PATH=C:\Program Files\Microsoft Platform SDK\Bin;C:\Program Files\Microsoft Platform SDK\Bin\WinNT;C:\Program Files\Microsoft Visual Studio\VC98\Bin;C:\Program Files\Microsoft Visual Studio\Common\MSDev98\Bin;C:\Perl-5.12\site\bin;C:\Perl-5.12\bin;C:\cygwin\bin;C:\Program Files\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\mysql\bin
Start 2011-05-20T23:46:34
ActivePerl-1200 CPAN-1.9402
LIB=C:\PROGRA~1\MICROS~3\VC98\Lib\PSDK;C:\PROGRA~1\MICROS~2\Lib;C:\PROGRA~1\MICROS~3\VC98\Lib;C:\PROGRA~1\MICROS~3\VC98\MFC\Lib
INCLUDE=C:\PROGRA~1\MICROS~2\Include;C:\PROGRA~1\MICROS~3\VC98\ATL\Include;C:\PROGRA~1\MICROS~3\VC98\Include;C:\PROGRA~1\MICROS~3\VC98\MFC\Include
PATH=C:/CPANFL~1.12/var/libs/bin;C:\PROGRA~1\MICROS~2\Bin;C:\PROGRA~1\MICROS~2\Bin\WinNT;C:\PROGRA~1\MICROS~3\VC98\Bin;C:\PROGRA~1\MICROS~3\Common\MSDev98\Bin;C:\Perl-5.12\site\bin;C:\Perl-5.12\bin;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\mysql\bin
Going to read 'C:\cpanfly-5.12\var\cpan\Metadata'
  Database was generated on Fri, 20 May 2011 22:31:42 GMT
Running make for C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\C\CJ\CJFIELDS\BioPerl-1.6.901.tar.gz ok
BioPerl-1.6.901
BioPerl-1.6.901/AUTHORS
BioPerl-1.6.901/BioPerl.pm
BioPerl-1.6.901/BUGS
BioPerl-1.6.901/Build.PL
BioPerl-1.6.901/Changes
BioPerl-1.6.901/DEPENDENCIES
BioPerl-1.6.901/DEPRECATED
BioPerl-1.6.901/INSTALL
BioPerl-1.6.901/INSTALL.SKIP
BioPerl-1.6.901/INSTALL.WIN
BioPerl-1.6.901/LICENSE
BioPerl-1.6.901/MANIFEST
BioPerl-1.6.901/META.json
BioPerl-1.6.901/META.yml
BioPerl-1.6.901/README
BioPerl-1.6.901/Bio
BioPerl-1.6.901/Bio/AlignIO.pm
BioPerl-1.6.901/Bio/AnalysisI.pm
BioPerl-1.6.901/Bio/AnalysisParserI.pm
BioPerl-1.6.901/Bio/AnalysisResultI.pm
BioPerl-1.6.901/Bio/AnnotatableI.pm
BioPerl-1.6.901/Bio/AnnotationCollectionI.pm
BioPerl-1.6.901/Bio/AnnotationI.pm
BioPerl-1.6.901/Bio/Biblio.pm
BioPerl-1.6.901/Bio/ClusterI.pm
BioPerl-1.6.901/Bio/ClusterIO.pm
BioPerl-1.6.901/Bio/DasI.pm
BioPerl-1.6.901/Bio/DBLinkContainerI.pm
BioPerl-1.6.901/Bio/DescribableI.pm
BioPerl-1.6.901/Bio/FeatureHolderI.pm
BioPerl-1.6.901/Bio/FeatureIO.pm
BioPerl-1.6.901/Bio/HandlerBaseI.pm
BioPerl-1.6.901/Bio/IdCollectionI.pm
BioPerl-1.6.901/Bio/IdentifiableI.pm
BioPerl-1.6.901/Bio/LocatableSeq.pm
BioPerl-1.6.901/Bio/LocationI.pm
BioPerl-1.6.901/Bio/MapIO.pm
BioPerl-1.6.901/Bio/NexmlIO.pm
BioPerl-1.6.901/Bio/OntologyIO.pm
BioPerl-1.6.901/Bio/ParameterBaseI.pm
BioPerl-1.6.901/Bio/Perl.pm
BioPerl-1.6.901/Bio/PhyloNetwork.pm
BioPerl-1.6.901/Bio/PrimarySeq.pm
BioPerl-1.6.901/Bio/PrimarySeqI.pm
BioPerl-1.6.901/Bio/PullParserI.pm
BioPerl-1.6.901/Bio/Range.pm
BioPerl-1.6.901/Bio/RangeI.pm
BioPerl-1.6.901/Bio/SearchDist.pm
BioPerl-1.6.901/Bio/SearchIO.pm
BioPerl-1.6.901/Bio/Seq.pm
BioPerl-1.6.901/Bio/SeqAnalysisParserI.pm
BioPerl-1.6.901/Bio/SeqFeatureI.pm
BioPerl-1.6.901/Bio/SeqI.pm
BioPerl-1.6.901/Bio/SeqIO.pm
BioPerl-1.6.901/Bio/SeqUtils.pm
BioPerl-1.6.901/Bio/SimpleAlign.pm
BioPerl-1.6.901/Bio/SimpleAnalysisI.pm
BioPerl-1.6.901/Bio/Species.pm
BioPerl-1.6.901/Bio/Taxon.pm
BioPerl-1.6.901/Bio/Taxonomy.pm
BioPerl-1.6.901/Bio/TreeIO.pm
BioPerl-1.6.901/Bio/UpdateableSeqI.pm
BioPerl-1.6.901/Bio/WebAgent.pm
BioPerl-1.6.901/Bio/Align
BioPerl-1.6.901/Bio/Align/AlignI.pm
BioPerl-1.6.901/Bio/Align/DNAStatistics.pm
BioPerl-1.6.901/Bio/Align/Graphics.pm
BioPerl-1.6.901/Bio/Align/PairwiseStatistics.pm
BioPerl-1.6.901/Bio/Align/ProteinStatistics.pm
BioPerl-1.6.901/Bio/Align/StatisticsI.pm
BioPerl-1.6.901/Bio/Align/Utilities.pm
BioPerl-1.6.901/Bio/AlignIO
BioPerl-1.6.901/Bio/AlignIO/arp.pm
BioPerl-1.6.901/Bio/AlignIO/bl2seq.pm
BioPerl-1.6.901/Bio/AlignIO/clustalw.pm
BioPerl-1.6.901/Bio/AlignIO/emboss.pm
BioPerl-1.6.901/Bio/AlignIO/fasta.pm
BioPerl-1.6.901/Bio/AlignIO/largemultifasta.pm
BioPerl-1.6.901/Bio/AlignIO/maf.pm
BioPerl-1.6.901/Bio/AlignIO/mase.pm
BioPerl-1.6.901/Bio/AlignIO/mega.pm
BioPerl-1.6.901/Bio/AlignIO/meme.pm
BioPerl-1.6.901/Bio/AlignIO/metafasta.pm
BioPerl-1.6.901/Bio/AlignIO/msf.pm
BioPerl-1.6.901/Bio/AlignIO/nexml.pm
BioPerl-1.6.901/Bio/AlignIO/nexus.pm
BioPerl-1.6.901/Bio/AlignIO/pfam.pm
BioPerl-1.6.901/Bio/AlignIO/phylip.pm
BioPerl-1.6.901/Bio/AlignIO/po.pm
BioPerl-1.6.901/Bio/AlignIO/proda.pm
BioPerl-1.6.901/Bio/AlignIO/prodom.pm
BioPerl-1.6.901/Bio/AlignIO/psi.pm
BioPerl-1.6.901/Bio/AlignIO/selex.pm
BioPerl-1.6.901/Bio/AlignIO/stockholm.pm
BioPerl-1.6.901/Bio/AlignIO/xmfa.pm
BioPerl-1.6.901/Bio/AlignIO/Handler
BioPerl-1.6.901/Bio/AlignIO/Handler/GenericAlignHandler.pm
BioPerl-1.6.901/Bio/Annotation
BioPerl-1.6.901/Bio/Annotation/AnnotationFactory.pm
BioPerl-1.6.901/Bio/Annotation/Collection.pm
BioPerl-1.6.901/Bio/Annotation/Comment.pm
BioPerl-1.6.901/Bio/Annotation/DBLink.pm
BioPerl-1.6.901/Bio/Annotation/OntologyTerm.pm
BioPerl-1.6.901/Bio/Annotation/Reference.pm
BioPerl-1.6.901/Bio/Annotation/Relation.pm
BioPerl-1.6.901/Bio/Annotation/SimpleValue.pm
BioPerl-1.6.901/Bio/Annotation/StructuredValue.pm
BioPerl-1.6.901/Bio/Annotation/TagTree.pm
BioPerl-1.6.901/Bio/Annotation/Target.pm
BioPerl-1.6.901/Bio/Annotation/Tree.pm
BioPerl-1.6.901/Bio/Annotation/TypeManager.pm
BioPerl-1.6.901/Bio/Assembly
BioPerl-1.6.901/Bio/Assembly/Contig.pm
BioPerl-1.6.901/Bio/Assembly/ContigAnalysis.pm
BioPerl-1.6.901/Bio/Assembly/IO.pm
BioPerl-1.6.901/Bio/Assembly/Scaffold.pm
BioPerl-1.6.901/Bio/Assembly/ScaffoldI.pm
BioPerl-1.6.901/Bio/Assembly/Singlet.pm
BioPerl-1.6.901/Bio/Assembly/IO
BioPerl-1.6.901/Bio/Assembly/IO/ace.pm
BioPerl-1.6.901/Bio/Assembly/IO/bowtie.pm
BioPerl-1.6.901/Bio/Assembly/IO/maq.pm
BioPerl-1.6.901/Bio/Assembly/IO/phrap.pm
BioPerl-1.6.901/Bio/Assembly/IO/sam.pm
BioPerl-1.6.901/Bio/Assembly/IO/tigr.pm
BioPerl-1.6.901/Bio/Assembly/Tools
BioPerl-1.6.901/Bio/Assembly/Tools/ContigSpectrum.pm
BioPerl-1.6.901/Bio/Biblio
BioPerl-1.6.901/Bio/Biblio/Article.pm
BioPerl-1.6.901/Bio/Biblio/BiblioBase.pm
BioPerl-1.6.901/Bio/Biblio/Book.pm
BioPerl-1.6.901/Bio/Biblio/BookArticle.pm
BioPerl-1.6.901/Bio/Biblio/IO.pm
BioPerl-1.6.901/Bio/Biblio/Journal.pm
BioPerl-1.6.901/Bio/Biblio/JournalArticle.pm
BioPerl-1.6.901/Bio/Biblio/MedlineArticle.pm
BioPerl-1.6.901/Bio/Biblio/MedlineBook.pm
BioPerl-1.6.901/Bio/Biblio/MedlineBookArticle.pm
BioPerl-1.6.901/Bio/Biblio/MedlineJournal.pm
BioPerl-1.6.901/Bio/Biblio/MedlineJournalArticle.pm
BioPerl-1.6.901/Bio/Biblio/Organisation.pm
BioPerl-1.6.901/Bio/Biblio/Patent.pm
BioPerl-1.6.901/Bio/Biblio/Person.pm
BioPerl-1.6.901/Bio/Biblio/Proceeding.pm
BioPerl-1.6.901/Bio/Biblio/Provider.pm
BioPerl-1.6.901/Bio/Biblio/PubmedArticle.pm
BioPerl-1.6.901/Bio/Biblio/PubmedBookArticle.pm
BioPerl-1.6.901/Bio/Biblio/PubmedJournalArticle.pm
BioPerl-1.6.901/Bio/Biblio/Ref.pm
BioPerl-1.6.901/Bio/Biblio/Service.pm
BioPerl-1.6.901/Bio/Biblio/TechReport.pm
BioPerl-1.6.901/Bio/Biblio/Thesis.pm
BioPerl-1.6.901/Bio/Biblio/WebResource.pm
BioPerl-1.6.901/Bio/Biblio/IO
BioPerl-1.6.901/Bio/Biblio/IO/medline2ref.pm
BioPerl-1.6.901/Bio/Biblio/IO/medlinexml.pm
BioPerl-1.6.901/Bio/Biblio/IO/pubmed2ref.pm
BioPerl-1.6.901/Bio/Biblio/IO/pubmedxml.pm
BioPerl-1.6.901/Bio/Cluster
BioPerl-1.6.901/Bio/Cluster/ClusterFactory.pm
BioPerl-1.6.901/Bio/Cluster/FamilyI.pm
BioPerl-1.6.901/Bio/Cluster/SequenceFamily.pm
BioPerl-1.6.901/Bio/Cluster/UniGene.pm
BioPerl-1.6.901/Bio/Cluster/UniGeneI.pm
BioPerl-1.6.901/Bio/ClusterIO
BioPerl-1.6.901/Bio/ClusterIO/dbsnp.pm
BioPerl-1.6.901/Bio/ClusterIO/unigene.pm
BioPerl-1.6.901/Bio/CodonUsage
BioPerl-1.6.901/Bio/CodonUsage/IO.pm
BioPerl-1.6.901/Bio/CodonUsage/Table.pm
BioPerl-1.6.901/Bio/Coordinate
BioPerl-1.6.901/Bio/Coordinate/Chain.pm
BioPerl-1.6.901/Bio/Coordinate/Collection.pm
BioPerl-1.6.901/Bio/Coordinate/ExtrapolatingPair.pm
BioPerl-1.6.901/Bio/Coordinate/GeneMapper.pm
BioPerl-1.6.901/Bio/Coordinate/Graph.pm
BioPerl-1.6.901/Bio/Coordinate/MapperI.pm
BioPerl-1.6.901/Bio/Coordinate/Pair.pm
BioPerl-1.6.901/Bio/Coordinate/Result.pm
BioPerl-1.6.901/Bio/Coordinate/ResultI.pm
BioPerl-1.6.901/Bio/Coordinate/Utils.pm
BioPerl-1.6.901/Bio/Coordinate/Result
BioPerl-1.6.901/Bio/Coordinate/Result/Gap.pm
BioPerl-1.6.901/Bio/Coordinate/Result/Match.pm
BioPerl-1.6.901/Bio/Das
BioPerl-1.6.901/Bio/Das/FeatureTypeI.pm
BioPerl-1.6.901/Bio/Das/SegmentI.pm
BioPerl-1.6.901/Bio/DB
BioPerl-1.6.901/Bio/DB/Ace.pm
BioPerl-1.6.901/Bio/DB/BiblioI.pm
BioPerl-1.6.901/Bio/DB/BioFetch.pm
BioPerl-1.6.901/Bio/DB/CUTG.pm
BioPerl-1.6.901/Bio/DB/DBFetch.pm
BioPerl-1.6.901/Bio/DB/EMBL.pm
BioPerl-1.6.901/Bio/DB/EntrezGene.pm
BioPerl-1.6.901/Bio/DB/EUtilities.pm
BioPerl-1.6.901/Bio/DB/Expression.pm
BioPerl-1.6.901/Bio/DB/Failover.pm
BioPerl-1.6.901/Bio/DB/Fasta.pm
BioPerl-1.6.901/Bio/DB/FileCache.pm
BioPerl-1.6.901/Bio/DB/Flat.pm
BioPerl-1.6.901/Bio/DB/GenBank.pm
BioPerl-1.6.901/Bio/DB/GenericWebAgent.pm
BioPerl-1.6.901/Bio/DB/GenPept.pm
BioPerl-1.6.901/Bio/DB/GFF.pm
BioPerl-1.6.901/Bio/DB/HIV.pm
BioPerl-1.6.901/Bio/DB/InMemoryCache.pm
BioPerl-1.6.901/Bio/DB/LocationI.pm
BioPerl-1.6.901/Bio/DB/MeSH.pm
BioPerl-1.6.901/Bio/DB/NCBIHelper.pm
BioPerl-1.6.901/Bio/DB/Qual.pm
BioPerl-1.6.901/Bio/DB/QueryI.pm
BioPerl-1.6.901/Bio/DB/RandomAccessI.pm
BioPerl-1.6.901/Bio/DB/ReferenceI.pm
BioPerl-1.6.901/Bio/DB/RefSeq.pm
BioPerl-1.6.901/Bio/DB/Registry.pm
BioPerl-1.6.901/Bio/DB/SeqFeature.pm
BioPerl-1.6.901/Bio/DB/SeqHound.pm
BioPerl-1.6.901/Bio/DB/SeqI.pm
BioPerl-1.6.901/Bio/DB/SeqVersion.pm
BioPerl-1.6.901/Bio/DB/SwissProt.pm
BioPerl-1.6.901/Bio/DB/Taxonomy.pm
BioPerl-1.6.901/Bio/DB/TFBS.pm
BioPerl-1.6.901/Bio/DB/Universal.pm
BioPerl-1.6.901/Bio/DB/UpdateableSeqI.pm
BioPerl-1.6.901/Bio/DB/WebDBSeqI.pm
BioPerl-1.6.901/Bio/DB/Biblio
BioPerl-1.6.901/Bio/DB/Biblio/biofetch.pm
BioPerl-1.6.901/Bio/DB/Biblio/eutils.pm
BioPerl-1.6.901/Bio/DB/Biblio/soap.pm
BioPerl-1.6.901/Bio/DB/Expression
BioPerl-1.6.901/Bio/DB/Expression/geo.pm
BioPerl-1.6.901/Bio/DB/Flat
BioPerl-1.6.901/Bio/DB/Flat/BDB.pm
BioPerl-1.6.901/Bio/DB/Flat/BinarySearch.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB
BioPerl-1.6.901/Bio/DB/Flat/BDB/embl.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB/fasta.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB/genbank.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB/swiss.pm
BioPerl-1.6.901/Bio/DB/GFF
BioPerl-1.6.901/Bio/DB/GFF/Aggregator.pm
BioPerl-1.6.901/Bio/DB/GFF/Featname.pm
BioPerl-1.6.901/Bio/DB/GFF/Feature.pm
BioPerl-1.6.901/Bio/DB/GFF/Homol.pm
BioPerl-1.6.901/Bio/DB/GFF/RelSegment.pm
BioPerl-1.6.901/Bio/DB/GFF/Segment.pm
BioPerl-1.6.901/Bio/DB/GFF/Typename.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/ace.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/berkeleydb.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/biofetch.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/biofetch_oracle.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/berkeleydb
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/iterator.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysql.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/oracle.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/oracleace.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/pg.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory/iterator.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/alignment.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/clone.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/coding.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/gene.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/match.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/none.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/orf.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/processed_transcript.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/so_transcript.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/transcript.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_acembly.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_genscan.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_refgene.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_softberry.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_unigene.pm
BioPerl-1.6.901/Bio/DB/GFF/Util
BioPerl-1.6.901/Bio/DB/GFF/Util/Binning.pm
BioPerl-1.6.901/Bio/DB/GFF/Util/Rearrange.pm
BioPerl-1.6.901/Bio/DB/HIV
BioPerl-1.6.901/Bio/DB/HIV/HIVAnnotProcessor.pm
BioPerl-1.6.901/Bio/DB/HIV/HIVQueryHelper.pm
BioPerl-1.6.901/Bio/DB/HIV/lanl-schema.xml
BioPerl-1.6.901/Bio/DB/Query
BioPerl-1.6.901/Bio/DB/Query/GenBank.pm
BioPerl-1.6.901/Bio/DB/Query/HIVQuery.pm
BioPerl-1.6.901/Bio/DB/Query/WebQuery.pm
BioPerl-1.6.901/Bio/DB/SeqFeature
BioPerl-1.6.901/Bio/DB/SeqFeature/NormalizedFeature.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/NormalizedFeatureI.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Segment.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/bdb.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/berkeleydb.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/berkeleydb3.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/GFF2Loader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/GFF3Loader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/Loader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/LoadHelper.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/memory.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/Iterator.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/mysql.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/Pg.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/SQLite.pm
BioPerl-1.6.901/Bio/DB/SeqVersion
BioPerl-1.6.901/Bio/DB/SeqVersion/gi.pm
BioPerl-1.6.901/Bio/DB/Taxonomy
BioPerl-1.6.901/Bio/DB/Taxonomy/entrez.pm
BioPerl-1.6.901/Bio/DB/Taxonomy/flatfile.pm
BioPerl-1.6.901/Bio/DB/Taxonomy/list.pm
BioPerl-1.6.901/Bio/DB/TFBS
BioPerl-1.6.901/Bio/DB/TFBS/transfac_pro.pm
BioPerl-1.6.901/Bio/Draw
BioPerl-1.6.901/Bio/Draw/Pictogram.pm
BioPerl-1.6.901/Bio/Event
BioPerl-1.6.901/Bio/Event/EventGeneratorI.pm
BioPerl-1.6.901/Bio/Event/EventHandlerI.pm
BioPerl-1.6.901/Bio/Factory
BioPerl-1.6.901/Bio/Factory/AnalysisI.pm
BioPerl-1.6.901/Bio/Factory/ApplicationFactoryI.pm
BioPerl-1.6.901/Bio/Factory/DriverFactory.pm
BioPerl-1.6.901/Bio/Factory/FTLocationFactory.pm
BioPerl-1.6.901/Bio/Factory/LocationFactoryI.pm
BioPerl-1.6.901/Bio/Factory/MapFactoryI.pm
BioPerl-1.6.901/Bio/Factory/ObjectBuilderI.pm
BioPerl-1.6.901/Bio/Factory/ObjectFactory.pm
BioPerl-1.6.901/Bio/Factory/ObjectFactoryI.pm
BioPerl-1.6.901/Bio/Factory/SeqAnalysisParserFactory.pm
BioPerl-1.6.901/Bio/Factory/SeqAnalysisParserFactoryI.pm
BioPerl-1.6.901/Bio/Factory/SequenceFactoryI.pm
BioPerl-1.6.901/Bio/Factory/SequenceProcessorI.pm
BioPerl-1.6.901/Bio/Factory/SequenceStreamI.pm
BioPerl-1.6.901/Bio/Factory/TreeFactoryI.pm
BioPerl-1.6.901/Bio/FeatureIO
BioPerl-1.6.901/Bio/FeatureIO/bed.pm
BioPerl-1.6.901/Bio/FeatureIO/gff.pm
BioPerl-1.6.901/Bio/FeatureIO/gtf.pm
BioPerl-1.6.901/Bio/FeatureIO/interpro.pm
BioPerl-1.6.901/Bio/FeatureIO/ptt.pm
BioPerl-1.6.901/Bio/FeatureIO/vecscreen_simple.pm
BioPerl-1.6.901/Bio/Index
BioPerl-1.6.901/Bio/Index/Abstract.pm
BioPerl-1.6.901/Bio/Index/AbstractSeq.pm
BioPerl-1.6.901/Bio/Index/Blast.pm
BioPerl-1.6.901/Bio/Index/BlastTable.pm
BioPerl-1.6.901/Bio/Index/EMBL.pm
BioPerl-1.6.901/Bio/Index/Fasta.pm
BioPerl-1.6.901/Bio/Index/Fastq.pm
BioPerl-1.6.901/Bio/Index/GenBank.pm
BioPerl-1.6.901/Bio/Index/Hmmer.pm
BioPerl-1.6.901/Bio/Index/Qual.pm
BioPerl-1.6.901/Bio/Index/Stockholm.pm
BioPerl-1.6.901/Bio/Index/SwissPfam.pm
BioPerl-1.6.901/Bio/Index/Swissprot.pm
BioPerl-1.6.901/Bio/LiveSeq
BioPerl-1.6.901/Bio/LiveSeq/AARange.pm
BioPerl-1.6.901/Bio/LiveSeq/Chain.pm
BioPerl-1.6.901/Bio/LiveSeq/ChainI.pm
BioPerl-1.6.901/Bio/LiveSeq/DNA.pm
BioPerl-1.6.901/Bio/LiveSeq/Exon.pm
BioPerl-1.6.901/Bio/LiveSeq/Gene.pm
BioPerl-1.6.901/Bio/LiveSeq/Intron.pm
BioPerl-1.6.901/Bio/LiveSeq/Mutation.pm
BioPerl-1.6.901/Bio/LiveSeq/Mutator.pm
BioPerl-1.6.901/Bio/LiveSeq/Prim_Transcript.pm
BioPerl-1.6.901/Bio/LiveSeq/Range.pm
BioPerl-1.6.901/Bio/LiveSeq/Repeat_Region.pm
