cN\c@6\c@\cO\cA\cF\c@\cJ\c@,\c@\cY\c@é\c@\cF\c@(\c@!\c@Ú\c@\cC\c@(\c@%\c@Û\c@\cA\c@.\c@\$\c@ñ\c@\c@\c@7\c@\c]\cA\cU\c@\c@\c@A\c@\cT\cAC\c@\c@\c@K\c@\cK\cAo\c@\c@\c@U\c@\cD\cAŽ\c@\c@\c@a\c@\c@\cA–\c@\c@\c@o\c@\c@\cA\c@\cB\c@€\c@\c@\cAN\c@\cD\c@–\c@\c@\cA\cC\c@\cE\c@­\c@\c@\c@±\c@\cE\c@Å\c@\c@\c@k\c@\cE\c@Ù\c@\c@\c@3\c@\cD\c@ç\c@\c@\c@\cN\c@\cB\c@ì\c@\cE\c@\c@\c@\c@\c@ç\c@\cN\c@\c@\c@\c@\c@Ø\c@\cZ\c@\cD\c@\c@\c@Ã\c@&\c@\cH\c@\c@\c@©\c@5\c@\cM\c@\c@\c@\c@<\c@\cQ\c@\c@\c@x\c@=\c@\cZ\c@\cB\c@g\c@6\c@!\c@\cF\c@[\c@+\c@,\c@\cL\c@S\c@\c]\c@<\c@\cS\c@M\c@\cQ\c@U\c@\e\c@J\c@\cG\c@x\c@#\c@I\c@\cA\c@¡\c@)\c@I\c@\cD\c@Ï\c@+\c@M\c@\cK\c@ú\c@)\c@U\c@\cW\cA\cY\c@\"\c@]\c@&\cA%\c@\cY\c@d\c@8\cA\e\c@\cP\c@j\c@I\c@ü\c@\cH\c@m\c@W\c@Ð\c@\cB\c@l\c@`\c@¢\c@\c@\c@i\c@c\c@z\c@\c@\c@d\c@a\c@_\c@\c@\c@\\\c@Z\c@S\c@\c@\c@S\c@Q\c@T\c@\c@\c@I\c@H\c@\\\c@\c@\c@B\c@A\c@e\c@\c@\c@=\c@;\c@n\c@\cB\c@<\c@9\c@s\c@\cD\c@\@\c@8\c@u\c@\cD\c@F\c@:\c@q\c@\cD\c@K\c@=\c@j\c@\cD\c@M\c@D\c@^\c@\cB\c@K\c@K\c@M\c@\c@\c@F\c@T\c@:\c@\c@\c@=\c@\\\c@&\c@\c@\c@3\c@^\c@\cW\c@\c@\c@*\c@\\\c@\cK\c@\c@\c@#\c@U\c@\cC\c@\cE\c@ \c@M\c@\c@\c@\cL\c@\c_\c@D\c@\c@\c@\cU\c@\c^\c@\@\c@\c@\c@\c]\c@\c\\c@>\c@\c@\c@\$\c@\cX\c@\@\c@\c@\c@%\c@\cQ\c@F\c@\c@\c@\c^\c@\cK\c@O\c@\c@\c@\cV\c@\cE\c@\\\c@\c@\c@\cM\c@\cA\c@m\c@\c@\c@\cE\c@\c@\c@\c?\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@\c@š\c@\c@\c@\c@\c@\cA\c@œ\c@\c@\c@\cB\c@\cF\c@”\c@\c@\c@\cF\c@\cN\c@\c@\c@\c@\cK\c@\cV\c@g\c@\c@\c@\cQ\c@\c\\c@I\c@\c@\c@\cW\c@ \c@.\c@\c@\c@\c\\c@\c\\c@\cZ\c@\c@\c@\c\\c@\cV\c@\cJ\c@\c@\c@\cZ\c@\cN\c@\cA\c@\c@\c@\cS\c@\cF\c@\cB\c@\c@\c@\cN\c@\cA\c@\cJ\c@\c@\c@\cG\c@\c@\c@\cV\c@\c@\c@\cC\c@\c@\c@\"\c@\c@\c@\c@\c@\c@\c@0\c@\c@\c@\c@\c@\c@\c@<\c@\c@\c@\cC\c@\cC\c@B\c@\c@\c@\cG\c@\cI\c@D\c@\cJ\c@\cN\c@\cQ\c@B\c@#\c@\cV\c@\cX\c@>\c@J\c@!\c@ \c@9\c@}\c@,\c@\$\c@2\c@½\c@6\c@%\c@)\cA\c@\c@\@\c@\$\c@\c_\cA:\c@H\c@ \c@\cU\cAe\c@M\c@\c]\c@\cL\cA€\c@N\c@\cY\c@\cF\cA‡\c@M\c@\cT\c@\cA\cAz\c@H\c@\cO\c@\c@\cA[\c@D\c@\cK\c@\c@\cA)\c@B\c@\cG\c@\c@\c@é\c@B\c@\cF\c@\cD\c@£\c@D\c@\cI\c@\cJ\c@g\c@J\c@\cO\c@\cQ\c@7\c@Q\c@\cY\c@\cZ\c@\cT\c@Y\c@#\c@\"\c@\cA\c@b\c@,\c@&\c@\cB\c@j\c@4\c@%\c@\cI\c@r\c@9\c@\"\c@\cP\c@x\c@;\c@\c]\c@\cW\c@{\c@:\c@\cY\c@\c]\c@{\c@5\c@\cV\c@!\c@x\c@,\c@\cV\c@\c_\c@q\c@ \c@\cW\c@\cX\c@g\c@\cU\c@\cZ\c@\cP\c@[\c@\cL\c@\e\c@\cJ\c@N\c@\cD\c@\e\c@\cE\c@A\c@\c@\c@\cZ\c@\cA\c@7\c@\c@\c@\cW\c@\c@\c@0\c@\c@\c@\cS\c@\c@\c@.\c@\cF\c@\cO\c@\c@\c@1\c@\cN\c@\cJ\c@\c@\c@8\c@\cY\c@\cG\c@\c@\c@B\c@\$\c@\cC\c@\c@\c@K\c@.\c@\cA\c@\c@\c@Q\c@3\c@\c@\c@\c@\c@Q\c@0\c@\c@\c@\c@\c@L\c@&\c@\c@\c@\c@\c@C\c@\e\c@\c@\c@\cA\c@6\c@\cP\c@\c@\c@\cN\c@+\c@\cG\c@\c@\c@%\c@#\c@\cA\c@\c@\c@D\c@\c]\c@\c@\c@\c@\c@j\c@\e\c@\cE\c@\c@\c@‘\c@\e\c@\cP\c@\c@\c@®\c@\c\\c@\c^\c@\c@\c@º\c@\c_\c@/\c@\c@\c@¶\c@\"\c@B\c@\c@\c@¤\c@&\c@R\c@\c@\c@‹\c@+\c@Z\c@\c@\c@p\c@/\c@[\c@\c@\c@Z\c@1\c@U\c@\cA\c@J\c@2\c@K\c@\cD\c@\@\c@0\c@>\c@\cF\c@=\c@.\c@3\c@\cH\c@?\c@(\c@*\c@\cH\c@D\c@!\c@'\c@\cG\c@I\c@\cX\c@)\c@\cD\c@M\c@\cQ\c@,\c@\cB\c@K\c@\cI\c@1\c@\c@\c@B\c@\cD\c@6\c@\cC\c@3\c@\c@\c@<\c@\cJ\c@#\c@\c@\c@C\c@\cT\c@\cU\c@\c@\c@K\c@!\c@\cI\c@\c@\c@T\c@/\c@\cJ\c@\cD\c@_\c@9\c@\cY\c@\cL\c@h\c@:\c@.\c@\cV\c@q\c@3\c@G\c@ \c@w\c@'\c@c\c@*\c@|\c@\cZ\c@x\c@.\c@€\c@\cM\c@…\c@,\c@ƒ\c@\cD\c@‡\c@\"\c@…\c@\c@\c@\c?\c@\cX\c@†\c@\c@\c@n\c@\cN\c@‰\c@\cG\c@W\c@\cE\c@Œ\c@\cS\c@<\c@\c@\c@“\c@#\c@%\c@\c@\c@œ\c@4\c@\cS\c@\c@\c@¨\c@D\c@\cF\c@\cB\c@²\c@K\c@\c@\c@\cD\c@¸\c@H\c@\cD\c@\cG\c@·\c@=\c@\cI\c@\cI\c@­\c@+\c@\cP\c@\cK\c@œ\c@\e\c@\cZ\c@\cJ\c@‡\c@\cM\c@'\c@\cG\c@r\c@\cD\c@4\c@\cD\c@b\c@\c@\c@=\c@\cB\c@Y\c@\cB\c@A\c@\c@\c@X\c@\cF\c@<\c@\c@\c@]\c@\cJ\c@/\c@\c@\c@i\c@\cM\c@!\c@\c@\c@v\c@\cP\c@\cS\c@\c@\c@ƒ\c@\cO\c@\cG\c@\c@\c@Œ\c@\cL\c@\c@\c@\c@\c@\c@\cH\c@\cC\c@\cC\c@Ž\c@\cD\c@\cO\c@\cK\c@‡\c@\cB\c@#\c@\cX\c@|\c@\c@\c@:\c@(\c@p\c@\c@\c@R\c@:\c@d\c@\c@\c@f\c@K\c@Y\c@\c@\c@m\c@W\c@N\c@\c@\c@g\c@]\c@B\c@\cD\c@V\c@_\c@4\c@\cK\c@?\c@]\c@\$\c@\cT\c@)\c@Y\c@\cW\c@\c_\c@\cW\c@V\c@\cL\c@*\c@\cL\c@T\c@\cD\c@1\c@\cH\c@U\c@\cE\c@3\c@\cK\c@Y\c@\cN\c@0\c@\cV\c@a\c@\e\c@*\c@&\c@j\c@*\c@!\c@<\c@t\c@:\c@\cW\c@W\c@~\c@E\c@\cN\c@u\c@„\c@J\c@\cH\c@˜\c@ˆ\c@F\c@\cC\c@Á\c@ˆ\c@;\c@\c@\c@î\c@†\c@-\c@\c@\cA\c\\c@\c@\c]\c@\c@\cAG\c@}\c@\cP\c@\c@\cAi\c@x\c@\cG\c@\c@\cA|\c@u\c@\cE\c@\c@\cA{\c@u\c@\cH\c@\c@\cAf\c@t\c@\cN\c@\c@\cA?\c@t\c@\cU\c@\c@\cA\cM\c@s\c@\c\\c@\c@\c@×\c@o\c@ \c@\c@\c@¨\c@i\c@!\c@\c@\c@†\c@b\c@ \c@\c@\c@v\c@Z\c@\c^\c@\c@\c@{\c@R\c@\c]\c@\c@\c@\c@K\c@\c]\c@\cB\c@®\c@F\c@ \c@\cD\c@Ì\c@B\c@%\c@\cG\c@ã\c@\@\c@+\c@\cH\c@ì\c@=\c@0\c@\cH\c@ã\c@9\c@4\c@\cG\c@È\c@2\c@6\c@\cD\c@Ÿ\c@*\c@4\c@\cB\c@o\c@\"\c@0\c@\c@\c@E\c@\c\\c@+\c@\c@\c@\$\c@\c\\c@%\c@\c@\c@\cM\c@!\c@!\c@\c@\c@\c@\c@*\c@\c_\c@\c@\c@\c@\c@3\c@\c_\c@\c@\c@\c@\c@:\c@\c_\c@\cA\c@\c@\c@>\c@\c_\c@\cD\c@\c@\c@?\c@\c]\c@\cH\c@\c@\c@>\c@\cZ\c@\cM\c@\c@\c@=\c@\cV\c@\cU\c@\c@\c@?\c@\cQ\c@\c]\c@\c@\c@C\c@\cM\c@&\c@\c@\c@J\c@\cI\c@/\c@\c@\c@T\c@\cF\c@6\c@\cG\c@^\c@\cC\c@;\c@\cX\c@f\c@\cA\c@<\c@0\c@k\c@\c@\c@8\c@K\c@l\c@\c@\c@1\c@f\c@h\c@\c@\c@(\c@y\c@a\c@\c@\c@\c]\c@|\c@Y\c@\c@\c@\cS\c@q\c@Q\c@\c@\c@\cL\c@\\\c@K\c@\c@\c@\cG\c@G\c@G\c@\cF\c@\cC\c@8\c@F\c@\cO\c@\cA\c@8\c@H\c@\e\c@\cA\c@J\c@J\c@*\c@\c@\c@m\c@K\c@:\c@\c@\c@\c@H\c@E\c@\c@\c@Ï\c@?\c@J\c@\c@\c@ú\c@/\c@G\c@\c@\cA\cU\c@ \c@=\c@\c@\cA\c_\c@\cR\c@.\c@\cB\cA\cX\c@\cF\c@\c_\c@\cD\cA\cH\c@\c@\c@\cR\c@\cG\c@ó\c@\cH\c@\cI\c@\cH\c@á\c@\cT\c@\cG\c@\cH\c@Ô\c@%\c@\cM\c@\cG\c@É\c@8\c@\cX\c@\cD\c@À\c@K\c@%\c@\cB\c@µ\c@X\c@1\c@\c@\c@¤\c@^\c@:\c@\c@\c@\c@[\c@\@\c@\c@\c@u\c@T\c@B\c@\c@\c@a\c@I\c@B\c@\c@\c@X\c@?\c@C\c@\c@\c@a\c@7\c@D\c@\c@\c@{\c@4\c@F\c@\c@\c@¢\c@4\c@H\c@\c@\c@É\c@7\c@I\c@\c@\c@æ\c@;\c@G\c@\c@\c@ì\c@>\c@B\c@\c@\c@Ù\c@=\c@8\c@\c@\c@¯\c@8\c@+\c@\c@\c@z\c@/\c@\c]\c@\c@\c@K\c@#\c@\cQ\c@\c@\c@%\c@\cW\c@\cH\c@\c@\c@\cK\c@\cM\c@\cA\c@\c@\c@\c@\c@\cF\c@\c@\c@\cB\c@\cC\c@\cD\c@\cI\c@\cC\c@\cS\c@\cG\c@\cW\c@\cC\c@)\c@\cM\c@'\c@\cC\c@C\c@\cS\c@8\c@\cC\c@`\c@\cW\c@I\c@\cB\c@~\c@\cY\c@P\c@\c@\c@‘\c@\cU\c@M\c@\c@\c@—\c@\cO\c@A\c@\c@\c@‘\c@\cI\c@0\c@\c@\c@€\c@\cD\c@\c_\c@\c@\c@f\c@\c@\c@\cQ\c@\c@\c@H\c@\c@\c@\cH\c@\cA\c@-\c@\c@\c@\cJ\c@\cA\c@\cW\c@\cF\c@\cW\c@\cA\c@\cH\c@\cO\c@*\c@\cA\c@\cA\c@\cX\c@\@\c@\cA\c@\cB\c@ \c@X\c@\c@\c@\cK\c@'\c@h\c@\c@\c@\c^\c@'\c@p\c@\c@\c@?\c@!\c@o\c@\cD\c@r\c@\cW\c@e\c@\cK\c@µ\c@\cN\c@W\c@\cU\c@þ\c@\cG\c@H\c@!\cA?\c@\cD\c@=\c@/\cAj\c@\cE\c@8\c@<\cAt\c@\cJ\c@8\c@I\cAW\c@\cQ\c@;\c@T\cA\e\c@\cY\c@\@\c@\\\c@É\c@\c_\c@B\c@c\c@\c?\c@!\c@B\c@g\c@B\c@ \c@=\c@g\c@\cX\c@\c\\c@7\c@`\c@\cA\c@\cV\c@0\c@W\c@\cG\c@\cQ\c@+\c@J\c@\c^\c@\cO\c@)\c@;\c@>\c@\cR\c@*\c@,\c@d\c@\cX\c@.\c@\c_\c@\c@ \c@4\c@\cW\c@·\c@)\c@9\c@\cS\c@Í\c@/\c@=\c@\cV\c@Ï\c@1\c@;\c@\c^\c@½\c@.\c@4\c@-\c@›\c@)\c@(\c@\@\c@o\c@#\c@\e\c@R\c@G\c@\c_\c@\cP\c@`\c@%\c@\c_\c@\cF\c@h\c@\cL\c@#\c@\c@\c@h\c@\c@\c@+\c@\c@\c@^\c@\c@\c@7\c@\c@\c@J\c@\cA\c@C\c@\c@\c@5\c@\cC\c@O\c@\c@\c@!\c@\cB\c@X\c@\cB\c@\cP\c@\cB\c@_\c@\cB\c@\cD\c@\cC\c@c\c@\cB\c@\c@\c@\cA\c@c\c@\cA\c@\c@\c@\c@\c@^\c@\cA\c@\cC\c@\cG\c@V\c@\c@\c@\cL\c@\cT\c@J\c@\c@\c@\e\c@)\c@=\c@\c@\c@/\c@B\c@.\c@\cB\c@G\c@a\c@!\c@\cF\c@^\c@€\c@\cV\c@\cM\c@n\c@œ\c@\cN\c@\cW\c@v\c@³\c@\cH\c@#\c@u\c@Å\c@\cD\c@1\c@l\c@Î\c@\cB\c@?\c@^\c@Ë\c@\cB\c@L\c@N\c@¹\c@\cF\c@W\c@?\c@›\c@\cK\c@b\c@2\c@r\c@\cQ\c@h\c@+\c@K\c@\cW\c@j\c@'\c@*\c@\e\c@g\c@(\c@\cQ\c@\c\\c@`\c@,\c@\cB\c@\e\c@S\c@4\c@\c@\c@\cX\c@C\c@>\c@\c@\c@\cV\c@0\c@J\c@\c@\c@\cT\c@\c_\c@T\c@\c@\c@\cS\c@\cR\c@[\c@\cO\c@\cR\c@\cH\c@^\c@7\c@\cP\c@\cB\c@[\c@t\c@\cN\c@\c@\c@V\c@¼\c@\cK\c@\c@\c@O\cA\cI\c@\cJ\c@\c@\c@K\cAD\c@\cI\c@\c@\c@H\cAW\c@\cI\c@\c@\c@J\cA<\c@\cG\c@\cC\c@M\c@ú\c@\cF\c@\cH\c@P\c@®\c@\cE\c@\cN\c@R\c@g\c@\cF\c@\cU\c@Q\c@/\c@\cJ\c@\c\\c@M\c@\cJ\c@\cO\c@!\c@G\c@\c@\c@\cS\c@#\c@B\c@\cQ\c@\cV\c@\"\c@=\c@1\c@\cU\c@ \c@>\c@W\c@\cP\c@\c\\c@E\c@z\c@\cK\c@\cW\c@Q\c@™\c@\cF\c@\cT\c@_\c@ž\c@\cB\c@\cT\c@p\c@ˆ\c@\c@\c@\cY\c@|\c@c\c@\c@\c@%\c@\c@>\c@\c@\c@6\c@|\c@\c\\c@\c@\c@K\c@m\c@\cG\c@\cD\c@a\c@X\c@\c@\c@\cI\c@v\c@A\c@\c@\c@\cO\c@…\c@+\c@\c@\c@\cS\c@\c@\cZ\c@\c@\c@\cX\c@“\c@\cO\c@\c@\c@\cX\c@‘\c@\cJ\c@\c@\c@\cV\c@Œ\c@\cH\c@\c@\c@\cU\c@†\c@\cG\c@\c@\c@\cW\c@\c?\c@\cG\c@\c@\c@\c]\c@z\c@\cF\c@\c@\c@'\c@w\c@\cD\c@\c@\c@4\c@u\c@\cC\c@\c@\c@?\c@r\c@\cB\c@\c@\c@F\c@n\c@\c@\c@\cC\c@F\c@h\c@\c@\c@\cM\c@>\c@`\c@\c@\c@\cZ\c@0\c@W\c@\c@\c@'\c@ \c@O\c@\c@\c@0\c@\cS\c@J\c@\c@\c@3\c@\cH\c@I\c@\c@\c@+\c@\cB\c@M\c@\cC\c@ \c@\c@\c@U\c@\cG\c@\cT\c@\c@\c@a\c@\cL\c@\cQ\c@\c@\c@l\c@\cR\c@\cZ\c@\c@\c@v\c@\cX\c@0\c@\c@\c@|\c@\e\c@O\c@\c@\c@}\c@\c]\c@w\c@\c@\c@z\c@\c_\c@¤\c@\cA\c@u\c@\c_\c@Ò\c@\cE\c@n\c@!\c@ÿ\c@\cJ\c@g\c@\"\cA'\c@\cQ\c@a\c@#\cAD\c@\cV\c@]\c@\"\cAV\c@\cZ\c@]\c@ \cAX\c@\cX\c@`\c@\e\cAL\c@\cT\c@d\c@\cV\cA5\c@\cM\c@i\c@\cO\cA\cV\c@\cH\c@n\c@\cK\c@õ\c@\cC\c@r\c@\cH\c@×\c@\c@\c@u\c@\cH\c@Á\c@\c@\c@z\c@\cJ\c@±\c@\c@\c@€\c@\cN\c@¨\c@\c@\c@ˆ\c@\cQ\c@¥\c@\c@\c@\c@\cR\c@¡\c@\cB\c@–\c@\cQ\c@›\c@\cE\c@›\c@\cM\c@’\c@\cG\c@œ\c@\cI\c@…\c@\cI\c@™\c@\cE\c@u\c@\cI\c@“\c@\cA\c@c\c@\cG\c@‹\c@\cA\c@Q\c@\cE\c@ƒ\c@\cF\c@A\c@\cB\c@|\c@\cL\c@7\c@\c@\c@z\c@\cR\c@5\c@\c@\c@|\c@\cX\c@=\c@\c@\c@ƒ\c@\e\c@O\c@\cB\c@Œ\c@\cZ\c@i\c@\cE\c@—\c@\cT\c@‰\c@\cF\c@ \c@\cN\c@©\c@\cG\c@¥\c@\cH\c@Ã\c@\cF\c@¤\c@\cC\c@Ò\c@\cE\c@š\c@\c@\c@Ñ\c@\cB\c@‰\c@\c@\c@¿\c@\c@\c@s\c@\cA\c@ž\c@\c@\c@\\\c@\cA\c@q\c@\c@\c@H\c@\cC\c@I\c@\c@\c@:\c@\cE\c@(\c@\c@\c@2\c@\cH\c@\cO\c@\c@\c@/\c@\cL\c@\cA\c@\c@\c@0\c@\cQ\c@\c@\c@\c@\c@4\c@\cW\c@\c@\c@\cC\c@9\c@\c]\c@\cH\c@\cI\c@A\c@\"\c@\cU\c@\cR\c@M\c@'\c@'\c@\c\\c@]\c@+\c@;\c@(\c@n\c@/\c@T\c@4\c@|\c@2\c@j\c@?\c@…\c@5\c@\c?\c@I\c@†\c@6\c@–\c@R\c@}\c@6\c@¯\c@X\c@m\c@4\c@È\c@]\c@X\c@0\c@ß\c@^\c@\@\c@+\c@ï\c@\\\c@*\c@&\c@ö\c@V\c@\cY\c@!\c@ò\c@O\c@\cL\c@\c_\c@æ\c@G\c@\cF\c@!\c@Õ\c@>\c@\cH\c@&\c@Ä\c@4\c@\cR\c@,\c@¹\c@+\c@\c]\c@2\c@·\c@!\c@(\c@6\c@¾\c@\cY\c@/\c@9\c@Ê\c@\cS\c@1\c@9\c@Ö\c@\cQ\c@-\c@6\c@Ý\c@\cR\c@%\c@3\c@Ù\c@\cV\c@\e\c@2\c@Ë\c@\c\\c@\cS\c@2\c@·\c@!\c@\cO\c@3\c@¡\c@%\c@\cM\c@3\c@“\c@%\c@\cL\c@2\c@\c@ \c@\cL\c@0\c@œ\c@\cX\c@\cJ\c@,\c@³\c@\cP\c@\cH\c@&\c@Ð\c@\cH\c@\cE\c@!\c@ê\c@\cD\c@\cB\c@\c\\c@ø\c@\cE\c@\c@\c@\cZ\c@õ\c@\cL\c@\c@\c@\cY\c@Þ\c@\cV\c@\c@\c@\c]\c@¶\c@\$\c@\c@\c@%\c@ƒ\c@4\c@\c@\c@1\c@U\c@C\c@\c@\c@\@\c@.\c@R\c@\c@\c@P\c@\cS\c@^\c@\c@\c@]\c@\cC\c@f\c@\c@\c@b\c@\c@\c@h\c@\c@\c@a\c@\cE\c@e\c@\c@\c@V\c@\cJ\c@]\c@\c@\c@E\c@\cM\c@R\c@\c@\c@/\c@\cK\c@F\c@\c@\c@\c]\c@\cL\c@;\c@\c@\c@\cN\c@\cI\c@4\c@\c@\c@\cD\c@\cD\c@/\c@\cB\c@\c@\c@\c@\c@1\c@\cF\c@\c@\c@\c@\c@7\c@\cK\c@\cB\c@\c@\c@A\c@\cO\c@\cC\c@\cQ\c@L\c@\cR\c@\cC\c@8\c@X\c@\cR\c@\cC\c@q\c@a\c@\cO\c@\cC\c@´\c@f\c@\cK\c@\cA\c@ý\c@f\c@\cF\c@\c@\cA1\c@b\c@\cB\c@\c@\cA?\c@Z\c@\c@\c@\c@\cA%\c@P\c@\cA\c@\c@\c@é\c@G\c@\cD\c@\c@\c@¡\c@>\c@\cG\c@\c@\c@`\c@:\c@\cJ\c@\cB\c@,\c@9\c@\cJ\c@\cB\c@\cK\c@=\c@\cJ\c@\cB\c@\c@\c@C\c@\cG\c@\cB\c@\c@\c@K\c@\cD\c@\cB\c@\c@\c@P\c@\cA\c@\c@\c@\c@\c@Q\c@\c@\c@\c@\c@\c@\c@M\c@\c@\c@\c@\c@\c@\c@D\c@\c@\c@\c@\c@\c@\c@8\c@\c@\c@\c@\c@\c@\c@-\c@\c@\c@\c@\c@\c@\c@%\c@\c@\c@\c@\c@\c@\c@!\c@\cC\c@\c@\c@\c@\c@\"\c@\cH\c@\c@\c@\c@\c@'\c@\cN\c@\c@\c@\c@\c@-\c@\cU\c@\c@\c@\cC\c@2\c@\c\\c@\c@\c@\cU\c@6\c@\"\c@\cB\c@6\c@7\c@%\c@\cF\c@f\c@6\c@&\c@\cJ\c@¤\c@3\c@&\c@\cM\c@ê\c@/\c@\$\c@\cQ\cA'\c@)\c@ \c@\cS\cAQ\c@\"\c@\e\c@\cS\cAc\c@\e\c@\cU\c@\cR\cAY\c@\cU\c@\cO\c@\cR\cA8\c@\cQ\c@\cM\c@\cT\cA\cE\c@\cO\c@\cN\c@\cX\c@Ê\c@\cQ\c@\cT\c@\c^\c@\c@\cX\c@\c]\c@%\c@^\c@\"\c@(\c@+\c@9\c@-\c@2\c@-\c@\$\c@6\c@9\c@+\c@\e\c@<\c@;\c@#\c@\cZ\c@<\c@7\c@\cY\c@\cZ\c@5\c@/\c@\cO\c@\cW\c@*\c@!\c@\cK\c@\cR\c@\c]\c@\cV\c@\cO\c@\cL\c@\cR\c@\cL\c@\c]\c@\cE\c@\cH\c@\cD\c@2\c@\c@\c@\cB\c@\c@\c@K\c@\c@\c@\c@\c@\c@\c@c\c@\c@\c@\c@\c@\cC\c@w\c@\cE\c@\c@\c@\cM\c@„\c@\cR\c@\c@\c@\e\c@Š\c@%\c@\c@\c@-\c@ˆ\c@<\c@\c@\c@\@\c@‚\c@T\c@\cB\c@R\c@y\c@i\c@\cG\c@\\\c@n\c@v\c@\cO\c@_\c@b\c@{\c@\cY\c@Z\c@V\c@|\c@%\c@P\c@J\c@y\c@1\c@C\c@=\c@t\c@9\c@5\c@0\c@o\c@<\c@'\c@%\c@l\c@;\c@\c]\c@\cZ\c@i\c@3\c@\cW\c@\cQ\c@l\c@(\c@\cV\c@\cK\c@u\c@\e\c@\e\c@\cH\c@†\c@\cP\c@%\c@\cJ\c@¢\c@\cG\c@4\c@\cP\c@Ë\c@\cB\c@F\c@\e\c@ü\c@\c@\c@V\c@)\cA0\c@\c@\c@f\c@8\cA[\c@\c@\c@r\c@F\cAr\c@\c@\c@{\c@P\cAk\c@\c@\c@}\c@V\cAF\c@\cC\c@z\c@X\cA\cE\c@\cJ\c@r\c@U\c@·\c@\cU\c@d\c@P\c@r\c@!\c@S\c@J\c@:\c@-\c@\@\c@F\c@\cU\c@4\c@0\c@C\c@\cA\c@2\c@!\c@\@\c@\c@\c@*\c@\cV\c@?\c@\c@\c@\c^\c@\cN\c@?\c@\c@\c@\cR\c@\cH\c@>\c@\c@\c@\cH\c@\cF\c@<\c@\cF\c@\cD\c@\cF\c@:\c@\cQ\c@\cG\c@\cJ\c@5\c@!\c@\cN\c@\cP\c@/\c@6\c@\cX\c@\cW\c@'\c@T\c@\$\c@\cZ\c@\c_\c@t\c@0\c@\cX\c@\cV\c@˜\c@9\c@\cT\c@\cN\c@½\c@\@\c@\cN\c@\cH\c@ß\c@C\c@\cG\c@\cD\c@ø\c@C\c@\cE\c@\cA\cA\cC\c@\@\c@\cK\c@\c@\c@ú\c@:\c@\cU\c@\c@\c@Ý\c@2\c@!\c@\c@\c@®\c@'\c@-\c@\cC\c@x\c@\e\c@6\c@\cJ\c@J\c@\cQ\c@:\c@\cT\c@\$\c@\cI\c@8\c@\c_\c@\cM\c@\cC\c@3\c@,\c@\cU\c@\c@\c@.\c@6\c@:\c@\c@\c@+\c@;\c@l\c@\c@\c@,\c@7\c@¤\c@\c@\c@3\c@/\c@Û\c@\cC\c@>\c@\"\c@ù\c@\cJ\c@L\c@\cV\c@ô\c@\cS\c@Z\c@\cK\c@Ì\c@\e\c@e\c@\cD\c@”\c@#\c@m\c@\c@\c@]\c@%\c@o\c@\c@\c@-\c@\c_\c@m\c@\cA\c@\cL\c@\cW\c@h\c@\cD\c@\cF\c@\cN\c@a\c@\cG\c@\c^\c@\cF\c@Z\c@\cI\c@\@\c@\c@\c@S\c@\cK\c@e\c@\cA\c@N\c@\cI\c@‡\c@\cI\c@J\c@\cG\c@›\c@\cU\c@H\c@\cD\c@’\c@\$\c@G\c@\cA\c@s\c@3\c@F\c@\c@\c@O\c@A\c@F\c@\c@\c@*\c@F\c@D\c@\c@\c@\cM\c@\@\c@?\c@\cA\c@\c@\c@3\c@8\c@\cF\c@\cE\c@#\c@.\c@\cM\c@\cW\c@\cU\c@\$\c@\cX\c@5\c@\cI\c@\e\c@'\c@Y\c@\cB\c@\cV\c@8\c@\c@\c@\c@\cU\c@H\c@¦\c@\c@\c@\cX\c@W\c@¾\c@\c@\c@\c_\c@c\c@Ä\c@\c@\c@)\c@k\c@º\c@\cC\c@3\c@l\c@¥\c@\cK\c@<\c@h\c@Š\c@\cW\c@C\c@\\\c@j\c@&\c@G\c@K\c@M\c@8\c@G\c@5\c@2\c@H\c@A\c@\"\c@\c_\c@P\c@8\c@\cR\c@\cV\c@N\c@*\c@\cG\c@\cX\c@D\c@\c]\c@\cC\c@#\c@2\c@\cQ\c@\cF\c@5\c@ \c@\cH\c@\cL\c@L\c@\cQ\c@\cA\c@\cS\c@f\c@\cF\c@\c@\c@\e\c@\c@\c@\c@\cH\c@ \c@ž\c@\c@\c@\e\c@!\c@¼\c@\c@\c@8\c@\c^\c@×\c@\cB\c@]\c@\cW\c@ë\c@\cG\c@ˆ\c@\cO\c@õ\c@\cN\c@¯\c@\cH\c@õ\c@\cR\c@É\c@\cC\c@ë\c@\cU\c@Ó\c@\c@\c@Þ\c@\cT\c@Î\c@\c@\c@Ð\c@\cP\c@¼\c@\c@\c@Ã\c@\cJ\c@£\c@\c@\c@·\c@\cE\c@‰\c@\c@\c@¨\c@\c@\c@w\c@\cC\c@’\c@\c@\c@o\c@\cG\c@u\c@\c@\c@r\c@\cL\c@U\c@\c@\c@\c?\c@\cP\c@7\c@\c@\c@‘\c@\cT\c@!\c@\c@\c@£\c@\cR\c@\cY\c@\c@\c@°\c@\cN\c@\c]\c@\c@\c@·\c@\cI\c@'\c@\c@\c@·\c@\cD\c@3\c@\c@\c@²\c@\c@\c@>\c@\c@\c@¨\c@\c@\c@F\c@\cD\c@œ\c@\c@\c@L\c@\cN\c@\c@\cB\c@V\c@\cZ\c@\c@\cI\c@a\c@)\c@t\c@\cR\c@i\c@9\c@e\c@\c]\c@i\c@F\c@U\c@*\c@_\c@M\c@C\c@4\c@K\c@O\c@3\c@8\c@7\c@M\c@\$\c@5\c@/\c@G\c@\cZ\c@-\c@9\c@A\c@\cU\c@ \c@Y\c@;\c@\cT\c@\cU\c@ˆ\c@7\c@\cV\c@\cK\c@¼\c@2\c@\cY\c@\cD\c@ã\c@.\c@\c\\c@\c@\c@ô\c@)\c@\c]\c@\c@\c@ë\c@\$\c@\c\\c@\cD\c@Ç\c@\c_\c@\cZ\c@\cL\c@“\c@\cZ\c@\cY\c@\cU\c@`\c@\cV\c@\cZ\c@\c]\c@5\c@\cT\c@\c_\c@%\c@\cU\c@\cT\c@&\c@&\c@\cC\c@\cU\c@0\c@!\c@\c@\c@\e\c@;\c@\cX\c@\c@\c@\"\c@E\c@\cP\c@\c@\c@,\c@L\c@\cH\c@\cG\c@5\c@O\c@\cB\c@\e\c@;\c@M\c@\c@\c@=\c@>\c@G\c@\c@\c@h\c@=\c@>\c@\c@\c@\c@:\c@4\c@\c@\c@Ñ\c@5\c@*\c@\c@\c@û\c@/\c@\"\c@\c@\cA\cR\c@)\c@\c]\c@\cA\cA\cU\c@\$\c@\e\c@\cF\cA\cD\c@!\c@\cZ\c@\cP\c@ä\c@ \c@\e\c@\c^\c@¼\c@#\c@\c]\c@.\c@•\c@)\c@\c]\c@>\c@t\c@1\c@\c]\c@K\c@b\c@8\c@\c]\c@Q\c@_\c@>\c@\c\\c@N\c@h\c@A\c@\c\\c@E\c@w\c@B\c@\c\\c@5\c@ƒ\c@B\c@\c^\c@%\c@…\c@A\c@#\c@\cV\c@z\c@\@\c@*\c@\cK\c@c\c@>\c@3\c@\cC\c@F\c@<\c@=\c@\c@\c@,\c@:\c@E\c@\c@\c@\c_\c@8\c@H\c@\c@\c@%\c@7\c@G\c@\c@\c@\@\c@4\c@B\c@\c@\c@k\c@2\c@8\c@\c@\c@\c@.\c@.\c@\c@\c@È\c@)\c@&\c@\c@\c@á\c@\$\c@!\c@\c@\c@ä\c@ \c@\c_\c@\cD\c@Ô\c@\c_\c@ \c@\cJ\c@»\c@\c_\c@ \c@\cP\c@ª\c@#\c@\c^\c@\cV\c@­\c@)\c@\cX\c@\e\c@É\c@0\c@\cR\c@\cZ\c@ø\c@6\c@\cK\c@\cT\cA*\c@=\c@\cE\c@\cO\cAK\c@D\c@\c@\c@\cH\cAJ\c@K\c@\cA\c@\cC\cA#\c@S\c@\cE\c@\c@\c@Ý\c@]\c@\cJ\c@\cG\c@•\c@i\c@\cN\c@\cS\c@S\c@v\c@\cQ\c@\c_\c@ \c@ƒ\c@\cR\c@,\c@\cC\c@\c@\cO\c@6\c@\c@\c@•\c@\cK\c@7\c@\cA\c@—\c@\cF\c@-\c@\cL\c@“\c@\cB\c@\"\c@\c_\c@‰\c@\c@\c@\cT\c@7\c@|\c@\c@\c@\cK\c@S\c@m\c@\c@\c@\cI\c@t\c@_\c@\c@\c@\cQ\c@\c@S\c@\c@\c@\c\\c@¥\c@J\c@\c@\c@(\c@·\c@C\c@\c@\c@1\c@Å\c@?\c@\c@\c@3\c@Ñ\c@<\c@\c@\c@/\c@Ö\c@:\c@\c@\c@&\c@Ï\c@7\c@\c@\c@\c]\c@º\c@3\c@\c@\c@\cX\c@˜\c@,\c@\c@\c@\cZ\c@l\c@\$\c@\c@\c@#\c@E\c@\cZ\c@\c@\c@3\c@#\c@\cP\c@\c@\c@G\c@\cK\c@\cI\c@\c@\c@X\c@\c@\c@\cI\c@\c@\c@d\c@\c@\c@\cO\c@\c@\c@f\c@\c@\c@\cY\c@\c@\c@]\c@\c@\c@\$\c@\c@\c@J\c@\c@\c@/\c@\c@\c@4\c@\cJ\c@7\c@\c@\c@ \c@(\c@9\c@\c@\c@\cO\c@U\c@9\c@\c@\c@\cD\c@Ž\c@8\c@\c@\c@\c@\c@Ò\c@7\c@\cB\c@\c@\cA\cU\c@6\c@\cH\c@\c@\cAH\c@7\c@\cP\c@\cB\cAe\c@:\c@\cZ\c@\cD\cAh\c@>\c@&\c@\cG\cAQ\c@C\c@/\c@\cH\cA\$\c@J\c@3\c@\cH\c@è\c@Q\c@3\c@\cG\c@§\c@W\c@/\c@\cD\c@n\c@]\c@'\c@\cB\c@E\c@b\c@\c^\c@\c@\c@6\c@e\c@\cT\c@\c@\c@?\c@e\c@\cL\c@\cA\c@\\\c@e\c@\cF\c@\cJ\c@\c@d\c@\cB\c@\cV\c@¡\c@b\c@\c@\c@\$\c@°\c@a\c@\c@\c@0\c@ª\c@`\c@\c@\c@:\c@\c@]\c@\c@\c@8\c@k\c@W\c@\c@\c@-\c@K\c@O\c@\c@\c@ \c@=\c@D\c@\c@\c@\cR\c@E\c@:\c@\c@\c@\cG\c@e\c@1\c@\cD\c@\c@\c@”\c@+\c@\cL\c@\c@\c@Ê\c@'\c@\cX\c@\c@\c@û\c@'\c@'\c@\c@\cA\c]\c@)\c@6\c@\c@\cA,\c@.\c@B\c@\c@\cA#\c@6\c@H\c@\c@\cA\cC\c@A\c@G\c@\c@\c@Ð\c@M\c@\@\c@\c@\c@”\c@Y\c@6\c@\c@\c@]\c@`\c@,\c@\c@\c@2\c@b\c@\$\c@\c@\c@\cT\c@]\c@\c_\c@\cB\c@\cC\c@T\c@\c^\c@\cH\c@\c@\c@F\c@\c^\c@\cP\c@\c@\c@9\c@\c_\c@\cY\c@\c@\c@/\c@\c_\c@\$\c@\c@\c@+\c@\c]\c@-\c@\c@\c@+\c@\cY\c@2\c@\c@\c@1\c@\cU\c@2\c@\c@\c@8\c@\cQ\c@1\c@\c@\c@?\c@\cO\c@-\c@\c@\c@D\c@\cM\c@*\c@\c@\c@G\c@\cL\c@&\c@\c@\c@F\c@\cI\c@%\c@\c@\c@B\c@\cG\c@#\c@\cF\c@=\c@\cD\c@ \c@\cQ\c@5\c@\cA\c@\e\c@\c^\c@-\c@\c@\c@\cV\c@*\c@\"\c@\c@\c@\cO\c@4\c@\cW\c@\cE\c@\cL\c@8\c@\cN\c@\cP\c@\cM\c@7\c@\cG\c@\c_\c@\cT\c@6\c@\cC\c@/\c@ \c@;\c@\c@\c@A\c@0\c@N\c@\c@\c@M\c@\@\c@m\c@\c@\c@P\c@K\c@–\c@\cC\c@I\c@Q\c@À\c@\cJ\c@:\c@N\c@ã\c@\cT\c@)\c@D\c@ö\c@ \c@\cY\c@4\c@ñ\c@-\c@\cL\c@#\c@Ö\c@6\c@\cE\c@\cU\c@¨\c@:\c@\cF\c@\cJ\c@t\c@8\c@\cM\c@\cC\c@E\c@0\c@\cR\c@\c@\c@!\c@&\c@\cV\c@\cB\c@\cQ\c@\cZ\c@\cV\c@\cF\c@\c^\c@\cQ\c@\cS\c@\cN\c@A\c@\cL\c@\cM\c@\cW\c@n\c@\cK\c@\cG\c@#\c@£\c@\cM\c@\cC\c@.\c@×\c@\cP\c@\cC\c@8\c@ü\c@\cQ\c@\cE\c@>\cA\cL\c@\cN\c@\cH\c@B\cA\cE\c@\cK\c@\cI\c@C\c@ê\c@\cF\c@\cK\c@D\c@¾\c@\cB\c@\cK\c@F\c@‰\c@\c@\c@\cK\c@L\c@X\c@\c@\c@\cM\c@U\c@2\c@\c@\c@\cR\c@`\c@\cV\c@\c@\c@\cZ\c@l\c@\cE\c@\c@\c@\$\c@t\c@\c@\c@\c@\c@.\c@y\c@\cO\c@\cA\c@5\c@u\c@*\c@\cG\c@7\c@i\c@M\c@\cO\c@3\c@U\c@o\c@\cY\c@*\c@\@\c@Ž\c@\$\c@\c^\c@-\c@˜\c@-\c@\cR\c@\"\c@‡\c@2\c@\cH\c@!\c@f\c@1\c@\cB\c@+\c@C\c@+\c@\c@\c@<\c@\"\c@\"\c@\c@\c@Q\c@\cJ\c@\cW\c@\c@\c@d\c@\c@\c@\cO\c@\c@\c@q\c@\c@\c@\cK\c@\c@\c@t\c@\cN\c@\cK\c@\c@\c@l\c@-\c@\cP\c@\c@\c@[\c@U\c@\cZ\c@\cC\c@C\c@€\c@#\c@\cJ\c@,\c@ª\c@(\c@\cS\c@\cX\c@Å\c@*\c@\e\c@\cJ\c@Ê\c@%\c@!\c@\cA\c@¼\c@\c\\c@!\c@\c@\c@¥\c@\cS\c@\e\c@\cC\c@’\c@\cJ\c@\cS\c@\cJ\c@Š\c@\cD\c@\cJ\c@\cS\c@‘\c@\cA\c@\cC\c@\c]\c@¦\c@\cC\c@\c@\c@&\c@Å\c@\cH\c@\c@\c@+\c@å\c@\cP\c@\c@\c@(\c@ù\c@\cX\c@\c@\c@!\c@ü\c@\c_\c@\c@\c@\cW\c@ë\c@#\c@\c@\c@\cM\c@Í\c@\$\c@\c@\c@\cF\c@¯\c@ \c@\c@\c@\cA\c@¡\c@\c\\c@\c@\c@\c@\c@«\c@\cX\c@\c@\c@\c@\c@Î\c@\cV\c@\c@\c@\c@\c@ÿ\c@\cU\c@\c@\c@\c@\cA.\c@\cV\c@\c@\c@\c@\cAJ\c@\cU\c@\cC\c@\c@\cAK\c@\cU\c@\cF\c@\cA\cA1\c@\cS\c@\cI\c@\cF\cA\cD\c@\cQ\c@\cK\c@\cL\c@Ò\c@\cP\c@\cJ\c@\cR\c@¨\c@\cQ\c@\cI\c@\cX\c@Œ\c@\cU\c@\cF\c@\c\\c@€\c@\c]\c@\cF\c@\c]\c@‚\c@(\c@\cI\c@\cZ\c@Œ\c@7\c@\cQ\c@\cW\c@›\c@F\c@\e\c@\cR\c@©\c@U\c@\$\c@\cN\c@±\c@_\c@*\c@\cJ\c@®\c@d\c@,\c@\cH\c@\c@b\c@)\c@\cH\c@|\c@Y\c@\$\c@\cM\c@X\c@K\c@ \c@\cT\c@6\c@;\c@\c_\c@!\c@\cY\c@*\c@%\c@.\c@\cE\c@\c]\c@.\c@;\c@\c@\c@\cR\c@:\c@F\c@\cB\c@\cJ\c@F\c@P\c@\cP\c@\cG\c@M\c@W\c@(\c@\cF\c@M\c@_\c@G\c@\cE\c@E\c@f\c@h\c@\cE\c@7\c@m\c@…\c@\cD\c@&\c@q\c@“\c@\cD\c@\cW\c@t\c@\c@\cB\c@\cK\c@q\c@w\c@\c@\c@\cC\c@m\c@[\c@\c@\c@\c@\c@f\c@A\c@\c@\c@\c@\c@]\c@2\c@\c@\c@\cA\c@T\c@3\c@\c@\c@\cI\c@M\c@D\c@\c@\c@\cX\c@G\c@`\c@\cB\c@,\c@B\c@„\c@\cF\c@E\c@\@\c@­\c@\cK\c@^\c@\@\c@Ø\c@\cP\c@p\c@?\cA\cC\c@\cT\c@w\c@\@\cA(\c@\cT\c@q\c@C\cAF\c@\cP\c@_\c@F\cAY\c@\cK\c@F\c@L\cAc\c@\cF\c@.\c@S\cAf\c@\cB\c@\cY\c@Z\cAg\c@\c@\c@\cK\c@]\cAn\c@\c@\c@\cK\c@Z\cA~\c@\c@\c@\cU\c@P\cAš\c@\c@\c@#\c@?\cAÁ\c@\cB\c@3\c@+\cAï\c@\cF\c@D\c@\cZ\cB\e\c@\cM\c@Q\c@\cL\cB:\c@\cU\c@[\c@\cD\cBF\c@ \c@b\c@\c@\cB4\c@,\c@d\c@\c@\cB\cG\c@5\c@c\c@\cA\cAÄ\c@=\c@^\c@\cG\cAy\c@A\c@R\c@\cQ\cA/\c@?\c@B\c@\c^\c@ð\c@8\c@.\c@/\c@¼\c@-\c@\c]\c@B\c@\c@\c_\c@\cO\c@Q\c@g\c@\cS\c@\cE\c@]\c@E\c@\cI\c@\c@\c@d\c@)\c@\cC\c@\c@\c@g\c@\cS\c@\c@\c@\c@\c@e\c@\cL\c@\c@\c@\cD\c@a\c@\c]\c@\c@\c@\cM\c@\\\c@<\c@\c@\c@\cX\c@W\c@c\c@\c@\c@\$\c@R\c@\c@\cA\c@1\c@L\c@¸\c@\cC\c@9\c@F\c@Ï\c@\cE\c@<\c@A\c@Ó\c@\cH\c@9\c@<\c@Ã\c@\cJ\c@3\c@8\c@£\c@\cK\c@*\c@5\c@{\c@\cK\c@ \c@2\c@W\c@\cL\c@\cX\c@,\c@D\c@\cL\c@\cP\c@\$\c@K\c@\cK\c@\cJ\c@\cZ\c@n\c@\cK\c@\cF\c@\cQ\c@¥\c@\cJ\c@\cC\c@\cI\c@â\c@\cG\c@\cC\c@\cB\cA\cR\c@\cE\c@\cF\c@\c@\cA*\c@\cB\c@\cL\c@\c@\cA&\c@\c@\c@\cU\c@\cD\cA\cN\c@\c@\c@ \c@\cN\c@ï\c@\c@\c@,\c@\c]\c@Ý\c@\cA\c@6\c@/\c@ß\c@\cC\c@<\c@C\c@ø\c@\cF\c@=\c@S\cA\c\\c@\cL\c@9\c@]\cA;\c@\cT\c@/\c@^\cAD\c@\c^\c@\$\c@X\cA-\c@,\c@\cX\c@L\c@ö\c@;\c@\cN\c@=\c@°\c@K\c@\cF\c@.\c@m\c@[\c@\cB\c@!\c@5\c@h\c@\c@\c@\cY\c@\cO\c@p\c@\c@\c@\cX\c@\cR\c@r\c@\c@\c@\e\c@0\c@m\c@\c@\c@%\c@T\c@_\c@\c@\c@3\c@w\c@J\c@\c@\c@D\c@•\c@3\c@\c@\c@V\c@š\c@\c_\c@\c@\c@i\c@„\c@\cN\c@\c@\c@z\c@a\c@\cC\c@\cB\c@‡\c@<\c@\c@\c@\cG\c@‘\c@\c\\c@\c@\c@\cO\c@–\c@\cG\c@\cC\c@\cY\c@”\c@\c@\c@\cH\c@&\c@Ž\c@\c@\c@\cP\c@2\c@†\c@\c@\c@\cX\c@9\c@z\c@\c@\c@ \c@<\c@n\c@\c@\c@&\c@8\c@e\c@\cB\c@)\c@/\c@^\c@\cI\c@(\c@\"\c@Y\c@\cT\c@&\c@\cV\c@Y\c@\c_\c@&\c@\cL\c@Y\c@&\c@'\c@\cE\c@[\c@'\c@)\c@\c@\c@]\c@\"\c@/\c@\c@\c@`\c@\cY\c@4\c@\c@\c@b\c@\cN\c@6\c@\c@\c@d\c@\cD\c@5\c@\c@\c@e\c@\cE\c@0\c@\c@\c@e\c@\c]\c@&\c@\c@\c@a\c@E\c@\e\c@\c@\c@Z\c@u\c@\cQ\c@\c@\c@Q\c@ª\c@\cI\c@\c@\c@F\c@Û\c@\cC\c@\cE\c@=\c@ñ\c@\c@\c@\cQ\c@8\c@é\c@\c@\c@\$\c@8\c@Ã\c@\cA\c@;\c@=\c@Œ\c@\cD\c@V\c@H\c@Y\c@\cI\c@k\c@R\c@.\c@\cN\c@v\c@Z\c@\cN\c@\cV\c@u\c@^\c@\c@\c@!\c@h\c@Z\c@\cR\c@-\c@R\c@N\c@3\c@;\c@;\c@=\c@_\c@H\c@'\c@*\c@\c@R\c@\cZ\c@\cZ\c@Ç\c@V\c@\cU\c@\cM\c@ò\c@S\c@\cW\c@\cD\cA\cK\c@J\c@\c^\c@\c@\cA\cU\c@\@\c@)\c@\cA\cA\cT\c@9\c@4\c@\cC\cA\cL\c@6\c@A\c@\cD\cA\c@\c@:\c@N\c@\cE\c@ï\c@A\c@Y\c@\cE\c@Ø\c@F\c@a\c@\cE\c@¾\c@F\c@d\c@\cB\c@¢\c@?\c@`\c@\cA\c@‹\c@0\c@V\c@\c@\c@~\c@!\c@F\c@\c@\c@\c@\cR\c@2\c@\cA\c@•\c@\cG\c@ \c@\cF\c@¶\c@\c@\c@\cQ\c@\cM\c@Ý\c@\c@\c@\cI\c@\cV\c@ÿ\c@\c@\c@\cH\c@!\cA\cW\c@\cB\c@\cP\c@,\cA\$\c@\cF\c@\e\c@5\cA)\c@\cK\c@(\c@9\cA-\c@\cP\c@4\c@9\cA9\c@\cU\c@;\c@3\cAN\c@\e\c@<\c@)\cAk\c@\c_\c@7\c@\c]\cA…\c@\"\c@.\c@\cR\cA•\c@%\c@#\c@\cH\cA’\c@(\c@\cY\c@\cB\cAx\c@*\c@\cQ\c@\c@\cAL\c@*\c@\cK\c@\cA\cA\cW\c@'\c@\cF\c@\cF\c@ä\c@#\c@\cD\c@\cM\c@¿\c@\c]\c@\cB\c@\cT\c@±\c@\cV\c@\cA\c@\cX\c@¸\c@\cN\c@\c@\c@\cZ\c@Î\c@\cH\c@\c@\c@\cV\c@ê\c@\cC\c@\c@\c@\cP\c@þ\c@\c@\c@\cA\c@\cI\cA\cA\c@\c@\c@\cI\c@\cC\c@ð\c@\c@\c@\cU\c@\c@\c@Ï\c@\c@\c@\$\c@\cC\c@¦\c@\cF\c@6\c@\cG\c@‚\c@\cS\c@H\c@\cK\c@l\c@&\c@W\c@\cM\c@f\c@;\c@`\c@\cN\c@p\c@Q\c@e\c@\cL\c@†\c@`\c@e\c@\cI\c@Ÿ\c@d\c@a\c@\cD\c@µ\c@]\c@Z\c@\cA\c@Ä\c@L\c@M\c@\cB\c@È\c@7\c@=\c@\cE\c@¿\c@#\c@,\c@\cI\c@©\c@\cT\c@\c\\c@\cN\c@‡\c@\cL\c@\cO\c@\cS\c@^\c@\cL\c@\cF\c@\cY\c@;\c@\cR\c@\cA\c@\e\c@\c^\c@\c]\c@\c@\c@\c\\c@\cJ\c@'\c@\c@\c@\e\c@\c@\c@/\c@\c@\c@\cY\c@\cB\c@4\c@\c@\c@\cT\c@\cJ\c@7\c@\c@\c@\cN\c@\cP\c@8\c@\c@\c@\cI\c@\cQ\c@:\c@\c@\c@\cE\c@\cQ\c@;\c@\c@\c@\cB\c@\cQ\c@;\c@\c@\c@\c@\c@\cK\c@9\c@\c@\c@\cE\c@\cC\c@6\c@\c@\c@\cO\c@\cF\c@/\c@\c@\c@\c]\c@\c^\c@(\c@\c@\c@.\c@C\c@!\c@\c@\c@\@\c@q\c@\c]\c@\c@\c@M\c@¦\c@\c\\c@\c@\c@S\c@Û\c@\c_\c@\c@\c@P\c@ÿ\c@\$\c@\c@\c@G\cA\cP\c@,\c@\c@\c@:\cA\cL\c@4\c@\c@\c@)\c@÷\c@;\c@\c@\c@\e\c@Ô\c@?\c@\c@\c@\cP\c@ª\c@A\c@\c@\c@\cG\c@~\c@?\c@\c@\c@\cA\c@U\c@=\c@\c@\c@\c@\c@4\c@<\c@\cC\c@\c@\c@\c]\c@>\c@\cM\c@\cA\c@\cS\c@C\c@\cY\c@\cC\c@\cW\c@K\c@&\c@\cF\c@\$\c@T\c@3\c@\cH\c@:\c@^\c@:\c@\cI\c@Q\c@e\c@8\c@\cI\c@a\c@h\c@/\c@\cG\c@e\c@f\c@\"\c@\cD\c@[\c@_\c@\cT\c@\cB\c@F\c@T\c@\cJ\c@\cC\c@/\c@F\c@\cB\c@\cG\c@\cY\c@7\c@\c@\c@\cM\c@\cH\c@(\c@\c@\c@\cV\c@\c@\c@\c]\c@\cA\c@#\c@\c@\c@\cV\c@\cB\c@/\c@\c@\c@\cT\c@\cB\c@;\c@\c@\c@\cV\c@\cB\c@D\c@\c@\c@\e\c@\cC\c@I\c@\c@\c@\c^\c@\cB\c@J\c@\c@\c@\c^\c@\cA\c@G\c@\c@\c@\cZ\c@\c@\c@C\c@\c@\c@\cT\c@\c@\c@>\c@\cG\c@\cM\c@\c@\c@9\c@\cX\c@\cF\c@\c@\c@3\c@0\c@\cC\c@\c@\c@*\c@K\c@\cD\c@\cA\c@ \c@j\c@\cH\c@\cH\c@\cU\c@‡\c@\cM\c@\cV\c@\cL\c@ \c@\cT\c@)\c@\cE\c@µ\c@\cZ\c@<\c@\cA\c@Ç\c@!\c@N\c@\c@\c@×\c@'\c@Y\c@\c@\c@á\c@-\c@[\c@\c@\c@Þ\c@2\c@X\c@\c@\c@Ê\c@3\c@P\c@\c@\c@¥\c@3\c@K\c@\c@\c@v\c@3\c@G\c@\c@\c@K\c@5\c@E\c@\c@\c@&\c@;\c@D\c@\c@\c@\cL\c@F\c@B\c@\c@\c@\c@\c@T\c@=\c@\c@\c@\cN\c@c\c@4\c@\c@\c@,\c@o\c@(\c@\c@\c@T\c@w\c@\e\c@\c@\c@~\c@w\c@\cP\c@\c@\c@©\c@o\c@\cH\c@\c@\c@Á\c@a\c@\cB\c@\c@\c@Â\c@N\c@\cB\c@\c@\c@®\c@9\c@\cH\c@\c@\c@\c@&\c@\cP\c@\cA\c@s\c@\cV\c@\e\c@\cB\c@_\c@\cK\c@(\c@\cB\c@\\\c@\cD\c@5\c@\cB\c@i\c@\cB\c@\@\c@\cB\c@‚\c@\cF\c@H\c@\cA\c@Ÿ\c@\cN\c@N\c@\c@\c@º\c@\cY\c@P\c@\c@\c@Ì\c@'\c@O\c@\c@\c@Ñ\c@5\c@J\c@\cA\c@Ç\c@?\c@\@\c@\cG\c@°\c@E\c@2\c@\cP\c@\c@D\c@#\c@\c]\c@i\c@=\c@\cV\c@,\c@E\c@1\c@\cK\c@;\c@'\c@\$\c@\cD\c@F\c@\cR\c@\cW\c@\cC\c@N\c@\cF\c@\cN\c@\cE\c@R\c@\cJ\c@\cF\c@\cM\c@S\c@\cX\c@\cB\c@\cW\c@U\c@*\c@\c@\c@%\c@U\c@>\c@\c@\c@4\c@U\c@Q\c@\c@\c@C\c@R\c@`\c@\c@\c@O\c@N\c@j\c@\c@\c@X\c@F\c@s\c@\c@\c@]\c@;\c@\c@\c@\c@_\c@/\c@—\c@\c@\c@_\c@\$\c@´\c@\c@\c@^\c@\c^\c@Õ\c@\c@\c@]\c@\c\\c@ö\c@\c@\c@[\c@\"\cA\cQ\c@\cC\c@Y\c@.\cA!\c@\cJ\c@U\c@>\cA\$\c@\cV\c@N\c@M\cA\cZ\c@)\c@D\c@Z\cA\cA\c@?\c@9\c@`\c@Û\c@T\c@.\c@b\c@ª\c@d\c@%\c@`\c@w\c@m\c@\c_\c@\\\c@L\c@k\c@\c]\c@Y\c@/\c@c\c@\c]\c@W\c@&\c@V\c@\c^\c@W\c@-\c@J\c@\c^\c@X\c@<\c@\@\c@\c\\c@X\c@G\c@:\c@\cX\c@W\c@F\c@7\c@\cR\c@W\c@:\c@9\c@\cL\c@T\c@*\c@=\c@\cG\c@Q\c@\cW\c@B\c@\cC\c@L\c@\cG\c@G\c@\cA\c@E\c@\cB\c@L\c@\c@\c@;\c@\c\\c@N\c@\c@\c@1\c@I\c@N\c@\cB\c@&\c@‚\c@M\c@\cF\c@\e\c@Á\c@J\c@\cJ\c@\cQ\cA\cA\c@F\c@\cO\c@\cJ\cA\$\c@C\c@\cS\c@\cE\cA\$\c@>\c@\cU\c@\cA\cA\cA\c@8\c@\cT\c@\c@\c@Ä\c@2\c@\cO\c@\c@\c@…\c@+\c@\cK\c@\cD\c@L\c@'\c@\cG\c@\cK\c@!\c@(\c@\cC\c@\cS\c@\cF\c@.\c@\c@\c@\e\c@\cF\c@:\c@\c@\c@&\c@\cX\c@L\c@\c@\c@+\c@1\c@`\c@\c@\c@+\c@N\c@r\c@\c@\c@&\c@j\c@\c?\c@\c@\c@\c]\c@\c?\c@„\c@\c@\c@\cS\c@\c@~\c@\c@\c@\cJ\c@q\c@p\c@\c@\c@\cD\c@U\c@[\c@\c@\c@\c@\c@8\c@D\c@\c@\c@\c@\c@\c^\c@-\c@\c@\c@\c@\c@\cL\c@\c\\c@\c@\c@\c@\c@\cA\c@\cR\c@\c@\c@\c@\c@\c@\c@\cN\c@\c@\c@\cD\c@\c@\c@\cR\c@\c@\c@\cN\c@\c@\c@\cY\c@\c@\c@\c]\c@\c@\c@\"\c@\c@\c@/\c@\c@\c@,\c@\c@\c@B\c@\cD\c@5\c@\c@\c@P\c@\cT\c@>\c@\c@\c@S\c@-\c@E\c@\c@\c@I\c@L\c@L\c@\c@\c@8\c@o\c@Q\c@\c@\c@%\c@Ž\c@T\c@\c@\c@\cT\c@Ÿ\c@T\c@\c@\c@\cF\c@ž\c@R\c@\c@\c@\c@\c@\c@N\c@\c@\c@\cA\c@|\c@I\c@\c@\c@\cD\c@n\c@B\c@\c@\c@\cH\c@o\c@:\c@\c@\c@\cI\c@€\c@1\c@\c@\c@\cJ\c@ž\c@(\c@\c@\c@\cI\c@¿\c@\c_\c@\c@\c@\cG\c@Û\c@\cW\c@\c@\c@\cC\c@ç\c@\cO\c@\c@\c@\cB\c@ã\c@\cJ\c@\c@\c@\cC\c@Î\c@\cE\c@\c@\c@\cG\c@±\c@\cB\c@\c@\c@\cI\c@“\c@\cA\c@\c@\c@\cJ\c@‚\c@\c@\c@\c@\c@\cJ\c@…\c@\c@\c@\cC\c@\cH\c@¡\c@\cA\c@\cK\c@\cE\c@Ò\c@\cF\c@\cV\c@\cB\cA\cS\c@\cN\c@\$\c@\c@\cAS\c@\cW\c@4\c@\c@\cA†\c@\c]\c@B\c@\c@\cA¢\c@ \c@J\c@\c@\cA¡\c@\e\c@K\c@\c@\cA‡\c@\cU\c@E\c@\c@\cAW\c@\cL\c@;\c@\c@\cA\cZ\c@\cD\c@3\c@\cA\c@Ö\c@\c@\c@2\c@\cF\c@–\c@\c@\c@:\c@\cO\c@_\c@\c@\c@M\c@\cX\c@:\c@\cC\c@e\c@\"\c@-\c@\cK\c@}\c@)\c@8\c@\cV\c@\c@+\c@W\c@\"\c@•\c@&\c@…\c@/\c@Ž\c@\c]\c@º\c@7\c@~\c@\cS\c@ë\c@8\c@i\c@\cJ\cA\cS\c@1\c@S\c@\cF\cA-\c@&\c@?\c@\cD\cA7\c@\cY\c@1\c@\cF\cA.\c@\cO\c@'\c@\cI\cA\cS\c@\cJ\c@#\c@\cL\c@è\c@\cI\c@\"\c@\cN\c@²\c@\cM\c@\$\c@\cO\c@}\c@\cR\c@(\c@\cO\c@R\c@\cW\c@.\c@\cP\c@<\c@\cZ\c@7\c@\cS\c@<\c@\e\c@A\c@\cV\c@P\c@\cY\c@N\c@\c\\c@p\c@\cU\c@\\\c@!\c@\c@\cP\c@g\c@&\c@Ÿ\c@\cL\c@p\c@*\c@ \c@\cJ\c@v\c@+\c@’\c@\cJ\c@y\c@+\c@{\c@\cN\c@{\c@*\c@j\c@\cU\c@\c?\c@&\c@d\c@\c]\c@†\c@!\c@j\c@%\c@\c@\c\\c@x\c@+\c@›\c@\cU\c@„\c@.\c@¤\c@\cO\c@ƒ\c@,\c@¨\c@\cJ\c@t\c@&\c@£\c@\cF\c@Y\c@\c]\c@”\c@\cB\c@=\c@\cS\c@|\c@\cA\c@&\c@\cK\c@^\c@\cF\c@\cZ\c@\cE\c@?\c@\cR\c@\cX\c@\cA\c@%\c@#\c@\cX\c@\c@\c@\cU\c@8\c@\cW\c@\c@\c@\cP\c@O\c@\cS\c@\c@\c@\cW\c@c\c@\cN\c@\c@\c@)\c@o\c@\cG\c@\c@\c@>\c@r\c@\cA\c@\c@\c@R\c@j\c@\c@\c@\c@\c@`\c@\\\c@\c@\c@\c@\c@e\c@I\c@\c@\c@\c@\c@a\c@5\c@\cD\c@\c@\c@S\c@\$\c@\cO\c@\c@\c@\@\c@\cY\c@\c_\c@\cD\c@-\c@\cR\c@/\c@\cJ\c@\c^\c@\cO\c@\@\c@\cP\c@\cW\c@\cO\c@H\c@\cV\c@\cZ\c@\cN\c@E\c@\cY\c@'\c@\cL\c@7\c@\cX\c@8\c@\cJ\c@'\c@\cS\c@I\c@\cH\c@\cV\c@\cM\c@V\c@\cF\c@\cH\c@\cF\c@]\c@\cF\c@\c@\c@\cB\c@^\c@\cF\c@\c@\c@\c@\c@\\\c@\cE\c@\c@\c@\c@\c@Z\c@\cD\c@\c@\c@\cG\c@Y\c@\cC\c@\c@\c@\cP\c@[\c@\cA\c@\c@\c@\c]\c@_\c@\c@\c@\cH\c@'\c@d\c@\c@\c@\c_\c@0\c@i\c@\c@\c@\@\c@1\c@m\c@\cA\c@i\c@+\c@o\c@\cD\c@•\c@ \c@o\c@\cJ\c@´\c@\cT\c@m\c@\cP\c@¼\c@\cJ\c@j\c@\cW\c@©\c@\cD\c@f\c@\c^\c@‚\c@\c@\c@b\c@\"\c@X\c@\c@\c@_\c@#\c@0\c@\c@\c@_\c@\"\c@\cS\c@\cC\c@c\c@\c^\c@\cQ\c@\cL\c@k\c@\cW\c@*\c@\cY\c@w\c@\cP\c@O\c@)\c@„\c@\cJ\c@w\c@;\c@Ž\c@\cD\c@›\c@I\c@“\c@\cA\c@ª\c@Q\c@“\c@\c@\c@Ÿ\c@Q\c@\c@\c@\c@|\c@J\c@ƒ\c@\c@\c@U\c@?\c@x\c@\cA\c@.\c@3\c@l\c@\cC\c@\cQ\c@&\c@b\c@\cH\c@\c@\c@\c]\c@V\c@\cM\c@\c@\c@\cV\c@K\c@\cR\c@\c@\c@\cP\c@>\c@\cU\c@\c@\c@\cK\c@1\c@\cV\c@\cC\c@\cG\c@&\c@\cS\c@\cP\c@\cD\c@\c]\c@\cP\c@&\c@\cD\c@\cX\c@\cL\c@B\c@\cI\c@\cW\c@\cK\c@`\c@\cS\c@\c\\c@\cL\c@x\c@!\c@#\c@\cO\c@€\c@4\c@+\c@\cR\c@o\c@G\c@1\c@\cS\c@U\c@Y\c@3\c@\cR\c@8\c@g\c@/\c@\cO\c@\e\c@p\c@%\c@\cL\c@\cF\c@s\c@\cY\c@\cJ\c@\cH\c@q\c@\cO\c@\cI\c@.\c@m\c@\cF\c@\cH\c@l\c@g\c@\c@\c@\cF\c@½\c@d\c@\c@\c@\cE\cA\c\\c@a\c@\c@\c@\cC\cA}\c@^\c@\cG\c@\cA\cAÀ\c@Y\c@\cW\c@\c@\cAÜ\c@P\c@/\c@\c@\cAÐ\c@C\c@M\c@\cF\cA¢\c@5\c@r\c@\cU\cAb\c@(\c@’\c@+\cA!\c@ \c@§\c@G\c@ê\c@ \c@®\c@f\c@Æ\c@&\c@¥\c@}\c@±\c@/\c@Ž\c@ˆ\c@¨\c@6\c@o\c@„\c@¤\c@8\c@L\c@t\c@¡\c@2\c@.\c@]\c@œ\c@%\c@\cX\c@G\c@˜\c@\cX\c@\cI\c@4\c@”\c@\cL\c@\cA\c@*\c@\c@\cD\c@\cC\c@\$\c@\c@\c@\c@\cJ\c@\$\c@‹\c@\c@\c@\cT\c@%\c@ˆ\c@\c@\c@ \c@#\c@„\c@\c@\c@0\c@\c_\c@}\c@\c@\c@=\c@\cZ\c@p\c@\cA\c@G\c@\cS\c@[\c@\cA\c@L\c@\cM\c@A\c@\cA\c@K\c@\cK\c@*\c@\cA\c@E\c@\cM\c@\cV\c@\cA\c@;\c@\cQ\c@\cS\c@\c@\c@1\c@\cW\c@&\c@\c@\c@(\c@\c]\c@P\c@\c@\c@\"\c@ \c@‡\c@\c@\c@!\c@!\c@Ç\c@\c@\c@#\c@\"\c@ù\c@\c@\c@'\c@#\cA\cP\c@\c@\c@.\c@%\cA\cD\c@\c@\c@6\c@*\c@Ô\c@\c@\c@?\c@1\c@—\c@\c@\c@H\c@8\c@\\\c@\c@\c@R\c@A\c@)\c@\c@\c@Z\c@H\c@\cI\c@\c@\c@_\c@M\c@\cO\c@\c@\c@_\c@P\c@'\c@\c@\c@X\c@R\c@D\c@\c@\c@L\c@S\c@c\c@\c@\c@=\c@X\c@\c@\c@\c@.\c@`\c@\c@\c@\c@\$\c@k\c@‹\c@\c@\c@\c_\c@z\c@u\c@\c@\c@\"\c@‰\c@V\c@\c@\c@&\c@˜\c@8\c@\c@\c@+\c@ \c@\c_\c@\c@\c@,\c@ \c@\cL\c@\c@\c@*\c@–\c@\cA\c@\c@\c@&\c@ƒ\c@\c@\c@\cF\c@#\c@g\c@\c@\c@\cR\c@#\c@H\c@\cM\c@\$\c@'\c@-\c@2\c@:\c@-\c@\cX\c@h\c@T\c@3\c@\cJ\c@¨\c@j\c@6\c@\cA\c@ì\c@x\c@5\c@\c@\cA#\c@\c?\c@.\c@\c@\cA:\c@€\c@%\c@\c@\cA1\c@~\c@\cY\c@\c@\cA\cR\c@}\c@\cO\c@\c@\c@ì\c@~\c@\cG\c@\c@\c@Ï\c@‚\c@\cB\c@\c@\c@Å\c@…\c@\c@\c@\c@\c@Í\c@…\c@\c@\c@\c@\c@ß\c@~\c@\c@\c@\c@\c@í\c@o\c@\c@\c@\cD\c@æ\c@Z\c@\c@\c@\cU\c@Æ\c@D\c@\c@\c@3\c@”\c@1\c@\cA\c@[\c@a\c@!\c@\cE\c@‰\c@1\c@\cZ\c@\cH\c@·\c@\cN\c@\cY\c@\cK\c@×\c@\c@\c@\c]\c@\cK\c@ã\c@\cL\c@#\c@\cJ\c@×\c@+\c@)\c@\cH\c@»\c@V\c@,\c@\cD\c@•\c@…\c@+\c@\cA\c@m\c@´\c@&\c@\c@\c@K\c@Ï\c@\c]\c@\cA\c@5\c@È\c@\cS\c@\cF\c@*\c@¤\c@\cK\c@\cO\c@*\c@u\c@\cH\c@\cZ\c@-\c@F\c@\cJ\c@'\c@0\c@*\c@\cP\c@4\c@/\c@4\c@\cY\c@:\c@(\c@a\c@\"\c@9\c@\c]\c@š\c@'\c@2\c@\cS\c@Ñ\c@(\c@%\c@\cI\c@ô\c@&\c@\cX\c@\cF\c@ñ\c@!\c@\cM\c@\cJ\c@È\c@\c]\c@\cE\c@\cS\c@\c@\e\c@\c@\c@\c^\c@W\c@\e\c@\c@\c@-\c@(\c@\c^\c@\c@\c@;\c@\cI\c@!\c@\c@\c@G\c@\c@\c@\"\c@\c@\c@Q\c@\cI\c@\"\c@\c@\c@X\c@,\c@\c_\c@\c@\c@[\c@b\c@\c\\c@\c@\c@W\c@¤\c@\c\\c@\c@\c@N\c@ì\c@!\c@\c@\c@A\cA+\c@,\c@\c@\c@/\cAL\c@;\c@\cB\c@\c^\cAK\c@L\c@\cJ\c@\cQ\cA.\c@]\c@\cU\c@\cG\cA\cC\c@k\c@!\c@\cA\c@×\c@s\c@.\c@\c@\c@¸\c@u\c@9\c@\c@\c@¬\c@r\c@=\c@\c@\c@µ\c@n\c@<\c@\c@\c@Ì\c@h\c@7\c@\c@\c@ê\c@c\c@/\c@\c@\cA\cB\c@_\c@(\c@\c@\cA\cO\c@[\c@\"\c@\c@\cA\cP\c@T\c@\c]\c@\c@\cA\cG\c@J\c@\cZ\c@\c@\c@û\c@=\c@\cY\c@\c@\c@ñ\c@0\c@\cW\c@\c@\c@í\c@%\c@\cV\c@\c@\c@í\c@\c]\c@\cX\c@\c@\c@í\c@\cZ\c@\c]\c@\c@\c@ë\c@\cZ\c@&\c@\c@\c@ã\c@\c]\c@4\c@\cC\c@Ö\c@ \c@F\c@\cK\c@Ç\c@\$\c@Y\c@\cT\c@¸\c@'\c@j\c@\c_\c@©\c@'\c@v\c@(\c@›\c@%\c@|\c@/\c@Ž\c@\"\c@{\c@/\c@€\c@\c_\c@v\c@.\c@r\c@\c]\c@p\c@-\c@f\c@\c]\c@j\c@-\c@]\c@\c_\c@g\c@,\c@\\\c@\"\c@e\c@,\c@c\c@\$\c@e\c@*\c@s\c@\$\c@e\c@\"\c@Š\c@\c_\c@e\c@\cX\c@¥\c@\cW\c@d\c@\cO\c@Â\c@\cO\c@c\c@\cG\c@Ý\c@\cH\c@c\c@\cA\c@ð\c@\cC\c@c\c@\c@\c@ù\c@\c@\c@d\c@\c@\c@ö\c@\c@\c@g\c@\c@\c@å\c@\c@\c@m\c@\c@\c@Æ\c@\c@\c@y\c@\cA\c@œ\c@\c@\c@‰\c@\cI\c@l\c@\c@\c@¡\c@\cS\c@D\c@\c@\c@»\c@ \c@\$\c@\cD\c@Ó\c@.\c@\cM\c@\cJ\c@ä\c@9\c@\c@\c@\cP\c@é\c@<\c@\c@\c@\cV\c@Ý\c@7\c@\cI\c@\cY\c@Â\c@,\c@\c\\c@\cX\c@™\c@\c]\c@3\c@\cS\c@i\c@\cQ\c@M\c@\cM\c@B\c@\cK\c@h\c@\cF\c@!\c@\cM\c@z\c@\cB\c@\cJ\c@\cU\c@\c?\c@\c@\c@\c@\c@\"\c@y\c@\c@\c@\cI\c@1\c@l\c@\c@\c@\cW\c@=\c@[\c@\c@\c@)\c@C\c@G\c@\c@\c@9\c@D\c@5\c@\c@\c@J\c@?\c@%\c@\cC\c@R\c@7\c@\cX\c@\cH\c@Q\c@-\c@\cP\c@\cN\c@J\c@'\c@\cO\c@\cV\c@A\c@#\c@\cW\c@\e\c@9\c@#\c@&\c@\c\\c@1\c@&\c@:\c@\cY\c@)\c@*\c@M\c@\cS\c@ \c@-\c@]\c@\cL\c@\cW\c@/\c@g\c@\cF\c@\cN\c@0\c@o\c@\cA\c@\cJ\c@/\c@y\c@\cA\c@\cM\c@/\c@‡\c@\cC\c@\cX\c@.\c@\c@\cE\c@)\c@.\c@·\c@\cH\c@;\c@0\c@Ñ\c@\cJ\c@I\c@4\c@æ\c@\cJ\c@N\c@<\c@ï\c@\cH\c@H\c@F\c@í\c@\cE\c@9\c@N\c@Ý\c@\cC\c@'\c@T\c@¿\c@\cA\c@\cV\c@V\c@—\c@\cE\c@\cL\c@T\c@j\c@\cO\c@\cK\c@N\c@C\c@\c_\c@\cQ\c@G\c@\"\c@0\c@\cZ\c@A\c@\cK\c@E\c@!\c@?\c@\c@\c@U\c@%\c@=\c@\c@\c@_\c@!\c@?\c@\c@\c@`\c@\cZ\c@B\c@\c@\c@]\c@\cQ\c@F\c@\c@\c@T\c@\cH\c@H\c@\c@\c@L\c@\cB\c@L\c@\c@\c@D\c@\c@\c@O\c@\c@\c@?\c@\c@\c@Q\c@\c@\c@=\c@\c@\c@Q\c@\c@\c@>\c@\c@\c@O\c@\cC\c@A\c@\c@\c@J\c@\cK\c@E\c@\c@\c@A\c@\cV\c@L\c@\c@\c@3\c@\c_\c@R\c@\c@\c@\$\c@&\c@Z\c@\c@\c@\cW\c@(\c@b\c@\cC\c@\cL\c@%\c@h\c@\cK\c@\cD\c@ \c@l\c@\cW\c@\c@\c@!\c@k\c@#\c@\c@\c@+\c@h\c@.\c@\c@\c@>\c@b\c@4\c@\cC\c@W\c@\\\c@3\c@\cK\c@n\c@Y\c@,\c@\cV\c@{\c@\\\c@%\c@ \c@}\c@b\c@!\c@(\c@v\c@k\c@\$\c@*\c@l\c@t\c@/\c@\$\c@j\c@x\c@?\c@\e\c@x\c@u\c@O\c@\cP\c@–\c@i\c@\\\c@\cG\c@À\c@V\c@a\c@\cA\c@ê\c@?\c@]\c@\c@\cA\cF\c@(\c@T\c@\c@\cA\cI\c@\cV\c@I\c@\c@\c@ð\c@\cL\c@C\c@\cD\c@Â\c@\cJ\c@C\c@\cL\c@Š\c@\cO\c@K\c@\cV\c@V\c@\cW\c@X\c@ \c@3\c@!\c@f\c@(\c@\$\c@*\c@n\c@*\c@\"\c@1\c@m\c@\$\c@%\c@6\c@b\c@\e\c@%\c@8\c@R\c@\cQ\c@ \c@8\c@A\c@\cG\c@\cW\c@6\c@6\c@\cA\c@\cL\c@4\c@4\c@\c@\c@\cC\c@1\c@<\c@\c@\c@\c@\c@/\c@K\c@\c@\c@\cI\c@.\c@\\\c@\c@\c@ \c@1\c@j\c@\c@\c@?\c@8\c@p\c@\c@\c@]\c@A\c@n\c@\c@\c@x\c@M\c@e\c@\c@\c@€\c@X\c@X\c@\c@\c@q\c@a\c@M\c@\c@\c@U\c@g\c@F\c@\cD\c@7\c@h\c@D\c@\cI\c@\cY\c@e\c@F\c@\cP\c@\cF\c@_\c@J\c@\cW\c@\c@\c@V\c@L\c@\c\\c@\c@\c@L\c@J\c@\c\\c@\c@\c@A\c@H\c@\cW\c@\cB\c@4\c@G\c@\cP\c@\cJ\c@'\c@I\c@\cI\c@\cY\c@\cZ\c@O\c@\cC\c@1\c@\cP\c@W\c@\c@\c@Q\c@\cH\c@`\c@\c@\c@r\c@\cB\c@f\c@\c@\c@Ž\c@\c@\c@i\c@\c@\c@š\c@\c@\c@i\c@\cF\c@–\c@\c@\c@j\c@\cS\c@\c?\c@\c@\c@l\c@\$\c@\\\c@\c@\c@o\c@7\c@;\c@\c@\c@s\c@K\c@\c_\c@\c@\c@v\c@Z\c@\cJ\c@\c@\c@x\c@_\c@\c@\c@\c@\c@y\c@\\\c@\c@\c@\c@\c@y\c@R\c@\cE\c@\c@\c@{\c@F\c@\cU\c@\c@\c@\c?\c@9\c@+\c@\c@\c@†\c@1\c@D\c@\cA\c@\c@/\c@b\c@\cB\c@™\c@3\c@\c?\c@\cB\c@ \c@8\c@”\c@\cB\c@¤\c@;\c@¡\c@\cB\c@£\c@9\c@§\c@\cA\c@ž\c@0\c@¥\c@\c@\c@•\c@#\c@š\c@\c@\c@Œ\c@\cU\c@‡\c@\c@\c@ƒ\c@\cI\c@k\c@\c@\c@|\c@\cA\c@J\c@\c@\c@w\c@\cD\c@.\c@\c@\c@v\c@\cI\c@\cX\c@\c@\c@w\c@\cN\c@\cH\c@\c@\c@z\c@\cO\c@\c@\c@\c@\c@~\c@\cO\c@\cF\c@\c@\c@‚\c@\cM\c@\cR\c@\c@\c@„\c@\cH\c@\c]\c@\c@\c@‚\c@\cE\c@\"\c@\c@\c@|\c@\cJ\c@#\c@\c@\c@r\c@\cX\c@ \c@\c@\c@d\c@(\c@\cV\c@\cB\c@S\c@:\c@\cN\c@\cF\c@B\c@K\c@\cU\c@\cK\c@0\c@U\c@/\c@\cS\c@!\c@U\c@Q\c@\c^\c@\cV\c@N\c@x\c@(\c@\cN\c@A\c@ž\c@1\c@\cH\c@3\c@¹\c@9\c@\cE\c@%\c@È\c@>\c@\cC\c@\c\\c@Ð\c@?\c@\cA\c@\cX\c@Ø\c@<\c@\c@\c@\cY\c@ã\c@4\c@\c@\c@\c^\c@î\c@'\c@\c@\c@(\c@õ\c@\e\c@\c@\c@5\c@í\c@\cP\c@\c@\c@C\c@Ð\c@\cG\c@\c@\c@O\c@Ÿ\c@\cA\c@\cA\c@Y\c@m\c@\c@\c@\cF\c@]\c@>\c@\cD\c@\cO\c@Y\c@\cY\c@\cN\c@\e\c@N\c@\cK\c@\c\\c@(\c@>\c@\e\c@,\c@3\c@.\c@2\c@=\c@6\c@\c_\c@G\c@H\c@1\c@\cU\c@Y\c@H\c@'\c@\cQ\c@_\c@?\c@\cZ\c@\cT\c@S\c@1\c@\cQ\c@\cZ\c@=\c@\"\c@\cN\c@\$\c@&\c@\cZ\c@\cU\c@-\c@\cR\c@\c\\c@\"\c@2\c@\cD\c@)\c@0\c@3\c@\c@\c@>\c@<\c@/\c@\c@\c@S\c@A\c@&\c@\c@\c@b\c@<\c@\cZ\c@\c@\c@f\c@.\c@\cP\c@\c@\c@_\c@ \c@\cI\c@\c@\c@N\c@\cR\c@\cE\c@\c@\c@7\c@\cG\c@\cG\c@\c@\c@\"\c@\c@\c@\cL\c@\c@\c@\cS\c@\c@\c@\cQ\c@\c@\c@\cL\c@\cD\c@\cV\c@\c@\c@\cQ\c@\cM\c@\cZ\c@\c@\c@\c_\c@\cY\c@\e\c@\cJ\c@1\c@(\c@\cX\c@\c]\c@E\c@9\c@\cS\c@;\c@V\c@G\c@\cM\c@a\c@b\c@P\c@\cG\c@\c@h\c@R\c@\cB\c@¹\c@i\c@N\c@\c@\c@Ò\c@e\c@E\c@\c@\c@Ø\c@`\c@9\c@\c@\c@É\c@[\c@.\c@\c@\c@¬\c@V\c@%\c@\c@\c@‰\c@S\c@\c^\c@\c@\c@n\c@R\c@\c\\c@\c@\c@a\c@R\c@\c]\c@\c@\c@c\c@S\c@\c^\c@\c@\c@q\c@R\c@ \c@\c@\c@€\c@N\c@\"\c@\c@\c@ˆ\c@G\c@\$\c@\c@\c@\c?\c@>\c@(\c@\c@\c@g\c@3\c@-\c@\c@\c@J\c@*\c@2\c@\cA\c@-\c@%\c@6\c@\cC\c@\c\\c@#\c@8\c@\cE\c@ \c@&\c@7\c@\cG\c@;\c@+\c@3\c@\cH\c@b\c@2\c@-\c@\cG\c@‘\c@7\c@'\c@\cE\c@¾\c@;\c@#\c@\cC\c@Ü\c@;\c@!\c@\cA\c@å\c@9\c@!\c@\c@\c@Õ\c@4\c@\"\c@\c@\c@³\c@-\c@\"\c@\c@\c@‡\c@\$\c@!\c@\c@\c@a\c@\e\c@\c\\c@\cA\c@K\c@\cS\c@\cU\c@\cC\c@N\c@\cK\c@\cN\c@\cH\c@h\c@\cF\c@\cH\c@\cM\c@\c@\cB\c@\cB\c@\cS\c@¯\c@\cA\c@\c@\c@\cZ\c@½\c@\c@\c@\cC\c@\c_\c@²\c@\c@\c@\cN\c@\"\c@\c@\c@\c@\c^\c@#\c@d\c@\cD\c@0\c@!\c@A\c@\cL\c@E\c@\e\c@6\c@\cX\c@V\c@\cV\c@N\c@'\c@_\c@\cP\c@‡\c@8\c@\\\c@\cM\c@Ó\c@H\c@P\c@\cN\cA\c^\c@U\c@=\c@\cU\cAU\c@]\c@)\c@!\cAj\c@_\c@\cW\c@.\cA]\c@]\c@\cJ\c@8\cA7\c@Y\c@\cB\c@=\cA\cH\c@Q\c@\c@\c@9\c@ß\c@F\c@\c@\c@-\c@Ç\c@:\c@\cA\c@\c_\c@Á\c@,\c@\cD\c@\cR\c@Æ\c@\c^\c@\cJ\c@\cF\c@Î\c@\cR\c@\cQ\c@\c@\c@Î\c@\cK\c@\cZ\c@\c@\c@¾\c@\cJ\c@\$\c@\cA\c@œ\c@\cO\c@,\c@\cE\c@p\c@\cX\c@2\c@\cI\c@H\c@#\c@6\c@\cN\c@&\c@,\c@9\c@\cT\c@\cL\c@/\c@:\c@\c\\c@\c@\c@)\c@9\c@'\c@\cL\c@ \c@6\c@5\c@&\c@\cU\c@2\c@H\c@N\c@\cK\c@,\c@]\c@ƒ\c@\cC\c@'\c@r\c@Â\c@\cD\c@!\c@„\c@ÿ\c@\cM\c@\c]\c@\cA1\c@\cY\c@\e\c@‹\cAS\c@&\c@\c\\c@~\cAd\c@2\c@\c_\c@i\cAe\c@:\c@\$\c@P\cAW\c@=\c@+\c@9\cA<\c@<\c@1\c@*\cA\cY\c@<\c@5\c@\$\c@ñ\c@=\c@6\c@'\c@Ë\c@A\c@3\c@.\c@­\c@G\c@,\c@4\c@ \c@M\c@#\c@6\c@¦\c@S\c@\cZ\c@1\c@¿\c@V\c@\cR\c@(\c@ã\c@Y\c@\cM\c@\e\cA\cG\c@Z\c@\cJ\c@\cQ\cA\e\c@Z\c@\cJ\c@\cH\cA\cR\c@Z\c@\cJ\c@\cC\c@é\c@X\c@\cL\c@\cD\c@­\c@T\c@\cM\c@\cL\c@q\c@M\c@\cM\c@\cV\c@:\c@D\c@\cM\c@!\c@\cQ\c@:\c@\cK\c@+\c@\cQ\c@2\c@\cI\c@/\c@3\c@.\c@\cH\c@)\c@[\c@.\c@\cJ\c@\c_\c@€\c@2\c@\cP\c@\cT\c@\c@7\c@\cZ\c@\cJ\c@Ÿ\c@9\c@'\c@\cA\c@ƒ\c@9\c@3\c@\c@\c@^\c@5\c@:\c@\cF\c@6\c@0\c@;\c@\cQ\c@\cU\c@+\c@5\c@ \c@\cA\c@(\c@(\c@-\c@\cG\c@&\c@\cZ\c@<\c@\cW\c@#\c@\cN\c@D\c@+\c@\c^\c@\cE\c@E\c@:\c@\cV\c@\c@\c@\@\c@D\c@\cO\c@\c@\c@<\c@B\c@\cH\c@\c@\c@8\c@6\c@\cC\c@\c@\c@7\c@#\c@\c@\c@\c@\c@7\c@\cQ\c@\c@\c@\c@\c@6\c@\cC\c@\c@\c@\cC\c@4\c@\c@\c@\cC\c@\cJ\c@/\c@\c@\c@\cG\c@\cR\c@*\c@\cG\c@\cL\c@\e\c@'\c@\c^\c@\cQ\c@\$\c@'\c@D\c@\cW\c@*\c@,\c@t\c@\cZ\c@*\c@3\c@¨\c@\cZ\c@&\c@=\c@×\c@\cY\c@\c_\c@F\c@ð\c@\cV\c@\cW\c@M\c@ñ\c@\cQ\c@\cP\c@O\c@Ü\c@\cL\c@\cK\c@M\c@¼\c@\cH\c@\cK\c@E\c@\c@\cC\c@\cO\c@:\c@‡\c@\c@\c@\cX\c@,\c@}\c@\cD\c@&\c@ \c@}\c@\cN\c@7\c@\cU\c@€\c@\c\\c@K\c@\cL\c@\c?\c@,\c@^\c@\cG\c@s\c@;\c@m\c@\cD\c@_\c@D\c@t\c@\cB\c@G\c@B\c@q\c@\c@\c@3\c@6\c@e\c@\cA\c@(\c@&\c@Q\c@\cD\c@(\c@\cW\c@:\c@\cJ\c@-\c@\cJ\c@\$\c@\cN\c@0\c@\cA\c@\cV\c@\cS\c@+\c@\c@\c@\cR\c@\cV\c@#\c@\cA\c@\cZ\c@\cW\c@\cW\c@\cF\c@-\c@\cU\c@\cI\c@\cM\c@H\c@\cT\c@\c@\c@\cT\c@d\c@\cS\c@\cM\c@\cY\c@|\c@\cT\c@3\c@\c\\c@Š\c@\cX\c@l\c@\cY\c@Š\c@\c^\c@¯\c@\cS\c@}\c@&\c@õ\c@\cL\c@g\c@,\cA-\c@\cH\c@K\c@/\cAD\c@\cH\c@1\c@.\cA9\c@\cO\c@\c]\c@(\cA\cV\c@\cX\c@\cS\c@\c]\c@é\c@%\c@\cR\c@\cS\c@¿\c@1\c@\e\c@\cJ\c@\c@:\c@)\c@\cC\c@‡\c@\@\c@8\c@\c@\c@v\c@B\c@E\c@\c@\c@g\c@=\c@K\c@\c@\c@Z\c@2\c@I\c@\c@\c@Q\c@%\c@?\c@\cB\c@T\c@\cX\c@0\c@\cE\c@j\c@\cM\c@!\c@\cH\c@“\c@\cE\c@\cV\c@\cK\c@É\c@\c@\c@\cT\c@\cL\c@ý\c@\c@\c@\c\\c@\cK\cA\c]\c@\c@\c@-\c@\cH\cA\c\\c@\c@\c@C\c@\cE\c@÷\c@\c@\c@Y\c@\cB\c@¹\c@\c@\c@k\c@\c@\c@x\c@\c@\c@v\c@\c@\c@?\c@\cC\c@|\c@\c@\c@\cZ\c@\cJ\c@|\c@\c@\c@\c\\c@\cU\c@{\c@\cA\c@C\c@#\c@y\c@\cD\c@y\c@4\c@v\c@\cG\c@»\c@D\c@n\c@\cH\cA\c@\c@P\c@`\c@\cI\cA5\c@W\c@M\c@\cH\cAR\c@W\c@5\c@\cF\cAV\c@R\c@!\c@\cC\cAG\c@I\c@\cQ\c@\cA\cA,\c@=\c@\cE\c@\cE\cA\cQ\c@2\c@\cD\c@\cR\c@ù\c@*\c@\cO\c@(\c@è\c@&\c@!\c@D\c@Û\c@'\c@7\c@f\c@Î\c@-\c@P\c@„\c@½\c@6\c@d\c@–\c@¨\c@>\c@m\c@š\c@’\c@D\c@g\c@Ž\c@~\c@E\c@T\c@x\c@s\c@A\c@<\c@\\\c@t\c@:\c@%\c@E\c@€\c@1\c@\cQ\c@7\c@”\c@*\c@\cC\c@2\c@©\c@\$\c@\c@\c@5\c@µ\c@\"\c@\c@\c@?\c@³\c@ \c@\cA\c@J\c@Ÿ\c@\c^\c@\cB\c@T\c@{\c@\cY\c@\cB\c@]\c@T\c@\cS\c@\cB\c@d\c@1\c@\cL\c@\cC\c@i\c@\cU\c@\cF\c@\cB\c@n\c@\cC\c@\cB\c@\cA\c@o\c@\c@\c@\c@\c@\c@\c@n\c@\cI\c@\cB\c@\c@\c@i\c@\cW\c@\cG\c@\c@\c@_\c@#\c@\cL\c@\c@\c@S\c@&\c@\cP\c@\c@\c@H\c@&\c@\cV\c@\c@\c@\@\c@\"\c@\cX\c@\c@\c@<\c@\cW\c@\cY\c@\c@\c@>\c@\cH\c@\cX\c@\c@\c@A\c@\cJ\c@\cW\c@\cA\c@D\c@2\c@\cX\c@\cD\c@C\c@q\c@\cZ\c@\cH\c@=\c@½\c@\c]\c@\cK\c@4\cA\cK\c@ \c@\cN\c@)\cAK\c@#\c@\cM\c@\"\cAa\c@%\c@\cK\c@ \cAK\c@&\c@\cH\c@\$\cA\cW\c@'\c@\cD\c@+\c@Ù\c@*\c@\cA\c@2\c@¤\c@/\c@\c@\c@5\c@„\c@4\c@\c@\c@1\c@y\c@:\c@\c@\c@&\c@w\c@=\c@\c@\c@\cZ\c@r\c@=\c@\c@\c@\cO\c@]\c@9\c@\c@\c@\cF\c@H\c@2\c@\c@\c@\cH\c@-\c@)\c@\c@\c@\cT\c@\cS\c@\c_\c@\c@\c@\"\c@\c@\c@\cV\c@\c@\c@/\c@\cY\c@\cN\c@\c@\c@8\c@M\c@\cH\c@\c@\c@6\c@’\c@\cC\c@\c@\c@-\c@â\c@\cA\c@\cC\c@\c_\cA7\c@\c@\c@\cI\c@\cR\cAp\c@\c@\c@\cS\c@\cF\cA\c@\c@\c@!\c@\c@\cAj\c@\cF\c@5\c@\c@\cA6\c@\cP\c@J\c@\c@\c@÷\c@\c^\c@^\c@\c@\c@½\c@.\c@l\c@\c@\c@”\c@>\c@r\c@\c@\c@ƒ\c@J\c@l\c@\c@\c@‡\c@P\c@[\c@\c@\c@›\c@Q\c@B\c@\c@\c@µ\c@N\c@+\c@\c@\c@Î\c@I\c@\cV\c@\c@\c@à\c@D\c@\cG\c@\c@\c@é\c@?\c@\cD\c@\c@\c@æ\c@=\c@\cL\c@\c@\c@×\c@=\c@\cU\c@\cA\c@¿\c@=\c@\c^\c@\cC\c@Ÿ\c@?\c@'\c@\cG\c@}\c@\@\c@*\c@\cK\c@Z\c@\@\c@&\c@\cO\c@=\c@=\c@\c]\c@\cQ\c@)\c@9\c@\cT\c@\cP\c@\"\c@3\c@\cK\c@\cM\c@'\c@+\c@\cD\c@\cI\c@<\c@#\c@\c@\c@\cE\c@_\c@\e\c@\cF\c@\cA\c@\c@\cT\c@\cR\c@\c@\c@Ë\c@\cP\c@#\c@\cB\cA\cI\c@\cQ\c@6\c@\cC\cA>\c@\cW\c@M\c@\cD\cA\\\c@!\c@]\c@\cC\cAY\c@+\c@f\c@\cD\cA/\c@3\c@g\c@\cB\c@æ\c@5\c@`\c@\cA\c@›\c@2\c@U\c@\c@\c@W\c@-\c@J\c@\c@\c@\"\c@(\c@A\c@\c@\c@\cC\c@*\c@9\c@\c@\c@\c@\c@1\c@5\c@\c@\c@\cJ\c@>\c@2\c@\c@\c@ \c@L\c@0\c@\c@\c@=\c@X\c@-\c@\c@\c@_\c@]\c@'\c@\c@\c@‡\c@]\c@\c_\c@\c@\c@¦\c@U\c@\cV\c@\c@\c@¶\c@J\c@\cN\c@\cD\c@º\c@>\c@\cH\c@\cJ\c@°\c@2\c@\cF\c@\cS\c@›\c@)\c@\cH\c@\c\\c@|\c@\"\c@\cN\c@&\c@X\c@\c^\c@\cW\c@,\c@9\c@\c]\c@\"\c@.\c@\c_\c@\c]\c@,\c@*\c@\cT\c@ \c@5\c@\$\c@'\c@\$\c@;\c@\e\c@X\c@*\c@>\c@\cR\c@–\c@/\c@;\c@\cJ\c@Ú\c@4\c@6\c@\cE\cA\cX\c@6\c@,\c@\cA\cA<\c@5\c@\c_\c@\cB\cA\@\c@2\c@\cT\c@\cH\cA&\c@-\c@\cK\c@\cR\c@÷\c@&\c@\cD\c@\c]\c@¿\c@\"\c@\c@\c@+\c@Œ\c@\c]\c@\c@\c@8\c@h\c@\cY\c@\c@\c@C\c@Z\c@\cV\c@\c@\c@I\c@d\c@\cS\c@\c@\c@J\c@ƒ\c@\cQ\c@\c@\c@G\c@±\c@\cO\c@\c@\c@C\c@å\c@\cL\c@\c@\c@=\cA\cR\c@\cH\c@\cB\c@7\cA0\c@\cE\c@\cH\c@2\cA8\c@\cC\c@\cP\c@,\cA%\c@\cA\c@\cZ\c@#\c@÷\c@\c@\c@'\c@\cY\c@·\c@\c@\c@3\c@\cQ\c@z\c@\c@\c@;\c@\cH\c@D\c@\c@\c@>\c@\cB\c@!\c@\c@\c@<\c@\cA\c@ \c@\c@\c@3\c@\cG\c@=\c@\c@\c@&\c@\cP\c@b\c@\cB\c@\cY\c@\cZ\c@\c@\cJ\c@\cN\c@%\c@’\c@\cV\c@\cE\c@0\c@†\c@%\c@\c@\c@6\c@i\c@8\c@\c@\c@7\c@D\c@K\c@\cA\c@3\c@!\c@[\c@\cC\c@-\c@\cG\c@f\c@\cE\c@&\c@\cH\c@n\c@\cG\c@!\c@#\c@t\c@\cH\c@\e\c@J\c@y\c@\cG\c@\cX\c@t\c@~\c@\cE\c@\cW\c@œ\c@„\c@\cC\c@\cX\c@¹\c@Š\c@\cA\c@\cY\c@¿\c@Ž\c@\c@\c@\c\\c@²\c@\c@\c@\c@\"\c@Ÿ\c@\c@\c@\c@)\c@‘\c@‡\c@\c@\c@0\c@\c@{\c@\c@\c@6\c@\c@l\c@\c@\c@<\c@Œ\c@Z\c@\c@\c@?\c@€\c@G\c@\c@\c@?\c@d\c@7\c@\c@\c@>\c@G\c@-\c@\c@\c@9\c@)\c@'\c@\cE\c@1\c@\cP\c@&\c@\cL\c@*\c@\c@\c@(\c@\cV\c@\$\c@\c@\c@*\c@\c_\c@\c^\c@\cO\c@*\c@&\c@\c]\c@F\c@(\c@&\c@!\c@\c@\"\c@ \c@&\cA\cB\c@\e\c@\cW\c@.\cAd\c@\cS\c@\cN\c@8\cA¨\c@\cM\c@\cF\c@A\cA«\c@\cI\c@\cE\c@K\cAk\c@\cK\c@\cI\c@S\cA\cH\c@\cO\c@\cO\c@W\c@¢\c@\cT\c@\cT\c@W\c@L\c@\cZ\c@\cX\c@T\c@\cS\c@\c^\c@\cV\c@M\c@\c@\c@\c^\c@\cQ\c@D\c@\c@\c@\c]\c@\cK\c@;\c@\c@\c@\c\\c@\cE\c@3\c@\c@\c@\cW\c@\cA\c@,\c@\cA\c@\cS\c@\cB\c@&\c@\cA\c@\cN\c@\cF\c@!\c@\cA\c@\cI\c@\cK\c@\c]\c@\cA\c@\cE\c@\cP\c@\e\c@\cB\c@\cB\c@\cV\c@\cZ\c@\cC\c@\c@\c@\cY\c@\cZ\c@\cH\c@\c@\c@\cX\c@\cZ\c@\cO\c@\c@\c@\cU\c@\c^\c@\cZ\c@\c@\c@\cP\c@\$\c@%\c@\c@\c@\cL\c@,\c@0\c@\c@\c@\cI\c@:\c@7\c@\c@\c@\cJ\c@I\c@=\c@\c@\c@\cN\c@X\c@C\c@\c@\c@\cT\c@d\c@P\c@\c@\c@\cY\c@m\c@e\c@\c@\c@\c]\c@o\c@„\c@\c@\c@\c]\c@k\c@ª\c@\c@\c@\e\c@d\c@Ê\c@\c@\c@\cZ\c@[\c@Ü\c@\c@\c@\c]\c@S\c@Ö\c@\c@\c@%\c@L\c@·\c@\cA\c@6\c@J\c@‡\c@\cH\c@L\c@I\c@X\c@\cU\c@c\c@G\c@-\c@%\c@w\c@D\c@\cN\c@8\c@‚\c@?\c@\cI\c@I\c@€\c@5\c@\e\c@R\c@p\c@(\c@2\c@O\c@T\c@\e\c@L\c@B\c@9\c@\cQ\c@h\c@/\c@ \c@\cH\c@}\c@\c]\c@\cM\c@\cB\c@Œ\c@\cM\c@\cB\c@\c@\c@š\c@\cC\c@\c@\c@\c@\c@¬\c@\cD\c@\cD\c@\c@\c@Å\c@\cK\c@\cN\c@\c@\c@á\c@\cR\c@\e\c@\c@\c@ø\c@\cY\c@'\c@\c@\cA\cA\c@\c^\c@1\c@\c@\c@ô\c@\c]\c@4\c@\c@\c@Ð\c@\cW\c@+\c@\cC\c@›\c@\cP\c@ \c@\cG\c@f\c@\cH\c@\cS\c@\cM\c@9\c@\cC\c@\cG\c@\cT\c@\c\\c@\cD\c@\c@\c@\e\c@\c]\c@\cN\c@\cC\c@\c]\c@;\c@\c\\c@\cN\c@\e\c@d\c@,\c@\c^\c@\cU\c@Š\c@?\c@.\c@\cO\c@¤\c@O\c@>\c@\cH\c@¢\c@X\c@H\c@\cB\c@„\c@Z\c@G\c@\c@\c@^\c@U\c@;\c@\cE\c@5\c@K\c@*\c@\cN\c@\cT\c@\@\c@\cZ\c@\cY\c@\cA\c@5\c@\cM\c@\"\c@\c@\c@-\c@\cD\c@*\c@\cA\c@+\c@\cG\c@,\c@\cH\c@+\c@\cT\c@%\c@\cR\c@0\c@\$\c@\e\c@\c]\c@7\c@6\c@\cP\c@(\c@>\c@I\c@\cI\c@1\c@B\c@U\c@\cH\c@0\c@C\c@V\c@\cL\c@&\c@\@\c@M\c@\cP\c@\c\\c@:\c@;\c@\cU\c@\cP\c@4\c@(\c@\cX\c@\cF\c@2\c@\cW\c@\cV\c@\c@\c@1\c@\cJ\c@\cR\c@\cD\c@1\c@\cB\c@\cM\c@\cR\c@0\c@\c@\c@\cH\c@\$\c@+\c@\c@\c@\cC\c@9\c@ \c@\c@\c@\cA\c@P\c@\cV\c@\c@\c@\c@\c@f\c@\cL\c@\c@\c@\cC\c@y\c@\cD\c@\cB\c@\cG\c@‹\c@\cB\c@\cL\c@\cL\c@¡\c@\cJ\c@\c]\c@\cO\c@¹\c@\cT\c@5\c@\cS\c@Ï\c@\c_\c@S\c@\cT\c@Ù\c@(\c@s\c@\cU\c@Ð\c@.\c@Ž\c@\cX\c@°\c@+\c@ž\c@ \c@\c@!\c@¢\c@-\c@T\c@\cW\c@™\c@;\c@*\c@\cL\c@†\c@I\c@\cM\c@\cD\c@p\c@Q\c@\c@\c@\cB\c@\\\c@P\c@\cF\c@\cG\c@P\c@F\c@\cY\c@\cM\c@L\c@5\c@5\c@\cS\c@R\c@\$\c@R\c@\cX\c@^\c@\cT\c@m\c@\cY\c@l\c@\cI\c@}\c@\cU\c@x\c@\cA\c@z\c@\cO\c@\c?\c@\c@\c@g\c@\cI\c@‚\c@\c@\c@O\c@\cC\c@\c@\c@\c@=\c@\c@\c@\c?\c@\c@\c@9\c@\c@\c@|\c@\c@\c@C\c@\c@\c@}\c@\c@\c@R\c@\cC\c@\c@\c@\c@]\c@\cF\c@‰\c@\c@\c@[\c@\cH\c@‘\c@\c@\c@J\c@\cJ\c@™\c@\c@\c@5\c@\cJ\c@›\c@\c@\c@\c_\c@\cH\c@–\c@\c@\c@\cL\c@\cF\c@Š\c@\c@\c@\c@\c@\cC\c@z\c@\c@\c@\c@\c@\c@\c@i\c@\cD\c@\c@\c@\c@\c@Z\c@\cK\c@\c@\c@\cB\c@R\c@\cR\c@\c@\c@\cH\c@P\c@\cZ\c@\c@\c@\cM\c@R\c@!\c@\c@\c@\cR\c@W\c@#\c@\c@\c@\cU\c@[\c@ \c@\c@\c@\cT\c@]\c@\cY\c@\c@\c@\cO\c@Y\c@\cQ\c@\c@\c@\cJ\c@R\c@\cJ\c@\c@\c@\cE\c@H\c@\cD\c@\c@\c@\cA\c@<\c@\cA\c@\c@\c@\c@\c@2\c@\c@\c@\cK\c@\c@\c@,\c@\c@\c@*\c@\c@\c@,\c@\c@\c@Z\c@\c@\c@2\c@\c@\c@–\c@\c@\c@>\c@\c@\c@Ü\c@\c@\c@O\c@\cB\cA\c_\c@\cA\c@`\c@\cC\cAN\c@\cE\c@p\c@\cD\cAc\c@\cJ\c@|\c@\cC\cAY\c@\cP\c@ƒ\c@\cD\cA2\c@\cU\c@ƒ\c@\cB\c@ö\c@\cY\c@~\c@\cA\c@­\c@\e\c@t\c@\cD\c@n\c@\cX\c@f\c@\cN\c@9\c@\cT\c@U\c@\c^\c@\cU\c@\cO\c@D\c@1\c@\cA\c@\cL\c@6\c@I\c@\c@\c@\cI\c@,\c@]\c@\c@\c@\cK\c@'\c@j\c@\cE\c@\cP\c@)\c@l\c@\cQ\c@\cX\c@0\c@c\c@\"\c@\"\c@9\c@N\c@7\c@+\c@C\c@7\c@M\c@1\c@J\c@\"\c@\\\c@2\c@M\c@\cP\c@^\c@.\c@K\c@\cD\c@S\c@%\c@E\c@\cA\c@?\c@\cZ\c@9\c@\cE\c@*\c@\cP\c@*\c@\cJ\c@\cX\c@\cG\c@\c\\c@\cP\c@\cU\c@\cD\c@\cP\c@\cU\c@!\c@\cG\c@\cG\c@\cW\c@5\c@\cM\c@\cA\c@\cS\c@C\c@\cT\c@\cD\c@\cO\c@F\c@\c\\c@\cK\c@\cI\c@>\c@ \c@\cS\c@\cC\c@/\c@ \c@\cY\c@\cC\c@\cZ\c@\c]\c@\c^\c@\cI\c@\cL\c@\cU\c@\c]\c@\cP\c@!\c@\cN\c@\cW\c@\cU\c@N\c@\cH\c@\cO\c@\cY\c@…\c@\cB\c@\cH\c@\cX\c@À\c@\c@\c@\cB\c@\cS\c@ù\c@\c@\c@\cA\c@\cM\cA\cV\c@\c@\c@\cG\c@\cF\cA\cT\c@\c@\c@\cN\c@\cB\c@ô\c@\c@\c@\cX\c@\cC\c@Ã\c@\c@\c@#\c@\cG\c@\c@\cB\c@.\c@\cK\c@`\c@\cI\c@7\c@\cN\c@E\c@\cR\c@=\c@\cO\c@B\c@\c\\c@\@\c@\cM\c@Q\c@\$\c@\@\c@\cI\c@m\c@&\c@=\c@\cE\c@Š\c@!\c@5\c@\cA\c@¡\c@\cY\c@(\c@\c@\c@­\c@\cO\c@\c\\c@\c@\c@¯\c@\cF\c@\cQ\c@\c@\c@­\c@\c@\c@\cG\c@\c@\c@§\c@\cF\c@\cA\c@\c@\c@¡\c@\cO\c@\cC\c@\cA\c@›\c@\e\c@\cL\c@\cA\c@–\c@*\c@\cW\c@\cC\c@\c@;\c@!\c@\cG\c@‚\c@G\c@*\c@\cL\c@r\c@O\c@.