BioPerl-1.6.901/Bio/LiveSeq/Repeat_Unit.pm
BioPerl-1.6.901/Bio/LiveSeq/SeqI.pm
BioPerl-1.6.901/Bio/LiveSeq/Transcript.pm
BioPerl-1.6.901/Bio/LiveSeq/Translation.pm
BioPerl-1.6.901/Bio/LiveSeq/IO
BioPerl-1.6.901/Bio/LiveSeq/IO/BioPerl.pm
BioPerl-1.6.901/Bio/LiveSeq/IO/Loader.pm
BioPerl-1.6.901/Bio/LiveSeq/IO/README
BioPerl-1.6.901/Bio/Location
BioPerl-1.6.901/Bio/Location/Atomic.pm
BioPerl-1.6.901/Bio/Location/AvWithinCoordPolicy.pm
BioPerl-1.6.901/Bio/Location/CoordinatePolicyI.pm
BioPerl-1.6.901/Bio/Location/Fuzzy.pm
BioPerl-1.6.901/Bio/Location/FuzzyLocationI.pm
BioPerl-1.6.901/Bio/Location/NarrowestCoordPolicy.pm
BioPerl-1.6.901/Bio/Location/Simple.pm
BioPerl-1.6.901/Bio/Location/Split.pm
BioPerl-1.6.901/Bio/Location/SplitLocationI.pm
BioPerl-1.6.901/Bio/Location/WidestCoordPolicy.pm
BioPerl-1.6.901/Bio/Map
BioPerl-1.6.901/Bio/Map/Clone.pm
BioPerl-1.6.901/Bio/Map/Contig.pm
BioPerl-1.6.901/Bio/Map/CytoMap.pm
BioPerl-1.6.901/Bio/Map/CytoMarker.pm
BioPerl-1.6.901/Bio/Map/CytoPosition.pm
BioPerl-1.6.901/Bio/Map/EntityI.pm
BioPerl-1.6.901/Bio/Map/FPCMarker.pm
BioPerl-1.6.901/Bio/Map/Gene.pm
BioPerl-1.6.901/Bio/Map/GeneMap.pm
BioPerl-1.6.901/Bio/Map/GenePosition.pm
BioPerl-1.6.901/Bio/Map/GeneRelative.pm
BioPerl-1.6.901/Bio/Map/LinkageMap.pm
BioPerl-1.6.901/Bio/Map/LinkagePosition.pm
BioPerl-1.6.901/Bio/Map/MapI.pm
BioPerl-1.6.901/Bio/Map/Mappable.pm
BioPerl-1.6.901/Bio/Map/MappableI.pm
BioPerl-1.6.901/Bio/Map/Marker.pm
BioPerl-1.6.901/Bio/Map/MarkerI.pm
BioPerl-1.6.901/Bio/Map/Microsatellite.pm
BioPerl-1.6.901/Bio/Map/OrderedPosition.pm
BioPerl-1.6.901/Bio/Map/OrderedPositionWithDistance.pm
BioPerl-1.6.901/Bio/Map/Physical.pm
BioPerl-1.6.901/Bio/Map/Position.pm
BioPerl-1.6.901/Bio/Map/PositionHandler.pm
BioPerl-1.6.901/Bio/Map/PositionHandlerI.pm
BioPerl-1.6.901/Bio/Map/PositionI.pm
BioPerl-1.6.901/Bio/Map/PositionWithSequence.pm
BioPerl-1.6.901/Bio/Map/Prediction.pm
BioPerl-1.6.901/Bio/Map/Relative.pm
BioPerl-1.6.901/Bio/Map/RelativeI.pm
BioPerl-1.6.901/Bio/Map/SimpleMap.pm
BioPerl-1.6.901/Bio/Map/TranscriptionFactor.pm
BioPerl-1.6.901/Bio/MapIO
BioPerl-1.6.901/Bio/MapIO/fpc.pm
BioPerl-1.6.901/Bio/MapIO/mapmaker.pm
BioPerl-1.6.901/Bio/Matrix
BioPerl-1.6.901/Bio/Matrix/Generic.pm
BioPerl-1.6.901/Bio/Matrix/IO.pm
BioPerl-1.6.901/Bio/Matrix/MatrixI.pm
BioPerl-1.6.901/Bio/Matrix/Mlagan.pm
BioPerl-1.6.901/Bio/Matrix/PhylipDist.pm
BioPerl-1.6.901/Bio/Matrix/Scoring.pm
BioPerl-1.6.901/Bio/Matrix/IO
BioPerl-1.6.901/Bio/Matrix/IO/mlagan.pm
BioPerl-1.6.901/Bio/Matrix/IO/phylip.pm
BioPerl-1.6.901/Bio/Matrix/IO/scoring.pm
BioPerl-1.6.901/Bio/Matrix/PSM
BioPerl-1.6.901/Bio/Matrix/PSM/InstanceSite.pm
BioPerl-1.6.901/Bio/Matrix/PSM/InstanceSiteI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO.pm
BioPerl-1.6.901/Bio/Matrix/PSM/ProtMatrix.pm
BioPerl-1.6.901/Bio/Matrix/PSM/ProtPsm.pm
BioPerl-1.6.901/Bio/Matrix/PSM/Psm.pm
BioPerl-1.6.901/Bio/Matrix/PSM/PsmHeader.pm
BioPerl-1.6.901/Bio/Matrix/PSM/PsmHeaderI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/PsmI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/SiteMatrix.pm
BioPerl-1.6.901/Bio/Matrix/PSM/SiteMatrixI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO
BioPerl-1.6.901/Bio/Matrix/PSM/IO/mast.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/masta.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/meme.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/psiblast.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/transfac.pm
BioPerl-1.6.901/Bio/MolEvol
BioPerl-1.6.901/Bio/MolEvol/CodonModel.pm
BioPerl-1.6.901/Bio/Nexml
BioPerl-1.6.901/Bio/Nexml/Factory.pm
BioPerl-1.6.901/Bio/Ontology
BioPerl-1.6.901/Bio/Ontology/DocumentRegistry.pm
BioPerl-1.6.901/Bio/Ontology/GOterm.pm
BioPerl-1.6.901/Bio/Ontology/InterProTerm.pm
BioPerl-1.6.901/Bio/Ontology/OBOEngine.pm
BioPerl-1.6.901/Bio/Ontology/OBOterm.pm
BioPerl-1.6.901/Bio/Ontology/Ontology.pm
BioPerl-1.6.901/Bio/Ontology/OntologyEngineI.pm
BioPerl-1.6.901/Bio/Ontology/OntologyI.pm
BioPerl-1.6.901/Bio/Ontology/OntologyStore.pm
BioPerl-1.6.901/Bio/Ontology/Path.pm
BioPerl-1.6.901/Bio/Ontology/PathI.pm
BioPerl-1.6.901/Bio/Ontology/Relationship.pm
BioPerl-1.6.901/Bio/Ontology/RelationshipFactory.pm
BioPerl-1.6.901/Bio/Ontology/RelationshipI.pm
BioPerl-1.6.901/Bio/Ontology/RelationshipType.pm
BioPerl-1.6.901/Bio/Ontology/SimpleOntologyEngine.pm
BioPerl-1.6.901/Bio/Ontology/Term.pm
BioPerl-1.6.901/Bio/Ontology/TermFactory.pm
BioPerl-1.6.901/Bio/Ontology/TermI.pm
BioPerl-1.6.901/Bio/Ontology/SimpleGOEngine
BioPerl-1.6.901/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
BioPerl-1.6.901/Bio/Ontology/SimpleGOEngine/GraphAdaptor02.pm
BioPerl-1.6.901/Bio/OntologyIO
BioPerl-1.6.901/Bio/OntologyIO/dagflat.pm
BioPerl-1.6.901/Bio/OntologyIO/goflat.pm
BioPerl-1.6.901/Bio/OntologyIO/InterProParser.pm
BioPerl-1.6.901/Bio/OntologyIO/obo.pm
BioPerl-1.6.901/Bio/OntologyIO/simplehierarchy.pm
BioPerl-1.6.901/Bio/OntologyIO/soflat.pm
BioPerl-1.6.901/Bio/OntologyIO/Handlers
BioPerl-1.6.901/Bio/OntologyIO/Handlers/BaseSAXHandler.pm
BioPerl-1.6.901/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
BioPerl-1.6.901/Bio/OntologyIO/Handlers/InterProHandler.pm
BioPerl-1.6.901/Bio/Phenotype
BioPerl-1.6.901/Bio/Phenotype/Correlate.pm
BioPerl-1.6.901/Bio/Phenotype/Measure.pm
BioPerl-1.6.901/Bio/Phenotype/Phenotype.pm
BioPerl-1.6.901/Bio/Phenotype/PhenotypeI.pm
BioPerl-1.6.901/Bio/Phenotype/MeSH
BioPerl-1.6.901/Bio/Phenotype/MeSH/Term.pm
BioPerl-1.6.901/Bio/Phenotype/MeSH/Twig.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM
BioPerl-1.6.901/Bio/Phenotype/OMIM/MiniMIMentry.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM/OMIMentry.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM/OMIMparser.pm
BioPerl-1.6.901/Bio/PhyloNetwork
BioPerl-1.6.901/Bio/PhyloNetwork/Factory.pm
BioPerl-1.6.901/Bio/PhyloNetwork/FactoryX.pm
BioPerl-1.6.901/Bio/PhyloNetwork/GraphViz.pm
BioPerl-1.6.901/Bio/PhyloNetwork/muVector.pm
BioPerl-1.6.901/Bio/PhyloNetwork/RandomFactory.pm
BioPerl-1.6.901/Bio/PhyloNetwork/TreeFactory.pm
BioPerl-1.6.901/Bio/PhyloNetwork/TreeFactoryMulti.pm
BioPerl-1.6.901/Bio/PhyloNetwork/TreeFactoryX.pm
BioPerl-1.6.901/Bio/PopGen
BioPerl-1.6.901/Bio/PopGen/Genotype.pm
BioPerl-1.6.901/Bio/PopGen/GenotypeI.pm
BioPerl-1.6.901/Bio/PopGen/HtSNP.pm
BioPerl-1.6.901/Bio/PopGen/Individual.pm
BioPerl-1.6.901/Bio/PopGen/IndividualI.pm
BioPerl-1.6.901/Bio/PopGen/IO.pm
BioPerl-1.6.901/Bio/PopGen/Marker.pm
BioPerl-1.6.901/Bio/PopGen/MarkerI.pm
BioPerl-1.6.901/Bio/PopGen/PopStats.pm
BioPerl-1.6.901/Bio/PopGen/Population.pm
BioPerl-1.6.901/Bio/PopGen/PopulationI.pm
BioPerl-1.6.901/Bio/PopGen/Statistics.pm
BioPerl-1.6.901/Bio/PopGen/TagHaplotype.pm
BioPerl-1.6.901/Bio/PopGen/Utilities.pm
BioPerl-1.6.901/Bio/PopGen/IO
BioPerl-1.6.901/Bio/PopGen/IO/csv.pm
BioPerl-1.6.901/Bio/PopGen/IO/hapmap.pm
BioPerl-1.6.901/Bio/PopGen/IO/phase.pm
BioPerl-1.6.901/Bio/PopGen/IO/prettybase.pm
BioPerl-1.6.901/Bio/PopGen/Simulation
BioPerl-1.6.901/Bio/PopGen/Simulation/Coalescent.pm
BioPerl-1.6.901/Bio/PopGen/Simulation/GeneticDrift.pm
BioPerl-1.6.901/Bio/Restriction
BioPerl-1.6.901/Bio/Restriction/Analysis.pm
BioPerl-1.6.901/Bio/Restriction/Enzyme.pm
BioPerl-1.6.901/Bio/Restriction/EnzymeCollection.pm
BioPerl-1.6.901/Bio/Restriction/EnzymeI.pm
BioPerl-1.6.901/Bio/Restriction/IO.pm
BioPerl-1.6.901/Bio/Restriction/Enzyme
BioPerl-1.6.901/Bio/Restriction/Enzyme/MultiCut.pm
BioPerl-1.6.901/Bio/Restriction/Enzyme/MultiSite.pm
BioPerl-1.6.901/Bio/Restriction/IO
BioPerl-1.6.901/Bio/Restriction/IO/bairoch.pm
BioPerl-1.6.901/Bio/Restriction/IO/base.pm
BioPerl-1.6.901/Bio/Restriction/IO/itype2.pm
BioPerl-1.6.901/Bio/Restriction/IO/prototype.pm
BioPerl-1.6.901/Bio/Restriction/IO/withrefm.pm
BioPerl-1.6.901/Bio/Root
BioPerl-1.6.901/Bio/Root/Build.pm
BioPerl-1.6.901/Bio/Root/Exception.pm
BioPerl-1.6.901/Bio/Root/HTTPget.pm
BioPerl-1.6.901/Bio/Root/IO.pm
BioPerl-1.6.901/Bio/Root/Root.pm
BioPerl-1.6.901/Bio/Root/RootI.pm
BioPerl-1.6.901/Bio/Root/Storable.pm
BioPerl-1.6.901/Bio/Root/Test.pm
BioPerl-1.6.901/Bio/Root/Utilities.pm
BioPerl-1.6.901/Bio/Root/Version.pm
BioPerl-1.6.901/Bio/Root/Test
BioPerl-1.6.901/Bio/Root/Test/Warn.pm
BioPerl-1.6.901/Bio/Search
BioPerl-1.6.901/Bio/Search/BlastStatistics.pm
BioPerl-1.6.901/Bio/Search/BlastUtils.pm
BioPerl-1.6.901/Bio/Search/DatabaseI.pm
BioPerl-1.6.901/Bio/Search/GenericDatabase.pm
BioPerl-1.6.901/Bio/Search/GenericStatistics.pm
BioPerl-1.6.901/Bio/Search/Processor.pm
BioPerl-1.6.901/Bio/Search/SearchUtils.pm
BioPerl-1.6.901/Bio/Search/StatisticsI.pm
BioPerl-1.6.901/Bio/Search/Hit
BioPerl-1.6.901/Bio/Search/Hit/BlastHit.pm
BioPerl-1.6.901/Bio/Search/Hit/BlastPullHit.pm
BioPerl-1.6.901/Bio/Search/Hit/Fasta.pm
BioPerl-1.6.901/Bio/Search/Hit/GenericHit.pm
BioPerl-1.6.901/Bio/Search/Hit/HitFactory.pm
BioPerl-1.6.901/Bio/Search/Hit/HitI.pm
BioPerl-1.6.901/Bio/Search/Hit/hmmer3Hit.pm
BioPerl-1.6.901/Bio/Search/Hit/HMMERHit.pm
BioPerl-1.6.901/Bio/Search/Hit/HmmpfamHit.pm
BioPerl-1.6.901/Bio/Search/Hit/ModelHit.pm
BioPerl-1.6.901/Bio/Search/Hit/PsiBlastHit.pm
BioPerl-1.6.901/Bio/Search/Hit/PullHitI.pm
BioPerl-1.6.901/Bio/Search/HSP
BioPerl-1.6.901/Bio/Search/HSP/BlastHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/BlastPullHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/FastaHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/GenericHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/hmmer3HSP.pm
BioPerl-1.6.901/Bio/Search/HSP/HMMERHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/HmmpfamHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/HSPFactory.pm
BioPerl-1.6.901/Bio/Search/HSP/HSPI.pm
BioPerl-1.6.901/Bio/Search/HSP/ModelHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/PsiBlastHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/PSLHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/PullHSPI.pm
BioPerl-1.6.901/Bio/Search/HSP/WABAHSP.pm
BioPerl-1.6.901/Bio/Search/Iteration
BioPerl-1.6.901/Bio/Search/Iteration/GenericIteration.pm
BioPerl-1.6.901/Bio/Search/Iteration/IterationI.pm
BioPerl-1.6.901/Bio/Search/Result
BioPerl-1.6.901/Bio/Search/Result/BlastPullResult.pm
BioPerl-1.6.901/Bio/Search/Result/BlastResult.pm
BioPerl-1.6.901/Bio/Search/Result/CrossMatchResult.pm
BioPerl-1.6.901/Bio/Search/Result/GenericResult.pm
BioPerl-1.6.901/Bio/Search/Result/hmmer3Result.pm
BioPerl-1.6.901/Bio/Search/Result/HMMERResult.pm
BioPerl-1.6.901/Bio/Search/Result/HmmpfamResult.pm
BioPerl-1.6.901/Bio/Search/Result/PullResultI.pm
BioPerl-1.6.901/Bio/Search/Result/ResultFactory.pm
BioPerl-1.6.901/Bio/Search/Result/ResultI.pm
BioPerl-1.6.901/Bio/Search/Result/WABAResult.pm
BioPerl-1.6.901/Bio/Search/Tiling
BioPerl-1.6.901/Bio/Search/Tiling/MapTileUtils.pm
BioPerl-1.6.901/Bio/Search/Tiling/MapTiling.pm
BioPerl-1.6.901/Bio/Search/Tiling/TilingI.pm
BioPerl-1.6.901/Bio/SearchIO
BioPerl-1.6.901/Bio/SearchIO/axt.pm
BioPerl-1.6.901/Bio/SearchIO/blast.pm
BioPerl-1.6.901/Bio/SearchIO/blast_pull.pm
BioPerl-1.6.901/Bio/SearchIO/blasttable.pm
BioPerl-1.6.901/Bio/SearchIO/blastxml.pm
BioPerl-1.6.901/Bio/SearchIO/cross_match.pm
BioPerl-1.6.901/Bio/SearchIO/erpin.pm
BioPerl-1.6.901/Bio/SearchIO/EventHandlerI.pm
BioPerl-1.6.901/Bio/SearchIO/exonerate.pm
BioPerl-1.6.901/Bio/SearchIO/fasta.pm
BioPerl-1.6.901/Bio/SearchIO/FastHitEventBuilder.pm
BioPerl-1.6.901/Bio/SearchIO/gmap_f9.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer2.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer3.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer_pull.pm
BioPerl-1.6.901/Bio/SearchIO/infernal.pm
BioPerl-1.6.901/Bio/SearchIO/IteratedSearchResultEventBuilder.pm
BioPerl-1.6.901/Bio/SearchIO/megablast.pm
BioPerl-1.6.901/Bio/SearchIO/psl.pm
BioPerl-1.6.901/Bio/SearchIO/rnamotif.pm
BioPerl-1.6.901/Bio/SearchIO/SearchResultEventBuilder.pm
BioPerl-1.6.901/Bio/SearchIO/SearchWriterI.pm
BioPerl-1.6.901/Bio/SearchIO/sim4.pm
BioPerl-1.6.901/Bio/SearchIO/waba.pm
BioPerl-1.6.901/Bio/SearchIO/wise.pm
BioPerl-1.6.901/Bio/SearchIO/Writer
BioPerl-1.6.901/Bio/SearchIO/Writer/BSMLResultWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/GbrowseGFF.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/HitTableWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/HSPTableWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/HTMLResultWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/ResultTableWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/TextResultWriter.pm
BioPerl-1.6.901/Bio/SearchIO/XML
BioPerl-1.6.901/Bio/SearchIO/XML/BlastHandler.pm
BioPerl-1.6.901/Bio/SearchIO/XML/PsiBlastHandler.pm
BioPerl-1.6.901/Bio/Seq
BioPerl-1.6.901/Bio/Seq/BaseSeqProcessor.pm
BioPerl-1.6.901/Bio/Seq/EncodedSeq.pm
BioPerl-1.6.901/Bio/Seq/LargeLocatableSeq.pm
BioPerl-1.6.901/Bio/Seq/LargePrimarySeq.pm
BioPerl-1.6.901/Bio/Seq/LargeSeq.pm
BioPerl-1.6.901/Bio/Seq/LargeSeqI.pm
BioPerl-1.6.901/Bio/Seq/Meta.pm
BioPerl-1.6.901/Bio/Seq/MetaI.pm
BioPerl-1.6.901/Bio/Seq/PrimaryQual.pm
BioPerl-1.6.901/Bio/Seq/PrimedSeq.pm
BioPerl-1.6.901/Bio/Seq/QualI.pm
BioPerl-1.6.901/Bio/Seq/Quality.pm
BioPerl-1.6.901/Bio/Seq/RichSeq.pm
BioPerl-1.6.901/Bio/Seq/RichSeqI.pm
BioPerl-1.6.901/Bio/Seq/SeqBuilder.pm
BioPerl-1.6.901/Bio/Seq/SeqFactory.pm
BioPerl-1.6.901/Bio/Seq/SeqFastaSpeedFactory.pm
BioPerl-1.6.901/Bio/Seq/SequenceTrace.pm
BioPerl-1.6.901/Bio/Seq/SeqWithQuality.pm
BioPerl-1.6.901/Bio/Seq/TraceI.pm
BioPerl-1.6.901/Bio/Seq/Meta
BioPerl-1.6.901/Bio/Seq/Meta/Array.pm
BioPerl-1.6.901/Bio/SeqEvolution
BioPerl-1.6.901/Bio/SeqEvolution/DNAPoint.pm
BioPerl-1.6.901/Bio/SeqEvolution/EvolutionI.pm
BioPerl-1.6.901/Bio/SeqEvolution/Factory.pm
BioPerl-1.6.901/Bio/SeqFeature
BioPerl-1.6.901/Bio/SeqFeature/Annotated.pm
BioPerl-1.6.901/Bio/SeqFeature/AnnotationAdaptor.pm
BioPerl-1.6.901/Bio/SeqFeature/Collection.pm
BioPerl-1.6.901/Bio/SeqFeature/CollectionI.pm
BioPerl-1.6.901/Bio/SeqFeature/Computation.pm
BioPerl-1.6.901/Bio/SeqFeature/FeaturePair.pm
BioPerl-1.6.901/Bio/SeqFeature/Generic.pm
BioPerl-1.6.901/Bio/SeqFeature/Lite.pm
BioPerl-1.6.901/Bio/SeqFeature/PositionProxy.pm
BioPerl-1.6.901/Bio/SeqFeature/Primer.pm
BioPerl-1.6.901/Bio/SeqFeature/Similarity.pm
BioPerl-1.6.901/Bio/SeqFeature/SimilarityPair.pm
BioPerl-1.6.901/Bio/SeqFeature/TypedSeqFeatureI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene
BioPerl-1.6.901/Bio/SeqFeature/Gene/Exon.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/ExonI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/GeneStructure.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/GeneStructureI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Intron.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/NC_Feature.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Poly_A_site.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Promoter.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Transcript.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/TranscriptI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/UTR.pm
BioPerl-1.6.901/Bio/SeqFeature/SiRNA
BioPerl-1.6.901/Bio/SeqFeature/SiRNA/Oligo.pm
BioPerl-1.6.901/Bio/SeqFeature/SiRNA/Pair.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools
BioPerl-1.6.901/Bio/SeqFeature/Tools/FeatureNamer.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools/IDHandler.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools/TypeMapper.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools/Unflattener.pm
BioPerl-1.6.901/Bio/SeqIO
BioPerl-1.6.901/Bio/SeqIO/abi.pm
BioPerl-1.6.901/Bio/SeqIO/ace.pm
BioPerl-1.6.901/Bio/SeqIO/agave.pm
BioPerl-1.6.901/Bio/SeqIO/alf.pm
BioPerl-1.6.901/Bio/SeqIO/asciitree.pm
BioPerl-1.6.901/Bio/SeqIO/bsml.pm
BioPerl-1.6.901/Bio/SeqIO/bsml_sax.pm
BioPerl-1.6.901/Bio/SeqIO/chadoxml.pm
BioPerl-1.6.901/Bio/SeqIO/chaos.pm
BioPerl-1.6.901/Bio/SeqIO/chaosxml.pm
BioPerl-1.6.901/Bio/SeqIO/ctf.pm
BioPerl-1.6.901/Bio/SeqIO/embl.pm
BioPerl-1.6.901/Bio/SeqIO/embldriver.pm
BioPerl-1.6.901/Bio/SeqIO/entrezgene.pm
BioPerl-1.6.901/Bio/SeqIO/excel.pm
BioPerl-1.6.901/Bio/SeqIO/exp.pm
BioPerl-1.6.901/Bio/SeqIO/fasta.pm
BioPerl-1.6.901/Bio/SeqIO/fastq.pm
BioPerl-1.6.901/Bio/SeqIO/flybase_chadoxml.pm
BioPerl-1.6.901/Bio/SeqIO/FTHelper.pm
BioPerl-1.6.901/Bio/SeqIO/game.pm
BioPerl-1.6.901/Bio/SeqIO/gbdriver.pm
BioPerl-1.6.901/Bio/SeqIO/gbxml.pm
BioPerl-1.6.901/Bio/SeqIO/gcg.pm
BioPerl-1.6.901/Bio/SeqIO/genbank.pm
BioPerl-1.6.901/Bio/SeqIO/interpro.pm
BioPerl-1.6.901/Bio/SeqIO/kegg.pm
BioPerl-1.6.901/Bio/SeqIO/largefasta.pm
BioPerl-1.6.901/Bio/SeqIO/lasergene.pm
BioPerl-1.6.901/Bio/SeqIO/locuslink.pm
BioPerl-1.6.901/Bio/SeqIO/mbsout.pm
BioPerl-1.6.901/Bio/SeqIO/metafasta.pm
BioPerl-1.6.901/Bio/SeqIO/msout.pm
BioPerl-1.6.901/Bio/SeqIO/MultiFile.pm
BioPerl-1.6.901/Bio/SeqIO/nexml.pm
BioPerl-1.6.901/Bio/SeqIO/phd.pm
BioPerl-1.6.901/Bio/SeqIO/pir.pm
BioPerl-1.6.901/Bio/SeqIO/pln.pm
BioPerl-1.6.901/Bio/SeqIO/qual.pm
BioPerl-1.6.901/Bio/SeqIO/raw.pm
BioPerl-1.6.901/Bio/SeqIO/scf.pm
BioPerl-1.6.901/Bio/SeqIO/seqxml.pm
BioPerl-1.6.901/Bio/SeqIO/strider.pm
BioPerl-1.6.901/Bio/SeqIO/swiss.pm
BioPerl-1.6.901/Bio/SeqIO/swissdriver.pm
BioPerl-1.6.901/Bio/SeqIO/tab.pm
BioPerl-1.6.901/Bio/SeqIO/table.pm
BioPerl-1.6.901/Bio/SeqIO/tigr.pm
BioPerl-1.6.901/Bio/SeqIO/tigrxml.pm
BioPerl-1.6.901/Bio/SeqIO/tinyseq.pm
BioPerl-1.6.901/Bio/SeqIO/ztr.pm
BioPerl-1.6.901/Bio/SeqIO/game
BioPerl-1.6.901/Bio/SeqIO/game/featHandler.pm
BioPerl-1.6.901/Bio/SeqIO/game/gameHandler.pm
BioPerl-1.6.901/Bio/SeqIO/game/gameSubs.pm
BioPerl-1.6.901/Bio/SeqIO/game/gameWriter.pm
BioPerl-1.6.901/Bio/SeqIO/game/seqHandler.pm
BioPerl-1.6.901/Bio/SeqIO/Handler
BioPerl-1.6.901/Bio/SeqIO/Handler/GenericRichSeqHandler.pm
BioPerl-1.6.901/Bio/SeqIO/tinyseq
BioPerl-1.6.901/Bio/SeqIO/tinyseq/tinyseqHandler.pm
BioPerl-1.6.901/Bio/Structure
BioPerl-1.6.901/Bio/Structure/Atom.pm
BioPerl-1.6.901/Bio/Structure/Chain.pm
BioPerl-1.6.901/Bio/Structure/Entry.pm
BioPerl-1.6.901/Bio/Structure/IO.pm
BioPerl-1.6.901/Bio/Structure/Model.pm
BioPerl-1.6.901/Bio/Structure/Residue.pm
BioPerl-1.6.901/Bio/Structure/StructureI.pm
BioPerl-1.6.901/Bio/Structure/IO
BioPerl-1.6.901/Bio/Structure/IO/pdb.pm
BioPerl-1.6.901/Bio/Structure/SecStr
BioPerl-1.6.901/Bio/Structure/SecStr/DSSP
BioPerl-1.6.901/Bio/Structure/SecStr/DSSP/Res.pm
BioPerl-1.6.901/Bio/Structure/SecStr/STRIDE
BioPerl-1.6.901/Bio/Structure/SecStr/STRIDE/Res.pm
BioPerl-1.6.901/Bio/Symbol
BioPerl-1.6.901/Bio/Symbol/Alphabet.pm
BioPerl-1.6.901/Bio/Symbol/AlphabetI.pm
BioPerl-1.6.901/Bio/Symbol/DNAAlphabet.pm
BioPerl-1.6.901/Bio/Symbol/ProteinAlphabet.pm
BioPerl-1.6.901/Bio/Symbol/README.Symbol
BioPerl-1.6.901/Bio/Symbol/Symbol.pm
BioPerl-1.6.901/Bio/Symbol/SymbolI.pm
BioPerl-1.6.901/Bio/Taxonomy
BioPerl-1.6.901/Bio/Taxonomy/FactoryI.pm
BioPerl-1.6.901/Bio/Taxonomy/Node.pm
BioPerl-1.6.901/Bio/Taxonomy/Taxon.pm
BioPerl-1.6.901/Bio/Taxonomy/Tree.pm
BioPerl-1.6.901/Bio/Tools
BioPerl-1.6.901/Bio/Tools/AlignFactory.pm
BioPerl-1.6.901/Bio/Tools/AnalysisResult.pm
BioPerl-1.6.901/Bio/Tools/Blat.pm
BioPerl-1.6.901/Bio/Tools/CodonTable.pm
BioPerl-1.6.901/Bio/Tools/Coil.pm
BioPerl-1.6.901/Bio/Tools/dpAlign.pm
BioPerl-1.6.901/Bio/Tools/ECnumber.pm
BioPerl-1.6.901/Bio/Tools/EPCR.pm
BioPerl-1.6.901/Bio/Tools/Eponine.pm
BioPerl-1.6.901/Bio/Tools/ERPIN.pm
BioPerl-1.6.901/Bio/Tools/Est2Genome.pm
BioPerl-1.6.901/Bio/Tools/ESTScan.pm
BioPerl-1.6.901/Bio/Tools/EUtilities.pm
BioPerl-1.6.901/Bio/Tools/Fgenesh.pm
BioPerl-1.6.901/Bio/Tools/FootPrinter.pm
BioPerl-1.6.901/Bio/Tools/Gel.pm
BioPerl-1.6.901/Bio/Tools/Geneid.pm
BioPerl-1.6.901/Bio/Tools/Genemark.pm
BioPerl-1.6.901/Bio/Tools/Genewise.pm
BioPerl-1.6.901/Bio/Tools/Genomewise.pm
BioPerl-1.6.901/Bio/Tools/Genscan.pm
BioPerl-1.6.901/Bio/Tools/GFF.pm
BioPerl-1.6.901/Bio/Tools/Glimmer.pm
BioPerl-1.6.901/Bio/Tools/Grail.pm
BioPerl-1.6.901/Bio/Tools/GuessSeqFormat.pm
BioPerl-1.6.901/Bio/Tools/Hmmpfam.pm
BioPerl-1.6.901/Bio/Tools/Infernal.pm
BioPerl-1.6.901/Bio/Tools/ipcress.pm
BioPerl-1.6.901/Bio/Tools/isPcr.pm
BioPerl-1.6.901/Bio/Tools/IUPAC.pm
BioPerl-1.6.901/Bio/Tools/Lucy.pm
BioPerl-1.6.901/Bio/Tools/Match.pm
BioPerl-1.6.901/Bio/Tools/MZEF.pm
BioPerl-1.6.901/Bio/Tools/OddCodes.pm
BioPerl-1.6.901/Bio/Tools/pICalculator.pm
BioPerl-1.6.901/Bio/Tools/Primer3.pm
BioPerl-1.6.901/Bio/Tools/Prints.pm
BioPerl-1.6.901/Bio/Tools/Profile.pm
BioPerl-1.6.901/Bio/Tools/Promoterwise.pm
BioPerl-1.6.901/Bio/Tools/PrositeScan.pm
BioPerl-1.6.901/Bio/Tools/Protparam.pm
BioPerl-1.6.901/Bio/Tools/Pseudowise.pm
BioPerl-1.6.901/Bio/Tools/pSW.pm
BioPerl-1.6.901/Bio/Tools/QRNA.pm
BioPerl-1.6.901/Bio/Tools/RandomDistFunctions.pm
BioPerl-1.6.901/Bio/Tools/RepeatMasker.pm
BioPerl-1.6.901/Bio/Tools/RNAMotif.pm
BioPerl-1.6.901/Bio/Tools/Seg.pm
BioPerl-1.6.901/Bio/Tools/SeqPattern.pm
BioPerl-1.6.901/Bio/Tools/SeqStats.pm
BioPerl-1.6.901/Bio/Tools/SeqWords.pm
BioPerl-1.6.901/Bio/Tools/Sigcleave.pm
BioPerl-1.6.901/Bio/Tools/Signalp.pm
BioPerl-1.6.901/Bio/Tools/SiRNA.pm
BioPerl-1.6.901/Bio/Tools/TandemRepeatsFinder.pm
BioPerl-1.6.901/Bio/Tools/TargetP.pm
BioPerl-1.6.901/Bio/Tools/Tmhmm.pm
BioPerl-1.6.901/Bio/Tools/tRNAscanSE.pm
BioPerl-1.6.901/Bio/Tools/Alignment
BioPerl-1.6.901/Bio/Tools/Alignment/Consed.pm
BioPerl-1.6.901/Bio/Tools/Alignment/Trim.pm
BioPerl-1.6.901/Bio/Tools/Analysis
BioPerl-1.6.901/Bio/Tools/Analysis/SimpleAnalysisBase.pm
BioPerl-1.6.901/Bio/Tools/Analysis/DNA
BioPerl-1.6.901/Bio/Tools/Analysis/DNA/ESEfinder.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Domcut.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/ELM.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/GOR4.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/HNN.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Mitoprot.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/NetPhos.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Scansite.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Sopma.pm
BioPerl-1.6.901/Bio/Tools/EMBOSS
BioPerl-1.6.901/Bio/Tools/EMBOSS/Palindrome.pm
BioPerl-1.6.901/Bio/Tools/EUtilities
BioPerl-1.6.901/Bio/Tools/EUtilities/EUtilDataI.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/EUtilParameters.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/History.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/HistoryI.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Info.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Link.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Query.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Info
BioPerl-1.6.901/Bio/Tools/EUtilities/Info/FieldInfo.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Info/LinkInfo.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Link
BioPerl-1.6.901/Bio/Tools/EUtilities/Link/LinkSet.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Link/UrlLink.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Query
BioPerl-1.6.901/Bio/Tools/EUtilities/Query/GlobalQuery.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary/DocSum.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary/Item.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary/ItemContainerI.pm
BioPerl-1.6.901/Bio/Tools/HMMER
BioPerl-1.6.901/Bio/Tools/HMMER/Domain.pm
BioPerl-1.6.901/Bio/Tools/HMMER/Results.pm
BioPerl-1.6.901/Bio/Tools/HMMER/Set.pm
BioPerl-1.6.901/Bio/Tools/Phylo
BioPerl-1.6.901/Bio/Tools/Phylo/Gerp.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Gumby.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Molphy.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Molphy
BioPerl-1.6.901/Bio/Tools/Phylo/Molphy/Result.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML
BioPerl-1.6.901/Bio/Tools/Phylo/PAML/Codeml.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML/ModelResult.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML/Result.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Phylip
BioPerl-1.6.901/Bio/Tools/Phylo/Phylip/ProtDist.pm
BioPerl-1.6.901/Bio/Tools/Prediction
BioPerl-1.6.901/Bio/Tools/Prediction/Exon.pm
BioPerl-1.6.901/Bio/Tools/Prediction/Gene.pm
BioPerl-1.6.901/Bio/Tools/Primer
BioPerl-1.6.901/Bio/Tools/Primer/AssessorI.pm
BioPerl-1.6.901/Bio/Tools/Primer/Feature.pm
BioPerl-1.6.901/Bio/Tools/Primer/Pair.pm
BioPerl-1.6.901/Bio/Tools/Primer/Assessor
BioPerl-1.6.901/Bio/Tools/Primer/Assessor/Base.pm
BioPerl-1.6.901/Bio/Tools/Run
BioPerl-1.6.901/Bio/Tools/Run/GenericParameters.pm
BioPerl-1.6.901/Bio/Tools/Run/hmmer3.pm
BioPerl-1.6.901/Bio/Tools/Run/ParametersI.pm
BioPerl-1.6.901/Bio/Tools/Run/README
BioPerl-1.6.901/Bio/Tools/Run/RemoteBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/StandAloneBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/StandAloneNCBIBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/StandAloneWUBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/WrapperBase.pm
BioPerl-1.6.901/Bio/Tools/Run/WrapperBase
BioPerl-1.6.901/Bio/Tools/Run/WrapperBase/CommandExts.pm
BioPerl-1.6.901/Bio/Tools/SeqPattern
BioPerl-1.6.901/Bio/Tools/SeqPattern/Backtranslate.pm
BioPerl-1.6.901/Bio/Tools/Signalp
BioPerl-1.6.901/Bio/Tools/Signalp/ExtendedSignalp.pm
BioPerl-1.6.901/Bio/Tools/Sim4
BioPerl-1.6.901/Bio/Tools/Sim4/Exon.pm
BioPerl-1.6.901/Bio/Tools/Sim4/Results.pm
BioPerl-1.6.901/Bio/Tools/SiRNA
BioPerl-1.6.901/Bio/Tools/SiRNA/Ruleset
BioPerl-1.6.901/Bio/Tools/SiRNA/Ruleset/saigo.pm
BioPerl-1.6.901/Bio/Tools/SiRNA/Ruleset/tuschl.pm
BioPerl-1.6.901/Bio/Tools/Spidey
BioPerl-1.6.901/Bio/Tools/Spidey/Exon.pm
BioPerl-1.6.901/Bio/Tools/Spidey/Results.pm
BioPerl-1.6.901/Bio/Tree
BioPerl-1.6.901/Bio/Tree/AlleleNode.pm
BioPerl-1.6.901/Bio/Tree/AnnotatableNode.pm
BioPerl-1.6.901/Bio/Tree/Compatible.pm
BioPerl-1.6.901/Bio/Tree/DistanceFactory.pm
BioPerl-1.6.901/Bio/Tree/Node.pm
BioPerl-1.6.901/Bio/Tree/NodeI.pm
BioPerl-1.6.901/Bio/Tree/NodeNHX.pm
BioPerl-1.6.901/Bio/Tree/RandomFactory.pm
BioPerl-1.6.901/Bio/Tree/Statistics.pm
BioPerl-1.6.901/Bio/Tree/Tree.pm
BioPerl-1.6.901/Bio/Tree/TreeFunctionsI.pm
BioPerl-1.6.901/Bio/Tree/TreeI.pm
BioPerl-1.6.901/Bio/Tree/Draw
BioPerl-1.6.901/Bio/Tree/Draw/Cladogram.pm
BioPerl-1.6.901/Bio/TreeIO
BioPerl-1.6.901/Bio/TreeIO/cluster.pm
BioPerl-1.6.901/Bio/TreeIO/lintree.pm
BioPerl-1.6.901/Bio/TreeIO/newick.pm
BioPerl-1.6.901/Bio/TreeIO/NewickParser.pm
BioPerl-1.6.901/Bio/TreeIO/nexml.pm
BioPerl-1.6.901/Bio/TreeIO/nexus.pm
BioPerl-1.6.901/Bio/TreeIO/nhx.pm
BioPerl-1.6.901/Bio/TreeIO/pag.pm
BioPerl-1.6.901/Bio/TreeIO/phyloxml.pm
BioPerl-1.6.901/Bio/TreeIO/svggraph.pm
BioPerl-1.6.901/Bio/TreeIO/tabtree.pm
BioPerl-1.6.901/Bio/TreeIO/TreeEventBuilder.pm
BioPerl-1.6.901/Bio/Variation
BioPerl-1.6.901/Bio/Variation/AAChange.pm
BioPerl-1.6.901/Bio/Variation/AAReverseMutate.pm
BioPerl-1.6.901/Bio/Variation/Allele.pm
BioPerl-1.6.901/Bio/Variation/DNAMutation.pm
BioPerl-1.6.901/Bio/Variation/IO.pm
BioPerl-1.6.901/Bio/Variation/README
BioPerl-1.6.901/Bio/Variation/RNAChange.pm
BioPerl-1.6.901/Bio/Variation/SeqDiff.pm
BioPerl-1.6.901/Bio/Variation/SNP.pm
BioPerl-1.6.901/Bio/Variation/VariantI.pm
BioPerl-1.6.901/Bio/Variation/IO
BioPerl-1.6.901/Bio/Variation/IO/flat.pm
BioPerl-1.6.901/Bio/Variation/IO/xml.pm
BioPerl-1.6.901/doc
BioPerl-1.6.901/doc/makedoc.PL
BioPerl-1.6.901/doc/README
BioPerl-1.6.901/doc/Deobfuscator
BioPerl-1.6.901/doc/Deobfuscator/Build.PL
BioPerl-1.6.901/doc/Deobfuscator/Changes
BioPerl-1.6.901/doc/Deobfuscator/excluded_modules.txt
BioPerl-1.6.901/doc/Deobfuscator/LICENSE
BioPerl-1.6.901/doc/Deobfuscator/Makefile.PL
BioPerl-1.6.901/doc/Deobfuscator/MANIFEST
BioPerl-1.6.901/doc/Deobfuscator/META.yml
BioPerl-1.6.901/doc/Deobfuscator/README
BioPerl-1.6.901/doc/Deobfuscator/bin
BioPerl-1.6.901/doc/Deobfuscator/bin/deob_index.pl
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_detail.cgi
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_flowchart.png
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_help.html
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_interface.cgi
BioPerl-1.6.901/doc/Deobfuscator/lib
BioPerl-1.6.901/doc/Deobfuscator/lib/Deobfuscator.pm
BioPerl-1.6.901/doc/Deobfuscator/t
BioPerl-1.6.901/doc/Deobfuscator/t/00.load.t
BioPerl-1.6.901/doc/Deobfuscator/t/pod.t
BioPerl-1.6.901/examples
BioPerl-1.6.901/examples/bioperl.pl
BioPerl-1.6.901/examples/generate_random_seq.pl
BioPerl-1.6.901/examples/longorf.pl
BioPerl-1.6.901/examples/make_primers.pl
BioPerl-1.6.901/examples/rev_and_trans.pl
BioPerl-1.6.901/examples/revcom_dir.pl
BioPerl-1.6.901/examples/subsequence.cgi
BioPerl-1.6.901/examples/align
BioPerl-1.6.901/examples/align/align_on_codons.pl
BioPerl-1.6.901/examples/align/aligntutorial.pl
BioPerl-1.6.901/examples/align/clustalw.pl
BioPerl-1.6.901/examples/align/simplealign.pl
BioPerl-1.6.901/examples/biblio
BioPerl-1.6.901/examples/biblio/biblio-eutils-example.pl
BioPerl-1.6.901/examples/biblio/biblio-soap-example.pl
BioPerl-1.6.901/examples/biblio/biblio_soap.pl
BioPerl-1.6.901/examples/Bio-DB-GFF
BioPerl-1.6.901/examples/Bio-DB-GFF/load_ucsc.pl
BioPerl-1.6.901/examples/cluster
BioPerl-1.6.901/examples/cluster/dbsnp.pl
BioPerl-1.6.901/examples/contributed
BioPerl-1.6.901/examples/contributed/nmrpdb_parse.pl
BioPerl-1.6.901/examples/contributed/prosite2perl.pl
BioPerl-1.6.901/examples/contributed/rebase2list.pl
BioPerl-1.6.901/examples/db
BioPerl-1.6.901/examples/db/dbfetch
BioPerl-1.6.901/examples/db/est_tissue_query.pl
BioPerl-1.6.901/examples/db/gb2features.pl
BioPerl-1.6.901/examples/db/get_seqs.pl
BioPerl-1.6.901/examples/db/getGenBank.pl
BioPerl-1.6.901/examples/db/rfetch.pl
BioPerl-1.6.901/examples/db/use_registry.pl
BioPerl-1.6.901/examples/liveseq
BioPerl-1.6.901/examples/liveseq/change_gene.pl
BioPerl-1.6.901/examples/popgen
BioPerl-1.6.901/examples/popgen/parse_calc_stats.pl
BioPerl-1.6.901/examples/quality
BioPerl-1.6.901/examples/quality/svgtrace.pl
BioPerl-1.6.901/examples/root
BioPerl-1.6.901/examples/root/exceptions1.pl
BioPerl-1.6.901/examples/root/exceptions2.pl
BioPerl-1.6.901/examples/root/exceptions3.pl
BioPerl-1.6.901/examples/root/exceptions4.pl
BioPerl-1.6.901/examples/root/README
BioPerl-1.6.901/examples/root/lib
BioPerl-1.6.901/examples/root/lib/TestInterface.pm
BioPerl-1.6.901/examples/root/lib/TestObject.pm
BioPerl-1.6.901/examples/searchio
BioPerl-1.6.901/examples/searchio/blast_example.pl
BioPerl-1.6.901/examples/searchio/custom_writer.pl
BioPerl-1.6.901/examples/searchio/hitwriter.pl
BioPerl-1.6.901/examples/searchio/hspwriter.pl
BioPerl-1.6.901/examples/searchio/htmlwriter.pl
BioPerl-1.6.901/examples/searchio/psiblast_features.pl
BioPerl-1.6.901/examples/searchio/psiblast_iterations.pl
BioPerl-1.6.901/examples/searchio/rawwriter.pl
BioPerl-1.6.901/examples/searchio/resultwriter.pl
BioPerl-1.6.901/examples/searchio/waba2gff.pl
BioPerl-1.6.901/examples/searchio/waba2gff3.pl
BioPerl-1.6.901/examples/sirna
BioPerl-1.6.901/examples/sirna/rnai_finder.cgi
BioPerl-1.6.901/examples/sirna/TAG
BioPerl-1.6.901/examples/structure
BioPerl-1.6.901/examples/structure/structure-io.pl
BioPerl-1.6.901/examples/tk
BioPerl-1.6.901/examples/tk/gsequence.pl
BioPerl-1.6.901/examples/tk/hitdisplay.pl
BioPerl-1.6.901/examples/tools
BioPerl-1.6.901/examples/tools/extract_genes.pl
BioPerl-1.6.901/examples/tools/gb_to_gff.pl
BioPerl-1.6.901/examples/tools/gff2ps.pl
BioPerl-1.6.901/examples/tools/parse_codeml.pl
BioPerl-1.6.901/examples/tools/psw.pl
BioPerl-1.6.901/examples/tools/reverse-translate.pl
BioPerl-1.6.901/examples/tools/run_genscan.pl
BioPerl-1.6.901/examples/tools/run_primer3.pl
BioPerl-1.6.901/examples/tools/seq_pattern.pl
BioPerl-1.6.901/examples/tools/standaloneblast.pl
BioPerl-1.6.901/examples/tree
BioPerl-1.6.901/examples/tree/paup2phylip.pl
BioPerl-1.6.901/ide
BioPerl-1.6.901/ide/bioperl.komodo
BioPerl-1.6.901/ide/bioperl-mode
BioPerl-1.6.901/ide/bioperl-mode/README
BioPerl-1.6.901/ide/bioperl-mode/dist
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode.tar
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode.tar.md5
BioPerl-1.6.901/ide/bioperl-mode/dist/Changes
BioPerl-1.6.901/ide/bioperl-mode/dist/package-me