\c@\cR\c@_\c@Q\c@(\c@\e\c@L\c@M\c@\c^\c@#\c@\@\c@E\c@\cS\c@,\c@>\c@8\c@\cI\c@5\c@M\c@)\c@\cB\c@=\c@m\c@\cZ\c@\c@\c@E\c@Ÿ\c@\cO\c@\c@\c@M\c@Ü\c@\cG\c@\c@\c@R\cA\e\c@\cA\c@\c@\c@U\cAO\c@\c@\c@\cA\c@U\cAk\c@\c@\c@\cF\c@R\cAe\c@\c@\c@\cN\c@N\cA:\c@\c@\c@\cY\c@I\c@ð\c@\c@\c@%\c@F\c@¤\c@\c@\c@3\c@F\c@_\c@\cB\c@?\c@J\c@'\c@\cI\c@I\c@P\c@\cF\c@\cQ\c@O\c@X\c@\cA\c@\e\c@T\c@\\\c@\cN\c@#\c@S\c@]\c@ \c@(\c@M\c@\\\c@3\c@(\c@\@\c@Z\c@E\c@\$\c@.\c@X\c@S\c@\c]\c@\c^\c@Y\c@R\c@\cW\c@\cP\c@_\c@F\c@\cS\c@\cE\c@e\c@4\c@\cT\c@\c@\c@j\c@#\c@\cY\c@\c@\c@n\c@\cY\c@\c_\c@\c@\c@m\c@\cY\c@'\c@\c@\c@f\c@!\c@,\c@\c@\c@\\\c@/\c@.\c@\c@\c@O\c@\@\c@/\c@\c@\c@A\c@R\c@.\c@\c@\c@5\c@d\c@0\c@\c@\c@,\c@y\c@5\c@\c@\c@&\c@’\c@<\c@\cC\c@!\c@®\c@E\c@\cK\c@\cZ\c@È\c@K\c@\cU\c@\cS\c@Ü\c@L\c@ \c@\cM\c@à\c@F\c@,\c@\cF\c@Ï\c@;\c@5\c@\cE\c@¨\c@-\c@8\c@\cK\c@y\c@ \c@6\c@\cV\c@L\c@\cX\c@2\c@#\c@%\c@\cV\c@/\c@/\c@\cS\c@\cZ\c@/\c@4\c@,\c@#\c@4\c@3\c@e\c@.\c@?\c@(\c@«\c@9\c@M\c@\c\\c@ö\c@\@\c@]\c@\cP\cA4\c@B\c@m\c@\cF\cAI\c@?\c@z\c@\c@\cA3\c@8\c@\c@\c@\c@÷\c@/\c@\c@\cD\c@«\c@'\c@{\c@\cL\c@e\c@ \c@n\c@\cW\c@/\c@\c\\c@]\c@\"\c@\cL\c@\cZ\c@J\c@+\c@\c@\c@\cY\c@6\c@/\c@\c@\c@\cV\c@#\c@*\c@\cA\c@\cS\c@\cU\c@\"\c@\cO\c@\cP\c@\cJ\c@\cX\c@)\c@\cL\c@\cC\c@\cQ\c@L\c@\cG\c@\c@\c@\cS\c@w\c@\cD\c@\c@\c@\cZ\c@¥\c@\cB\c@\c@\c@%\c@Ä\c@\c@\c@\cC\c@/\c@Í\c@\c@\c@\cJ\c@7\c@¾\c@\c@\c@\cU\c@:\c@\c@\c@\c@#\c@9\c@q\c@\c@\c@4\c@5\c@H\c@\c@\c@B\c@/\c@)\c@\c@\c@J\c@*\c@\cX\c@\cE\c@M\c@\"\c@\cR\c@\cK\c@K\c@\cY\c@\cS\c@\cR\c@E\c@\cQ\c@\cR\c@\cW\c@?\c@\cJ\c@\cP\c@\cZ\c@;\c@\cC\c@\cK\c@\cW\c@6\c@\c@\c@\cF\c@\cR\c@0\c@\cA\c@\cA\c@\cK\c@(\c@\cK\c@\c@\c@\cE\c@\c]\c@\c\\c@\cH\c@\c@\c@\cS\c@2\c@\c_\c@\c@\c@\cJ\c@J\c@E\c@\c@\c@\cC\c@c\c@y\c@\cC\c@\cC\c@q\c@µ\c@\cG\c@\cK\c@r\c@ì\c@\cL\c@\cW\c@h\cA\cK\c@\cQ\c@)\c@V\cA\cL\c@\cV\c@=\c@C\c@é\c@\cW\c@N\c@3\c@­\c@\cW\c@Z\c@*\c@r\c@\cW\c@^\c@)\c@=\c@\cY\c@Y\c@.\c@\cU\c@\c]\c@P\c@2\c@\c@\c@#\c@D\c@5\c@\cB\c@(\c@9\c@5\c@\cV\c@*\c@0\c@3\c@6\c@'\c@'\c@/\c@]\c@\c_\c@\c^\c@.\c@ƒ\c@\cV\c@\cU\c@1\c@¥\c@\cM\c@\cN\c@5\c@®\c@\cG\c@\cG\c@:\c@Ÿ\c@\cI\c@\cB\c@<\c@€\c@\cT\c@\c@\c@9\c@]\c@#\c@\cB\c@/\c@B\c@4\c@\cG\c@\"\c@9\c@D\c@\cP\c@\cV\c@D\c@L\c@\cY\c@\cJ\c@a\c@L\c@\"\c@\cB\c@‰\c@C\c@(\c@\c@\c@¶\c@5\c@'\c@\cG\c@à\c@%\c@ \c@\cT\cA\c@\c@\cW\c@\cW\c@\$\cA\cP\c@\cM\c@\cM\c@6\cA\cL\c@\cJ\c@\cG\c@H\c@ò\c@\cN\c@\cE\c@R\c@Ã\c@\cX\c@\cH\c@U\c@‰\c@\$\c@\cL\c@Q\c@V\c@1\c@\cN\c@I\c@+\c@9\c@\cN\c@\@\c@\cM\c@:\c@\cL\c@8\c@\c@\c@2\c@\cH\c@3\c@\c@\c@&\c@\cC\c@2\c@\c@\c@\cX\c@\cA\c@4\c@\c@\c@\cL\c@\c@\c@<\c@\c@\c@\cC\c@\c@\c@F\c@\cF\c@\c@\c@\cF\c@Q\c@\cO\c@\c@\c@\cQ\c@Z\c@\cZ\c@\c@\c@\c]\c@b\c@#\c@\c@\c@'\c@i\c@*\c@\cC\c@.\c@k\c@+\c@\cI\c@+\c@m\c@*\c@\cR\c@#\c@o\c@+\c@\c\\c@\cW\c@o\c@2\c@)\c@\cL\c@m\c@B\c@2\c@\cC\c@i\c@Z\c@8\c@\cA\c@b\c@v\c@9\c@\cG\c@X\c@\c@8\c@\cQ\c@L\c@¡\c@5\c@\e\c@>\c@£\c@2\c@\$\c@/\c@”\c@/\c@*\c@!\c@w\c@,\c@)\c@\cW\c@T\c@,\c@\"\c@\cQ\c@4\c@,\c@\cY\c@\cQ\c@\cY\c@/\c@\cQ\c@\cT\c@\cG\c@4\c@\cO\c@\e\c@\c@\c@>\c@\cR\c@\c^\c@\c@\c@J\c@\cX\c@\c^\c@\c@\c@Y\c@\c^\c@\cZ\c@\cM\c@h\c@ \c@\cS\c@*\c@v\c@\e\c@\cL\c@T\c@€\c@\cU\c@\cE\c@„\c@„\c@\cM\c@\cA\c@·\c@‚\c@\cE\c@\c@\c@Û\c@z\c@\c@\c@\c@\c@æ\c@o\c@\c@\c@\c@\c@Ù\c@c\c@\cB\c@\c@\c@»\c@Y\c@\cH\c@\c@\c@—\c@S\c@\cP\c@\c@\c@x\c@S\c@\cX\c@\c@\c@b\c@V\c@\c_\c@\c@\c@Z\c@Z\c@\"\c@\c@\c@Y\c@[\c@ \c@\c@\c@[\c@W\c@\cY\c@\c@\c@\\\c@L\c@\cQ\c@\c@\c@^\c@:\c@\cJ\c@\c@\c@d\c@(\c@\cD\c@\c@\c@r\c@\cW\c@\cA\c@\c@\c@\c@\cJ\c@\cD\c@\c@\c@²\c@\cB\c@\cM\c@\c@\c@Ù\c@\c@\c@\c\\c@\c@\c@÷\c@\c@\c@2\c@\c@\cA\cE\c@\cC\c@N\c@\c@\cA\cA\c@\cH\c@j\c@\c@\c@ð\c@\cM\c@\c@\c@\c@Ü\c@\cS\c@Ž\c@\cA\c@Ð\c@\cW\c@\c@\cB\c@Ô\c@\cX\c@~\c@\cD\c@ê\c@\cU\c@e\c@\cD\cA\cK\c@\cQ\c@G\c@\cD\cA,\c@\cN\c@,\c@\cD\cA>\c@\cN\c@\cV\c@\cB\cA:\c@\cR\c@\cH\c@\cA\cA\c]\c@\cZ\c@\cE\c@\c@\c@ó\c@\$\c@\cL\c@\c@\c@Í\c@.\c@\cU\c@\c@\c@º\c@6\c@\c]\c@\cA\c@Å\c@=\c@%\c@\cE\c@ð\c@\@\c@&\c@\cJ\cA.\c@?\c@!\c@\cO\cAi\c@;\c@\cX\c@\cT\cA\c@4\c@\cP\c@\cW\cA\c@,\c@\cH\c@\cW\cAg\c@\"\c@\cG\c@\cU\cA\c]\c@\cZ\c@\cM\c@\cQ\c@Å\c@\cT\c@\cY\c@\cM\c@w\c@\cR\c@*\c@\cI\c@:\c@\cS\c@<\c@\cF\c@\cR\c@\cY\c@N\c@\cC\c@\cG\c@\c_\c@\\\c@\cB\c@\cX\c@&\c@d\c@\cA\c@,\c@*\c@e\c@\c@\c@>\c@*\c@b\c@\c@\c@J\c@\$\c@Z\c@\c@\c@L\c@\c\\c@S\c@\c@\c@>\c@\cR\c@M\c@\c@\c@+\c@\cJ\c@K\c@\cA\c@\cW\c@\cD\c@J\c@\cJ\c@\cI\c@\c@\c@I\c@\cV\c@\cO\c@\c@\c@F\c@'\c@)\c@\c@\c@?\c@8\c@O\c@\c@\c@5\c@G\c@€\c@\cA\c@)\c@L\c@´\c@\cC\c@\c]\c@G\c@ß\c@\cD\c@\cT\c@7\c@÷\c@\cF\c@\cO\c@'\c@÷\c@\cG\c@\cN\c@\cV\c@â\c@\cG\c@\cR\c@\cI\c@»\c@\cG\c@\cY\c@\cA\c@‹\c@\cG\c@\"\c@\c@\c@\\\c@\cI\c@+\c@\c@\c@7\c@\cM\c@5\c@\c@\c@!\c@\cU\c@\@\c@\c@\c@\c]\c@\c^\c@K\c@\c@\c@&\c@*\c@T\c@\cA\c@6\c@5\c@\\\c@\cD\c@E\c@>\c@]\c@\cH\c@M\c@D\c@Y\c@\cN\c@L\c@G\c@O\c@\cS\c@I\c@H\c@\@\c@\cV\c@J\c@J\c@/\c@\cU\c@V\c@P\c@\c_\c@\cQ\c@q\c@Y\c@\cT\c@\cL\c@’\c@f\c@\cQ\c@\cF\c@­\c@q\c@\cY\c@\cA\c@·\c@w\c@-\c@\c@\c@¨\c@w\c@J\c@\c@\c@ƒ\c@o\c@k\c@\c@\c@Z\c@_\c@‰\c@\cE\c@1\c@M\c@\c@\cM\c@\cQ\c@9\c@£\c@\cX\c@\c@\c@'\c@š\c@#\c@\c@\c@\cY\c@‰\c@-\c@\c@\c@\cP\c@s\c@2\c@\c@\c@\cM\c@`\c@0\c@\c@\c@\cM\c@T\c@'\c@\cK\c@\cO\c@P\c@\c\\c@\$\c@\cN\c@Q\c@\cR\c@E\c@\cL\c@X\c@\cM\c@e\c@\cI\c@`\c@\cP\c@‚\c@\cE\c@i\c@\cZ\c@Ž\c@\cA\c@s\c@*\c@‚\c@\c@\c@\c?\c@:\c@e\c@\cC\c@Œ\c@D\c@C\c@\cL\c@˜\c@D\c@'\c@\cX\c@¡\c@:\c@\c_\c@&\c@£\c@+\c@,\c@3\c@\c@\e\c@N\c@<\c@\c@\cL\c@y\c@<\c@{\c@\cB\c@¥\c@5\c@e\c@\c@\c@Å\c@)\c@N\c@\cA\c@Ï\c@\c\\c@;\c@\cG\c@Â\c@\cQ\c@.\c@\cN\c@ \c@\cJ\c@&\c@\cV\c@s\c@\cJ\c@%\c@\c]\c@H\c@\cN\c@)\c@#\c@)\c@\cU\c@2\c@!\c@ \c@ \c@=\c@\c\\c@,\c@,\c@J\c@\cT\c@H\c@5\c@V\c@\cM\c@i\c@=\c@`\c@\cF\c@…\c@B\c@d\c@\cA\c@–\c@E\c@c\c@\c@\c@˜\c@F\c@Z\c@\c@\c@\c@H\c@M\c@\c@\c@‚\c@K\c@=\c@\c@\c@y\c@Q\c@.\c@\c@\c@{\c@Y\c@#\c@\c@\c@†\c@`\c@\e\c@\c@\c@š\c@f\c@\cW\c@\c@\c@ª\c@g\c@\cU\c@\c@\c@¯\c@`\c@\cT\c@\c@\c@ \c@S\c@\cU\c@\c@\c@\c?\c@\@\c@\cZ\c@\c@\c@Y\c@+\c@%\c@\c@\c@5\c@\cY\c@5\c@\c@\c@\cV\c@\cK\c@G\c@\c@\c@\cC\c@\cB\c@Z\c@\c@\c@\cB\c@\c@\c@i\c@\cD\c@\cL\c@\cB\c@r\c@\cJ\c@\cW\c@\cG\c@u\c@\cQ\c@\c]\c@\cN\c@q\c@\cV\c@#\c@\cU\c@g\c@\cY\c@*\c@\e\c@Y\c@\cV\c@4\c@\c^\c@J\c@\cQ\c@H\c@\c^\c@<\c@\cJ\c@n\c@\cZ\c@0\c@\cD\c@¡\c@\cU\c@*\c@\c@\c@Õ\c@\cP\c@+\c@\c@\c@ù\c@\cN\c@2\c@\c@\cA\cA\c@\cK\c@=\c@\c@\c@ì\c@\cJ\c@L\c@\c@\c@Â\c@\cH\c@Z\c@\cD\c@•\c@\cF\c@c\c@\cJ\c@v\c@\cC\c@d\c@\cR\c@o\c@\cB\c@[\c@\c]\c@}\c@\c@\c@J\c@)\c@’\c@\c@\c@4\c@2\c@ \c@\c@\c@ \c@7\c@œ\c@\c@\c@\cO\c@8\c@‚\c@\c@\c@\cF\c@5\c@]\c@\c@\c@\cI\c@1\c@9\c@\c@\c@\cT\c@/\c@\cY\c@\c@\c@!\c@0\c@\cF\c@\c@\c@.\c@4\c@\c@\c@\c@\c@9\c@:\c@\cC\c@\c@\c@>\c@>\c@\cI\c@\c@\c@;\c@\@\c@\cO\c@\c@\c@3\c@?\c@\cQ\c@\c@\c@)\c@;\c@\cR\c@\c@\c@\"\c@7\c@\cQ\c@\c@\c@!\c@5\c@\cK\c@\c@\c@(\c@5\c@\cE\c@\cB\c@7\c@6\c@\cA\c@\cI\c@I\c@8\c@\c@\c@\cS\c@Z\c@9\c@\c@\c@\c_\c@b\c@8\c@\c@\c@,\c@`\c@6\c@\c@\c@5\c@Q\c@2\c@\cH\c@8\c@;\c@-\c@\cX\c@6\c@&\c@\$\c@.\c@0\c@\cS\c@\cZ\c@H\c@(\c@\cF\c@\cR\c@g\c@\$\c@\c@\c@\cJ\c@„\c@%\c@\c@\c@\cD\c@\c@)\c@\c@\c@\c@\c@³\c@1\c@\cF\c@\c@\c@Ë\c@:\c@\cM\c@\cD\c@ä\c@A\c@\cU\c@\cI\cA\cA\c@F\c@\c\\c@\cO\cA\c]\c@J\c@!\c@\cR\cA7\c@N\c@\"\c@\cS\cAH\c@Q\c@\c_\c@\cP\cAK\c@T\c@\cY\c@\cL\cA=\c@U\c@\cT\c@\cF\cA\e\c@T\c@\cO\c@\cA\c@é\c@Q\c@\cJ\c@\c@\c@«\c@O\c@\cG\c@\cA\c@p\c@O\c@\cD\c@\cE\c@\@\c@Q\c@\cB\c@\cK\c@\c\\c@W\c@\c@\c@\cS\c@\cG\c@]\c@\c@\c@\e\c@\cM\c@b\c@\cB\c@\"\c@!\c@b\c@\cF\c@'\c@;\c@[\c@\cI\c@(\c@W\c@O\c@\cM\c@'\c@r\c@?\c@\cQ\c@%\c@†\c@/\c@\cS\c@\$\c@’\c@'\c@\cT\c@#\c@ž\c@&\c@\cT\c@#\c@³\c@.\c@\cS\c@#\c@Ù\c@;\c@\cQ\c@!\cA\cM\c@I\c@\cM\c@\c]\cAL\c@U\c@\cI\c@\cW\cA…\c@[\c@\cF\c@\cR\cA¨\c@Z\c@\cB\c@\cL\cA§\c@S\c@\c@\c@\cF\cA|\c@I\c@\cA\c@\cC\cA-\c@<\c@\cD\c@\cA\c@Ñ\c@0\c@\cI\c@\c@\c@~\c@&\c@\cM\c@\c@\c@;\c@ \c@\cO\c@\c@\c@\cP\c@\c_\c@\cO\c@\c@\c@\c@\c@\"\c@\cL\c@\c@\c@\c@\c@+\c@\cH\c@\c@\c@\c@\c@7\c@\cD\c@\c@\c@\c@\c@D\c@\cA\c@\c@\c@\c@\c@Q\c@\cD\c@\c@\c@\c@\c@Y\c@\cH\c@\c@\c@\cL\c@^\c@\cK\c@\c@\c@)\c@\\\c@\cM\c@\c@\c@U\c@U\c@\cL\c@\c@\c@Œ\c@I\c@\cJ\c@\c@\c@Ç\c@:\c@\cF\c@\c@\c@ó\c@+\c@\cB\c@\c@\cA\c@\c@\c]\c@\c@\c@\c@\c@æ\c@\cT\c@\cA\c@\c@\c@¯\c@\cP\c@\cG\c@\c@\c@x\c@\cT\c@\cS\c@\cC\c@A\c@\e\c@&\c@\cF\c@\cW\c@\$\c@?\c@\cH\c@ \c@*\c@]\c@\cJ\c@U\c@+\c@y\c@\cJ\c@–\c@&\c@\c@\cH\c@Ö\c@\c\\c@š\c@\cF\cA\cR\c@\cR\c@š\c@\cC\cA'\c@\cH\c@\c@\c@\cA\cQ\c@\cB\c@\c@\c@\c@Ø\c@\c@\c@p\c@\cB\c@“\c@\c@\c@f\c@\cC\c@V\c@\c@\c@e\c@\cC\c@'\c@\c@\c@m\c@\cC\c@\cI\c@\c@\c@}\c@\cC\c@\c@\c@\c@\c@‘\c@\cB\c@\c@\c@\c@\c@£\c@\cB\c@\c@\c@\c@\c@­\c@\cH\c@\c@\c@\c@\c@®\c@\cQ\c@\c@\c@\c@\c@¥\c@\c\\c@\cC\c@\c@\c@•\c@(\c@\cT\c@\c@\c@\c@2\c@/\c@\cB\c@l\c@5\c@R\c@\cH\c@Y\c@3\c@y\c@\cR\c@J\c@+\c@ \c@ \c@>\c@ \c@º\c@4\c@7\c@\cU\c@Ç\c@H\c@2\c@\cL\c@Ç\c@[\c@2\c@\cE\c@Â\c@j\c@1\c@\cA\c@¼\c@s\c@0\c@\cA\c@»\c@u\c@-\c@\cH\c@¾\c@r\c@(\c@\cS\c@Ä\c@m\c@!\c@\c_\c@Ë\c@d\c@\e\c@+\c@Ñ\c@[\c@\cY\c@7\c@Ð\c@Q\c@\c\\c@=\c@Ì\c@E\c@#\c@>\c@Â\c@7\c@.\c@<\c@¶\c@'\c@:\c@9\c@§\c@\cY\c@C\c@6\c@–\c@\cN\c@I\c@5\c@ƒ\c@\cG\c@K\c@3\c@o\c@\cG\c@J\c@/\c@Y\c@\cR\c@H\c@*\c@F\c@\c^\c@H\c@\"\c@6\c@*\c@L\c@\cX\c@+\c@2\c@Q\c@\cO\c@%\c@1\c@X\c@\cJ\c@\"\c@'\c@^\c@\cH\c@\c^\c@\c\\c@b\c@\cK\c@\cY\c@\cN\c@a\c@\cP\c@\cS\c@\cD\c@\\\c@\cU\c@\cM\c@\c@\c@T\c@\cW\c@\cF\c@\cC\c@J\c@\cW\c@\cA\c@\cL\c@A\c@\cU\c@\c@\c@\cX\c@:\c@\cS\c@\c@\c@%\c@6\c@\cR\c@\c@\c@2\c@2\c@\cS\c@\cC\c@<\c@+\c@\cT\c@\cL\c@<\c@!\c@\cU\c@\cX\c@5\c@\cX\c@\cW\c@\$\c@)\c@\cN\c@\cY\c@.\c@\e\c@\cE\c@\e\c@3\c@\cP\c@\c@\c@\c_\c@2\c@\cG\c@\cD\c@&\c@-\c@\cD\c@\cP\c@,\c@'\c@\cG\c@\"\c@0\c@#\c@\cR\c@9\c@1\c@\$\c@\c_\c@T\c@-\c@(\c@2\c@k\c@\"\c@0\c@E\c@y\c@\cX\c@;\c@W\c@z\c@\cN\c@H\c@b\c@p\c@\cE\c@S\c@f\c@]\c@\c@\c@X\c@a\c@F\c@\c@\c@R\c@U\c@1\c@\c@\c@B\c@C\c@\"\c@\cA\c@0\c@2\c@\cZ\c@\cE\c@\c\\c@%\c@\cY\c@\cK\c@\cK\c@\c_\c@\c\\c@\cP\c@\cA\c@\c_\c@\c_\c@\cS\c@\c@\c@\$\c@ \c@\cS\c@\c@\c@+\c@\c]\c@\cP\c@\cP\c@1\c@\cW\c@\cK\c@3\c@5\c@\cQ\c@\cE\c@d\c@8\c@\cL\c@\cA\c@ž\c@:\c@\cL\c@\c@\c@Û\c@=\c@\cP\c@\c@\cA\cB\c@\@\c@\cY\c@\c@\cA\cE\c@C\c@\$\c@\c@\c@á\c@E\c@/\c@\cA\c@§\c@F\c@6\c@\cE\c@m\c@E\c@7\c@\cJ\c@7\c@D\c@0\c@\cP\c@\cP\c@D\c@%\c@\cU\c@\e\c@E\c@\cY\c@\cV\c@I\c@H\c@\cO\c@\cS\c@\c?\c@L\c@\cL\c@\cN\c@°\c@O\c@\cU\c@\cI\c@Ù\c@P\c@%\c@\cC\c@Û\c@M\c@6\c@\c@\c@¶\c@F\c@E\c@\cC\c@ƒ\c@<\c@K\c@\cJ\c@M\c@2\c@F\c@\cP\c@\c_\c@)\c@8\c@\cU\c@\cC\c@#\c@(\c@\cX\c@\cB\c@!\c@\c\\c@\cV\c@\cQ\c@%\c@\cW\c@\cQ\c@'\c@-\c@\c]\c@\cJ\c@B\c@:\c@*\c@\cD\c@^\c@G\c@:\c@\c@\c@w\c@S\c@H\c@\c@\c@\c?\c@\\\c@O\c@\c@\c@u\c@`\c@N\c@\c@\c@`\c@_\c@F\c@\c@\c@D\c@Z\c@:\c@\c@\c@+\c@S\c@/\c@\c@\c@\e\c@I\c@&\c@\cB\c@\cU\c@A\c@\"\c@\cE\c@\c\\c@;\c@\"\c@\cH\c@,\c@6\c@ \c@\cK\c@E\c@1\c@\e\c@\cM\c@f\c@.\c@\cU\c@\cL\c@‘\c@(\c@\cN\c@\cI\c@Â\c@ \c@\cF\c@\cF\c@÷\c@\cX\c@\cB\c@\cC\cA&\c@\cP\c@\cH\c@\c@\cAE\c@\cI\c@\cU\c@\cB\cAK\c@\cC\c@\$\c@\cJ\cA5\c@\cA\c@1\c@\cW\cA\cD\c@\c@\c@=\c@&\c@Ã\c@\c@\c@A\c@7\c@€\c@\c@\c@?\c@E\c@I\c@\cB\c@8\c@J\c@-\c@\cG\c@1\c@H\c@.\c@\cM\c@+\c@>\c@J\c@\cU\c@'\c@1\c@q\c@\c\\c@#\c@&\c@“\c@\c_\c@\c_\c@ \c@¢\c@\c\\c@\cZ\c@\"\c@—\c@\cV\c@\cT\c@-\c@v\c@\cP\c@\cN\c@?\c@Q\c@\cH\c@\cK\c@R\c@+\c@\cB\c@\cG\c@c\c@\cN\c@\cC\c@\cF\c@l\c@\c@\c@\cK\c@\cF\c@j\c@\c@\c@\cW\c@\cI\c@Z\c@\c@\c@#\c@\cO\c@D\c@\c@\c@0\c@\e\c@-\c@\c@\c@:\c@(\c@\cY\c@\c@\c@<\c@4\c@\cJ\c@\c@\c@8\c@<\c@\cF\c@\c@\c@0\c@:\c@\cK\c@\c@\c@'\c@0\c@\cQ\c@ \c@ \c@#\c@\cV\c@_\c@\c_\c@\cU\c@\cX\c@´\c@\"\c@\cI\c@\cV\cA\cQ\c@*\c@\cA\c@\cQ\cAo\c@5\c@\cD\c@\cK\cA¦\c@=\c@\cP\c@\cE\cA¦\c@?\c@\c^\c@\cD\cAr\c@=\c@-\c@\cJ\cA\c^\c@6\c@:\c@\cU\c@Á\c@.\c@\@\c@\"\c@q\c@+\c@:\c@1\c@=\c@-\c@-\c@;\c@&\c@2\c@\c^\c@>\c@\$\c@9\c@\cP\c@7\c@,\c@?\c@\cF\c@*\c@1\c@\@\c@\cA\c@\c\\c@/\c@=\c@\c@\c@\cO\c@%\c@9\c@\c@\c@\cE\c@\cY\c@6\c@\c@\c@\c@\c@\cS\c@6\c@\c@\c@\c@\c@\cY\c@8\c@\c@\c@\c@\c@/\c@=\c@\c@\c@\c@\c@Q\c@B\c@\c@\c@\c@\c@x\c@F\c@\c@\c@\c@\c@›\c@G\c@\c@\c@\c@\c@±\c@G\c@\c@\c@\cB\c@³\c@F\c@\c@\c@\cH\c@ \c@E\c@\c@\c@\cN\c@y\c@E\c@\c@\c@\cT\c@R\c@H\c@\c@\c@\cX\c@/\c@J\c@\c@\c@\cZ\c@\cS\c@M\c@\c@\c@\cV\c@\cA\c@O\c@\c@\c@\cQ\c@\cA\c@M\c@\c@\c@\cM\c@\c\\c@H\c@\c@\c@\cL\c@I\c@?\c@\c@\c@\cL\c@…\c@4\c@\c@\c@\cN\c@Æ\c@*\c@\cA\c@\cO\cA\cG\c@!\c@\cD\c@\cQ\cA&\c@\c^\c@\cI\c@\cR\cA\c^\c@ \c@\cM\c@\cV\c@ò\c@'\c@\cP\c@\c]\c@²\c@1\c@\cP\c@'\c@p\c@;\c@\cM\c@1\c@\@\c@C\c@\cI\c@7\c@,\c@G\c@\cD\c@7\c@5\c@F\c@\cA\c@0\c@S\c@C\c@\c@\c@\$\c@u\c@>\c@\c@\c@\cW\c@‘\c@:\c@\c@\c@\cK\c@›\c@9\c@\c@\c@\cC\c@”\c@:\c@\c@\c@\cA\c@€\c@;\c@\c@\c@\cD\c@j\c@<\c@\c@\c@\cI\c@Y\c@9\c@\c@\c@\cN\c@V\c@1\c@\c@\c@\cS\c@`\c@%\c@\c@\c@\cX\c@r\c@\cY\c@\c@\c@\e\c@…\c@\cO\c@\c@\c@\c_\c@“\c@\cF\c@\c@\c@%\c@˜\c@\cA\c@\c@\c@.\c@–\c@\cE\c@\cD\c@6\c@”\c@\cL\c@\cK\c@>\c@”\c@\cR\c@\cS\c@A\c@˜\c@\cY\c@\cY\c@<\c@œ\c@\c_\c@\e\c@1\c@ž\c@\"\c@\cX\c@\"\c@›\c@%\c@\cS\c@\cU\c@–\c@&\c@\cK\c@\cJ\c@™\c@(\c@\cC\c@\cB\c@«\c@*\c@\cE\c@\c@\c@Ï\c@(\c@\cQ\c@\cB\cA\cA\c@\"\c@ \c@\cI\cA5\c@\cZ\c@1\c@\cR\cAY\c@\cQ\c@A\c@\c]\cAb\c@\cI\c@K\c@+\cAI\c@\cB\c@K\c@8\cA\cR\c@\c@\c@B\c@D\c@É\c@\c@\c@5\c@O\c@‚\c@\c@\c@%\c@X\c@G\c@\c@\c@\cY\c@`\c@%\c@\c@\c@\cQ\c@g\c@\c]\c@\c@\c@\cR\c@i\c@'\c@\c@\c@\cZ\c@f\c@3\c@\c@\c@,\c@b\c@<\c@\c@\c@G\c@]\c@;\c@\c@\c@e\c@X\c@5\c@\c@\c@‚\c@W\c@/\c@\c@\c@–\c@Z\c@0\c@\c@\c@Ÿ\c@`\c@8\c@\c@\c@š\c@g\c@\@\c@\c@\c@Š\c@o\c@\@\c@\c@\c@u\c@t\c@7\c@\c@\c@e\c@w\c@*\c@\c@\c@^\c@{\c@\cX\c@\c@\c@b\c@~\c@\cG\c@\c@\c@n\c@\c@\cJ\c@\c@\c@|\c@ƒ\c@/\c@\c@\c@„\c@ƒ\c@e\c@\c@\c@€\c@€\c@¤\c@\c@\c@o\c@z\c@ä\c@\c@\c@R\c@t\cA\cV\c@\c@\c@6\c@k\cA\"\c@\c@\c@\c]\c@f\cA\cF\c@\c@\c@\cJ\c@b\c@Ì\c@\c@\c@\cC\c@a\c@‹\c@\c@\c@\cO\c@`\c@P\c@\c@\c@!\c@a\c@#\c@\c@\c@6\c@a\c@\cH\c@\c@\c@M\c@^\c@\cC\c@\c@\c@`\c@Y\c@\cN\c@\c@\c@g\c@P\c@\cY\c@\c@\c@c\c@C\c@\"\c@\c@\c@V\c@5\c@&\c@\c@\c@E\c@)\c@#\c@\c@\c@6\c@!\c@\c\\c@\c@\c@+\c@\c_\c@\cQ\c@\c@\c@\$\c@\"\c@\cF\c@\c@\c@ \c@*\c@\c@\c@\c@\c@\e\c@1\c@\cH\c@\c@\c@\cU\c@6\c@\c_\c@\cA\c@\cN\c@7\c@?\c@\cF\c@\cH\c@3\c@e\c@\cO\c@\cB\c@(\c@Ž\c@\cZ\c@\cB\c@\c\\c@´\c@%\c@\cI\c@\cR\c@Ð\c@.\c@\cR\c@\cH\c@ã\c@1\c@\e\c@\cA\c@ð\c@,\c@ \c@\c@\c@ö\c@\"\c@!\c@\c@\c@ó\c@\cW\c@\e\c@\cD\c@ß\c@\cL\c@\cS\c@\cL\c@·\c@\cD\c@\cJ\c@\cV\c@…\c@\c@\c@\cC\c@ \c@V\c@\cB\c@\cA\c@+\c@,\c@\cI\c@\cC\c@3\c@\cM\c@\cP\c@\cE\c@5\c@\cK\c@\cX\c@\cF\c@1\c@(\c@ \c@\cF\c@*\c@N\c@&\c@\cF\c@\c_\c@u\c@)\c@\cD\c@\cT\c@–\c@+\c@\cA\c@\cK\c@¥\c@-\c@\c@\c@\cD\c@˜\c@0\c@\cA\c@\c@\c@z\c@3\c@\cD\c@\cC\c@Y\c@6\c@\cI\c@\cF\c@L\c@6\c@\cL\c@\cI\c@[\c@4\c@\cN\c@\cL\c@†\c@1\c@\cM\c@\cM\c@À\c@.\c@\cJ\c@\cK\c@ø\c@.\c@\cF\c@\cH\cA\cY\c@1\c@\cB\c@\cE\cA\cV\c@9\c@\cC\c@\cB\c@ð\c@F\c@\cJ\c@\c@\c@±\c@U\c@\cS\c@\c@\c@s\c@f\c@\c^\c@\c@\c@<\c@r\c@(\c@\c@\c@\cU\c@x\c@/\c@\c@\c@\cA\c@w\c@/\c@\cB\c@\c@\c@o\c@)\c@\cD\c@\c@\c@d\c@\c^\c@\cG\c@\c@\c@\\\c@\cT\c@\cL\c@\c@\c@Z\c@\cJ\c@\cR\c@\c@\c@_\c@\cC\c@\cW\c@\c@\c@g\c@\c@\c@\e\c@\c@\c@p\c@\c@\c@\c^\c@\c@\c@t\c@\c@\c@\c_\c@\c@\c@s\c@\c@\c@\c\\c@\c@\c@j\c@\c@\c@\cX\c@\c@\c@`\c@\c@\c@\cS\c@\c@\c@V\c@\c@\c@\cM\c@\c@\c@P\c@\c@\c@\cI\c@\c@\c@N\c@\c@\c@\cI\c@\c@\c@S\c@\c@\c@\cM\c@\c@\c@Z\c@\cC\c@\cR\c@\cH\c@c\c@\cG\c@\cV\c@\cS\c@i\c@\cL\c@\cW\c@ \c@n\c@\cQ\c@\cU\c@*\c@o\c@\cT\c@\cO\c@0\c@m\c@\cT\c@\cI\c@.\c@k\c@\cP\c@\cD\c@(\c@h\c@\cK\c@\c@\c@%\c@c\c@\cF\c@\c@\c@/\c@[\c@\cB\c@\c@\c@J\c@S\c@\c@\c@\c@\c@w\c@K\c@\c@\c@\c@\c@±\c@C\c@\cC\c@\c@\c@î\c@>\c@\cG\c@\c@\cA \c@<\c@\cL\c@\c@\cA\@\c@<\c@\cR\c@\c@\cAI\c@;\c@\cX\c@\c@\cA?\c@9\c@\c^\c@\c@\cA)\c@7\c@&\c@\cB\cA\cW\c@5\c@0\c@\cJ\cA\cP\c@7\c@=\c@\cS\cA\cX\c@>\c@K\c@\c\\cA+\c@G\c@W\c@\$\cA>\c@S\c@]\c@&\cAC\c@]\c@Z\c@ \cA0\c@e\c@N\c@\cX\cA\cF\c@i\c@9\c@\cN\c@Ê\c@j\c@&\c@\cE\c@\c@i\c@\cT\c@\c@\c@[\c@f\c@\cG\c@\c@\c@C\c@b\c@\c@\c@\c@\c@K\c@[\c@\cF\c@\cA\c@p\c@T\c@\cQ\c@\cG\c@¨\c@L\c@\c_\c@\cQ\c@æ\c@F\c@/\c@\cZ\cA\cW\c@B\c@B\c@#\cA.\c@B\c@R\c@+\cA\$\c@C\c@_\c@-\c@ø\c@D\c@g\c@,\c@µ\c@B\c@j\c@)\c@v\c@?\c@f\c@(\c@?\c@9\c@\\\c@'\c@\cV\c@3\c@M\c@(\c@\c@\c@/\c@<\c@&\c@\cD\c@.\c@-\c@\c_\c@\cV\c@3\c@!\c@\cX\c@0\c@=\c@\c\\c@\cP\c@M\c@K\c@\c]\c@\cG\c@g\c@Z\c@#\c@\cB\c@|\c@g\c@+\c@\cI\c@\c@l\c@3\c@\cV\c@x\c@g\c@9\c@&\c@m\c@[\c@;\c@8\c@k\c@J\c@:\c@I\c@v\c@:\c@6\c@Q\c@\c@/\c@0\c@N\c@±\c@-\c@)\c@B\c@Î\c@4\c@#\c@0\c@Ý\c@D\c@\c_\c@\c^\c@Ü\c@X\c@\c]\c@\cO\c@Ì\c@l\c@\c]\c@\cE\c@µ\c@|\c@ \c@\c@\c@œ\c@ƒ\c@%\c@\c@\c@ˆ\c@€\c@,\c@\c@\c@s\c@v\c@2\c@\cD\c@Z\c@h\c@7\c@\cL\c@A\c@[\c@8\c@\cW\c@+\c@R\c@7\c@#\c@\cV\c@Q\c@2\c@0\c@\cE\c@S\c@,\c@6\c@\cD\c@W\c@\$\c@5\c@\cV\c@Z\c@\cZ\c@-\c@0\c@W\c@\cR\c@ \c@J\c@O\c@\cK\c@\cT\c@_\c@C\c@\cE\c@\cJ\c@h\c@7\c@\cA\c@\cI\c@Z\c@/\c@\c@\c@\cU\c@E\c@1\c@\cB\c@*\c@*\c@<\c@\cJ\c@B\c@\cR\c@N\c@\cU\c@Z\c@\cC\c@c\c@ \c@f\c@\cV\c@v\c@+\c@d\c@;\c@\c@2\c@S\c@p\c@ƒ\c@4\c@;\c@¯\c@{\c@1\c@%\c@í\c@l\c@-\c@\cY\cA\cH\c@Z\c@)\c@\cZ\c@í\c@I\c@&\c@%\c@¿\c@?\c@\$\c@4\c@†\c@=\c@#\c@?\c@E\c@D\c@\c_\c@C\c@%\c@R\c@\cX\c@>\c@¡\c@e\c@\cQ\c@:\cAq\c@x\c@\cJ\c@;\cBF\c@‡\c@\cF\c@D\cBæ\c@‘\c@\cI\c@Q\cC4\c@”\c@\cT\c@]\cBÛ\c@\c@%\c@`\cB/\c@ƒ\c@8\c@U\cAV\c@o\c@I\c@A\c@\c@U\c@O\c@+\c@\cS\c@;\c@J\c@\cV\c@\c@\c@%\c@9\c@\cF\c@\c@\c@\cR\c@'\c@\c@\c@\c@\c@\cD\c@\cU\c@\c@\c@\c@\c@\c@\c@\cF\c@\cA\c@\cC\c@\cC\c@\cA\c@\cE\c@\cL\c@\cF\c@\cB\c@\cI\c@\cS" 'length' => 112856 'string' => 0..56427 364 1308 167 17 328 1204 494 45 252 1033 1076 75 198 1060 1600 97 127 1035 1600 109 50 941 1600 97 75 780 1600 76 404 571 1600 46 947 374 1600 17 1600 208 1600 0 1600 85 1600 0 1600 14 1600 430 1600 0 1600 1230 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1192 1600 44 1600 406 1600 195 1600 0 1600 463 1600 0 1600 838 1600 0 1600 1297 1600 0 1600 1600 1600 0 1600 1600 1600 411 1600 1600 1600 1201 1600 1600 1600 1600 993 1600 1600 1600 414 1600 1600 1600 62 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1202 64 1600 1600 411 199 1600 1600 0 426 1600 1600 0 768 1600 1600 0 1257 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 0 1600 1600 1600 18 1600 1600 1600 101 1600 1600 1600 235 1600 1600 1600 391 1600 1600 1600 533 1600 1600 1600 628 1600 1600 1457 615 1600 1600 1340 500 1600 1600 1405 353 1600 1600 1585 199 1600 1342 1600 76 1600 929 1600 6 1600 571 1600 0 1600 304 1600 0 1600 138 1600 0 1600 50 1600 0 1600 12 1600 0 1600 0 1600 0 1600 0 1600 0 1600 0 1600 0 1600 0 1600 0 1600 0 1600 0 1589 38 1600 0 1216 115 1600 3 915 229 1600 74 680 378 1600 209 502 562 1600 405 366 729 1600 658 265 855 1600 973 191 919 1600 1280 138 908 1600 1559 98 824 1600 1600 68 679 1600 1600 43 498 1600 1600 26 324 1520 1600 12 183 1455 1600 9 79 1395 1600 27 18 1327 1600 67 0 1236 1600 131 0 1111 1600 221 0 948 1600 330 0 753 1600 446 0 541 1600 556 0 348 1600 646 0 195 1472 705 0 86 1195 729 0 44 1137 717 0 80 1351 672 0 163 1600 601 0 261 1600 514 0 362 1600 420 1 430 1600 328 24 437 1600 244 70 382 1600 174 147 284 1600 121 260 185 1600 85 415 96 1600 64 595 31 1600 55 786 0 1600 54 973 0 1600 59 1130 0 1600 67 1239 0 1600 78 1279 0 812 92 1240 0 236 111 1122 0 0 134 938 0 0 163 711 0 0 196 474 0 0 227 284 0 0 252 138 0 236 269 44 0 813 271 0 0 1600 258 1 0 1600 230 20 0 1600 190 46 0 1600 142 70 0 1600 94 86 0 1600 55 97 0 1600 25 84 0 1600 7 61 0 1600 0 36 0 1600 0 14 0 1600 0 1 0 1600 0 1 0 1600 0 16 0 1600 0 41 0 1600 0 71 0 1600 0 98 0 1600 0 119 83 1600 0 120 278 1600 0 100 591 1600 0 72 1036 1479 0 42 1600 1124 0 17 1600 761 0 2 1600 467 0 0 1600 239 0 0 1600 85 0 0 1600 4 0 3 1600 0 0 72 1600 0 0 203 1600 0 0 391 1600 0 0 620 1600 0 0 887 1600 0 0 1109 1600 0 0 1250 1600 0 0 1290 1600 0 0 1225 1600 0 0 1070 1600 0 0 851 1600 0 0 604 1600 0 0 382 1600 0 0 208 1600 0 0 87 1600 0 0 24 1600 79 0 44 1600 235 0 109 1600 454 0 193 1600 707 0 291 1600 985 0 398 1600 1189 0 483 1600 1282 23 541 1600 1261 75 580 1600 1150 151 612 1600 988 241 655 1600 819 338 721 1600 670 412 818 1600 557 440 945 1140 482 418 1090 656 434 351 1234 337 403 255 1355 138 383 165 1430 29 370 90 1445 0 367 35 1400 0 380 4 1301 0 411 0 1171 0 456 0 1038 0 504 9 930 0 540 34 866 0 551 73 856 0 526 124 890 0 461 190 947 0 365 261 997 0 253 331 1008 0 157 396 955 0 80 458 831 0 27 517 648 0 4 575 445 0 13 632 269 0 22 687 129 4 24 740 37 20 24 789 0 47 23 834 0 80 15 876 0 114 6 915 0 141 1 949 0 147 13 977 0 131 28 994 0 99 42 994 0 65 49 973 0 34 49 927 0 11 42 856 0 0 34 765 0 0 51 661 0 0 115 555 0 0 244 457 0 0 433 376 0 0 677 317 0 0 940 279 0 0 1182 258 0 0 1361 248 0 0 1442 238 0 0 1407 224 48 0 1260 200 142 0 1023 166 280 0 737 123 453 0 472 82 660 0 260 48 840 0 109 22 964 0 22 5 1011 0 0 0 974 0 0 0 860 0 0 23 689 0 0 74 487 0 0 156 307 0 0 270 164 0 0 419 64 0 0 576 9 0 0 725 0 0 0 845 0 0 0 925 0 0 5 951 0 0 61 920 0 0 165 834 0 0 321 705 0 0 526 547 0 0 782 380 0 0 1035 237 0 0 1261 127 0 0 1431 52 0 0 1528 9 0 0 1535 0 0 0 1448 0 0 0 1273 0 0 0 1029 0 0 0 744 0 0 0 482 0 0 0 273 0 0 40 120 0 0 123 27 0 0 238 0 0 0 364 0 0 0 484 0 0 0 544 49 0 0 521 214 0 0 421 517 0 0 296 977 0 0 173 1596 0 0 73 1600 3 0 13 1600 7 0 0 1600 11 0 0 1600 14 0 0 1600 15 0 0 1600 13 0 0 1600 10 0 0 1600 6 0 0 1600 2 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 45 1600 0 0 166 1600 0 0 353 1600 0 0 585 1600 0 0 844 1600 0 0 1062 1600 0 0 1167 1600 0 0 1135 1600 16 0 972 1600 65 0 718 1600 148 0 471 1600 267 0 258 1600 425 0 100 1262 603 0 12 850 774 0 0 519 919 0 0 287 1020 0 0 130 1064 26 0 37 1046 89 0 0 969 185 0 0 840 308 0 16 678 453 0 45 501 586 0 77 330 677 0 104 195 711 0 127 97 683 0 128 34 599 0 105 3 473 0 75 0 326 0 43 0 202 0 18 0 103 0 3 0 36 0 0 2 1 0 0 34 0 0 0 102 0 0 0 214 0 0 0 376 0 0 0 588 0 0 1 815 0 0 10 1030 50 0 26 1198 156 0 48 1289 319 0 74 1284 533 0 101 1179 795 0 122 988 1035 0 130 741 1212 0 128 491 1291 0 116 286 1261 0 99 132 1132 0 78 36 942 0 58 0 741 0 38 0 587 0 23 0 528 0 12 0 591 0 4 3 771 0 0 8 1033 0 0 16 1320 0 0 22 1569 0 2 23 1600 0 5 21 1600 0 7 17 1600 0 8 10 1365 0 9 3 1036 0 8 0 690 0 5 0 408 0 2 35 195 0 0 124 60 0 0 269 0 0 0 469 0 0 0 723 0 0 0 990 0 0 0 1223 0 0 0 1392 0 0 0 1473 0 0 0 1457 0 11 0 1348 0 56 0 1164 0 133 0 931 0 240 0 680 0 373 0 441 0 519 0 257 0 642 0 125 0 722 0 43 0 747 0 3 0 713 0 0 0 623 0 0 0 490 0 0 0 337 0 0 0 209 0 0 0 105 0 0 0 35 68 0 0 0 230 0 0 0 486 0 0 0 821 0 0 0 1224 0 0 0 1598 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1279 0 0 0 947 0 0 0 713 0 0 0 659 0 0 0 827 0 0 0 1208 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1600 3 0 0 1600 9 0 0 1600 19 0 0 1600 30 0 0 1600 41 0 0 1600 48 0 0 1300 47 0 0 1065 39 0 0 1044 29 0 0 1204 17 0 0 1467 8 0 0 1600 2 0 0 1600 0 0 0 1600 3 0 0 1600 12 0 0 1438 22 0 0 1101 29 0 0 818 32 0 1 672 30 0 7 705 24 0 18 912 14 0 31 1238 4 0 46 1598 0 0 64 1600 11 0 84 1600 66 0 103 1600 164 0 124 1600 306 0 146 1394 490 0 169 956 702 0 189 581 896 0 205 284 1045 0 217 88 1127 0 226 0 1132 0 238 0 1057 0 261 0 915 0 305 0 724 0 384 0 514 0 504 0 325 0 666 0 179 0 862 0 76 0 1073 0 17 0 1266 0 0 0 1406 0 0 0 1459 0 0 0 1405 0 0 0 1245 0 0 0 1001 0 0 0 719 0 0 0 457 0 0 0 273 0 0 0 207 0 0 0 275 0 0 0 460 0 0 0 718 0 0 0 984 0 0 0 1196 0 0 0 1302 0 0 0 1277 0 0 0 1130 0 0 0 894 0 0 0 628 0 0 0 388 0 0 0 226 0 0 0 168 0 0 0 217 0 0 0 349 0 0 0 518 0 0 0 674 0 0 0 774 0 0 0 791 0 0 0 723 0 0 0 592 0 0 0 439 0 0 0 311 0 0 0 247 0 0 0 273 0 0 0 384 0 0 0 555 0 0 0 741 0 0 0 893 0 0 0 970 0 0 0 951 0 0 0 841 0 0 0 670 0 0 0 488 0 0 0 345 0 0 0 284 0 0 0 326 0 0 0 467 0 0 0 678 0 0 0 912 0 0 0 1117 0 0 0 1247 0 0 0 1273 0 1 0 1187 0 60 0 1007 0 182 0 764 0 369 0 509 0 619 0 301 0 931 0 143 0 1233 0 43 0 1479 0 0 0 1600 0 0 0 1600 0 0 0 1596 0 0 0 1414 0 32 0 1158 0 103 0 867 0 226 0 579 0 405 0 347 0 648 0 177 0 913 0 67 0 1167 0 9 0 1368 0 0 0 1478 0 0 0 1472 0 0 0 1346 0 47 0 1116 0 144 0 823 0 291 0 538 0 483 0 304 0 720 0 133 0 945 0 31 0 1124 0 0 0 1234 0 0 0 1262 0 0 0 1208 0 0 0 1082 0 0 0 905 0 0 0 700 35 0 0 494 133 0 0 309 295 0 0 172 516 0 0 78 795 0 0 23 1085 7 0 0 1329 17 0 0 1488 28 0 0 1537 38 1 3 1469 45 5 4 1295 43 11 4 1043 35 17 4 750 28 21 4 481 32 23 2 268 58 20 0 117 115 15 0 28 204 9 0 0 319 3 0 0 443 0 0 2 556 0 0 11 636 0 0 22 665 0 0 32 633 2 0 40 544 8 0 45 415 16 0 41 279 24 0 30 163 30 0 20 90 32 0 11 94 28 0 4 179 21 0 0 327 12 0 0 514 5 0 0 709 0 0 0 867 0 0 0 953 0 0 0 950 0 0 0 857 0 0 0 698 0 0 0 508 0 3 0 327 0 8 0 195 0 15 0 137 0 23 0 160 0 33 0 251 0 40 0 378 1 43 0 504 7 41 0 589 17 34 0 609 29 25 0 557 41 15 0 448 51 7 0 314 52 2 0 196 46 0 0 132 38 0 0 146 34 0 0 241 41 3 0 397 61 9 0 576 92 15 0 732 125 20 0 824 151 23 0 826 162 22 0 741 156 17 0 592 135 11 0 421 107 5 0 281 81 1 0 215 63 0 0 250 56 0 0 387 59 0 0 602 68 0 0 849 76 0 0 1077 80 0 0 1235 77 0 0 1291 68 0 0 1231 56 57 0 1068 48 193 0 833 47 415 0 567 56 718 0 345 74 1100 0 172 94 1488 0 58 111 1600 0 1 119 1600 0 0 116 1600 0 0 101 1600 0 0 78 1600 0 0 53 1367 0 0 32 971 0 0 15 613 0 74 4 335 0 227 3 141 0 454 21 31 0 735 52 0 0 1062 94 0 0 1330 140 0 0 1485 179 0 0 1493 190 0 0 1356 162 0 0 1102 125 0 0 785 82 0 3 497 37 0 12 265 3 0 26 102 13 2 42 14 123 4 61 0 332 8 77 0 641 12 86 0 1037 15 88 0 1498 15 83 0 1600 13 75 0 1600 9 66 0 1600 6 58 0 1600 2 51 0 1600 0 45 0 1380 0 39 13 922 0 32 98 537 0 23 255 245 0 15 479 64 0 9 757 0 0 4 1066 0 0 0 1317 0 0 0 1459 0 0 0 1466 0 0 0 1334 0 0 0 1092 0 0 0 795 0 0 0 508 0 0 0 294 0 0 0 204 0 0 0 254 0 0 0 431 0 0 0 687 0 0 0 960 0 0 0 1181 3 0 0 1297 11 0 0 1278 21 0 0 1129 31 0 0 885 39 0 37 603 40 0 170 363 35 0 401 175 26 0 729 54 16 0 1148 0 7 0 1600 0 1 0 1600 0 0 0 1600 0 0 0 1600 0 2 0 1600 0 5 0 1600 0 9 0 1600 0 12 0 1330 0 14 0 889 20 12 0 529 70 9 0 265 146 5 0 96 241 2 0 12 351 0 0 4 447 0 0 18 505 0 0 32 515 0 0 42 474 0 0 48 392 0 0 52 286 0 9 44 185 0 62 37 102 10 162 34 43 32 307 39 9 62 492 47 0 98 700 55 0 138 876 58 0 170 988 54 0 189 1013 44 0 191 947 31 0 180 805 19 0 161 622 9 0 138 442 2 0 115 306 0 0 99 247 0 0 90 276 0 0 87 382 0 2 89 533 0 4 90 689 0 3 88 807 0 3 80 854 0 3 67 816 0 1 52 701 0 0 37 531 0 0 24 354 0 15 14 205 0 94 8 93 0 235 3 24 2 431 1 0 10 673 0 0 24 934 0 0 41 1141 0 0 58 1256 5 0 71 1261 12 0 75 1156 21 10 68 967 28 78 52 728 33 206 35 482 31 396 19 283 25 641 8 138 16 925 1 46 8 1181 0 2 2 1365 0 7 0 1450 0 20 0 1420 0 33 0 1283 0 46 0 1065 0 60 0 800 0 68 0 527 0 68 0 312 24 66 0 152 85 62 0 49 184 60 3 0 319 59 8 0 488 60 16 8 655 61 28 29 785 63 42 53 855 62 56 71 847 59 70 78 762 53 82 73 615 43 90 59 433 32 93 36 273 21 92 12 142 12 87 0 52 5 79 56 4 1 69 180 0 0 63 378 0 0 62 646 0 0 66 988 0 0 74 1330 0 0 81 1600 0 0 82 1600 0 0 74 1600 0 0 57 1600 0 0 40 1584 2 0 22 1278 14 0 8 922 33 46 0 592 56 140 0 331 73 281 0 144 77 452 9 34 68 643 27 0 53 788 53 0 32 849 84 0 9 810 118 2 0 680 141 5 0 491 148 8 100 314 139 10 306 164 119 15 619 58 94 21 1022 2 71 29 1515 0 54 40 1600 0 44 53 1600 0 37 66 1600 0 30 76 1600 0 22 82 1600 0 15 83 1600 0 7 80 1367 0 1 74 900 0 0 67 527 11 0 60 251 56 0 53 77 135 2 46 0 244 9 39 0 376 23 33 0 514 44 29 0 615 73 27 0 655 106 26 0 624 137 24 0 524 160 22 0 379 168 17 0 245 155 12 0 128 123 8 0 43 87 3 0 53 53 0 0 163 23 0 0 323 3 0 0 520 6 0 0 743 32 0 0 918 70 0 0 1006 116 0 0 985 164 0 0 861 207 0 0 663 225 0 1 448 219 0 2 262 193 0 3 120 159 0 3 72 125 0 2 127 97 0 1 255 78 0 0 411 67 0 0 588 59 0 0 731 53 0 0 802 46 0 0 789 38 0 0 695 32 17 0 540 29 105 0 367 31 265 1 219 39 492 12 104 53 774 30 30 73 1085 51 0 100 1345 68 0 133 1515 78 0 172 1576 68 0 210 1531 55 0 238 1397 35 0 250 1199 15 0 240 961 2 0 206 706 40 0 157 464 113 0 104 277 222 0 59 135 363 0 30 42 531 0 20 0 684 0 26 0 797 0 39 16 850 0 50 36 834 0 53 48 752 0 47 43 615 0 35 48 447 0 22 38 289 0 10 19 161 0 2 0 68 0 3 0 14 0 13 75 0 0 27 238 0 0 48 496 0 0 75 840 0 0 108 1268 0 0 142 1600 0 0 176 1600 0 0 206 1600 0 0 226 1600 0 0 229 1600 0 0 214 1600 0 0 177 1321 0 22 128 901 0 113 82 547 0 267 43 281 0 470 14 106 0 702 10 15 0 922 36 0 0 1050 73 7 0 1052 118 18 0 926 167 26 0 700 206 29 0 471 221 30 0 264 210 26 0 107 174 16 0 49 124 7 0 148 79 1 0 324 40 0 0 546 13 0 0 795 0 0 0 1020 4 2 0 1140 14 6 0 1133 23 11 0 1002 29 15 0 782 32 20 0 532 29 21 0 316 22 18 0 162 12 13 0 127 4 8 0 214 0 3 0 394 0 0 0 605 0 0 0 819 0 0 0 963 0 0 0 1000 1 0 0 921 8 0 0 747 20 0 0 526 34 0 0 325 45 0 0 180 51 0 0 147 46 0 0 240 36 0 0 446 23 0 0 708 10 0 0 991 1 0 0 1222 1 0 0 1347 13 0 0 1339 33 0 0 1199 56 0 0 960 75 0 0 677 89 0 0 419 86 0 0 232 68 0 0 158 47 0 0 201 25 0 1 341 8 0 3 529 0 0 6 723 0 0 8 873 0 0 9 946 0 0 8 928 0 0 6 828 0 0 3 668 0 0 1 478 0 0 0 303 0 0 0 167 71 0 0 71 216 0 0 16 443 0 0 0 747 0 0 0 1127 0 0 0 1487 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1459 0 0 0 1119 0 41 0 787 0 148 0 515 0 320 0 332 0 553 0 237 6 840 0 207 16 1125 0 209 28 1348 0 212 39 1470 0 201 47 1469 0 170 47 1347 0 129 38 1127 0 89 27 847 9 59 15 559 43 41 5 328 103 32 0 156 188 25 0 47 297 19 0 0 416 13 0 0 516 7 0 8 577 10 0 21 587 27 0 31 536 52 0 36 434 81 0 39 307 111 0 34 193 133 0 23 96 141 0 11 43 134 0 2 82 114 0 2 203 86 0 7 369 58 0 12 569 38 0 11 777 30 0 12 926 37 0 11 985 58 0 7 942 87 0 1 805 115 0 0 604 134 0 0 400 139 0 55 228 131 0 196 100 112 2 421 23 89 11 721 0 68 26 1090 0 53 44 1452 0 48 63 1600 0 52 78 1600 0 63 82 1600 0 80 76 1600 0 97 60 1389 0 111 40 1024 0 119 23 665 0 121 10 379 22 119 2 170 68 121 2 46 137 131 6 0 220 153 9 0 313 184 10 0 383 217 10 0 412 241 9 1 396 246 6 1 335 226 2 1 245 184 0 2 159 130 9 3 86 80 54 4 33 39 141 5 4 11 270 4 0 0 438 4 0 5 630 3 0 17 802 1 0 28 919 0 0 36 960 0 0 38 914 0 0 35 792 0 0 27 621 0 0 15 442 0 0 3 295 0 0 9 212 0 0 30 210 0 0 57 285 0 0 87 414 0 0 119 561 0 0 146 689 1 0 162 767 4 0 174 776 9 0 184 714 13 0 193 594 16 0 199 441 16 0 196 288 13 0 180 165 9 21 151 75 5 96 115 20 4 218 80 0 8 373 58 0 13 544 54 7 17 695 66 15 20 768 91 22 17 742 117 25 13 619 137 27 9 446 144 22 4 283 137 14 0 142 122 6 0 42 104 1 10 18 87 0 26 104 74 0 48 243 63 0 72 423 52 0 98 630 43 0 114 838 35 0 118 975 30 0 109 1021 31 0 90 980 37 0 66 869 43 48 42 726 48 157 23 588 45 330 10 489 36 560 2 448 26 844 0 468 14 1120 0 533 5 1333 0 614 0 1449 0 683 0 1445 0 721 0 1321 0 725 0 1097 0 716 0 814 0 728 0 534 0 800 0 306 0 961 0 138 0 1223 0 36 0 1566 0 0 0 1600 0 0 0 1600 0 2 0 1600 0 4 0 1600 0 4 0 1600 0 4 0 1600 0 4 0 1600 0 3 0 1600 0 0 0 1600 0 2 0 1600 0 8 0 1600 0 17 0 1600 0 28 0 1575 77 39 0 1525 232 48 0 1501 457 53 0 1489 733 52 0 1480 1052 47 0 1465 1309 37 0 1439 1452 26 0 1394 1455 16 0 1331 1322 8 0 1251 1082 3 0 1167 785 4 0 1095 503 12 0 1056 278 25 0 1066 118 41 0 1137 27 59 0 1262 0 72 0 1422 0 79 0 1584 2 78 0 1600 2 71 0 1600 2 60 0 1600 2 49 0 1527 2 38 0 1283 0 32 0 1002 0 27 0 739 0 23 0 548 0 19 0 466 0 14 0 504 0 9 0 644 0 5 0 844 0 3 0 1050 0 4 0 1209 0 8 0 1282 0 10 0 1251 0 12 0 1123 0 11 0 924 0 8 0 690 0 5 0 456 0 2 2 269 57 0 6 133 181 2 13 48 380 4 19 6 654 7 24 0 1003 8 25 0 1346 8 21 0 1600 6 16 0 1600 4 9 0 1600 2 4 0 1600 3 0 0 1383 12 0 0 1023 25 0 5 669 42 0 71 380 61 0 199 168 78 0 386 41 88 0 619 0 89 0 884 0 82 0 1096 0 68 0 1209 4 48 0 1196 18 31 0 1056 36 17 2 817 54 6 10 556 72 0 23 327 86 0 38 148 92 0 54 89 92 0 68 178 92 0 75 366 95 0 73 594 104 0 62 846 117 0 46 1044 131 0 30 1125 141 0 17 1068 142 0 6 886 132 0 0 633 108 0 0 400 78 0 2 202 50 0 6 110 25 0 11 180 7 0 14 398 0 0 16 683 0 0 15 1017 6 0 11 1333 14 0 7 1544 22 0 3 1600 31 0 0 1511 39 0 0 1280 42 0 0 962 43 30 0 636 44 126 0 368 47 290 0 167 55 521 0 44 71 814 0 0 95 1126 0 0 124 1390 0 0 154 1560 1 0 175 1600 4 0 181 1522 8 0 166 1321 12 0 134 1041 17 0 94 728 19 25 57 452 19 131 25 240 15 310 11 96 11 543 13 17 6 804 21 0 2 1048 27 6 0 1182 30 16 0 1169 30 26 0 1012 29 33 0 746 33 38 0 492 46 37 0 266 67 28 0 98 92 18 0 4 111 9 0 78 119 3 0 221 112 0 0 413 96 0 0 629 77 0 0 861 62 0 0 1006 55 0 0 1029 54 0 0 932 55 0 0 739 51 0 0 510 41 0 0 307 30 0 72 146 18 0 247 41 7 0 532 0 0 0 917 0 0 3 1396 0 2 8 1600 0 6 14 1600 0 10 19 1600 0 12 23 1600 0 12 24 1600 0 11 22 1600 0 8 19 1471 0 4 16 992 32 0 14 595 96 4 14 299 190 12 15 108 307 22 15 13 446 32 13 6 567 42 10 26 652 46 7 46 693 42 3 64 694 33 1 80 670 23 0 90 644 13 0 85 644 5 1 74 695 0 4 64 812 0 9 58 998 0 13 55 1239 0 15 55 1508 0 14 54 1600 0 12 50 1600 0 8 40 1600 0 3 29 1600 0 0 19 1600 0 0 9 1600 0 0 1 1600 0 0 0 1600 0 0 36 1600 0 0 125 1600 0 0 276 1600 0 0 491 1600 0 0 773 1600 0 0 1072 1600 0 0 1342 1600 0 0 1539 1600 0 0 1600 1600 0 0 1594 1600 0 0 1443 1600 0 0 1202 1600 0 0 912 1600 0 0 620 1600 0 31 373 1600 0 108 193 1600 0 230 77 1600 0 393 17 1600 0 595 5 1600 0 793 14 1481 0 945 24 1364 0 1024 32 1269 0 1014 41 1198 0 916 46 1146 0 749 45 1101 0 550 44 1053 0 364 42 993 0 234 40 919 0 193 39 830 0 255 38 728 0 405 36 619 0 607 33 511 0 811 31 408 4 968 29 321 10 1038 26 255 16 1005 22 218 21 878 18 204 26 689 14 209 29 485 10 220 33 315 7 226 41 217 5 217 54 211 3 190 72 295 2 148 90 445 1 101 103 622 0 60 106 786 0 29 96 901 0 9 75 940 0 0 52 899 0 0 30 786 0 0 13 624 0 0 2 442 0 0 2 277 0 27 5 150 0 89 6 63 0 185 7 14 0 305 8 9 0 447 12 21 0 572 21 32 0 648 38 41 0 657 61 50 0 596 87 49 0 477 106 40 0 333 114 29 0 204 108 18 0 99 91 11 0 49 69 6 0 89 50 3 0 200 36 1 0 342 30 1 0 505 28 0 0 659 28 0 0 755 28 0 0 773 27 0 0 712 26 23 0 587 30 96 0 425 36 220 0 272 46 391 0 149 56 606 0 60 64 829 0 10 66 1009 0 0 65 1114 0 0 61 1125 0 0 61 1040 0 0 67 877 0 0 79 667 0 0 93 447 0 0 104 266 8 0 106 131 51 0 96 45 130 0 76 4 246 0 54 0 392 0 36 0 556 0 29 1 697 0 34 4 788 0 52 8 815 0 75 14 775 0 99 23 677 0 120 31 540 0 135 39 389 0 143 45 246 0 146 49 138 1 146 49 63 26 143 46 18 72 138 38 5 137 129 28 16 214 113 19 27 300 89 11 36 363 63 4 44 389 40 0 45 372 20 0 39 317 5 4 28 234 2 43 17 154 16 118 8 85 38 232 3 34 67 383 0 4 102 565 2 0 142 736 5 0 176 869 7 0 201 943 8 0 217 944 9 0 223 873 8 0 216 740 5 0 196 568 2 0 167 384 0 0 133 232 0 7 100 117 0 65 79 41 0 169 75 3 1 312 92 0 1 480 124 0 1 656 164 0 1 781 198 0 1 830 215 0 1 793 206 0 0 683 171 0 0 525 124 6 0 353 78 18 0 210 40 31 0 101 51 44 0 32 130 56 0 0 275 57 0 0 477 49 0 0 732 36 0 0 991 22 0 0 1212 10 0 0 1358 2 0 0 1405 0 0 0 1347 0 1 0 1198 0 6 0 988 0 11 0 752 0 17 0 526 0 21 26 336 0 22 107 198 0 18 238 113 0 13 412 73 0 7 621 64 0 2 827 70 0 0 976 79 0 0 1042 80 2 0 1014 69 7 0 899 53 15 0 722 35 24 0 513 23 33 0 324 39 39 0 175 95 39 0 72 201 33 0 14 359 24 1 0 565 16 6 0 794 12 14 0 1012 13 25 0 1179 19 37 0 1260 25 48 0 1234 29 54 0 1102 29 56 0 886 23 52 0 628 16 44 0 394 8 37 35 208 3 32 129 81 0 33 280 13 0 42 478 0 0 55 715 6 0 67 940 15 0 68 1096 28 0 57 1152 48 0 45 1097 76 0 28 942 108 0 10 719 140 0 20 481 169 0 109 283 188 0 279 132 195 0 537 37 189 0 879 0 172 0 1279 0 153 0 1600 0 134 0 1600 0 119 0 1600 0 110 0 1600 0 108 0 1600 0 115 0 1600 0 130 0 1271 0 155 0 957 0 185 0 735 0 216 0 644 0 239 0 688 0 249 0 834 0 244 0 1025 0 227 0 1197 0 205 0 1295 0 186 0 1287 0 175 0 1178 0 173 0 996 0 176 0 791 0 179 0 614 0 176 0 508 0 167 0 493 0 153 0 563 0 138 0 693 0 126 0 843 0 118 0 971 0 112 0 1045 0 104 0 1047 0 91 0 977 0 75 0 850 0 59 0 695 0 49 0 537 0 51 0 399 5 64 0 295 46 87 0 228 122 112 0 189 228 134 0 170 357 149 0 160 498 156 0 150 607 153 0 140 661 145 0 127 655 129 0 113 595 109 0 100 498 85 4 89 390 60 43 78 292 38 118 67 222 23 232 56 185 15 381 47 179 15 557 39 194 20 717 37 219 24 832 40 245 25 878 48 269 22 846 59 289 17 741 70 305 9 584 78 321 3 409 78 342 3 254 70 365 5 154 55 393 5 130 38 426 5 184 22 463 5 301 10 502 3 449 2 542 2 594 0 578 6 702 0 605 12 751 0 619 17 734 0 616 19 656 0 599 19 535 0 576 16 395 0 562 10 256 0 573 4 148 0 624 0 70 0 723 0 23 0 866 0 0 0 1037 0 0 0 1213 0 0 0 1365 0 0 0 1466 0 0 0 1499 0 0 0 1457 2 0 0 1348 10 0 0 1189 21 0 0 1009 33 0 0 840 41 0 0 714 44 0 0 651 38 0 0 663 28 0 0 742 16 0 0 867 6 4 0 1007 0 13 0 1128 0 24 0 1200 0 35 0 1203 0 45 0 1136 0 47 0 1010 0 41 0 850 0 31 0 689 0 20 0 558 0 9 0 478 1 2 0 461 12 0 0 502 33 0 0 581 62 0 0 673 95 0 0 752 129 0 0 797 152 0 0 794 161 0 0 744 156 10 0 655 140 77 0 542 119 200 0 422 95 381 0 315 71 610 0 233 48 874 0 184 30 1103 0 162 16 1262 0 159 5 1323 0 159 0 1277 0 150 0 1131 0 130 0 913 0 105 0 657 0 94 0 421 0 117 0 233 0 193 0 100 0 325 0 23 0 505 0 0 0 704 0 0 7 890 0 0 22 1023 0 0 42 1081 0 0 64 1050 0 0 85 941 0 0 98 774 0 0 97 582 0 0 83 395 0 0 61 237 25 0 39 124 112 2 20 52 264 3 7 15 478 3 0 0 749 3 4 0 1040 3 13 0 1283 1 27 0 1435 0 44 0 1466 0 64 0 1368 5 80 0 1159 52 89 2 878 142 89 5 584 279 80 9 342 457 66 13 160 669 52 17 46 864 42 18 0 1010 40 15 21 1083 47 12 46 1073 61 8 67 984 79 4 78 833 96 0 85 648 109 0 72 458 116 0 49 290 118 17 25 162 119 89 7 76 124 216 0 33 136 392 0 23 156 608 0 31 182 839 0 39 208 1024 0 40 231 1129 0 36 248 1139 0 27 258 1055 0 15 265 895 0 3 270 691 0 39 278 475 1 127 289 291 3 270 302 153 4 467 314 61 4 718 323 12 4 967 329 0 3 1176 331 0 2 1306 331 0 7 1335 333 0 19 1257 336 0 32 1090 340 0 42 865 344 0 46 621 346 0 43 394 342 6 33 221 333 54 21 102 316 143 9 33 294 268 1 2 267 422 0 0 240 592 0 0 215 725 3 0 194 794 9 7 177 785 15 19 166 699 20 35 158 552 22 50 151 381 20 64 145 233 15 67 139 116 9 60 132 79 3 45 125 128 0 29 117 255 0 14 109 415 0 4 98 601 0 0 84 765 0 0 68 874 0 1 53 917 0 4 39 892 0 8 29 812 0 11 22 698 0 13 18 574 0 13 14 460 0 10 11 373 59 6 9 322 180 3 7 308 366 0 10 327 607 0 18 367 899 0 31 415 1160 0 49 456 1340 0 68 480 1400 0 84 483 1322 0 94 471 1120 0 95 460 831 0 87 469 548 0 71 521 306 0 51 630 127 0 33 800 23 0 17 1017 0 0 7 1255 0 0 1 1480 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1600 0 0 0 1560 0 0 0 1374 0 0 0 1174 0 0 0 986 0 0 0 832 1 0 0 720 65 0 0 655 192 0 0 628 376 0 0 628 598 0 0 638 839 0 0 644 1010 0 0 633 1067 0 0 603 994 0 0 561 810 0 0 522 569 0 0 507 351 0 0 539 170 0 0 634 52 0 0 793 0 0 0 1001 0 0 4 1229 0 0 13 1434 0 0 18 1576 0 0 16 1600 0 0 17 1562 0 0 15 1404 0 0 8 1179 0 0 0 929 0 0 24 697 0 0 125 514 0 0 309 395 0 0 570 335 0 0 895 316 0 0 1245 318 0 0 1524 321 0 0 1600 313 0 0 1600 295 0 0 1504 270 0 0 1224 244 0 0 893 223 0 0 583 208 0 0 359 198 0 0 257 193 0 0 280 189 0 0 396 184 7 5 556 176 19 13 703 166 33 20 793 152 44 21 802 137 49 21 732 122 44 18 603 110 35 12 445 103 22 4 290 99 8 0 166 95 2 10 80 89 21 65 29 78 52 162 12 62 89 298 17 43 122 466 24 26 147 649 28 13 145 795 28 4 120 876 23 2 85 879 15 3 49 803 7 4 19 669 5 4 2 507 11 4 0 359 21 3 0 260 32 2 4 233 44 0 24 284 51 0 58 397 52 0 99 539 49 0 138 672 43 0 167 759 36 0 168 777 30 0 141 717 26 0 103 597 26 0 62 444 29 0 34 297 37 0 31 193 50 0 53 156 64 0 78 196 80 0 97 302 92 0 103 453 98 0 89 612 95 0 66 747 86 0 39 826 71 0 17 836 55 0 14 772 42 0 28 652 35 0 47 500 36 0 65 355 45 0 78 248 61 0 77 206 81 0 62 238 104 0 44 336 124 0 25 474 138 0 9 621 143 0 0 741 137 0 7 809 123 0 18 812 102 0 29 751 79 0 36 639 57 0 39 496 39 0 35 345 25 0 26 213 16 18 14 114 10 74 4 47 8 162 3 10 5 272 19 0 3 390 44 3 3 488 74 5 1 530 104 5 0 503 128 5 0 419 131 5 0 299 114 3 30 188 84 0 132 96 54 0 308 33 26 0 553 1 7 0 858 0 0 0 1180 3 0 0 1445 7 0 0 1600 9 0 0 1600 10 0 0 1549 10 0 0 1346 8 0 0 1070 5 0 0 769 1 0 0 487 0 0 48 273 0 0 147 123 0 0 296 36 0 0 487 0 0 1 714 1 0 15 914 4 0 38 1052 6 0 66 1102 7 0 93 1057 7 0 113 928 6 0 112 738 3 0 92 520 1 0 66 326 0 10 38 175 0 61 14 70 0 148 0 12 0 265 4 0 0 397 16 0 0 531 31 0 0 620 45 0 0 645 54 0 0 604 55 0 0 510 46 0 0 383 32 0 0 252 17 0 0 146 5 0 0 74 0 0 0 59 0 0 0 104 0 0 0 196 0 0 0 310 0 0 0 434 0 0 0 533 0 0 0 586 0 0 0 583 0 0 0 525 0 0 0 427 0 0 0 313 0 0 0 208 7 0 0 137 27 0 0 114 59 0 0 143 98 0 0 213 136 0 0 306 163 0 0 397 165 0 0 465 142 0 0 495 104 0 0 483 66 0 0 433 31 0 0 358 8 44 0 271 3 142 0 186 7 292 0 115 7 482 0 62 7 707 0 28 8 907 0 10 5 1041 0 3 2 1088 0 1 0 1041 1 1 0 915 3 0 0 735 7 0 0 533 11 0 0 340 13 0 97 192 13 0 298 88 11 0 598 26 8 0 975 0 4 0 1421 0 1 0 1600 2 0 0 1600 2 0 0 1600 2 0 0 1600 2 0 0 1600 2 0 0 1342 0 0 0 918 0 0 0 562 1 0 0 289 7 0 32 106 17 0 116 10 28 0 255 0 38 0 445 0 45 0 681 0 42 0 917 0 33 0 1105 0 23 0 1210 0 12 0 1214 0 3 0 1117 0 4 0 939 0 53 0 715 0 150 0 482 0 298 0 288 0 491 0 146 0 721 0 54 0 933 0 8 0 1091 0 8 0 1170 0 16 0 1160 0 13 0 1067 0 13 0 911 0 16 0 718 0 10 0 518 0 0 0 337 0 0 0 195 0 46 1 96 0 151 8 40 0 309 19 21 0 506 30 27 0 732 39 41 0 924 41 55 0 1038 36 65 0 1057 28 66 0 983 17 61 0 838 6 52 0 655 0 45 0 462 0 40 0 288 0 42 2 160 36 46 17 73 137 53 44 22 303 57 80 0 528 59 120 0 804 51 158 0 1082 39 180 0 1301 27 179 0 1426 15 157 0 1441 4 121 0 1353 1 80 0 1187 38 46 0 981 111 26 0 773 222 19 0 595 363 23 0 467 532 31 0 392 681 36 0 360 786 35 0 348 826 28 0 335 796 19 0 302 704 10 0 244 566 3 0 177 408 0 0 131 260 1 0 144 145 4 0 249 64 8 0 459 17 14 0 765 0 22 0 1131 0 30 0 1501 2 36 0 1600 4 40 0 1600 5 40 0 1600 5 38 0 1600 5 34 0 1600 4 30 0 1450 1 28 0 1084 0 27 0 726 0 28 0 431 0 29 33 219 0 31 128 84 0 35 284 29 0 39 489 30 0 43 738 44 0 44 986 48 0 41 1175 49 0 35 1274 43 0 26 1272 27 0 16 1173 10 0 8 998 14 0 2 775 48 43 0 539 93 134 0 334 142 270 0 179 192 438 0 73 225 633 0 15 233 796 0 0 223 892 0 0 210 904 0 0 202 833 0 0 206 693 0 0 213 514 0 0 215 336 0 0 199 192 0 0 163 87 20 1 116 24 77 4 71 0 168 6 37 6 286 7 24 14 423 7 30 19 550 6 42 21 631 4 51 22 649 2 55 18 602 0 52 11 502 0 46 4 371 0 39 0 241 0 33 0 136 0 27 0 59 0 21 26 15 2 16 98 8 2 9 215 17 2 6 370 24 2 17 559 26 1 37 749 27 0 56 898 22 0 67 982 13 0 67 989 4 0 58 918 1 0 41 783 11 0 21 604 26 0 5 408 41 27 20 248 53 98 55 124 59 207 98 42 52 345 139 1 40 503 174 0 24 645 180 0 10 733 153 0 2 754 113 0 5 707 70 0 10 605 31 0 13 470 7 36 14 326 0 108 14 201 1 215 11 106 14 348 6 43 35 506 2 8 59 641 0 0 76 730 0 0 79 759 0 0 71 722 0 0 55 630 0 0 31 499 0 0 8 351 0 0 21 220 0 0 137 118 0 1 356 48 0 10 678 9 0 28 1095 0 0 49 1577 0 0 71 1600 0 0 90 1600 0 0 95 1600 0 0 81 1600 0 0 61 1600 0 0 39 1600 0 0 18 1392 0 0 2 922 0 0 0 545 0 0 20 264 0 0 93 86 0 0 221 1 0 0 397 2 0 0 615 13 0 0 846 21 0 0 1032 26 0 0 1141 29 0 0 1153 35 0 0 1067 35 0 0 898 38 0 0 676 43 0 0 448 48 0 0 262 47 0 3 124 39 0 9 79 29 0 16 129 17 0 21 247 6 0 24 384 1 0 21 530 10 0 17 634 19 0 10 670 22 2 4 636 21 5 0 543 22 9 2 418 16 11 5 286 6 11 7 171 0 10 9 88 40 7 9 36 140 4 8 9 296 1 5 0 490 0 2 0 712 0 0 0 903 0 0 0 1010 0 0 0 1015 0 0 0 923 8 0 0 761 48 0 0 569 119 0 0 389 217 0 0 252 337 0 1 172 466 0 4 144 568 0 7 149 624 0 6 164 623 0 6 170 567 0 6 158 465 0 3 132 338 0 0 104 218 0 0 85 121 0 6 79 51 0 67 87 10 0 182 102 0 0 347 116 0 0 549 125 0 0 778 128 0 0 967 126 0 0 1086 121 0 0 1117 114 0 0 1061 108 0 0 932 104 0 0 755 106 0 0 558 114 30 0 364 125 101 0 213 136 211 0 104 140 355 0 35 135 527 0 1 121 687 0 0 102 800 0 0 85 845 4 0 71 813 8 0 60 710 12 0 50 555 14 0 39 379 14 0 29 231 12 0 23 114 8 1 24 48 3 1 32 56 3 1 44 127 8 1 53 213 16 0 51 305 23 0 44 382 29 0 31 412 27 0 16 388 23 0 7 318 16 0 20 224 8 0 47 138 1 0 78 68 3 0 109 21 36 3 137 0 98 8 148 0 188 13 141 0 301 17 120 0 432 18 92 0 543 16 61 0 616 12 37 0 640 7 18 0 611 3 6 0 538 0 0 0 436 0 0 0 325 0 0 0 225 0 0 0 150 0 0 42 106 0 0 154 89 0 0 332 90 0 0 566 97 0 0 844 97 0 0 1110 87 0 0 1301 67 0 0 1387 45 0 2 1358 24 0 6 1225 9 0 11 1019 0 0 14 777 0 0 16 535 0 5 14 326 1 43 11 175 6 111 6 75 13 205 2 21 20 315 0 0 25 430 0 0 26 508 0 0 22 532 0 0 16 494 0 0 9 404 0 0 3 286 0 0 0 180 0 0 0 91 0 0 0 56 0 0 0 82 0 0 0 164 0 0 0 265 0 0 0 378 0 0 0 468 0 0 0 512 0 0 0 503 0 0 0 444 0 0 0 353 0 0 0 252 0 0 0 167 0 0 0 120 0 0 0 123 0 0 0 178 0 0 0 271 0 0 0 380 0 0 0 480 0 0 0 544 2 0 0 559 11 0 0 519 22 0 0 435 33 18 0 325 39 87 0 212 40 205 0 121 34 365 0 56 24 561 0 16 12 767 0 0 3 930 0 0 0 1026 0 0 0 1040 0 0 0 973 0 0 0 839 0 0 0 661 0 0 0 466 0 0 0 293 0 17 0 160 0 83 0 67 0 194 0 15 0 340 0 0 0 512 0 0 0 683 0 0 0 804 0 0 0 854 0 0 0 833 0 0 0 751 3 0 0 627 14 0 0 483 29 18 0 339 48 74 0 213 71 164 0 119 94 283 0 55 114 423 0 16 129 559 0 0 135 651 0 0 129 682 0 0 112 644 0 0 83 546 0 0 56 408 0 0 30 269 0 0 10 153 0 0 0 80 0 0 0 75 0 0 0 135 0 2 2 230 0 8 4 340 0 18 5 444 0 28 7 513 0 38 7 537 0 42 5 516 0 36 4 458 0 29 2 375 0 18 0 283 0 7 0 197 0 0 2 126 0 0 5 77 0 28 8 54 0 85 10 50 0 165 10 58 0 261 8 66 0 371 6 68 0 456 2 59 0 503 0 44 0 503 0 28 0 461 0 13 0 387 0 3 0 297 0 2 0 205 0 10 0 125 0 22 0 67 40 38 0 28 129 56 0 7 266 73 0 0 442 81 0 0 655 79 0 0 850 67 0 0 992 49 0 0 1057 31 0 0 1035 15 0 0 933 4 0 0 769 0 0 0 571 0 0 0 374 0 0 3 217 0 0 39 101 0 0 106 30 0 0 203 11 0 0 324 24 0 0 463 33 0 0 575 37 0 0 640 43 0 0 643 43 0 0 584 42 0 0 473 48 1 0 336 59 4 0 211 69 7 0 114 74 9 0 80 66 10 0 120 51 9 0 225 34 7 0 359 16 4 0 505 4 1 0 617 0 0 0 666 7 0 0 641 29 0 0 548 59 0 0 412 91 0 0 274 118 0 0 168 130 0 0 128 118 0 0 163 91 0 0 268 59 0 0 415 29 0 0 572 7 0 0 700 0 0 0 777 9 0 0 789 27 0 2 738 48 0 7 638 65 0 13 510 76 35 19 375 73 115 24 252 59 238 25 155 40 396 22 86 30 586 16 43 33 762 10 18 49 889 4 8 66 945 1 4 79 923 0 2 79 831 0 0 68 689 0 0 51 522 0 0 34 361 0 32 22 228 0 105 16 135 0 217 17 80 0 355 22 52 0 515 30 38 0 656 41 30 0 744 52 22 0 763 56 12 0 712 52 3 0 601 42 0 0 454 29 3 2 303 15 7 9 181 4 10 16 118 0 12 22 131 0 13 26 221 0 11 25 371 0 7 20 547 0 3 13 714 0 0 6 839 0 0 1 900 0 0 0 887 9 0 0 807 27 15 0 679 51 68 0 524 78 159 0 366 109 285 0 227 131 442 0 124 141 609 0 54 137 749 0 15 120 838 0 0 95 864 0 0 65 825 0 0 41 732 0 0 20 602 0 0 6 457 0 0 0 320 0 0 0 207 0 15 0 128 0 67 0 79 0 155 0 54 0 274 0 41 0 417 0 31 0 560 0 23 0 663 0 15 0 706 0 6 0 679 0 0 0 588 0 0 0 452 1 2 0 304 9 6 0 180 28 10 41 85 57 13 123 25 89 16 241 0 120 15 386 0 138 11 556 0 138 7 699 0 123 3 791 0 102 0 823 0 86 0 795 0 84 0 715 0 99 0 601 0 122 0 468 0 141 33 337 0 145 106 220 0 127 220 128 0 96 371 65 0 63 558 29 0 31 739 15 0 8 883 15 0 0 965 20 0 17 973 25 0 48 901 27 0 88 764 25 0 128 585 20 0 166 400 15 0 180 242 11 0 168 144 10 1 137 120 10 2 102 167 10 2 76 267 10 2 68 390 8 2 78 504 6 1 99 581 3 0 121 605 1 1 133 574 0 4 134 492 0 6 127 381 0 7 117 265 0 8 112 169 0 7 116 115 1 5 125 114 2 2 135 166 2 0 140 256 2 0 133 363 2 0 114 462 1 0 87 531 0 0 61 556 0 0 44 529 2 0 42 460 8 0 58 362 17 0 85 260 29 0 113 178 41 0 131 139 53 0 131 153 62 0 110 218 66 0 80 318 64 0 49 428 58 0 22 526 45 0 12 591 32 0 19 612 20 0 29 587 9 0 35 523 2 0 38 430 1 0 32 325 4 0 23 219 6 1 12 132 6 31 3 67 7 86 0 26 6 162 0 4 3 251 0 0 1 349 0 0 0 422 0 0 0 457 1 0 0 450 3 0 1 408 2 2 3 339 2 5 6 258 2 8 8 178 5 12 9 109 44 17 8 59 137 20 6 25 289 21 3 7 496 16 1 0 747 13 0 0 985 9 2 0 1161 4 6 0 1235 0 13 0 1189 0 18 0 1033 24 24 0 801 86 28 1 543 183 28 2 324 306 28 2 158 451 27 2 57 585 28 2 30 676 29 1 55 710 