BioPerl-1.6.901/ide/bioperl-mode/dist/SKIP
BioPerl-1.6.901/ide/bioperl-mode/etc
BioPerl-1.6.901/ide/bioperl-mode/etc/images
BioPerl-1.6.901/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm
BioPerl-1.6.901/ide/bioperl-mode/etc/images/bpmode-tool.xpm
BioPerl-1.6.901/ide/bioperl-mode/site-lisp
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/bioperl-init.el
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/bioperl-mode.el
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/bioperl-skel.el
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/pod.el
BioPerl-1.6.901/maintenance
BioPerl-1.6.901/maintenance/authors.pl
BioPerl-1.6.901/maintenance/check_NAME.pl
BioPerl-1.6.901/maintenance/check_URLs.pl
BioPerl-1.6.901/maintenance/cvs2cl_by_file.pl
BioPerl-1.6.901/maintenance/dependencies.pl
BioPerl-1.6.901/maintenance/deprecated.pl
BioPerl-1.6.901/maintenance/find_mod_deps.pl
BioPerl-1.6.901/maintenance/module_usage.pl
BioPerl-1.6.901/maintenance/modules.pl
BioPerl-1.6.901/maintenance/ncbi_blast_switches.pl
BioPerl-1.6.901/maintenance/perltidy.conf
BioPerl-1.6.901/maintenance/pod.pl
BioPerl-1.6.901/maintenance/README
BioPerl-1.6.901/maintenance/symlink_script.pl
BioPerl-1.6.901/maintenance/version.pl
BioPerl-1.6.901/maintenance/big_split
BioPerl-1.6.901/maintenance/big_split/file_classification.csv
BioPerl-1.6.901/maintenance/big_split/rbuels_notes.txt
BioPerl-1.6.901/models
BioPerl-1.6.901/models/biblio.dia
BioPerl-1.6.901/models/bio_liveseq_variation.dia
BioPerl-1.6.901/models/bio_map.dia
BioPerl-1.6.901/models/bio_restriction.dia
BioPerl-1.6.901/models/bioperl.dia
BioPerl-1.6.901/models/coordinatemapper.dia
BioPerl-1.6.901/models/map_proposal.txt
BioPerl-1.6.901/models/maps_and_markers.dia
BioPerl-1.6.901/models/popgen.dia
BioPerl-1.6.901/models/population_proposal.txt
BioPerl-1.6.901/models/README
BioPerl-1.6.901/scripts
BioPerl-1.6.901/scripts/README
BioPerl-1.6.901/scripts/biblio
BioPerl-1.6.901/scripts/biblio/biblio.PLS
BioPerl-1.6.901/scripts/biblio/TAG
BioPerl-1.6.901/scripts/Bio-DB-EUtilities
BioPerl-1.6.901/scripts/Bio-DB-EUtilities/einfo.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF
BioPerl-1.6.901/scripts/Bio-DB-GFF/bulk_load_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/fast_load_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/genbank2gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/genbank2gff3.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/generate_histogram.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/load_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/meta_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/process_gadfly.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/process_sgd.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/process_wormbase.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/README
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.PLS
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.PLS
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.PLS
BioPerl-1.6.901/scripts/das
BioPerl-1.6.901/scripts/das/das_server.pl
BioPerl-1.6.901/scripts/das/README
BioPerl-1.6.901/scripts/das/TAG
BioPerl-1.6.901/scripts/DB
BioPerl-1.6.901/scripts/DB/biofetch_genbank_proxy.PLS
BioPerl-1.6.901/scripts/DB/bioflat_index.PLS
BioPerl-1.6.901/scripts/DB/biogetseq.PLS
BioPerl-1.6.901/scripts/DB/flanks.PLS
BioPerl-1.6.901/scripts/DB/TAG
BioPerl-1.6.901/scripts/DB-HIV
BioPerl-1.6.901/scripts/DB-HIV/hivq.PLS
BioPerl-1.6.901/scripts/index
BioPerl-1.6.901/scripts/index/bp_fetch.PLS
BioPerl-1.6.901/scripts/index/bp_index.PLS
BioPerl-1.6.901/scripts/index/bp_seqret.PLS
BioPerl-1.6.901/scripts/index/TAG
BioPerl-1.6.901/scripts/popgen
BioPerl-1.6.901/scripts/popgen/composite_LD.PLS
BioPerl-1.6.901/scripts/popgen/heterogeneity_test.PLS
BioPerl-1.6.901/scripts/searchio
BioPerl-1.6.901/scripts/searchio/fastam9_to_table.PLS
BioPerl-1.6.901/scripts/searchio/filter_search.PLS
BioPerl-1.6.901/scripts/searchio/hmmer_to_table.PLS
BioPerl-1.6.901/scripts/searchio/parse_hmmsearch.PLS
BioPerl-1.6.901/scripts/searchio/README
BioPerl-1.6.901/scripts/searchio/search2table.PLS
BioPerl-1.6.901/scripts/searchio/TAG
BioPerl-1.6.901/scripts/seq
BioPerl-1.6.901/scripts/seq/extract_feature_seq.PLS
BioPerl-1.6.901/scripts/seq/make_mrna_protein.PLS
BioPerl-1.6.901/scripts/seq/seqconvert.PLS
BioPerl-1.6.901/scripts/seq/seqretsplit.PLS
BioPerl-1.6.901/scripts/seq/split_seq.PLS
BioPerl-1.6.901/scripts/seq/TAG
BioPerl-1.6.901/scripts/seq/translate_seq.PLS
BioPerl-1.6.901/scripts/seq/unflatten_seq.PLS
BioPerl-1.6.901/scripts/seqstats
BioPerl-1.6.901/scripts/seqstats/aacomp.PLS
BioPerl-1.6.901/scripts/seqstats/chaos_plot.PLS
BioPerl-1.6.901/scripts/seqstats/gccalc.PLS
BioPerl-1.6.901/scripts/seqstats/oligo_count.PLS
BioPerl-1.6.901/scripts/seqstats/TAG
BioPerl-1.6.901/scripts/taxa
BioPerl-1.6.901/scripts/taxa/classify_hits_kingdom.PLS
BioPerl-1.6.901/scripts/taxa/local_taxonomydb_query.PLS
BioPerl-1.6.901/scripts/taxa/query_entrez_taxa.PLS
BioPerl-1.6.901/scripts/taxa/TAG
BioPerl-1.6.901/scripts/taxa/taxid4species.PLS
BioPerl-1.6.901/scripts/taxa/taxonomy2tree.PLS
BioPerl-1.6.901/scripts/tree
BioPerl-1.6.901/scripts/tree/blast2tree.PLS
BioPerl-1.6.901/scripts/tree/nexus2nh.PLS
BioPerl-1.6.901/scripts/tree/TAG
BioPerl-1.6.901/scripts/tree/tree2pag.PLS
BioPerl-1.6.901/scripts/utilities
BioPerl-1.6.901/scripts/utilities/bp_mrtrans.PLS
BioPerl-1.6.901/scripts/utilities/bp_netinstall.PLS
BioPerl-1.6.901/scripts/utilities/bp_nrdb.PLS
BioPerl-1.6.901/scripts/utilities/bp_sreformat.PLS
BioPerl-1.6.901/scripts/utilities/dbsplit.PLS
BioPerl-1.6.901/scripts/utilities/download_query_genbank.PLS
BioPerl-1.6.901/scripts/utilities/mask_by_search.PLS
BioPerl-1.6.901/scripts/utilities/mutate.PLS
BioPerl-1.6.901/scripts/utilities/pairwise_kaks.PLS
BioPerl-1.6.901/scripts/utilities/README
BioPerl-1.6.901/scripts/utilities/remote_blast.PLS
BioPerl-1.6.901/scripts/utilities/revtrans-motif.PLS
BioPerl-1.6.901/scripts/utilities/search2alnblocks.PLS
BioPerl-1.6.901/scripts/utilities/search2BSML.PLS
BioPerl-1.6.901/scripts/utilities/search2gff.PLS
BioPerl-1.6.901/scripts/utilities/search2tribe.PLS
BioPerl-1.6.901/scripts/utilities/seq_length.PLS
BioPerl-1.6.901/scripts/utilities/TAG
BioPerl-1.6.901/t
BioPerl-1.6.901/t/Alphabet.t
BioPerl-1.6.901/t/nexml.t
BioPerl-1.6.901/t/Perl.t
BioPerl-1.6.901/t/PodSyntax.t
BioPerl-1.6.901/t/SearchDist.t
BioPerl-1.6.901/t/SeqEvolution.t
BioPerl-1.6.901/t/Species.t
BioPerl-1.6.901/t/Symbol.t
BioPerl-1.6.901/t/TaxonTree.t
BioPerl-1.6.901/t/Align
BioPerl-1.6.901/t/Align/AlignStats.t
BioPerl-1.6.901/t/Align/AlignUtil.t
BioPerl-1.6.901/t/Align/Graphics.t
BioPerl-1.6.901/t/Align/SimpleAlign.t
BioPerl-1.6.901/t/Align/TreeBuild.t
BioPerl-1.6.901/t/Align/Utilities.t
BioPerl-1.6.901/t/AlignIO
BioPerl-1.6.901/t/AlignIO/AlignIO.t
BioPerl-1.6.901/t/AlignIO/arp.t
BioPerl-1.6.901/t/AlignIO/bl2seq.t
BioPerl-1.6.901/t/AlignIO/clustalw.t
BioPerl-1.6.901/t/AlignIO/emboss.t
BioPerl-1.6.901/t/AlignIO/fasta.t
BioPerl-1.6.901/t/AlignIO/largemultifasta.t
BioPerl-1.6.901/t/AlignIO/maf.t
BioPerl-1.6.901/t/AlignIO/mase.t
BioPerl-1.6.901/t/AlignIO/mega.t
BioPerl-1.6.901/t/AlignIO/meme.t
BioPerl-1.6.901/t/AlignIO/metafasta.t
BioPerl-1.6.901/t/AlignIO/msf.t
BioPerl-1.6.901/t/AlignIO/nexml.t
BioPerl-1.6.901/t/AlignIO/nexus.t
BioPerl-1.6.901/t/AlignIO/pfam.t
BioPerl-1.6.901/t/AlignIO/phylip.t
BioPerl-1.6.901/t/AlignIO/po.t
BioPerl-1.6.901/t/AlignIO/prodom.t
BioPerl-1.6.901/t/AlignIO/psi.t
BioPerl-1.6.901/t/AlignIO/selex.t
BioPerl-1.6.901/t/AlignIO/stockholm.t
BioPerl-1.6.901/t/AlignIO/xmfa.t
BioPerl-1.6.901/t/Annotation
BioPerl-1.6.901/t/Annotation/Annotation.t
BioPerl-1.6.901/t/Annotation/AnnotationAdaptor.t
BioPerl-1.6.901/t/Assembly
BioPerl-1.6.901/t/Assembly/ContigSpectrum.t
BioPerl-1.6.901/t/Assembly/core.t
BioPerl-1.6.901/t/Assembly/IO
BioPerl-1.6.901/t/Assembly/IO/bowtie.t
BioPerl-1.6.901/t/Assembly/IO/sam.t
BioPerl-1.6.901/t/Biblio
BioPerl-1.6.901/t/Biblio/Biblio.t
BioPerl-1.6.901/t/Biblio/biofetch.t
BioPerl-1.6.901/t/Biblio/eutils.t
BioPerl-1.6.901/t/Biblio/References.t
BioPerl-1.6.901/t/ClusterIO
BioPerl-1.6.901/t/ClusterIO/ClusterIO.t
BioPerl-1.6.901/t/ClusterIO/SequenceFamily.t
BioPerl-1.6.901/t/ClusterIO/unigene.t
BioPerl-1.6.901/t/Coordinate
BioPerl-1.6.901/t/Coordinate/CoordinateBoundaryTest.t
BioPerl-1.6.901/t/Coordinate/CoordinateGraph.t
BioPerl-1.6.901/t/Coordinate/CoordinateMapper.t
BioPerl-1.6.901/t/Coordinate/GeneCoordinateMapper.t
BioPerl-1.6.901/t/data
BioPerl-1.6.901/t/data/01_basic.xml
BioPerl-1.6.901/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_dogfish_no_taxrefs.xml
BioPerl-1.6.901/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_no_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/03_bootstraps.xml
BioPerl-1.6.901/t/data/03_bootstraps_in_tag.xml
BioPerl-1.6.901/t/data/04_labeled_ancestors.xml
BioPerl-1.6.901/t/data/05_ancestral_states.xml
BioPerl-1.6.901/t/data/1.bed
BioPerl-1.6.901/t/data/13-pilE-F.scf
BioPerl-1.6.901/t/data/1A11.pdb
BioPerl-1.6.901/t/data/1A3I.pdb
BioPerl-1.6.901/t/data/1BPT.pdb
BioPerl-1.6.901/t/data/1ZZ19XR301R-Alignment.tblastn
BioPerl-1.6.901/t/data/2008.blasttable
BioPerl-1.6.901/t/data/27-contig_Newbler.ace
BioPerl-1.6.901/t/data/503384.MEGABLAST.0
BioPerl-1.6.901/t/data/503384.MEGABLAST.2
BioPerl-1.6.901/t/data/5X_1895.FASTXY
BioPerl-1.6.901/t/data/8HVP.pdb
BioPerl-1.6.901/t/data/a_thaliana.blastn
BioPerl-1.6.901/t/data/AAC12660.fa
BioPerl-1.6.901/t/data/aaml.mlc
BioPerl-1.6.901/t/data/aaml_pairwise.mlc
BioPerl-1.6.901/t/data/AB077698.gb
BioPerl-1.6.901/t/data/acefile.ace.1
BioPerl-1.6.901/t/data/acefile.singlets
BioPerl-1.6.901/t/data/adh.mb_tree.nexus
BioPerl-1.6.901/t/data/AE003528_ecoli.bls
BioPerl-1.6.901/t/data/AE003644_Adh-genomic.gb
BioPerl-1.6.901/t/data/AF032047.gbk
BioPerl-1.6.901/t/data/AF165282.gb
BioPerl-1.6.901/t/data/AF305198.gb
BioPerl-1.6.901/t/data/AHCYL1.kegg
BioPerl-1.6.901/t/data/alleles.fas
BioPerl-1.6.901/t/data/alnfile.fasta
BioPerl-1.6.901/t/data/amino.fa
BioPerl-1.6.901/t/data/AnnIX-v003.gbk
BioPerl-1.6.901/t/data/ar.embl
BioPerl-1.6.901/t/data/assembly_with_singlets.ace
BioPerl-1.6.901/t/data/ATF14F8.gbk
BioPerl-1.6.901/t/data/atp1.matrix
BioPerl-1.6.901/t/data/ay007676.gb
BioPerl-1.6.901/t/data/AY095303S1.gbk
BioPerl-1.6.901/t/data/ay116458.gb
BioPerl-1.6.901/t/data/ay149291.gb
BioPerl-1.6.901/t/data/AY763288.gb
BioPerl-1.6.901/t/data/BAB68554.gb
BioPerl-1.6.901/t/data/barns-combined.nex
BioPerl-1.6.901/t/data/baseml.pairwise
BioPerl-1.6.901/t/data/baseml.usertree
BioPerl-1.6.901/t/data/basic-bush.nex
BioPerl-1.6.901/t/data/basic-ladder.nex
BioPerl-1.6.901/t/data/BC000007.gbk
BioPerl-1.6.901/t/data/BEL16-LTR_AG.embl
BioPerl-1.6.901/t/data/biofpc.cor
BioPerl-1.6.901/t/data/biofpc.fpc
BioPerl-1.6.901/t/data/biorecipe.nhx
BioPerl-1.6.901/t/data/Bird_Ovomucoids.nex
BioPerl-1.6.901/t/data/BK000016-tpa.gbk
BioPerl-1.6.901/t/data/bl2seq.blastn
BioPerl-1.6.901/t/data/bl2seq.blastn.rev
BioPerl-1.6.901/t/data/bl2seq.blastx.out
BioPerl-1.6.901/t/data/bl2seq.bug940.out
BioPerl-1.6.901/t/data/bl2seq.out
BioPerl-1.6.901/t/data/bl2seq.tblastx.out
BioPerl-1.6.901/t/data/blast.report
BioPerl-1.6.901/t/data/blast_no_hit_desc.txt
BioPerl-1.6.901/t/data/blast_plus.blastp
BioPerl-1.6.901/t/data/blastp2215.blast
BioPerl-1.6.901/t/data/blat.psLayout3
BioPerl-1.6.901/t/data/BLOSUM50
BioPerl-1.6.901/t/data/blosum62.bla
BioPerl-1.6.901/t/data/BN000066-tpa.embl
BioPerl-1.6.901/t/data/bootstrap.tre
BioPerl-1.6.901/t/data/BOSS_DROME.FASTP_v35_04
BioPerl-1.6.901/t/data/branchSite.mlc
BioPerl-1.6.901/t/data/brassica_ATH.WUBLASTN
BioPerl-1.6.901/t/data/bug1986.blast2
BioPerl-1.6.901/t/data/bug1986.blastp
BioPerl-1.6.901/t/data/bug2120.phd
BioPerl-1.6.901/t/data/bug2246.blast
BioPerl-1.6.901/t/data/bug2391.megablast
BioPerl-1.6.901/t/data/bug2399.tblastn
BioPerl-1.6.901/t/data/bug2453.maf
BioPerl-1.6.901/t/data/bug2473.fasta
BioPerl-1.6.901/t/data/bug2862.pmr
BioPerl-1.6.901/t/data/bug2869.tree
BioPerl-1.6.901/t/data/bug2901.fa
BioPerl-1.6.901/t/data/bug2937.fasta
BioPerl-1.6.901/t/data/bug2942.blastx
BioPerl-1.6.901/t/data/bug2982.embl
BioPerl-1.6.901/t/data/bug2982.gb
BioPerl-1.6.901/t/data/bug3021.gmap
BioPerl-1.6.901/t/data/bug3086.embl
BioPerl-1.6.901/t/data/c200-vs-yeast.BLASTN
BioPerl-1.6.901/t/data/c200-vs-yeast.BLASTN.m8
BioPerl-1.6.901/t/data/calm.swiss
BioPerl-1.6.901/t/data/catalase-webblast.BLASTP
BioPerl-1.6.901/t/data/cds-266.fas
BioPerl-1.6.901/t/data/cds_sample.embl
BioPerl-1.6.901/t/data/CG11099.fasaln
BioPerl-1.6.901/t/data/CG2865.fasaln
BioPerl-1.6.901/t/data/chad100.scf
BioPerl-1.6.901/t/data/char-interleave.nex
BioPerl-1.6.901/t/data/char-matrix-spaces.nex
BioPerl-1.6.901/t/data/characters+trees.nexml.xml
BioPerl-1.6.901/t/data/characters.nexml.old.xml
BioPerl-1.6.901/t/data/codeml.mlc
BioPerl-1.6.901/t/data/codeml315.mlc
BioPerl-1.6.901/t/data/codeml4.mlc
BioPerl-1.6.901/t/data/codeml43.mlc
BioPerl-1.6.901/t/data/codeml43_nssites.mlc
BioPerl-1.6.901/t/data/codeml_nan.mlc
BioPerl-1.6.901/t/data/codeml_nssites.mlc
BioPerl-1.6.901/t/data/compLD_missingtest.prettybase
BioPerl-1.6.901/t/data/compLD_test.prettybase
BioPerl-1.6.901/t/data/component.ontology.test
BioPerl-1.6.901/t/data/component.ontology.test2
BioPerl-1.6.901/t/data/contig-by-hand.wublastp
BioPerl-1.6.901/t/data/contigspectrumtest.tigr
BioPerl-1.6.901/t/data/crab.dat.cn
BioPerl-1.6.901/t/data/crab.nj
BioPerl-1.6.901/t/data/crab.njb
BioPerl-1.6.901/t/data/crypto.sim4-0
BioPerl-1.6.901/t/data/crypto.sim4-3
BioPerl-1.6.901/t/data/crypto.sim4-4
BioPerl-1.6.901/t/data/ctgdemo.fpc
BioPerl-1.6.901/t/data/cys1_dicdi.water
BioPerl-1.6.901/t/data/cysprot.fa
BioPerl-1.6.901/t/data/cysprot.msf
BioPerl-1.6.901/t/data/cysprot.needle
BioPerl-1.6.901/t/data/cysprot.tblastn
BioPerl-1.6.901/t/data/cysprot.water
BioPerl-1.6.901/t/data/cysprot1.fa
BioPerl-1.6.901/t/data/cysprot1.FASTA
BioPerl-1.6.901/t/data/cysprot1a.fa
BioPerl-1.6.901/t/data/cysprot1a.msf
BioPerl-1.6.901/t/data/cysprot1b.fa
BioPerl-1.6.901/t/data/cysprot1b.hmmsearch
BioPerl-1.6.901/t/data/cysprot1b.msf
BioPerl-1.6.901/t/data/cysprot1b.newick
BioPerl-1.6.901/t/data/cysprot_vs_gadfly.FASTA
BioPerl-1.6.901/t/data/D10483.gbk
BioPerl-1.6.901/t/data/D12555.gbk
BioPerl-1.6.901/t/data/dcr1_sp.WUBLASTP
BioPerl-1.6.901/t/data/directives.gff3
BioPerl-1.6.901/t/data/dmel_2Lchunk.gb
BioPerl-1.6.901/t/data/dna1.fa
BioPerl-1.6.901/t/data/dna2.fa
BioPerl-1.6.901/t/data/dnaE-bsub-prot.fa
BioPerl-1.6.901/t/data/dnaE-bsub.fa
BioPerl-1.6.901/t/data/dnaEbsub_ecoli.wublastx
BioPerl-1.6.901/t/data/dnaEbsub_ecoli.wutblastn
BioPerl-1.6.901/t/data/dnaEbsub_ecoli.wutblastx
BioPerl-1.6.901/t/data/DQ018368.gb
BioPerl-1.6.901/t/data/dq519393.gb
BioPerl-1.6.901/t/data/ECAPAH02.embl
BioPerl-1.6.901/t/data/echofilter.wublastn
BioPerl-1.6.901/t/data/ecoli-trna-qrna.out
BioPerl-1.6.901/t/data/ecoli_domains.rps.xml
BioPerl-1.6.901/t/data/ecoli_domains.rpsblast
BioPerl-1.6.901/t/data/ecolitst.bls
BioPerl-1.6.901/t/data/ecolitst.fa
BioPerl-1.6.901/t/data/ecolitst.noseqs.wublastp
BioPerl-1.6.901/t/data/ecolitst.wublastp
BioPerl-1.6.901/t/data/EG352462.gbxml
BioPerl-1.6.901/t/data/empty.bl2seq
BioPerl-1.6.901/t/data/ENr111.mfa.example.elems
BioPerl-1.6.901/t/data/entrezgene.dat
BioPerl-1.6.901/t/data/ex1.nucl.nhx
BioPerl-1.6.901/t/data/example.hap
BioPerl-1.6.901/t/data/example.phase
BioPerl-1.6.901/t/data/example.vcf
BioPerl-1.6.901/t/data/exonerate.output.dontwork
BioPerl-1.6.901/t/data/exonerate.output.works
BioPerl-1.6.901/t/data/exonerate.whitespace_before_query.works
BioPerl-1.6.901/t/data/expected.blast.out
BioPerl-1.6.901/t/data/exsignalp.out
BioPerl-1.6.901/t/data/factor7.embl
BioPerl-1.6.901/t/data/Fang_2003.xml
BioPerl-1.6.901/t/data/fgenesh.out
BioPerl-1.6.901/t/data/footprinter.out
BioPerl-1.6.901/t/data/frac_problems.blast
BioPerl-1.6.901/t/data/frac_problems2.blast
BioPerl-1.6.901/t/data/frac_problems3.blast
BioPerl-1.6.901/t/data/geneid_1.0.out
BioPerl-1.6.901/t/data/genemark-fragment.out
BioPerl-1.6.901/t/data/genemark.out
BioPerl-1.6.901/t/data/genewise.out
BioPerl-1.6.901/t/data/genewise_output.paracel_btk
BioPerl-1.6.901/t/data/genomewise.out
BioPerl-1.6.901/t/data/genomic-seq.epcr
BioPerl-1.6.901/t/data/genomic-seq.fasta
BioPerl-1.6.901/t/data/genomic-seq.genscan
BioPerl-1.6.901/t/data/genomic-seq.mzef
BioPerl-1.6.901/t/data/Genscan.FastA
BioPerl-1.6.901/t/data/gf-s71.needle
BioPerl-1.6.901/t/data/Glimmer2.out
BioPerl-1.6.901/t/data/glimmer3-fragment.detail
BioPerl-1.6.901/t/data/glimmer3-fragment.predict
BioPerl-1.6.901/t/data/Glimmer3.detail
BioPerl-1.6.901/t/data/Glimmer3.predict
BioPerl-1.6.901/t/data/GlimmerHMM.out
BioPerl-1.6.901/t/data/GlimmerM.out
BioPerl-1.6.901/t/data/gmap_f9-multiple_results.txt
BioPerl-1.6.901/t/data/gmap_f9-reverse-strand.txt
BioPerl-1.6.901/t/data/gmap_f9.txt
BioPerl-1.6.901/t/data/GO.defs.test
BioPerl-1.6.901/t/data/GO.defs.test2
BioPerl-1.6.901/t/data/headerless.psl
BioPerl-1.6.901/t/data/hemoglobinA.meg
BioPerl-1.6.901/t/data/hg16_chroms.gff
BioPerl-1.6.901/t/data/hmmpfam.out
BioPerl-1.6.901/t/data/hmmpfam_cs.out
BioPerl-1.6.901/t/data/hmmpfam_fake.out
BioPerl-1.6.901/t/data/hmmscan.out
BioPerl-1.6.901/t/data/hmmscan_multi_domain.out
BioPerl-1.6.901/t/data/hmmscan_sec_struct.out
BioPerl-1.6.901/t/data/hmmsearch.out
BioPerl-1.6.901/t/data/hmmsearch3.out
BioPerl-1.6.901/t/data/hs_est.est2genome
BioPerl-1.6.901/t/data/hs_fugu.newick
BioPerl-1.6.901/t/data/hs_owlmonkey.aln
BioPerl-1.6.901/t/data/hs_owlmonkey.fas
BioPerl-1.6.901/t/data/hs_owlmonkey.fasta
BioPerl-1.6.901/t/data/hsinsulin.blastcl3.blastn
BioPerl-1.6.901/t/data/HUMBETGLOA.fa
BioPerl-1.6.901/t/data/HUMBETGLOA.FASTA
BioPerl-1.6.901/t/data/HUMBETGLOA.gff
BioPerl-1.6.901/t/data/HUMBETGLOA.grail
BioPerl-1.6.901/t/data/HUMBETGLOA.grailexp
BioPerl-1.6.901/t/data/HUMBETGLOA.mzef
BioPerl-1.6.901/t/data/HUMBETGLOA.tblastx
BioPerl-1.6.901/t/data/humor.maf
BioPerl-1.6.901/t/data/humts1.pal
BioPerl-1.6.901/t/data/hybrid1.gff3
BioPerl-1.6.901/t/data/hybrid2.gff3
BioPerl-1.6.901/t/data/in.fasta
BioPerl-1.6.901/t/data/insulin.water
BioPerl-1.6.901/t/data/interpro.xml
BioPerl-1.6.901/t/data/interpro_ebi.xml
BioPerl-1.6.901/t/data/interpro_relationship.xml
BioPerl-1.6.901/t/data/interpro_sample.xml
BioPerl-1.6.901/t/data/interpro_short.xml
BioPerl-1.6.901/t/data/intrablock-comment.nex
BioPerl-1.6.901/t/data/Kingdoms_DNA.nex
BioPerl-1.6.901/t/data/knownGene.gff3
BioPerl-1.6.901/t/data/L77119.hmmer
BioPerl-1.6.901/t/data/little.largemultifasta
BioPerl-1.6.901/t/data/LittleChrY.dbsnp.xml
BioPerl-1.6.901/t/data/LOAD_Ccd1.dnd
BioPerl-1.6.901/t/data/long-names.nex
BioPerl-1.6.901/t/data/longnames.aln
BioPerl-1.6.901/t/data/longnames.dnd
BioPerl-1.6.901/t/data/lucy.info
BioPerl-1.6.901/t/data/lucy.qual
BioPerl-1.6.901/t/data/lucy.seq
BioPerl-1.6.901/t/data/lucy.stderr
BioPerl-1.6.901/t/data/lysozyme6.protml
BioPerl-1.6.901/t/data/lysozyme6.simple.protml
BioPerl-1.6.901/t/data/M0.mlc
BioPerl-1.6.901/t/data/M12730.gb
BioPerl-1.6.901/t/data/mapmaker.out
BioPerl-1.6.901/t/data/mapmaker.txt
BioPerl-1.6.901/t/data/mast.dat
BioPerl-1.6.901/t/data/masta.dat
BioPerl-1.6.901/t/data/match.output
BioPerl-1.6.901/t/data/Mcjanrna_rdbII.gbk
BioPerl-1.6.901/t/data/megablast_output.paracel_btk
BioPerl-1.6.901/t/data/meme.dat
BioPerl-1.6.901/t/data/mini-AE001405.gb
BioPerl-1.6.901/t/data/mini-align.aln
BioPerl-1.6.901/t/data/mixedmast.dat
BioPerl-1.6.901/t/data/MmCT
BioPerl-1.6.901/t/data/mpath.ontology.test
BioPerl-1.6.901/t/data/MSGEFTUA.gb
BioPerl-1.6.901/t/data/multi.blast.m8
BioPerl-1.6.901/t/data/multi.blast.m9
BioPerl-1.6.901/t/data/multi.phd
BioPerl-1.6.901/t/data/multi_1.fa
BioPerl-1.6.901/t/data/multi_2.fa
BioPerl-1.6.901/t/data/multi_blast.bls
BioPerl-1.6.901/t/data/multifa.seq
BioPerl-1.6.901/t/data/multifa.seq.qual
BioPerl-1.6.901/t/data/multiline-intrablock-comment.nex
BioPerl-1.6.901/t/data/multiseq.bls
BioPerl-1.6.901/t/data/multiseq_tags.phd
BioPerl-1.6.901/t/data/mus.bls.xml
BioPerl-1.6.901/t/data/mutations.dat
BioPerl-1.6.901/t/data/mutations.old.dat
BioPerl-1.6.901/t/data/mutations.old.xml
BioPerl-1.6.901/t/data/mutations.xml
BioPerl-1.6.901/t/data/myco_sites.gff
BioPerl-1.6.901/t/data/NC_001284.gbk
BioPerl-1.6.901/t/data/NC_006346.gb
BioPerl-1.6.901/t/data/NC_006511-short.gbk
BioPerl-1.6.901/t/data/NC_008536.gb
BioPerl-1.6.901/t/data/nei_gojobori_test.aln
BioPerl-1.6.901/t/data/neighbor.dist
BioPerl-1.6.901/t/data/new_blastn.txt
BioPerl-1.6.901/t/data/newblast.xml
BioPerl-1.6.901/t/data/nhx-bacteria.nhx
BioPerl-1.6.901/t/data/NM_002254.gb
BioPerl-1.6.901/t/data/no-genes.genscan
BioPerl-1.6.901/t/data/no_cds_example.gb
BioPerl-1.6.901/t/data/no_FH.embl
BioPerl-1.6.901/t/data/no_hsps.blastp
BioPerl-1.6.901/t/data/no_semicolon.newick
BioPerl-1.6.901/t/data/noninterleaved.phy
BioPerl-1.6.901/t/data/NT_021877.gbk
BioPerl-1.6.901/t/data/nucmatrix.txt
BioPerl-1.6.901/t/data/O_sat.wgs
BioPerl-1.6.901/t/data/omim_genemap_test
BioPerl-1.6.901/t/data/omim_genemap_test_nolinebreak
BioPerl-1.6.901/t/data/omim_text_test
BioPerl-1.6.901/t/data/P33897
BioPerl-1.6.901/t/data/P35527.gb
BioPerl-1.6.901/t/data/P39765.gb
BioPerl-1.6.901/t/data/PAM250
BioPerl-1.6.901/t/data/pep-266.aln
BioPerl-1.6.901/t/data/pfam_tests.stk
BioPerl-1.6.901/t/data/phi.out
BioPerl-1.6.901/t/data/phipsi.out
BioPerl-1.6.901/t/data/phylipdist-36.out
BioPerl-1.6.901/t/data/phylipdist.out
BioPerl-1.6.901/t/data/phyloxml_examples.xml
BioPerl-1.6.901/t/data/pictogram.fa
BioPerl-1.6.901/t/data/plague_yeast.bls.xml
BioPerl-1.6.901/t/data/polymorphism.dat
BioPerl-1.6.901/t/data/polymorphism.old.xml
BioPerl-1.6.901/t/data/polymorphism.xml
BioPerl-1.6.901/t/data/popgen_saureus.dat
BioPerl-1.6.901/t/data/popgen_saureus.multidat
BioPerl-1.6.901/t/data/popstats.prettybase
BioPerl-1.6.901/t/data/pre_rel9.swiss
BioPerl-1.6.901/t/data/Primate_mtDNA.nex
BioPerl-1.6.901/t/data/primedseq.fa
BioPerl-1.6.901/t/data/primer3_infile.txt
BioPerl-1.6.901/t/data/primer3_outfile.txt
BioPerl-1.6.901/t/data/primer3_output.txt
BioPerl-1.6.901/t/data/prints.out
BioPerl-1.6.901/t/data/promoterwise.out
BioPerl-1.6.901/t/data/protpars.phy
BioPerl-1.6.901/t/data/protpars_longid.phy
BioPerl-1.6.901/t/data/pseudowise.out
BioPerl-1.6.901/t/data/psi_xml.dat
BioPerl-1.6.901/t/data/psiblast.xml
BioPerl-1.6.901/t/data/psiblastreport.out
BioPerl-1.6.901/t/data/purine_v081.infernal
BioPerl-1.6.901/t/data/puzzle.tre
BioPerl-1.6.901/t/data/PX1CG.gb
BioPerl-1.6.901/t/data/Q8GBD3.swiss
BioPerl-1.6.901/t/data/qrna-relloc.out
BioPerl-1.6.901/t/data/qualfile.qual
BioPerl-1.6.901/t/data/quoted-strings1.nex
BioPerl-1.6.901/t/data/quoted-strings2.nex
BioPerl-1.6.901/t/data/Rab1.chaos-xml
BioPerl-1.6.901/t/data/radical-whitespace.nex
BioPerl-1.6.901/t/data/radical-whitespace_02.nex
BioPerl-1.6.901/t/data/rebase.itype2
BioPerl-1.6.901/t/data/rebase.withrefm
BioPerl-1.6.901/t/data/reference_ace.ace
BioPerl-1.6.901/t/data/regulation_test.obo
BioPerl-1.6.901/t/data/rel9.swiss
BioPerl-1.6.901/t/data/repeatmasker.fa.out
BioPerl-1.6.901/t/data/revcomp_mrna.gb
BioPerl-1.6.901/t/data/rfam_tests.stk
BioPerl-1.6.901/t/data/ribosome-slippage.gb
BioPerl-1.6.901/t/data/roa1.dat
BioPerl-1.6.901/t/data/roa1.gbxml
BioPerl-1.6.901/t/data/roa1.genbank
BioPerl-1.6.901/t/data/roa1.swiss
BioPerl-1.6.901/t/data/roa1_v2.dat
BioPerl-1.6.901/t/data/rpsblast.bls
BioPerl-1.6.901/t/data/sample_dataset.tigr
BioPerl-1.6.901/t/data/sbay_c127.fas
BioPerl-1.6.901/t/data/sbay_c545-yeast.BLASTZ.PSL
BioPerl-1.6.901/t/data/seg.out
BioPerl-1.6.901/t/data/semicolon.newick
BioPerl-1.6.901/t/data/seqdatabase.ini
BioPerl-1.6.901/t/data/seqfile.pir
BioPerl-1.6.901/t/data/seqs.fas
BioPerl-1.6.901/t/data/sequencefamily.dat
BioPerl-1.6.901/t/data/seqxml.xml
BioPerl-1.6.901/t/data/short.blx
BioPerl-1.6.901/t/data/signalp.hmm.short
BioPerl-1.6.901/t/data/signalp.hmm.summary
BioPerl-1.6.901/t/data/signalp.negative.out
BioPerl-1.6.901/t/data/signalp.nn.short
BioPerl-1.6.901/t/data/signalp.nn.summary
BioPerl-1.6.901/t/data/signalp.positive.out
BioPerl-1.6.901/t/data/signalp.short
BioPerl-1.6.901/t/data/signalp.summary
BioPerl-1.6.901/t/data/sim4.for.for
BioPerl-1.6.901/t/data/sim4.for.rev
BioPerl-1.6.901/t/data/sim4.rev
BioPerl-1.6.901/t/data/singleNSsite.mlc
BioPerl-1.6.901/t/data/singlet_w_CT.ace
BioPerl-1.6.901/t/data/so.obo
BioPerl-1.6.901/t/data/sofa.ontology
BioPerl-1.6.901/t/data/sp_subset.obo
BioPerl-1.6.901/t/data/spaces.nex
BioPerl-1.6.901/t/data/SPAN_Family4nl.nex
BioPerl-1.6.901/t/data/SPAN_Family7n.nex
BioPerl-1.6.901/t/data/SPAN_Family8a.nex
BioPerl-1.6.901/t/data/sparsealn.needle
BioPerl-1.6.901/t/data/spidey.noalignment
BioPerl-1.6.901/t/data/spidey.test1
BioPerl-1.6.901/t/data/sprintf.rnamotif
BioPerl-1.6.901/t/data/ssp160.embl.1
BioPerl-1.6.901/t/data/stress_test_medline.xml
BioPerl-1.6.901/t/data/stress_test_pubmed.xml
BioPerl-1.6.901/t/data/sv40_small.xml
BioPerl-1.6.901/t/data/swiss.dat
BioPerl-1.6.901/t/data/swisspfam.data
BioPerl-1.6.901/t/data/SwissProt.dat
BioPerl-1.6.901/t/data/T7.aln
BioPerl-1.6.901/t/data/tab1part.mif
BioPerl-1.6.901/t/data/tab2part.mif
BioPerl-1.6.901/t/data/tab3part.mif
BioPerl-1.6.901/t/data/tandem_repeats_finder.dat
BioPerl-1.6.901/t/data/tandem_repeats_finder.noresults
BioPerl-1.6.901/t/data/tandem_repeats_finder_no_desc.dat
BioPerl-1.6.901/t/data/targetp.out
BioPerl-1.6.901/t/data/tblastn.out
BioPerl-1.6.901/t/data/test 2.txt
BioPerl-1.6.901/t/data/test.abi
BioPerl-1.6.901/t/data/test.ace
BioPerl-1.6.901/t/data/test.bam
BioPerl-1.6.901/t/data/test.bowtie
BioPerl-1.6.901/t/data/test.cns.fastq
BioPerl-1.6.901/t/data/test.ctf
BioPerl-1.6.901/t/data/test.embl
BioPerl-1.6.901/t/data/test.embl2sq
BioPerl-1.6.901/t/data/test.exp
BioPerl-1.6.901/t/data/test.fasta
BioPerl-1.6.901/t/data/test.fastq
BioPerl-1.6.901/t/data/test.game
BioPerl-1.6.901/t/data/test.gcg
BioPerl-1.6.901/t/data/test.gcgblast
BioPerl-1.6.901/t/data/test.gcgfasta
BioPerl-1.6.901/t/data/test.genbank
BioPerl-1.6.901/t/data/test.genbank.noseq
BioPerl-1.6.901/t/data/test.infernal
BioPerl-1.6.901/t/data/test.interpro
BioPerl-1.6.901/t/data/test.interpro-go.xml
BioPerl-1.6.901/t/data/test.lasergene
BioPerl-1.6.901/t/data/test.locuslink
BioPerl-1.6.901/t/data/test.maq
BioPerl-1.6.901/t/data/test.mase
BioPerl-1.6.901/t/data/test.meme
BioPerl-1.6.901/t/data/test.meme2
BioPerl-1.6.901/t/data/test.metafasta
BioPerl-1.6.901/t/data/test.nh
BioPerl-1.6.901/t/data/test.nhx
BioPerl-1.6.901/t/data/test.pfam
BioPerl-1.6.901/t/data/test.phd
BioPerl-1.6.901/t/data/test.pir
BioPerl-1.6.901/t/data/test.pln
BioPerl-1.6.901/t/data/test.ptt
BioPerl-1.6.901/t/data/test.raw
BioPerl-1.6.901/t/data/test.ref.fas
BioPerl-1.6.901/t/data/test.swiss
BioPerl-1.6.901/t/data/test.tab
BioPerl-1.6.901/t/data/test.tigrxml
BioPerl-1.6.901/t/data/test.tseq
BioPerl-1.6.901/t/data/test.tsv
BioPerl-1.6.901/t/data/test.txt
BioPerl-1.6.901/t/data/test.waba
BioPerl-1.6.901/t/data/test.xls
BioPerl-1.6.901/t/data/test.ztr
BioPerl-1.6.901/t/data/test1.blasttab3
BioPerl-1.6.901/t/data/test1.wublastp
BioPerl-1.6.901/t/data/test2.infernal
BioPerl-1.6.901/t/data/test2.raw
BioPerl-1.6.901/t/data/test_badlf.gcg
BioPerl-1.6.901/t/data/test_clear_range.fastq
BioPerl-1.6.901/t/data/test_data.axt
BioPerl-1.6.901/t/data/test_singlets.cns.fastq
BioPerl-1.6.901/t/data/test_singlets.maq
BioPerl-1.6.901/t/data/testaln.aln
BioPerl-1.6.901/t/data/testaln.arp
BioPerl-1.6.901/t/data/testaln.fasta
BioPerl-1.6.901/t/data/testaln.fastq
BioPerl-1.6.901/t/data/testaln.list
BioPerl-1.6.901/t/data/testaln.mase
BioPerl-1.6.901/t/data/testaln.metafasta
BioPerl-1.6.901/t/data/testaln.msf
BioPerl-1.6.901/t/data/testaln.nexus
BioPerl-1.6.901/t/data/testaln.pfam
BioPerl-1.6.901/t/data/testaln.phylip
BioPerl-1.6.901/t/data/testaln.po
BioPerl-1.6.901/t/data/testaln.prodom
BioPerl-1.6.901/t/data/testaln.psi
BioPerl-1.6.901/t/data/testaln.selex
BioPerl-1.6.901/t/data/testaln.stockholm
BioPerl-1.6.901/t/data/testaln.xmfa
BioPerl-1.6.901/t/data/testaln2.arp
BioPerl-1.6.901/t/data/testaln2.fasta
BioPerl-1.6.901/t/data/testdat.exonerate
BioPerl-1.6.901/t/data/testdata.crossmatch
BioPerl-1.6.901/t/data/testdbaccnums.out
BioPerl-1.6.901/t/data/testfile.erpin
BioPerl-1.6.901/t/data/testfuzzy.genbank
BioPerl-1.6.901/t/data/tmhmm.out
BioPerl-1.6.901/t/data/tmp.fst
BioPerl-1.6.901/t/data/tol-2010-02-18.nhx
BioPerl-1.6.901/t/data/traits.tab
BioPerl-1.6.901/t/data/traittree.nexus
BioPerl-1.6.901/t/data/transfac.dat
BioPerl-1.6.901/t/data/tree_nonewline.nexus
BioPerl-1.6.901/t/data/Treebase-chlamy-dna.nex
BioPerl-1.6.901/t/data/trees.nexml.old.xml
BioPerl-1.6.901/t/data/tricky.wublast
BioPerl-1.6.901/t/data/trna.strict.rnamotif
BioPerl-1.6.901/t/data/U58726.gb
BioPerl-1.6.901/t/data/U71225.gb
BioPerl-1.6.901/t/data/U71225.gb.unix
BioPerl-1.6.901/t/data/U71225.gb.win
BioPerl-1.6.901/t/data/U83300.bsml
BioPerl-1.6.901/t/data/UnaSmithHIV-both.nex
BioPerl-1.6.901/t/data/unigene.data
BioPerl-1.6.901/t/data/urease.tre.nexus
BioPerl-1.6.901/t/data/vecscreen_simple.test_output
BioPerl-1.6.901/t/data/version2.scf
BioPerl-1.6.901/t/data/version3.scf
BioPerl-1.6.901/t/data/wellcome_tol.nhx
BioPerl-1.6.901/t/data/withrefm.906
BioPerl-1.6.901/t/data/worm_fam_2785.cdna
BioPerl-1.6.901/t/data/X98338_Adh-mRNA.gb
BioPerl-1.6.901/t/data/yeast.tRNAscanSE
BioPerl-1.6.901/t/data/yn00.mlc
BioPerl-1.6.901/t/data/ZABJ4EA7014.CH878695.1.blast.txt
BioPerl-1.6.901/t/data/bad_dbfa
BioPerl-1.6.901/t/data/bad_dbfa/bug3172.fa
BioPerl-1.6.901/t/data/biodbgff
BioPerl-1.6.901/t/data/biodbgff/test.gff
BioPerl-1.6.901/t/data/biodbgff/test.gff3
BioPerl-1.6.901/t/data/codeml_lysozyme
BioPerl-1.6.901/t/data/codeml_lysozyme/2NG.dN
BioPerl-1.6.901/t/data/codeml_lysozyme/2NG.dS
BioPerl-1.6.901/t/data/codeml_lysozyme/2NG.tt
BioPerl-1.6.901/t/data/codeml_lysozyme/4fold.nuc
BioPerl-1.6.901/t/data/codeml_lysozyme/lnf
BioPerl-1.6.901/t/data/codeml_lysozyme/lysozymeSmall.ctl
BioPerl-1.6.901/t/data/codeml_lysozyme/lysozymeSmall.trees
BioPerl-1.6.901/t/data/codeml_lysozyme/lysozymeSmall.txt
BioPerl-1.6.901/t/data/codeml_lysozyme/mlc
BioPerl-1.6.901/t/data/codeml_lysozyme/rst
BioPerl-1.6.901/t/data/codeml_lysozyme/rst1
BioPerl-1.6.901/t/data/codeml_lysozyme/rub
BioPerl-1.6.901/t/data/consed_project
BioPerl-1.6.901/t/data/consed_project/edit_dir
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.contigs
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.log
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.log
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.problems
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.qual
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.view
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.newtags
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.phrap.out
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.screen.out
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project_to_alu.cross
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_projectNewChromats.fof
BioPerl-1.6.901/t/data/consed_project/phd_dir
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4922R.phd.1
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4924F.phd.1
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4924R.phd.1
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4947F.phd.1
BioPerl-1.6.901/t/data/dbfa
BioPerl-1.6.901/t/data/dbfa/1.fa
BioPerl-1.6.901/t/data/dbfa/2.fa
BioPerl-1.6.901/t/data/dbfa/3.fa
BioPerl-1.6.901/t/data/dbfa/4.fa
BioPerl-1.6.901/t/data/dbfa/5.fa
BioPerl-1.6.901/t/data/dbfa/6.fa
BioPerl-1.6.901/t/data/dbfa/7.fa
BioPerl-1.6.901/t/data/dbqual
BioPerl-1.6.901/t/data/dbqual/1.qual
BioPerl-1.6.901/t/data/dbqual/2.qual
BioPerl-1.6.901/t/data/dbqual/3.qual
BioPerl-1.6.901/t/data/eutils
BioPerl-1.6.901/t/data/eutils/egquery.xml
BioPerl-1.6.901/t/data/eutils/einfo.xml
BioPerl-1.6.901/t/data/eutils/einfo_dbs.xml
BioPerl-1.6.901/t/data/eutils/elink_acheck.xml
BioPerl-1.6.901/t/data/eutils/elink_acheck_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_dball.xml
BioPerl-1.6.901/t/data/eutils/elink_lcheck.xml