29 0 81 685 28 0 98 608 26 0 106 495 23 0 93 364 21 0 75 236 21 0 72 137 24 0 96 64 28 42 150 19 33 128 216 0 38 250 269 0 42 398 285 0 45 567 253 0 48 703 194 0 50 783 125 0 50 796 60 0 48 745 13 0 44 643 0 0 40 512 0 0 37 371 13 0 35 237 41 0 35 135 98 0 37 64 195 0 39 20 341 0 42 0 523 0 43 0 720 0 44 0 896 0 41 0 1012 0 36 0 1038 0 29 0 963 0 22 0 804 0 17 0 598 0 15 0 396 0 17 0 240 0 22 31 153 0 26 92 134 0 28 180 164 0 25 289 212 0 19 418 249 0 13 527 258 0 6 598 237 0 1 622 191 0 0 598 132 3 4 533 82 13 11 441 43 30 20 336 17 50 30 233 1 71 40 143 2 85 44 78 54 85 41 34 149 71 32 10 282 52 23 0 437 31 13 0 604 13 4 0 720 4 3 0 760 13 13 0 718 27 26 0 604 41 40 0 448 53 52 0 292 60 59 0 164 54 56 51 70 41 47 151 21 27 35 299 16 13 25 485 26 4 20 706 28 0 19 896 28 0 21 1025 27 0 24 1071 18 0 26 1030 6 0 28 913 7 0 28 742 36 32 28 547 77 101 28 357 118 208 28 207 152 349 28 99 168 524 30 34 151 691 38 2 115 825 53 0 73 904 74 0 34 914 101 0 8 854 129 0 0 732 153 0 0 568 170 0 0 387 176 13 0 236 171 82 0 119 156 201 0 41 133 363 0 2 108 557 2 0 84 762 8 0 67 915 16 0 61 989 26 0 69 972 39 0 90 869 56 0 119 703 78 0 151 505 102 0 177 321 126 0 191 175 144 0 191 100 146 0 177 108 128 0 152 196 98 0 122 325 66 0 95 473 34 0 73 601 10 0 58 676 2 0 49 683 8 0 43 623 16 0 38 513 24 5 32 381 33 12 26 256 42 21 23 163 47 29 26 121 46 36 34 133 41 36 49 190 32 30 64 277 23 22 76 370 13 13 83 449 4 5 85 495 0 0 83 497 7 0 83 453 18 0 86 370 28 1 93 268 37 2 99 173 47 2 101 110 54 2 94 101 61 2 80 151 71 1 59 252 84 0 39 376 95 0 23 494 100 0 15 576 94 0 13 603 76 0 16 569 54 0 21 485 32 0 25 372 15 0 27 259 3 0 29 173 0 0 31 134 0 0 34 149 0 0 39 216 0 0 42 316 0 0 43 423 0 0 39 514 0 0 31 569 0 0 22 575 0 0 13 536 0 0 5 463 0 0 1 370 0 0 0 272 0 0 0 184 43 0 0 110 139 1 1 60 285 2 7 27 466 2 16 8 676 2 28 0 856 2 39 0 968 2 49 0 996 1 55 0 943 15 56 0 827 47 54 0 674 102 51 0 510 182 50 0 356 287 52 0 226 399 57 0 128 505 64 0 63 587 72 0 24 631 78 0 4 625 83 0 0 568 87 0 0 468 90 4 0 342 92 11 0 221 93 18 0 122 91 24 5 73 87 27 20 84 82 25 40 150 78 19 60 244 79 12 78 350 86 5 91 434 99 0 94 475 114 0 89 461 126 0 81 395 130 0 70 293 125 0 57 194 112 6 42 107 98 17 30 56 87 30 17 70 83 42 9 152 86 51 19 269 92 51 46 409 96 42 75 551 95 30 100 657 88 17 118 711 78 6 118 707 67 0 100 651 59 0 74 558 53 0 46 446 51 0 24 330 51 0 10 223 53 0 4 135 56 26 0 73 61 76 0 32 66 149 0 9 70 236 0 0 71 337 0 0 70 415 0 0 67 455 5 1 64 444 25 5 61 386 55 10 60 291 87 14 60 196 114 17 62 111 129 18 65 51 122 15 67 50 95 11 68 110 63 7 66 201 33 3 60 306 12 1 51 416 7 0 40 492 14 0 29 521 22 0 20 500 28 0 14 435 31 34 9 340 28 107 6 233 21 219 4 144 13 364 2 74 10 537 0 26 15 691 2 2 26 798 6 0 38 840 10 0 47 811 12 0 49 719 13 0 46 585 11 0 42 432 8 0 49 283 4 0 70 165 1 18 106 81 0 76 147 28 0 170 181 3 0 294 194 0 0 440 182 0 0 584 147 0 4 686 102 0 10 729 60 0 16 706 32 2 23 623 25 8 29 497 38 15 32 352 61 21 33 221 90 25 34 118 119 26 37 63 141 21 44 67 153 15 52 128 153 8 62 221 140 2 70 332 118 0 76 438 95 0 80 513 77 0 83 544 69 0 82 525 70 0 81 462 73 15 77 366 73 74 72 257 65 170 66 160 51 299 61 85 36 452 56 33 28 609 53 5 25 727 50 0 27 792 47 0 31 794 44 0 36 739 43 0 46 635 43 0 68 498 48 0 105 347 54 0 153 218 60 0 201 116 64 27 236 45 65 98 248 6 62 206 236 0 56 339 207 0 49 489 170 0 40 618 135 0 32 687 108 0 23 685 87 0 17 617 69 0 15 499 50 0 20 356 33 0 34 225 18 0 56 122 10 0 84 71 12 0 113 80 25 0 137 145 44 0 152 244 66 0 152 363 83 0 138 475 91 0 113 556 84 0 82 594 66 0 52 584 46 0 30 529 26 14 18 439 9 73 16 331 0 174 19 219 0 310 23 130 0 475 24 63 0 649 20 21 0 787 14 0 0 865 8 0 0 874 2 0 0 816 0 0 1 702 0 0 4 555 0 0 10 399 0 0 22 258 1 4 37 147 1 35 55 73 1 93 69 30 0 180 77 10 0 294 72 5 0 428 58 3 0 551 41 2 0 641 23 0 0 682 9 0 2 666 0 0 6 596 0 0 9 488 0 22 12 362 2 68 12 240 3 141 11 140 4 241 8 71 4 365 4 33 4 486 1 18 3 585 0 14 2 644 0 13 0 652 0 12 0 608 0 10 0 519 0 4 0 402 0 0 0 274 3 0 4 167 8 3 25 85 14 37 57 31 18 101 95 3 21 192 130 0 21 304 150 0 20 433 144 0 19 541 116 0 22 610 80 0 28 632 42 0 39 605 13 0 50 534 0 0 60 432 0 0 66 316 17 0 67 204 72 0 64 117 165 0 58 54 294 0 50 15 454 0 43 0 622 0 35 0 765 0 30 0 865 0 26 0 915 0 25 0 914 0 27 0 866 4 30 0 779 14 34 0 661 29 37 0 523 45 37 0 378 62 33 0 242 72 28 27 138 72 21 83 64 62 15 167 19 45 11 278 0 29 11 412 0 15 14 533 0 4 18 621 0 0 22 661 3 0 25 646 30 0 28 577 78 0 33 469 143 38 38 339 212 115 43 218 277 230 47 121 308 375 47 52 298 551 43 12 249 708 36 0 178 822 29 0 110 876 24 0 55 864 22 0 18 790 24 0 0 667 27 0 0 513 29 0 0 354 28 23 0 218 24 86 0 114 19 187 0 46 13 322 0 9 8 484 0 0 4 642 0 0 2 760 0 0 0 821 0 0 0 818 0 5 2 755 0 17 7 648 0 33 13 516 0 51 17 378 0 72 20 250 0 88 19 147 35 97 15 76 112 98 9 30 236 91 4 6 400 75 0 0 603 54 0 0 799 37 0 0 953 21 0 0 1042 8 0 0 1054 0 0 0 991 8 1 0 869 46 5 0 714 114 11 0 556 208 17 0 417 323 23 0 312 450 27 0 240 553 27 0 194 618 24 0 157 635 18 0 117 603 11 0 83 529 6 0 51 423 2 0 22 305 0 0 7 195 0 0 17 112 0 0 32 70 0 0 41 76 0 0 43 124 1 0 42 201 7 0 33 285 16 0 18 357 28 0 14 397 42 0 28 394 56 0 48 348 67 0 64 267 76 0 77 183 83 0 78 107 90 0 68 47 96 0 56 45 102 0 49 104 104 0 50 199 102 0 62 310 93 0 80 431 78 0 101 516 57 0 122 548 38 0 141 523 21 0 155 453 9 0 158 355 0 0 146 252 0 0 119 160 23 0 86 89 80 0 54 43 173 0 25 17 296 0 5 4 446 0 3 0 591 0 16 0 701 0 34 0 757 0 53 0 753 0 69 0 691 0 78 0 586 0 72 0 456 0 55 0 321 4 37 0 200 19 19 0 110 46 6 0 49 86 0 0 13 138 0 0 0 196 0 0 0 248 0 0 0 285 0 0 1 299 0 0 3 290 0 0 4 258 0 2 4 210 0 4 4 157 6 6 3 110 18 6 2 83 33 6 0 84 50 4 0 116 67 2 0 175 78 0 2 253 81 0 4 332 79 0 5 398 75 0 5 435 71 0 5 436 67 0 4 399 63 0 2 335 54 0 0 258 41 0 0 188 29 0 0 142 17 0 0 128 6 0 0 147 0 0 0 192 0 0 0 248 1 0 0 300 1 0 0 338 1 2 0 352 1 10 0 341 0 20 0 305 0 32 0 250 10 43 0 182 48 50 0 119 112 49 0 67 200 40 0 29 317 28 0 6 454 17 3 0 587 7 9 0 700 1 16 0 776 0 22 0 803 0 26 0 770 0 25 0 682 0 20 0 548 0 14 0 393 0 8 8 249 0 2 44 137 0 0 106 58 0 0 192 13 0 0 298 0 0 1 414 0 0 1 509 0 0 1 569 0 0 1 585 1 0 1 553 25 0 0 478 70 0 0 374 134 0 0 255 211 0 0 156 294 0 41 78 351 0 134 26 369 0 277 0 345 0 460 2 285 0 678 4 207 0 874 3 131 0 1008 3 73 5 1058 4 37 15 1017 2 24 26 896 0 24 36 722 4 30 44 528 14 36 44 344 32 38 35 197 58 35 25 96 93 28 14 35 133 22 5 6 174 15 3 0 209 7 10 0 233 1 17 0 239 0 24 0 226 0 32 0 196 0 37 0 152 0 39 0 103 0 41 0 62 0 44 0 31 23 46 0 10 89 47 0 0 192 45 0 0 319 42 0 0 461 37 0 0 587 34 0 0 660 35 0 0 667 40 0 0 609 46 0 0 504 54 0 0 374 58 0 0 245 56 0 0 141 49 0 21 74 37 0 66 49 25 0 132 54 14 0 213 72 6 0 308 82 0 0 387 76 0 0 436 62 0 0 448 39 1 0 420 15 2 0 359 6 3 0 281 13 3 0 204 19 3 0 144 19 3 0 119 20 1 0 137 17 0 0 192 10 0 0 270 3 0 0 351 0 0 9 413 0 0 28 444 0 0 56 435 0 0 91 390 0 0 128 320 0 0 157 237 0 1 168 154 4 3 159 90 32 3 134 42 87 3 98 13 171 3 63 0 284 2 34 0 418 1 13 0 543 0 2 4 636 0 0 7 679 0 0 10 662 0 2 12 590 15 7 12 477 49 12 9 345 102 16 6 220 170 19 2 122 252 17 0 56 325 13 0 27 375 9 0 26 393 4 0 41 377 0 0 54 333 0 0 63 269 0 0 59 198 0 1 47 128 0 19 31 75 0 57 16 36 0 118 4 12 0 202 0 0 0 305 0 0 0 407 0 0 0 491 0 0 0 543 0 0 0 552 0 0 6 514 0 0 16 434 0 0 28 326 0 0 40 218 0 0 51 126 0 1 54 69 0 4 50 68 4 8 39 125 21 10 26 216 48 9 15 322 77 9 6 425 104 7 1 501 124 3 0 537 128 0 0 531 125 0 0 489 122 5 0 420 125 33 0 330 131 81 0 235 135 147 0 150 123 228 0 83 99 317 0 35 71 394 0 7 39 445 0 0 12 465 0 0 3 451 0 0 23 407 0 0 55 337 0 0 90 254 0 0 127 170 0 0 165 101 0 12 190 49 0 49 204 21 0 106 213 12 0 179 219 14 0 265 220 16 0 347 212 18 0 404 190 15 0 431 153 10 0 423 109 8 0 384 68 13 0 319 35 30 0 238 18 62 0 158 13 112 0 92 14 177 0 42 13 251 2 11 13 324 6 0 9 385 10 4 5 423 12 8 10 431 13 7 21 408 11 7 29 358 8 8 30 291 4 6 30 216 1 0 25 144 0 0 14 86 0 22 10 44 0 65 24 17 0 123 48 6 0 192 71 7 0 271 92 10 5 332 104 11 12 367 101 12 20 374 87 10 27 354 71 6 32 314 59 2 30 260 60 0 24 199 75 0 16 138 109 1 9 86 162 1 8 46 231 1 11 19 311 1 15 4 395 0 17 0 472 0 17 0 535 0 16 0 573 0 18 0 581 0 29 0 556 0 49 0 497 2 76 0 408 5 105 0 299 10 126 0 197 14 133 0 112 17 123 20 48 15 98 58 10 13 68 118 0 8 40 192 0 3 18 281 0 0 4 357 0 0 0 409 0 0 0 426 1 9 0 403 17 28 0 346 41 60 0 265 70 108 0 179 101 180 0 106 133 264 0 50 155 356 0 14 168 446 0 0 170 522 0 0 162 571 0 0 144 588 0 0 115 568 0 0 83 516 0 0 52 441 0 0 25 353 0 0 7 265 0 4 0 185 0 36 3 120 0 92 24 71 0 168 59 38 0 257 99 18 0 352 133 7 0 423 157 2 0 461 152 0 0 462 121 0 0 429 84 5 0 368 45 11 2 290 15 16 3 208 0 18 3 136 0 19 3 86 13 16 3 71 33 11 2 93 56 5 0 145 75 1 0 211 92 0 0 277 94 0 0 325 87 0 0 344 77 0 2 332 71 0 3 293 70 1 3 237 70 20 3 173 68 59 3 115 59 115 2 68 48 186 1 36 40 269 4 20 39 341 8 15 46 392 14 17 56 414 19 19 64 407 24 21 63 375 24 19 56 325 21 15 48 268 15 10 43 211 10 5 44 160 8 2 48 117 17 0 48 81 39 0 43 52 75 0 33 31 120 0 21 15 169 0 10 4 211 0 5 0 239 0 3 0 248 0 3 0 238 0 3 3 214 0 2 10 182 0 0 20 148 0 0 29 117 0 9 38 91 0 63 42 69 0 159 39 51 0 290 30 34 0 443 20 22 0 605 11 15 0 727 3 15 1 796 0 21 5 810 0 32 8 782 0 41 11 728 0 45 13 659 16 44 12 579 50 37 9 491 103 29 6 399 170 23 2 309 253 19 0 231 326 17 0 172 379 15 0 135 402 12 0 117 391 8 0 107 351 4 0 96 290 1 0 78 219 1 0 56 148 3 6 35 89 4 25 17 47 4 58 4 20 5 104 0 5 4 163 0 0 2 228 0 0 0 286 0 0 0 330 0 0 0 354 0 0 0 354 0 0 0 329 0 0 0 285 0 3 0 226 8 30 0 160 25 79 0 102 50 150 0 56 77 241 0 24 101 343 0 5 112 431 0 0 105 489 0 0 82 508 0 0 55 486 0 0 30 429 0 0 10 349 0 0 0 259 0 4 0 172 0 20 0 101 0 47 0 51 0 87 0 19 0 140 0 3 0 201 0 0 0 258 0 0 2 305 0 0 9 333 0 2 21 340 0 6 35 324 0 12 50 289 0 20 59 238 0 30 58 180 14 38 48 121 45 44 35 74 92 46 20 39 155 42 8 15 237 34 11 2 321 24 25 0 400 14 39 0 471 6 51 0 529 1 59 0 574 0 59 0 602 0 55 0 608 0 51 0 586 0 53 0 530 0 60 0 443 0 69 0 332 0 74 13 221 0 74 48 128 0 67 98 58 0 57 161 15 0 47 235 0 0 41 305 0 0 38 355 0 0 37 380 7 0 38 377 37 0 37 350 81 0 34 302 131 16 29 238 179 62 22 169 213 133 15 107 215 224 8 59 189 333 4 24 147 437 5 5 103 513 9 0 71 553 12 0 53 554 13 0 44 523 12 0 38 465 10 0 31 390 6 0 23 305 2 0 13 219 0 13 4 140 0 54 9 80 0 118 23 37 0 201 36 10 0 298 44 0 3 388 49 0 10 447 44 2 20 466 33 7 33 443 19 15 49 385 7 22 64 306 1 28 74 220 0 30 77 141 0 25 74 79 17 18 64 37 71 11 49 12 158 4 33 2 265 0 20 2 385 3 10 2 497 14 3 2 573 30 0 2 605 51 0 2 600 75 0 0 561 96 0 0 494 107 0 0 404 104 1 0 294 89 1 3 196 65 1 32 112 42 1 86 46 21 1 159 5 7 0 247 0 0 0 344 18 0 5 421 53 0 11 465 94 0 16 473 130 0 20 448 159 0 23 395 161 0 24 326 135 0 26 252 96 0 34 186 56 0 46 139 23 0 59 122 4 0 69 137 0 0 69 183 0 0 60 248 0 0 47 315 5 0 34 366 29 0 28 383 66 0 31 359 106 0 41 298 141 0 51 215 164 0 55 136 161 0 52 80 139 0 42 66 112 0 30 99 91 0 19 171 80 0 13 256 77 0 12 340 73 0 13 404 61 0 15 437 46 0 17 441 27 0 21 419 10 0 26 380 0 10 32 328 0 43 39 268 0 99 43 202 0 171 42 136 0 259 34 83 0 350 25 43 0 423 15 15 0 471 7 0 0 489 7 0 10 481 14 0 38 448 21 0 75 397 26 0 112 334 27 0 140 267 23 9 147 201 17 39 126 142 12 87 93 93 13 153 55 55 19 232 21 29 25 313 1 13 29 376 0 4 26 412 0 2 21 415 0 7 13 387 0 13 5 336 0 20 3 270 0 28 9 198 0 33 15 131 8 34 19 77 52 30 22 40 131 23 22 16 240 15 18 4 369 9 13 0 501 4 9 0 595 4 7 0 631 8 5 0 605 13 3 0 529 20 2 0 425 25 1 0 312 30 0 0 210 32 0 13 127 32 0 43 70 31 0 89 34 30 0 150 12 29 0 226 1 29 0 299 0 33 0 355 0 40 0 386 0 50 0 384 0 61 0 348 0 69 0 284 0 72 0 207 0 65 0 133 6 51 0 80 21 36 0 63 39 20 0 83 58 8 0 137 71 0 0 212 70 0 2 289 59 0 8 351 43 0 13 387 23 0 18 388 12 0 23 355 30 0 27 295 67 0 32 225 105 0 39 161 136 0 50 121 152 0 60 115 140 0 64 144 108 0 62 199 70 0 52 265 34 0 39 328 9 0 30 377 2 0 28 406 5 0 34 411 12 0 45 393 24 4 54 352 43 36 58 291 63 90 56 218 82 165 51 144 93 254 48 83 93 351 52 38 81 426 63 10 62 471 80 0 43 480 98 0 26 456 112 0 15 404 121 0 8 333 123 0 6 254 122 0 4 173 118 18 2 106 113 54 7 56 104 107 21 22 91 171 38 4 73 246 53 0 52 311 62 0 32 356 58 0 19 377 47 3 14 373 32 8 18 348 15 14 27 306 1 20 33 253 0 25 34 194 15 27 29 136 53 25 21 85 108 23 11 47 181 22 4 21 271 25 0 6 361 29 0 0 435 35 0 0 484 36 0 0 497 31 0 0 473 24 0 1 410 16 0 4 318 7 0 7 217 5 0 8 131 13 0 9 81 23 1 8 93 30 4 6 173 35 8 2 308 33 10 0 475 27 13 0 646 17 17 0 786 8 23 0 873 3 37 0 896 3 58 0 854 4 86 0 757 4 115 0 624 4 136 0 481 4 143 0 360 2 136 0 290 0 116 0 291 0 91 0 365 0 69 0 491 0 58 0 633 0 58 0 745 0 68 0 795 0 83 0 763 0 98 0 656 0 109 0 495 0 116 0 329 0 117 7 190 0 114 41 86 0 107 100 21 0 96 180 6 0 82 275 24 0 67 375 43 0 53 455 51 0 43 504 51 0 36 522 50 0 34 510 37 0 35 476 17 0 37 422 15 18 41 353 36 55 44 274 60 113 49 191 81 189 54 119 102 283 60 63 114 372 64 25 119 443 67 3 123 486 70 0 127 498 74 0 127 478 78 0 117 430 84 0 93 362 88 0 68 284 88 3 39 204 82 22 15 133 71 55 10 76 57 100 22 37 43 157 31 14 33 219 35 3 31 271 36 0 35 307 31 0 44 321 20 0 56 312 9 0 68 284 1 2 79 239 0 4 86 184 0 7 89 127 5 8 84 78 41 10 73 41 105 12 54 16 194 17 36 3 301 25 19 0 421 37 7 0 519 51 1 0 581 64 5 0 598 76 11 0 565 88 15 0 487 103 17 0 375 126 17 0 256 159 13 0 154 202 9 0 73 251 4 0 20 299 0 0 0 338 0 0 0 360 0 0 0 363 0 0 0 345 0 3 0 310 0 6 0 263 0 9 12 209 0 11 46 154 0 11 101 100 1 9 172 60 2 6 261 30 2 3 356 10 2 0 448 0 3 0 538 0 8 0 626 0 21 0 707 0 40 0 767 0 64 0 786 0 89 0 748 0 112 0 649 0 128 0 507 0 137 0 355 0 138 11 228 0 132 45 152 0 117 99 130 0 97 172 149 2 74 261 178 4 52 355 193 3 35 433 179 3 25 487 138 3 21 513 92 2 20 508 49 0 19 474 16 2 16 416 0 21 11 340 0 55 5 255 0 101 1 174 7 155 0 104 19 216 1 54 33 266 2 22 44 299 4 5 52 314 8 0 50 310 14 0 41 288 22 0 28 252 29 0 17 206 32 0 11 157 30 0 8 109 24 18 7 67 17 57 6 36 9 117 5 17 2 191 2 5 1 279 0 0 5 355 0 0 10 408 0 0 18 427 6 4 29 412 26 14 41 368 55 31 53 307 87 58 60 236 119 95 60 169 140 139 52 111 145 185 39 66 134 228 26 35 117 264 14 17 101 286 11 6 92 294 16 1 89 289 23 0 87 272 28 0 81 247 29 0 69 218 25 0 52 189 18 0 35 161 9 0 21 133 2 9 12 107 0 34 7 81 0 74 5 57 0 126 4 36 0 186 2 20 0 239 0 8 0 272 6 3 0 278 22 5 0 259 42 10 0 221 61 17 0 177 80 25 0 132 98 33 0 93 115 37 0 62 142 38 0 38 183 35 0 22 237 27 5 12 295 19 16 4 343 11 32 0 369 5 50 0 371 0 70 0 357 1 86 0 339 3 95 0 328 4 96 0 326 4 91 0 328 5 80 0 326 4 66 3 311 2 51 17 283 0 39 41 245 0 34 75 209 0 37 116 181 0 50 161 166 0 71 200 163 0 97 229 167 0 121 245 168 0 141 248 161 0 153 238 142 10 158 213 110 36 155 175 77 76 145 128 47 129 130 84 21 193 111 47 4 256 90 19 0 307 71 3 3 342 55 4 16 358 44 3 35 357 37 3 58 339 31 3 81 308 27 4 98 265 24 0 102 217 22 8 91 166 24 34 70 120 28 75 49 81 32 125 31 52 33 185 24 35 31 246 31 25 24 292 48 21 16 320 72 19 8 328 99 17 4 316 123 13 8 287 137 9 17 244 137 5 28 190 126 2 38 135 110 1 44 84 100 5 44 46 109 12 38 20 142 23 28 5 204 35 18 0 283 46 9 0 364 52 4 0 429 55 1 0 463 56 0 0 456 61 0 0 411 75 0 0 340 103 0 0 259 145 0 0 184 197 0 0 124 254 0 0 81 304 0 0 53 343 0 0 35 365 0 0 24 369 0 0 21 357 0 0 28 333 0 0 44 300 0 0 64 259 0 0 82 216 0 0 91 172 0 0 90 130 0 14 86 93 0 39 83 64 2 74 82 43 8 117 81 29 13 169 76 19 17 216 62 12 18 253 47 8 17 279 28 5 13 292 11 10 9 288 0 28 12 267 0 58 25 228 0 99 41 176 7 150 55 119 21 202 62 72 39 248 56 34 56 283 45 9 71 304 29 0 75 312 13 0 69 306 2 0 57 288 5 0 47 261 11 1 46 228 18 5 58 192 25 10 81 157 31 19 111 123 33 34 138 91 29 54 157 63 23 81 161 39 16 114 149 22 12 150 125 9 11 182 95 2 14 205 68 0 17 215 50 0 18 211 42 0 17 193 41 0 16 167 42 0 19 137 42 0 35 108 38 0 69 81 34 0 121 58 32 0 185 39 38 0 252 24 48 0 311 13 60 0 356 7 66 0 385 7 64 0 397 13 51 0 394 22 36 0 378 31 20 0 347 38 7 0 304 40 0 0 254 36 0 2 207 27 0 7 175 18 0 11 165 10 2 15 179 3 3 17 211 0 3 16 250 0 3 12 284 0 3 7 306 0 2 3 313 0 0 0 305 0 3 0 287 0 11 2 262 0 23 8 233 0 36 19 201 0 49 32 168 0 60 43 136 4 65 50 105 13 62 49 77 27 52 39 51 45 39 27 31 66 26 15 16 83 14 5 6 94 5 0 0 94 0 0 2 86 1 0 5 72 3 0 6 59 6 0 7 51 8 0 7 53 10 2 6 65 10 10 3 83 9 21 1 102 9 33 0 115 13 44 0 118 22 50 0 111 34 46 0 98 46 36 0 84 52 24 0 73 48 12 0 68 39 3 0 70 27 0 3 74 14 0 11 78 9 2 21 79 26 6 31 77 53 10 40 72 79 13 45 65 102 17 43 59 115 19 38 55 111 21 30 53 95 25 23 49 73 35 17 45 54 53 14 41 41 80 12 35 35 113 11 28 40 152 11 21 57 191 12 14 84 225 15 9 120 249 19 6 156 262 25 2 183 265 29 0 191 258 34 0 175 246 37 0 141 231 37 3 99 216 34 9 64 197 28 17 49 175 20 28 57 148 12 43 84 117 6 61 120 86 2 82 150 58 0 105 165 36 0 127 159 21 0 145 134 12 0 154 96 6 0 156 61 4 0 151 32 2 1 141 11 0 1 130 0 0 1 119 6 2 0 106 19 7 0 92 40 12 0 75 71 19 0 56 112 25 0 38 156 29 0 24 197 27 0 14 233 23 0 9 259 17 0 6 276 10 0 4 283 5 0 3 279 4 0 4 264 8 0 7 237 19 0 15 201 31 4 27 162 41 8 42 126 46 13 60 98 43 16 79 79 34 18 97 67 23 17 113 56 11 15 125 43 3 16 132 30 0 23 132 17 0 35 125 6 0 52 114 0 0 69 101 0 0 82 91 0 2 87 85 0 4 84 84 0 4 73 88 0 4 58 94 0 4 43 101 0 3 30 108 0 1 20 113 0 0 16 118 0 0 17 122 3 0 25 123 12 0 40 121 23 0 63 114 32 0 96 100 38 0 136 79 39 0 181 56 36 0 226 35 39 0 266 19 55 2 297 7 87 5 317 0 129 10 326 0 166 16 328 0 186 22 324 0 175 25 315 0 138 27 300 0 96 24 279 0 53 20 249 2 18 14 210 10 3 9 165 21 14 4 120 36 26 2 81 51 33 0 54 64 38 0 40 71 40 0 40 74 37 0 48 71 36 0 58 67 41 0 63 64 49 0 59 62 58 0 48 62 59 0 34 65 54 1 19 75 45 1 8 90 40 2 1 111 47 2 0 132 67 2 0 150 93 1 0 157 117 0 0 154 131 0 0 140 133 1 2 121 134 6 6 100 146 14 11 84 177 24 15 68 223 34 17 55 267 44 16 45 287 48 13 38 268 46 9 35 212 43 4 41 148 41 0 53 80 47 0 69 27 61 0 82 0 81 0 87 0 102 0 84 0 119 0 72 0 127 0 56 0 129 0 42 0 131 0 32 0 136 0 26 0 149 0 24 0 167 0 20 2 185 0 16 6 195 0 11 9 196 0 8 11 188 0 10 11 176 0 17 10 164 0 25 11 156 3 31 19 153 6 33 33 152 10 28 52 148 12 21 69 143 12 12 75 135 11 4 67 127 8 0 53 122 3 0 33 121 0 0 15 124 4 0 2 128 11 0 0 131 19 0 13 129 27 0 46 123 35 0 92 113 37 2 145 102 34 7 196 92 26 12 224 85 18 15 216 81 13 17 176 78 14 15 125 76 19 12 73 76 29 7 30 76 41 4 4 77 51 6 0 77 59 12 1 73 64 18 2 66 65 23 8 55 63 27 22 41 58 29 47 26 54 31 81 15 50 32 120 7 47 35 158 2 44 37 187 0 40 40 204 0 35 43 206 0 28 46 197 0 24 49 177 0 28 51 148 0 45 52 112 0 76 52 78 0 119 52 48 0 166 52 33 0 210 52 40 0 243 51 65 0 263 48 94 1 270 39 117 7 270 29 122 17 266 18 105 30 262 8 77 44 255 1 46 57 243 0 20 67 219 0 4 76 183 0 0 88 136 0 8 107 90 0 34 138 51 0 77 178 22 0 133 220 4 0 197 258 1 0 253 281 3 0 286 285 2 0 288 269 2 0 263 238 3 0 218 199 2 0 165 156 0 0 117 116 0 0 80 81 0 2 56 53 1 11 46 34 5 22 45 22 10 36 49 18 14 50 56 17 19 63 64 18 20 72 75 18 18 79 91 16 14 81 112 14 9 81 133 12 4 74 148 14 1 62 148 18 0 48 131 24 0 33 99 28 2 21 66 30 6 17 34 27 9 20 11 21 12 27 0 14 14 36 0 7 15 44 0 2 17 51 3 0 21 57 29 0 31 63 73 0 47 71 130 0 68 78 185 0 90 82 230 0 107 83 236 0 115 76 203 0 114 64 151 0 105 49 93 0 90 33 44 2 75 20 28 6 62 14 41 14 53 14 56 21 46 18 60 29 45 23 60 34 46 28 49 38 51 30 29 39 61 27 9 39 74 21 9 38 89 15 28 35 103 8 50 29 118 3 70 22 132 0 90 14 148 0 103 7 167 0 105 2 188 0 100 0 207 3 89 0 219 8 74 0 221 16 58 0 209 25 41 0 186 37 29 0 155 47 28 0 122 54 43 0 93 58 72 0 69 60 107 0 50 58 137 4 36 56 152 11 27 52 147 20 20 51 124 32 17 51 93 47 14 53 67 61 11 52 56 73 8 46 61 80 5 36 75 81 2 26 87 76 0 15 86 69 0 5 73 62 0 0 53 61 0 0 40 67 0 0 46 79 1 0 78 92 8 0 124 102 19 0 170 105 32 0 204 100 43 0 216 89 49 0 208 76 47 0 189 64 38 0 166 55 28 0 145 49 23 0 124 45 28 0 98 40 41 0 71 35 59 4 47 29 75 14 23 24 83 31 6 19 82 52 3 17 72 75 16 15 56 93 33 13 37 99 51 10 23 93 63 7 12 75 69 5 5 52 63 2 0 32 50 0 0 18 37 0 9 13 33 0 25 12 39 0 47 12 54 0 73 11 75 0 101 10 100 0 121 6 123 2 133 6 142 5 134 11 151 7 127 19 147 8 113 25 128 8 96 30 96 6 76 31 65 4 54 31 35 2 35 31 13 0 22 33 0 0 18 41 0 0 24 52 0 0 37 63 0 0 50 72 4 0 59 76 24 3 59 74 56 11 52 65 95 24 41 50 133 41 31 35 161 62 27 21 166 82 31 10 151 97 41 6 129 107 53 11 113 109 63 21 114 104 67 30 129 92 64 36 146 76 56 37 153 57 44 33 138 38 31 28 107 22 20 27 71 11 13 34 36 3 7 50 10 0 5 71 1 0 3 94 4 0 2 113 10 0 0 126 21 0 1 131 35 0 3 128 49 1 6 120 58 3 9 110 58 3 10 101 49 3 9 96 36 2 7 94 22 2 4 94 8 0 1 95 1 0 0 96 0 3 0 95 0 7 0 97 0 12 0 102 5 20 0 109 20 28 0 118 43 34 0 124 67 37 0 124 90 36 0 115 105 31 0 98 106 22 0 76 94 14 0 51 75 7 0 31 56 2 0 17 44 1 0 10 42 6 0 9 50 13 2 12 64 22 4 17 83 29 5 19 103 36 5 19 122 36 5 16 140 32 4 13 158 27 1 8 174 21 0 4 188 19 4 1 196 20 16 0 194 25 33 0 183 31 56 0 164 39 82 0 140 45 106 0 114 52 121 1 90 59 126 6 68 66 121 13 49 74 110 22 36 81 97 29 36 84 85 33 50 81 74 32 78 74 62 25 114 60 46 17 143 45 33 10 151 34 20 11 134 31 8 20 103 38 1 35 66 54 2 51 32 72 13 64 23 86 31 69 43 92 50 66 77 87 66 55 115 75 76 39 152 62 72 24 170 52 57 12 164 49 39 5 139 53 23 2 103 60 15 11 69 68 12 26 45 73 13 44 37 76 12 62 41 74 11 76 48 67 8 78 54 56 9 69 55 43 16 52 52 33 27 36 47 28 37 26 42 33 45 25 36 45 45 34 28 60 37 50 21 74 26 70 13 81 15 89 4 82 6 105 9 78 1 113 26 73 0 111 44 65 0 99 54 58 0 79 58 48 0 56 52 37 0 37 39 25 0 27 23 14 0 25 28 7 0 30 58 5 0 37 99 13 0 41 138 26 0 40 168 44 0 37 171 66 2 31 144 87 8 25 104 101 13 18 62 107 18 13 27 100 20 8 6 82 19 5 0 59 15 6 0 37 14 10 0 18 18 17 4 5 30 26 20 2 49 34 45 8 71 41 74 15 93 45 101 22 113 44 117 28 127 38 112 30 136 28 92 27 136 19 68 20 127 10 57 12 108 3 70 6 81 0 110 1 55 0 165 0 31 0 219 0 12 3 253 0 1 10 260 0 4 20 240 0 13 30 203 0 25 41 160 0 38 46 119 2 53 44 83 5 62 35 54 8 65 25 34 12 60 14 19 16 50 5 13 21 36 0 23 27 23 0 44 36 13 0 67 47 8 0 90 58 10 0 106 66 18 0 113 68 29 0 110 62 41 0 102 48 52 3 86 33 60 9 66 18 65 18 47 7 64 29 30 0 60 40 14 1 52 46 2 5 42 43 13 11 32 35 39 19 23 25 71 29 19 14 101 39 20 13 128 46 27 26 140 50 36 48 134 50 44 72 120 43 48 93 109 34 43 105 104 23 34 101 106 14 23 88 111 6 12 69 110 1 3 52 98 0 0 40 79 0 4 34 58 1 12 32 43 1 22 33 40 1 30 32 51 1 39 29 77 0 42 25 112 0 40 19 153 0 37 13 189 0 35 7 211 0 36 6 212 3 40 6 190 8 45 9 152 15 49 17 111 21 48 33 76 25 42 54 57 25 32 81 49 20 22 110 47 15 12 136 41 9 5 153 35 6 1 157 23 5 0 147 9 8 0 125 4 13 0 94 19 21 0 62 41 33 0 37 69 50 0 17 98 69 0 5 122 88 1 0 128 102 3 0 115 108 5 0 88 104 6 1 60 92 7 3 32 75 6 4 10 57 5 5 6 42 2 5 24 32 0 4 46 27 0 3 65 30 1 2 79 38 4 0 82 50 9 0 70 61 15 0 54 70 19 0 45 74 22 0 55 71 21 0 82 64 18 0 120 51 15 0 158 37 13 0 189 24 11 0 209 13 10 0 220 5 8 1 228 1 7 9 234 0 9 19 239 2 17 32 239 6 30 45 231 10 48 58 208 12 66 66 174 12 77 71 130 11 79 72 87 8 70 72 51 4 58 70 23 0 49 64 6 5 52 55 0 16 70 41 0 30 100 28 0 45 135 16 0 62 165 6 0 73 183 0 0 78 184 0 0 75 172 0 0 66 151 0 0 52 129 0 2 36 109 0 9 23 97 0 21 12 92 0 36 3 97 0 53 0 111 0 70 0 134 0 79 0 163 0 81 0 193 0 76 0 217 0 64 1 231 0 50 2 230 0 36 4 215 0 24 5 189 0 16 5 157 2 11 4 124 5 9 3 94 11 8 4 71 18 8 7 58 24 6 15 57 30 5 24 63 33 4 36 74 33 2 49 84 30 1 64 88 25 7 78 85 18 15 89 75 12 23 95 64 7 28 91 54 3 28 75 46 0 24 55 42 1 17 35 38 12 9 16 33 29 4 10 28 48 8 21 22 66 15 37 17 83 17 51 13 91 17 63 11 91 16 65 10 87 12 58 7 82 4 45 6 76 12 32 4 68 41 21 1 57 77 17 3 42 111 14 17 28 138 13 43 15 145 10 78 5 131 8 120 0 104 5 165 0 75 2 201 0 53 0 224 0 38 0 234 0 28 0 232 0 23 0 221 0 16 0 205 1 9 0 184 4 17 0 160 10 37 0 134 14 52 0 111 19 58 0 92 20 59 0 82 19 51 0 82 14 42 0 89 9 46 1 102 4 66 2 114 1 100 4 123 0 141 4 124 0 186 4 117 0 233 4 101 0 280 2 80 0 319 1 61 0 338 0 47 0 325 6 43 1 274 18 49 4 203 35 62 6 129 53 77 7 68 70 89 7 42 78 92 6 50 74 85 4 73 61 70 2 94 43 49 0 114 26 31 0 127 13 16 0 138 5 12 0 151 3 21 0 161 3 42 1 159 3 68 4 140 4 96 7 108 5 117 9 72 7 128 9 37 9 128 8 10 10 120 6 0 9 108 3 0 8 97 0 0 5 88 0 0 2 82 6 0 3 76 18 1 15 69 32 10 33 60 45 25 52 50 56 48 71 38 57 75 85 27 48 102 90 17 34 119 88 10 20 119 83 5 13 103 79 1 13 77 77 0 20 49 74 0 29 24 70 1 39 6 60 2 45 1 49 2 47 5 37 2 46 11 29 2 42 22 25 3 39 35 25 3 37 50 24 5 38 60 23 4 43 62 20 5 52 52 15 3 62 41 10 2 71 26 6 3 73 11 4 8 68 1 2 11 57 0 1 11 40 18 1 11 25 52 4 10 11 96 7 5 3 145 9 4 0 196 9 9 0 229 8 16 0 238 6 23 0 229 5 29 0 209 7 33 0 188 13 34 0 171 20 32 0 159 26 29 0 150 29 25 0 139 27 19 0 123 24 14 0 103 21 9 1 81 21 3 2 62 24 0 3 50 28 3 4 49 30 8 6 55 27 13 7 68 21 19 9 83 14 27 13 96 6 33 16 103 1 39 18 104 0 49 18 97 0 60 18 82 0 71 17 63 3 77 18 43 8 74 19 29 15 64 21 28 23 48 20 41 32 32 17 63 37 24 12 88 38 25 7 106 36 36 3 108 32 52 0 95 29 65 0 70 28 73 0 45 30 73 0 24 35 67 4 20 43 58 11 36 53 50 17 76 64 44 22 131 76 43 24 193 86 44 21 246 91 47 16 272 87 49 9 259 72 49 6 210 53 45 11 151 34 38 21 90 16 29 33 38 4 22 46 6 7 17 58 8 17 17 64 28 25 19 65 50 30 22 62 69 32 21 56 89 28 18 48 102 20 13 38 109 10 7 28 120 7 2 19 139 10 0 11 164 19 4 6 185 28 7 2 190 35 9 1 172 37 10 0 133 33 10 4 90 24 8 16 48 16 4 35 16 8 1 58 0 2 0 83 0 3 0 103 2 10 0 113 17 19 0 112 43 28 0 102 75 36 0 86 108 41 0 69 136 39 0 53 146 33 0 37 136 26 0 23 112 19 0 14 83 14 0 6 61 10 0 1 53 7 2 0 59 6 5 1 74 5 9 4 91 5 14 6 104 6 19 9 106 7 21 15 104 8 21 21 101 12 19 27 106 20 14 31 121 31 9 32 146 46 5 28 173 60 2 22 193 69 2 14 198 70 2 7 185 60 4 1 157 45 7 2 121 29 12 13 84 14 19 29 52 4 25 47 28 0 32 67 14 0 36 85 14 1 39 91 26 5 39 88 52 11 39 73 83 17 39 54 113 23 38 35 130 28 38 19 129 30 38 8 117 29 38 6 102 27 39 9 96 25 40 15 109 22 41 20 140 20 39 23 179 16 34 20 214 14 26 15 233 12 18 9 233 13 13 4 215 17 15 0 186 25 21 0 155 35 32 0 128 47 41 0 108 58 45 0 91 65 43 1 74 69 36 7 54 69 27 19 38 64 21 32 22 57 19 46 8 49 20 57 8 41 22 59 20 38 23 50 29 39 19 37 33 44 14 23 35 52 8 10 31 61 4 1 20 67 2 1 14 68 2 4 13 65 2 6 17 59 2 7 19 51 2 8 18 44 1 10 16 39 2 15 10 34 6 24 3 29 11 36 0 24 15 47 0 19 16 53 0 15 15 50 0 15 12 40 0 18 7 27 0 24 2 14 0 33 4 4 0 43 12 4 0 52 21 9 0 60 29 12 0 66 35 12 0 69 37 13 0 70 33 11 0 67 25 10 0 61 16 13 2 51 9 20 14 39 4 30 29 26 1 41 44 18 0 47 53 16 0 51 55 20 2 50 47 28 4 46 34 36 6 39 18 40 7 30 15 38 8 21 32 31 9 14 61 23 13 6 92 18 18 1 127 19 27 0 154 23 36 0 169 29 42 0 176 31 41 0 181 27 34 0 188 20 25 1 199 12 14 2 215 6 6 4 228 6 0 5 234 10 8 6 229 14 21 6 213 17 36 6 188 18 52 9 160 15 66 11 136 11 69 14 115 6 63 18 96 2 49 22 75 0 34 27 54 0 22 32 36 1 18 40 18 5 22 46 4 11 31 49 0 16 41 45 0 21 46 36 7 21 45 26 19 18 41 14 34 13 38 13 51 7 42 23 71 2 57 41 90 0 81 55 109 1 108 65 129 3 134 62 152 4 151 50 175 6 157 33 193 7 153 20 203 6 143 14 202 5 129 17 192 3 116 22 178 2 104 24 164 3 92 22 150 6 83 17 135 10 74 10 117 16 70 3 95 22 71 0 74 25 79 0 64 28 92 0 67 26 105 0 83 22 114 0 103 16 111 0 115 10 96 0 109 5 71 0 88 2 47 0 61 0 24 3 32 0 8 9 9 0 0 18 0 0 0 28 2 1 0 37 16 1 0 42 35 1 0 39 58 1 0 32 86 0 0 21 123 0 0 12 162 2 0 6 204 6 0 5 246 11 0 7 278 14 2 10 291 16 8 14 281 14 15 18 249 12 22 25 206 10 28 32 167 10 30 41 141 13 27 51 133 17 22 59 136 20 16 63 143 19 12 64 144 15 9 63 138 10 8 60 124 5 7 57 106 1 6 51 88 3 4 43 71 7 3 34 59 10 1 24 53 14 0 15 53 18 0 12 56 23 0 15 60 29 0 23 58 40 0 32 49 53 1 39 38 66 5 41 30 73 11 38 36 73 16 29 59 63 21 20 97 47 22 11 140 30 19 7 180 16 14 11 212 5 8 21 237 0 3 30 264 0 1 37 296 0 6 37 331 1 15 31 361 3 26 22 371 4 39 12 354 4 51 3 310 5 56 3 248 3 54 11 182 2 45 19 126 0 33 27 89 0 20 35 72 0 10 41 74 0 4 45 92 1 5 50 117 2 12 60 141 3 18 74 156 3 23 89 155 3 25 104 136 3 23 114 105 1 17 118 72 0 12 116 50 0 9 112 49 0 13 108 71 0 21 105 111 3 31 103 157 10 40 99 195 17 46 88 212 24 45 71 200 29 41 52 160 29 33 34 115 23 26 27 69 16 19 31 30 8 13 47 4 3 8 67 0 0 5 84 15 0 2 90 38 0 0 85 68 0 0 71 101 0 0 55 134 0 6 43 148 4 16 35 141 10 27 32 115 18 38 31 82 25 46 30 50 30 47 30 22 31 39 33 11 27 28 39 18 22 16 49 32 18 6 61 48 18 0 70 69 21 0 71 88 25 0 66 102 28 0 55 112 28 0 42 112 25 2 30 103 19 8 21 84 12 19 13 60 7 34 9 37 4 55 6 17 2 77 2 4 1 97 4 0 1 110 14 0 0 113 26 0 0 107 37 2 2 91 45 11 8 70 45 23 16 50 37 36 23 34 25 45 31 26 14 46 36 22 4 39 39 21 0 29 43 19 0 16 50 15 0 4 61 10 0 0 76 8 0 12 89 9 0 33 98 13 0 58 101 17 0 80 101 19 0 99 99 17 0 100 97 14 0 87 95 8 0 69 91 3 0 60 81 0 0 70 65 0 3 100 46 0 9 146 30 0 17 189 21 0 23 214 23 0 27 210 34 0 24 175 50 3 19 127 63 9 12 77 72 19 5 35 73 30 0 7 67 42 6 0 56 48 17 0 43 48 31 0 30 40 46 13 19 29 63 37 10 18 72 66 4 8 73 92 0 1 69 112 0 0 62 110 5 5 55 90 12 14 52 64 20 24 55 35 28 33 61 11 34 40 70 0 35 39 78 0 32 31 83 6 26 21 82 17 23 11 74 32 23 3 59 46 26 0 41 62 31 0 26 72 35 2 13 78 36 9 4 86 32 18 1 102 26 28 2 130 22 36 2 172 22 39 2 218 29 36 2 256 39 28 2 273 48 18 3 262 54 9 4 222 51 2 6 163 42 0 7 105 30 0 7 58 19 0 5 38 15 0 3 45 17 0 1 72 23 3 0 102 30 6 0 131 32 10 2 151 30 12 4 163 23 12 8 170 15 11 9 177 7 10 11 181 4 13 9 177 4 21 8 159 6 33 6 128 6 47 6 91 6 59 7 56 4 69 12 42 2 77 17 63 0 84 21 118 2 94 23 193 7 106 21 273 12 120 17 333 16 134 12 354 19 143 7 331 19 146 2 273 16 142 0 202 13 132 0 142 11 117 1 111 10 101 4 113 12 86 7 141 14 75 9 176 15 66 10 201 15 58 9 205 12 49 7 187 9 36 3 156 7 25 1 122 6 15 0 93 7 6 0 73 9 0 1 60 11 0 3 53 11 3 4 53 8 7 8 59 6 12 11 72 3 19 13 90 3 27 14 106 7 33 14 113 13 37 10 104 21 38 7 81 29 37 5 56 35 33 5 31 39 28 9 10 41 22 17 0 42 20 27 2 44 24 36 11 49 33 42 24 55 47 45 39 62 63 40 53 67 76 30 61 65 82 20 59 57 79 11 48 44 70 4 34 29 60 0 19 16 55 2 7 6 56 11 1 0 65 23 0 0 77 37 0 0 89 50 0 0 96 59 0 0 99 60 0 0 99 54 0 3 100 44 2 8 101 34 16 13 102 24 39 16 100 18 70 18 90 14 104 18 72 12 142 16 51 14 171 16 32 18 190 18 15 24 200 24 6 29 201 30 7 32 194 34 10 28 178 32 11 23 153 26 11 15 121 18 10 7 87 10 6 1 57 3 2 0 36 0 6 5 25 1 17 16 24 3 31 31 25 4 41 46 25 7 49 62 21 9 47 75 16 10 38 81 9 10 26 84 3 8 13 86 0 6 3 87 0 4 0 87 0 2 1 84 4 0 7 76 8 0 18 65 10 0 34 55 9 0 54 50 10 0 75 53 8 0 90 62 3 0 98 71 17 3 99 75 54 10 96 68 102 19 96 53 149 27 105 36 188 35 124 19 199 37 150 5 175 34 173 0 131 27 185 0 81 18 179 0 44 10 156 0 34 5 120 0 50 4 82 1 80 6 50 5 114 14 29 10 143 27 18 16 160 46 17 21 165 67 20 22 156 86 23 18 135 99 25 14 105 103 24 8 73 99 21 3 45 89 16 0 22 76 11 4 6 62 7 9 2 49 5 15 21 38 6 18 50 27 12 19 80 18 21 16 105 10 32 12 120 5 43 6 109 5 50 2 85 9 54 3 55 19 54 6 31 32 50 9 31 50 44 10 60 68 38 10 99 81 34 9 138 86 35 6 169 82 41 2 178 68 50 0 164 48 58 2 133 30 64 10 93 15 66 23 57 9 64 37 30 12 60 51 12 22 55 62 2 35 52 63 0 50 48 54 0 63 42 40 0 71 32 26 0 73 22 13 0 68 13 4 2 56 5 0 7 41 0 0 14 26 1 6 21 14 5 17 31 6 10 28 42 7 16 38 57 17 21 45 81 27 26 42 113 38 28 33 154 45 29 22 199 47 28 11 241 42 26 3 270 32 22 0 280 21 17 0 268 12 11 1 237 6 6 3 196 6 2 5 157 11 0 7 132 22 0 8 128 35 0 7 144 49 0 5 173 60 0 3 202 64 0 1 220 61 0 0 222 53 0 0 213 41 0 0 202 30 1 0 202 23 3 0 221 18 5 0 255 17 6 4 294 16 7 10 325 14 6 19 336 11 5 28 327 8 3 38 300 4 1 44 266 1 0 46 231 0 0 45 199 0 0 43 168 0 4 42 136 4 12 45 101 9 22 53 68 15 31 67 41 19 39 83 27 21 40 100 24 18 35 117 28 13 26 130 32 8 15 139 31 3 7 139 26 0 1 130 17 0 0 113 8 0 0 88 1 0 0 59 0 0 0 36 0 2 0 17 0 11 0 7 0 28 1 6 0 53 4 9 0 84 9 10 0 117 15 10 2 146 20 9 9 163 24 6 17 165 25 2 26 153 24 0 35 128 22 0 43 94 19 6 49 61 18 18 57 34 18 34 71 15 18 53 90 3 20 73 113 1 23 88 138 5 28 96 156 10 35 97 165 13 43 93 161 15 50 89 147 14 52 85 126 11 49 84 101 6 40 81 76 2 29 76 52 0 17 66 33 2 8 52 19 6 6 36 8 11 17 21 1 14 33 10 0 15 48 3 0 14 60 2 5 11 62 3 24 6 51 4 54 2 38 4 91 2 21 4 128 5 7 3 159 9 4 5 170 12 10 10 161 14 14 21 138 15 13 32 112 15 14 44 93 15 12 50 88 15 7 50 96 15 1 43 111 13 7 35 124 11 21 28 128 8 40 25 121 4 62 24 107 3 89 25 93 11 111 25 89 26 125 21 99 44 131 15 124 61 131 9 158 74 124 4 191 74 113 0 214 64 99 0 218 47 85 0 201 31 70 0 167 20 56 0 126 19 45 1 91 23 34 5 73 30 26 12 77 33 20 22 98 30 16 35 130 23 12 46 160 15 10 53 175 7 11 53 168 1 17 44 142 0 27 33 102 0 42 20 65 0 57 9 33 0 71 2 10 0 77 4 0 0 76 8 2 0 66 12 12 0 51 15 27 3 36 19 44 10 25 17 62 21 20 12 81 34 21 8 97 47 26 5 108 56 30 1 116 57 31 0 120 50 26 0 120 37 20 0 115 24 12 0 107 12 5 0 98 4 1 0 90 0 0 1 81 0 3 4 70 0 8 9 55 0 14 14 40 0 18 20 25 0 23 27 17 0 26 31 22 1 28 35 40 2 32 38 62 2 39 41 79 2 45 44 81 1 51 48 70 0 53 52 53 0 54 57 31 0 55 60 10 1 60 61 22 6 69 59 63 13 82 52 114 20 92 41 166 27 97 29 216 30 94 17 237 27 85 8 221 21 72 2 175 14 59 0 121 6 49 3 70 1 42 9 30 2 38 16 5 10 35 21 4 23 34 25 22 36 34 22 47 49 36 18 73 58 37 12 97 57 36 5 114 47 29 0 115 34 22 0 104 20 14 4 91 9 6 13 82 6 0 27 80 9 8 46 84 14 23 70 87 18 41 94 84 21 59 117 72 19 75 135 53 15 80 149 34 9 73 156 17 4 55 154 5 1 37 145 0 0 20 128 0 0 8 106 0 1 6 83 0 5 16 64 0 9 28 54 0 13 40 54 0 16 50 62 2 17 52 76 8 14 44 91 13 11 33 100 15 9 21 102 15 11 10 97 14 17 2 86 10 24 0 74 4 31 0 63 2 34 0 53 10 33 0 44 26 28 0 37 43 23 0 29 58 20 0 20 69 23 0 13 70 34 0 7 60 52 1 4 48 76 7 4 40 102 15 7 42 128 24 8 53 148 34 11 68 159 43 11 80 161 48 11 86 153 49 11 82 138 47 12 71 117 43 13 57 96 36 13 44 74 27 14 33 53 19 15 23 35 11 22 16 21 5 35 10 11 1 56 5 4 1 82 1 0 2 109 0 0 1 131 0 0 1 144 0 0 2 145 0 0 1 136 0 2 2 119 0 4 9 100 0 6 21 82 3 8 32 66 12 8 42 54 23 7 47 46 34 4 44 41 44 2 34 38 53 0 22 38 62 3 15 41 74 7 14 45 93 12 19 50 115 16 26 54 135 19 32 57 145 16 32 58 139 12 26 59 116 7 19 59 86 3 13 62 58 0 12 66 41 0 18 71 37 3 30 74 43 11 45 74 49 25 59 67 48 43 68 54 41 64 69 38 29 83 63 24 15 99 51 12 5 109 39 4 15 114 29 0 33 115 26 0 50 112 30 0 60 108 41 0 62 100 55 0 54 89 69 0 38 75 76 0 19 61 75 0 12 48 66 0 32 37 52 0 73 29 37 0 129 23 25 0 197 19 19 0 263 17 18 0 310 15 20 0 328 13 24 0 314 12 26 0 269 12 26 1 206 12 25 4 140 12 23 7 88 14 22 10 62 18 21 13 68 24 22 15 101 31 24 16 149 38 25 17 197 41 25 18 230 37 24 19 242 29 21 18 236 20 17 17 227 12 12 16 231 4 7 14 261 0 4 12 319 0 5 10 395 0 12 8 470 2 21 6 517 6 30 3 517 10 38 2 464 16 38 0 363 24 32 0 251 31 24 0 149 37 14 0 68 42 5 2 16 44 0 6 8 43 0 11 36 39 0 14 75 35 0 16 117 30 0 14 158 28 0 10 190 29 1 6 193 36 5 2 170 47 12 0 131 59 20 1 89 71 28 2 51 77 35 4 25 74 36 3 17 64 30 4 25 50 23 3 42 36 14 3 60 27 6 4 78 27 1 7 90 34 1 9 95 45 2 10 94 55 3 9 90 59 4 8 88 56 7 4 88 45 12 1 92 31 18 0 97 18 26 2 100 10 34 6 93 8 39 10 76 11 40 11 56 14 36 12 35 17 29 10 16 16 20 7 3 13 11 3 0 8 6 0 1 3 4 0 11 0 6 0 31 0 10 0 64 0 16 0 110 0 21 0 165 0 26 0 217 2 28 0 254 7 28 0 270 12 27 0 264 16 26 0 239 19 24 0 209 18 22 3 185 14 21 10 176 9 19 20 183 4 18 31 203 0 17 42 225 3 19 47 241 7 23 47 241 12 31 43 225 16 40 39 197 20 50 38 162 21 56 40 128 20 56 47 99 21 49 55 76 23 37 62 56 27 25 66 38 30 13 65 25 29 4 60 16 25 0 51 19 19 0 39 34 11 1 26 62 5 3 16 94 0 5 7 121 0 7 4 132 0 10 8 122 0 12 18 96 0 15 33 66 0 19 52 36 2 25 74 27 6 33 95 46 9 43 114 86 11 52 127 123 11 57 134 157 10 56 135 168 7 49 131 151 3 36 121 113 0 24 106 74 3 12 89 38 11 3 70 13 23 1 51 0 38 6 35 0 56 12 26 0 72 16 22 0 85 19 25 4 92 20 31 20 96 16 40 45 94 11 44 73 91 6 45 99 86 4 41 117 79 7 33 118 70 14 23 101 60 21 14 73 49 29 7 45 39 36 4 23 29 40 8 7 23 43 19 0 18 43 34 0 16 41 52 0 18 38 68 12 22 34 82 36 25 28 87 68 28 21 85 101 28 14 76 129 24 8 61 135 18 4 44 115 12 1 30 87 6 0 18 54 2 0 11 22 0 0 8 2 0 0 5 1 0 0 4 14 0 2 3 34 2 8 1 59 3 17 0 88 5 26 0 120 8 33 0 145 10 35 1 164 12 31 3 176 14 24 7 179 15 17 11 174 14 14 16 156 13 17 22 126 12 24 28 89 12 32 33 57 15 36 36 28 20 34 36 19 27 26 33 33 32 18 26 59 36 9 19 80 37 2 13 96 37 0 11 93 37 0 11 75 40 0 14 51 47 0 16 26 58 3 16 7 71 7 13 0 84 12 10 8 94 18 6 21 98 24 2 36 97 27 0 49 90 27 0 61 78 23 0 65 64 17 0 66 49 11 0 69 35 6 0 84 23 2 0 113 17 0 0 153 16 0 0 197 23 4 0 236 35 12 0 259 50 24 0 260 64 38 0 238 74 53 0 196 75 65 0 141 69 71 0 91 58 70 0 50 44 64 0 20 31 55 0 13 21 46 0 26 13 40 0 47 7 37 0 70 5 39 0 94 6 43 0 111 11 47 1 121 20 48 3 127 30 46 4 137 40 41 4 154 46 32 4 180 45 22 3 212 40 14 2 245 32 7 0 271 22 2 0 286 14 0 0 286 7 0 0 272 3 0 0 246 1 0 0 212 0 0 2 177 0 1 8 146 0 4 14 125 0 6 21 116 6 7 28 121 19 8 32 135 39 8 33 151 63 8 29 164 90 10 26 169 111 14 23 168 121 21 22 161 120 28 21 150 109 32 23 138 91 31 22 123 73 25 18 107 57 18 14 91 45 10 9 80 39 3 4 78 37 4 0 89 38 11 0 113 40 19 4 145 44 26 12 176 48 31 21 197 52 30 31 201 52 24 44 186 49 16 57 156 41 9 70 120 30 2 83 88 19 0 96 67 10 0 106 59 3 0 110 62 0 0 107 68 0 0 99 70 2 0 88 63 7 1 78 48 13 5 71 32 19 13 68 17 23 22 67 5 24 30 66 0 21 34 64 2 15 32 60 14 9 26 55 34 4 18 50 63 0 9 46 99 0 2 43 137 0 1 43 166 0 7 41 182 2 18 39 185 3 31 35 176 4 44 27 156 4 55 19 131 4 59 12 100 3 54 6 69 1 43 5 44 0 30 12 23 0 17 22 7 3 8 33 0 13 4 44 0 26 8 48 5 41 16 44 13 56 25 35 22 67 34 24 31 69 41 13 41 63 43 4 47 53 40 0 53 42 33 1 61 33 24 3 73 28 15 4 87 28 8 4 102 33 5 4 112 39 8 3 115 45 17 1 106 50 29 0 88 51 42 0 63 50 52 0 40 44 56 3 21 37 52 11 7 29 41 21 0 22 28 32 0 16 17 44 0 15 7 52 0 19 1 56 7 30 0 53 30 46 2 48 69 65 8 38 118 82 15 27 168 92 21 17 203 90 26 9 209 76 26 2 180 56 21 0 134 35 15 7 84 18 8 21 39 5 2 39 9 0 0 57 0 3 0 75 0 11 0 82 14 24 0 76 42 40 0 60 80 57 0 41 122 70 4 24 169 75 12 10 200 71 22 1 210 58 32 0 199 41 43 0 170 25 49 0 129 12 50 0 86 3 46 0 51 0 38 1 25 0 27 3 7 0 18 7 0 0 10 11 7 5 7 15 24 15 11 18 47 28 20 19 74 42 30 19 102 56 39 19 123 63 41 20 130 62 37 21 123 54 28 23 106 43 17 25 85 32 8 27 66 25 2 25 55 21 0 22 54 21 0 18 59 24 0 12 67 28 0 7 73 30 0 3 75 31 0 1 72 31 0 0 68 31 0 0 66 30 0 0 68 30 0 0 70 31 0 0 71 31 0 0 69 31 0 0 63 30 4 0 55 30 9 0 49 30 17 0 51 31 26 2 60 30 35 8 73 27 42 16 85 22 47 24 90 16 49 33 83 10 52 39 65 7 53 42 46 8 57 40 25 13 61 38 9 20 67 35 0 25 71 34 0 27 72 35 0 23 71 40 0 17 65 47 0 11 57 52 13 5 46 53 44 1 36 48 89 0 30 37 138 0 27 25 187 0 31 15 216 0 39 5 212 3 48 0 178 10 56 0 128 20 60 0 79 31 58 0 37 45 51 0 14 56 40 0 13 63 30 0 24 70 21 0 30 74 15 0 31 77 11 0 29 81 8 4 22 87 5 11 11 93 3 18 2 98 1 26 12 102 0 32 37 102 0 34 69 97 1 30 101 89 6 23 128 79 15 15 134 67 26 10 115 56 38 8 86 44 49 13 53 33 56 22 23 22 57 34 4 14 53 46 8 7 47 58 31 2 40 69 61 0 33 78 90 0 27 88 114 0 23 98 121 0 20 105 105 0 19 108 78 0 21 106 48 0 25 97 20 0 29 82 3 0 33 67 0 0 36 53 0 0 38 43 9 0 38 40 31 0 37 42 63 1 37 48 105 6 36 56 154 12 36 64 198 18 37 69 226 23 37 70 233 24 38 69 217 20 38 64 180 14 36 57 130 8 32 50 84 3 26 43 45 0 19 37 17 0 12 32 1 3 9 29 0 7 11 27 0 9 21 28 0 11 38 32 0 10 61 38 0 8 85 47 0 5 108 58 0 2 125 68 0 0 136 74 0 0 140 75 0 0 140 72 0 3 136 64 0 7 131 54 7 11 126 45 26 14 121 37 57 16 114 31 95 14 105 26 138 11 92 22 179 7 75 18 206 5 57 15 214 5 40 13 199 8 26 13 162 13 17 16 117 17 13 22 75 21 14 31 38 23 20 41 14 23 29 50 32 23 41 54 82 23 52 52 147 23 62 43 225 23 68 31 310 20 69 19 374 17 64 9 406 12 54 2 401 7 39 0 358 4 26 0 285 1 15 5 199 0 10 13 124 0 10 23 61 1 14 32 19 4 18 38 0 8 21 36 0 12 20 29 0 16 17 20 0 17 14 10 0 16 13 2 0 14 13 1 0 14 15 8 0 18 18 18 0 25 20 31 0 37 21 44 0 49 23 54 11 59 25 57 33 65 30 53 62 64 36 42 91 58 43 28 121 48 48 17 136 35 50 7 136 22 49 2 122 13 44 6 104 6 37 14 91 1 28 24 92 3 19 34 113 9 12 43 151 17 6 46 202 23 2 41 255 26 0 33 300 23 0 22 325 18 0 14 325 11 0 11 301 4 0 13 255 0 2 20 195 5 9 27 131 15 19 33 79 27 33 33 39 39 48 29 14 50 62 21 15 54 69 13 43 51 67 6 84 40 56 3 142 27 41 3 214 16 26 4 287 7 13 4 350 1 3 4 392 0 3 3 405 3 9 2 388 7 18 0 346 10 25 0 289 12 32 0 231 11 33 0 185 10 27 3 157 6 20 11 148 3 12 21 151 0 4 31 160 0 0 41 166 0 7 44 162 3 19 42 149 13 34 33 129 30 49 23 107 53 64 13 88 79 71 6 78 105 70 1 77 122 61 0 84 129 47 0 95 123 32 3 104 109 19 6 107 89 12 10 100 66 10 15 81 42 14 21 58 25 21 27 37 13 28 35 18 4 34 45 4 0 37 55 0 0 39 62 0 1 38 66 0 6 37 63 0 12 35 53 3 21 33 38 13 31 28 24 31 40 22 12 54 47 15 4 81 50 9 0 108 49 4 0 127 45 1 0 133 40 0 0 127 34 3 0 112 30 12 0 91 29 24 0 72 29 39 0 60 30 56 0 54 30 71 0 53 29 80 0 53 26 81 0 49 19 76 0 38 13 64 2 27 8 50 6 15 3 33 11 5 2 20 18 0 6 10 26 3 15 3 33 17 27 0 38 40 42 0 37 68 56 0 32 97 65 0 24 119 68 0 16 124 65 1 8 110 56 4 2 82 46 10 4 53 37 18 11 32 33 30 21 28 33 43 30 40 38 56 39 63 44 66 43 88 50 69 39 108 52 64 31 117 48 51 21 118 39 36 13 120 28 22 9 131 17 10 11 157 8 2 18 197 2 0 25 241 0 0 30 277 0 0 32 291 0 0 30 274 0 0 24 227 0 6 20 162 0 18 19 103 0 33 21 52 2 49 23 17 6 63 26 0 11 67 26 9 17 61 20 24 24 46 15 38 27 30 9 47 27 15 3 52 24 4 2 46 18 2 10 34 13 8 22 19 13 14 35 7 18 20 48 3 29 25 56 15 46 26 56 31 64 21 48 50 77 15 35 70 84 8 21 90 82 3 10 104 73 0 2 115 58 0 0 126 43 0 0 140 30 1 0 158 22 7 0 177 19 17 0 197 18 29 0 213 19 44 0 222 20 58 0 219 21 68 0 202 22 71 0 170 25 70 2 124 31 64 3 83 40 56 4 46 51 47 4 17 61 38 4 1 66 31 3 3 63 26 2 24 52 22 0 57 37 20 0 99 23 18 0 142 10 17 0 179 2 17 0 190 0 17 0 171 0 18 0 131 0 20 0 88 0 23 0 47 0 26 0 15 0 28 2 0 5 27 6 0 13 26 9 1 25 25 12 21 41 27 13 55 61 31 11 101 79 37 8 151 91 43 4 202 97 48 1 236 93 49 4 245 81 46 9 232 63 40 16 201 45 36 22 161 29 35 28 119 18 40 28 86 14 51 24 65 13 68 18 59 15 87 11 67 17 105 5 83 17 118 1 99 15 124 0 108 12 123 0 107 8 116 1 96 4 104 2 82 1 89 4 69 0 76 7 61 0 64 12 59 0 55 15 63 1 48 17 68 6 43 19 71 14 39 17 68 23 34 13 57 32 28 9 42 40 23 5 28 43 18 1 15 41 13 0 4 34 10 0 0 27 7 0 0 20 4 1 0 16 3 4 0 17 1 7 0 25 0 11 0 39 0 15 0 60 0 17 5 83 0 18 21 108 0 17 45 129 4 16 73 143 11 14 102 148 19 14 124 146 29 16 132 136 38 19 125 120 45 24 109 102 50 29 90 85 52 34 78 69 54 36 72 56 56 37 73 48 59 35 78 42 63 33 79 39 67 30 72 35 71 28 58 32 75 27 41 29 79 26 25 27 83 25 10 26 85 21 2 27 85 16 0 29 81 11 0 31 74 6 3 31 65 2 8 29 55 0 14 25 45 0 18 18 37 0 20 12 29 0 18 7 22 1 14 2 15 3 8 0 9 5 3 3 4 6 0 11 1 6 0 21 0 5 0 33 0 4 0 47 0 2 0 59 0 1 2 66 0 0 8 69 0 0 14 69 0 0 19 67 0 0 20 65 0 0 19 66 0 0 15 68 3 1 8 75 8 5 4 83 14 9 14 91 21 12 35 95 26 14 59 95 28 14 82 90 25 11 103 80 19 7 109 66 12 7 99 51 8 14 82 36 9 28 66 22 15 48 63 12 24 72 82 5 33 93 126 1 39 107 192 0 40 111 266 4 37 105 333 9 31 90 377 16 27 68 386 23 25 45 357 28 26 27 297 29 30 13 217 25 34 3 140 18 38 0 78 11 39 0 33 5 41 2 7 1 44 7 11 0 52 14 39 0 66 22 83 0 86 31 137 0 111 38 200 0 139 41 256 0 165 40 292 0 185 38 302 0 197 35 286 0 198 32 248 0 190 29 194 1 176 24 135 2 160 19 84 5 141 13 44 9 123 8 17 11 104 3 2 12 83 0 0 10 61 0 0 8 40 0 3 5 23 0 11 2 10 0 19 0 2 0 26 0 0 2 32 2 0 7 35 5 0 13 37 9 0 19 46 13 0 24 65 15 0 25 96 14 1 21 134 11 4 15 173 7 9 9 206 3 14 4 229 0 18 0 242 0 20 0 251 0 18 0 261 4 14 0 274 12 10 0 288 22 6 0 299 32 4 0 303 41 6 0 291 43 11 0 262 38 18 0 215 28 25 0 158 18 30 4 103 8 31 14 57 2 29 28 31 0 22 44 34 3 15 61 65 8 8 72 115 16 3 75 174 24 0 68 238 31 0 54 290 33 0 37 328 30 0 22 346 23 0 11 349 15 0 3 336 8 0 0 313 2 5 0 283 0 14 0 251 0 26 0 218 2 41 1 186 4 57 1 155 5 68 3 125 6 73 7 95 6 69 16 65 4 59 30 40 4 44 49 21 4 29 73 7 5 16 97 0 8 7 117 3 12 1 131 7 14 0 137 11 15 1 136 13 14 3 128 14 10 6 118 12 7 10 109 9 4 13 101 4 1 15 95 1 3 14 93 0 9 11 89 0 20 8 84 0 32 4 76 0 45 2 64 0 56 0 50 0 64 0 35 0 67 0 24 0 68 0 17 0 70 0 15 0 75 0 17 0 83 0 21 0 93 0 25 0 104 0 27 0 113 0 25 0 119 0 21 0 120 0 15 0 116 0 10 7 108 0 5 23 95 0 2 44 79 0 0 72 63 0 0 106 50 0 0 140 41 0 2 170 36 3 5 192 35 11 8 202 36 23 12 199 35 35 19 179 32 46 27 143 26 51 39 100 18 48 54 62 12 39 70 31 8 27 83 9 7 15 92 0 9 6 95 12 11 1 90 38 12 0 78 74 12 0 63 114 11 0 47 156 11 0 31 181 13 0 20 181 17 1 13 158 22 6 9 118 25 13 9 76 27 22 10 44 24 31 11 35 18 38 11 52 12 41 11 94 6 39 10 145 2 34 7 198 0 28 5 237 0 23 4 252 0 22 2 244 0 26 0 216 0 33 0 178 0 42 0 141 0 51 0 113 0 56 0 101 0 57 0 104 0 53 0 117 0 45 0 134 2 34 0 147 4 23 0 151 8 14 0 144 12 7 0 129 16 5 3 114 20 4 10 105 25 5 19 105 30 5 30 116 36 5 41 134 43 5 49 154 50 6 51 167 58 11 47 169 66 18 38 157 74 28 27 131 83 38 16 94 91 44 8 62 95 46 3 33 95 40 0 12 89 31 0 0 77 20 0 0 60 11 0 11 41 3 0 29 25 0 0 51 12 0 0 74 4 0 0 97 0 0 0 107 4 0 0 103 12 3 0 88 23 8 0 66 37 15 0 43 53 22 0 24 67 29 0 11 76 32 1 7 81 29 5 13 81 22 7 31 77 15 9 55 71 8 10 85 63 2 10 113 54 0 8 132 43 0 8 135 32 0 11 119 21 4 18 90 12 12 28 61 5 24 38 32 1 37 46 10 0 53 48 0 0 69 45 8 0 84 36 25 0 98 25 50 0 114 14 76 0 128 6 101 0 142 1 116 1 151 1 116 4 155 4 100 9 150 5 75 16 138 6 49 23 121 6 27 27 100 5 11 28 79 3 2 24 61 2 0 18 48 5 0 11 39 12 0 5 34 23 0 1 30 36 0 0 26 50 1 0 22 60 2 0 18 65 4 4 13 62 9 13 10 52 16 27 10 38 26 44 13 25 36 65 18 12 45 84 24 4 51 98 28 0 51 108 29 0 46 112 26 1 37 112 19 6 26 111 13 14 16 109 7 23 8 106 2 34 2 102 0 46 0 97 0 54 0 92 6 60 0 87 14 61 0 84 25 59 0 82 39 51 1 82 54 39 2 81 66 27 3 79 74 16 5 73 79 7 12 64 80 1 24 54 79 0 44 42 78 0 72 32 79 0 105 25 84 1 138 20 91 1 164 17 101 1 179 15 110 1 181 12 114 0 173 9 110 0 160 6 100 0 149 3 83 0 147 0 62 0 156 0 42 2 177 2 29 6 202 6 22 8 224 13 25 10 234 20 33 11 223 27 43 11 191 32 50 11 143 32 53 12 95 29 48 18 53 21 37 27 20 14 26 38 2 7 15 50 0 2 6 62 0 0 1 71 0 0 0 76 0 0 0 76 11 0 0 70 32 0 1 59 61 3 7 45 93 10 15 30 126 18 24 17 147 25 34 8 150 30 41 2 133 29 43 0 101 24 39 0 69 17 30 5 39 9 20 12 16 3 11 21 1 0 4 32 0 0 0 43 7 0 0 50 25 0 0 53 53 0 2 55 88 0 5 55 128 0 9 57 164 0 11 62 188 0 12 70 193 2 11 79 177 5 8 89 142 9 5 96 102 14 1 99 64 19 0 98 31 22 1 91 10 24 4 80 28 22 7 66 77 19 10 49 145 16 14 32 226 12 18 19 316 8 23 9 383 5 30 2 415 3 39 0 405 1 51 0 357 1 64 0 284 2 78 0 200 5 89 2 123 7 98 6 65 8 105 10 34 9 110 16 33 9 112 21 58 9 113 26 99 10 113 30 148 13 112 33 191 17 109 35 220 22 103 37 227 24 93 39 211 26 79 41 178 27 60 41 134 28 41 40 88 29 25 36 51 32 11 28 24 36 