BioPerl-1.6.901/t/data/eutils/elink_lcheck_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_llinks.xml
BioPerl-1.6.901/t/data/eutils/elink_llinks_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_multidb.xml
BioPerl-1.6.901/t/data/eutils/elink_multidb_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_ncheck.xml
BioPerl-1.6.901/t/data/eutils/elink_ncheck_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_neighbor.xml
BioPerl-1.6.901/t/data/eutils/elink_neighbor_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_nhist.xml
BioPerl-1.6.901/t/data/eutils/elink_nhist_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_scores.xml
BioPerl-1.6.901/t/data/eutils/epost.xml
BioPerl-1.6.901/t/data/eutils/esearch1.xml
BioPerl-1.6.901/t/data/eutils/esearch2.xml
BioPerl-1.6.901/t/data/eutils/espell.xml
BioPerl-1.6.901/t/data/eutils/esummary1.xml
BioPerl-1.6.901/t/data/eutils/esummary2.xml
BioPerl-1.6.901/t/data/fastq
BioPerl-1.6.901/t/data/fastq/bug2335.fastq
BioPerl-1.6.901/t/data/fastq/error_diff_ids.fastq
BioPerl-1.6.901/t/data/fastq/error_double_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_double_seq.fastq
BioPerl-1.6.901/t/data/fastq/error_long_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_no_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_del.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_escape.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_null.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_space.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_tab.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_unit_sep.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_vtab.fastq
BioPerl-1.6.901/t/data/fastq/error_short_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_spaces.fastq
BioPerl-1.6.901/t/data/fastq/error_tabs.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_at_plus.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_at_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_at_seq.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_plus.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_seq.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_title.fastq
BioPerl-1.6.901/t/data/fastq/evil_wrapping.fastq
BioPerl-1.6.901/t/data/fastq/example.fasta
BioPerl-1.6.901/t/data/fastq/example.fastq
BioPerl-1.6.901/t/data/fastq/example.qual
BioPerl-1.6.901/t/data/fastq/illumina_faked.fastq
BioPerl-1.6.901/t/data/fastq/sanger_93.fastq
BioPerl-1.6.901/t/data/fastq/sanger_faked.fastq
BioPerl-1.6.901/t/data/fastq/solexa_example.fastq
BioPerl-1.6.901/t/data/fastq/solexa_faked.fastq
BioPerl-1.6.901/t/data/fastq/test1_sanger.fastq
BioPerl-1.6.901/t/data/fastq/test2_solexa.fastq
BioPerl-1.6.901/t/data/fastq/test3_illumina.fastq
BioPerl-1.6.901/t/data/fastq/tricky.fastq
BioPerl-1.6.901/t/data/fastq/wrapping_issues.fastq
BioPerl-1.6.901/t/data/map_hem
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM12.fa.revcom
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM2.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM2.fa.revcom
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM2.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM3.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM3.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM4.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM4.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM1.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM12.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM12.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM13.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM13.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM14-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM14-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM14.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM14.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM15.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM15.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM3.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM3.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM4.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM4.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM2.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM4.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM4.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM3.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM4.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/yeast.nc.1.freq
BioPerl-1.6.901/t/data/mbsout
BioPerl-1.6.901/t/data/mbsout/mbsout_infile1
BioPerl-1.6.901/t/data/mbsout/mbsout_infile2
BioPerl-1.6.901/t/data/mbsout/mbsout_infile3
BioPerl-1.6.901/t/data/msout
BioPerl-1.6.901/t/data/msout/msout_infile1
BioPerl-1.6.901/t/data/msout/msout_infile2
BioPerl-1.6.901/t/data/msout/msout_infile3
BioPerl-1.6.901/t/data/msout/msout_infile4
BioPerl-1.6.901/t/data/nexml
BioPerl-1.6.901/t/data/nexml/characters.nexml.8.xml
BioPerl-1.6.901/t/data/nexml/characters.nexml.xml
BioPerl-1.6.901/t/data/nexml/trees.nexml.8.xml
BioPerl-1.6.901/t/data/nexml/trees.nexml.xml
BioPerl-1.6.901/t/data/registry
BioPerl-1.6.901/t/data/registry/bdb
BioPerl-1.6.901/t/data/registry/bdb/seqdatabase.ini
BioPerl-1.6.901/t/data/registry/flat
BioPerl-1.6.901/t/data/registry/flat/seqdatabase.ini
BioPerl-1.6.901/t/data/seqfeaturedb
BioPerl-1.6.901/t/data/seqfeaturedb/test.gff3
BioPerl-1.6.901/t/data/taxdump
BioPerl-1.6.901/t/data/taxdump/names.dmp
BioPerl-1.6.901/t/data/taxdump/nodes.dmp
BioPerl-1.6.901/t/data/transfac_pro
BioPerl-1.6.901/t/data/transfac_pro/factor.dat
BioPerl-1.6.901/t/data/transfac_pro/fragment.dat
BioPerl-1.6.901/t/data/transfac_pro/gene.dat
BioPerl-1.6.901/t/data/transfac_pro/matrix.dat
BioPerl-1.6.901/t/data/transfac_pro/readme.txt
BioPerl-1.6.901/t/data/transfac_pro/reference.dat
BioPerl-1.6.901/t/data/transfac_pro/site.dat
BioPerl-1.6.901/t/Draw
BioPerl-1.6.901/t/Draw/Pictogram.t
BioPerl-1.6.901/t/lib
BioPerl-1.6.901/t/lib/Error.pm
BioPerl-1.6.901/t/lib/Array
BioPerl-1.6.901/t/lib/Array/Compare.pm
BioPerl-1.6.901/t/lib/Sub
BioPerl-1.6.901/t/lib/Sub/Uplevel.pm
BioPerl-1.6.901/t/lib/Test
BioPerl-1.6.901/t/lib/Test/Builder.pm
BioPerl-1.6.901/t/lib/Test/Exception.pm
BioPerl-1.6.901/t/lib/Test/Harness.pm
BioPerl-1.6.901/t/lib/Test/More.pm
BioPerl-1.6.901/t/lib/Test/Simple.pm
BioPerl-1.6.901/t/lib/Test/Tutorial.pod
BioPerl-1.6.901/t/lib/Test/Warn.pm
BioPerl-1.6.901/t/lib/Test/Builder
BioPerl-1.6.901/t/lib/Test/Builder/Module.pm
BioPerl-1.6.901/t/lib/Test/Builder/Tester.pm
BioPerl-1.6.901/t/lib/Test/Builder/Tester
BioPerl-1.6.901/t/lib/Test/Builder/Tester/Color.pm
BioPerl-1.6.901/t/lib/Test/Harness
BioPerl-1.6.901/t/lib/Test/Harness/Assert.pm
BioPerl-1.6.901/t/lib/Test/Harness/Iterator.pm
BioPerl-1.6.901/t/lib/Test/Harness/Point.pm
BioPerl-1.6.901/t/lib/Test/Harness/Results.pm
BioPerl-1.6.901/t/lib/Test/Harness/Straps.pm
BioPerl-1.6.901/t/lib/Test/Harness/TAP.pod
BioPerl-1.6.901/t/lib/Test/Harness/Util.pm
BioPerl-1.6.901/t/lib/Tree
BioPerl-1.6.901/t/lib/Tree/DAG_Node.pm
BioPerl-1.6.901/t/LiveSeq
BioPerl-1.6.901/t/LiveSeq/Chain.t
BioPerl-1.6.901/t/LiveSeq/LiveSeq.t
BioPerl-1.6.901/t/LiveSeq/Mutation.t
BioPerl-1.6.901/t/LiveSeq/Mutator.t
BioPerl-1.6.901/t/LocalDB
BioPerl-1.6.901/t/LocalDB/BioDBGFF.t
BioPerl-1.6.901/t/LocalDB/DBFasta.t
BioPerl-1.6.901/t/LocalDB/DBQual.t
BioPerl-1.6.901/t/LocalDB/Flat.t
BioPerl-1.6.901/t/LocalDB/Registry.t
BioPerl-1.6.901/t/LocalDB/SeqFeature.t
BioPerl-1.6.901/t/LocalDB/transfac_pro.t
BioPerl-1.6.901/t/LocalDB/Index
BioPerl-1.6.901/t/LocalDB/Index/Blast.t
BioPerl-1.6.901/t/LocalDB/Index/BlastTable.t
BioPerl-1.6.901/t/LocalDB/Index/Index.t
BioPerl-1.6.901/t/Map
BioPerl-1.6.901/t/Map/Cyto.t
BioPerl-1.6.901/t/Map/Linkage.t
BioPerl-1.6.901/t/Map/Map.t
BioPerl-1.6.901/t/Map/MapIO.t
BioPerl-1.6.901/t/Map/MicrosatelliteMarker.t
BioPerl-1.6.901/t/Map/Physical.t
BioPerl-1.6.901/t/Matrix
BioPerl-1.6.901/t/Matrix/InstanceSite.t
BioPerl-1.6.901/t/Matrix/Matrix.t
BioPerl-1.6.901/t/Matrix/ProtMatrix.t
BioPerl-1.6.901/t/Matrix/ProtPsm.t
BioPerl-1.6.901/t/Matrix/SiteMatrix.t
BioPerl-1.6.901/t/Matrix/IO
BioPerl-1.6.901/t/Matrix/IO/masta.t
BioPerl-1.6.901/t/Matrix/IO/psm.t
BioPerl-1.6.901/t/Ontology
BioPerl-1.6.901/t/Ontology/GOterm.t
BioPerl-1.6.901/t/Ontology/GraphAdaptor.t
BioPerl-1.6.901/t/Ontology/Ontology.t
BioPerl-1.6.901/t/Ontology/OntologyEngine.t
BioPerl-1.6.901/t/Ontology/OntologyStore.t
BioPerl-1.6.901/t/Ontology/Relationship.t
BioPerl-1.6.901/t/Ontology/RelationshipType.t
BioPerl-1.6.901/t/Ontology/Term.t
BioPerl-1.6.901/t/Ontology/IO
BioPerl-1.6.901/t/Ontology/IO/go.t
BioPerl-1.6.901/t/Ontology/IO/interpro.t
BioPerl-1.6.901/t/Ontology/IO/obo.t
BioPerl-1.6.901/t/Phenotype
BioPerl-1.6.901/t/Phenotype/Correlate.t
BioPerl-1.6.901/t/Phenotype/Measure.t
BioPerl-1.6.901/t/Phenotype/MeSH.t
BioPerl-1.6.901/t/Phenotype/MiniMIMentry.t
BioPerl-1.6.901/t/Phenotype/OMIMentry.t
BioPerl-1.6.901/t/Phenotype/OMIMentryAllelicVariant.t
BioPerl-1.6.901/t/Phenotype/OMIMparser.t
BioPerl-1.6.901/t/Phenotype/Phenotype.t
BioPerl-1.6.901/t/PopGen
BioPerl-1.6.901/t/PopGen/Coalescent.t
BioPerl-1.6.901/t/PopGen/HtSNP.t
BioPerl-1.6.901/t/PopGen/MK.t
BioPerl-1.6.901/t/PopGen/PopGen.t
BioPerl-1.6.901/t/PopGen/PopGenSims.t
BioPerl-1.6.901/t/PopGen/TagHaplotype.t
BioPerl-1.6.901/t/RemoteDB
BioPerl-1.6.901/t/RemoteDB/BioFetch.t
BioPerl-1.6.901/t/RemoteDB/CUTG.t
BioPerl-1.6.901/t/RemoteDB/EMBL.t
BioPerl-1.6.901/t/RemoteDB/EntrezGene.t
BioPerl-1.6.901/t/RemoteDB/EUtilities.t
BioPerl-1.6.901/t/RemoteDB/GenBank.t
BioPerl-1.6.901/t/RemoteDB/GenPept.t
BioPerl-1.6.901/t/RemoteDB/MeSH.t
BioPerl-1.6.901/t/RemoteDB/RefSeq.t
BioPerl-1.6.901/t/RemoteDB/SeqHound.t
BioPerl-1.6.901/t/RemoteDB/SeqRead_fail.t
BioPerl-1.6.901/t/RemoteDB/SeqVersion.t
BioPerl-1.6.901/t/RemoteDB/SwissProt.t
BioPerl-1.6.901/t/RemoteDB/Taxonomy.t
BioPerl-1.6.901/t/RemoteDB/HIV
BioPerl-1.6.901/t/RemoteDB/HIV/HIV.t
BioPerl-1.6.901/t/RemoteDB/HIV/HIVAnnotProcessor.t
BioPerl-1.6.901/t/RemoteDB/HIV/HIVQuery.t
BioPerl-1.6.901/t/RemoteDB/HIV/HIVQueryHelper.t
BioPerl-1.6.901/t/RemoteDB/Query
BioPerl-1.6.901/t/RemoteDB/Query/GenBank.t
BioPerl-1.6.901/t/Restriction
BioPerl-1.6.901/t/Restriction/Analysis-refac.t
BioPerl-1.6.901/t/Restriction/Analysis.t
BioPerl-1.6.901/t/Restriction/Gel.t
BioPerl-1.6.901/t/Restriction/IO.t
BioPerl-1.6.901/t/Root
BioPerl-1.6.901/t/Root/Exception.t
BioPerl-1.6.901/t/Root/HTTPget.t
BioPerl-1.6.901/t/Root/RootI.t
BioPerl-1.6.901/t/Root/RootIO.t
BioPerl-1.6.901/t/Root/Storable.t
BioPerl-1.6.901/t/Root/Tempfile.t
BioPerl-1.6.901/t/Root/Utilities.t
BioPerl-1.6.901/t/SearchIO
BioPerl-1.6.901/t/SearchIO/axt.t
BioPerl-1.6.901/t/SearchIO/blast.t
BioPerl-1.6.901/t/SearchIO/blast_pull.t
BioPerl-1.6.901/t/SearchIO/blasttable.t
BioPerl-1.6.901/t/SearchIO/blastxml.t
BioPerl-1.6.901/t/SearchIO/CigarString.t
BioPerl-1.6.901/t/SearchIO/cross_match.t
BioPerl-1.6.901/t/SearchIO/erpin.t
BioPerl-1.6.901/t/SearchIO/exonerate.t
BioPerl-1.6.901/t/SearchIO/fasta.t
BioPerl-1.6.901/t/SearchIO/gmap_f9.t
BioPerl-1.6.901/t/SearchIO/hmmer.t
BioPerl-1.6.901/t/SearchIO/hmmer_pull.t
BioPerl-1.6.901/t/SearchIO/infernal.t
BioPerl-1.6.901/t/SearchIO/megablast.t
BioPerl-1.6.901/t/SearchIO/psl.t
BioPerl-1.6.901/t/SearchIO/rnamotif.t
BioPerl-1.6.901/t/SearchIO/SearchIO.t
BioPerl-1.6.901/t/SearchIO/sim4.t
BioPerl-1.6.901/t/SearchIO/SimilarityPair.t
BioPerl-1.6.901/t/SearchIO/Tiling.t
BioPerl-1.6.901/t/SearchIO/waba.t
BioPerl-1.6.901/t/SearchIO/wise.t
BioPerl-1.6.901/t/SearchIO/Writer
BioPerl-1.6.901/t/SearchIO/Writer/GbrowseGFF.t
BioPerl-1.6.901/t/SearchIO/Writer/HitTableWriter.t
BioPerl-1.6.901/t/SearchIO/Writer/HSPTableWriter.t
BioPerl-1.6.901/t/SearchIO/Writer/HTMLWriter.t
BioPerl-1.6.901/t/SearchIO/Writer/TextWriter.t
BioPerl-1.6.901/t/Seq
BioPerl-1.6.901/t/Seq/DBLink.t
BioPerl-1.6.901/t/Seq/EncodedSeq.t
BioPerl-1.6.901/t/Seq/LargeLocatableSeq.t
BioPerl-1.6.901/t/Seq/LargePSeq.t
BioPerl-1.6.901/t/Seq/LocatableSeq.t
BioPerl-1.6.901/t/Seq/MetaSeq.t
BioPerl-1.6.901/t/Seq/PrimaryQual.t
BioPerl-1.6.901/t/Seq/PrimarySeq.t
BioPerl-1.6.901/t/Seq/PrimedSeq.t
BioPerl-1.6.901/t/Seq/Quality.t
BioPerl-1.6.901/t/Seq/Seq.t
BioPerl-1.6.901/t/Seq/WithQuality.t
BioPerl-1.6.901/t/SeqFeature
BioPerl-1.6.901/t/SeqFeature/Clone.t
BioPerl-1.6.901/t/SeqFeature/FeatureIO.t
BioPerl-1.6.901/t/SeqFeature/Location.t
BioPerl-1.6.901/t/SeqFeature/LocationFactory.t
BioPerl-1.6.901/t/SeqFeature/Primer.t
BioPerl-1.6.901/t/SeqFeature/Range.t
BioPerl-1.6.901/t/SeqFeature/RangeI.t
BioPerl-1.6.901/t/SeqFeature/SeqAnalysisParser.t
BioPerl-1.6.901/t/SeqFeature/SeqFeatAnnotated.t
BioPerl-1.6.901/t/SeqFeature/SeqFeatCollection.t
BioPerl-1.6.901/t/SeqFeature/SeqFeature.t
BioPerl-1.6.901/t/SeqFeature/SeqFeaturePrimer.t
BioPerl-1.6.901/t/SeqFeature/Unflattener.t
BioPerl-1.6.901/t/SeqFeature/Unflattener2.t
BioPerl-1.6.901/t/SeqIO
BioPerl-1.6.901/t/SeqIO/abi.t
BioPerl-1.6.901/t/SeqIO/ace.t
BioPerl-1.6.901/t/SeqIO/agave.t
BioPerl-1.6.901/t/SeqIO/alf.t
BioPerl-1.6.901/t/SeqIO/asciitree.t
BioPerl-1.6.901/t/SeqIO/bsml.t
BioPerl-1.6.901/t/SeqIO/bsml_sax.t
BioPerl-1.6.901/t/SeqIO/chadoxml.t
BioPerl-1.6.901/t/SeqIO/chaos.t
BioPerl-1.6.901/t/SeqIO/chaosxml.t
BioPerl-1.6.901/t/SeqIO/ctf.t
BioPerl-1.6.901/t/SeqIO/embl.t
BioPerl-1.6.901/t/SeqIO/entrezgene.t
BioPerl-1.6.901/t/SeqIO/excel.t
BioPerl-1.6.901/t/SeqIO/exp.t
BioPerl-1.6.901/t/SeqIO/fasta.t
BioPerl-1.6.901/t/SeqIO/fastq.t
BioPerl-1.6.901/t/SeqIO/flybase_chadoxml.t
BioPerl-1.6.901/t/SeqIO/game.t
BioPerl-1.6.901/t/SeqIO/gbxml.t
BioPerl-1.6.901/t/SeqIO/gcg.t
BioPerl-1.6.901/t/SeqIO/genbank.t
BioPerl-1.6.901/t/SeqIO/Handler.t
BioPerl-1.6.901/t/SeqIO/interpro.t
BioPerl-1.6.901/t/SeqIO/kegg.t
BioPerl-1.6.901/t/SeqIO/largefasta.t
BioPerl-1.6.901/t/SeqIO/lasergene.t
BioPerl-1.6.901/t/SeqIO/locuslink.t
BioPerl-1.6.901/t/SeqIO/mbsout.t
BioPerl-1.6.901/t/SeqIO/metafasta.t
BioPerl-1.6.901/t/SeqIO/msout.t
BioPerl-1.6.901/t/SeqIO/MultiFile.t
BioPerl-1.6.901/t/SeqIO/Multiple_fasta.t
BioPerl-1.6.901/t/SeqIO/nexml.t
BioPerl-1.6.901/t/SeqIO/phd.t
BioPerl-1.6.901/t/SeqIO/pir.t
BioPerl-1.6.901/t/SeqIO/pln.t
BioPerl-1.6.901/t/SeqIO/qual.t
BioPerl-1.6.901/t/SeqIO/raw.t
BioPerl-1.6.901/t/SeqIO/scf.t
BioPerl-1.6.901/t/SeqIO/SeqBuilder.t
BioPerl-1.6.901/t/SeqIO/SeqIO.t
BioPerl-1.6.901/t/SeqIO/seqxml.t
BioPerl-1.6.901/t/SeqIO/Splicedseq.t
BioPerl-1.6.901/t/SeqIO/strider.t
BioPerl-1.6.901/t/SeqIO/swiss.t
BioPerl-1.6.901/t/SeqIO/tab.t
BioPerl-1.6.901/t/SeqIO/table.t
BioPerl-1.6.901/t/SeqIO/tigr.t
BioPerl-1.6.901/t/SeqIO/tigrxml.t
BioPerl-1.6.901/t/SeqIO/tinyseq.t
BioPerl-1.6.901/t/SeqIO/ztr.t
BioPerl-1.6.901/t/SeqTools
BioPerl-1.6.901/t/SeqTools/Backtranslate.t
BioPerl-1.6.901/t/SeqTools/CodonTable.t
BioPerl-1.6.901/t/SeqTools/ECnumber.t
BioPerl-1.6.901/t/SeqTools/GuessSeqFormat.t
BioPerl-1.6.901/t/SeqTools/OddCodes.t
BioPerl-1.6.901/t/SeqTools/SeqPattern.t
BioPerl-1.6.901/t/SeqTools/SeqStats.t
BioPerl-1.6.901/t/SeqTools/SeqUtils.t
BioPerl-1.6.901/t/SeqTools/SeqWords.t
BioPerl-1.6.901/t/Structure
BioPerl-1.6.901/t/Structure/IO.t
BioPerl-1.6.901/t/Structure/Structure.t
BioPerl-1.6.901/t/Tools
BioPerl-1.6.901/t/Tools/ePCR.t
BioPerl-1.6.901/t/Tools/Est2Genome.t
BioPerl-1.6.901/t/Tools/FootPrinter.t
BioPerl-1.6.901/t/Tools/Geneid.t
BioPerl-1.6.901/t/Tools/Genewise.t
BioPerl-1.6.901/t/Tools/Genomewise.t
BioPerl-1.6.901/t/Tools/Genpred.t
BioPerl-1.6.901/t/Tools/GFF.t
BioPerl-1.6.901/t/Tools/GuessSeqFormat.t
BioPerl-1.6.901/t/Tools/Hmmer.t
BioPerl-1.6.901/t/Tools/IUPAC.t
BioPerl-1.6.901/t/Tools/Lucy.t
BioPerl-1.6.901/t/Tools/Match.t
BioPerl-1.6.901/t/Tools/pICalculator.t
BioPerl-1.6.901/t/Tools/Primer3.t
BioPerl-1.6.901/t/Tools/Promoterwise.t
BioPerl-1.6.901/t/Tools/Pseudowise.t
BioPerl-1.6.901/t/Tools/QRNA.t
BioPerl-1.6.901/t/Tools/RandDistFunctions.t
BioPerl-1.6.901/t/Tools/RepeatMasker.t
BioPerl-1.6.901/t/Tools/rnamotif.t
BioPerl-1.6.901/t/Tools/Seg.t
BioPerl-1.6.901/t/Tools/Sigcleave.t
BioPerl-1.6.901/t/Tools/Signalp.t
BioPerl-1.6.901/t/Tools/Sim4.t