2 20 8 42 0 12 0 48 0 6 0 56 5 1 0 64 12 0 0 70 20 0 0 73 29 0 0 71 39 0 0 65 44 0 0 55 45 0 0 41 43 0 1 27 39 1 10 16 32 2 24 7 25 4 44 2 18 7 69 0 13 11 101 0 9 16 135 1 7 22 172 7 7 27 209 17 7 31 243 31 8 33 269 47 9 31 277 64 10 26 262 78 11 20 224 85 12 13 167 85 13 7 111 77 12 4 63 64 11 6 26 47 9 13 3 31 7 24 12 17 4 38 39 8 2 53 74 6 0 65 111 7 0 73 149 12 0 73 173 18 0 66 173 22 0 52 154 23 2 36 121 21 6 22 83 17 9 10 50 12 12 2 25 7 13 1 9 3 11 7 0 0 9 16 0 0 5 27 0 0 2 39 0 0 0 52 0 0 0 60 0 0 2 64 9 0 4 62 33 0 6 56 74 0 8 45 133 0 9 34 209 0 10 21 290 1 12 12 361 5 15 5 410 11 18 1 429 19 23 0 415 28 26 0 371 38 26 0 308 43 24 0 237 46 19 0 170 43 13 0 115 38 7 0 77 28 3 0 56 19 0 0 48 11 0 1 50 5 0 6 57 1 0 14 67 0 0 24 78 0 0 36 87 0 0 49 94 0 5 59 98 0 11 68 97 2 19 75 89 6 27 81 77 12 33 86 59 18 35 89 41 24 33 91 26 28 27 90 13 26 20 87 5 21 15 83 2 15 9 77 0 9 6 69 0 3 3 61 0 0 2 52 0 0 0 41 0 0 0 30 0 0 0 22 0 0 6 16 0 0 16 15 0 0 27 18 12 0 39 24 37 0 52 34 73 0 60 44 115 0 63 56 161 0 61 70 192 0 57 87 201 0 50 106 183 0 44 126 143 0 38 145 99 0 35 161 58 0 32 171 25 3 31 172 3 11 29 163 0 22 25 144 22 35 18 116 71 51 12 81 141 66 7 52 224 76 2 27 315 81 0 9 387 84 0 0 422 86 0 0 413 88 0 0 367 94 0 1 293 103 0 4 208 114 0 8 131 126 0 13 70 136 0 18 35 143 0 22 30 145 0 24 51 144 0 24 84 138 0 20 121 129 0 16 154 119 0 11 173 109 0 7 179 98 2 2 176 88 4 0 170 77 7 0 164 67 11 0 166 55 16 0 175 44 21 0 189 34 27 0 205 27 32 0 219 22 37 0 223 20 39 0 211 18 37 0 184 19 31 3 145 19 23 8 102 19 14 13 68 17 7 18 51 15 2 22 56 12 0 22 78 9 0 17 110 5 0 12 141 3 0 7 162 1 0 3 166 0 0 0 155 0 2 0 130 4 7 0 102 13 13 1 78 24 20 4 66 37 27 8 71 50 32 13 92 59 33 21 124 62 32 31 155 58 27 44 176 50 20 61 178 40 13 82 162 28 7 107 132 17 2 132 97 9 0 157 66 4 0 175 48 0 0 186 47 0 0 190 60 0 0 184 82 2 4 171 104 4 9 154 117 8 16 135 113 12 21 115 95 19 25 97 69 25 25 81 42 32 22 67 19 39 16 53 4 45 10 40 0 47 5 29 0 47 2 18 0 44 0 12 0 38 1 10 0 29 3 14 0 19 5 23 2 12 7 37 4 5 8 56 5 1 7 78 6 0 6 101 5 0 6 121 4 0 9 137 2 0 16 147 0 0 29 150 0 4 44 147 0 12 59 137 0 22 69 123 0 30 70 105 0 38 61 86 0 38 46 66 0 31 30 49 0 22 15 35 0 13 4 26 3 5 0 23 6 0 3 24 8 0 12 28 9 0 26 35 11 4 44 43 14 13 63 51 23 25 80 57 40 38 89 62 66 51 87 65 100 58 77 66 139 57 60 66 179 48 41 68 214 34 24 72 239 21 12 78 248 10 3 85 237 3 0 93 208 0 0 100 169 0 6 102 128 0 19 101 98 0 39 93 88 0 65 80 100 0 98 63 130 0 129 45 168 3 155 28 201 8 172 15 218 15 182 6 213 22 183 1 184 28 180 0 138 31 174 2 92 30 167 7 52 25 160 13 21 18 153 23 3 11 145 33 4 6 137 43 13 2 130 51 20 0 124 55 26 2 120 55 30 5 117 50 27 10 114 42 21 14 110 33 13 19 102 21 5 19 92 13 1 17 80 6 0 13 67 2 0 8 53 0 0 3 42 4 2 1 32 11 8 0 24 19 16 0 19 29 22 0 17 39 27 0 17 47 27 0 20 51 22 0 26 55 16 0 32 57 8 0 38 59 2 0 42 62 0 2 44 68 0 9 42 73 0 21 37 77 0 36 31 78 0 55 23 79 9 74 16 75 27 88 9 69 52 92 5 60 77 88 2 50 100 76 0 38 110 58 0 27 103 38 0 18 82 22 0 10 55 11 0 6 31 8 0 3 19 12 0 2 23 22 0 1 47 35 0 0 84 50 0 0 134 62 1 0 189 70 4 0 239 73 8 0 276 72 14 0 295 66 21 0 291 58 29 0 268 51 37 0 232 45 45 0 192 41 52 0 156 40 57 1 130 41 59 3 115 41 56 5 111 41 49 6 113 39 36 6 115 33 25 5 115 25 14 3 107 18 6 1 93 12 0 0 76 12 0 0 60 18 2 0 48 29 8 0 44 42 15 0 46 57 22 0 50 68 29 0 52 76 32 0 50 80 31 0 40 80 25 0 29 76 18 0 17 69 11 0 7 62 5 0 1 53 1 2 0 47 0 7 4 45 0 12 23 48 2 18 54 55 7 23 94 65 14 25 139 74 19 25 183 80 24 22 209 81 24 19 213 77 20 16 198 67 14 14 167 53 8 14 129 39 2 15 94 25 0 15 70 14 0 18 57 6 0 21 52 2 0 25 51 0 0 33 46 0 0 42 37 0 2 52 26 0 4 62 15 0 8 72 4 0 15 79 0 0 24 84 0 0 35 84 0 0 48 80 0 0 59 69 2 2 67 54 12 4 69 37 29 8 66 22 52 12 56 10 78 15 41 2 104 16 27 2 119 13 15 7 120 10 6 16 106 6 0 26 83 3 0 39 56 0 0 48 37 0 0 53 33 0 1 50 48 0 3 41 81 4 4 29 126 10 7 17 173 19 10 8 212 30 14 2 240 42 17 0 253 52 21 0 253 57 24 3 245 57 27 8 233 52 29 13 219 43 29 19 207 31 29 26 196 20 27 31 188 11 23 33 182 4 17 36 179 0 12 37 178 0 7 37 178 2 5 37 177 4 7 37 175 8 12 36 171 14 19 34 163 21 28 30 152 30 35 25 137 38 42 18 119 46 46 12 99 51 47 7 79 55 45 2 62 55 40 0 48 54 33 0 38 54 25 0 30 54 17 0 23 55 10 0 16 56 6 0 11 56 5 0 6 53 6 0 2 46 6 0 0 36 6 0 0 25 5 1 0 15 4 3 0 7 3 5 8 2 4 7 26 0 10 10 51 0 19 14 81 0 33 17 114 0 48 19 140 1 63 19 158 5 75 17 165 12 79 13 166 19 75 9 164 27 64 5 163 33 48 1 163 35 32 0 166 33 18 0 168 27 10 0 166 21 9 0 156 15 16 0 136 12 28 0 106 13 43 0 73 17 57 3 45 23 68 8 21 28 75 14 6 33 76 21 0 35 71 27 0 37 63 29 0 39 52 28 0 45 41 23 0 53 32 16 4 64 26 10 18 78 20 4 39 90 15 1 66 102 10 0 100 110 7 0 137 115 3 0 173 117 0 0 208 116 0 0 239 111 0 0 266 105 0 0 282 98 0 4 282 91 0 11 265 87 3 21 232 86 8 33 191 90 16 47 152 98 25 59 126 109 35 65 118 122 41 64 131 132 43 57 158 136 41 43 191 134 35 29 219 123 26 17 233 105 18 7 226 82 10 1 197 56 5 1 151 34 2 9 103 17 0 20 61 6 0 36 27 0 0 54 6 0 0 72 0 0 0 84 0 0 0 88 0 1 0 84 0 4 0 74 2 9 0 60 10 15 0 46 22 21 2 35 35 26 8 27 50 29 19 23 63 28 31 23 72 23 44 24 78 17 55 24 84 11 58 24 89 6 53 23 92 2 41 19 92 0 28 15 88 0 16 10 78 0 6 6 64 0 0 3 49 0 0 1 37 0 3 0 32 0 13 0 36 1 26 0 52 2 41 0 77 5 56 0 107 7 68 0 140 8 73 0 172 9 70 0 200 7 63 0 223 5 52 0 241 3 42 0 254 1 33 0 262 2 26 0 265 6 22 0 261 13 20 0 252 21 19 0 237 29 19 0 218 37 20 1 197 43 22 2 174 46 26 3 150 48 31 3 128 50 36 2 106 50 41 1 87 48 43 0 70 45 41 0 55 40 36 0 41 33 27 0 29 26 18 0 21 20 10 0 19 16 4 1 23 13 4 2 33 14 9 3 46 17 18 3 56 22 28 2 62 29 41 1 59 36 53 0 50 42 62 0 36 46 69 0 22 45 73 0 13 41 74 0 12 33 71 0 21 24 68 0 40 14 63 4 64 7 58 11 88 3 53 19 104 2 49 28 106 4 45 39 92 6 40 49 69 7 35 57 44 8 27 65 22 6 19 72 6 4 12 80 0 2 7 87 0 1 2 93 0 0 0 101 0 0 0 109 0 0 1 116 0 0 4 119 0 0 10 121 0 0 16 118 2 0 23 111 10 0 28 101 20 3 31 90 33 8 30 77 50 13 26 65 67 18 20 53 79 23 15 41 87 24 11 32 87 23 11 25 81 18 13 23 68 13 17 24 52 8 19 30 35 3 19 37 20 0 16 44 10 0 11 52 4 0 6 59 0 0 2 66 0 1 0 73 0 5 0 82 2 12 0 92 11 23 0 100 26 35 0 107 48 47 0 109 77 55 0 106 110 56 0 98 142 51 0 87 167 40 0 73 183 27 0 60 187 15 0 50 181 7 0 43 165 1 0 40 145 0 0 39 121 0 0 42 97 0 0 46 75 0 2 49 57 1 5 53 42 2 8 57 31 4 12 60 24 6 14 62 19 9 14 63 14 11 12 63 10 13 8 60 7 14 5 56 3 14 2 51 0 14 0 46 0 16 0 42 0 20 0 39 0 27 1 38 0 37 5 38 0 48 11 37 0 57 18 36 0 64 25 35 0 68 31 33 0 69 33 31 0 69 31 30 0 68 25 29 4 67 18 26 17 65 11 23 39 62 5 17 72 57 1 11 115 52 0 6 164 46 0 2 210 40 0 0 247 32 0 0 270 25 0 0 278 17 1 0 269 11 4 1 245 5 10 5 208 2 15 10 162 0 22 18 111 0 26 28 71 0 29 36 37 1 29 43 13 2 28 47 0 4 26 47 2 6 24 44 7 7 23 38 12 7 24 32 14 6 26 25 16 6 30 19 16 6 35 16 13 8 39 14 9 10 43 14 8 14 45 17 9 16 46 22 13 18 43 29 19 18 38 39 25 19 31 50 32 20 22 61 35 22 14 69 33 26 7 74 27 28 3 74 20 30 0 71 12 29 0 64 5 24 0 56 1 17 0 52 0 11 0 49 0 6 0 49 0 2 0 53 0 0 0 59 0 0 0 64 0 2 2 66 0 4 4 66 0 8 8 61 0 11 12 53 4 14 16 45 18 16 19 37 41 17 22 32 72 16 22 29 108 15 24 31 139 14 26 32 159 12 29 33 163 9 35 33 151 6 44 33 127 3 56 30 97 1 70 25 66 0 84 20 40 0 97 14 22 0 107 8 9 0 111 3 2 0 110 0 0 0 104 0 0 0 97 0 0 0 90 0 0 0 86 0 0 0 86 0 0 0 89 0 0 0 95 1 0 0 101 4 0 0 104 7 0 0 104 11 0 0 98 15 3 2 87 18 20 6 73 16 51 9 55 13 94 14 37 9 144 19 22 5 197 23 11 1 236 26 4 0 258 28 0 0 259 28 0 0 244 26 0 0 217 23 0 0 185 20 0 0 150 17 2 1 117 17 4 4 90 22 7 7 74 30 11 11 73 40 16 17 90 52 22 21 121 64 29 23 163 74 34 24 208 80 38 23 248 82 39 21 277 81 36 18 295 77 31 15 301 71 26 11 296 65 20 8 283 58 17 4 263 50 16 2 234 41 19 0 196 32 26 0 151 24 37 0 103 17 49 1 63 11 63 2 31 7 72 5 9 4 77 8 0 2 76 12 0 1 69 14 0 0 58 15 3 0 48 14 11 0 39 13 24 0 34 11 37 0 33 8 52 0 36 6 65 0 41 4 74 0 48 3 76 0 55 1 74 1 61 0 65 3 67 0 52 7 72 0 37 11 75 0 24 17 76 0 11 23 73 0 3 28 66 0 0 29 57 0 0 30 46 0 0 29 35 0 0 27 26 0 0 26 18 0 0 28 12 0 0 30 8 0 0 35 5 0 2 39 3 0 11 44 1 0 27 48 0 0 47 52 0 0 68 55 0 0 88 59 0 1 97 63 0 6 96 66 0 13 84 70 0 22 66 74 0 33 47 79 0 42 30 85 0 48 17 93 2 49 11 101 4 45 11 109 6 36 18 116 10 25 32 123 14 16 50 128 18 8 70 132 23 2 87 134 28 0 97 134 30 0 100 130 31 0 95 123 28 0 85 115 25 3 73 104 19 7 61 93 14 15 52 81 9 22 47 67 5 31 47 53 2 38 50 39 0 43 58 29 0 45 70 25 0 43 82 26 0 40 94 32 0 33 103 42 0 26 107 52 0 16 103 63 0 9 91 73 0 4 72 81 0 1 50 89 0 0 31 94 0 0 15 94 0 0 4 89 0 0 0 81 0 0 0 68 2 0 0 53 6 0 0 40 10 0 0 29 16 0 7 21 25 0 18 15 34 0 31 11 43 0 42 7 52 0 51 4 58 1 50 2 60 6 42 0 57 15 31 0 50 26 20 0 40 40 11 0 30 53 6 0 20 64 4 1 13 70 3 3 7 73 2 5 3 72 0 7 1 69 0 9 1 65 0 9 2 60 4 7 3 56 18 5 5 52 43 3 6 50 80 2 7 47 129 3 7 45 186 6 9 42 243 10 11 37 292 15 16 30 326 19 22 21 341 23 28 14 336 25 36 7 314 25 44 2 280 22 54 0 240 17 67 0 198 12 81 0 156 8 95 0 117 3 110 0 82 0 123 1 52 0 134 2 30 0 142 5 16 0 148 7 11 3 153 9 13 6 156 9 18 9 158 8 23 11 160 5 25 12 161 3 22 9 162 1 17 7 160 0 11 4 155 0 5 1 147 0 1 0 135 0 0 1 118 1 0 2 99 3 0 2 78 5 2 2 56 6 15 2 36 6 37 1 21 5 67 0 9 3 103 0 2 1 144 0 0 0 175 0 0 0 196 0 3 0 201 0 10 0 193 0 20 0 173 0 32 0 145 0 49 3 113 0 64 6 83 0 77 12 60 0 86 18 49 0 89 25 50 0 85 29 64 0 73 32 86 0 56 31 114 0 38 28 143 0 23 24 167 0 10 19 180 0 2 15 179 0 0 14 164 0 0 15 135 0 0 18 96 0 0 22 62 0 0 27 33 0 2 29 11 0 4 30 0 1 7 30 0 4 10 28 2 9 14 25 16 14 15 22 39 19 15 18 69 22 14 14 104 20 10 9 141 16 7 6 168 10 4 3 183 5 2 2 185 1 0 5 177 0 0 11 161 0 0 19 139 0 0 30 115 0 1 44 90 0 7 58 68 0 16 70 51 0 26 79 42 0 38 85 41 0 48 85 49 4 53 79 63 8 54 68 80 14 50 53 99 19 45 36 117 23 39 23 132 24 35 12 143 22 33 4 148 18 33 0 148 13 36 0 144 9 41 0 140 6 47 0 134 5 54 0 129 5 61 0 122 6 68 1 112 8 72 2 100 9 77 5 86 9 80 8 72 8 82 13 59 6 83 17 48 4 84 20 39 2 83 22 27 1 83 22 18 0 82 20 10 0 82 17 4 0 82 13 4 0 82 8 16 2 83 5 31 7 84 2 49 15 86 1 70 25 86 0 94 37 85 0 118 49 83 0 143 57 79 0 166 62 71 0 183 64 62 0 188 61 50 0 179 55 36 4 154 46 24 13 119 35 14 27 79 23 6 44 46 14 1 64 22 6 0 82 7 2 0 94 0 0 0 98 12 0 0 95 33 0 0 85 61 0 0 70 89 0 4 52 121 0 10 35 140 0 18 22 145 0 27 16 138 1 36 18 122 3 41 26 100 5 42 40 76 8 39 57 51 11 31 74 32 15 22 91 16 17 13 107 6 17 6 120 0 16 2 127 0 14 0 129 0 11 0 123 0 9 0 111 0 7 0 93 0 5 0 74 0 4 0 55 0 3 0 39 0 1 0 28 0 0 0 22 0 0 2 21 15 0 7 24 44 0 12 28 82 1 17 31 125 5 22 33 171 10 24 32 205 17 22 29 222 24 18 23 222 29 12 16 210 34 7 10 192 38 3 5 171 42 1 1 152 46 0 0 136 52 1 0 124 56 2 0 115 58 4 0 109 57 4 0 103 54 4 0 97 48 4 0 87 41 2 0 75 32 0 0 60 23 1 0 45 15 5 0 30 8 11 3 19 2 17 6 15 0 23 9 16 0 28 14 22 0 31 18 31 0 31 22 41 0 31 24 48 0 31 26 50 0 31 26 48 0 30 23 39 0 27 19 28 0 22 15 17 0 16 11 9 0 10 9 2 2 4 10 0 4 1 12 0 7 0 15 0 12 0 19 0 17 0 23 0 22 3 26 2 27 8 27 9 30 15 26 22 32 23 23 39 33 31 17 60 33 38 11 80 32 42 6 94 31 44 2 99 30 44 0 96 28 43 0 86 24 41 0 72 21 41 0 56 17 40 0 43 15 39 0 31 12 38 0 22 12 36 2 16 13 35 6 15 16 35 10 18 21 37 13 26 29 40 15 36 40 42 15 48 51 44 12 60 62 43 8 70 71 39 4 75 76 32 2 76 78 23 0 69 77 15 0 55 73 8 0 40 68 3 0 25 61 0 0 12 53 0 0 3 43 0 0 0 31 0 3 0 20 2 9 0 11 8 16 0 4 18 23 0 0 33 30 0 0 51 34 10 0 70 33 28 0 85 29 52 0 96 21 79 0 99 13 109 0 95 7 134 0 86 2 150 0 73 2 161 0 58 7 164 0 46 14 161 0 35 25 149 0 27 39 130 0 23 52 107 0 21 64 85 0 20 74 68 0 21 80 62 0 22 83 65 0 24 84 74 0 25 82 84 0 25 79 90 0 25 75 92 0 26 71 92 0 26 68 89 0 26 66 84 0 26 65 81 0 26 64 80 0 26 64 83 0 26 64 91 0 26 62 108 0 26 59 128 0 26 55 149 0 26 51 162 0 26 47 163 0 26 43 148 0 27 40 119 2 28 38 83 5 28 37 51 9 29 37 25 13 28 37 7 16 26 36 0 16 23 34 2 13 19 32 11 9 13 30 24 5 9 27 41 2 5 24 65 0 2 22 91 0 0 20 115 0 0 17 133 0 0 15 145 0 0 13 148 0 0 11 142 0 0 9 126 0 0 7 104 0 0 5 78 0 0 3 53 1 0 2 32 3 0 1 20 5 0 0 18 9 0 0 27 13 0 0 47 16 2 0 73 17 4 0 102 17 7 0 129 16 10 1 150 15 13 4 164 17 14 8 172 22 14 12 175 28 13 15 174 36 12 15 169 44 11 13 161 50 10 9 148 55 9 5 134 59 7 1 118 64 7 0 104 69 8 0 92 73 11 0 84 75 17 0 76 75 25 0 71 74 33 0 64 72 39 0 59 70 41 0 54 70 39 0 53 70 32 0 53 72 24 0 55 72 16 0 57 72 9 0 59 70 4 0 60 68 1 0 61 64 0 0 62 61 0 0 64 56 0 0 65 52 0 0 66 47 0 0 65 42 0 0 60 37 0 0 51 33 0 0 40 29 0 0 27 24 0 0 16 20 0 0 8 17 0 0 2 14 0 0 2 13 0 0 6 14 1 0 13 18 3 1 21 24 7 3 33 31 10 6 46 37 11 8 58 42 11 9 71 47 10 8 84 50 7 6 97 54 3 3 110 57 1 1 121 60 0 0 125 60 0 0 123 57 0 0 113 50 0 0 96 39 0 0 76 27 0 0 55 16 0 0 35 8 0 0 20 2 1 0 10 0 4 0 4 0 9 1 0 0 14 5 0 0 20 10 0 0 24 16 0 1 27 23 0 4 29 29 0 9 31 33 0 16 34 35 0 24 38 34 0 34 44 31 0 43 50 27 0 51 56 23 0 58 60 21 0 63 61 19 0 64 59 18 0 63 52 17 0 59 42 15 0 53 29 11 0 47 18 8 0 41 9 6 0 37 3 6 4 34 0 9 26 31 0 13 63 28 4 18 111 26 11 22 167 23 21 24 228 23 34 24 277 24 51 21 311 28 68 17 328 32 87 12 332 37 105 7 323 41 123 3 303 44 136 0 275 44 143 0 242 43 143 0 207 40 137 0 175 36 127 0 148 31 115 0 129 26 103 2 117 21 90 3 112 18 76 4 111 16 61 5 114 14 45 7 119 12 32 8 126 10 23 11 133 9 18 13 135 7 17 15 132 6 18 16 122 4 21 15 107 4 23 11 87 2 25 7 67 1 26 4 49 0 27 3 37 0 28 4 28 0 28 8 26 3 28 12 25 9 28 15 26 16 25 18 25 25 21 20 22 35 17 22 16 43 13 23 11 49 10 24 5 53 10 25 1 53 11 25 0 51 12 25 0 49 11 24 0 48 10 22 0 48 7 21 0 51 4 19 0 55 2 15 0 62 0 11 2 72 0 7 9 84 0 3 21 98 0 0 39 115 0 0 66 132 0 0 99 148 0 0 133 163 2 0 163 174 6 0 188 181 11 0 204 184 17 0 211 181 22 0 212 175 23 0 209 166 22 0 202 153 19 0 192 140 14 0 177 128 9 0 159 117 5 0 138 108 3 2 119 101 1 3 108 96 0 4 107 92 0 5 119 91 0 4 139 91 0 3 164 94 0 2 187 98 0 0 205 105 0 0 213 110 0 0 210 113 0 0 199 112 0 0 180 105 0 0 156 93 0 0 129 78 0 1 103 62 0 8 79 48 0 19 60 38 0 32 47 33 0 46 41 32 0 59 39 36 5 66 42 43 13 67 49 51 23 64 58 58 33 57 69 65 42 49 80 70 47 42 89 73 45 32 95 75 38 24 99 74 27 16 102 72 17 9 103 67 9 3 104 61 3 0 104 54 0 0 99 48 0 0 89 42 0 0 74 37 0 0 54 36 1 0 35 36 4 2 20 38 10 7 8 42 16 13 1 47 22 21 0 53 28 30 0 57 32 36 0 58 34 40 0 56 34 41 0 49 32 42 0 39 27 42 0 27 20 44 0 17 14 48 3 8 8 53 17 3 3 58 38 0 3 59 69 0 8 59 111 0 13 55 164 0 20 48 217 0 28 39 268 0 36 31 310 0 43 23 336 0 52 18 343 0 61 14 331 0 69 12 303 0 77 13 263 0 83 13 218 0 88 13 175 0 91 12 137 0 91 11 108 1 91 9 91 4 89 8 90 8 84 7 102 12 77 5 125 16 69 4 155 17 58 3 187 16 47 2 216 14 36 0 241 10 27 0 259 6 22 0 271 4 20 0 275 2 19 0 270 0 21 0 255 0 24 0 233 0 25 0 201 0 26 0 167 0 27 0 129 0 28 2 92 0 28 7 58 0 28 14 34 0 27 23 16 0 25 34 7 0 22 44 10 0 19 51 21 0 17 54 36 0 17 53 53 0 19 50 70 0 22 44 82 0 25 38 91 0 29 31 95 0 30 29 99 0 30 29 104 0 28 33 110 0 25 41 117 0 20 51 126 0 14 62 131 0 9 73 131 0 5 81 124 0 2 88 109 0 4 94 88 0 10 99 64 0 19 101 41 0 31 100 23 0 45 97 10 0 56 90 3 0 63 80 0 1 66 68 0 4 64 56 0 9 59 43 0 15 51 30 0 19 41 19 0 22 31 10 0 22 20 4 2 19 12 0 10 14 6 0 24 10 2 1 42 5 0 6 60 3 0 12 72 1 1 22 73 0 3 36 62 1 6 52 46 4 8 70 28 9 10 87 12 15 13 102 2 21 15 113 0 27 17 118 0 30 19 118 0 31 20 113 0 32 20 105 0 33 18 97 0 35 16 89 0 37 13 83 0 40 12 80 0 41 11 79 0 40 10 80 0 36 9 83 0 29 7 89 0 21 5 99 0 13 3 110 0 7 2 123 1 2 2 135 12 0 3 143 33 0 6 146 63 0 10 143 102 0 16 133 148 0 22 117 192 0 28 99 231 0 34 80 260 0 39 62 277 0 42 46 279 0 46 34 267 0 48 27 241 0 51 24 203 0 55 27 158 0 58 36 109 1 60 48 67 2 61 63 36 4 62 79 14 6 62 94 2 8 61 107 0 9 56 117 0 9 48 125 0 9 36 132 6 9 24 136 20 9 14 138 40 8 6 140 63 6 1 141 87 4 0 141 105 3 0 141 112 1 0 142 109 1 0 141 98 2 0 139 83 4 0 136 69 4 2 131 54 6 4 124 42 7 7 117 31 8 10 110 22 10 13 104 17 14 15 98 17 18 16 94 22 22 15 88 32 27 13 83 43 31 10 78 53 33 7 73 59 33 4 67 58 30 2 62 51 26 0 56 40 20 0 52 26 14 0 50 15 8 0 49 8 4 0 49 2 2 0 52 0 1 3 54 0 3 9 58 0 8 17 61 0 14 27 63 0 20 37 67 1 26 44 72 6 30 47 78 15 33 44 83 28 35 37 87 46 38 27 89 66 41 17 89 84 42 9 86 96 40 3 83 98 35 0 79 91 26 0 76 73 17 0 73 52 9 0 72 32 4 0 71 16 0 0 69 5 0 0 68 0 0 0 68 0 0 0 66 0 0 0 64 0 0 0 61 0 0 0 59 0 0 0 57 0 0 0 58 4 0 0 58 19 0 1 59 44 0 4 58 76 0 10 53 116 0 17 47 160 0 27 37 200 0 39 26 232 0 50 16 256 3 62 9 270 8 71 3 278 16 77 0 281 24 78 0 280 34 74 0 275 40 65 0 265 44 52 0 250 43 38 0 232 39 25 0 213 35 15 0 196 30 7 0 185 25 3 0 177 20 0 0 174 17 0 0 171 15 0 0 169 14 0 0 167 14 1 0 167 16 2 0 170 19 4 0 178 23 5 0 188 27 9 0 199 31 13 0 209 34 17 0 216 39 24 0 217 44 31 0 216 51 39 0 209 58 45 0 197 66 49 0 180 73 50 0 162 77 48 0 143 80 42 0 127 79 33 0 117 77 23 3 112 76 14 6 111 73 6 10 113 70 1 14 115 66 0 19 117 60 0 22 120 50 2 24 126 38 5 25 133 25 10 26 141 15 17 26 150 7 27 27 158 2 38 29 166 0 51 30 175 2 63 30 184 6 73 28 192 10 80 23 199 17 81 17 202 25 78 11 200 34 71 6 194 42 61 1 186 50 52 0 175 54 44 0 163 55 38 0 151 54 36 0 139 50 35 0 127 47 36 0 117 44 38 0 109 43 39 0 104 41 39 1 105 40 39 4 113 37 39 9 128 33 38 16 149 29 37 25 177 26 38 34 205 25 39 41 232 25 41 45 254 28 45 44 267 31 50 41 272 36 54 34 267 41 57 27 252 45 59 18 230 49 60 11 202 51 60 6 171 52 59 3 136 51 57 0 102 50 53 0 69 48 48 0 43 45 42 0 23 42 37 0 9 39 31 0 1 37 27 0 0 37 22 0 0 40 18 1 0 48 15 4 0 58 13 7 0 71 11 11 0 85 10 13 0 100 8 13 3 113 6 11 12 124 4 8 25 133 2 4 40 139 1 1 57 142 3 0 72 142 6 0 81 139 8 0 82 135 11 0 74 129 13 0 60 122 13 0 43 115 13 0 27 109 12 3 13 101 12 7 3 95 11 12 0 88 10 17 0 82 9 21 0 76 8 24 1 72 6 24 5 70 6 22 11 67 8 18 18 64 12 14 25 61 19 8 32 55 28 5 35 48 37 4 37 41 46 5 37 36 52 6 35 31 57 9 32 29 61 11 25 26 65 13 18 25 68 17 11 23 69 21 5 20 70 29 1 17 68 38 0 15 63 48 0 14 55 57 0 14 46 64 0 15 36 67 0 17 28 67 0 21 20 64 2 26 14 57 9 32 10 47 20 39 7 35 33 46 5 23 51 52 4 13 70 56 2 6 86 58 1 1 97 59 0 0 100 59 0 0 96 58 0 1 86 56 0 4 72 52 0 7 61 46 0 11 55 39 0 15 55 33 0 19 62 27 0 22 71 23 0 26 82 21 0 32 94 20 0 38 105 18 0 44 117 15 0 52 127 11 0 59 134 8 0 65 134 4 0 71 127 3 0 78 114 4 0 85 96 8 0 91 79 13 0 97 64 20 0 100 53 27 0 100 46 32 0 97 45 36 0 93 47 39 0 88 52 39 0 82 59 37 0 76 68 35 0 70 80 31 0 63 95 29 0 54 113 30 0 43 131 33 1 32 150 36 5 21 165 39 11 12 177 42 20 5 183 44 30 1 183 45 41 0 177 47 50 0 165 49 57 0 147 51 62 0 125 52 64 0 102 52 63 0 79 50 61 1 59 45 57 6 44 40 51 11 34 35 47 15 26 32 42 19 21 30 38 22 16 32 35 23 11 35 33 22 7 39 31 21 3 42 32 19 0 44 34 19 0 44 38 18 0 44 44 17 0 44 50 16 3 44 55 17 10 44 57 18 21 44 58 20 36 44 58 23 56 42 57 27 74 38 56 30 88 33 55 31 96 29 53 30 101 27 52 27 104 29 53 23 108 35 55 20 111 44 60 18 115 54 66 15 117 62 72 13 119 67 74 11 120 68 72 10 120 65 65 10 121 60 54 15 122 52 42 23 121 43 31 34 117 34 23 47 108 24 20 61 96 15 22 73 80 9 27 83 63 5 33 90 46 2 39 95 31 1 43 98 19 1 45 98 13 0 44 96 10 0 40 92 13 0 34 86 20 0 29 78 31 0 24 71 45 0 23 64 60 0 24 57 75 0 26 51 88 0 30 46 99 0 33 42 108 0 38 40 115 0 43 39 117 0 50 37 113 0 57 37 99 0 65 36 77 0 70 34 54 0 72 32 33 0 70 31 14 0 65 31 2 0 57 33 0 0 48 36 0 0 38 39 1 0 29 44 8 0 19 51 20 0 12 57 35 0 6 68 52 0 2 80 73 0 0 91 92 0 1 101 112 0 4 107 132 0 9 107 153 0 16 101 171 0 26 92 184 0 38 81 187 0 50 71 181 0 60 61 165 0 69 54 141 0 75 48 115 0 78 43 89 0 79 38 66 0 79 36 46 0 78 37 30 0 76 41 18 0 73 47 10 0 67 55 4 0 59 63 1 2 51 69 0 5 44 73 0 10 38 74 0 16 36 73 0 25 35 69 0 36 37 61 0 49 39 51 0 62 41 40 0 75 43 28 0 88 43 17 0 99 42 9 0 109 39 4 3 118 36 0 11 124 32 0 24 128 30 0 40 130 29 0 61 131 29 1 82 131 28 4 100 132 25 7 116 134 19 8 128 136 13 10 135 138 7 8 139 137 2 7 142 133 0 4 145 127 0 1 147 120 0 0 146 111 0 0 140 102 0 0 127 92 0 0 106 80 0 0 80 68 0 0 52 54 2 1 30 40 6 5 13 27 14 10 3 16 24 20 0 9 37 34 0 6 51 51 0 6 62 70 0 11 68 89 0 19 68 104 0 30 60 114 0 40 46 116 0 50 32 112 0 57 18 103 0 63 8 92 0 64 1 79 0 63 0 70 0 57 0 61 0 50 0 55 0 41 0 51 0 31 0 51 0 20 0 52 2 12 0 56 8 6 0 61 15 2 0 67 22 0 0 72 27 1 0 75 27 5 1 77 23 11 3 75 16 19 5 71 10 30 6 62 7 41 6 51 7 52 5 37 8 62 3 24 8 70 1 13 8 73 0 6 6 73 0 1 2 70 0 0 0 63 0 0 2 54 0 0 10 45 0 0 23 35 0 1 41 26 0 1 62 18 0 1 82 12 0 1 99 8 0 2 114 8 0 3 133 11 0 5 158 16 1 6 191 23 5 6 232 29 11 5 277 34 20 4 324 37 31 1 370 39 42 0 414 40 52 0 458 40 59 0 499 39 62 0 532 37 62 0 551 35 59 0 554 31 54 0 540 27 47 3 511 22 42 6 471 16 38 10 422 11 36 14 366 6 35 19 302 2 35 22 233 0 36 23 164 0 37 23 103 0 39 21 56 0 43 17 24 0 48 12 9 0 54 7 9 0 64 3 23 2 75 0 46 4 88 0 79 6 102 0 122 10 114 0 171 14 124 0 222 18 130 0 267 24 132 0 303 31 131 0 325 38 128 0 330 44 125 0 320 49 122 2 297 51 117 8 267 50 112 16 235 46 105 26 205 40 97 37 181 31 88 44 159 23 80 47 138 15 74 45 114 8 70 38 89 3 67 27 64 1 65 17 43 0 62 9 28 0 59 3 20 0 56 0 16 0 54 0 13 0 54 0 10 2 55 0 7 5 57 0 3 10 59 0 1 15 60 0 0 21 59 0 0 26 55 0 0 31 49 0 0 35 40 0 0 39 31 0 5 44 22 0 16 48 13 0 34 51 7 0 61 52 3 0 95 52 1 0 132 50 0 0 167 48 0 0 199 46 2 0 220 43 6 0 229 39 13 0 224 33 22 0 206 27 33 0 177 21 45 0 140 17 58 0 102 15 70 0 68 15 81 0 40 15 89 0 20 17 94 0 9 20 94 0 2 25 90 0 2 28 81 0 12 30 70 0 26 29 59 0 42 25 48 0 55 19 39 2 63 12 34 5 60 5 34 10 47 1 40 16 32 0 50 22 17 0 66 29 6 0 84 35 0 0 102 39 0 0 119 41 0 0 132 42 0 0 140 41 0 2 144 39 0 8 142 37 0 17 136 33 0 28 126 29 0 40 114 23 0 52 102 17 0 60 90 11 0 64 78 6 0 66 67 1 0 65 57 0 0 62 49 0 0 56 42 0 0 48 37 1 0 38 33 6 0 27 30 14 1 16 28 22 13 9 26 30 31 4 25 38 56 2 24 40 86 1 24 40 120 1 25 38 151 0 26 37 177 0 26 34 198 0 27 33 214 0 28 32 225 1 28 31 228 4 30 30 219 9 31 31 197 15 32 33 161 22 31 37 116 27 27 41 75 30 20 44 41 30 14 46 15 29 8 46 1 29 2 45 0 29 0 43 0 28 0 40 0 27 0 38 2 26 0 36 14 23 0 33 35 22 1 29 64 23 6 21 98 25 15 15 133 28 26 9 157 31 42 3 163 33 58 0 152 34 72 0 124 34 83 0 87 32 90 1 54 30 93 5 27 27 93 8 8 24 92 13 0 21 89 20 0 19 87 27 0 18 85 34 0 18 83 42 0 18 83 50 7 18 84 59 28 18 87 66 61 18 91 68 102 19 96 67 151 21 102 61 198 25 106 51 231 29 109 38 247 32 109 26 244 34 107 15 221 33 102 8 183 31 95 6 134 27 86 8 89 21 77 16 50 16 67 27 21 12 58 39 3 10 50 52 0 10 42 62 0 13 37 67 0 15 34 68 5 17 34 62 25 17 36 53 56 16 40 39 98 12 47 26 150 8 55 15 207 4 65 7 254 2 77 1 288 0 91 0 303 0 103 0 299 0 114 0 277 0 121 0 241 0 124 0 198 0 125 0 154 0 123 0 117 0 122 0 90 0 120 2 76 1 118 3 76 2 116 4 87 4 112 5 106 7 109 4 129 9 105 3 150 11 100 2 167 11 97 0 179 11 93 0 184 9 89 0 185 7 86 0 180 4 85 0 170 2 85 0 153 1 87 1 129 0 89 4 98 0 90 8 67 0 88 16 41 0 85 25 19 0 80 34 5 0 74 44 0 0 67 50 0 0 59 52 0 3 51 49 7 9 41 40 20 18 29 29 41 29 19 18 66 42 11 9 96 52 4 2 121 59 0 0 137 63 0 0 142 65 0 0 139 64 0 0 128 62 0 0 113 57 0 0 97 50 0 0 79 40 0 0 61 29 0 0 43 18 0 4 28 10 0 11 21 4 0 18 25 2 0 26 40 4 0 34 64 9 0 37 93 14 0 35 122 22 0 31 149 30 0 24 171 38 0 16 189 45 0 9 202 50 0 5 210 52 0 1 211 50 0 0 207 44 0 0 198 35 0 0 186 24 0 0 173 15 2 0 160 7 5 0 147 3 10 0 133 3 17 0 119 4 25 0 107 6 33 0 98 6 40 0 95 6 44 2 97 4 46 8 103 2 46 17 112 1 45 28 123 0 43 42 134 0 41 55 144 0 40 67 153 0 39 75 159 0 38 85 160 0 38 93 154 0 40 105 141 0 43 116 123 0 47 127 102 0 51 134 81 0 56 138 64 0 59 135 51 0 61 129 44 0 62 121 42 0 62 112 45 0 61 104 50 1 59 99 58 2 56 94 68 3 51 88 80 5 44 83 95 9 36 78 116 14 27 71 143 20 18 65 176 26 11 58 208 31 8 49 232 33 8 42 244 33 11 36 242 30 15 30 225 25 19 27 199 20 21 26 170 15 21 25 140 11 18 26 107 8 14 26 75 6 9 25 49 4 6 26 26 2 3 28 9 1 1 32 0 0 0 38 0 0 0 44 0 0 0 51 0 0 0 56 0 0 2 60 0 0 6 64 0 0 10 70 0 0 15 75 2 0 22 81 8 0 30 86 20 0 40 88 38 0 53 86 62 0 66 82 90 0 78 75 116 0 88 66 137 0 94 58 152 0 96 50 158 1 96 43 154 3 94 39 143 6 91 37 125 10 87 37 104 15 83 38 81 18 77 39 60 20 69 40 44 19 61 42 37 16 51 43 39 13 41 44 50 11 31 45 71 13 24 44 97 17 20 43 125 24 19 39 152 31 22 34 175 40 28 28 193 48 35 24 207 55 41 21 219 61 46 21 226 66 48 23 230 70 48 26 230 72 46 28 224 73 41 29 214 72 34 29 204 70 25 28 195 68 17 29 190 65 10 32 189 60 4 36 191 53 1 39 193 45 0 43 195 34 0 44 196 23 2 45 196 13 4 43 196 6 7 40 196 1 10 37 196 0 15 34 197 0 20 30 198 1 24 26 200 3 29 21 201 4 32 17 202 6 33 14 201 7 32 14 197 7 29 15 191 6 24 18 184 4 20 23 177 2 15 28 171 3 12 31 162 5 8 34 147 10 5 34 127 18 3 31 99 27 1 29 68 36 0 27 42 43 0 24 22 47 0 22 15 49 0 20 22 50 0 15 38 49 0 11 58 48 3 7 79 47 7 3 100 46 12 0 117 44 19 0 129 41 25 0 135 35 31 0 130 28 35 0 113 20 36 0 85 13 35 0 58 7 31 0 32 2 24 6 11 0 17 15 0 0 10 29 0 0 5 45 0 0 1 63 0 0 0 79 0 0 0 91 0 0 0 101 0 0 0 107 0 2 0 111 0 6 0 114 7 11 0 115 23 18 0 115 45 27 0 115 67 35 0 115 86 42 0 116 92 46 0 118 82 46 0 123 62 44 0 130 40 40 3 139 18 34 7 147 4 30 10 151 0 29 14 152 0 30 15 147 0 34 14 135 0 40 10 119 0 46 7 103 0 50 3 88 1 52 0 77 5 53 0 68 12 55 0 63 19 58 0 59 27 62 2 55 34 66 6 51 39 72 10 48 40 78 16 45 39 83 22 42 34 88 27 38 27 91 33 33 19 93 38 26 12 95 43 18 5 98 47 11 1 102 49 6 0 108 48 3 0 117 44 1 0 128 36 1 0 141 26 0 0 154 17 0 6 166 9 0 20 177 3 0 40 184 0 0 62 189 0 0 87 190 0 0 107 188 0 0 120 183 0 0 122 176 0 2 119 164 0 3 107 152 0 6 91 135 0 11 69 117 0 17 47 98 0 23 28 82 0 29 13 67 0 33 6 57 0 35 9 50 0 37 18 48 4 37 32 48 8 37 49 50 15 38 64 54 22 39 73 57 31 39 74 60 38 39 64 60 45 39 48 60 49 41 31 57 50 44 15 53 49 49 4 47 44 56 0 39 35 65 0 29 24 74 0 20 16 83 0 12 8 90 0 5 2 96 0 1 0 97 4 0 0 96 16 0 3 93 33 0 9 89 56 0 17 83 82 0 27 76 106 0 41 70 121 0 55 62 126 3 67 55 116 8 78 50 94 12 85 47 67 17 87 47 43 21 83 50 21 21 73 55 6 18 59 64 0 13 42 75 0 9 27 85 0 4 15 95 0 2 6 102 0 0 0 105 0 0 0 106 0 0 0 105 0 0 0 102 3 0 1 98 15 0 5 93 32 0 14 86 54 0 27 77 76 0 44 67 97 0 63 57 109 0 80 48 113 0 93 41 111 0 99 36 107 0 99 34 105 0 95 34 104 0 88 34 103 0 79 37 99 0 68 42 93 0 58 50 84 0 48 59 74 0 40 69 65 0 34 78 58 0 31 84 53 0 32 86 51 0 37 86 53 0 44 83 58 0 53 79 66 0 64 75 78 0 75 69 90 4 86 62 99 12 97 54 102 23 108 44 99 36 118 34 90 50 128 23 78 61 137 15 67 68 143 8 60 70 147 4 58 67 147 0 59 61 145 0 62 51 141 0 64 39 139 1 64 26 139 5 60 16 141 10 53 8 146 17 47 2 154 24 45 0 162 31 45 0 168 35 50 0 173 35 57 0 175 32 65 0 174 26 69 0 172 18 70 0 168 11 67 0 163 6 58 2 157 1 44 7 150 0 31 14 141 0 19 22 130 0 8 31 119 0 1 38 107 0 0 41 94 0 0 39 82 0 0 33 71 0 0 26 61 0 0 18 54 0 1 11 50 0 7 6 48 0 17 2 48 0 31 0 50 0 48 0 53 0 66 0 57 0 80 0 62 1 88 1 68 6 90 2 73 12 85 5 77 19 72 8 79 26 54 12 79 35 37 14 77 41 22 15 73 45 10 15 68 49 1 15 61 52 0 14 54 53 3 14 45 50 10 13 36 44 21 11 26 34 34 9 17 24 51 7 10 14 68 6 4 6 86 7 3 1 104 11 6 0 121 16 12 0 136 20 19 0 145 23 28 0 148 23 35 1 145 22 41 5 138 20 45 8 132 20 49 14 129 22 53 21 133 24 58 25 141 27 62 28 151 29 65 30 162 30 64 30 172 29 59 30 179 28 51 31 184 29 41 34 184 30 31 38 181 32 22 43 170 33 15 48 155 34 11 54 131 36 7 61 105 37 5 68 78 38 4 73 53 40 2 76 33 41 1 75 18 40 0 69 9 36 0 58 4 33 0 45 2 30 0 32 3 28 0 20 6 28 0 11 10 30 0 5 16 32 0 2 24 34 0 0 31 34 0 0 36 34 0 0 39 33 2 0 39 33 8 0 34 33 17 4 26 36 28 8 18 40 42 15 11 48 54 22 4 58 63 30 0 69 69 35 4 80 70 39 11 91 66 40 18 99 57 40 26 106 44 38 34 110 30 36 39 113 19 34 40 113 9 32 37 111 2 29 31 106 0 27 23 97 0 25 15 87 0 24 9 76 0 23 8 64 0 23 12 53 0 24 20 44 0 24 24 35 0 23 26 28 1 21 23 23 3 20 17 23 7 20 9 27 10 20 2 35 12 20 0 47 12 20 0 60 10 17 1 73 7 13 5 83 3 8 11 90 1 5 21 95 0 1 35 95 0 0 53 91 0 0 73 83 0 0 93 72 0 0 109 61 0 1 123 52 3 6 132 47 7 12 139 47 14 18 143 51 22 25 147 57 31 33 150 65 40 38 154 73 47 40 159 80 53 40 166 87 56 39 178 95 58 33 193 100 58 25 211 104 56 17 230 105 55 10 246 103 56 4 258 98 59 0 262 89 65 0 256 80 73 0 242 72 82 0 221 66 90 0 196 63 99 0 169 62 106 0 146 60 115 0 124 58 122 0 107 55 128 0 93 50 131 0 80 45 131 2 68 41 129 3 58 37 125 3 50 32 121 3 42 24 118 3 38 17 117 2 35 10 117 0 35 5 118 0 38 1 119 0 43 0 121 0 51 0 122 0 61 0 123 0 75 0 124 0 91 3 124 0 108 8 122 0 124 15 117 0 138 23 111 0 147 31 102 0 152 36 91 0 154 37 78 0 153 36 64 0 146 31 48 0 130 26 33 0 109 21 21 0 82 15 11 0 55 10 4 0 32 6 1 4 21 3 1 9 23 0 4 17 38 0 7 26 62 3 13 36 90 11 20 44 115 22 27 47 133 36 35 47 139 53 42 43 135 69 47 34 120 84 51 24 100 97 51 15 80 107 48 8 65 118 42 3 58 129 33 0 61 140 23 0 71 150 15 0 90 160 9 0 115 170 7 0 147 180 6 0 187 189 7 0 234 200 7 0 283 211 7 0 329 221 8 0 365 228 9 0 385 231 11 0 385 228 13 0 365 219 15 0 329 205 15 0 283 189 12 0 233 171 9 1 184 155 5 6 141 142 2 14 108 132 0 24 85 123 0 35 74 116 0 46 74 109 0 56 85 100 0 64 105 90 0 69 132 79 0 72 161 66 0 74 185 55 1 74 201 44 4 74 208 35 9 73 205 28 14 72 195 24 21 71 180 22 28 71 165 23 33 71 150 25 37 70 139 29 41 69 131 34 43 66 127 38 45 64 127 44 45 62 131 48 45 65 135 50 45 68 137 52 45 73 135 52 45 79 129 49 46 84 118 43 46 86 104 36 43 85 92 26 40 81 86 17 34 77 87 9 27 71 94 4 19 65 109 1 13 61 127 0 7 57 142 0 4 54 152 0 4 51 153 0 7 48 142 0 12 46 121 0 18 47 91 0 25 50 61 0 32 58 36 0 38 71 16 0 44 87 3 0 51 106 0 0 57 126 0 0 61 144 0 0 62 159 0 0 59 169 0 0 52 171 0 0 42 166 0 0 31 153 4 0 20 136 16 0 12 117 30 0 6 100 42 0 2 84 51 0 1 72 51 0 2 63 42 0 5 56 30 0 12 49 16 0 21 44 4 0 33 41 0 0 46 43 0 0 58 47 0 5 67 53 0 13 73 61 0 23 73 68 0 37 69 72 0 51 59 72 0 64 44 71 0 70 30 67 0 72 17 63 0 69 7 60 0 62 1 60 0 53 0 64 0 43 0 73 0 33 0 85 0 24 0 100 0 16 0 115 0 10 1 129 0 5 4 141 0 2 9 150 0 3 16 155 0 7 23 154 0 13 30 150 0 21 34 139 7 29 33 123 18 35 28 105 30 39 20 86 43 39 13 69 55 36 6 56 60 33 1 51 57 31 0 51 50 32 0 57 39 37 0 65 27 44 0 74 16 54 0 80 9 63 0 84 4 73 0 86 0 82 0 84 0 93 0 78 2 103 0 71 11 115 0 60 23 126 0 47 35 136 0 34 47 144 0 22 59 148 0 12 69 148 0 5 78 145 0 3 91 141 0 3 108 135 0 5 126 131 0 5 144 127 0 5 157 125 0 4 164 124 0 2 169 122 0 0 173 119 0 0 182 115 0 0 195 109 0 0 211 103 0 0 226 98 2 0 238 93 6 0 242 90 13 0 241 88 22 0 237 85 34 0 234 81 46 0 235 76 55 0 241 72 64 0 252 69 69 0 266 68 72 0 279 69 73 0 286 71 73 0 287 74 71 0 281 76 70 0 267 78 66 0 248 79 62 0 224 81 55 0 197 81 46 0 166 82 33 0 133 82 22 0 99 80 12 0 67 77 5 0 41 73 0 0 21 68 0 0 8 63 0 0 3 59 0 0 7 56 0 0 19 54 0 0 37 53 0 0 65 51 1 2 99 48 5 3 136 46 10 3 169 42 15 3 194 39 22 3 204 38 28 2 192 37 34 3 163 36 39 7 120 36 42 14 79 35 43 23 43 33 42 33 16 30 36 42 1 24 27 52 0 17 19 60 0 11 10 66 0 6 4 73 0 2 0 77 0 0 0 79 0 0 0 78 1 0 0 75 10 0 0 71 27 0 2 66 48 0 4 60 70 0 9 54 93 0 15 49 108 0 24 43 114 0 33 39 113 0 43 39 111 0 51 42 108 0 59 47 109 0 64 52 111 0 67 56 111 0 67 56 104 0 66 55 90 0 62 52 70 0 57 51 47 0 50 53 28 0 43 57 16 0 36 63 15 0 30 69 21 0 26 74 33 0 24 77 46 0 25 80 59 0 26 82 74 0 28 84 89 0 30 85 104 0 30 86 121 0 29 86 136 0 27 86 149 0 24 85 160 1 19 83 169 4 13 80 176 9 9 76 183 14 5 72 190 21 2 68 196 27 0 65 204 32 2 62 213 35 6 57 224 38 12 52 236 38 20 44 246 35 29 36 252 32 37 28 250 29 43 25 243 25 47 26 230 21 50 32 213 19 51 39 192 17 50 47 168 17 46 53 140 17 40 56 109 20 32 55 79 24 23 53 55 29 16 51 41 32 10 47 37 32 7 40 43 29 7 32 55 25 8 25 71 19 9 16 86 14 11 8 99 11 13 4 107 10 14 1 111 9 15 0 108 8 15 0 100 6 14 0 89 4 11 0 79 4 8 2 70 7 5 5 64 13 2 8 59 21 0 11 54 31 0 14 48 39 0 15 41 46 0 15 34 51 0 15 30 54 0 15 32 53 0 15 40 49 0 16 57 42 0 16 81 32 0 17 110 22 0 19 143 13 0 23 174 6 0 29 202 2 0 35 222 0 0 43 232 0 0 47 230 2 0 49 218 7 0 47 197 14 0 44 174 22 0 40 151 33 0 36 133 42 0 32 124 51 0 29 124 56 0 26 132 59 0 22 147 58 0 17 169 55 0 13 195 49 0 11 227 42 0 10 261 34 0 12 294 27 0 15 323 20 0 19 345 14 0 24 359 8 0 31 365 4 0 37 364 2 0 46 358 1 1 56 348 2 3 63 335 4 4 65 320 7 5 63 305 10 4 56 293 14 4 43 287 18 2 30 287 22 0 18 293 29 1 9 301 36 5 3 308 44 8 0 310 53 12 0 303 63 16 0 286 74 18 0 263 84 17 0 234 93 13 0 200 100 9 0 163 105 5 0 125 107 2 0 84 106 0 0 52 101 0 0 27 93 0 3 9 81 0 10 0 66 0 19 0 51 0 27 0 37 0 37 0 26 0 41 0 18 0 41 0 12 3 37 0 8 11 32 0 6 22 27 0 3 37 25 0 4 55 26 0 8 71 28 0 16 85 30 0 24 98 33 0 35 107 33 0 43 114 31 0 48 118 29 0 52 117 26 4 55 112 22 15 57 100 17 30 60 86 13 47 63 72 9 67 64 61 5 88 63 54 1 109 59 51 0 129 53 52 0 146 43 54 0 157 34 55 0 160 23 54 0 152 15 52 0 137 8 51 0 117 4 52 0 100 1 55 0 89 0 61 0 87 0 67 0 92 0 73 0 102 0 77 0 112 1 79 0 117 5 79 0 117 11 79 0 112 20 80 0 102 32 80 0 92 44 81 0 84 54 80 0 81 62 77 0 84 66 71 0 92 65 62 0 108 59 50 0 128 49 35 0 155 38 22 0 183 29 12 0 214 21 5 0 243 15 1 0 269 13 2 0 290 12 4 0 304 13 4 0 309 15 4 0 302 21 4 0 284 28 2 0 255 37 1 0 217 45 0 0 175 50 0 0 132 52 0 0 90 51 0 0 56 48 0 0 32 46 0 2 14 47 0 6 2 50 0 10 0 55 2 15 0 62 5 20 0 70 8 23 0 79 11 23 0 87 14 20 0 95 14 15 0 102 14 10 4 106 13 6 13 107 11 2 26 104 8 0 41 98 7 0 58 90 6 0 72 82 9 0 81 72 14 0 81 64 22 0 77 56 33 2 68 49 45 6 59 43 55 11 49 38 62 19 40 34 64 26 31 30 61 34 22 25 54 41 15 21 44 47 9 17 37 51 4 12 30 54 1 7 25 56 0 4 22 56 0 2 19 58 0 0 16 62 0 0 13 69 0 0 10 78 0 0 9 87 0 0 9 94 0 0 10 97 0 0 11 96 0 0 12 92 0 0 12 86 8 0 13 80 24 0 13 77 47 0 13 74 74 0 13 72 104 0 13 70 126 0 13 65 137 0 13 56 137 0 13 44 127 0 13 32 112 0 13 21 95 0 13 14 81 0 14 13 74 0 14 16 76 0 15 21 86 0 15 28 102 0 14 33 122 0 11 36 142 0 8 37 158 0 5 38 169 0 2 40 172 0 0 42 169 1 0 44 158 3 0 45 144 6 0 45 126 8 0 45 108 11 0 43 89 12 0 41 69 11 0 39 50 8 0 38 33 6 0 40 19 3 0 46 8 1 0 53 1 0 0 62 0 0 0 70 0 0 0 75 0 0 0 75 4 0 0 72 9 0 0 68 15 0 0 65 22 0 0 63 31 0 1 64 41 2 5 65 53 8 11 67 66 17 19 65 77 27 27 63 82 39 34 59 79 50 38 57 66 58 38 57 48 63 32 59 30 66 24 63 15 68 16 67 3 66 8 71 0 61 3 71 0 52 0 71 0 41 0 69 0 27 0 67 0 16 0 67 0 8 0 69 0 2 0 71 0 0 0 72 0 0 3 72 7 0 9 71 19 0 18 68 34 0 26 64 48 0 34 59 60 0 37 52 63 2 36 46 55 4 29 39 41 8 21 34 26 13 12 31 13 19 6 30 4 26 1 29 0 35 0 29 0 44 0 29 0 55 0 27 0 65 0 25 0 74 0 24 0 82 0 22 0 87 0 21 0 90 0 21 0 92 0 21 8 94 0 21 32 96 0 21 72 98 3 21 124 101 9 20 189 105 16 18 255 109 25 14 309 110 35 10 344 109 42 6 358 105 47 3 351 99 49 3 328 91 48 6 295 84 47 10 259 79 46 15 224 75 46 19 191 71 46 23 163 70 46 25 141 68 46 26 127 67 44 25 123 67 41 23 133 70 37 20 157 75 31 17 195 81 26 13 239 85 20 9 284 85 15 6 324 80 11 4 350 68 8 2 361 53 6 0 358 35 5 0 342 21 5 1 314 10 6 5 281 3 10 10 243 0 16 17 206 0 23 24 170 0 32 32 137 0 39 37 108 0 44 39 84 1 48 38 63 3 49 37 48 7 49 34 39 13 48 28 36 20 46 23 44 26 43 16 62 31 39 10 87 34 36 5 118 35 32 2 148 34 28 0 172 32 24 0 187 29 20 0 191 28 16 0 183 29 13 0 166 33 11 0 144 40 10 0 118 49 10 0 93 59 12 0 69 68 13 0 47 75 13 0 29 77 10 0 16 73 8 0 7 65 5 0 3 53 2 2 6 40 0 8 11 29 1 16 17 20 5 26 23 15 14 38 31 13 26 50 39 14 41 59 48 17 57 64 54 21 71 65 58 26 79 60 54 30 81 53 43 33 78 45 31 34 70 37 18 33 59 31 7 31 48 28 0 28 38 28 0 23 30 29 0 17 25 29 3 12 23 29 9 7 21 27 15 3 21 26 21 0 21 26 28 0 23 29 32 0 26 34 35 0 32 43 37 0 40 55 44 0 50 70 56 3 58 84 77 7 64 99 108 14 66 110 147 22 65 119 187 29 60 123 224 34 53 126 250 35 47 126 260 32 39 126 257 26 32 122 244 17 26 117 224 10 22 109 204 5 19 98 180 1 20 82 157 0 22 66 135 0 28 49 116 0 35 35 107 0 46 24 110 0 58 18 124 0 73 17 147 0 89 22 174 0 107 31 201 0 125 42 224 0 142 54 243 0 157 64 256 0 170 70 261 0 179 74 256 0 187 74 238 3 191 68 210 8 192 60 174 14 188 48 137 21 181 34 102 27 170 22 74 31 156 12 55 31 142 4 44 29 127 0 39 26 114 0 40 24 102 1 47 23 94 5 60 23 88 10 78 24 85 15 100 23 84 22 120 22 85 29 136 18 88 34 141 13 90 38 135 8 92 41 120 5 93 43 96 2 92 42 70 0 89 40 45 0 85 36 26 0 81 33 12 0 77 32 4 0 73 33 0 0 71 35 0 0 70 39 0 0 71 45 0 0 73 51 0 0 77 56 10 0 81 63 29 0 85 67 53 0 90 68 83 0 93 64 117 0 95 55 145 0 97 43 164 0 97 29 173 0 96 17 172 0 94 8 162 0 90 2 141 0 83 0 111 0 76 0 78 0 68 0 49 0 60 0 24 0 51 0 7 0 43 0 0 0 35 2 0 0 28 4 0 0 23 6 0 0 19 7 0 0 17 9 0 0 18 10 0 0 22 11 0 0 27 13 0 0 36 16 2 0 46 18 13 0 57 19 33 0 66 18 62 0 75 15 100 2 81 13 145 4 85 10 189 7 86 9 228 8 85 9 256 8 82 11 271 7 76 14 272 4 69 17 258 2 59 20 230 0 49 23 189 0 39 29 142 0 29 36 94 0 21 45 56 0 15 56 27 0 11 67 8 0 8 76 0 0 6 82 0 0 4 84 0 0 3 82 0 0 1 77 0 0 0 70 0 0 0 60 0 0 0 50 0 4 0 38 0 8 0 27 0 13 2 19 0 18 5 14 0 22 8 12 0 23 12 13 0 24 16 14 0 24 18 15 0 24 18 17 0 26 16 19 0 30 12 22 0 34 8 25 0 39 5 27 0 43 2 29 0 46 0 29 0 48 0 25 0 48 0 20 0 48 0 15 0 47 0 10 0 47 0 6 1 46 0 4 6 46 0 2 13 46 0 1 21 46 0 0 28 47 0 0 34 47 0 0 37 48 2 0 37 48 5 0 36 48 8 0 35 48 11 0 36 45 13 0 37 40 13 0 37 34 12 0 34 27 11 0 28 20 12 0 21 15 15 0 13 13 18 1 6 12 23 1 1 13 27 1 0 15 29 1 0 17 29 0 1 18 28 0 2 20 26 1 4 24 26 1 9 29 29 2 17 35 35 2 30 39 43 2 44 43 51 1 59 45 57 1 71 46 59 0 79 48 58 0 82 53 54 0 81 60 49 0 76 69 43 0 68 80 36 0 57 91 28 0 45 97 20 0 31 98 12 0 19 93 6 0 9 84 2 0 4 70 0 3 4 56 0 9 10 43 0 14 18 35 0 20 28 29 0 26 37 26 0 29 44 26 0 26 48 26 0 20 50 26 0 14 51 28 2 9 55 30 6 3 61 34 11 0 71 40 17 0 78 46 24 0 82 52 29 0 78 57 31 0 64 62 29 0 46 64 24 0 30 64 17 0 14 62 11 0 3 58 6 0 0 52 5 0 0 46 8 0 0 40 15 0 0 34 24 0 1 28 35 0 7 22 47 0 18 15 60 0 33 10 73 0 55 5 84 0 82 2 93 0 110 0 100 0 134 0 104 0 150 0 106 0 155 0 106 0 148 0 103 0 133 0 100 0 112 0 95 0 90 0 90 0 68 0 87 3 48 0 85 9 32 2 86 17 20 4 88 27 9 7 91 37 2 8 94 45 0 8 95 51 0 7 94 54 0 4 93 54 0 2 89 53 0 0 85 51 0 0 79 49 0 0 72 45 0 0 66 40 0 0 60 33 0 1 56 25 2 3 55 16 8 5 57 10 15 7 62 5 26 9 68 1 40 10 75 0 53 9 79 0 64 8 82 0 69 6 83 0 68 5 82 0 60 5 79 2 50 7 74 6 41 10 68 11 40 13 60 15 47 16 52 22 61 19 44 26 81 21 39 32 103 23 36 36 123 27 37 42 139 33 39 49 150 41 44 55 155 51 50 60 154 65 56 64 148 80 64 67 139 95 71 67 129 109 77 65 117 120 82 60 102 128 85 53 85 131 84 43 66 129 79 33 45 125 72 25 28 119 61 19 14 113 50 15 4 108 38 13 0 105 28 10 0 104 19 7 0 104 13 4 0 106 9 1 0 107 8 0 0 110 9 0 0 112 11 0 0 112 13 3 0 112 13 8 0 109 11 16 0 104 8 25 0 98 5 34 0 90 2 40 0 79 0 42 0 68 0 40 0 56 0 34 0 42 1 27 0 30 3 18 0 20 7 12 0 13 13 6 8 12 22 2 23 15 33 0 39 21 48 0 54 29 63 0 65 36 77 1 67 42 87 6 60 50 90 13 46 57 85 21 32 65 74 29 21 73 60 35 12 80 45 35 7 83 31 29 6 82 18 21 11 78 10 13 24 72 5 6 47 65 2 1 80 60 0 0 119 56 0 0 162 54 0 0 202 53 0 0 238 52 0 2 266 50 0 8 288 47 0 17 303 43 0 29 309 38 0 44 302 31 0 60 284 23 0 74 251 15 0 85 207 9 0 95 155 4 1 103 103 1 4 110 61 0 7 115 30 1 11 119 9 4 13 121 0 7 13 121 0 10 11 119 0 13 7 116 0 14 4 111 0 14 1 105 0 14 0 99 1 15 0 92 7 18 0 84 18 22 0 75 33 27 0 66 54 30 0 54 78 33 0 45 102 36 5 37 124 39 13 31 143 42 24 27 159 44 37 26 170 46 52 26 175 46 63 26 168 44 69 26 148 40 70 26 116 35 67 27 82 30 60 30 49 24 51 36 22 17 41 45 5 11 32 58 0 6 24 73 0 2 17 88 0 0 11 100 0 0 6 108 0 0 3 109 0 0 1 103 0 2 0 89 1 4 0 70 14 4 2 48 35 4 5 30 64 4 9 15 96 2 15 5 128 0 25 0 147 0 35 0 149 0 48 0 135 0 62 0 109 0 77 3 78 0 90 10 49 0 100 19 29 0 104 30 19 0 102 41 19 0 95 48 28 0 87 50 41 0 77 48 57 0 67 42 72 0 58 36 85 3 51 31 93 8 46 30 93 15 42 29 86 23 42 32 73 30 43 35 59 34 48 38 47 34 53 40 41 30 59 39 42 24 64 35 47 17 68 30 55 10 72 25 64 5 75 20 73 2 79 17 82 0 85 16 91 0 92 17 98 0 101 18 102 0 111 20 101 0 121 21 99 0 131 24 97 0 140 25 100 0 147 25 108 0 153 24 121 0 157 21 137 0 161 15 151 0 165 11 161 0 169 6 164 0 174 2 162 0 179 0 152 0 181 0 139 0 179 0 121 0 173 0 103 0 163 0 84 0 147 0 65 0 129 0 47 0 108 0 32 0 87 3 20 0 67 8 9 0 49 14 2 0 35 21 0 0 28 28 0 0 27 33 0 0 30 35 0 0 39 35 0 0 50 37 2 0 63 39 5 0 76 45 10 0 88 55 16 0 97 66 26 0 102 78 39 0 102 89 56 0 97 97 76 0 88 101 99 0 76 100 120 0 64 96 138 0 53 89 152 0 45 82 158 0 40 75 159 0 39 71 154 0 39 65 146 0 40 60 137 0 42 53 126 0 43 46 114 0 44 38 101 0 45 33 86 0 47 32 68 0 48 34 50 0 49 39 32 0 49 42 18 0 47 44 9 2 43 43 8 4 36 39 13 5 26 32 25 6 17 26 43 6 9 20 64 5 3 16 89 3 0 15 114 2 0 19 138 1 0 28 158 1 0 40 174 1 0 57 184 0 0 75 189 0 0 93 190 0 0 108 189 1 0 119 186 5 0 124 182 10 0 124 177 16 0 117 171 22 0 106 165 26 0 92 157 26 0 79 148 22 0 67 136 16 0 60 119 10 0 58 95 5 0 60 67 1 0 64 43 0 2 70 23 0 5 76 8 0 8 80 0 0 11 85 0 0 14 86 0 0 15 85 0 0 15 79 7 0 14 71 26 0 12 57 57 0 11 42 97 0 10 27 145 0 10 17 192 1 11 11 229 4 14 13 251 7 18 19 258 12 22 31 250 18 26 45 229 23 30 60 198 25 33 71 158 24 36 81 112 21 37 89 72 15 37 95 40 9 36 98 16 4 33 100 2 1 31 98 0 0 31 92 0 0 32 82 5 0 35 68 12 0 38 52 20 0 42 36 27 0 45 22 34 0 48 11 37 0 52 5 37 5 57 1 36 12 64 0 34 21 69 0 34 31 74 0 35 41 74 0 35 47 69 0 34 49 58 0 31 49 43 0 26 47 28 2 21 45 16 5 18 44 5 9 15 42 0 16 12 40 0 26 10 39 0 36 8 40 0 48 5 44 0 58 2 52 0 66 0 65 0 71 0 79 0 70 0 93 0 64 0 102 0 56 7 109 0 44 19 111 0 32 36 110 0 21 57 106 0 12 87 99 0 5 119 88 0 1 156 73 0 0 198 56 0 0 243 37 0 0 287 22 0 0 326 11 0 2 354 3 0 5 370 0 0 7 376 0 4 9 376 0 11 11 373 0 19 10 370 0 29 9 368 0 39 7 368 0 47 6 365 0 53 5 357 0 58 7 342 0 62 8 322 0 65 13 301 0 67 18 283 3 66 22 272 8 63 24 273 12 58 24 282 17 53 22 295 21 48 18 308 23 45 15 318 23 43 12 324 22 40 10 328 23 37 7 330 24 34 5 332 27 31 4 332 29 29 2 331 31 28 0 325 32 26 0 317 31 24 0 304 30 20 0 284 30 16 0 254 29 14 0 212 29 17 0 156 28 26 0 106 28 39 0 61 27 52 1 26 27 62 3 3 26 66 7 0 24 65 11 16 19 59 16 47 14 52 20 94 9 45 23 154 4 40 25 229 0 37 25 296 0 36 23 345 0 36 20 371 0 36 16 371 3 35 11 345 7 34 7 296 11 32 3 233 14 30 1 164 16 29 0 105 16 27 0 57 15 25 0 23 11 23 1 3 7 22 4 0 4 24 9 0 2 27 16 0 0 30 24 0 2 33 29 0 5 36 33 0 9 35 31 2 13 34 26 10 20 33 18 18 26 32 12 25 32 30 6 29 36 28 5 28 39 24 9 23 40 20 16 15 37 16 24 6 34 13 31 3 31 11 35 6 28 8 37 10 28 6 35 13 30 4 31 19 33 2 26 27 37 0 20 38 41 0 14 54 43 0 9 72 44 0 5 92 43 0 1 108 41 0 0 122 36 0 3 133 30 0 9 144 24 0 16 156 17 0 26 169 10 0 36 181 6 0 44 187 4 0 47 186 4 0 47 175 6 0 42 156 8 0 35 132 9 0 26 110 10 0 20 93 10 4 14 84 7 10 13 86 5 17 13 96 3 25 15 112 1 33 21 130 0 38 29 147 0 41 38 160 0 42 49 167 0 43 59 163 0 45 65 149 0 48 66 122 0 55 61 88 0 63 50 58 0 75 35 31 0 88 23 10 0 99 11 0 0 107 4 0 0 112 0 5 0 111 0 22 0 106 0 49 0 97 0 87 0 88 0 134 0 80 0 182 0 73 0 222 0 67 0 246 0 63 3 250 0 61 7 233 0 60 11 196 0 62 15 146 0 64 19 97 0 66 21 56 0 66 26 24 0 63 30 14 0 54 35 34 0 41 42 76 0 28 45 131 0 16 44 198 3 7 39 267 8 1 29 324 15 0 19 362 24 0 10 377 35 0 4 370 45 0 0 342 54 0 0 299 62 0 0 248 68 2 0 199 74 5 0 159 80 8 0 131 87 11 0 118 95 14 0 116 102 14 0 121 109 13 0 127 115 12 0 134 121 10 0 139 124 10 0 144 125 12 0 150 122 14 0 156 117 18 0 159 109 21 0 157 99 25 0 145 88 31 0 125 78 39 2 96 69 50 9 65 60 64 20 38 54 77 33 18 51 87 47 4 51 93 59 0 54 94 64 4 56 90 62 16 55 82 54 30 49 75 43 44 39 69 30 57 27 64 18 64 16 61 10 61 7 58 5 50 2 55 1 34 0 49 0 21 0 44 0 10 0 41 0 3 0 41 2 0 0 45 6 1 0 54 11 8 0 63 16 17 0 73 21 27 0 79 22 35 0 82 21 39 0 83 16 37 0 81 11 28 0 78 6 18 0 76 3 9 0 75 3 2 0 75 7 0 0 77 12 0 0 81 19 0 0 87 26 0 0 93 32 6 0 100 37 23 0 105 38 50 0 108 35 84 3 110 29 123 8 110 21 158 17 108 13 179 30 103 7 185 46 94 2 176 62 83 0 160 77 67 0 138 87 51 0 114 93 35 0 89 94 22 0 64 90 13 0 42 84 7 1 24 78 3 5 9 72 3 9 1 67 4 13 0 63 8 16 0 60 13 17 0 59 19 16 0 58 26 14 4 57 32 11 19 55 38 7 44 52 42 5 78 49 45 3 118 44 47 1 161 39 49 0 197 35 50 0 221 32 50 1 230 30 51 1 225 30 51 1 207 30 49 1 179 31 43 0 145 33 36 0 113 34 26 2 87 34 17 4 69 35 9 5 61 36 4 4 60 37 0 4 58 38 0 3 55 39 0 4 49 37 0 7 39 33 0 14 28 27 2 23 19 19 7 33 14 12 12 42 17 7 17 50 29 2 23 57 47 0 27 62 69 0 27 66 90 0 27 70 103 0 23 72 105 0 20 75 93 0 15 76 70 0 12 78 47 0 11 81 26 0 13 85 10 0 17 88 0 0 24 91 0 0 30 92 4 0 33 91 18 0 33 89 41 0 29 85 71 0 22 80 105 0 16 72 138 0 12 65 160 0 10 57 167 1 13 50 160 6 18 44 141 13 25 40 114 22 31 36 85 33 37 31 57 44 42 26 34 53 45 20 18 58 47 13 7 61 48 7 1 61 48 4 0 58 47 1 0 53 47 0 4 45 48 0 18 38 48 0 38 32 48 0 62 29 46 0 88 28 43 0 110 31 37 0 123 35 29 0 125 39 22 3 117 42 15 8 102 43 10 15 80 41 7 25 55 37 6 39 36 32 7 54 19 27 10 67 6 24 15 78 0 22 21 85 8 23 26 86 32 25 30 79 70 30 30 66 120 36 28 49 184 41 23 32 252 46 19 18 309 49 15 7 349 49 11 1 367 48 8 0 359 47 6 0 327 47 4 0 275 47 2 0 211 50 0 0 144 53 0 0 88 55 0 0 46 58 0 0 18 61 0 0 2 64 0 0 0 68 0 0 4 73 0 0 17 76 0 0 33 78 0 0 52 77 0 0 74 71 0 0 100 63 0 0 126 52 0 0 153 40 0 0 179 26 0 0 203 16 0 0 217 8 0 0 223 3 1 0 223 0 6 0 218 1 13 0 214 3 22 0 211 5 31 0 205 8 38 0 194 10 40 0 175 12 37 0 151 12 29 0 126 10 20 0 107 8 12 0 97 5 5 0 94 3 1 0 96 1 0 2 98 0 1 7 94 0 5 13 85 0 11 21 73 0 18 29 63 0 25 36 58 0 32 38 61 2 36 37 70 4 38 31 81 7 38 23 92 9 36 15 101 11 32 8 109 9 26 3 115 7 18 5 119 4 11 14 120 2 5 26 115 0 1 40 104 0 0 58 88 0 0 74 73 0 0 87 62 0 0 97 58 0 2 104 60 0 6 106 68 0 10 105 79 2 16 101 94 7 23 93 114 12 29 84 139 20 34 74 167 28 36 64 194 35 36 54 216 39 34 45 231 41 29 38 239 42 22 32 242 41 15 28 242 39 9 26 238 36 4 26 229 31 1 27 211 25 0 30 186 17 1 33 155 10 4 39 122 5 11 45 89 2 20 50 60 0 32 54 37 3 47 54 21 9 63 49 10 16 77 41 4 27 87 29 7 41 93 19 15 55 93 10 26 67 87 3 38 76 77 0 50 79 65 0 60 73 53 0 68 60 41 0 75 43 30 4 82 27 20 11 89 13 12 19 95 4 7 30 102 4 2 41 110 11 0 50 121 19 1 54 136 28 4 55 151 38 7 52 164 43 10 47 173 43 13 43 175 38 15 41 170 29 14 44 160 19 12 52 148 11 10 62 136 4 9 76 124 0 10 92 113 0 12 108 99 0 16 125 83 0 21 139 67 2 26 146 52 8 31 145 43 17 35 134 41 27 39 113 44 36 44 86 48 41 47 57 48 38 50 33 40 30 51 15 30 20 51 9 18 11 53 12 7 3 56 23 0 0 65 37 0 0 80 54 0 0 99 69 0 0 118 81 0 0 135 89 0 0 148 92 0 0 154 89 0 0 155 79 0 0 155 64 0 0 154 45 0 0 154 29 0 0 154 14 0 0 152 4 0 0 147 0 0 0 139 0 0 2 127 0 0 5 111 0 0 7 94 3 3 9 75 8 22 9 57 16 55 7 39 24 97 5 25 33 144 2 14 38 192 0 6 37 226 0 6 34 241 0 12 28 239 0 25 21 227 0 42 18 213 3 62 17 202 8 81 19 200 16 96 22 206 24 106 27 218 31 109 33 228 36 105 40 231 37 94 49 224 35 79 57 206 33 62 67 181 32 45 72 156 35 32 72 132 40 24 66 114 48 23 54 100 58 25 38 91 66 29 24 83 73 32 12 77 76 32 4 74 74 26 0 72 69 20 0 70 61 12 0 66 49 6 0 55 35 1 0 41 23 0 0 27 14 0 0 14 6 0 2 4 1 0 6 0 0 0 10 0 0 0 15 2 0 3 20 17 0 9 24 42 0 16 24 75 0 23 24 111 0 28 20 147 0 28 17 171 3 23 13 183 7 16 12 188 11 9 11 189 15 3 13 191 20 0 14 194 22 0 15 196 23 0 14 191 22 0 14 173 21 2 14 143 20 8 16 103 21 18 20 68 25 29 25 37 32 41 26 14 39 51 25 1 45 55 20 0 48 51 15 4 47 41 8 20 39 29 3 44 29 18 0 73 18 8 0 106 10 2 0 139 4 0 3 165 0 0 11 183 0 1 24 195 0 4 39 203 0 10 56 212 0 16 69 222 0 22 76 233 1 28 73 245 5 33 64 255 10 36 49 260 17 38 33 253 26 42 19 235 35 48 9 206 41 56 2 168 46 66 0 126 48 75 0 87 48 81 0 54 46 83 0 30 43 81 0 17 38 76 0 14 32 70 0 18 26 68 0 25 18 70 0 31 11 76 0 32 6 87 0 28 2 99 0 21 0 112 0 13 0 123 2 6 0 132 6 1 0 138 10 0 0 140 15 0 0 138 20 0 0 131 24 9 0 121 25 29 0 110 24 60 0 98 21 102 0 87 17 153 1 80 13 204 4 77 9 244 8 77 6 271 14 79 4 281 22 81 5 277 27 81 8 260 29 77 13 237 27 70 19 210 22 59 27 184 15 48 33 164 9 38 38 149 4 30 41 139 2 26 42 135 1 24 41 134 1 23 38 133 1 24 33 131 0 25 26 129 0 26 18 129 0 28 11 128 0 31 6 128 0 36 1 125 2 40 0 116 5 45 0 102 6 48 0 86 7 51 0 72 6 51 0 64 5 51 0 68 2 49 0 82 0 45 0 99 0 40 0 115 0 34 0 120 0 28 0 112 0 26 0 89 0 26 0 63 0 28 0 37 0 34 1 16 0 40 6 3 0 44 15 0 0 48 24 0 0 50 35 10 1 51 43 33 3 51 46 65 6 50 42 107 8 49 32 159 10 46 22 207 11 43 12 241 11 39 4 259 10 35 0 256 9 29 0 234 10 24 0 196 11 17 0 148 12 12 0 98 11 7 0 59 9 3 5 28 7 0 13 9 5 0 23 8 2 0 36 27 4 0 50 58 11 0 61 96 19 2 67 142 28 8 68 184 37 17 67 212 43 28 65 221 44 41 63 213 43 52 65 190 40 57 70 156 34 56 80 121 26 48 89 92 18 35 99 77 11 23 107 78 6 13 110 98 2 4 107 133 0 0 100 179 2 0 89 225 7 0 75 264 16 0 61 290 27 3 51 301 42 9 43 292 55 16 42 270 66 23 45 233 70 28 52 188 67 28 62 137 60 23 76 89 49 16 90 52 37 9 104 23 26 3 115 6 17 0 124 0 12 0 128 0 10 1 127 0 13 4 120 0 18 7 108 0 24 9 92 0 30 10 74 0 36 9 58 0 40 7 47 11 42 4 41 30 41 1 41 58 40 0 47 91 34 0 55 130 27 0 62 160 19 0 68 178 12 0 73 179 5 0 79 164 1 0 86 134 0 2 98 95 0 6 111 61 0 12 126 32 0 19 141 11 0 29 154 0 2 38 161 11 6 45 163 36 12 51 156 72 19 54 144 116 28 54 127 167 34 52 109 209 38 47 92 235 40 42 80 241 40 37 71 230 38 34 69 205 36 31 71 177 35 30 74 151 33 29 78 133 33 27 81 125 32 23 80 127 31 18 75 138 30 12 67 154 28 9 55 173 24 7 43 192 17 9 31 208 12 12 24 218 7 19 20 222 3 24 21 220 0 29 25 215 3 32 32 213 10 34 38 217 22 34 40 230 35 33 37 249 50 32 29 268 63 32 21 283 69 32 12 288 70 32 4 281 63 31 0 261 52 28 0 232 39 24 0 199 26 20 0 169 15 18 0 148 7 19 0 143 2 23 1 161 0 31 10 200 0 38 23 257 0 46 39 323 2 51 59 385 4 55 80 428 7 56 98 443 9 55 111 426 11 50 120 379 10 44 125 309 7 36 127 228 4 27 123 148 2 21 115 86 0 19 100 41 0 20 80 13 0 26 59 7 0 36 38 26 0 48 21 53 0 62 10 86 0 77 6 123 0 92 9 154 0 105 16 171 0 116 25 171 0 125 36 155 0 133 45 127 0 139 50 92 0 147 52 58 0 156 50 32 0 166 46 13 0 177 43 2 0 185 39 0 0 189 37 0 0 188 36 0 0 180 34 9 0 165 30 30 0 147 25 62 0 128 19 104 0 110 11 158 0 96 6 210 0 88 2 249 0 86 0 270 7 88 0 268 19 93 0 249 35 99 0 219 53 103 0 190 72 104 0 170 87 101 0 168 96 93 0 183 97 79 0 208 96 61 0 238 92 42 0 260 88 25 0 268 86 12 0 259 86 3 0 235 86 0 0 200 87 0 0 164 89 1 0 135 91 6 1 119 93 13 2 120 95 20 4 134 95 28 6 158 95 38 8 183 94 44 11 200 92 50 13 206 90 54 17 200 88 56 21 185 83 54 23 167 78 48 27 156 72 37 30 156 66 26 33 169 60 15 38 191 56 7 45 214 53 1 54 230 50 1 62 230 46 4 71 210 41 8 78 171 34 12 83 121 27 16 83 77 22 18 78 39 19 17 70 12 20 14 59 0 25 10 44 0 31 6 29 0 38 3 17 2 43 1 8 16 45 0 2 39 48 0 0 71 50 0 0 110 54 0 0 150 59 0 2 178 65 0 4 185 70 0 5 171 72 0 8 136 70 0 12 95 66 0 16 57 59 2 21 25 52 6 27 6 44 10 34 0 39 14 39 0 34 16 45 0 31 14 49 0 30 11 53 0 30 7 57 0 32 4 59 0 33 7 60 3 36 15 58 17 38 24 53 43 41 31 47 76 41 34 39 113 39 31 32 145 32 24 27 160 24 15 25 152 16 6 26 125 8 0 33 89 2 0 44 54 0 2 58 27 3 9 71 19 9 19 82 30 18 32 87 55 28 51 88 88 41 68 81 126 51 83 72 161 56 90 60 190 57 89 48 207 52 78 39 210 45 61 34 200 36 41 31 176 28 24 32 144 23 13 33 109 22 11 33 73 25 17 31 44 30 28 26 23 38 41 18 9 48 52 11 6 62 60 6 12 77 62 2 27 95 59 0 49 114 53 0 79 133 42 0 111 149 30 0 141 164 20 0 163 174 11 0 170 180 4 0 158 182 0 0 130 177 0 0 93 168 0 0 58 153 0 0 28 136 0 0 8 118 0 2 0 102 0 6 0 89 0 13 0 80 0 21 0 74 0 31 0 70 0 41 0 66 0 51 0 64 0 58 0 61 0 65 1 58 2 70 7 54 5 71 20 52 9 71 37 48 12 71 59 43 15 69 83 38 17 70 104 32 16 75 118 28 16 86 125 25 15 101 125 23 14 118 117 22 13 134 106 22 12 147 93 20 10 153 82 17 9 151 74 13 8 141 70 9 8 124 69 4 11 102 69 2 17 77 67 0 25 54 64 0 34 35 61 0 42 21 60 0 48 13 64 0 50 10 74 0 51 9 91 0 50 9 115 0 48 8 146 0 47 6 179 0 47 4 208 0 46 3 229 0 46 2 240 0 46 0 238 0 46 0 228 0 46 0 211 0 46 0 193 0 46 0 176 0 46 0 161 0 46 0 148 0 47 0 138 0 47 0 130 0 48 0 127 0 49 1 130 2 49 4 139 4 49 8 153 7 47 12 171 10 43 17 190 10 39 19 205 9 33 19 213 7 26 17 211 4 19 14 198 2 13 12 181 1 9 11 163 1 7 12 152 1 9 15 149 1 13 19 157 0 19 24 173 0 24 28 191 0 30 31 210 0 35 35 225 0 41 39 235 0 46 41 238 2 51 42 235 5 52 41 224 10 49 37 207 15 41 30 184 20 30 22 162 22 19 14 145 20 10 7 139 16 6 3 143 11 10 3 157 6 23 6 175 2 39 10 193 0 59 16 207 0 79 23 217 1 96 31 221 4 107 35 222 7 113 38 216 9 113 37 203 13 107 34 180 14 99 29 151 13 90 24 121 9 80 20 96 7 73 18 83 4 68 17 86 1 66 18 107 0 67 20 143 0 72 23 188 0 79 27 234 0 91 33 270 4 104 38 289 13 117 40 286 24 125 41 263 38 128 38 224 57 123 31 178 75 110 22 134 91 92 14 98 105 70 7 76 116 47 2 65 122 29 0 62 124 15 0 61 121 5 0 56 114 0 0 46 104 0 0 34 91 0 0 20 78 0 0 8 66 1 0 0 56 3 0 0 53 6 0 0 55 11 0 0 63 17 0 0 74 22 0 0 85 26 0 0 94 28 0 0 99 25 0 0 99 19 0 0 97 14 0 3 94 7 0 10 91 2 0 20 89 0 0 28 88 1 0 34 86 7 0 34 82 16 0 28 77 26 0 20 71 38 2 10 67 48 5 3 64 54 7 0 64 56 9 0 67 53 11 0 71 48 11 3 77 42 11 10 80 35 11 21 82 28 11 34 81 22 9 49 76 17 7 60 69 11 5 65 60 6 2 63 50 3 0 56 42 1 0 50 36 0 0 51 33 5 0 64 32 15 0 91 32 30 0 131 33 48 0 181 33 67 0 234 31 84 0 281 29 94 0 317 26 96 0 338 24 91 0 339 21 81 3 323 18 68 8 295 14 54 15 262 10 44 25 233 6 40 33 218 3 40 37 219 1 46 36 241 0 55 29 277 0 65 20 323 0 75 11 367 0 85 4 398 0 97 0 406 0 111 0 385 2 128 0 334 4 150 0 259 5 173 0 177 5 197 0 107 5 217 0 51 4 231 0 14 2 236 5 0 0 231 14 0 0 216 26 4 0 195 38 8 0 169 53 13 0 143 60 17 0 120 61 26 2 103 54 33 6 91 43 44 12 83 29 60 19 77 17 85 27 74 7 120 35 73 1 161 41 73 4 207 43 77 11 250 41 85 23 281 34 93 38 293 25 100 56 283 16 106 73 252 8 109 87 208 2 108 96 162 0 105 99 122 0 100 97 95 0 92 90 83 0 83 81 84 0 73 72 92 0 66 65 101 0 61 59 110 2 60 57 115 4 64 56 117 4 70 58 113 4 75 61 106 4 77 68 94 2 75 75 77 0 70 84 58 0 61 92 38 0 51 94 23 0 42 92 11 0 35 85 3 5 32 77 0 12 31 68 0 21 30 64 0 29 28 62 0 36 24 64 0 37 17 70 0 30 11 79 0 22 5 92 0 13 1 109 0 5 0 127 0 0 0 143 0 0 0 154 0 0 1 156 0 2 6 148 0 6 14 129 0 11 22 103 0 17 28 73 0 23 32 46 0 28 28 26 0 28 22 10 0 26 14 1 0 19 6 2 0 14 1 10 0 7 0 22 0 3 0 34 0 0 0 48 0 0 0 60 0 3 3 66 0 7 9 68 10 14 17 66 35 22 24 62 74 33 32 57 125 44 36 50 189 54 37 41 256 64 36 31 314 72 32 21 357 77 29 12 384 78 25 6 391 77 20 1 378 72 15 0 347 68 11 0 297 66 7 0 233 66 6 4 163 68 9 10 103 74 15 17 55 81 25 26 20 89 35 34 1 98 44 38 2 106 52 37 9 114 57 34 16 120 59 29 23 123 58 25 29 123 53 22 33 120 44 22 31 113 32 23 24 103 21 26 16 91 12 27 10 78 4 27 5 65 0 26 1 55 0 23 0 48 0 19 0 46 6 15 0 49 14 10 0 56 25 7 0 66 36 3 0 75 46 1 0 81 51 0 0 81 48 0 0 76 38 0 0 67 27 0 1 54 16 0 14 43 7 0 37 35 1 0 68 29 0 0 106 27 5 0 145 27 16 0 174 28 30 0 186 31 47 0 182 34 66 0 164 38 82 0 139 43 90 0 112 47 91 0 90 49 85 1 74 50 75 4 64 48 62 6 61 46 51 8 63 40 42 8 68 33 39 7 73 24 41 4 77 17 44 2 75 9 49 0 66 4 54 3 51 0 60 10 35 0 67 20 21 0 75 33 9 0 84 47 10 4 95 57 25 12 104 58 46 22 113 51 71 32 119 39 99 42 124 26 120 46 128 13 133 44 131 4 135 34 133 0 127 24 134 0 110 14 137 7 87 5 140 19 60 0 147 35 37 0 156 52 19 0 168 68 6 2 178 75 0 4 184 72 4 7 183 61 9 9 173 43 16 11 156 27 26 10 135 13 39 7 114 4 52 4 98 0 61 2 89 2 65 0 88 6 60 0 93 10 47 0 105 13 33 0 118 16 19 0 131 15 7 0 140 12 0 0 144 8 3 3 142 4 15 11 135 2 35 24 124 0 58 40 112 0 82 58 100 0 102 75 89 0 109 87 78 0 103 93 66 4 86 95 52 11 63 93 36 20 41 89 23 31 23 86 12 42 12 84 4 49 8 85 5 51 11 89 14 48 22 97 27 42 38 106 42 33 60 116 58 23 87 126 69 14 117 132 74 8 152 136 70 3 193 136 59 0 238 134 45 0 284 129 29 0 327 125 16 0 361 120 7 0 380 117 5 0 379 117 8 0 358 116 14 0 319 116 21 0 269 115 28 0 215 111 32 0 168 105 33 0 134 98 32 0 118 90 30 0 123 82 29 0 144 75 29 2 174 70 32 4 204 66 37 7 227 64 43 8 236 61 48 8 227 57 52 7 200 50 54 4 159 42 52 2 111 34 48 0 69 28 43 0 36 28 37 0 13 33 33 0 0 42 31 0 0 51 31 0 0 58 31 1 0 62 31 4 0 63 29 8 0 62 26 13 0 61 22 21 0 63 17 29 0 67 13 38 0 74 9 47 0 84 6 54 7 94 3 59 24 102 1 60 48 107 0 56 75 108 0 49 102 104 0 40 121 97 0 29 124 89 0 19 113 81 0 12 92 75 0 7 71 71 6 3 56 70 15 1 56 72 27 1 74 74 42 0 109 75 58 0 157 72 69 0 207 63 74 0 250 47 71 0 277 32 61 0 287 18 46 2 280 6 31 4 264 0 18 7 243 8 9 8 225 20 7 8 212 37 13 7 201 56 24 4 192 75 37 2 181 88 49 0 164 94 58 0 141 91 64 0 117 84 66 0 97 73 66 0 88 63 67 0 97 55 68 0 123 52 70 0 162 52 72 0 201 55 73 0 230 59 71 0 236 62 66 0 217 61 56 0 175 56 43 0 122 47 29 0 75 35 17 0 37 23 8 0 11 13 1 0 0 6 0 2 3 4 9 3 19 7 23 3 41 13 39 3 67 19 56 3 96 23 73 2 126 25 80 0 145 21 77 0 151 15 65 0 145 9 48 0 128 4 31 0 102 0 17 0 72 0 8 1 45 0 10 1 23 6 23 1 8 15 42 1 1 24 64 1 2 32 88 0 11 39 104 0 30 39 112 0 63 33 111 4 114 23 101 11 181 14 87 21 254 7 72 33 319 4 61 47 362 5 56 60 372 10 56 73 343 17 59 84 283 25 64 92 201 31 66 99 127 33 66 103 66 32 61 103 24 28 55 96 1 22 48 87 7 17 43 74 30 15 41 59 62 18 42 44 100 24 46 31 143 32 52 23 183 41 57 19 205 47 61 22 207 49 59 30 189 46 52 45 155 41 40 64 111 35 27 82 71 31 16 96 37 31 6 104 12 35 0 104 0 43 0 94 0 55 0 74 1 67 0 53 3 79 0 33 2 88 2 16 2 95 2 4 3 99 2 0 1 99 1 0 0 94 1 3 7 86 0 12 20 74 0 27 41 61 0 47 66 46 2 71 97 33 6 94 128 22 13 110 156 14 23 118 179 8 35 117 197 4 49 108 206 2 63 94 203 2 76 78 185 6 87 63 155 11 98 50 114 17 104 43 75 23 106 39 42 27 103 40 17 28 96 44 2 27 83 52 0 24 67 62 0 22 48 74 0 20 31 84 0 19 18 91 15 18 8 94 55 16 2 91 116 14 0 86 188 11 0 79 265 10 0 75 324 9 0 72 343 9 0 74 316 7 3 77 250 6 8 80 174 5 14 82 103 6 21 81 47 10 28 77 10 15 33 71 0 19 35 66 17 22 34 61 49 21 32 62 87 16 28 69 122 11 23 81 153 6 20 95 158 2 20 112 136 0 25 124 99 0 37 129 62 0 54 124 28 0 75 109 7 4 97 88 0 9 118 65 0 15 133 43 0 19 143 26 0 24 147 15 0 24 145 10 0 22 140 8 0 21 134 7 0 23 127 7 0 29 122 6 0 39 119 4 0 52 117 3 0 63 114 2 0 70 110 0 3 70 104 0 13 62 96 0 26 48 87 0 39 32 79 0 48 19 74 0 51 8 73 0 43 2 77 3 32 0 85 7 20 0 97 12 17 0 108 18 26 0 118 24 48 0 124 27 79 0 125 29 119 0 122 31 164 1 117 31 210 5 110 33 255 10 103 34 295 17 97 35 324 22 93 34 342 26 93 32 344 24 96 27 332 20 100 22 309 13 105 15 278 8 110 11 245 3 114 8 215 0 117 8 193 0 122 10 177 0 128 14 168 0 136 17 165 0 143 18 161 2 150 17 155 5 155 13 146 7 156 9 133 9 153 5 117 9 147 1 99 7 139 1 81 5 131 6 65 2 124 12 55 0 122 18 53 0 124 24 61 0 131 27 79 2 140 26 105 5 151 20 137 6 160 14 169 7 165 8 195 6 164 3 210 5 154 0 209 2 137 0 191 0 115 1 158 0 92 1 113 0 72 3 73 0 58 5 40 0 50 8 15 0 47 12 1 0 48 17 0 0 52 23 0 3 57 29 8 9 65 34 21 18 77 39 39 28 93 43 59 40 110 47 84 52 124 50 106 63 133 53 127 73 134 54 150 82 125 54 175 88 109 52 200 93 88 48 223 94 64 43 239 92 42 38 246 86 25 33 242 79 12 31 230 71 6 33 213 62 8 38 196 52 18 44 185 43 29 50 183 33 40 54 190 25 47 57 202 19 49 57 214 17 45 54 221 18 37 51 217 22 27 50 203 28 19 50 183 33 15 51 161 37 13 51 147 37 12 50 144 32 12 48 156 24 10 44 179 16 8 38 208 8 5 33 234 4 2 28 248 5 0 26 245 12 0 25 222 22 0 29 182 36 0 37 131 52 0 49 85 67 0 64 46 82 0 80 19 94 0 93 3 102 0 98 0 104 0 97 5 101 0 86 10 93 0 69 13 82 0 47 11 70 0 29 12 59 0 14 9 52 0 4 4 47 2 0 0 49 6 0 0 55 11 2 0 65 15 3 17 76 18 3 56 88 18 3 113 97 15 3 180 102 11 1 253 102 6 0 305 98 2 0 319 90 0 0 293 80 1 0 233 71 4 0 161 62 7 0 96 58 10 2 44 57 10 2 11 61 10 2 0 67 7 2 0 75 4 2 0 80 1 0 0 81 0 0 0 77 0 0 0 68 0 0 0 56 0 0 0 45 0 0 0 37 0 0 0 33 3 0 0 34 8 0 0 39 14 0 0 45 21 0 3 50 28 0 21 54 34 2 54 55 37 6 102 54 38 10 164 51 38 13 234 47 36 17 295 41 32 19 337 34 27 19 355 27 21 18 345 21 15 18 312 17 13 20 261 15 14 24 202 17 20 30 143 24 29 37 94 34 40 43 57 45 50 45 36 54 57 43 27 60 59 35 26 60 55 25 26 53 47 15 23 42 33 11 18 29 22 15 12 18 12 29 5 8 4 50 0 2 0 75 0 0 0 99 0 0 3 119 5 0 13 132 18 0 27 138 37 0 45 136 60 0 64 130 84 2 82 121 105 7 92 110 118 15 95 98 123 25 90 86 124 37 80 74 121 49 67 61 116 57 53 48 111 60 39 37 108 59 29 26 105 51 23 17 108 40 22 11 117 27 27 8 134 16 37 10 162 7 52 16 203 2 70 27 252 0 86 41 304 0 102 56 347 0 114 70 370 0 123 80 363 0 125 86 326 3 122 88 261 10 114 85 183 21 100 80 114 33 83 74 58 45 64 70 21 52 48 67 1 50 33 64 0 42 22 63 0 30 14 63 0 18 8 62 0 8 6 60 6 4 6 58 17 7 10 53 33 14 16 47 54 24 23 39 84 36 26 31 116 48 24 22 152 57 20 14 189 64 14 8 223 67 7 4 248 67 5 1 259 64 11 0 250 58 21 0 221 50 33 0 174 39 45 3 120 27 54 10 74 17 58 20 36 9 56 31 13 3 51 44 21 0 46 54 58 0 43 59 108 0 44 55 164 0 51 47 219 3 62 34 249 10 76 22 244 19 90 11 204 27 101 4 148 35 109 0 93 37 111 0 45 31 109 1 12 23 104 4 6 14 97 7 30 6 90 9 64 0 83 11 101 1 78 9 135 9 74 7 155 21 72 4 146 36 71 1 115 51 70 0 79 65 70 0 42 70 68 0 13 64 63 1 0 51 56 6 5 35 46 13 23 21 36 24 53 9 27 39 89 2 22 56 129 0 21 72 166 0 24 87 190 0 31 99 196 0 41 107 186 3 51 108 165 11 60 104 138 23 67 92 106 38 71 75 77 56 71 53 50 72 65 34 31 80 56 18 22 78 42 7 24 68 29 3 35 50 17 6 53 32 8 12 76 17 1 19 102 6 0 27 129 0 8 32 158 0 27 33 188 0 56 30 215 2 93 23 235 7 136 15 245 14 175 8 245 18 201 3 235 21 211 0 222 20 206 0 208 16 188 0 195 10 163 0 183 5 137 0 168 0 119 3 146 0 111 7 117 0 114 12 85 0 127 16 55 0 145 20 33 0 163 18 25 0 176 14 29 0 183 9 39 0 183 4 51 0 178 0 62 0 168 0 70 4 156 0 76 14 143 2 86 26 129 9 97 41 116 18 105 57 101 29 105 70 85 42 95 77 67 52 75 79 51 56 55 77 36 53 47 71 26 45 57 65 21 32 89 59 20 21 136 55 22 11 188 50 25 4 227 46 28 0 244 41 29 0 235 36 28 4 199 31 26 12 147 26 25 21 96 22 26 29 53 20 31 37 21 20 38 38 3 21 48 33 0 27 59 24 0 34 69 16 0 44 76 8 7 53 79 2 27 59 77 0 61 62 71 0 104 61 62 0 157 58 52 0 209 53 42 0 251 47 34 0 274 41 29 1 277 36 27 6 260 33 26 16 228 32 27 30 188 35 29 46 149 41 29 62 116 49 29 75 98 56 29 81 95 62 28 78 104 65 28 69 119 66 28 53 131 66 30 37 133 65 35 22 122 64 42 11 99 62 51 3 70 60 61 0 44 58 69 0 31 56 72 0 37 55 71 0 64 52 66 0 107 50 56 0 157 46 46 0 200 41 38 0 225 36 33 0 228 32 31 4 212 31 32 10 187 31 32 16 170 35 30 22 173 41 24 27 201 48 18 26 248 54 11 20 298 61 5 15 331 68 0 8 330 75 1 3 291 83 5 0 221 93 10 7 149 105 14 19 83 118 17 31 32 131 18 44 3 143 15 54 0 149 11 55 1 151 6 45 12 147 2 34 31 137 0 20 55 124 0 11 83 109 0 9 116 95 0 17 143 83 0 28 165 74 0 40 183 67 0 49 197 63 0 51 209 60 0 47 214 58 0 38 207 55 0 29 186 51 0 24 152 44 0 26 108 36 0 35 69 26 0 51 35 16 0 71 11 9 0 88 0 9 0 100 0 15 0 102 0 25 0 93 0 36 0 74 0 47 0 52 10 55 0 32 40 57 0 15 85 57 0 4 142 56 0 0 210 55 2 0 277 54 8 0 328 55 16 2 357 58 26 4 360 62 38 7 337 67 47 8 292 74 51 8 232 81 51 7 167 87 47 4 110 93 39 2 69 98 30 0 54 101 20 0 63 101 12 1 92 101 6 10 129 100 2 22 161 98 0 36 176 97 0 48 170 96 0 58 143 93 0 56 107 87 0 45 75 79 0 32 61 68 0 18 69 58 0 7 101 49 4 0 148 43 12 0 202 39 24 0 251 39 39 0 285 41 54 0 300 46 66 0 291 54 72 0 259 65 71 0 208 77 64 0 148 89 54 0 93 96 44 0 50 98 36 0 20 93 31 2 3 84 30 8 0 70 30 16 0 57 31 25 0 47 31 36 0 43 29 45 0 43 25 50 0 49 21 50 0 56 17 49 0 63 15 45 0 68 13 42 0 71 12 38 0 70 9 37 0 66 7 35 6 61 4 32 17 53 1 27 30 45 0 22 42 34 0 15 52 23 5 12 56 14 16 13 55 7 31 20 54 3 47 32 59 0 65 48 78 0 77 64 109 0 80 75 150 3 73 81 192 10 58 78 227 20 41 68 246 32 25 52 241 45 12 35 214 54 5 21 168 58 6 10 116 56 13 3 69 48 18 0 33 38 22 2 17 26 22 6 30 17 19 14 65 12 13 23 110 11 7 35 163 13 3 46 215 16 3 56 252 17 5 62 268 14 8 66 261 11 9 67 234 6 11 68 190 2 11 70 137 0 11 76 88 0 13 85 50 0 18 96 22 0 26 108 5 0 36 116 0 0 46 121 15 1 53 117 42 7 55 105 77 15 51 85 111 25 42 64 142 36 30 45 152 45 18 34 135 50 8 33 102 49 2 43 67 43 0 60 34 34 0 81 10 23 0 100 0 15 0 113 0 11 0 116 14 11 0 108 45 16 0 91 85 26 3 67 128 35 10 44 170 40 19 24 197 42 27 10 202 37 33 1 188 28 33 0 165 19 27 3 146 10 19 10 138 4 10 19 145 1 3 29 166 3 0 38 197 8 0 43 229 16 0 40 249 24 0 33 252 31 0 23 235 35 0 13 205 36 0 6 175 32 0 1 161 28 0 0 171 24 0 0 206 22 0 0 255 21 0 0 302 22 0 0 330 21 3 0 331 21 6 1 305 19 9 6 260 17 11 12 210 16 10 18 168 17 9 24 140 21 6 28 128 29 6 29 130 40 9 26 140 55 17 23 155 70 27 18 169 85 36 14 177 95 42 10 174 100 44 8 157 98 41 8 124 89 36 13 88 75 32 20 54 59 31 33 25 42 37 46 5 29 46 59 0 18 58 70 2 10 70 80 16 7 77 87 40 6 77 95 71 5 69 102 104 5 55 109 133 4 38 113 147 4 23 116 141 2 11 113 119 0 3 109 91 0 0 102 65 0 0 93 50 0 1 84 51 0 9 77 68 0 24 71 96 2 44 66 132 6 69 64 173 11 94 64 216 16 112 63 259 20 119 64 296 20 113 67 326 16 95 70 345 11 70 76 355 6 46 83 358 2 25 90 359 0 11 93 366 0 11 90 382 0 21 80 410 0 35 63 449 2 51 43 495 6 68 26 539 13 81 12 570 21 91 4 582 32 98 0 564 44 100 0 519 53 99 1 452 61 94 7 377 65 82 17 303 63 66 30 240 56 46 47 188 45 29 66 144 31 15 81 103 19 5 93 69 9 0 100 41 3 0 103 19 0 0 101 12 0 4 97 29 0 13 92 60 0 24 87 99 0 36 82 143 1 49 76 184 3 57 70 207 5 60 65 211 8 57 60 195 10 51 56 163 11 42 53 123 11 32 50 87 12 24 44 68 12 16 36 75 11 10 26 110 11 6 17 165 10 3 9 226 7 3 2 274 5 6 0 298 2 12 0 294 0 21 4 270 0 32 14 239 0 44 29 221 1 54 47 223 3 60 67 248 6 61 83 284 12 57 93 315 20 47 94 324 30 36 88 301 44 24 76 246 59 14 61 176 75 6 46 109 91 2 33 53 104 0 25 15 112 0 24 18 114 0 27 48 109 0 37 84 95 0 51 119 74 0 68 149 51 0 86 154 31 0 105 132 14 0 122 97 3 2 135 60 0 7 145 28 0 15 150 7 3 25 148 0 8 38 142 0 16 50 134 0 24 57 122 0 32 60 110 0 38 56 101 2 41 47 94 9 40 34 89 20 38 22 89 31 38 12 89 38 39 5 91 39 41 0 93 34 47 0 96 25 52 0 98 14 54 0 100 4 53 0 101 5 48 0 101 29 38 0 97 69 27 0 90 117 17 0 81 170 9 0 70 219 3 5 61 241 0 17 56 233 0 36 56 195 1 59 61 140 4 86 72 89 9 107 82 46 14 118 90 14 22 117 94 0 33 104 90 18 45 82 78 51 59 59 61 95 72 39 42 143 82 26 26 199 86 21 13 242 83 23 4 267 74 30 0 277 64 41 1 276 57 52 3 268 54 65 4 256 58 78 5 239 65 89 5 216 70 97 5 190 70 100 2 162 63 96 1 139 48 86 0 126 33 70 0 129 18 50 1 149 7 32 6 182 0 17 13 221 0 9 22 255 0 8 33 279 2 16 44 292 6 27 53 297 11 40 57 301 16 52 57 313 21 59 51 334 27 60 41 363 31 55 29 389 34 46 18 405 37 35 8 402 40 25 2 376 42 17 0 332 42 11 1 279 39 6 6 228 35 4 13 191 29 2 20 177 22 1 24 184 14 0 26 206 8 0 22 234 3 0 16 254 0 1 9 257 0 9 3 240 0 21 0 207 0 36 3 166 6 54 7 130 19 72 11 108 38 87 13 102 59 96 14 112 81 101 12 134 96 101 9 159 100 97 4 181 93 90 1 196 76 77 2 200 55 61 5 191 35 44 9 169 20 28 14 135 12 15 19 94 12 6 25 59 18 1 27 30 29 0 28 10 39 0 27 0 47 0 25 2 52 0 20 10 55 0 14 16 56 0 9 17 58 0 5 17 59 0 2 17 59 0 0 11 57 0 5 3 54 0 15 6 47 0 29 30 40 0 46 67 33 0 64 113 29 0 77 166 28 0 83 219 31 0 80 255 36 0 71 272 44 0 58 268 52 0 41 247 59 0 27 212 63 0 16 170 65 0 7 126 63 0 1 85 61 0 0 52 60 3 0 29 62 13 1 19 67 25 3 23 75 38 6 36 84 51 8 58 94 58 9 81 101 56 9 97 104 47 7 101 102 34 4 91 95 20 2 70 84 10 3 47 70 2 7 25 55 0 13 8 40 0 22 0 29 1 35 0 22 2 47 0 20 2 59 0 22 2 68 0 27 3 73 0 30 2 74 0 30 1 71 0 26 0 67 0 20 0 62 7 13 0 57 24 6 0 51 48 3 0 42 75 4 1 32 106 8 8 21 135 13 22 12 160 20 41 5 181 26 60 1 199 33 78 0 215 39 89 0 225 45 91 0 222 50 88 0 202 51 80 0 165 51 75 0 118 51 71 0 75 53 69 0 38 59 68 0 12 70 66 0 0 84 61 0 14 99 52 0 44 111 40 0 84 119 27 0 126 119 16 0 169 111 8 0 193 97 2 0 194 78 2 0 174 57 8 0 144 38 16 1 115 22 27 2 95 11 40 2 92 4 53 2 105 2 64 2 130 6 72 1 159 14 78 0 186 25 80 0 204 39 79 0 209 53 74 1 199 63 64 7 176 69 50 16 143 68 35 29 105 61 22 44 69 49 11 59 39 36 4 70 18 23 3 78 6 14 5 82 10 6 13 83 24 2 23 85 42 0 37 85 62 0 52 85 81 0 67 82 96 0 79 78 106 0 88 70 115 0 93 59 129 0 95 47 151 0 95 36 180 0 94 30 213 0 93 28 246 0 91 34 273 3 89 46 289 10 85 62 292 22 78 77 282 41 68 90 257 63 57 96 219 84 46 98 170 100 37 96 119 109 31 92 76 107 29 89 47 99 29 87 38 86 30 87 45 74 30 88 60 64 28 88 71 58 24 87 70 55 18 87 58 57 12 84 42 61 7 81 23 66 3 76 7 71 1 69 2 76 0 59 28 78 0 49 73 78 2 38 130 77 6 27 193 74 10 17 257 70 15 10 292 67 19 5 292 62 21 1 257 56 20 0 196 50 15 0 133 43 11 4 76 39 7 11 33 40 3 19 6 46 0 27 6 58 0 38 24 76 0 43 49 96 0 43 78 114 0 38 106 127 0 29 127 132 0 19 129 126 0 10 113 112 0 4 85 91 0 0 56 68 0 0 30 45 0 0 12 28 0 0 1 18 0 0 0 14 0 4 0 18 0 14 0 25 0 29 0 34 0 47 0 44 0 66 4 53 0 80 20 62 0 83 45 69 0 73 76 76 0 56 111 81 0 37 142 84 0 20 159 84 0 6 158 82 0 0 144 78 0 1 124 73 0 4 110 66 0 8 111 58 0 9 128 49 0 10 158 40 0 9 191 31 0 7 219 23 0 3 231 15 0 2 227 10 0 3 206 5 0 7 177 2 0 9 147 1 0 10 130 0 0 10 133 0 3 8 161 1 11 5 210 6 22 2 275 14 36 0 339 23 52 0 390 29 66 0 418 32 74 0 417 27 75 0 391 21 69 0 343 12 59 0 282 4 51 1 214 0 50 6 150 0 58 15 95 0 77 24 58 3 101 34 45 11 125 41 56 22 143 43 87 34 149 38 133 47 142 29 186 55 126 19 235 56 105 10 275 49 83 6 301 38 63 4 311 25 49 6 302 15 39 9 275 10 35 12 232 9 34 14 178 13 36 15 125 18 40 15 82 23 46 16 60 26 55 19 60 27 65 22 80 25 78 28 112 21 92 33 141 16 103 38 159 12 112 42 160 10 118 43 146 10 121 43 123 14 123 42 106 21 127 38 100 29 134 33 106 37 144 28 120 43 155 21 132 46 164 15 131 44 168 10 116 38 163 6 89 29 148 2 61 19 124 1 38 11 94 6 26 5 63 18 24 1 37 35 24 0 21 56 23 0 16 79 19 0 23 99 14 0 41 111 7 0 62 114 1 0 82 106 0 0 96 92 0 0 101 73 0 0 97 53 4 0 83 36 15 0 64 25 31 4 45 18 47 10 30 15 64 16 23 15 72 22 26 14 69 25 39 12 55 24 56 10 39 19 73 8 22 13 86 6 8 6 93 6 0 2 94 6 0 0 92 5 0 0 90 4 0 7 89 3 0 16 91 1 0 29 95 0 8 39 100 0 31 48 105 0 64 49 109 1 105 43 111 4 149 32 111 10 180 20 109 16 188 10 106 23 169 4 102 30 130 0 98 34 88 0 95 35 48 0 95 34 19 3 99 30 17 12 107 23 42 25 119 16 79 41 132 10 119 59 142 4 155 73 147 1 170 81 147 0 159 81 141 0 124 74 131 0 85 63 120 1 46 51 108 3 17 38 98 8 0 29 86 13 0 22 75 18 0 16 62 21 0 11 49 22 3 7 38 19 16 4 29 16 38 4 24 12 66 9 23 11 96 19 28 12 120 33 35 15 128 52 43 18 111 71 49 19 85 89 51 18 56 103 47 15 27 112 37 12 6 115 25 10 8 113 15 9 46 109 6 8 108 103 0 6 189 100 0 5 284 97 0 3 381 94 7 1 448 89 23 0 476 80 47 0 464 67 77 6 418 53 114 21 354 40 146 43 289 32 167 71 234 32 174 102 198 38 165 125 177 47 142 136 168 54 111 132 164 56 76 116 161 50 46 93 156 37 24 71 152 24 9 52 148 12 1 42 144 4 3 36 141 0 10 36 139 0 20 37 136 0 32 35 132 0 48 31 125 0 61 26 112 1 71 19 91 1 76 13 65 1 75 11 42 1 69 13 22 1 59 17 19 0 49 23 38 0 40 29 80 0 34 32 135 0 33 33 199 0 35 34 249 0 39 35 272 0 46 37 260 0 54 42 212 0 63 49 151 0 72 56 92 0 82 65 41 0 90 72 9 0 95 77 15 0 95 80 39 0 88 82 68 0 76 83 99 0 61 88 129 0 46 96 143 0 36 107 139 0 31 122 117 0 34 137 86 0 38 152 56 0 43 160 31 0 44 160 12 0 42 150 1 0 38 131 0 6 35 103 0 18 35 72 13 36 39 45 50 58 45 24 104 84 51 10 168 106 54 1 236 120 53 0 291 127 46 0 314 128 37 0 305 126 25 0 274 125 15 0 236 126 7 0 207 130 2 0 197 133 0 0 205 133 0 0 223 126 0 0 237 111 0 4 230 90 0 21 198 68 0 51 148 49 1 91 97 33 5 137 49 26 8 183 14 25 11 215 0 29 11 227 12 35 10 215 43 41 8 187 86 44 4 149 133 43 1 109 180 38 0 75 207 29 1 53 200 19 6 42 164 11 15 42 117 8 26 45 70 10 39 48 42 16 52 47 52 25 58 40 97 34 57 29 154 39 50 19 209 40 37 9 244 38 24 6 241 33 13 10 200 29 5 19 144 27 0 30 87 27 0 45 40 30 0 59 9 33 0 71 0 34 0 81 9 34 0 88 44 31 0 91 98 28 0 87 164 28 0 78 236 33 0 65 299 44 0 47 332 59 2 30 331 76 10 17 302 93 21 7 259 107 33 1 215 115 46 0 184 117 57 0 172 114 61 0 181 110 60 0 204 104 55 0 234 99 47 0 258 95 40 0 271 91 34 0 272 84 29 0 263 74 26 0 251 61 25 0 241 48 23 0 237 37 22 0 237 29 24 0 237 26 29 0 235 26 38 0 227 29 52 3 214 32 70 11 199 36 89 20 184 39 106 31 169 39 118 40 155 37 124 47 142 34 123 47 128 31 118 46 114 29 112 45 102 29 106 45 93 31 103 44 92 34 101 44 99 36 101 42 115 36 101 34 138 31 101 24 165 23 100 15 194 15 99 7 221 8 99 1 240 3 99 0 249 0 100 0 246 0 103 0 229 0 109 0 198 0 121 1 156 0 137 9 108 0 161 19 68 0 187 32 36 4 211 46 13 10 228 57 0 16 233 60 0 22 221 55 9 25 194 44 28 24 153 29 51 19 105 17 77 13 66 11 104 6 33 13 122 2 10 21 127 0 0 34 121 0 9 49 108 0 23 61 91 0 41 67 71 0 57 68 53 0 74 63 37 3 82 55 24 8 81 45 16 14 74 39 15 22 65 35 23 27 57 35 38 28 49 38 58 25 41 42 77 19 32 45 93 12 23 47 103 6 14 48 111 1 10 47 121 1 13 47 135 3 24 46 157 5 41 46 183 8 59 48 209 10 73 52 230 10 78 60 239 8 72 70 237 5 57 78 221 3 39 84 191 1 22 86 151 5 12 84 106 15 11 78 67 31 17 71 34 48 26 65 11 69 33 63 0 85 37 61 0 95 33 63 0 96 26 66 0 93 17 70 0 84 8 72 0 76 2 76 0 68 0 79 0 63 0 81 0 61 0 81 0 62 0 79 3 65 0 74 11 69 0 65 22 76 0 51 31 82 0 36 38 90 0 23 40 98 3 12 37 104 11 4 32 108 23 0 33 107 35 0 43 104 46 0 62 98 52 3 87 92 51 11 110 89 44 22 123 92 37 32 125 98 33 40 118 107 36 42 108 116 47 36 106 120 63 27 120 117 79 16 150 105 92 7 192 86 97 1 234 63 93 0 262 40 84 0 265 22 73 0 240 12 67 4 194 10 67 12 138 15 75 22 86 23 88 32 51 33 102 40 36 42 110 42 34 49 109 36 37 54 98 27 37 56 82 17 32 56 65 7 23 54 54 1 12 52 52 0 3 49 60 0 0 47 75 0 9 46 92 0 32 49 106 0 63 56 112 0 93 65 110 0 120 77 101 0 128 88 88 0 113 97 77 0 85 103 70 4 55 104 68 9 25 101 70 16 6 95 74 23 0 86 76 28 0 76 74 28 0 65 72 23 2 52 71 16 10 39 73 9 25 26 79 3 49 16 87 0 81 8 96 0 114 2 102 0 142 0 105 0 154 0 105 6 150 0 106 19 127 0 108 36 92 0 111 55 59 0 115 75 31 0 118 90 10 0 120 95 0 0 121 92 0 0 121 82 5 0 123 70 21 0 127 57 43 0 134 49 68 1 143 47 98 2 153 51 127 2 160 56 148 2 164 59 161 2 163 57 167 1 158 48 165 0 149 35 154 0 140 21 135 0 131 9 107 0 124 1 74 0 119 4 46 0 118 9 24 0 119 14 8 0 122 15 0 0 126 15 6 0 130 13 18 0 132 8 29 0 130 5 34 0 124 10 35 0 114 24 32 0 100 40 22 2 83 58 14 6 66 75 21 11 48 85 47 19 33 85 81 30 22 78 120 40 14 65 158 49 8 51 185 57 5 37 200 62 3 28 208 63 1 24 216 60 0 25 227 52 0 30 238 39 0 40 245 27 0 53 237 16 0 67 208 7 0 79 159 1 1 89 109 0 6 93 62 4 15 89 25 14 27 78 11 28 40 62 27 44 51 46 50 61 54 31 71 72 49 21 89 72 39 17 95 63 26 20 83 49 17 26 61 34 14 36 38 26 21 45 18 28 34 50 4 41 48 51 0 62 60 47 0 83 65 38 0 98 60 26 0 102 46 16 0 95 32 9 0 78 18 5 0 55 7 7 0 34 0 12 0 19 0 17 0 12 4 22 0 17 13 26 0 31 25 27 10 49 40 24 29 69 57 19 59 86 71 13 97 98 80 7 144 104 82 2 185 105 78 0 210 101 69 0 216 96 57 0 201 91 46 0 172 86 37 0 137 83 30 0 110 82 28 0 97 82 29 0 99 83 30 0 113 82 32 0 128 78 34 0 136 71 36 0 127 62 40 0 103 51 45 0 74 42 50 1 45 37 54 3 28 35 56 5 32 38 55 7 59 43 51 8 98 50 45 7 145 55 39 5 190 59 35 3 220 59 33 1 229 57 33 0 213 52 34 0 179 45 34 0 135 36 33 0 97 27 28 1 75 19 21 3 78 11 14 8 104 6 8 13 141 2 2 19 175 1 0 26 189 0 3 31 178 0 14 34 144 0 30 35 100 4 48 33 65 12 69 27 54 24 86 22 78 39 95 16 135 56 92 13 211 72 80 14 286 85 61 21 341 93 41 33 362 95 23 46 349 93 10 56 311 89 2 61 264 81 0 57 223 70 0 45 199 58 1 31 193 44 4 18 198 30 10 6 206 18 17 0 206 11 26 0 190 10 36 1 156 15 44 5 112 24 50 9 72 35 54 14 38 44 57 20 12 47 58 28 0 41 57 39 12 32 54 53 38 21 50 72 78 11 44 93 131 3 39 114 194 4 33 132 255 13 29 141 305 25 27 139 339 38 28 126 356 50 31 105 357 58 36 80 343 61 43 57 316 60 49 42 281 60 53 36 241 61 54 39 203 65 51 46 173 71 44 52 160 77 35 54 166 83 26 49 191 86 18 40 227 89 13 27 263 90 10 17 283 90 10 8 274 90 10 3 233 88 12 4 173 84 13 12 113 77 13 22 58 68 13 33 17 58 11 43 17 50 9 47 51 46 8 41 91 46 10 31 128 50 16 20 157 55 26 10 159 57 39 1 131 57 51 0 94 53 58 6 54 48 59 17 21 43 53 32 1 40 40 45 7 38 26 60 23 35 14 68 43 30 5 69 58 22 0 64 68 15 0 60 66 8 0 56 54 3 0 55 35 0 0 55 17 0 0 54 3 0 3 52 0 3 10 47 0 7 18 42 7 12 27 39 30 17 36 39 68 23 42 44 116 26 42 51 168 26 38 61 215 25 31 70 240 22 23 77 241 17 16 79 220 12 11 77 188 8 11 69 157 3 15 58 135 0 24 44 125 4 38 32 125 14 55 21 128 28 75 12 127 44 94 7 115 59 109 4 95 68 116 2 71 66 113 0 51 54 101 1 40 38 81 4 40 23 58 10 45 10 36 14 48 1 22 19 43 0 18 22 35 1 26 23 23 6 45 21 9 13 72 20 0 20 100 19 13 25 124 20 51 28 138 24 108 25 138 30 175 19 125 38 245 12 103 44 301 8 75 47 324 8 49 46 313 15 29 40 278 24 19 29 233 37 18 19 191 49 27 10 157 58 41 3 135 64 56 0 118 66 69 0 103 61 75 0 90 50 73 0 81 37 63 2 84 24 48 5 106 13 33 8 147 5 22 11 201 0 20 12 253 0 28 11 285 0 45 8 284 0 67 5 247 0 89 2 185 0 107 0 120 0 118 0 63 3 124 0 26 10 124 0 28 21 123 1 67 35 121 4 121 52 118 7 187 68 110 8 256 80 96 9 309 87 77 8 338 87 53 6 342 82 33 3 327 73 17 1 300 61 5 5 273 50 4 18 249 42 15 40 232 38 33 68 219 39 55 102 206 45 80 132 189 54 100 150 168 62 109 154 146 68 103 142 126 69 84 120 115 65 60 92 116 58 37 69 128 49 17 55 148 42 3 50 169 36 0 53 181 34 0 63 179 32 1 74 159 30 2 84 123 25 2 93 84 19 2 100 49 12 3 105 21 6 2 110 3 2 1 111 0 0 0 110 9 2 0 105 23 7 0 95 35 12 0 83 38 16 0 72 38 22 0 64 34 24 0 60 23 25 0 62 8 24 0 65 10 23 1 68 50 24 4 67 113 26 8 61 189 29 11 52 267 32 14 41 331 35 13 34 353 37 11 32 331 38 8 36 279 39 4 43 217 42 1 50 164 47 0 53 132 52 0 49 121 58 0 38 119 61 0 26 114 61 0 15 93 57 0 6 72 50 0 8 45 41 0 20 19 31 0 34 0 22 0 47 25 14 0 56 77 8 0 54 146 3 0 45 226 1 3 31 311 0 9 18 368 0 19 6 385 0 33 0 362 6 53 0 310 16 74 0 247 30 94 0 189 46 108 0 148 62 114 0 131 74 108 0 135 80 91 0 155 81 66 0 181 78 43 0 206 73 22 0 224 68 7 0 233 63 4 0 230 61 12 0 215 61 21 1 191 61 30 3 159 63 39 7 125 64 42 11 90 64 38 15 61 61 29 17 41 57 20 16 34 51 11 13 39 43 4 9 60 35 0 5 95 27 6 1 143 20 18 0 203 16 35 2 265 17 54 3 318 23 77 4 348 33 93 3 345 43 102 4 303 51 103 2 230 53 96 1 155 50 85 0 87 45 74 0 34 40 65 0 3 42 57 0 0 49 53 0 10 62 50 0 32 76 48 0 61 88 45 0 95 93 39 0 135 93 31 0 166 85 22 0 182 74 14 4 186 62 8 10 176 50 6 19 155 41 8 28 124 34 14 38 88 30 23 44 57 29 34 46 31 29 44 42 20 32 53 36 39 36 59 27 88 42 62 18 150 47 59 10 218 52 54 5 280 54 44 1 316 53 31 2 320 50 20 8 294 45 11 18 247 38 4 29 191 34 0 43 140 29 0 56 104 25 0 67 90 22 0 73 100 19 0 74 131 17 0 71 177 15 0 67 229 12 0 61 274 8 2 55 304 5 8 50 312 3 16 44 293 1 26 35 247 0 39 25 183 0 51 17 122 0 59 8 68 0 62 2 33 0 60 1 32 0 51 7 61 0 38 16 98 2 25 26 129 10 14 37 146 22 5 48 134 37 0 54 105 56 0 55 68 75 1 51 33 91 3 45 7 102 5 38 8 110 7 33 35 116 8 27 74 121 7 24 116 126 5 23 156 132 3 24 185 138 1 25 191 142 0 28 178 143 0 34 159 141 0 41 145 135 0 48 141 123 0 54 141 108 0 60 140 90 0 63 128 71 0 63 100 55 0 62 71 45 0 57 41 39 5 49 16 38 12 42 0 40 22 36 0 42 31 30 15 42 38 29 70 40 38 33 157 34 32 38 258 27 23 46 356 19 14 56 424 13 6 65 427 9 5 75 363 11 9 83 264 15 15 87 162 20 20 87 76 26 24 84 19 30 22 77 0 30 17 68 0 29 11 59 0 28 5 51 0 23 1 44 1 19 2 38 1 14 6 33 1 9 11 29 1 5 16 27 2 2 22 26 3 0 25 26 8 0 24 26 15 0 21 30 26 0 16 36 37 0 12 44 48 0 9 58 55 0 10 73 61 0 14 88 67 0 20 100 80 0 25 109 101 0 29 111 132 0 29 107 170 0 27 100 202 0 26 91 220 0 29 83 214 0 37 76 183 1 54 74 135 8 76 73 88 21 99 71 45 37 119 68 14 56 130 63 9 73 128 53 27 82 112 40 50 79 84 27 76 66 57 17 104 47 32 8 125 29 13 2 140 13 2 0 154 3 0 0 172 4 4 0 197 11 14 0 225 18 27 0 248 25 39 0 257 30 49 0 244 29 52 0 208 23 43 3 155 16 32 7 102 8 19 13 57 3 7 20 28 4 0 27 29 14 3 29 59 28 14 27 100 44 30 21 138 63 46 15 164 79 62 8 162 88 72 2 132 90 71 0 94 85 59 5 53 75 42 14 20 64 26 25 1 53 13 34 0 45 4 42 1 43 7 44 8 43 20 37 18 48 36 27 29 55 54 16 40 62 73 9 49 66 85 8 48 67 86 12 38 64 77 16 28 58 59 21 16 52 40 24 6 50 23 22 0 49 10 18 4 49 2 13 18 48 0 8 36 43 0 3 57 32 0 1 80 22 0 0 102 12 0 3 121 4 2 7 139 2 12 12 161 10 29 15 185 20 53 19 207 31 83 20 217 40 115 21 208 46 142 24 176 43 158 32 129 33 162 45 84 23 153 59 42 12 134 73 13 4 112 81 0 2 92 80 6 7 80 70 25 13 76 53 53 19 82 36 82 24 94 20 109 25 108 9 125 21 120 1 122 15 127 0 103 9 130 0 79 3 129 0 61 0 127 0 57 0 124 0 67 0 125 0 82 3 129 0 93 6 137 0 91 8 145 0 74 10 153 0 53 10 155 0 31 8 150 0 12 6 138 0 0 3 122 0 0 0 105 4 0 0 90 11 0 2 82 18 0 8 80 26 0 13 82 33 0 18 87 35 0 21 91 32 0 20 93 25 0 15 89 17 0 10 82 10 0 5 72 4 0 1 60 1 0 0 50 0 11 0 44 0 42 0 44 0 90 0 50 0 150 0 62 0 220 0 79 2 287 1 96 3 334 5 112 4 355 10 124 3 345 16 131 4 306 21 131 2 246 25 126 1 173 27 116 4 110 24 102 14 57 20 85 30 21 15 68 49 1 12 54 73 0 9 44 93 0 11 39 106 5 16 41 108 17 24 48 99 34 34 57 78 55 43 67 55 77 49 74 34 92 50 77 16 94 46 75 4 83 37 69 1 63 26 57 5 42 16 42 10 24 7 28 16 21 4 16 21 33 7 7 23 53 13 1 19 67 20 4 15 70 28 11 9 62 32 19 3 47 32 25 3 26 29 30 9 12 21 29 16 33 14 23 21 78 8 15 25 133 2 8 24 192 0 2 19 249 0 1 13 278 0 7 6 276 0 14 2 244 0 24 3 195 0 35 7 141 2 46 11 96 9 55 14 69 18 61 15 66 28 64 13 81 36 64 9 109 38 61 5 138 33 53 1 161 25 40 0 173 15 28 0 175 6 17 0 173 0 7 0 167 6 1 0 161 15 3 1 155 27 12 1 150 42 23 3 141 59 33 7 130 71 42 12 114 79 46 18 95 81 40 27 76 77 30 35 64 69 19 44 62 56 9 53 77 41 2 61 109 26 0 69 159 15 0 77 220 7 0 82 283 1 0 85 335 0 1 85 363 0 6 82 357 0 14 78 314 0 25 73 240 0 37 70 164 0 51 70 95 2 63 74 39 9 73 80 6 17 79 88 1 27 84 92 14 35 83 93 32 40 77 92 51 40 64 90 69 36 46 88 83 29 30 89 82 23 16 95 70 19 5 101 52 20 0 106 35 25 0 110 25 31 0 109 25 39 0 102 33 44 0 92 47 46 0 79 64 47 0 65 82 46 0 53 100 48 0 44 121 53 0 38 146 60 3 33 174 69 11 26 200 75 21 19 220 76 32 13 224 70 44 6 207 59 53 5 168 45 56 11 121 32 54 22 76 24 50 35 37 22 47 47 19 26 47 52 44 35 52 51 101 46 63 40 171 57 77 28 246 64 93 16 308 66 109 6 329 63 122 0 307 56 129 0 247 47 129 4 171 39 123 12 101 32 110 23 47 28 93 34 12 26 74 43 0 25 54 47 0 22 35 42 1 19 21 34 15 16 10 24 41 12 3 17 76 7 0 19 119 4 0 26 165 2 0 37 196 0 3 47 205 0 10 55 190 0 21 58 157 0 35 57 113 0 52 53 72 0 66 47 41 0 74 42 24 5 77 34 18 11 75 25 19 18 69 17 18 23 63 10 16 26 59 3 11 23 54 0 6 18 48 1 1 11 40 11 0 5 29 28 8 0 19 50 31 0 10 74 69 0 3 99 121 3 3 113 181 7 11 114 236 12 23 104 267 17 41 86 268 22 61 67 233 23 78 51 173 23 90 42 114 23 94 41 61 25 89 46 21 29 80 50 0 35 68 53 2 40 57 53 22 42 48 51 54 39 39 47 93 31 30 46 131 22 21 49 165 13 14 53 174 7 7 58 159 9 2 60 128 20 0 57 93 35 2 47 66 52 7 34 57 68 16 22 68 76 25 10 97 76 34 2 137 67 40 0 182 53 39 7 224 37 32 20 256 23 23 36 272 13 13 54 268 10 7 72 242 14 5 82 195 24 8 85 137 36 12 81 86 49 14 73 43 57 14 64 13 58 12 56 0 50 8 51 0 38 3 50 0 24 1 52 0 12 0 60 0 3 0 70 6 0 6 81 15 0 17 90 26 0 29 98 35 0 39 105 42 3 46 107 43 9 43 109 42 18 35 111 43 28 23 111 50 41 12 109 66 50 3 105 90 56 1 98 118 57 7 88 144 56 17 76 161 53 27 62 163 50 36 47 148 47 42 33 119 44 41 23 84 44 34 17 52 44 25 17 25 47 17 20 7 52 15 27 0 62 18 30 0 74 24 30 0 89 30 26 13 104 32 19 42 118 27 12 84 128 21 5 132 132 13 1 183 130 5 0 219 122 0 0 230 111 0 0 217 99 2 0 187 89 8 0 151 83 16 0 120 83 24 0 98 86 31 0 90 90 34 0 89 91 32 0 91 87 25 0 92 76 17 0 94 58 10 0 100 40 4 0 114 23 1 0 141 10 4 0 178 2 13 0 217 0 28 0 247 0 50 0 261 3 78 0 257 8 106 0 240 13 129 0 220 19 142 1 208 23 141 2 212 24 126 4 234 21 101 4 267 17 71 4 300 14 44 4 318 14 22 2 314 18 8 1 285 26 5 0 243 36 12 0 205 46 21 0 186 54 29 1 197 61 37 5 240 64 38 10 302 63 33 15 361 59 24 20 399 52 16 23 399 44 8 23 359 34 7 21 285 26 13 17 197 20 25 13 119 18 42 9 58 19 60 6 18 25 78 3 7 31 92 2 24 38 100 1 44 42 101 0 62 42 98 0 74 36 90 0 76 28 83 0 62 18 77 0 43 10 75 1 23 4 74 10 9 0 73 22 15 0 70 39 41 0 63 56 79 0 53 71 128 1 41 76 180 3 29 71 223 4 20 55 247 6 15 39 247 7 14 22 226 7 18 9 187 7 25 1 139 7 34 0 92 9 43 0 55 13 53 0 33 21 64 0 29 30 75 0 38 42 84 1 54 53 92 4 69 62 93 8 77 68 89 14 76 71 79 19 73 72 64 22 74 74 47 21 86 80 31 17 113 89 20 12 146 102 17 6 173 113 25 1 183 119 45 0 168 119 74 0 131 111 107 0 90 95 137 5 49 77 157 13 17 57 163 24 0 39 154 35 0 25 137 45 0 16 115 50 0 13 96 48 0 13 84 39 11 15 80 28 36 14 81 18 69 12 88 13 101 9 96 16 130 5 105 26 142 1 115 42 130 0 127 58 101 3 140 68 67 12 152 68 39 24 161 58 31 38 163 43 44 51 157 27 78 60 143 12 121 60 123 2 165 53 101 0 197 41 78 1 207 28 59 7 194 17 46 14 160 10 38 22 115 10 37 29 72 14 41 35 41 21 50 33 32 32 61 28 44 44 74 20 72 53 86 13 105 61 96 6 133 66 100 1 150 69 99 0 152 70 90 0 143 72 77 0 130 75 61 0 121 81 46 0 123 89 35 0 134 96 27 0 154 102 23 0 170 103 21 0 175 96 20 0 160 83 21 0 127 64 26 0 89 43 37 0 53 25 53 0 22 11 71 0 3 2 90 0 2 0 105 4 12 2 114 10 23 7 117 17 29 14 113 22 35 21 103 25 42 27 89 22 52 30 74 17 72 30 60 10 110 26 48 4 161 21 42 0 213 16 43 0 249 14 50 0 257 11 61 0 236 10 76 0 194 8 90 4 149 6 99 10 118 3 100 18 111 2 91 29 125 0 74 41 146 0 52 50 160 0 32 55 156 0 15 56 130 0 6 53 93 0 9 49 57 0 20 47 25 0 33 48 6 0 46 52 0 0 57 58 3 0 62 62 9 0 59 64 15 0 51 63 17 0 41 59 18 0 34 55 17 0 33 53 11 0 40 53 5 2 55 54 1 9 73 56 0 19 90 57 0 31 98 56 0 44 96 54 0 53 81 50 8 56 59 45 24 54 38 36 46 48 19 26 72 40 6 18 103 36 0 10 132 37 0 4 157 41 0 0 179 49 6 0 203 58 13 4 228 65 21 9 257 70 28 15 285 74 33 18 311 78 34 19 328 81 31 16 331 84 25 12 317 85 20 6 283 84 15 1 233 81 10 0 171 79 7 1 112 79 4 5 64 81 2 11 28 87 0 19 7 93 0 27 13 98 2 34 33 98 6 39 59 91 9 40 87 79 13 39 114 63 17 37 134 47 19 36 146 39 20 35 158 38 20 35 179 46 19 35 217 59 17 33 269 73 13 29 332 85 9 23 389 91 6 18 424 90 2 12 423 83 0 6 380 73 1 3 301 60 4 1 209 48 9 0 126 38 13 0 59 32 15 0 16 31 15 0 0 34 12 0 0 43 8 0 0 55 4 0 0 68 1 0 0 81 4 0 0 89 8 0 12 94 11 0 41 92 13 0 85 85 12 0 140 73 10 0 199 58 6 0 243 43 2 0 256 29 0 0 230 20 1 0 175 16 7 0 120 20 19 3 65 27 38 6 23 36 63 8 32 42 93 10 85 43 121 10 150 38 143 8 214 28 154 6 274 18 154 3 295 8 144 0 273 2 129 0 216 0 112 2 147 0 102 3 86 0 101 3 39 0 109 3 9 0 125 3 0 0 145 2 0 0 163 2 0 0 173 8 0 0 174 17 0 0 165 28 3 0 149 40 20 0 129 50 47 2 108 53 82 8 89 51 121 18 74 43 160 32 62 32 186 52 55 21 199 72 50 12 199 91 50 5 194 106 49 1 188 115 48 1 187 117 45 8 190 114 40 19 196 109 33 31 203 100 27 43 209 91 25 55 208 81 28 61 204 69 35 62 194 55 46 60 182 39 58 57 167 25 67 54 150 14 73 53 131 7 75 51 111 7 74 47 89 18 72 42 70 30 72 34 54 42 76 24 43 50 81 15 37 49 88 10 34 39 94 8 30 28 98 11 25 14 97 16 19 4 92 21 13 0 84 23 6 3 74 23 1 12 65 21 0 24 58 19 0 37 54 18 0 50 50 19 3 60 43 20 12 60 33 21 24 53 24 23 36 41 14 25 46 27 5 27 51 16 0 31 50 7 4 38 45 4 16 44 39 7 34 48 35 18 57 49 36 31 84 45 40 50 107 34 48 69 121 24 59 87 122 14 72 98 112 5 83 102 93 0 88 97 70 0 82 85 49 0 66 67 34 1 48 50 26 5 28 37 25 11 11 31 28 16 1 31 31 19 0 36 32 19 0 43 29 16 16 49 23 11 51 53 17 5 100 56 12 1 158 58 12 0 219 61 16 0 258 64 25 0 261 67 36 0 225 69 47 1 167 70 54 5 109 69 55 10 55 68 48 16 16 68 37 21 27 69 25 22 73 72 15 19 127 76 12 14 176 79 21 9 217 80 37 3 219 77 54 0 182 70 69 3 131 60 75 10 77 50 70 16 31 41 56 21 3 35 40 24 2 33 28 22 17 37 23 17 39 45 29 10 66 58 42 4 94 71 58 0 119 83 72 0 127 92 79 0 117 96 78 0 96 95 70 0 68 90 58 0 43 83 47 0 27 73 38 2 21 65 34 5 28 59 34 8 44 54 32 11 69 49 27 13 102 46 21 12 145 40 14 9 194 32 6 6 247 24 2 3 294 16 8 0 325 9 21 2 331 3 36 10 309 1 49 23 260 0 61 38 195 0 65 55 128 0 63 69 73 2 56 74 45 7 49 72 46 13 43 62 74 21 39 49 113 28 35 38 147 31 31 32 162 28 26 34 151 22 20 45 118 16 14 63 81 8 11 82 43 2 7 99 14 3 6 108 0 11 6 106 0 23 9 90 0 35 15 68 0 48 27 45 0 58 40 25 0 60 52 10 0 56 60 6 0 48 58 11 0 39 48 17 32 32 35 22 95 31 21 24 180 34 9 22 273 42 1 17 367 53 4 11 422 61 16 5 422 63 30 4 370 61 45 10 286 54 58 21 193 46 64 34 113 43 58 49 61 45 45 59 38 50 30 62 36 57 16 55 44 63 6 42 49 64 1 28 47 61 0 15 37 57 0 5 25 54 0 0 19 54 0 0 25 56 0 0 47 61 0 0 81 66 0 0 120 70 0 0 155 71 0 0 177 71 0 2 179 70 0 8 160 69 0 14 121 69 0 20 82 72 0 24 47 74 0 26 19 77 0 22 1 79 0 17 1 77 0 13 28 72 0 12 73 63 0 12 133 52 0 14 198 42 1 15 263 33 4 17 294 30 9 18 286 32 13 22 242 39 16 29 178 49 16 39 112 59 13 49 64 67 9 55 44 71 4 55 53 70 1 48 83 67 0 36 117 62 0 23 145 58 0 11 155 57 0 3 148 58 0 1 128 59 0 4 106 60 0 9 89 57 0 14 86 49 0 19 96 37 0 24 114 25 0 27 133 15 0 31 147 6 0 37 152 1 0 46 150 5 4 54 148 12 11 62 148 18 19 65 152 25 25 60 156 31 27 49 158 34 24 34 155 37 19 21 150 38 11 10 153 40 3 2 171 42 5 0 207 40 17 2 257 34 32 9 309 26 49 18 345 17 65 29 354 9 75 43 329 2 75 56 274 0 66 68 201 0 53 79 130 0 37 88 71 0 25 96 37 0 17 103 29 0 18 105 39 0 26 102 51 0 44 98 60 0 71 93 59 0 101 88 53 0 130 87 47 0 150 90 48 0 159 96 56 0 154 103 64 0 138 111 64 0 117 116 55 0 101 119 42 0 94 123 24 0 98 126 7 0 110 129 10 0 124 131 47 0 132 131 101 0 128 128 164 0 111 122 228 0 82 116 278 0 54 107 290 0 29 102 262 0 10 98 204 0 3 97 139 0 15 96 80 0 33 97 35 0 54 97 8 0 77 94 3 0 96 89 14 0 103 80 25 0 99 67 34 0 86 53 38 0 69 41 35 0 54 33 28 0 43 31 17 0 36 34 6 0 32 42 0 0 27 49 8 0 21 54 31 1 14 55 63 6 8 51 101 15 2 40 142 26 2 28 180 37 9 18 208 46 18 8 227 49 27 1 240 44 32 0 246 34 33 0 243 23 27 4 223 12 19 12 183 4 10 22 133 0 3 32 86 2 1 43 44 9 3 51 13 16 5 53 11 24 6 49 40 32 6 42 78 38 6 31 117 41 4 20 150 43 1 11 165 45 0 4 152 48 1 0 122 51 4 3 89 54 9 6 76 54 12 9 91 52 14 12 134 49 13 13 192 46 10 11 248 46 6 8 281 49 2 5 278 57 3 2 240 70 10 0 177 85 19 0 115 102 30 0 60 114 40 0 21 120 47 0 1 119 47 2 0 111 41 4 0 100 30 7 0 92 20 12 0 90 10 18 0 95 3 23 0 103 0 27 0 112 0 30 0 116 0 31 0 115 0 28 0 106 0 24 0 96 0 19 0 86 0 13 0 80 0 9 0 78 0 9 0 83 0 13 0 90 3 18 8 99 7 22 19 105 12 23 32 110 17 21 42 111 20 15 48 109 20 9 46 107 16 4 40 104 11 0 37 99 6 0 47 91 2 0 74 83 0 0 119 75 0 0 177 67 3 0 238 62 7 0 288 60 12 0 320 60 18 0 329 59 24 0 319 57 30 0 297 55 38 2 279 53 48 10 272 55 61 19 280 62 75 28 299 71 87 36 318 83 93 38 323 93 90 32 304 101 78 24 262 105 57 14 202 106 38 5 141 105 20 0 91 102 7 0 67 98 0 0 75 91 6 1 112 84 17 7 168 76 31 17 230 70 47 26 279 66 66 35 302 66 82 43 292 67 95 45 248 68 103 44 181 66 106 41 118 63 102 40 63 57 92 39 22 51 77 40 0 47 60 38 4 46 45 31 22 51 33 24 48 61 28 16 77 75 29 7 103 90 35 2 124 103 43 9 129 108 51 22 120 103 57 38 109 91 59 56 107 74 58 73 118 58 54 81 144 47 48 78 177 45 41 66 206 52 35 48 221 68 31 30 220 88 29 15 204 108 29 5 181 124 32 0 156 131 37 0 136 128 44 0 115 118 50 4 90 104 55 12 65 91 56 23 43 82 55 35 22 81 50 48 5 83 44 54 4 87 36 53 22 90 26 45 48 87 18 32 74 79 11 20 95 67 5 10 104 55 1 9 90 47 0 21 69 49 2 42 42 60 10 66 18 78 21 90 3 99 32 102 22 118 43 100 59 129 50 83 112 131 52 59 175 123 49 37 237 108 45 25 264 90 41 26 237 73 38 37 191 63 36 52 134 61 35 63 69 68 31 67 37 82 24 62 161 101 17 58 369 120 10 59 582 135 6 68 742 145 9 81 820 148 20 93 731 143 37 96 559 131 56 85 342 111 73 65 143 85 79 43 19 59 74 22 0 37 57 6 0 18 39 0 0 4 21 0 0 0 6 1 3 3 1 5 12 6 2 9 19 'version' => 2 ok t/SearchDist.t ............... 1..3 ok 1 # Bio::Ext::Align not loaded ok 2 # Bio::Ext::Align not loaded ok 3 # Bio::Ext::Align not loaded ok Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 77. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 114. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 130. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 146. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 162. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 182. Subroutine new redefined at Bio\Location\Simple.pm line 89. Subroutine start redefined at Bio\Location\Simple.pm line 111. Subroutine end redefined at Bio\Location\Simple.pm line 137. Subroutine length redefined at Bio\Location\Simple.pm line 174. Subroutine location_type redefined at Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312. Subroutine trunc redefined at Bio\Location\Simple.pm line 343. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 660. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 160, line 660. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 239, line 660. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 259, line 660. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 286, line 660. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 304, line 660. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 324, line 660. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 345, line 660. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 366, line 660. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 388, line 660. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 411, line 660. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 433, line 660. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 454, line 660. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 469, line 660. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 486, line 660. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 501, line 660. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 520, line 660. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 543, line 660. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 556, line 660. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 573, line 660. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 590, line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 608, line 660. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 628, line 660. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 649, line 660. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 658, line 660. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 667, line 660. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 684, line 660. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 705, line 660. Subroutine new redefined at Bio/Search/Hit/GenericHit.pm line 116, line 660. Subroutine add_hsp redefined at Bio/Search/Hit/GenericHit.pm line 175, line 660. Subroutine name redefined at Bio/Search/Hit/GenericHit.pm line 202, line 660. Subroutine accession redefined at Bio/Search/Hit/GenericHit.pm line 222, line 660. Subroutine description redefined at Bio/Search/Hit/GenericHit.pm line 242, line 660. Subroutine length redefined at Bio/Search/Hit/GenericHit.pm line 262, line 660. Subroutine algorithm redefined at Bio/Search/Hit/GenericHit.pm line 287, line 660. Subroutine raw_score redefined at Bio/Search/Hit/GenericHit.pm line 309, line 660. Subroutine score redefined at Bio/Search/Hit/GenericHit.pm line 325, line 660. Subroutine significance redefined at Bio/Search/Hit/GenericHit.pm line 340, line 660. Subroutine bits redefined at Bio/Search/Hit/GenericHit.pm line 371, line 660. Subroutine next_hsp redefined at Bio/Search/Hit/GenericHit.pm line 399, line 660. Subroutine hsps redefined at Bio/Search/Hit/GenericHit.pm line 425, line 660. Subroutine num_hsps redefined at Bio/Search/Hit/GenericHit.pm line 454, line 660. Subroutine rewind redefined at Bio/Search/Hit/GenericHit.pm line 475, line 660. Subroutine ambiguous_aln redefined at Bio/Search/Hit/GenericHit.pm line 502, line 660. Subroutine overlap redefined at Bio/Search/Hit/GenericHit.pm line 516, line 660. Subroutine n redefined at Bio/Search/Hit/GenericHit.pm line 547, line 660. Subroutine p redefined at Bio/Search/Hit/GenericHit.pm line 596, line 660. Subroutine hsp redefined at Bio/Search/Hit/GenericHit.pm line 640, line 660. Subroutine logical_length redefined at Bio/Search/Hit/GenericHit.pm line 680, line 660. Subroutine length_aln redefined at Bio/Search/Hit/GenericHit.pm line 733, line 660. Subroutine gaps redefined at Bio/Search/Hit/GenericHit.pm line 791, line 660. Subroutine matches redefined at Bio/Search/Hit/GenericHit.pm line 825, line 660. Subroutine start redefined at Bio/Search/Hit/GenericHit.pm line 883, line 660. Subroutine end redefined at Bio/Search/Hit/GenericHit.pm line 941, line 660. Subroutine range redefined at Bio/Search/Hit/GenericHit.pm line 985, line 660. Subroutine frac_identical redefined at Bio/Search/Hit/GenericHit.pm line 1032, line 660. Subroutine frac_conserved redefined at Bio/Search/Hit/GenericHit.pm line 1092, line 660. Subroutine frac_aligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1141, line 660. Subroutine frac_aligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1177, line 660. Subroutine num_unaligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1226, line 660. Subroutine num_unaligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1258, line 660. Subroutine seq_inds redefined at Bio/Search/Hit/GenericHit.pm line 1296, line 660. Subroutine strand redefined at Bio/Search/Hit/GenericHit.pm line 1329, line 660. Subroutine frame redefined at Bio/Search/Hit/GenericHit.pm line 1387, line 660. Subroutine rank redefined at Bio/Search/Hit/GenericHit.pm line 1421, line 660. Subroutine locus redefined at Bio/Search/Hit/GenericHit.pm line 1437, line 660. Subroutine each_accession_number redefined at Bio/Search/Hit/GenericHit.pm line 1465, line 660. Subroutine tiled_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1513, line 660. Subroutine query_length redefined at Bio/Search/Hit/GenericHit.pm line 1530, line 660. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1202, line 660. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 162, line 353. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 374, line 353. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 396, line 353. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 415, line 353. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 419, line 353. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 442, line 353. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 480, line 353. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 508, line 353. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 533, line 353. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 557, line 353. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 583, line 353. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 613, line 353. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 645, line 353. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 676, line 353. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 744, line 353. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 790, line 353. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 809, line 353. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 827, line 353. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 865, line 353. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1000, line 353. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1102, line 353. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1115, line 353. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1147, line 353. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1204, line 353. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1226, line 353. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1258, line 353. Use of uninitialized value within @col_spec in lc at Bio/SearchIO/Writer/ResultTableWriter.pm line 201, line 353. Use of uninitialized value $_ in lc at Bio/SeqFeature/SimilarityPair.pm line 105, line 32. t/SearchIO.t ................. 1..1145 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 ok 598 ok 599 ok 600 ok 601 ok 602 ok 603 ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 # Significance parsing broken for GCG-BLAST Hits -- see HSP ok 674 # Raw score parsing broken for GCG-BLAST Hits -- see HSP ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 ok 979 ok 980 ok 981 ok 982 ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 ok 1007 ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 ok 1055 ok 1056 ok 1057 ok 1058 ok 1059 ok 1060 ok 1061 ok 1062 ok 1063 ok 1064 ok 1065 ok 1066 ok 1067 ok 1068 ok 1069 ok 1070 ok 1071 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 ok 1084 ok 1085 ok 1086 ok 1087 ok 1088 ok 1089 ok 1090 ok 1091 ok 1092 ok 1093 ok 1094 ok 1095 ok 1096 ok 1097 ok 1098 ok 1099 ok 1100 ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 ok 1117 ok 1118 ok 1119 ok 1120 ok 1121 ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/Seq.t ...................... 1..53 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 12. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 12. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 12. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 12. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 12. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 12. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 12. t/SeqAnalysisParser.t ........ 1..11 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 31. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 31. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 31. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 31. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 31. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 31. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 31. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 33. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 33. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 33. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 33. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 33. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 33. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 33. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 33. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 33. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 33. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 33. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 33. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 35. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 35. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 35. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 35. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 35. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 35. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 35. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 35. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 35. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 35. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 35. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 35. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 35. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 35. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 35. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 35. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 35. t/SeqBuilder.t ............... 1..101 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. t/SeqDiff.t .................. 1..42 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok DB_File not installed. This means the SeqFeatCollection wont work t/SeqFeatCollection.t ........ 1..432 ok 1 # DB_File ok 2 # DB_File ok 3 # DB_File ok 4 # DB_File ok 5 # DB_File ok 6 # DB_File ok 7 # DB_File ok 8 # DB_File ok 9 # DB_File ok 10 # DB_File ok 11 # DB_File ok 12 # DB_File ok 13 # DB_File ok 14 # DB_File ok 15 # DB_File ok 16 # DB_File ok 17 # DB_File ok 18 # DB_File ok 19 # DB_File ok 20 # DB_File ok 21 # DB_File ok 22 # DB_File ok 23 # DB_File ok 24 # DB_File ok 25 # DB_File ok 26 # DB_File ok 27 # DB_File ok 28 # DB_File ok 29 # DB_File ok 30 # DB_File ok 31 # DB_File ok 32 # DB_File ok 33 # DB_File ok 34 # DB_File ok 35 # DB_File ok 36 # DB_File ok 37 # DB_File ok 38 # DB_File ok 39 # DB_File ok 40 # DB_File ok 41 # DB_File ok 42 # DB_File ok 43 # DB_File ok 44 # DB_File ok 45 # DB_File ok 46 # DB_File ok 47 # DB_File ok 48 # DB_File ok 49 # DB_File ok 50 # DB_File ok 51 # DB_File ok 52 # DB_File ok 53 # DB_File ok 54 # DB_File ok 55 # DB_File ok 56 # DB_File ok 57 # DB_File ok 58 # DB_File ok 59 # DB_File ok 60 # DB_File ok 61 # DB_File ok 62 # DB_File ok 63 # DB_File ok 64 # DB_File ok 65 # DB_File ok 66 # DB_File ok 67 # DB_File ok 68 # DB_File ok 69 # DB_File ok 70 # DB_File ok 71 # DB_File ok 72 # DB_File ok 73 # DB_File ok 74 # DB_File ok 75 # DB_File ok 76 # DB_File ok 77 # DB_File ok 78 # DB_File ok 79 # DB_File ok 80 # DB_File ok 81 # DB_File ok 82 # DB_File ok 83 # DB_File ok 84 # DB_File ok 85 # DB_File ok 86 # DB_File ok 87 # DB_File ok 88 # DB_File ok 89 # DB_File ok 90 # DB_File ok 91 # DB_File ok 92 # DB_File ok 93 # DB_File ok 94 # DB_File ok 95 # DB_File ok 96 # DB_File ok 97 # DB_File ok 98 # DB_File ok 99 # DB_File ok 100 # DB_File ok 101 # DB_File ok 102 # DB_File ok 103 # DB_File ok 104 # DB_File ok 105 # DB_File ok 106 # DB_File ok 107 # DB_File ok 108 # DB_File ok 109 # DB_File ok 110 # DB_File ok 111 # DB_File ok 112 # DB_File ok 113 # DB_File ok 114 # DB_File ok 115 # DB_File ok 116 # DB_File ok 117 # DB_File ok 118 # DB_File ok 119 # DB_File ok 120 # DB_File ok 121 # DB_File ok 122 # DB_File ok 123 # DB_File ok 124 # DB_File ok 125 # DB_File ok 126 # DB_File ok 127 # DB_File ok 128 # DB_File ok 129 # DB_File ok 130 # DB_File ok 131 # DB_File ok 132 # DB_File ok 133 # DB_File ok 134 # DB_File ok 135 # DB_File ok 136 # DB_File ok 137 # DB_File ok 138 # DB_File ok 139 # DB_File ok 140 # DB_File ok 141 # DB_File ok 142 # DB_File ok 143 # DB_File ok 144 # DB_File ok 145 # DB_File ok 146 # DB_File ok 147 # DB_File ok 148 # DB_File ok 149 # DB_File ok 150 # DB_File ok 151 # DB_File ok 152 # DB_File ok 153 # DB_File ok 154 # DB_File ok 155 # DB_File ok 156 # DB_File ok 157 # DB_File ok 158 # DB_File ok 159 # DB_File ok 160 # DB_File ok 161 # DB_File ok 162 # DB_File ok 163 # DB_File ok 164 # DB_File ok 165 # DB_File ok 166 # DB_File ok 167 # DB_File ok 168 # DB_File ok 169 # DB_File ok 170 # DB_File ok 171 # DB_File ok 172 # DB_File ok 173 # DB_File ok 174 # DB_File ok 175 # DB_File ok 176 # DB_File ok 177 # DB_File ok 178 # DB_File ok 179 # DB_File ok 180 # DB_File ok 181 # DB_File ok 182 # DB_File ok 183 # DB_File ok 184 # DB_File ok 185 # DB_File ok 186 # DB_File ok 187 # DB_File ok 188 # DB_File ok 189 # DB_File ok 190 # DB_File ok 191 # DB_File ok 192 # DB_File ok 193 # DB_File ok 194 # DB_File ok 195 # DB_File ok 196 # DB_File ok 197 # DB_File ok 198 # DB_File ok 199 # DB_File ok 200 # DB_File ok 201 # DB_File ok 202 # DB_File ok 203 # DB_File ok 204 # DB_File ok 205 # DB_File ok 206 # DB_File ok 207 # DB_File ok 208 # DB_File ok 209 # DB_File ok 210 # DB_File ok 211 # DB_File ok 212 # DB_File ok 213 # DB_File ok 214 # DB_File ok 215 # DB_File ok 216 # DB_File ok 217 # DB_File ok 218 # DB_File ok 219 # DB_File ok 220 # DB_File ok 221 # DB_File ok 222 # DB_File ok 223 # DB_File ok 224 # DB_File ok 225 # DB_File ok 226 # DB_File ok 227 # DB_File ok 228 # DB_File ok 229 # DB_File ok 230 # DB_File ok 231 # DB_File ok 232 # DB_File ok 233 # DB_File ok 234 # DB_File ok 235 # DB_File ok 236 # DB_File ok 237 # DB_File ok 238 # DB_File ok 239 # DB_File ok 240 # DB_File ok 241 # DB_File ok 242 # DB_File ok 243 # DB_File ok 244 # DB_File ok 245 # DB_File ok 246 # DB_File ok 247 # DB_File ok 248 # DB_File ok 249 # DB_File ok 250 # DB_File ok 251 # DB_File ok 252 # DB_File ok 253 # DB_File ok 254 # DB_File ok 255 # DB_File ok 256 # DB_File ok 257 # DB_File ok 258 # DB_File ok 259 # DB_File ok 260 # DB_File ok 261 # DB_File ok 262 # DB_File ok 263 # DB_File ok 264 # DB_File ok 265 # DB_File ok 266 # DB_File ok 267 # DB_File ok 268 # DB_File ok 269 # DB_File ok 270 # DB_File ok 271 # DB_File ok 272 # DB_File ok 273 # DB_File ok 274 # DB_File ok 275 # DB_File ok 276 # DB_File ok 277 # DB_File ok 278 # DB_File ok 279 # DB_File ok 280 # DB_File ok 281 # DB_File ok 282 # DB_File ok 283 # DB_File ok 284 # DB_File ok 285 # DB_File ok 286 # DB_File ok 287 # DB_File ok 288 # DB_File ok 289 # DB_File ok 290 # DB_File ok 291 # DB_File ok 292 # DB_File ok 293 # DB_File ok 294 # DB_File ok 295 # DB_File ok 296 # DB_File ok 297 # DB_File ok 298 # DB_File ok 299 # DB_File ok 300 # DB_File ok 301 # DB_File ok 302 # DB_File ok 303 # DB_File ok 304 # DB_File ok 305 # DB_File ok 306 # DB_File ok 307 # DB_File ok 308 # DB_File ok 309 # DB_File ok 310 # DB_File ok 311 # DB_File ok 312 # DB_File ok 313 # DB_File ok 314 # DB_File ok 315 # DB_File ok 316 # DB_File ok 317 # DB_File ok 318 # DB_File ok 319 # DB_File ok 320 # DB_File ok 321 # DB_File ok 322 # DB_File ok 323 # DB_File ok 324 # DB_File ok 325 # DB_File ok 326 # DB_File ok 327 # DB_File ok 328 # DB_File ok 329 # DB_File ok 330 # DB_File ok 331 # DB_File ok 332 # DB_File ok 333 # DB_File ok 334 # DB_File ok 335 # DB_File ok 336 # DB_File ok 337 # DB_File ok 338 # DB_File ok 339 # DB_File ok 340 # DB_File ok 341 # DB_File ok 342 # DB_File ok 343 # DB_File ok 344 # DB_File ok 345 # DB_File ok 346 # DB_File ok 347 # DB_File ok 348 # DB_File ok 349 # DB_File ok 350 # DB_File ok 351 # DB_File ok 352 # DB_File ok 353 # DB_File ok 354 # DB_File ok 355 # DB_File ok 356 # DB_File ok 357 # DB_File ok 358 # DB_File ok 359 # DB_File ok 360 # DB_File ok 361 # DB_File ok 362 # DB_File ok 363 # DB_File ok 364 # DB_File ok 365 # DB_File ok 366 # DB_File ok 367 # DB_File ok 368 # DB_File ok 369 # DB_File ok 370 # DB_File ok 371 # DB_File ok 372 # DB_File ok 373 # DB_File ok 374 # DB_File ok 375 # DB_File ok 376 # DB_File ok 377 # DB_File ok 378 # DB_File ok 379 # DB_File ok 380 # DB_File ok 381 # DB_File ok 382 # DB_File ok 383 # DB_File ok 384 # DB_File ok 385 # DB_File ok 386 # DB_File ok 387 # DB_File ok 388 # DB_File ok 389 # DB_File ok 390 # DB_File ok 391 # DB_File ok 392 # DB_File ok 393 # DB_File ok 394 # DB_File ok 395 # DB_File ok 396 # DB_File ok 397 # DB_File ok 398 # DB_File ok 399 # DB_File ok 400 # DB_File ok 401 # DB_File ok 402 # DB_File ok 403 # DB_File ok 404 # DB_File ok 405 # DB_File ok 406 # DB_File ok 407 # DB_File ok 408 # DB_File ok 409 # DB_File ok 410 # DB_File ok 411 # DB_File ok 412 # DB_File ok 413 # DB_File ok 414 # DB_File ok 415 # DB_File ok 416 # DB_File ok 417 # DB_File ok 418 # DB_File ok 419 # DB_File ok 420 # DB_File ok 421 # DB_File ok 422 # DB_File ok 423 # DB_File ok 424 # DB_File ok 425 # DB_File ok 426 # DB_File ok 427 # DB_File ok 428 # DB_File ok 429 # DB_File ok 430 # DB_File ok 431 # DB_File ok 432 # DB_File ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 147. Subroutine set_attributes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 188. Subroutine direct_new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 253. Subroutine location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 274. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 304. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 321. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 338. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 355. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 372. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 400. Subroutine primary_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 428. Subroutine source_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 447. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 465. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 480. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 500. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 526. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 542. Subroutine attach_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 567. Subroutine seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 596. Subroutine entire_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 638. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 661. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 678. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 702. Subroutine get_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 733. Subroutine add_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 757. Subroutine remove_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 794. Subroutine gff_format redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 826. Subroutine gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 856. Subroutine slurp_gff_file redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 879. Subroutine _from_gff_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 913. Subroutine _expand_region redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 935. Subroutine _parse redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 966. Subroutine _tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 983. Subroutine seqname redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 999. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1005. Subroutine each_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1012. Subroutine all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1013. Subroutine cleanup_generic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1024. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1017. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1018. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1019. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Generic.pm line 1021. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 37. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 37. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 37. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 37. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 37. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 37. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 37. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 37. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 37. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 37. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 37. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 37. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 33. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 33. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 33. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 33. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 33. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 33. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 33. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 33. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 33. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 33. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 33. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 33. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 33. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 33. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 33. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 33. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 33. t/SeqFeature.t ............... 1..74 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 # Skipping tests which need the Bio::DB::GenBank module ok 70 # Skipping tests which need the Bio::DB::GenBank module ok 71 # Skipping tests which need the Bio::DB::GenBank module ok 72 # Skipping tests which need the Bio::DB::GenBank module ok 73 # Skipping tests which need the Bio::DB::GenBank module ok 74 # Skipping tests which need the Bio::DB::GenBank module ok t/seqfeaturePrimer.t ......... 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 48. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 48. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 48. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 48. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 48. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 48. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 48. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 35. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 35. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 35. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 35. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 35. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 35. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 35. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 35. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 35. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 35. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 35. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 35. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 54. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 54. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 54. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 54. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 54. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 54. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 54. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 54. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 54. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 54. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 54. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 54. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 54. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 54. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 54. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 54. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 54. t/SeqIO.t .................... 1..235 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 # skip ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 # skip ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 # skip ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok t/SeqPattern.t ............... 1..6 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok t/SeqStats.t ................. 1..28 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 70. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 70. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 70. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 70. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 70. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 70. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 70. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 142. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 142. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 142. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 142. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 142. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 142. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 142. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 142. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 142. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 142. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 142. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 142. t/SequenceFamily.t ........... 1..17 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/sequencetrace.t ............ 1..5 ok 1 ok 2 ok 3 ok 4 ok 5 ok t/SeqUtils.t ................. 1..21 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/seqwithquality.t ........... 1..18 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 6. Testing the subqual() method... 6d) Testing the subqual at the start (border condition) 6d) Testing the subqual at the end (border condition) 6d) Testing the subqual in the middle ok t/SeqWords.t ................. 1..16 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/Sigcleave.t ................ 1..16 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 6. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 6. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 6. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 6. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 6. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 6. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 6. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 6. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 6. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 6. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 6. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 6. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 6. t/Sim4.t ..................... 1..128 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 160. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 239. Subroutine algorithm_version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 259. Subroutine next_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 286. Subroutine query_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 304. Subroutine query_accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 324. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 345. Subroutine query_description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 366. Subroutine database_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 388. Subroutine database_letters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 411. Subroutine database_entries redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 433. Subroutine get_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 454. Subroutine available_parameters redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 469. Subroutine get_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 486. Subroutine available_statistics redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 501. Subroutine add_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 520. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 543. Subroutine _nexthitindex redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 556. Subroutine add_parameter redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 573. Subroutine add_statistic redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 590. Subroutine num_hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 608. Subroutine hits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 628. Subroutine algorithm_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 649. Subroutine program_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 658. Subroutine no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 667. Subroutine set_no_hits_found redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 684. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Result/GenericResult.pm line 705. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 116. Subroutine add_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 175. Subroutine name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 202. Subroutine accession redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 222. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 242. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 262. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 287. Subroutine raw_score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 309. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 325. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 340. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 371. Subroutine next_hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 399. Subroutine hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 425. Subroutine num_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 454. Subroutine rewind redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 475. Subroutine ambiguous_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 502. Subroutine overlap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 516. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 547. Subroutine p redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 596. Subroutine hsp redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 640. Subroutine logical_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 680. Subroutine length_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 733. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 791. Subroutine matches redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 825. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 883. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 941. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 985. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1032. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1092. Subroutine frac_aligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1141. Subroutine frac_aligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1177. Subroutine num_unaligned_hit redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1226. Subroutine num_unaligned_query redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1258. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1296. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1329. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1387. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1421. Subroutine locus redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1437. Subroutine each_accession_number redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1465. Subroutine tiled_hsps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1513. Subroutine query_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1530. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/Hit/GenericHit.pm line 1202. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 165. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 165. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 165. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 165. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 165. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 165. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 165. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 165. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 165. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 165. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 165. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 165. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 165. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 165. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 192. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 219. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 247. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 278. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 305. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 329. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 341. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 368. Use of uninitialized value $_ in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/SeqFeature/SimilarityPair.pm line 105, line 397. t/SimilarityPair.t ........... 1..5 ok 1 ok 2 ok 3 ok 4 ok 5 ok t/SimpleAlign.t .............. 1..60 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. set_attribute: not a compat02 graph at C:/cpanfly-5.12/var/megalib/Graph.pm line 2490, line 14. t/simpleGOparser.t ........... 1..98 Dubious, test returned 255 (wstat 65280, 0xff00) Failed 98/98 subtests Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 42. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 42. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 42. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 42. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 42. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 42. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 42. t/sirna.t .................... 1..2 # Running under perl version 5.012000 for MSWin32 # Win32::BuildNumber 1200 # Current time local: Fri May 7 20:13:15 2010 # Current time GMT: Sat May 8 03:13:15 2010 # Using Test.pm version 1.25 ok 1 Got 65 ok 2 ok t/SiteMatrix.t ............... 1..15 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SNP.t ...................... 1..13 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/Sopma.t .................... 1..15 ok 1 ok 2 ok 3 ok 4 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 5 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 6 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 7 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 8 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 9 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 10 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 11 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 12 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 13 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 14 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok 15 # Skipping tests which require remote servers - set env variable BIOPERLDEBUG to test ok t/Species.t .................. 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 82. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 82. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 82. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 82. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 82. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 82. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 82. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 101. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 101. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 101. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 101. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 101. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 101. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 101. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 101. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 101. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 101. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 101. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 101. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 101. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 101. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 101. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 101. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 101. t/splicedseq.t ............... 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/StandAloneBlast.t .......... 1..16 ok 1 ok 2 # Blast not installed ok 3 # Blast or env variables not installed correctly ok 4 # Blast or env variables not installed correctly ok 5 # Blast or env variables not installed correctly ok 6 # Blast or env variables not installed correctly ok 7 # Blast or env variables not installed correctly ok 8 # Blast or env variables not installed correctly ok 9 # Blast or env variables not installed correctly ok 10 # Blast or env variables not installed correctly ok 11 # Blast or env variables not installed correctly ok 12 # Blast or env variables not installed correctly ok 13 # Blast or env variables not installed correctly ok 14 # Blast or env variables not installed correctly ok 15 # Blast or env variables not installed correctly ok 16 # Blast or env variables not installed correctly ok t/StructIO.t ................. 1..9 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/Structure.t ................ 1..52 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 46. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 46. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 46. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 46. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 46. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 46. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 46. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 46. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 46. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 46. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 46. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 46. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 48. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 48. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 48. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 48. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 48. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 48. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 48. t/Swiss.t .................... 1..5 ok 1 ok 2 ok 3 ok 4 ok 5 ok t/Symbol.t ................... 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Taxonomy.t ................. 1..8 ok 1 ok 2 # Skip to avoid blocking ok 3 # Skip to avoid blocking ok 4 # Skip to avoid blocking ok 5 # Skip to avoid blocking ok 6 # Skip to avoid blocking ok 7 # Skip to avoid blocking ok 8 # Skip to avoid blocking ok t/Tempfile.t ................. 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok Useless localization of scalar assignment at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Root/Object.pm line 699. Constant subroutine Bio::Ontology::Term::TRUE redefined at C:/cpanfly-5.12/var/megalib/constant.pm line 131. Constant subroutine Bio::Ontology::Term::FALSE redefined at C:/cpanfly-5.12/var/megalib/constant.pm line 131. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 142. Subroutine init redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 190. Subroutine identifier redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 221. Subroutine name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 243. Subroutine definition redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 266. Subroutine ontology redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 292. Subroutine version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 323. Subroutine is_obsolete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 344. Subroutine comment redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 367. Subroutine get_synonyms redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 387. Subroutine add_synonym redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 407. Subroutine remove_synonyms redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 431. Subroutine get_dblinks redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 450. Subroutine add_dblink redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 471. Subroutine remove_dblinks redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 495. Subroutine get_references redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 515. Subroutine add_reference redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 531. Subroutine remove_references redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 551. Subroutine get_secondary_ids redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 572. Subroutine add_secondary_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 592. Subroutine remove_secondary_ids redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 616. Subroutine _is_true_or_false redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 630. Subroutine object_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 655. Subroutine authority redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 676. Subroutine namespace redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 705. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 729. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 753. Subroutine category redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 779. Subroutine Bio::Ontology::Term::each_synonym redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 805. Subroutine Bio::Ontology::Term::add_synonyms redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 806. Subroutine Bio::Ontology::Term::each_dblink redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 807. Subroutine Bio::Ontology::Term::add_dblinks redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Ontology\Term.pm line 808. t/Term.t ..................... 1..51 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Tools.t .................... 1..8 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 93. Subroutine nodelete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 120. Subroutine get_nodes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 137. Subroutine get_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 173. Subroutine set_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 188. Subroutine total_branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 212. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 234. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 255. Subroutine cleanup_tree redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 292. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 99. Subroutine DESTROY redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 108. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 123. Subroutine nhx_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 149. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 101, line 1. Subroutine add_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 153, line 1. Subroutine each_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 189, line 1. Subroutine remove_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 225, line 1. Subroutine remove_all_Descendents redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 272, line 1. Subroutine ancestor redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 306, line 1. Subroutine branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 323, line 1. Subroutine bootstrap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 348, line 1. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 370, line 1. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 395, line 1. Subroutine internal_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 419, line 1. Subroutine _creation_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 435, line 1. Subroutine is_Leaf redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 456, line 1. Subroutine height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 482, line 1. Subroutine invalidate_height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 515, line 1. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 536, line 1. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 556, line 1. Subroutine remove_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 577, line 1. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 594, line 1. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 610, line 1. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 626, line 1. Subroutine node_cleanup redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 631, line 1. t/Tree.t ..................... 1..22 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 93. Subroutine nodelete redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 120. Subroutine get_nodes redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 137. Subroutine get_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 173. Subroutine set_root_node redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 188. Subroutine total_branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 212. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 234. Subroutine score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 255. Subroutine cleanup_tree redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Tree.pm line 292. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 101. Subroutine add_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 153. Subroutine each_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 189. Subroutine remove_Descendent redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 225. Subroutine remove_all_Descendents redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 272. Subroutine ancestor redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 306. Subroutine branch_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 323. Subroutine bootstrap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 348. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 370. Subroutine id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 395. Subroutine internal_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 419. Subroutine _creation_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 435. Subroutine is_Leaf redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 456. Subroutine height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 482. Subroutine invalidate_height redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 515. Subroutine add_tag_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 536. Subroutine remove_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 556. Subroutine remove_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 577. Subroutine get_all_tags redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 594. Subroutine get_tag_values redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 610. Subroutine has_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 626. Subroutine node_cleanup redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\Node.pm line 631. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 99, line 1. Subroutine DESTROY redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 108, line 1. Subroutine to_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 123, line 1. Subroutine nhx_tag redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Tree\NodeNHX.pm line 149, line 1. t/TreeIO.t ................... 1..41 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 # skipping SVG::Graph output, verbosity flag too low ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 All 41 subtests passed t/trim.t ..................... 1..7 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok Replacement list is longer than search list at Bio/Perl.pm line 548. Replacement list is longer than search list at Bio/Perl.pm line 615. Use of uninitialized value $opt in uc at Bio/Restriction/Analysis.pm line 359, line 532. Use of uninitialized value $location in lc at Bio/DB/SwissProt.pm line 368. Use of uninitialized value $au in substitution (s///) at Bio\SeqIO\swiss.pm line 855, line 137. Subroutine new redefined at Bio\Location\Simple.pm line 89, line 555. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 555. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 555. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 555. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 555. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 555. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 555. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 160. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 239. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 259. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 286. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 304. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 324. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 345. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 366. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 388. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 411. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 433. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 454. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 469. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 486. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 501. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 543. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 556. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 573. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 590. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 608. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 628. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 649. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 658. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 667. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 684. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 705. Subroutine new redefined at Bio/Search/Hit/GenericHit.pm line 116. Subroutine add_hsp redefined at Bio/Search/Hit/GenericHit.pm line 175. Subroutine name redefined at Bio/Search/Hit/GenericHit.pm line 202. Subroutine accession redefined at Bio/Search/Hit/GenericHit.pm line 222. Subroutine description redefined at Bio/Search/Hit/GenericHit.pm line 242. Subroutine length redefined at Bio/Search/Hit/GenericHit.pm line 262. Subroutine algorithm redefined at Bio/Search/Hit/GenericHit.pm line 287. Subroutine raw_score redefined at Bio/Search/Hit/GenericHit.pm line 309. Subroutine score redefined at Bio/Search/Hit/GenericHit.pm line 325. Subroutine significance redefined at Bio/Search/Hit/GenericHit.pm line 340. Subroutine bits redefined at Bio/Search/Hit/GenericHit.pm line 371. Subroutine next_hsp redefined at Bio/Search/Hit/GenericHit.pm line 399. Subroutine hsps redefined at Bio/Search/Hit/GenericHit.pm line 425. Subroutine num_hsps redefined at Bio/Search/Hit/GenericHit.pm line 454. Subroutine rewind redefined at Bio/Search/Hit/GenericHit.pm line 475. Subroutine ambiguous_aln redefined at Bio/Search/Hit/GenericHit.pm line 502. Subroutine overlap redefined at Bio/Search/Hit/GenericHit.pm line 516. Subroutine n redefined at Bio/Search/Hit/GenericHit.pm line 547. Subroutine p redefined at Bio/Search/Hit/GenericHit.pm line 596. Subroutine hsp redefined at Bio/Search/Hit/GenericHit.pm line 640. Subroutine logical_length redefined at Bio/Search/Hit/GenericHit.pm line 680. Subroutine length_aln redefined at Bio/Search/Hit/GenericHit.pm line 733. Subroutine gaps redefined at Bio/Search/Hit/GenericHit.pm line 791. Subroutine matches redefined at Bio/Search/Hit/GenericHit.pm line 825. Subroutine start redefined at Bio/Search/Hit/GenericHit.pm line 883. Subroutine end redefined at Bio/Search/Hit/GenericHit.pm line 941. Subroutine range redefined at Bio/Search/Hit/GenericHit.pm line 985. Subroutine frac_identical redefined at Bio/Search/Hit/GenericHit.pm line 1032. Subroutine frac_conserved redefined at Bio/Search/Hit/GenericHit.pm line 1092. Subroutine frac_aligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1141. Subroutine frac_aligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1177. Subroutine num_unaligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1226. Subroutine num_unaligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1258. Subroutine seq_inds redefined at Bio/Search/Hit/GenericHit.pm line 1296. Subroutine strand redefined at Bio/Search/Hit/GenericHit.pm line 1329. Subroutine frame redefined at Bio/Search/Hit/GenericHit.pm line 1387. Subroutine rank redefined at Bio/Search/Hit/GenericHit.pm line 1421. Subroutine locus redefined at Bio/Search/Hit/GenericHit.pm line 1437. Subroutine each_accession_number redefined at Bio/Search/Hit/GenericHit.pm line 1465. Subroutine tiled_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1513. Subroutine query_length redefined at Bio/Search/Hit/GenericHit.pm line 1530. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1202. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 77, line 90. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 114, line 90. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 130, line 90. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 146, line 90. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 162, line 90. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 182, line 90. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 162, line 32. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 374, line 32. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 396, line 32. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 415, line 32. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 419, line 32. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 442, line 32. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 480, line 32. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 508, line 32. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 533, line 32. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 557, line 32. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 583, line 32. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 613, line 32. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 645, line 32. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 676, line 32. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 744, line 32. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 790, line 32. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 809, line 32. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 827, line 32. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 865, line 32. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1000, line 32. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1102, line 32. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1115, line 32. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1147, line 32. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1204, line 32. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1226, line 32. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1258, line 32. Subroutine new redefined at Bio\Location\Fuzzy.pm line 137, line 38. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 164, line 38. Subroutine start redefined at Bio\Location\Fuzzy.pm line 226, line 38. Subroutine end redefined at Bio\Location\Fuzzy.pm line 251, line 38. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 276, line 38. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 295, line 38. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 315, line 38. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 344, line 38. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 363, line 38. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 383, line 38. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 450, line 38. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 537, line 38. Subroutine new redefined at Bio\Location\Split.pm line 90, line 74. Subroutine each_Location redefined at Bio\Location\Split.pm line 122, line 74. Subroutine sub_Location redefined at Bio\Location\Split.pm line 151, line 74. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 214, line 74. Subroutine splittype redefined at Bio\Location\Split.pm line 238, line 74. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 266, line 74. Subroutine strand redefined at Bio\Location\Split.pm line 301, line 74. Subroutine start redefined at Bio\Location\Split.pm line 341, line 74. Subroutine end redefined at Bio\Location\Split.pm line 359, line 74. Subroutine min_start redefined at Bio\Location\Split.pm line 377, line 74. Subroutine max_start redefined at Bio\Location\Split.pm line 398, line 74. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 420, line 74. Subroutine min_end redefined at Bio\Location\Split.pm line 440, line 74. Subroutine max_end redefined at Bio\Location\Split.pm line 462, line 74. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 485, line 74. Subroutine seq_id redefined at Bio\Location\Split.pm line 510, line 74. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 556, line 74. Replacement list is longer than search list at Bio/Range.pm line 190. Use of uninitialized value $type in lc at Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at Bio\Location\Split.pm line 104, line 934. Use of uninitialized value $type in lc at Bio\Location\Split.pm line 104, line 934. Use of uninitialized value in print at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/bptutorial.pl line 4042, line 934. Subroutine new redefined at Bio\Tree\Tree.pm line 93. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 120. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 137. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 173. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 188. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 212. Subroutine id redefined at Bio\Tree\Tree.pm line 234. Subroutine score redefined at Bio\Tree\Tree.pm line 255. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 292. Subroutine new redefined at Bio\Tree\Node.pm line 101. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 153. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 189. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 225. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 272. Subroutine ancestor redefined at Bio\Tree\Node.pm line 306. Subroutine branch_length redefined at Bio\Tree\Node.pm line 323. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 348. Subroutine description redefined at Bio\Tree\Node.pm line 370. Subroutine id redefined at Bio\Tree\Node.pm line 395. Subroutine internal_id redefined at Bio\Tree\Node.pm line 419. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 435. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 456. Subroutine height redefined at Bio\Tree\Node.pm line 482. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 515. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 536. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 556. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 577. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 594. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 610. Subroutine has_tag redefined at Bio\Tree\Node.pm line 626. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 631. t/tutorial.t ................. 1..21 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 162. Subroutine algorithm redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 374. Subroutine pvalue redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 396. Subroutine evalue redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 415. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 419. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 442. Subroutine frac_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 480. Subroutine gaps redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 508. Subroutine query_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 533. Subroutine hit_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 557. Subroutine homology_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 583. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 613. Subroutine hsp_length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 645. Subroutine frame redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 676. Subroutine get_aln redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 744. Subroutine num_conserved redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 790. Subroutine num_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 809. Subroutine rank redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 827. Subroutine seq_inds redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 865. Subroutine _calculate_seq_positions redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1000. Subroutine n redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1102. Subroutine range redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1115. Subroutine links redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1147. Subroutine cigar_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1204. Subroutine generate_cigar_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1226. Subroutine _sub_cigar_string redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Search/HSP/GenericHSP.pm line 1258. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 77, line 1. Subroutine significance redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 114, line 1. Subroutine bits redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 130, line 1. Subroutine frac_identical redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 146, line 1. Subroutine seqlength redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 162, line 1. Subroutine seqdesc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\SeqFeature\Similarity.pm line 182, line 1. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 1. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 1. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 1. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 1. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 1. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 1. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 1. t/UCSCParsers.t .............. 1..38 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 106. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 106. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 106. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 106. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 106. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 106. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 106. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 117. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 117. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 117. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 117. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 117. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 117. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 117. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 117. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 117. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 117. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 117. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 117. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 117. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 117. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 117. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 117. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 117. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 137, line 2111. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 164, line 2111. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 226, line 2111. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 251, line 2111. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 276, line 2111. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 295, line 2111. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 315, line 2111. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 344, line 2111. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 363, line 2111. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 383, line 2111. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 450, line 2111. Subroutine _fuzzypointdecode redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Fuzzy.pm line 537, line 2111. t/Unflattener.t .............. 1..6 ok 1 ok 2 TOP:58 source ? gene ? mRNA CG4491-RA CDS CG4491-PA gene ? tRNA tRNA-Pro gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? mRNA CG4218-RA CDS CG4218-PA gene ? mRNA CG3473-RA CDS CG3473-PA gene ? tRNA tRNA-Pro gene ? tRNA tRNA-Pro gene ? tRNA tRNA-Pro gene ? mRNA CG3479-RA CDS CG3479-PA gene ? mRNA CG32954-RA mRNA CG32954-RC mRNA CG32954-RH mRNA CG32954-RG mRNA CG32954-RB mRNA CG32954-RD mRNA CG32954-RE mRNA CG32954-RF CDS CG32954-PA CDS CG32954-PB CDS CG32954-PD CDS CG32954-PF CDS CG32954-PG CDS CG32954-PH CDS CG32954-PC CDS CG32954-PE gene ? repeat_region ? gene ? repeat_region ? gene ? mRNA CG15282-RA CDS CG15282-PA gene ? mRNA CG12636-RA CDS CG12636-PA GROUPS: GROUP []:source GROUP [CG4491]:gene mRNA CDS GROUP [CR31985]:gene tRNA GROUP [CR31977]:gene tRNA GROUP [CR31978]:gene tRNA GROUP [CR31982]:gene tRNA GROUP [CR31981]:gene tRNA GROUP [CR31980]:gene tRNA GROUP [CG4218]:gene mRNA CDS GROUP [CG3473]:gene mRNA CDS GROUP [CR31983]:gene tRNA GROUP [CR31979]:gene tRNA GROUP [CR31984]:gene tRNA GROUP [CG3479]:gene mRNA CDS GROUP [CG32954]:gene mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA CDS CDS CDS CDS CDS CDS CDS CDS GROUP [TE19174]:gene GROUP []:repeat_region GROUP [TE19175]:gene GROUP []:repeat_region GROUP [CG15282]:gene mRNA CDS GROUP [CG12636]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:source UNFLATTENING GROUP: GROUP [noc]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP [BG:DS04641.8]:gene mRNA CDS UNFLATTENING GROUP: GROUP [BG:DS01486.1]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP [osp]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:gene mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA CDS CDS CDS CDS CDS CDS CDS CDS Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145378 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145378 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145378 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145378 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145378 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145378 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (145686 145752 146156 146227) Checking containment:[1] (145686 145752 146156 146227) IN (145686 145752 146156 146227) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[] (145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[] (144892 145378 145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[] (144892 145552 145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[] (145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[1] (144892 145552 145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[] (145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[] (144892 145378 145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[] (144892 145552 145686 145752 146156 146227) IN (146892 147319 147723 147775) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[1] (145686 145752 146156 146227 146892 147319 147723 147775) IN (146892 147319 147723 147775) Checking containment:[] (145686 145752 146156 146227) IN (146892 147319 147723 147775) UNRESOLVED PAIRS: PAIR: AAF53404.1 => CG32954-RD (of 4) PAIR: AAF53404.1 => CG32954-RA (of 4) PAIR: AAF53404.1 => CG32954-RC (of 4) PAIR: AAF53404.1 => CG32954-RE (of 4) PAIR: AAO41197.1 => CG32954-RD (of 8) PAIR: AAO41197.1 => CG32954-RB (of 8) PAIR: AAO41197.1 => CG32954-RA (of 8) PAIR: AAO41197.1 => CG32954-RF (of 8) PAIR: AAO41197.1 => CG32954-RC (of 8) PAIR: AAO41197.1 => CG32954-RE (of 8) PAIR: AAO41197.1 => CG32954-RH (of 8) PAIR: AAO41197.1 => CG32954-RG (of 8) PAIR: AAF53403.1 => CG32954-RD (of 8) PAIR: AAF53403.1 => CG32954-RB (of 8) PAIR: AAF53403.1 => CG32954-RA (of 8) PAIR: AAF53403.1 => CG32954-RF (of 8) PAIR: AAF53403.1 => CG32954-RC (of 8) PAIR: AAF53403.1 => CG32954-RH (of 8) PAIR: AAF53403.1 => CG32954-RE (of 8) PAIR: AAF53403.1 => CG32954-RG (of 8) PAIR: AAO41198.1 => CG32954-RD (of 8) PAIR: AAO41198.1 => CG32954-RB (of 8) PAIR: AAO41198.1 => CG32954-RA (of 8) PAIR: AAO41198.1 => CG32954-RF (of 8) PAIR: AAO41198.1 => CG32954-RC (of 8) PAIR: AAO41198.1 => CG32954-RE (of 8) PAIR: AAO41198.1 => CG32954-RH (of 8) PAIR: AAO41198.1 => CG32954-RG (of 8) PAIR: AAO41200.1 => CG32954-RD (of 8) PAIR: AAO41200.1 => CG32954-RB (of 8) PAIR: AAO41200.1 => CG32954-RA (of 8) PAIR: AAO41200.1 => CG32954-RF (of 8) PAIR: AAO41200.1 => CG32954-RC (of 8) PAIR: AAO41200.1 => CG32954-RE (of 8) PAIR: AAO41200.1 => CG32954-RH (of 8) PAIR: AAO41200.1 => CG32954-RG (of 8) PAIR: AAO41201.1 => CG32954-RD (of 8) PAIR: AAO41201.1 => CG32954-RB (of 8) PAIR: AAO41201.1 => CG32954-RA (of 8) PAIR: AAO41201.1 => CG32954-RF (of 8) PAIR: AAO41201.1 => CG32954-RC (of 8) PAIR: AAO41201.1 => CG32954-RE (of 8) PAIR: AAO41201.1 => CG32954-RH (of 8) PAIR: AAO41201.1 => CG32954-RG (of 8) PAIR: AAO41202.1 => CG32954-RD (of 4) PAIR: AAO41202.1 => CG32954-RA (of 4) PAIR: AAO41202.1 => CG32954-RC (of 4) PAIR: AAO41202.1 => CG32954-RE (of 4) PAIR: AAO41199.1 => CG32954-RD (of 8) PAIR: AAO41199.1 => CG32954-RB (of 8) PAIR: AAO41199.1 => CG32954-RA (of 8) PAIR: AAO41199.1 => CG32954-RF (of 8) PAIR: AAO41199.1 => CG32954-RC (of 8) PAIR: AAO41199.1 => CG32954-RE (of 8) PAIR: AAO41199.1 => CG32954-RH (of 8) PAIR: AAO41199.1 => CG32954-RG (of 8) find_best_matches: (/0) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/1) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/2) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/3) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/4) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/5) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/6) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/7) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] find_best_matches: (/8) Bio::SeqFeature::Generic=HASH(0x30395e4) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x303474c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3032934) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3034afc) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x303525c) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039234) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] Bio::SeqFeature::Generic=HASH(0x3039994) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6] Bio::SeqFeature::Generic=HASH(0x3034eac) : [Bio::SeqFeature::Generic=HASH(0x3031cd4) 0.6]; [Bio::SeqFeature::Generic=HASH(0x30319e4) 0.75]; [Bio::SeqFeature::Generic=HASH(0x30270fc) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3031ef4) 1]; [Bio::SeqFeature::Generic=HASH(0x3026f8c) 0.5]; [Bio::SeqFeature::Generic=HASH(0x3032034) 0.6]; [Bio::SeqFeature::Generic=HASH(0x302704c) 1]; [Bio::SeqFeature::Generic=HASH(0x302d68c) 0.75] resolved pair Bio::SeqFeature::Generic=HASH(0x3039994) Bio::SeqFeature::Generic=HASH(0x3031cd4) resolved pair Bio::SeqFeature::Generic=HASH(0x30395e4) Bio::SeqFeature::Generic=HASH(0x3032034) resolved pair Bio::SeqFeature::Generic=HASH(0x3039234) Bio::SeqFeature::Generic=HASH(0x3031ef4) resolved pair Bio::SeqFeature::Generic=HASH(0x3032934) Bio::SeqFeature::Generic=HASH(0x302704c) resolved pair Bio::SeqFeature::Generic=HASH(0x303474c) Bio::SeqFeature::Generic=HASH(0x30319e4) resolved pair Bio::SeqFeature::Generic=HASH(0x3034afc) Bio::SeqFeature::Generic=HASH(0x302d68c) resolved pair Bio::SeqFeature::Generic=HASH(0x303525c) Bio::SeqFeature::Generic=HASH(0x30270fc) resolved pair Bio::SeqFeature::Generic=HASH(0x3034eac) Bio::SeqFeature::Generic=HASH(0x3026f8c) UNFLATTENING GROUP: GROUP []:gene UNFLATTENING GROUP: GROUP []:repeat_region UNFLATTENING GROUP: GROUP []:gene UNFLATTENING GROUP: GROUP []:repeat_region UNFLATTENING GROUP: GROUP [BG:DS07721.3]:gene mRNA CDS UNFLATTENING GROUP: GROUP [BG:DS07721.6]:gene mRNA CDS POST PROCESSING: source ? gene ? mRNA CG4491-RA CDS CG4491-PA gene ? tRNA tRNA-Pro gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? tRNA tRNA-Gly gene ? mRNA CG4218-RA CDS CG4218-PA gene ? mRNA CG3473-RA CDS CG3473-PA gene ? tRNA tRNA-Pro gene ? tRNA tRNA-Pro gene ? tRNA tRNA-Pro gene ? mRNA CG3479-RA CDS CG3479-PA gene ? mRNA CG32954-RA CDS CG32954-PG mRNA CG32954-RC CDS CG32954-PF mRNA CG32954-RH CDS CG32954-PA mRNA CG32954-RG CDS CG32954-PD mRNA CG32954-RB CDS CG32954-PB mRNA CG32954-RD CDS CG32954-PE mRNA CG32954-RE CDS CG32954-PC mRNA CG32954-RF CDS CG32954-PH gene ? repeat_region ? gene ? repeat_region ? gene ? mRNA CG15282-RA CDS CG15282-PA gene ? mRNA CG12636-RA CDS CG12636-PA PROCESSED:21 ok 3 GROUPS: GROUP []:source GROUP [CG4491]:gene mRNA CDS GROUP [CR31985]:gene tRNA GROUP [CR31977]:gene tRNA GROUP [CR31978]:gene tRNA GROUP [CR31982]:gene tRNA GROUP [CR31981]:gene tRNA GROUP [CR31980]:gene tRNA GROUP [CG4218]:gene mRNA CDS GROUP [CG3473]:gene mRNA CDS GROUP [CR31983]:gene tRNA GROUP [CR31979]:gene tRNA GROUP [CR31984]:gene tRNA GROUP [CG3479]:gene mRNA CDS GROUP [CG32954]:gene mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA CDS CDS CDS CDS CDS CDS CDS CDS GROUP [TE19174]:gene GROUP []:repeat_region GROUP [TE19175]:gene GROUP []:repeat_region GROUP [CG15282]:gene mRNA CDS GROUP [CG12636]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:source UNFLATTENING GROUP: GROUP [noc]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP [BG:DS04641.8]:gene mRNA CDS UNFLATTENING GROUP: GROUP [BG:DS01486.1]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP []:gene tRNA UNFLATTENING GROUP: GROUP [osp]:gene mRNA CDS UNFLATTENING GROUP: GROUP []:gene mRNA mRNA mRNA mRNA mRNA mRNA mRNA mRNA CDS CDS CDS CDS CDS CDS CDS CDS UNRESOLVED PAIRS: PAIR: AAO41200.1 => CG32954-RG (of 1) PAIR: AAO41199.1 => CG32954-RF (of 1) PAIR: AAO41198.1 => CG32954-RD (of 1) PAIR: AAO41201.1 => CG32954-RH (of 1) PAIR: AAO41202.1 => CG32954-RE (of 1) PAIR: AAF53404.1 => CG32954-RC (of 1) PAIR: AAF53403.1 => CG32954-RA (of 1) PAIR: AAO41197.1 => CG32954-RB (of 1) find_best_matches: (/0) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/1) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/2) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/3) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/4) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/5) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/6) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/7) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] find_best_matches: (/8) Bio::SeqFeature::Generic=HASH(0x306dc8c) : [Bio::SeqFeature::Generic=HASH(0x3059d64) 0] Bio::SeqFeature::Generic=HASH(0x306d8dc) : [Bio::SeqFeature::Generic=HASH(0x3067b14) 0] Bio::SeqFeature::Generic=HASH(0x306d52c) : [Bio::SeqFeature::Generic=HASH(0x30678f4) 0] Bio::SeqFeature::Generic=HASH(0x306e03c) : [Bio::SeqFeature::Generic=HASH(0x3056614) 0] Bio::SeqFeature::Generic=HASH(0x30705a4) : [Bio::SeqFeature::Generic=HASH(0x3067c54) 0] Bio::SeqFeature::Generic=HASH(0x30701f4) : [Bio::SeqFeature::Generic=HASH(0x3053b5c) 0] Bio::SeqFeature::Generic=HASH(0x3068564) : [Bio::SeqFeature::Generic=HASH(0x30564e4) 0] Bio::SeqFeature::Generic=HASH(0x306d17c) : [Bio::SeqFeature::Generic=HASH(0x305a734) 0] resolved pair Bio::SeqFeature::Generic=HASH(0x30701f4) Bio::SeqFeature::Generic=HASH(0x3053b5c) resolved pair Bio::SeqFeature::Generic=HASH(0x306d52c) Bio::SeqFeature::Generic=HASH(0x30678f4) resolved pair Bio::SeqFeature::Generic=HASH(0x306d8dc) Bio::SeqFeature::Generic=HASH(0x3067b14) resolved pair Bio::SeqFeature::Generic=HASH(0x306dc8c) Bio::SeqFeature::Generic=HASH(0x3059d64) resolved pair Bio::SeqFeature::Generic=HASH(0x306e03c) Bio::SeqFeature::Generic=HASH(0x3056614) resolved pair Bio::SeqFeature::Generic=HASH(0x3068564) Bio::SeqFeature::Generic=HASH(0x30564e4) resolved pair Bio::SeqFeature::Generic=HASH(0x30705a4) Bio::SeqFeature::Generic=HASH(0x3067c54) resolved pair Bio::SeqFeature::Generic=HASH(0x306d17c) Bio::SeqFeature::Generic=HASH(0x305a734) UNFLATTENING GROUP: GROUP []:gene UNFLATTENING GROUP: GROUP []:repeat_region UNFLATTENING GROUP: GROUP []:gene UNFLATTENING GROUP: GROUP []:repeat_region UNFLATTENING GROUP: GROUP [BG:DS07721.3]:gene mRNA CDS UNFLATTENING GROUP: GROUP [BG:DS07721.6]:gene mRNA CDS POST PROCESSING: source ? gene ? mRNA CG4491-RA CDS CG4491-PA exon ? exon ? gene ? tRNA tRNA-Pro exon ? gene ? tRNA tRNA-Gly exon ? gene ? tRNA tRNA-Gly exon ? gene ? tRNA tRNA-Gly exon ? gene ? tRNA tRNA-Gly exon ? gene ? tRNA tRNA-Gly exon ? gene ? mRNA CG4218-RA CDS CG4218-PA exon ? exon ? exon ? gene ? mRNA CG3473-RA CDS CG3473-PA exon ? gene ? tRNA tRNA-Pro exon ? gene ? tRNA tRNA-Pro exon ? gene ? tRNA tRNA-Pro exon ? gene ? mRNA CG3479-RA CDS CG3479-PA exon ? exon ? exon ? exon ? exon ? exon ? exon ? exon ? exon ? exon ? exon ? gene ? mRNA CG32954-RA CDS CG32954-PA exon ? exon ? exon ? exon ? exon ? exon ? mRNA CG32954-RC CDS CG32954-PC exon ? exon ? exon ? exon ? exon ? exon ? mRNA CG32954-RH CDS CG32954-PH exon ? exon ? exon ? mRNA CG32954-RG CDS CG32954-PG exon ? exon ? exon ? exon ? mRNA CG32954-RB CDS CG32954-PB exon ? exon ? exon ? exon ? mRNA CG32954-RD CDS CG32954-PD exon ? exon ? exon ? exon ? exon ? mRNA CG32954-RE CDS CG32954-PE exon ? exon ? exon ? exon ? exon ? mRNA CG32954-RF CDS CG32954-PF exon ? exon ? exon ? gene ? repeat_region ? gene ? repeat_region ? gene ? mRNA CG15282-RA CDS CG15282-PA exon ? exon ? gene ? mRNA CG12636-RA CDS CG12636-PA exon ? exon ? exon ? exon ? exon ? PROCESSED2:21 ok 4 GROUPS: GROUP []:source GROUP [thrA]:gene CDS GROUP [thrB]:gene CDS GROUP [thrC]:gene CDS GROUP []:CDS GROUP []:CDS GROUP [yaaA]:gene CDS GROUP [yaaJ]:gene CDS GROUP [talB]:gene CDS GROUP [chlG]:gene CDS GROUP []:CDS GROUP [htgA]:gene misc_feature GROUP [yaaI]:gene misc_feature GROUP [dnaK]:gene CDS GROUP [dnaJ]:gene CDS GROUP [gef]:gene CDS GROUP [ant]:gene CDS GROUP [antO]:gene misc_feature GROUP [rpsT]:gene CDS GROUP [yaaC]:gene CDS GROUP [ileS]:gene CDS GROUP [lspA]:gene CDS GROUP [yaaD]:gene CDS GROUP [lytB]:gene CDS GROUP [yaaF]:gene CDS GROUP [dapB]:gene CDS GROUP [carA]:gene CDS GROUP [carB]:gene CDS GROUP [yaaV]:gene CDS GROUP [caiF]:gene misc_feature GROUP [caiE]:gene CDS GROUP [caiD]:gene CDS GROUP [caiC]:gene CDS GROUP [caiB]:gene CDS GROUP [caiA]:gene CDS GROUP [caiT]:gene CDS GROUP [fixA]:gene CDS GROUP [fixB]:gene misc_feature GROUP [fixC]:gene CDS GROUP [yaaT]:gene CDS GROUP [yaaU]:gene misc_feature GROUP [yabE]:gene CDS GROUP [yabF]:gene CDS GROUP [kefC]:gene CDS GROUP [folA]:gene CDS GROUP [apaH]:gene CDS GROUP [apaG]:gene CDS GROUP [pdxA]:gene CDS GROUP []:CDS GROUP [surA]:gene CDS GROUP [imp]:gene CDS GROUP [yabH]:gene CDS GROUP [yabP]:gene CDS GROUP [yabQ]:gene CDS GROUP [yabO]:gene misc_feature GROUP []:CDS GROUP [hepA]:gene CDS GROUP []:CDS GROUP []:CDS GROUP [araD]:gene CDS GROUP [araA]:gene CDS GROUP [araB]:gene CDS GROUP [araC]:gene CDS GROUP [yabI]:gene CDS GROUP [yabJ]:gene CDS GROUP [yabK]:gene CDS GROUP [tbpA]:gene CDS GROUP [yabN]:gene CDS GROUP [yabM]:gene CDS GROUP [leuD]:gene CDS GROUP [leuC]:gene CDS GROUP [leuB]:gene CDS GROUP [leuA]:gene CDS GROUP [leuLP]:gene CDS GROUP [lueO]:gene CDS GROUP [ilvI]:gene CDS GROUP [brnP]:gene CDS GROUP [fruR]:gene CDS GROUP [yabB]:gene CDS GROUP [yabC]:gene CDS GROUP [ftsL]:gene CDS GROUP [ftsI]:gene CDS GROUP [murE]:gene CDS GROUP [mra]:gene CDS GROUP [mraY]:gene CDS GROUP [murD]:gene CDS GROUP [ftsW]:gene CDS GROUP [murG]:gene CDS GROUP [murC]:gene CDS GROUP [ddl]:gene CDS GROUP [ftsQ]:gene CDS GROUP [divA]:gene CDS GROUP [ftsZ]:gene CDS GROUP [asmB]:gene CDS GROUP [yacA]:gene CDS GROUP [azi]:gene CDS GROUP [mutT]:gene CDS GROUP [yacG]:gene CDS UNFLATTENING GROUP: GROUP []:source UNFLATTENING GROUP: GROUP [thrA]:gene CDS UNFLATTENING GROUP: GROUP [thrB]:gene CDS UNFLATTENING GROUP: GROUP [thrC]:gene CDS UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP [yaaA]:gene CDS UNFLATTENING GROUP: GROUP [yaaJ]:gene CDS UNFLATTENING GROUP: GROUP [talB]:gene CDS UNFLATTENING GROUP: GROUP [chlG]:gene CDS UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP [htgA]:gene misc_feature UNFLATTENING GROUP: GROUP [yaaI]:gene misc_feature UNFLATTENING GROUP: GROUP [dnaK]:gene CDS UNFLATTENING GROUP: GROUP [dnaJ]:gene CDS UNFLATTENING GROUP: GROUP [gef]:gene CDS UNFLATTENING GROUP: GROUP [ant]:gene CDS UNFLATTENING GROUP: GROUP [antO]:gene misc_feature UNFLATTENING GROUP: GROUP [rpsT]:gene CDS UNFLATTENING GROUP: GROUP [yaaC]:gene CDS UNFLATTENING GROUP: GROUP [ileS]:gene CDS UNFLATTENING GROUP: GROUP [lspA]:gene CDS UNFLATTENING GROUP: GROUP [yaaD]:gene CDS UNFLATTENING GROUP: GROUP [lytB]:gene CDS UNFLATTENING GROUP: GROUP [yaaF]:gene CDS UNFLATTENING GROUP: GROUP [dapB]:gene CDS UNFLATTENING GROUP: GROUP [carA]:gene CDS UNFLATTENING GROUP: GROUP [carB]:gene CDS UNFLATTENING GROUP: GROUP [yaaV]:gene CDS UNFLATTENING GROUP: GROUP [caiF]:gene misc_feature UNFLATTENING GROUP: GROUP [caiE]:gene CDS UNFLATTENING GROUP: GROUP [caiD]:gene CDS UNFLATTENING GROUP: GROUP [caiC]:gene CDS UNFLATTENING GROUP: GROUP [caiB]:gene CDS UNFLATTENING GROUP: GROUP [caiA]:gene CDS UNFLATTENING GROUP: GROUP [caiT]:gene CDS UNFLATTENING GROUP: GROUP [fixA]:gene CDS UNFLATTENING GROUP: GROUP [fixB]:gene misc_feature UNFLATTENING GROUP: GROUP [fixC]:gene CDS UNFLATTENING GROUP: GROUP [yaaT]:gene CDS UNFLATTENING GROUP: GROUP [yaaU]:gene misc_feature UNFLATTENING GROUP: GROUP [yabE]:gene CDS UNFLATTENING GROUP: GROUP [yabF]:gene CDS UNFLATTENING GROUP: GROUP [kefC]:gene CDS UNFLATTENING GROUP: GROUP [folA]:gene CDS UNFLATTENING GROUP: GROUP [apaH]:gene CDS UNFLATTENING GROUP: GROUP [apaG]:gene CDS UNFLATTENING GROUP: GROUP [pdxA]:gene CDS UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP [surA]:gene CDS UNFLATTENING GROUP: GROUP [imp]:gene CDS UNFLATTENING GROUP: GROUP [yabH]:gene CDS UNFLATTENING GROUP: GROUP [yabP]:gene CDS UNFLATTENING GROUP: GROUP [yabQ]:gene CDS UNFLATTENING GROUP: GROUP [yabO]:gene misc_feature UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP [hepA]:gene CDS UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP []:CDS UNFLATTENING GROUP: GROUP [araD]:gene CDS UNFLATTENING GROUP: GROUP [araA]:gene CDS UNFLATTENING GROUP: GROUP [araB]:gene CDS UNFLATTENING GROUP: GROUP [araC]:gene CDS UNFLATTENING GROUP: GROUP [yabI]:gene CDS UNFLATTENING GROUP: GROUP [yabJ]:gene CDS UNFLATTENING GROUP: GROUP [yabK]:gene CDS UNFLATTENING GROUP: GROUP [tbpA]:gene CDS UNFLATTENING GROUP: GROUP [yabN]:gene CDS UNFLATTENING GROUP: GROUP [yabM]:gene CDS UNFLATTENING GROUP: GROUP [leuD]:gene CDS UNFLATTENING GROUP: GROUP [leuC]:gene CDS UNFLATTENING GROUP: GROUP [leuB]:gene CDS UNFLATTENING GROUP: GROUP [leuA]:gene CDS UNFLATTENING GROUP: GROUP [leuLP]:gene CDS UNFLATTENING GROUP: GROUP [lueO]:gene CDS UNFLATTENING GROUP: GROUP [ilvI]:gene CDS UNFLATTENING GROUP: GROUP [brnP]:gene CDS UNFLATTENING GROUP: GROUP [fruR]:gene CDS UNFLATTENING GROUP: GROUP [yabB]:gene CDS UNFLATTENING GROUP: GROUP [yabC]:gene CDS UNFLATTENING GROUP: GROUP [ftsL]:gene CDS UNFLATTENING GROUP: GROUP [ftsI]:gene CDS UNFLATTENING GROUP: GROUP [murE]:gene CDS UNFLATTENING GROUP: GROUP [mra]:gene CDS UNFLATTENING GROUP: GROUP [mraY]:gene CDS UNFLATTENING GROUP: GROUP [murD]:gene CDS UNFLATTENING GROUP: GROUP [ftsW]:gene CDS UNFLATTENING GROUP: GROUP [murG]:gene CDS UNFLATTENING GROUP: GROUP [murC]:gene CDS UNFLATTENING GROUP: GROUP [ddl]:gene CDS UNFLATTENING GROUP: GROUP [ftsQ]:gene CDS UNFLATTENING GROUP: GROUP [divA]:gene CDS UNFLATTENING GROUP: GROUP [ftsZ]:gene CDS UNFLATTENING GROUP: GROUP [asmB]:gene CDS UNFLATTENING GROUP: GROUP [yacA]:gene CDS UNFLATTENING GROUP: GROUP [azi]:gene CDS UNFLATTENING GROUP: GROUP [mutT]:gene CDS UNFLATTENING GROUP: GROUP [yacG]:gene CDS POST PROCESSING: source ? gene ? CDS ThrA bifunctional enzyme gene ? CDS Homoserine kinase (EC 2.7.1.39) gene ? CDS Threonine synthase (EC 4.2.99.2) CDS ? CDS ? gene ? CDS Hypothetical protein gene ? CDS Hypothetical 51.7 kd protein in thrC-talB intergenic region (ORF8). gene ? CDS Hypothetical protein gene ? CDS Molybdopterin biosynthesis Mog protein. CDS hgtA 5'-region hypothetical protein 1 gene ? misc_feature Heat shock protein Y gene ? misc_feature dnaK 5'-region hypothetical protein 1 gene ? CDS DnaK protein gene ? CDS DnaJ protein. gene ? CDS Gef protein gene ? CDS Na(+)/H(+) antiporter 1. gene ? misc_feature Transcriptional activator protein NhaR. gene ? CDS Ribosomal protein S20 gene ? CDS Hypothetical 35k protein (ileS-lsp operon) gene ? CDS Isoleucine--tRNA ligase (EC 6.1.1.5) gene ? CDS Lipoprotein signal peptidase (EC 3.4.23.36) (Prolipoprotein signal peptidase) (Signal peptidase II) (Spase II). gene ? CDS Hypothetical 16.4K protein (lsp-dapB intergenic region) gene ? CDS Hypothetical 34.8k protein (lsp-dapB intergenic region) gene ? CDS Hypothetical 32.6k protein (lsp-dapB intergenic region) gene ? CDS Dihydrodipicolinate reductase (EC 1.3.1.26). gene ? CDS Carbamoyl-phosphate synthase small chain (EC 6.3.5.5) (carbamoyl- phosphate synthetase glutamine chain). gene ? CDS Carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain gene ? CDS Hypothetical 6.8 kd protein in carB-caiE intergenic region. gene ? misc_feature Transcription activator caiF gene ? CDS Carnitine operon protein caiE. gene ? CDS Hypothetical protein. gene ? CDS Hypothetical protein. gene ? CDS L-carnitine dehydratase (EC 4.-.-.-). gene ? CDS Hypothetical protein. gene ? CDS Hypothetical protein. gene ? CDS FixA homolog. gene ? misc_feature FixB protein. gene ? CDS FixC protein gene ? CDS Hypothetical protein gene ? misc_feature Hypothetical 18.4 kd protein in fixC-kefC intergenic region (orf65). gene ? CDS Hypothetical protein gene ? CDS Hypothetical protein gene ? CDS Glutathione-regulated potassium-efflux system protein KefC (K(+)/H(+) antiporter). gene ? CDS Dihydrofolate reductase type I (EC 1.5.1.3). gene ? CDS Bis(5'-nucleosyl)-tetraphosphatase (symmetrical) (EC 3.6.1.41) gene ? CDS ApaG protein gene ? CDS PdxA protein CDS Hypothetical protein 98 (pdx 5' region) gene ? CDS Survival protein SurA precursor (peptidyl-prolyl cis-trans isomerase SurA) (EC 5.2.1.8) (PPiase) (rotamase C). gene ? CDS Organic solvent tolerance protein precursor. gene ? CDS Hypothetical 30.6 kd protein in folA-hepA intergenic region (orf81). gene ? CDS Hypothetical 5.9 kd protein in surA-hepA intergenic region. gene ? CDS Hypothetical 5.7 kd protein in surA-hepA intergenic region. gene ? misc_feature Hypothetical 24.9 kd protein in surA-hepA intergenic region. CDS ? gene ? CDS Probable ATP-dependent helicase HepA. CDS ? CDS ? gene ? CDS L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4). gene ? CDS L-arabinose isomerase (EC 5.3.1.4). gene ? CDS Ribulokinase (EC 2.7.1.16) gene ? CDS Arabinose operon regulatory protein gene ? CDS Hypothetical protein gene ? CDS Hypothetical protein gene ? CDS Hypothetical protein gene ? CDS Hypothetical protein. gene ? CDS Hypothetical 63.9 kd protein in tbpA-leuD intergenic region (orf103). gene ? CDS Hypothetical 42.7 kd protein in tbpA-leuD intergenic region (orf104). gene ? CDS Isopropylmalate isomerase subunit gene ? CDS 3-isopropylmalate dehydratase (EC 4.2.1.33) alpha chain gene ? CDS 3-isopropylmalate dehydrogenase (EC 1.1.1.85) (beta-ipm dehydrogenase) (imdH) (3-ipm-dh). gene ? CDS 2-Isopropylmalate synthase gene ? CDS LeuABCD leader peptide. gene ? CDS LeuO protein. gene ? CDS Acetolactate synthase (EC 4.1.3.18) III large chain. gene ? CDS Acetolactate synthase isozyme III small subunit (EC 4.1.3.18) (ahas- III) (acetohydroxy-acid synthase III small subunit) (als-III). gene ? CDS Pep-fructosephosphotransferase system repressor. gene ? CDS Hypothetical protein C. gene ? CDS Hypothetical 34.9 kd protein in fruR-ftsL intergenic region (orfB). gene ? CDS Cell division protein FtsL gene ? CDS Penicillin-binding protein 3 precursor. gene ? CDS UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase (EC 6.3.2.13) murE gene ? CDS UDP-n-acetylmuramoylalanyl-d-glutamyl-2, 6-diaminopimelate-d-alanyl -d- alanyl ligase (EC 6.3.2.15) (UDP-murnac-pentapeptide synthetase) (d-alanyl-d-alanine-adding enzyme). gene ? CDS Phospho-n-acetylmuramoyl-pentapeptide-transferas e (EC 2.7.8.13). gene ? CDS UDP-n-acetylmuramoylalanine-d-glutamate ligase (EC 6.3.2.9). gene ? CDS Cell division protein FtsW. gene ? CDS MurG protein. gene ? CDS UDP-n-acetylmuramate-alanine ligase (EC 6.3.2.8). gene ? CDS D-alanine-d-alanine ligase (EC 6.3.2.4) B. gene ? CDS Cell division protein FtsQ. gene ? CDS Cell division protein FtsA. gene ? CDS Cell division protein FtsZ. gene ? CDS Udp-3-o-[3-hydroxymyristoyl] n-acetylglucosamine deacetylase (EC 3.5.1.-) (EnvA protein). gene ? CDS Hypothetical 16k protein (eneA-secA intergenic region). gene ? CDS Preprotein translocase SecA subunit. gene ? CDS Mutator MutT (AT-GC transversion). gene ? CDS Hypothetical 5.8 kd protein in mutT-guaC intergenic region. PROCESSED:98 ok 5 GROUPS: GROUP []:source GROUP [ADH]:gene CDS GROUP []:polyA_signal GROUP []:polyA_site GROUP [ADHR]:gene CDS GROUP []:polyA_signal GROUP []:polyA_site UNFLATTENING GROUP: GROUP []:source UNFLATTENING GROUP: GROUP [ADH]:gene CDS UNFLATTENING GROUP: GROUP []:polyA_signal UNFLATTENING GROUP: GROUP []:polyA_site UNFLATTENING GROUP: GROUP [ADHR]:gene CDS UNFLATTENING GROUP: GROUP []:polyA_signal UNFLATTENING GROUP: GROUP []:polyA_site POST PROCESSING: source ? gene ? CDS alcohol dehydrogenase protein polyA_signal ? polyA_site ? gene ? CDS alcohol dehydrogenase related protein polyA_signal ? polyA_site ? PROCESSED:7 ok 6 ok Replacement list is longer than search list at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio/Range.pm line 190. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, line 31. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, line 31. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, line 31. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, line 31. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, line 31. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, line 31. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, line 31. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 90, line 52. Subroutine each_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 122, line 52. Subroutine sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 151, line 52. Subroutine add_sub_Location redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 214, line 52. Subroutine splittype redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 238, line 52. Subroutine is_single_sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 266, line 52. Subroutine strand redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 301, line 52. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 341, line 52. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 359, line 52. Subroutine min_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 377, line 52. Subroutine max_start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 398, line 52. Subroutine start_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 420, line 52. Subroutine min_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 440, line 52. Subroutine max_end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 462, line 52. Subroutine end_pos_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 485, line 52. Subroutine seq_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 510, line 52. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 556, line 52. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. Use of uninitialized value $type in lc at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Split.pm line 104. t/Unflattener2.t ............. 1..11 ok 1 ok 2 TOP:287 POST PROCESSING: source ? gene F14F8_10 mRNA ? CDS putative phytochelatin synthetase exon 1 exon 2 exon 3 exon 4 exon 5 gene F14F8_20 mRNA ? CDS putative mitochondrial carrier protein exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 gene F14F8_30 mRNA ? CDS reversibly glycosylated polypeptide-3 exon 1 exon 2 exon 3 exon 4 gene F14F8_40 mRNA ? CDS putative protein exon 1 exon 2 gene F14F8_50 mRNA ? CDS putative protein exon 1 exon 2 gene F14F8_60 mRNA ? CDS hypothetical protein exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 exon 7 exon 8 exon 9 exon 10 exon 11 exon 12 exon 13 exon 14 exon 15 exon 16 misc_feature ? gene F14F8_70 mRNA ? CDS putative protein exon 1 exon 2 gene F14F8_80 mRNA ? CDS DNA-directed RNA polymerase (mitochondrial) exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 exon 7 exon 8 exon 9 exon 10 exon 11 exon 12 exon 13 exon 14 exon 15 exon 16 exon 17 exon 18 exon 19 gene F14F8_90 mRNA ? CDS putative protein exon 1 gene F14F8_100 mRNA ? CDS putative protein exon 1 exon 2 exon 3 exon 4 exon 5 gene F14F8_110 mRNA ? CDS serine/threonine-specific protein kinase-like protein exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 gene F14F8_120 mRNA ? CDS putative protein exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 exon 7 exon 8 gene F14F8_130 mRNA ? CDS ribosomal protein-like exon 1 exon 2 exon 3 exon 4 gene F14F8_140 mRNA ? CDS ribosomal protein 3 precursor-like protein exon 1 exon 2 gene F14F8_150 mRNA ? CDS acetyltransferase-like protein exon 1 gene F14F8_160 mRNA ? CDS proline-rich protein exon 1 exon 2 gene F14F8_170 mRNA ? CDS putative protein exon 1 exon 2 exon 3 exon 4 gene F14F8_180 mRNA ? CDS MADS box protein AGL2 exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 exon 7 tRNA tRNA-Ile exon ? gene F14F8_190 mRNA ? CDS N2, N2-dimethylguanine tRNA methyltransferase-like protein exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 exon 7 exon 8 exon 9 exon 10 exon 11 exon 12 tRNA tRNA-Asp exon ? gene F14F8_200 mRNA ? CDS putative protein exon 1 gene F14F8_210 mRNA ? CDS bZIP DNA-binding protein-like exon 1 gene F14F8_220 mRNA ? CDS CONSTANS exon 1 exon 2 gene F14F8_230 mRNA ? CDS CONSTANS-like 1 exon 1 exon 2 gene F14F8_240 mRNA ? CDS Carboxylesterase-like protein exon 1 exon 2 exon 3 exon 4 exon 5 exon 6 exon 7 exon 8 exon 9 exon 10 PROCESSED/TOP:28 ok 3 ALL:202 ok 4 mRNAs:24 ok 5 TOP:16 TYPE:mRNA TYPE:mRNA TYPE:mRNA TYPE:mRNA POST PROCESSING: gene AnnIX mRNA AnnIX CDS AnnIX exon 1 exon 2 exon 3 exon 4 exon 5 mRNA AnnIX CDS AnnIX exon 1 exon 2 exon 3 exon 4 exon 6 PROCESSED/TOP:1 ok 6 ok 7 DISTINCT EXONS: 6 [6 4 1 3 2 5] ok 8 TOP:14 PROBLEM, SEVERITY==2 no containers possible for SeqFeature of type: CDS; this SF is being placed at root level SF [Bio::SeqFeature::Generic=HASH(0x2dad79c)]: CDS; l(2)gl; CG2671-PB PROBLEM, SEVERITY==2 no containers possible for SeqFeature of type: CDS; this SF is being placed at root level SF [Bio::SeqFeature::Generic=HASH(0x30a0a9c)]: CDS; l(2)gl; CG2671-PD PROBLEM, SEVERITY==2 no containers possible for SeqFeature of type: CDS; this SF is being placed at root level SF [Bio::SeqFeature::Generic=HASH(0x300938c)]: CDS; l(2)gl; CG2671-PE PROBLEM, SEVERITY==2 no containers possible for SeqFeature of type: CDS; this SF is being placed at root level SF [Bio::SeqFeature::Generic=HASH(0x30a0d2c)]: CDS; l(2)gl; CG2671-PF PROBLEM, SEVERITY==2 no containers possible for SeqFeature of type: CDS; this SF is being placed at root level SF [Bio::SeqFeature::Generic=HASH(0x3019684)]: CDS; l(2)gl; CG2671-PC PROBLEM, SEVERITY==2 no containers possible for SeqFeature of type: CDS; this SF is being placed at root level SF [Bio::SeqFeature::Generic=HASH(0x30ac134)]: CDS; l(2)gl; CG2671-PA POST PROCESSING: source ? gene l(2)gl mRNA l(2)gl exon ? CDS CG2671-PB mRNA l(2)gl exon ? CDS CG2671-PD mRNA l(2)gl exon ? CDS CG2671-PE mRNA l(2)gl exon ? CDS CG2671-PF mRNA l(2)gl exon ? CDS CG2671-PC mRNA l(2)gl exon ? CDS CG2671-PA PROCESSED/TOP:2 ok 9 ok 10 PROBLEMS ENCOUNTERED: 6 (EXPECTED: 6) ok 11 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 230. Subroutine unigene_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 292. Subroutine title redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 314. Subroutine gene redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 335. Subroutine cytoband redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 353. Subroutine mgi redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 370. Subroutine locuslink redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 398. Subroutine gnm_terminus redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 428. Subroutine scount redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 444. Subroutine express redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 466. Subroutine chromosome redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 484. Subroutine sts redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 502. Subroutine txmap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 520. Subroutine protsim redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 538. Subroutine sequences redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 561. Subroutine species redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 581. Subroutine display_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 613. Subroutine description redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 630. Subroutine size redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 648. Subroutine cluster_score redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 680. Subroutine get_members redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 703. Subroutine annotation redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 752. Subroutine add_member redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 784. Subroutine remove_members redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 814. Subroutine next_locuslink redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 843. Subroutine next_express redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 869. Subroutine next_chromosome redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 896. Subroutine next_protsim redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 923. Subroutine next_sts redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 950. Subroutine next_txmap redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 977. Subroutine _next_element redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 990. Subroutine object_id redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1027. Subroutine version redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1049. Subroutine authority redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1071. Subroutine namespace redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1093. Subroutine display_name redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1121. Subroutine next_seq redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1172. Subroutine sequence_factory redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1230. Subroutine _annotation_value redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1258. Subroutine _annotation_value_ary redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1299. Subroutine _annotation_dblink redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1335. Subroutine _remove_dblink redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1370. Subroutine Bio::Cluster::UniGene::sequence redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Cluster\UniGene.pm line 1394. t/UniGene.t .................. 1..61 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 89, chunk 1. Subroutine start redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 111, chunk 1. Subroutine end redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 137, chunk 1. Subroutine length redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 174, chunk 1. Subroutine location_type redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 265, chunk 1. Subroutine to_FTstring redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 312, chunk 1. Subroutine trunc redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Location\Simple.pm line 343, chunk 1. Subroutine new redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Variation\IO\xml.pm line 93. Subroutine _initialize redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Variation\IO\xml.pm line 100. Subroutine _seqDiff redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Variation\IO\xml.pm line 116. Subroutine _variant redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Variation\IO\xml.pm line 127. Subroutine next redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Variation\IO\xml.pm line 214. Subroutine write redefined at C:\cpanfly-5.12\var\cpan\build\bioperl-1.4-532EI0\blib\lib/Bio\Variation\IO\xml.pm line 243. 1,402c1,388 < < < < < < computed < gaagattcagccaagctcaaggatg < g < a < aagtgcagttagggctgggaagggt < -BccI < < < < experimental < gaagattcagccaagctcaaggatg < g < a < aagtgcagttagggctgggaagggt < < -BccI < coding < < < < < computed < E < K < < < < < < < < computed < ccaagctcaaggatggaagtgcagt < t < a < agggctgggaagggtctaccctcgg < < < < experimental < ccaagctcaaggatggaagtgcagt < t < a < agggctgggaagggtctaccctcgg < < coding < < < < computed < L < * < < < < < < < < computed < gaagattcagccaagctcaaggatg < g < a < aagtgcagttagggctgggaagggt < -BccI < < < < experimental < gaagattcagccaagctcaaggatg < g < a < aagtgcagttagggctgggaagggt < < -BccI < coding < < < < < computed < E < K < < < < < < < computed < tctgttccagagcgtgcgcgaagtg < atccag < < aacccgggccccaggcacccagagg < -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < < < < < experimental < tctgttccagagcgtgcgcgaagtg < atccag < < aacccgggccccaggcacccagagg < < -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < coding < < < < computed < IQ < < < < < < < < computed < ctgttccagagcgtgcgcgaagtga < t < < ccagaacccgggccccaggcaccca < -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < < < < < experimental < ctgttccagagcgtgcgcgaagtga < t < < ccagaacccgggccccaggcaccca < < -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < coding < < < < < computed < I < TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* < < < < < < < computed < ctgttccagagcgtgcgcgaagtga < < gggccc < tccagaacccgggccccaggcaccc < +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI < < < < < experimental < ctgttccagagcgtgcgcgaagtga < < gggccc < tccagaacccgggccccaggcaccc < < +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI < coding < < < < < computed < I < RAL < < < < < < < computed < tctgttccagagcgtgcgcgaagtg < < g < atccagaacccgggccccaggcacc < +BamHI, +BinI, +NlaIV, +XhoII < < < < < experimental < tctgttccagagcgtgcgcgaagtg < < g < atccagaacccgggccccaggcacc < < +BamHI, +BinI, +NlaIV, +XhoII < coding < < < < < computed < I < DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < < < < < < < computed < tctgttccagagcgtgcgcgaagtg < at < gggccc < ccagaacccgggccccaggcaccca < +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < < < < < experimental < tctgttccagagcgtgcgcgaagtg < at < gggccc < ccagaacccgggccccaggcaccca < < +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < coding < < < < < computed < I < GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < < < < < < < < computed < ggtggaagattcagccaagctcaag < g < a < atggaagtgcagttagggctgggaa < -BccI, -FokI, +Hpy178III < < < < experimental < ggtggaagattcagccaagctcaag < g < a < atggaagtgcagttagggctgggaa < -BccI, -FokI, +Hpy178III < 5'UTR < < < < < < < < computed < tctatttccacacccagtgaagcat < t < c < ggaaaccctatttccccaccccagc < +Hpy188I, +SfaNI, -XcmI < < < < experimental < tctatttccacacccagtgaagcat < t < c < ggaaaccctatttccccaccccagc < +Hpy188I, +SfaNI, -XcmI < 3'UTR < < < < < < < < experimental < cgcacacctgtggtgcctgccaccc < a < g < ctgggttgcccatgattcatttttg < +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI < 3'UTR < < < < computed < cgcacacctgtggtgcctgccaccc < a < g < ctgggttgcccatgattcatttttg < +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI < 3'UTR < < < < < < < < computed < gcagcactgcagagatttcatcatg < g < t < tctcccaggccctcaggctcctctg < -BsmAI, -Eco31I < exon < < < < experimental < gcagcactgcagagatttcatcatg < g < t < tctcccaggccctcaggctcctctg < < -BsmAI, -Eco31I < coding < < < < < computed < V < F < < < < < < < < computed < taaggcctcaggaggagaaacacgg < g < t < acatgccgtggaagccggggcctca < -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI < exon < < < < experimental < taaggcctcaggaggagaaacacgg < g < t < acatgccgtggaagccggggcctca < < -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI < coding < < < < < computed < D < Y < < < < < < < < computed < ggcaggggcagcactgcagagattt < c < g < atcatggtctcccaggccctcaggc < +BclI, +DpnI, +MboI < 5'UTR < < < < experimental < ggcaggggcagcactgcagagattt < c < g < atcatggtctcccaggccctcaggc < +BclI, +DpnI, +MboI < 5'UTR < < --- > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > > > > computed > ccaagctcaaggatggaagtgcagt > t > a > agggctgggaagggtctaccctcgg > > > > experimental > ccaagctcaaggatggaagtgcagt > t > a > agggctgggaagggtctaccctcgg > > coding > > > > computed > L > * > > > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > > > computed > tctgttccagagcgtgcgcgaagtg > atccag > > aacccgggccccaggcacccagagg > -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV > > > > > experimental > tctgttccagagcgtgcgcgaagtg > atccag > > aacccgggccccaggcacccagagg > > -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV > coding > > > > computed > IQ > > > > > > > computed > ctgttccagagcgtgcgcgaagtga > t > > ccagaacccgggccccaggcaccca > -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I > > > > > experimental > ctgttccagagcgtgcgcgaagtga > t > > ccagaacccgggccccaggcaccca > > -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I > coding > > > > > computed > I > TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* > > > > > > computed > ctgttccagagcgtgcgcgaagtga > > gggccc > tccagaacccgggccccaggcaccc > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI > > > > > experimental > ctgttccagagcgtgcgcgaagtga > > gggccc > tccagaacccgggccccaggcaccc > > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI > coding > > > > > computed > I > RAL > > > > > > computed > tctgttccagagcgtgcgcgaagtg > > g > atccagaacccgggccccaggcacc > +BamHI, +BinI, +NlaIV, +XhoII > > > > > experimental > tctgttccagagcgtgcgcgaagtg > > g > atccagaacccgggccccaggcacc > > +BamHI, +BinI, +NlaIV, +XhoII > coding > > > > > computed > I > DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* > > > > > > computed > tctgttccagagcgtgcgcgaagtg > at > gggccc > ccagaacccgggccccaggcaccca > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI > > > > > experimental > tctgttccagagcgtgcgcgaagtg > at > gggccc > ccagaacccgggccccaggcaccca > > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI > coding > > > > > computed > I > GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* > > > > > > > computed > ggtggaagattcagccaagctcaag > g > a > atggaagtgcagttagggctgggaa > -BccI, -FokI, +Hpy178III > > > > experimental > ggtggaagattcagccaagctcaag > g > a > atggaagtgcagttagggctgggaa > -BccI, -FokI, +Hpy178III > 5'UTR > > > > > > > computed > tctatttccacacccagtgaagcat > t > c > ggaaaccctatttccccaccccagc > +Hpy188I, +SfaNI, -XcmI > > > > experimental > tctatttccacacccagtgaagcat > t > c > ggaaaccctatttccccaccccagc > +Hpy188I, +SfaNI, -XcmI > 3'UTR > > > > > > > experimental > cgcacacctgtggtgcctgccaccc > a > g > ctgggttgcccatgattcatttttg > +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI > 3'UTR > > > > computed > cgcacacctgtggtgcctgccaccc > a > g > ctgggttgcccatgattcatttttg > +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI > 3'UTR > > > > > > > computed > gcagcactgcagagatttcatcatg > g > t > tctcccaggccctcaggctcctctg > -BsmAI, -Eco31I > exon > > > > experimental > gcagcactgcagagatttcatcatg > g > t > tctcccaggccctcaggctcctctg > > -BsmAI, -Eco31I > coding > > > > > computed > V > F > > > > > > > computed > taaggcctcaggaggagaaacacgg > g > t > acatgccgtggaagccggggcctca > -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI > exon > > > > experimental > taaggcctcaggaggagaaacacgg > g > t > acatgccgtggaagccggggcctca > > -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI > coding > > > > > computed > D > Y > > > > > > > computed > ggcaggggcagcactgcagagattt > c > g > atcatggtctcccaggccctcaggc > +BclI, +DpnI, +MboI > 5'UTR > > > > experimental > ggcaggggcagcactgcagagattt > c > g > atcatggtctcccaggccctcaggc > +BclI, +DpnI, +MboI > 5'UTR > > 1,86c1,85 < < < < < < computed < gaagattcagccaagctcaaggatg < g < a < aagtgcagttagggctgggaagggt < -BccI < < < < < computed < gaagattcagccaagctcaaggatg < g < t < aagtgcagttagggctgggaagggt < -BccI < < < < experimental < gaagattcagccaagctcaaggatg < g < a < aagtgcagttagggctgggaagggt < < -BccI < coding < < < < experimental < gaagattcagccaagctcaaggatg < g < t < aagtgcagttagggctgggaagggt < < -BccI < coding < < < < < computed < E < K < < < < computed < E < * < < < < < computed < gaagattcagccaagctcaaggatg < c < a < aagtgcagttagggctgggaagggt < -CviRI, -SfaNI < < < < experimental < gaagattcagccaagctcaaggatg < c < a < aagtgcagttagggctgggaagggt < < -CviRI, -SfaNI < coding < < < < < computed < Q < K < < --- > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > > computed > gaagattcagccaagctcaaggatg > g > t > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > experimental > gaagattcagccaagctcaaggatg > g > t > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > computed > E > * > > > > > computed > gaagattcagccaagctcaaggatg > c > a > aagtgcagttagggctgggaagggt > -CviRI, -SfaNI > > > > experimental > gaagattcagccaagctcaaggatg > c > a > aagtgcagttagggctgggaagggt > > -CviRI, -SfaNI > coding > > > > > computed > Q > K > > 1,350c1,388 < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+14T>A; L5X < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 14 < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature RNA; 1 < Feature /label: nonsense < Feature /proof: experimental < Feature /location: 14 (M20132::376) < Feature /upflank: ccaagctcaaggatggaagtgcagt < Feature /change: t>a < Feature /dnflank: agggctgggaagggtctaccctcgg < Feature /codon_table: 1 < Feature /codon: tta>taa; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: truncation < Feature /proof: computed < Feature /location: 5 < Feature /change: L>* < // < ID M20132:(362)c.+4G>A; E2K < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 4 < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 (M20132::366) < Feature /upflank: gaagattcagccaagctcaaggatg < Feature /change: g>a < Feature /dnflank: aagtgcagttagggctgggaagggt < Feature /re_site: -BccI < Feature /codon_table: 1 < Feature /codon: gaa>aaa; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, conservative < Feature /proof: computed < Feature /location: 2 < Feature /change: E>K < // < ID M20132:(362)c.+100delATCCAG; I34del-2 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 100..105 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature RNA; 1 < Feature /label: inframe, deletion < Feature /proof: experimental < Feature /location: 100..105 (M20132::462..467) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: atccag> < Feature /dnflank: aacccgggccccaggcacccagagg < Feature /re_site: -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 34..35 < Feature /change: IQ> < // < ID M20132:(362)c.+101delT; I34delX172 < Feature DNA; 1 < Feature /label: deletion < Feature /proof: computed < Feature /location: 101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature RNA; 1 < Feature /label: frameshift, deletion < Feature /proof: experimental < Feature /location: 101 (M20132::463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: t> < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAP < Feature GSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPAR < Feature GCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* < // < ID M20132:(362)c.+101insGGGCCC; I34ins+2 < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 100^101 < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature RNA; 1 < Feature /label: inframe, insertion < Feature /proof: experimental < Feature /location: 100^101 (M20132::462^463) < Feature /upflank: ctgttccagagcgtgcgcgaagtga < Feature /change: >gggccc < Feature /dnflank: tccagaacccgggccccaggcaccc < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, < Feature +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 2 < Feature /region: coding < Feature AA; 1 < Feature /label: insertion, complex < Feature /proof: computed < Feature /location: 34 < Feature /change: I>RAL < // < ID M20132:(362)c.+100insG; I34ins81X < Feature DNA; 1 < Feature /label: insertion < Feature /proof: computed < Feature /location: 99^100 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature RNA; 1 < Feature /label: frameshift, insertion < Feature /proof: experimental < Feature /location: 99^100 (M20132::461^462) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: >g < Feature /dnflank: atccagaacccgggccccaggcacc < Feature /re_site: +BamHI, +BinI, +NlaIV, +XhoII < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362)c.+100AT>GGGCCC; I34ins82X < Feature DNA; 1 < Feature /label: complex < Feature /proof: computed < Feature /location: 100..101 < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature RNA; 1 < Feature /label: frameshift, complex < Feature /proof: experimental < Feature /location: 100..101 (M20132::462..463) < Feature /upflank: tctgttccagagcgtgcgcgaagtg < Feature /change: at>gggccc < Feature /dnflank: ccagaacccgggccccaggcaccca < Feature /re_site: +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, < Feature +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI < Feature /codon_table: 1 < Feature /codon: atc>-; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: out-of-frame translation, truncation < Feature /proof: computed < Feature /location: 34 < Feature /change: I>GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* < // < ID M20132:(362+1)c.-1G>A < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: -1 < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -1 (M20132::361) < Feature /upflank: ggtggaagattcagccaagctcaag < Feature /change: g>a < Feature /dnflank: atggaagtgcagttagggctgggaa < Feature /re_site: -BccI, -FokI, +Hpy178III < Feature /region: 5'UTR < // < ID M20132:(362)c.+2766T>C < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: computed < Feature /location: 2766 < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: 2766 (M20132::3128) < Feature /upflank: tctatttccacacccagtgaagcat < Feature /change: t>c < Feature /dnflank: ggaaaccctatttccccaccccagc < Feature /re_site: +Hpy188I, +SfaNI, -XcmI < Feature /region: 3'UTR < // < ID J02933:(521)g.+12165A>G < Feature DNA; 1 < Feature /label: point, transition < Feature /proof: experimental < Feature /location: 12165 (J02933::12686) < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (+1027) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: computed < Feature /location: 2428 < Feature /upflank: cgcacacctgtggtgcctgccaccc < Feature /change: a>g < Feature /dnflank: ctgggttgcccatgattcatttttg < Feature /re_site: +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, < Feature -TspRI < Feature /region: 3'UTR; (-1) < // < ID J02933:(521)g.+4G>T; V2F < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 4 (J02933::525) < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /region: exon; 1 (+4) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 4 < Feature /upflank: gcagcactgcagagatttcatcatg < Feature /change: g>t < Feature /dnflank: tctcccaggccctcaggctcctctg < Feature /re_site: -BsmAI, -Eco31I < Feature /codon_table: 1 < Feature /codon: gtc>ttc; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 2 < Feature /change: V>F < // < ID J02933:(521)g.+1168G>T; D34Y < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: 1168 (J02933::1689) < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /region: exon; 1 (-29) < Feature RNA; 1 < Feature /label: missense < Feature /proof: experimental < Feature /location: 100 < Feature /upflank: taaggcctcaggaggagaaacacgg < Feature /change: g>t < Feature /dnflank: acatgccgtggaagccggggcctca < Feature /re_site: -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, < Feature +Tsp4CI < Feature /codon_table: 1 < Feature /codon: gac>tac; 1 < Feature /region: coding < Feature AA; 1 < Feature /label: substitution, nonconservative < Feature /proof: computed < Feature /location: 34 < Feature /change: D>Y < // < ID J02933:(521+1)g.-4C>G < Feature DNA; 1 < Feature /label: point, transversion < Feature /proof: computed < Feature /location: -4 (J02933::518) < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (-4) < Feature RNA; 1 < Feature /label: unknown < Feature /proof: experimental < Feature /location: -4 < Feature /upflank: ggcaggggcagcactgcagagattt < Feature /change: c>g < Feature /dnflank: atcatggtctcccaggccctcaggc < Feature /re_site: +BclI, +DpnI, +MboI < Feature /region: 5'UTR; (+31) < // --- > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > > > > computed > ccaagctcaaggatggaagtgcagt > t > a > agggctgggaagggtctaccctcgg > > > > experimental > ccaagctcaaggatggaagtgcagt > t > a > agggctgggaagggtctaccctcgg > > coding > > > > computed > L > * > > > > > > > computed > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > -BccI > > > > experimental > gaagattcagccaagctcaaggatg > g > a > aagtgcagttagggctgggaagggt > > -BccI > coding > > > > > computed > E > K > > > > > > computed > tctgttccagagcgtgcgcgaagtg > atccag > > aacccgggccccaggcacccagagg > -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV > > > > > experimental > tctgttccagagcgtgcgcgaagtg > atccag > > aacccgggccccaggcacccagagg > > -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV > coding > > > > computed > IQ > > > > > > > computed > ctgttccagagcgtgcgcgaagtga > t > > ccagaacccgggccccaggcaccca > -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I > > > > > experimental > ctgttccagagcgtgcgcgaagtga > t > > ccagaacccgggccccaggcaccca > > -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I > coding > > > > > computed > I > TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* > > > > > > computed > ctgttccagagcgtgcgcgaagtga > > gggccc > tccagaacccgggccccaggcaccc > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI > > > > > experimental > ctgttccagagcgtgcgcgaagtga > > gggccc > tccagaacccgggccccaggcaccc > > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI > coding > > > > > computed > I > RAL > > > > > > computed > tctgttccagagcgtgcgcgaagtg > > g > atccagaacccgggccccaggcacc > +BamHI, +BinI, +NlaIV, +XhoII > > > > > experimental > tctgttccagagcgtgcgcgaagtg > > g > atccagaacccgggccccaggcacc > > +BamHI, +BinI, +NlaIV, +XhoII > coding > > > > > computed > I > DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* > > > > > > computed > tctgttccagagcgtgcgcgaagtg > at > gggccc > ccagaacccgggccccaggcaccca > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI > > > > > experimental > tctgttccagagcgtgcgcgaagtg > at > gggccc > ccagaacccgggccccaggcaccca > > +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI > coding > > > > > computed > I > GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* > > > > > > > computed > ggtggaagattcagccaagctcaag > g > a > atggaagtgcagttagggctgggaa > -BccI, -FokI, +Hpy178III > > > > experimental > ggtggaagattcagccaagctcaag > g > a > atggaagtgcagttagggctgggaa > -BccI, -FokI, +Hpy178III > 5'UTR > > > > > > > computed > tctatttccacacccagtgaagcat > t > c > ggaaaccctatttccccaccccagc > +Hpy188I, +SfaNI, -XcmI > > > > experimental > tctatttccacacccagtgaagcat > t > c > ggaaaccctatttccccaccccagc > +Hpy188I, +SfaNI, -XcmI > 3'UTR > > > > > > > experimental > cgcacacctgtggtgcctgccaccc > a > g > ctgggttgcccatgattcatttttg > +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI > 3'UTR > > > > computed > cgcacacctgtggtgcctgccaccc > a > g > ctgggttgcccatgattcatttttg > +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI > 3'UTR > > > > > > > computed > gcagcactgcagagatttcatcatg > g > t > tctcccaggccctcaggctcctctg > -BsmAI, -Eco31I > exon > > > > experimental > gcagcactgcagagatttcatcatg > g > t > tctcccaggccctcaggctcctctg > > -BsmAI, -Eco31I > coding > > > > > computed > V > F > > > > > > > computed > taaggcctcaggaggagaaacacgg > g > t > acatgccgtggaagccggggcctca > -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI > exon > > > > experimental > taaggcctcaggaggagaaacacgg > g > t > acatgccgtggaagccggggcctca > > -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI > coding > > > > > computed > D > Y > > > > > > > computed > ggcaggggcagcactgcagagattt > c > g > atcatggtctcccaggccctcaggc > +BclI, +DpnI, +MboI > 5'UTR > > > > experimental > ggcaggggcagcactgcagagattt > c > g > atcatggtctcccaggccctcaggc > +BclI, +DpnI, +MboI > 5'UTR > > t/Variation_IO.t ............. 1..25 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 not ok 15 # Test 15 got: ' computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg experimental ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg coding computed L * computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV experimental tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV coding computed IQ computed ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I experimental ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I coding computed I TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* computed ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI experimental ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI coding computed I RAL computed tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII experimental tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII coding computed I DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI experimental tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI coding computed I GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III experimental ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III 5'UTR computed tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI experimental tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI 3'UTR experimental cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I exon experimental gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I coding computed V F computed taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI exon experimental taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI coding computed D Y computed ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR experimental ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR ' (t/Variation_IO.t at line 106 fail #3) # Expected: ' computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg experimental ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg coding computed L * computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV experimental tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV coding computed IQ computed ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I experimental ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I coding computed I TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* computed ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI experimental ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI coding computed I RAL computed tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII experimental tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII coding computed I DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI experimental tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI coding computed I GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III experimental ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III 5'UTR computed tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI experimental tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI 3'UTR experimental cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I exon experimental gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I coding computed V F computed taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI exon experimental taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI coding computed D Y computed ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR experimental ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR ' (test output file differs from input) ok 16 ok 17 ok 18 ok 19 not ok 20 # Test 20 got: ' computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI computed gaagattcagccaagctcaaggatg g t aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding experimental gaagattcagccaagctcaaggatg g t aagtgcagttagggctgggaagggt -BccI coding computed E K computed E * computed gaagattcagccaagctcaaggatg c a aagtgcagttagggctgggaagggt -CviRI, -SfaNI experimental gaagattcagccaagctcaaggatg c a aagtgcagttagggctgggaagggt -CviRI, -SfaNI coding computed Q K ' (t/Variation_IO.t at line 106 fail #4) # Expected: ' computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI computed gaagattcagccaagctcaaggatg g t aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding experimental gaagattcagccaagctcaaggatg g t aagtgcagttagggctgggaagggt -BccI coding computed E K computed E * computed gaagattcagccaagctcaaggatg c a aagtgcagttagggctgggaagggt -CviRI, -SfaNI experimental gaagattcagccaagctcaaggatg c a aagtgcagttagggctgggaagggt -CviRI, -SfaNI coding computed Q K ' (test output file differs from input) ok 21 ok 22 ok 23 ok 24 not ok 25 # Test 25 got: ' computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg experimental ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg coding computed L * computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV experimental tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV coding computed IQ computed ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I experimental ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I coding computed I TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* computed ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI experimental ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI coding computed I RAL computed tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII experimental tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII coding computed I DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI experimental tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI coding computed I GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III experimental ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III 5'UTR computed tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI experimental tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI 3'UTR experimental cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I exon experimental gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I coding computed V F computed taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI exon experimental taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI coding computed D Y computed ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR experimental ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR ' (t/Variation_IO.t at line 106 fail #5) # Expected: ' computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg experimental ccaagctcaaggatggaagtgcagt t a agggctgggaagggtctaccctcgg coding computed L * computed gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI experimental gaagattcagccaagctcaaggatg g a aagtgcagttagggctgggaagggt -BccI coding computed E K computed tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV experimental tctgttccagagcgtgcgcgaagtg atccag aacccgggccccaggcacccagagg -BinI, -BsiYI, -DpnI, -Hpy178III, -MboI, +MjaIV coding computed IQ computed ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I experimental ctgttccagagcgtgcgcgaagtga t ccagaacccgggccccaggcaccca -BinI, -DpnI, -Hpy178III, +MaeIII, -MboI, +Tsp45I coding computed I TRTRAPGTQRPRAQHLPAPVCCCCSSSSSSSSSSSSSSSSSSSSKRLAPGSSSSSRVRMVLPKPIVEAPQATWSWMRNSNLHSRSRPWSATPREVASQSLEPPWPPARGCRSSCQHLRTRMTQLPHPRCPCWAPLSPA* computed ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI experimental ctgttccagagcgtgcgcgaagtga gggccc tccagaacccgggccccaggcaccc +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +GsuI, +HaeIII, +HgiJII, -MboI, +MnlI, +NlaIV, +SduI coding computed I RAL computed tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII experimental tctgttccagagcgtgcgcgaagtg g atccagaacccgggccccaggcacc +BamHI, +BinI, +NlaIV, +XhoII coding computed I DPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI experimental tctgttccagagcgtgcgcgaagtg at gggccc ccagaacccgggccccaggcaccca +ApaI, +AsuI, -BinI, +BmgI, +BseSI, +CviJI, -DpnI, +DraII, +HaeIII, +HgiJII, -Hpy178III, -MboI, +NlaIV, +SduI coding computed I GPPEPGPQAPRGRERSTSRRQFAAAAAAAAAAAAAAAAAAAAAAAARD* computed ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III experimental ggtggaagattcagccaagctcaag g a atggaagtgcagttagggctgggaa -BccI, -FokI, +Hpy178III 5'UTR computed tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI experimental tctatttccacacccagtgaagcat t c ggaaaccctatttccccaccccagc +Hpy188I, +SfaNI, -XcmI 3'UTR experimental cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed cgcacacctgtggtgcctgccaccc a g ctgggttgcccatgattcatttttg +AciI, -BfiI, -BsrI, +FauI, +NspBII, +Sth132I, -TspRI 3'UTR computed gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I exon experimental gcagcactgcagagatttcatcatg g t tctcccaggccctcaggctcctctg -BsmAI, -Eco31I coding computed V F computed taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI exon experimental taaggcctcaggaggagaaacacgg g t acatgccgtggaagccggggcctca -BscGI, -Bsp24I, -CjePI, -FinI, +RsaI, -Sth132I, +Tsp4CI coding computed D Y computed ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR experimental ggcaggggcagcactgcagagattt c g atcatggtctcccaggccctcaggc +BclI, +DpnI, +MboI 5'UTR ' (test output file differs from input) Failed 3/25 subtests Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 160. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 239. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 259. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 286. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 304. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 324. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 345. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 366. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 388. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 411. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 433. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 454. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 469. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 486. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 501. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 543. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 556. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 573. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 590. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 608. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 628. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 649. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 658. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 667. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 684. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 705. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 162. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 374. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 396. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 415. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 419. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 442. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 480. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 508. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 533. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 557. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 583. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 613. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 645. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 676. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 744. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 790. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 809. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 827. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 865. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1000. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1102. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1115. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1147. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1204. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1226. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1258. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 77, line 4. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 114, line 4. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 130, line 4. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 146, line 4. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 162, line 4. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 182, line 4. Subroutine new redefined at Bio\Location\Simple.pm line 89, line 4. Subroutine start redefined at Bio\Location\Simple.pm line 111, line 4. Subroutine end redefined at Bio\Location\Simple.pm line 137, line 4. Subroutine length redefined at Bio\Location\Simple.pm line 174, line 4. Subroutine location_type redefined at Bio\Location\Simple.pm line 265, line 4. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 312, line 4. Subroutine trunc redefined at Bio\Location\Simple.pm line 343, line 4. t/WABA.t ..................... 1..62 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok defined(%hash) is deprecated at C:/cpanfly-5.12/var/megalib/SOAP/Lite.pm line 465. (Maybe you should just omit the defined()?) defined(%hash) is deprecated at C:/cpanfly-5.12/var/megalib/SOAP/Lite.pm line 2203. (Maybe you should just omit the defined()?) Use of "goto" to jump into a construct is deprecated at t/XEMBL_DB.t line 65. t/XEMBL_DB.t ................. 1..9 ok 1 ok 2 # server may be down ok 3 # Server may be down ok 4 # Server may be down ok 5 # Server may be down ok 6 # Server may be down ok 7 # Server may be down ok 8 # Server may be down ok 9 # Server may be down ok Test Summary Report ------------------- t/BioFetch_DB.t (Wstat: 0 Tests: 27 Failed: 4) Failed tests: 8, 20-21, 27 t/DB.t (Wstat: 0 Tests: 78 Failed: 2) Failed tests: 30-31 t/EMBL_DB.t (Wstat: 0 Tests: 15 Failed: 3) Failed tests: 6, 13-14 t/MeSH.t (Wstat: 0 Tests: 26 Failed: 1) Failed test: 26 t/Ontology.t (Wstat: 65280 Tests: 0 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 50 tests but ran 0. t/Registry.t (Wstat: 6400 Tests: 1 Failed: 0) Non-zero exit status: 25 Parse errors: Bad plan. You planned 6 tests but ran 1. t/simpleGOparser.t (Wstat: 65280 Tests: 0 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 98 tests but ran 0. t/TreeIO.t (Wstat: 0 Tests: 42 Failed: 1) Failed test: 42 Parse errors: Bad plan. You planned 41 tests but ran 42. t/Variation_IO.t (Wstat: 0 Tests: 25 Failed: 3) Failed tests: 15, 20, 25 Files=179, Tests=8116, 134 wallclock secs ( 0.92 usr + 0.14 sys = 1.06 CPU) Result: FAIL Failed 9/179 test programs. 14/8116 subtests failed. NMAKE : fatal error U1077: 'C:\Perl-5.12\bin\perl.exe' : return code '0xff' Stop. BIRNEY/bioperl-1.4.tar.gz nmake test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports BIRNEY/bioperl-1.4.tar.gz Finished 2010-05-07T20:13:33