BioPerl-1.6.901/t/Tools/SiRNA.t
BioPerl-1.6.901/t/Tools/TandemRepeatsFinder.t
BioPerl-1.6.901/t/Tools/TargetP.t
BioPerl-1.6.901/t/Tools/Tmhmm.t
BioPerl-1.6.901/t/Tools/tRNAscanSE.t
BioPerl-1.6.901/t/Tools/Alignment
BioPerl-1.6.901/t/Tools/Alignment/Consed.t
BioPerl-1.6.901/t/Tools/Analysis
BioPerl-1.6.901/t/Tools/Analysis/DNA
BioPerl-1.6.901/t/Tools/Analysis/DNA/ESEfinder.t
BioPerl-1.6.901/t/Tools/Analysis/Protein
BioPerl-1.6.901/t/Tools/Analysis/Protein/Domcut.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/ELM.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/GOR4.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/HNN.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/Mitoprot.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/NetPhos.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/Scansite.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/Sopma.t
BioPerl-1.6.901/t/Tools/EMBOSS
BioPerl-1.6.901/t/Tools/EMBOSS/Palindrome.t
BioPerl-1.6.901/t/Tools/EUtilities
BioPerl-1.6.901/t/Tools/EUtilities/egquery.t
BioPerl-1.6.901/t/Tools/EUtilities/einfo.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_acheck.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_lcheck.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_llinks.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_ncheck.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_neighbor.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_neighbor_history.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_scores.t
BioPerl-1.6.901/t/Tools/EUtilities/epost.t
BioPerl-1.6.901/t/Tools/EUtilities/esearch.t
BioPerl-1.6.901/t/Tools/EUtilities/espell.t
BioPerl-1.6.901/t/Tools/EUtilities/esummary.t
BioPerl-1.6.901/t/Tools/EUtilities/EUtilParameters.t
BioPerl-1.6.901/t/Tools/Phylo
BioPerl-1.6.901/t/Tools/Phylo/Gerp.t
BioPerl-1.6.901/t/Tools/Phylo/Molphy.t
BioPerl-1.6.901/t/Tools/Phylo/PAML.t
BioPerl-1.6.901/t/Tools/Phylo/Phylip
BioPerl-1.6.901/t/Tools/Phylo/Phylip/ProtDist.t
BioPerl-1.6.901/t/Tools/Run
BioPerl-1.6.901/t/Tools/Run/Dummy.pm
BioPerl-1.6.901/t/Tools/Run/RemoteBlast.t
BioPerl-1.6.901/t/Tools/Run/RemoteBlast_rpsblast.t
BioPerl-1.6.901/t/Tools/Run/StandAloneBlast.t
BioPerl-1.6.901/t/Tools/Run/WBCommandExts.t
BioPerl-1.6.901/t/Tools/Run/WrapperBase.t
BioPerl-1.6.901/t/Tools/Run/Dummy
BioPerl-1.6.901/t/Tools/Run/Dummy/Config.pm
BioPerl-1.6.901/t/Tools/Signalp
BioPerl-1.6.901/t/Tools/Signalp/ExtendedSignalp.t
BioPerl-1.6.901/t/Tools/Spidey
BioPerl-1.6.901/t/Tools/Spidey/Spidey.t
BioPerl-1.6.901/t/Tree
BioPerl-1.6.901/t/Tree/Compatible.t
BioPerl-1.6.901/t/Tree/Node.t
BioPerl-1.6.901/t/Tree/RandomTreeFactory.t
BioPerl-1.6.901/t/Tree/Tree.t
BioPerl-1.6.901/t/Tree/TreeIO.t
BioPerl-1.6.901/t/Tree/TreeStatistics.t
BioPerl-1.6.901/t/Tree/PhyloNetwork
BioPerl-1.6.901/t/Tree/PhyloNetwork/Factory.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/GraphViz.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/MuVector.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/PhyloNetwork.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/RandomFactory.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/TreeFactory.t
BioPerl-1.6.901/t/Tree/TreeIO
BioPerl-1.6.901/t/Tree/TreeIO/lintree.t
BioPerl-1.6.901/t/Tree/TreeIO/newick.t
BioPerl-1.6.901/t/Tree/TreeIO/nexml.t
BioPerl-1.6.901/t/Tree/TreeIO/nexus.t
BioPerl-1.6.901/t/Tree/TreeIO/nhx.t
BioPerl-1.6.901/t/Tree/TreeIO/phyloxml.t
BioPerl-1.6.901/t/Tree/TreeIO/svggraph.t
BioPerl-1.6.901/t/Tree/TreeIO/tabtree.t
BioPerl-1.6.901/t/Variation
BioPerl-1.6.901/t/Variation/AAChange.t
BioPerl-1.6.901/t/Variation/AAReverseMutate.t
BioPerl-1.6.901/t/Variation/Allele.t
BioPerl-1.6.901/t/Variation/DNAMutation.t
BioPerl-1.6.901/t/Variation/RNAChange.t
BioPerl-1.6.901/t/Variation/SeqDiff.t
BioPerl-1.6.901/t/Variation/SNP.t
BioPerl-1.6.901/t/Variation/Variation_IO.t
---- Unsatisfied dependencies detected during ----
----      CJFIELDS/BioPerl-1.6.901.tar.gz     ----
    Module::Build [build_requires]
Running make test
  Make had some problems, won't test
  Delayed until after prerequisites
Running test for module 'Module::Build'
Running make for D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Module-Build-0.3800.tar.gz ok
Module-Build-0.3800
Module-Build-0.3800/Changes
Module-Build-0.3800/MANIFEST
Module-Build-0.3800/META.json
Module-Build-0.3800/README
Module-Build-0.3800/LICENSE
Module-Build-0.3800/Build.PL
Module-Build-0.3800/META.yml
Module-Build-0.3800/INSTALL
Module-Build-0.3800/Makefile.PL
Module-Build-0.3800/t
Module-Build-0.3800/t/perl_mb_opt.t
Module-Build-0.3800/t/write_default_maniskip.t
Module-Build-0.3800/t/help.t
Module-Build-0.3800/t/tilde.t
Module-Build-0.3800/t/sample.t
Module-Build-0.3800/t/versions.t
Module-Build-0.3800/t/compat.t
Module-Build-0.3800/t/parents.t
Module-Build-0.3800/t/pod_parser.t
Module-Build-0.3800/t/install_extra_target.t
Module-Build-0.3800/t/manifypods.t
Module-Build-0.3800/t/metadata.t
Module-Build-0.3800/t/PL_files.t
Module-Build-0.3800/t/files.t
Module-Build-0.3800/t/destinations.t
Module-Build-0.3800/t/ppm.t
Module-Build-0.3800/t/par.t
Module-Build-0.3800/t/test_file_exts.t
Module-Build-0.3800/t/resume.t
Module-Build-0.3800/t/xs.t
Module-Build-0.3800/t/install.t
Module-Build-0.3800/t/script_dist.t
Module-Build-0.3800/t/00-compile.t
Module-Build-0.3800/t/notes.t
Module-Build-0.3800/t/runthrough.t
Module-Build-0.3800/t/mymeta.t
Module-Build-0.3800/t/use_tap_harness.t
Module-Build-0.3800/t/test_type.t
Module-Build-0.3800/t/test_types.t
Module-Build-0.3800/t/basic.t
Module-Build-0.3800/t/new_from_context.t
Module-Build-0.3800/t/ext.t
Module-Build-0.3800/t/bundle_inc.t
Module-Build-0.3800/t/README.pod
Module-Build-0.3800/t/add_property.t
Module-Build-0.3800/t/debug.t
Module-Build-0.3800/t/metadata2.t
Module-Build-0.3800/t/signature.t
Module-Build-0.3800/t/extend.t
Module-Build-0.3800/t/properties
Module-Build-0.3800/t/properties/module_name.t
Module-Build-0.3800/t/properties/share_dir.t
Module-Build-0.3800/t/properties/dist_suffix.t
Module-Build-0.3800/t/properties/needs_compiler.t
Module-Build-0.3800/t/properties/requires.t
Module-Build-0.3800/t/properties/license.t
Module-Build-0.3800/t/properties/release_status.t
Module-Build-0.3800/t/lib
Module-Build-0.3800/t/lib/DistGen.pm
Module-Build-0.3800/t/lib/MBTest.pm
Module-Build-0.3800/t/lib/Module
Module-Build-0.3800/t/lib/Module/Signature.pm
Module-Build-0.3800/t/lib/Software
Module-Build-0.3800/t/lib/Software/License
Module-Build-0.3800/t/lib/Software/License/VaporWare.pm
Module-Build-0.3800/t/bundled
Module-Build-0.3800/t/bundled/Tie
Module-Build-0.3800/t/bundled/Tie/CPHash.pm
Module-Build-0.3800/t/bundled/Software
Module-Build-0.3800/t/bundled/Software/License.pm
Module-Build-0.3800/t/compat
Module-Build-0.3800/t/compat/exit.t
Module-Build-0.3800/t/actions
Module-Build-0.3800/t/actions/installdeps.t
Module-Build-0.3800/t/actions/manifest_skip.t
Module-Build-0.3800/lib
Module-Build-0.3800/lib/Module
Module-Build-0.3800/lib/Module/Build.pm
Module-Build-0.3800/lib/Module/Build
Module-Build-0.3800/lib/Module/Build/PodParser.pm
Module-Build-0.3800/lib/Module/Build/Bundling.pod
Module-Build-0.3800/lib/Module/Build/Base.pm
Module-Build-0.3800/lib/Module/Build/YAML.pm
Module-Build-0.3800/lib/Module/Build/API.pod
Module-Build-0.3800/lib/Module/Build/Version.pm
Module-Build-0.3800/lib/Module/Build/Compat.pm
Module-Build-0.3800/lib/Module/Build/ModuleInfo.pm
Module-Build-0.3800/lib/Module/Build/Cookbook.pm
Module-Build-0.3800/lib/Module/Build/Config.pm
Module-Build-0.3800/lib/Module/Build/PPMMaker.pm
Module-Build-0.3800/lib/Module/Build/Notes.pm
Module-Build-0.3800/lib/Module/Build/Dumper.pm
Module-Build-0.3800/lib/Module/Build/Authoring.pod
Module-Build-0.3800/lib/Module/Build/Platform
Module-Build-0.3800/lib/Module/Build/Platform/darwin.pm
Module-Build-0.3800/lib/Module/Build/Platform/Unix.pm
Module-Build-0.3800/lib/Module/Build/Platform/EBCDIC.pm
Module-Build-0.3800/lib/Module/Build/Platform/aix.pm
Module-Build-0.3800/lib/Module/Build/Platform/MPEiX.pm
Module-Build-0.3800/lib/Module/Build/Platform/Default.pm
Module-Build-0.3800/lib/Module/Build/Platform/MacOS.pm
Module-Build-0.3800/lib/Module/Build/Platform/Windows.pm
Module-Build-0.3800/lib/Module/Build/Platform/Amiga.pm
Module-Build-0.3800/lib/Module/Build/Platform/cygwin.pm
Module-Build-0.3800/lib/Module/Build/Platform/VMS.pm
Module-Build-0.3800/lib/Module/Build/Platform/RiscOS.pm
Module-Build-0.3800/lib/Module/Build/Platform/VOS.pm
Module-Build-0.3800/lib/Module/Build/Platform/os2.pm
Module-Build-0.3800/lib/inc
Module-Build-0.3800/lib/inc/latest.pm
Module-Build-0.3800/lib/inc/latest
Module-Build-0.3800/lib/inc/latest/private.pm
Module-Build-0.3800/inc
Module-Build-0.3800/inc/MBVersion.pm
Module-Build-0.3800/inc/bootstrap.pl
Module-Build-0.3800/inc/Perl
Module-Build-0.3800/inc/Perl/OSType.pm
Module-Build-0.3800/inc/Module
Module-Build-0.3800/inc/Module/Metadata.pm
Module-Build-0.3800/bin
Module-Build-0.3800/bin/config_data
Module-Build-0.3800/contrib
Module-Build-0.3800/contrib/bash_completion.module-build

  CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
*** BOOTSTRAPPING version ***
*** BOOTSTRAPPING Module::Metadata ***
# running Build.PL 
*** BOOTSTRAPPING version ***
*** BOOTSTRAPPING Module::Metadata ***
Checking prerequisites...
  requires:
    !  CPAN::Meta (2.102400) is installed, but we need version >= 2.110420
    !  Module::Metadata (1.000001) is installed, but we need version >= 1.000002
  build_requires:
    !  Parse::CPAN::Meta (1.40) is installed, but we need version >= 1.4401

ERRORS/WARNINGS FOUND IN PREREQUISITES.  You may wish to install the versions
of the modules indicated above before proceeding with this installation

Could not create MYMETA files
Copied META.yml to MYMETA.yml for bootstrapping

These additional prerequisites must be installed:
  requires:
    ! version (we need version 0.87)
    ! Module::Metadata (we need version 1.000002)
Creating new 'Build' script for 'Module-Build' version '0.3800'

These additional prerequisites must be installed:
  requires:
    ! version (we need version 0.87)
    ! Module::Metadata (we need version 1.000002)
---- Unsatisfied dependencies detected during ----
----    DAGOLDEN/Module-Build-0.3800.tar.gz   ----
    Module::Metadata [requires]
    CPAN::Meta [requires]
    Parse::CPAN::Meta [build_requires]
    version [requires]
Running make test
  Delayed until after prerequisites
Running test for module 'Module::Metadata'
Running make for D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Module-Metadata-1.000004.tar.gz ok
Module-Metadata-1.000004/
Module-Metadata-1.000004/maint/
Module-Metadata-1.000004/maint/Makefile.PL.include
Module-Metadata-1.000004/maint/Makefile.include
Module-Metadata-1.000004/maint/bump-version
Module-Metadata-1.000004/t/
Module-Metadata-1.000004/t/lib/
Module-Metadata-1.000004/t/lib/Tie/
Module-Metadata-1.000004/t/lib/Tie/CPHash.pm
Module-Metadata-1.000004/t/lib/MBTest.pm
Module-Metadata-1.000004/t/lib/DistGen.pm
Module-Metadata-1.000004/t/metadata.t
Module-Metadata-1.000004/Changes
Module-Metadata-1.000004/MANIFEST
Module-Metadata-1.000004/lib/
Module-Metadata-1.000004/lib/Module/
Module-Metadata-1.000004/lib/Module/Metadata.pm
Module-Metadata-1.000004/xt/
Module-Metadata-1.000004/xt/pod.t
Module-Metadata-1.000004/Makefile.PL
Module-Metadata-1.000004/META.yml

  CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
Warning: prerequisite version 0.87 not found. We have 0.82.
Checking if your kit is complete...
Looks good
Writing Makefile for Module::Metadata
---- Unsatisfied dependencies detected during ----
---- DAGOLDEN/Module-Metadata-1.000004.tar.gz ----
    version [requires]
Running make test
  Delayed until after prerequisites
Running test for module 'version'
Running make for J/JP/JPEACOCK/version-0.88.tar.gz
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\J\JP\JPEACOCK\version-0.88.tar.gz ok
version-0.88/
version-0.88/t/
version-0.88/t/02derived.t
version-0.88/t/04strict_lax.t
version-0.88/t/coretests.pm
version-0.88/t/03require.t
version-0.88/t/survey_locales
version-0.88/t/01base.t
version-0.88/vutil/
version-0.88/vutil/vutil.h
version-0.88/vutil/vxs.xs
version-0.88/vutil/lib/
version-0.88/vutil/lib/version/
version-0.88/vutil/lib/version/vxs.pm
version-0.88/vutil/vutil.c
version-0.88/vutil/ppport.h
version-0.88/vperl/
version-0.88/vperl/vpp.pm
version-0.88/MANIFEST.SKIP
version-0.88/META.yml
version-0.88/Changes
version-0.88/Makefile.PL
version-0.88/README
version-0.88/lib/
version-0.88/lib/version.pod
version-0.88/lib/version.pm
version-0.88/lib/version/
version-0.88/lib/version/typemap
version-0.88/lib/version/Internals.pod
version-0.88/MANIFEST

  CPAN.pm: Going to build J/JP/JPEACOCK/version-0.88.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
Testing if you have a C compiler
compilet-1479933952.c
   Creating library C:\cpanfly-5.12\var\tmp\compilet.lib and object C:\cpanfly-5.12\var\tmp\compilet.exp
Checking if your kit is complete...
Looks good
Writing Makefile for version::vxs
Writing Makefile for version
>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

cp lib/version/Internals.pod blib\lib/version/Internals.pod
cp lib/version.pm blib\lib/version.pm
cp lib/version.pod blib\lib/version.pod
	nmake -f Makefile all -nologo
cp lib/version/vxs.pm ..\blib\lib\version\vxs.pm
	cl -c    -nologo -GF -W3 -MD -Zi -DNDEBUG -O1 -DWIN32 -D_CONSOLE -DNO_STRICT -DHAVE_DES_FCRYPT -DUSE_SITECUSTOMIZE -DPERL_IMPLICIT_CONTEXT -DPERL_IMPLICIT_SYS -DUSE_PERLIO -DPERL_MSVCRT_READFIX -MD -Zi -DNDEBUG -O1    -DVERSION=\"0.88\"  -DXS_VERSION=\"0.88\"  "-IC:\Perl-5.12\lib\CORE"   vutil.c
vutil.c
	C:\Perl-5.12\bin\perl.exe C:\cpanfly-5.12\var\megalib\ExtUtils\xsubpp  -typemap C:\Perl-5.12\lib\ExtUtils\typemap -typemap ../lib/version/typemap  vxs.xs > vxs.xsc && C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "mv" -- vxs.xsc vxs.c
	cl -c    -nologo -GF -W3 -MD -Zi -DNDEBUG -O1 -DWIN32 -D_CONSOLE -DNO_STRICT -DHAVE_DES_FCRYPT -DUSE_SITECUSTOMIZE -DPERL_IMPLICIT_CONTEXT -DPERL_IMPLICIT_SYS -DUSE_PERLIO -DPERL_MSVCRT_READFIX -MD -Zi -DNDEBUG -O1    -DVERSION=\"0.88\"  -DXS_VERSION=\"0.88\"  "-IC:\Perl-5.12\lib\CORE"   vxs.c
vxs.c
Running Mkbootstrap for version::vxs ()
	C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "chmod" -- 644 vxs.bs
	C:\Perl-5.12\bin\perl.exe -MExtUtils::Mksymlists  -e "Mksymlists('NAME'=>\"version::vxs\", 'DLBASE' => 'vxs', 'DL_FUNCS' => {  }, 'FUNCLIST' => [], 'IMPORTS' => {  }, 'DL_VARS' => []);"
	link -out:..\blib\arch\auto\version\vxs\vxs.dll -dll -nologo -nodefaultlib -debug -opt:ref,icf  -libpath:"C:\Perl-5.12\lib\CORE"  -machine:x86 vutil.obj  vxs.obj   C:\Perl-5.12\lib\CORE\perl512.lib oldnames.lib kernel32.lib user32.lib gdi32.lib winspool.lib  comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib  netapi32.lib uuid.lib ws2_32.lib mpr.lib winmm.lib  version.lib odbc32.lib odbccp32.lib comctl32.lib msvcrt.lib -def:vxs.def
   Creating library ..\blib\arch\auto\version\vxs\vxs.lib and object ..\blib\arch\auto\version\vxs\vxs.exp
	if exist ..\blib\arch\auto\version\vxs\vxs.dll.manifest mt -nologo -manifest ..\blib\arch\auto\version\vxs\vxs.dll.manifest -outputresource:..\blib\arch\auto\version\vxs\vxs.dll;2
	if exist ..\blib\arch\auto\version\vxs\vxs.dll.manifest del ..\blib\arch\auto\version\vxs\vxs.dll.manifest
	C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "chmod" -- 755 ..\blib\arch\auto\version\vxs\vxs.dll
	C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- vxs.bs ..\blib\arch\auto\version\vxs\vxs.bs
	C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "chmod" -- 644 ..\blib\arch\auto\version\vxs\vxs.bs
	cd ..
  JPEACOCK/version-0.88.tar.gz
  nmake -- OK
Running make test
>>> nmake test TEST_VERBOSE=1

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	nmake -f Makefile all -nologo
	cd ..
	C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t
t/01base.t ........ 
ok 1 - use version;
ok 2 - 5.005_03 eq 5.00503
ok 3 - 1.23 eq "1.23"
ok 4 - "5.005_03" eq "5.005_03"
ok 5 - "v1.23" eq "v1.23"
ok 6 - 5.005 eq "5.005"
ok 7 - 5.006.001 eq v5.6.1
ok 8 - No leading v
ok 9 - alpha version 1.2.3_4 eq v1.2.3_4
ok 10 - Invalid version format (multiple underscores)
ok 11 - Invalid version format (underscores before decimal)
ok 12 - Invalid version format (alpha without decimal)
ok 13 - Invalid version format (non-numeric data)
ok 14 - Invalid version format (non-numeric data)
ok 15 - Invalid version format (non-numeric data)
ok 16 - boolean
ok 17 - The object isa version
ok 18 - $version <=> $version == 0
ok 19 - $version == $version
ok 20 - $version == $version
ok 21 - $version < $new_version
ok 22 - $new_version > $version
ok 23 - $version != $new_version
ok 24 - $version < $new_version
ok 25 - $new_version > $version
ok 26 - $version != $new_version
ok 27 - $version->numify() == 5.006001
ok 28 - $version->numify() <= 5.006001
ok 29 - $version->numify() < 5.008
ok 30 - $version == "1.2.3"
ok 31 - $version->numify == 1.002003
ok 32 - $version == 2002.9.30.1
ok 33 - $version->numify == 2002.009030001
ok 34 - $version < $new_version
ok 35 - $new_version > $version
ok 36 - $version != $new_version
ok 37 - $version > $new_version
ok 38 - $new_version < $version
ok 39 - $version != $new_version
ok 40 - $version < $new_version
ok 41 - $new_version > $version
ok 42 - $version != $new_version
ok 43 - !$version->is_alpha
ok 44 - $new_version->is_alpha
ok 45 - $version > $new_version
ok 46 - $new_version < $version
ok 47 - $version != $new_version
ok 48 - $version > $new_version
ok 49 - $new_version < $version
ok 50 - $version != $new_version
ok 51 - $version == $new_version
ok 52 - $version == $new_version
ok 53 - $version < $new_version
ok 54 - $version < $new_version
ok 55 - $version > $new_version
ok 56 - noop ++
ok 57 - noop --
ok 58 - noop /
ok 59 - noop *
ok 60 - noop abs
ok 61 - qv("1.2") == "1.2.0"
ok 62 - qv(1.2) == "1.2.0"
ok 63 - The object isa version
ok 64 - new from existing object
ok 65 - class->new(v1.2) identical
ok 66 - The object isa version
ok 67 - version->new() doesn't clone
ok 68 - $version->$method("1.2.3") works too
ok 69 - qw$Revision: 1.2$ == 1.2.0
ok 70 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 71 - CPAN-style alpha version
ok 72 - 1.23_01 > 1.23
ok 73 - 1.23_01 < 1.24
ok 74 - Replacement eval works with exact version
ok 75 - Called as class method
ok 76 - Don't freak if the module doesn't even exist
ok 77 - Replacement eval works with incremented version
ok 78 - Replacement eval works with single digit
ok 79 - Replacement eval works with incremented digit
ok 80 - Replacement handles modules without package or VERSION
ok 81 - Replacement handles modules without package or VERSION
ok 82 - Called as class method
ok 83 - Replacement handles modules without VERSION
ok 84 - Replacement handles modules without VERSION
ok 85 - Replacement handles modules without VERSION
ok 86 - Replacement handles modules without VERSION
ok 87 - "$version" eq 1.2.3
ok 88 - $version == $new_version
ok 89 - v-string initialized $qv_declare()
ok 90 - "$version" eq "v1.2.3_4"
ok 91 - "$version" eq "v1.2.3_4" (from eval)
ok 92 - trailing zeros preserved
ok 93 - trailing zeros preserved
ok 94 - trailing zeros preserved
ok 95 - trailing zeros preserved
ok 96 - leading zero inferred
ok 97 - leading space ignored
ok 98 - Undef version comparison \#1
ok 99 - Undef version comparison \#2
ok 100 - Version string 'undef'
ok 101 - Version string 'undef'
ok 102 - Undef version comparison \#3
ok 103 - Undef version comparison \#4
ok 104 - No initializer at all
ok 105 - Undef version comparison \#5
ok 106 - Undef version comparison \#6
ok 107 - Very small version objects
ok 108 - Make sure very small versions don't freak
ok 109 - Comparing vs. version with no decimal
ok 110 - Comparing vs. version with decimal only
ok 111 - Make sure very small versions don't freak
ok 112 - Succeed - required == VERSION
ok 113 - No undef warnings
ok 114 - make sure we cleared qv() properly
ok 115 - make sure we exported qv() properly
ok 116 - The object isa tTywwKGT
ok 117 - User typed numeric so we error with numeric
ok 118 - User typed extended so we error with extended
ok 119 # skip Cannot test locale handling without a comma locale
ok 120 # skip Cannot test locale handling without a comma locale
ok 121 # skip Cannot test locale handling without a comma locale
ok 122 # skip Cannot test locale handling without a comma locale
ok 123 - Invalid version format 1._1
ok 124 - Too large version
ok 125 - Too large version
ok 126 - Don't fall for Data::Dumper's tricks
ok 127 - Deal with badly serialized versions from YAML
ok 128 - Deal with badly serialized versions from YAML 
ok 129 - Correctly guesses this is not a v-string
ok 130 - Correctly guess that this is a v-string
ok 131 - Compare 3 and 4 digit v-strings
ok 132 - Compare 3 and 4 digit v-strings, leaving v
ok 133 - Compare 3 and 4 digit v-strings, quoted
ok 134 - Compare 3 and 4 digit v-strings, quoted leading v
ok 135 - 5.005_03 eq 5.00503
ok 136 - 1.23 eq "1.23"
ok 137 - "5.005_03" eq "5.005_03"
ok 138 - "v1.23" eq "v1.23"
ok 139 - 5.005 eq "5.005"
ok 140 - 5.006.001 eq v5.6.1
ok 141 - No leading v
ok 142 - alpha version 1.2.3_4 eq v1.2.3_4
ok 143 - Invalid version format (multiple underscores)
ok 144 - Invalid version format (underscores before decimal)
ok 145 - Invalid version format (alpha without decimal)
ok 146 - Invalid version format (non-numeric data)
ok 147 - Invalid version format (non-numeric data)
ok 148 - Invalid version format (non-numeric data)
ok 149 - boolean
ok 150 - The object isa version
ok 151 - $version <=> $version == 0
ok 152 - $version == $version
ok 153 - $version == $version
ok 154 - $version < $new_version
ok 155 - $new_version > $version
ok 156 - $version != $new_version
ok 157 - $version < $new_version
ok 158 - $new_version > $version
ok 159 - $version != $new_version
ok 160 - $version->numify() == 5.006001
ok 161 - $version->numify() <= 5.006001
ok 162 - $version->numify() < 5.008
ok 163 - $version == "1.2.3"
ok 164 - $version->numify == 1.002003
ok 165 - $version == 2002.9.30.1
ok 166 - $version->numify == 2002.009030001
ok 167 - $version < $new_version
ok 168 - $new_version > $version
ok 169 - $version != $new_version
ok 170 - $version > $new_version
ok 171 - $new_version < $version
ok 172 - $version != $new_version
ok 173 - $version < $new_version
ok 174 - $new_version > $version
ok 175 - $version != $new_version
ok 176 - !$version->is_alpha
ok 177 - $new_version->is_alpha
ok 178 - $version > $new_version
ok 179 - $new_version < $version
ok 180 - $version != $new_version
ok 181 - $version > $new_version
ok 182 - $new_version < $version
ok 183 - $version != $new_version
ok 184 - $version == $new_version
ok 185 - $version == $new_version
ok 186 - $version < $new_version
ok 187 - $version < $new_version
ok 188 - $version > $new_version
ok 189 - noop ++
ok 190 - noop --
ok 191 - noop /
ok 192 - noop *
ok 193 - noop abs
ok 194 - declare("1.2") == "1.2.0"
ok 195 - declare(1.2) == "1.2.0"
ok 196 - The object isa version
ok 197 - new from existing object
ok 198 - class->new(v1.2) identical
ok 199 - The object isa version
ok 200 - version->new() doesn't clone
ok 201 - $version->$method("1.2.3") works too
ok 202 - qw$Revision: 1.2$ == 1.2.0
ok 203 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 204 - CPAN-style alpha version
ok 205 - 1.23_01 > 1.23
ok 206 - 1.23_01 < 1.24
ok 207 - Replacement eval works with exact version
ok 208 - Called as class method
ok 209 - Don't freak if the module doesn't even exist
ok 210 - Replacement eval works with incremented version
ok 211 - Replacement eval works with single digit
ok 212 - Replacement eval works with incremented digit
ok 213 - Replacement handles modules without package or VERSION
ok 214 - Replacement handles modules without package or VERSION
ok 215 - Called as class method
ok 216 - Replacement handles modules without VERSION
ok 217 - Replacement handles modules without VERSION
ok 218 - Replacement handles modules without VERSION
ok 219 - Replacement handles modules without VERSION
ok 220 - "$version" eq 1.2.3
ok 221 - $version == $new_version
ok 222 - v-string initialized $qv_declare()
ok 223 - "$version" eq "v1.2.3_4"
ok 224 - "$version" eq "v1.2.3_4" (from eval)
ok 225 - trailing zeros preserved
ok 226 - trailing zeros preserved
ok 227 - trailing zeros preserved
ok 228 - trailing zeros preserved
ok 229 - leading zero inferred
ok 230 - leading space ignored
ok 231 - Undef version comparison \#1
ok 232 - Undef version comparison \#2
ok 233 - Version string 'undef'
ok 234 - Version string 'undef'
ok 235 - Undef version comparison \#3
ok 236 - Undef version comparison \#4
ok 237 - No initializer at all
ok 238 - Undef version comparison \#5
ok 239 - Undef version comparison \#6
ok 240 - Very small version objects
ok 241 - Make sure very small versions don't freak
ok 242 - Comparing vs. version with no decimal
ok 243 - Comparing vs. version with decimal only
ok 244 - Make sure very small versions don't freak
ok 245 - Succeed - required == VERSION
ok 246 - No undef warnings
ok 247 - make sure we cleared declare() properly
ok 248 - make sure we exported declare() properly
ok 249 - The object isa tdoijhW9
ok 250 - User typed numeric so we error with numeric
ok 251 - User typed extended so we error with extended
ok 252 # skip Cannot test locale handling without a comma locale
ok 253 # skip Cannot test locale handling without a comma locale
ok 254 # skip Cannot test locale handling without a comma locale
ok 255 # skip Cannot test locale handling without a comma locale
ok 256 - Invalid version format 1._1
ok 257 - Too large version
ok 258 - Too large version
ok 259 - Don't fall for Data::Dumper's tricks
ok 260 - Deal with badly serialized versions from YAML
ok 261 - Deal with badly serialized versions from YAML 
ok 262 - Correctly guesses this is not a v-string
ok 263 - Correctly guess that this is a v-string
ok 264 - Compare 3 and 4 digit v-strings
ok 265 - Compare 3 and 4 digit v-strings, leaving v
ok 266 - Compare 3 and 4 digit v-strings, quoted
ok 267 - Compare 3 and 4 digit v-strings, quoted leading v
ok 268 - 5.005_03 eq 5.00503
ok 269 - 1.23 eq "1.23"
ok 270 - "5.005_03" eq "5.005_03"
ok 271 - "v1.23" eq "v1.23"
ok 272 - 5.005 eq "5.005"
ok 273 - 5.006.001 eq v5.6.1
ok 274 - No leading v
ok 275 - alpha version 1.2.3_4 eq v1.2.3_4
ok 276 - Invalid version format (multiple underscores)
ok 277 - Invalid version format (underscores before decimal)
ok 278 - Invalid version format (alpha without decimal)
ok 279 - Invalid version format (non-numeric data)
ok 280 - Invalid version format (non-numeric data)
ok 281 - Invalid version format (non-numeric data)
ok 282 - boolean
ok 283 - The object isa version
ok 284 - $version <=> $version == 0
ok 285 - $version == $version
ok 286 - $version == $version
ok 287 - $version < $new_version
ok 288 - $new_version > $version
ok 289 - $version != $new_version
ok 290 - $version < $new_version
ok 291 - $new_version > $version
ok 292 - $version != $new_version
ok 293 - $version->numify() == 5.006001
ok 294 - $version->numify() <= 5.006001
ok 295 - $version->numify() < 5.008
ok 296 - $version == "1.2.3"
ok 297 - $version->numify == 1.002003
ok 298 - $version == 2002.9.30.1
ok 299 - $version->numify == 2002.009030001
ok 300 - $version < $new_version
ok 301 - $new_version > $version
ok 302 - $version != $new_version
ok 303 - $version > $new_version
ok 304 - $new_version < $version
ok 305 - $version != $new_version
ok 306 - $version < $new_version
ok 307 - $new_version > $version
ok 308 - $version != $new_version
ok 309 - !$version->is_alpha
ok 310 - $new_version->is_alpha
ok 311 - $version > $new_version
ok 312 - $new_version < $version
ok 313 - $version != $new_version
ok 314 - $version > $new_version
ok 315 - $new_version < $version
ok 316 - $version != $new_version
ok 317 - $version == $new_version
ok 318 - $version == $new_version
ok 319 - $version < $new_version
ok 320 - $version < $new_version
ok 321 - $version > $new_version
ok 322 - noop ++
ok 323 - noop --
ok 324 - noop /
ok 325 - noop *
ok 326 - noop abs
ok 327 - qv("1.2") == "1.2.0"
ok 328 - qv(1.2) == "1.2.0"
ok 329 - The object isa version
ok 330 - new from existing object
ok 331 - class->parse(v1.2) identical
ok 332 - The object isa version
ok 333 - version->parse() doesn't clone
ok 334 - $version->$method("1.2.3") works too
ok 335 - qw$Revision: 1.2$ == 1.2.0
ok 336 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 337 - CPAN-style alpha version
ok 338 - 1.23_01 > 1.23
ok 339 - 1.23_01 < 1.24
ok 340 - Replacement eval works with exact version
ok 341 - Called as class method
ok 342 - Don't freak if the module doesn't even exist
ok 343 - Replacement eval works with incremented version
ok 344 - Replacement eval works with single digit
ok 345 - Replacement eval works with incremented digit
ok 346 - Replacement handles modules without package or VERSION
ok 347 - Replacement handles modules without package or VERSION
ok 348 - Called as class method
ok 349 - Replacement handles modules without VERSION
ok 350 - Replacement handles modules without VERSION
ok 351 - Replacement handles modules without VERSION
ok 352 - Replacement handles modules without VERSION
ok 353 - "$version" eq 1.2.3
ok 354 - $version == $new_version
ok 355 - v-string initialized $qv_declare()
ok 356 - "$version" eq "v1.2.3_4"
ok 357 - "$version" eq "v1.2.3_4" (from eval)
ok 358 - trailing zeros preserved
ok 359 - trailing zeros preserved
ok 360 - trailing zeros preserved
ok 361 - trailing zeros preserved
ok 362 - leading zero inferred
ok 363 - leading space ignored
ok 364 - Undef version comparison \#1
ok 365 - Undef version comparison \#2
ok 366 - Version string 'undef'
ok 367 - Version string 'undef'
ok 368 - Undef version comparison \#3
ok 369 - Undef version comparison \#4
ok 370 - No initializer at all
ok 371 - Undef version comparison \#5
ok 372 - Undef version comparison \#6
ok 373 - Very small version objects
ok 374 - Make sure very small versions don't freak
ok 375 - Comparing vs. version with no decimal
ok 376 - Comparing vs. version with decimal only
ok 377 - Make sure very small versions don't freak
ok 378 - Succeed - required == VERSION
ok 379 - No undef warnings
ok 380 - make sure we cleared qv() properly
ok 381 - make sure we exported qv() properly
ok 382 - The object isa tLNP5jK7
ok 383 - User typed numeric so we error with numeric
ok 384 - User typed extended so we error with extended
ok 385 # skip Cannot test locale handling without a comma locale
ok 386 # skip Cannot test locale handling without a comma locale
ok 387 # skip Cannot test locale handling without a comma locale
ok 388 # skip Cannot test locale handling without a comma locale
ok 389 - Invalid version format 1._1
ok 390 - Too large version
ok 391 - Too large version
ok 392 - Don't fall for Data::Dumper's tricks
ok 393 - Deal with badly serialized versions from YAML
ok 394 - Deal with badly serialized versions from YAML 
ok 395 - Correctly guesses this is not a v-string
ok 396 - Correctly guess that this is a v-string
ok 397 - Compare 3 and 4 digit v-strings
ok 398 - Compare 3 and 4 digit v-strings, leaving v
ok 399 - Compare 3 and 4 digit v-strings, quoted
ok 400 - Compare 3 and 4 digit v-strings, quoted leading v
ok 401 - 5.005_03 eq 5.00503
ok 402 - 1.23 eq "1.23"
ok 403 - "5.005_03" eq "5.005_03"
ok 404 - "v1.23" eq "v1.23"
ok 405 - 5.005 eq "5.005"
ok 406 - 5.006.001 eq v5.6.1
ok 407 - No leading v
ok 408 - alpha version 1.2.3_4 eq v1.2.3_4
ok 409 - Invalid version format (multiple underscores)
ok 410 - Invalid version format (underscores before decimal)
ok 411 - Invalid version format (alpha without decimal)
ok 412 - Invalid version format (non-numeric data)
ok 413 - Invalid version format (non-numeric data)
ok 414 - Invalid version format (non-numeric data)
ok 415 - boolean
ok 416 - The object isa version
ok 417 - $version <=> $version == 0
ok 418 - $version == $version
ok 419 - $version == $version
ok 420 - $version < $new_version
ok 421 - $new_version > $version
ok 422 - $version != $new_version
ok 423 - $version < $new_version
ok 424 - $new_version > $version
ok 425 - $version != $new_version
ok 426 - $version->numify() == 5.006001
ok 427 - $version->numify() <= 5.006001
ok 428 - $version->numify() < 5.008
ok 429 - $version == "1.2.3"
ok 430 - $version->numify == 1.002003
ok 431 - $version == 2002.9.30.1
ok 432 - $version->numify == 2002.009030001
ok 433 - $version < $new_version
ok 434 - $new_version > $version
ok 435 - $version != $new_version
ok 436 - $version > $new_version
ok 437 - $new_version < $version
ok 438 - $version != $new_version
ok 439 - $version < $new_version
ok 440 - $new_version > $version
ok 441 - $version != $new_version
ok 442 - !$version->is_alpha
ok 443 - $new_version->is_alpha
ok 444 - $version > $new_version
ok 445 - $new_version < $version
ok 446 - $version != $new_version
ok 447 - $version > $new_version
ok 448 - $new_version < $version
ok 449 - $version != $new_version
ok 450 - $version == $new_version
ok 451 - $version == $new_version
ok 452 - $version < $new_version
ok 453 - $version < $new_version
ok 454 - $version > $new_version
ok 455 - noop ++
ok 456 - noop --
ok 457 - noop /
ok 458 - noop *
ok 459 - noop abs
ok 460 - declare("1.2") == "1.2.0"
ok 461 - declare(1.2) == "1.2.0"
ok 462 - The object isa version
ok 463 - new from existing object
ok 464 - class->parse(v1.2) identical
ok 465 - The object isa version
ok 466 - version->parse() doesn't clone
ok 467 - $version->$method("1.2.3") works too
ok 468 - qw$Revision: 1.2$ == 1.2.0
ok 469 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 470 - CPAN-style alpha version
ok 471 - 1.23_01 > 1.23
ok 472 - 1.23_01 < 1.24
ok 473 - Replacement eval works with exact version
ok 474 - Called as class method
ok 475 - Don't freak if the module doesn't even exist
ok 476 - Replacement eval works with incremented version
ok 477 - Replacement eval works with single digit
ok 478 - Replacement eval works with incremented digit
ok 479 - Replacement handles modules without package or VERSION
ok 480 - Replacement handles modules without package or VERSION
ok 481 - Called as class method
ok 482 - Replacement handles modules without VERSION
ok 483 - Replacement handles modules without VERSION
ok 484 - Replacement handles modules without VERSION
ok 485 - Replacement handles modules without VERSION
ok 486 - "$version" eq 1.2.3
ok 487 - $version == $new_version
ok 488 - v-string initialized $qv_declare()
ok 489 - "$version" eq "v1.2.3_4"
ok 490 - "$version" eq "v1.2.3_4" (from eval)
ok 491 - trailing zeros preserved
ok 492 - trailing zeros preserved
ok 493 - trailing zeros preserved
ok 494 - trailing zeros preserved
ok 495 - leading zero inferred
ok 496 - leading space ignored
ok 497 - Undef version comparison \#1
ok 498 - Undef version comparison \#2
ok 499 - Version string 'undef'
ok 500 - Version string 'undef'
ok 501 - Undef version comparison \#3
ok 502 - Undef version comparison \#4
ok 503 - No initializer at all
ok 504 - Undef version comparison \#5
ok 505 - Undef version comparison \#6
ok 506 - Very small version objects
ok 507 - Make sure very small versions don't freak
ok 508 - Comparing vs. version with no decimal
ok 509 - Comparing vs. version with decimal only
ok 510 - Make sure very small versions don't freak
ok 511 - Succeed - required == VERSION
ok 512 - No undef warnings
ok 513 - make sure we cleared declare() properly
ok 514 - make sure we exported declare() properly
ok 515 - The object isa t1m7WjME
ok 516 - User typed numeric so we error with numeric
ok 517 - User typed extended so we error with extended
ok 518 # skip Cannot test locale handling without a comma locale
ok 519 # skip Cannot test locale handling without a comma locale
ok 520 # skip Cannot test locale handling without a comma locale
ok 521 # skip Cannot test locale handling without a comma locale
ok 522 - Invalid version format 1._1
ok 523 - Too large version
ok 524 - Too large version
ok 525 - Don't fall for Data::Dumper's tricks
ok 526 - Deal with badly serialized versions from YAML
ok 527 - Deal with badly serialized versions from YAML 
ok 528 - Correctly guesses this is not a v-string
ok 529 - Correctly guess that this is a v-string
ok 530 - Compare 3 and 4 digit v-strings
ok 531 - Compare 3 and 4 digit v-strings, leaving v
ok 532 - Compare 3 and 4 digit v-strings, quoted
ok 533 - Compare 3 and 4 digit v-strings, quoted leading v
ok 534 - Only export declare once per package (to prevent redefined warnings).
ok 535 - Fix for RT \#47980
1..535
ok
t/02derived.t ..... 
ok 1 - use version;
ok 2 - use tiwPbJYU;
ok 3 - The object isa tiwPbJYU
ok 4 - Numified correctly
ok 5 - Stringified correctly
ok 6 - Normalified correctly
ok 7 - Comparison vs parent class
ok 8 - 5.005_03 eq 5.00503
ok 9 - 1.23 eq "1.23"
ok 10 - "5.005_03" eq "5.005_03"
ok 11 - "v1.23" eq "v1.23"
ok 12 - 5.005 eq "5.005"
ok 13 - 5.006.001 eq v5.6.1
ok 14 - No leading v
ok 15 - alpha version 1.2.3_4 eq v1.2.3_4
ok 16 - Invalid version format (multiple underscores)
ok 17 - Invalid version format (underscores before decimal)
ok 18 - Invalid version format (alpha without decimal)
ok 19 - Invalid version format (non-numeric data)
ok 20 - Invalid version format (non-numeric data)
ok 21 - Invalid version format (non-numeric data)
ok 22 - boolean
ok 23 - The object isa tiwPbJYU
ok 24 - $version <=> $version == 0
ok 25 - $version == $version
ok 26 - $version == $version
ok 27 - $version < $new_version
ok 28 - $new_version > $version
ok 29 - $version != $new_version
ok 30 - $version < $new_version
ok 31 - $new_version > $version
ok 32 - $version != $new_version
ok 33 - $version->numify() == 5.006001
ok 34 - $version->numify() <= 5.006001
ok 35 - $version->numify() < 5.008
ok 36 - $version == "1.2.3"
ok 37 - $version->numify == 1.002003
ok 38 - $version == 2002.9.30.1
ok 39 - $version->numify == 2002.009030001
ok 40 - $version < $new_version
ok 41 - $new_version > $version
ok 42 - $version != $new_version
ok 43 - $version > $new_version
ok 44 - $new_version < $version
ok 45 - $version != $new_version
ok 46 - $version < $new_version
ok 47 - $new_version > $version
ok 48 - $version != $new_version
ok 49 - !$version->is_alpha
ok 50 - $new_version->is_alpha
ok 51 - $version > $new_version
ok 52 - $new_version < $version
ok 53 - $version != $new_version
ok 54 - $version > $new_version
ok 55 - $new_version < $version
ok 56 - $version != $new_version
ok 57 - $version == $new_version
ok 58 - $version == $new_version
ok 59 - $version < $new_version
ok 60 - $version < $new_version
ok 61 - $version > $new_version
ok 62 - noop ++
ok 63 - noop --
ok 64 - noop /
ok 65 - noop *
ok 66 - noop abs
ok 67 - qv("1.2") == "1.2.0"
ok 68 - qv(1.2) == "1.2.0"
ok 69 - The object isa tiwPbJYU
ok 70 - new from existing object
ok 71 - class->new(v1.2) identical
ok 72 - The object isa tiwPbJYU
ok 73 - version->new() doesn't clone
ok 74 - $version->$method("1.2.3") works too
ok 75 - qw$Revision: 1.2$ == 1.2.0
ok 76 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 77 - CPAN-style alpha version
ok 78 - 1.23_01 > 1.23
ok 79 - 1.23_01 < 1.24
ok 80 - Replacement eval works with exact version
ok 81 - Called as class method
ok 82 - Don't freak if the module doesn't even exist
ok 83 - Replacement eval works with incremented version
ok 84 - Replacement eval works with single digit
ok 85 - Replacement eval works with incremented digit
ok 86 - Replacement handles modules without package or VERSION
ok 87 - Replacement handles modules without package or VERSION
ok 88 - Called as class method
ok 89 - Replacement handles modules without VERSION
ok 90 - Replacement handles modules without VERSION
ok 91 - Replacement handles modules without VERSION
ok 92 - Replacement handles modules without VERSION
ok 93 - "$version" eq 1.2.3
ok 94 - $version == $new_version
ok 95 - v-string initialized $qv_declare()
ok 96 - "$version" eq "v1.2.3_4"
ok 97 - "$version" eq "v1.2.3_4" (from eval)
ok 98 - trailing zeros preserved
ok 99 - trailing zeros preserved
ok 100 - trailing zeros preserved
ok 101 - trailing zeros preserved
ok 102 - leading zero inferred
ok 103 - leading space ignored
ok 104 - Undef version comparison \#1
ok 105 - Undef version comparison \#2
ok 106 - Version string 'undef'
ok 107 - Version string 'undef'
ok 108 - Undef version comparison \#3
ok 109 - Undef version comparison \#4
ok 110 - No initializer at all
ok 111 - Undef version comparison \#5
ok 112 - Undef version comparison \#6
ok 113 - Very small version objects
ok 114 - Make sure very small versions don't freak
ok 115 - Comparing vs. version with no decimal
ok 116 - Comparing vs. version with decimal only
ok 117 - Make sure very small versions don't freak
ok 118 - Succeed - required == VERSION
ok 119 - No undef warnings
ok 120 - make sure we cleared qv() properly
ok 121 - make sure we exported qv() properly
ok 122 - The object isa ti4IClPU
ok 123 - User typed numeric so we error with numeric
ok 124 - User typed extended so we error with extended
ok 125 # skip Cannot test locale handling without a comma locale
ok 126 # skip Cannot test locale handling without a comma locale
ok 127 # skip Cannot test locale handling without a comma locale
ok 128 # skip Cannot test locale handling without a comma locale
ok 129 - Invalid version format 1._1
ok 130 - Too large version
ok 131 - Too large version
ok 132 - Don't fall for Data::Dumper's tricks
ok 133 - Deal with badly serialized versions from YAML
ok 134 - Deal with badly serialized versions from YAML 
ok 135 - Correctly guesses this is not a v-string
ok 136 - Correctly guess that this is a v-string
ok 137 - Compare 3 and 4 digit v-strings
ok 138 - Compare 3 and 4 digit v-strings, leaving v
ok 139 - Compare 3 and 4 digit v-strings, quoted
ok 140 - Compare 3 and 4 digit v-strings, quoted leading v
ok 141 - use tiwPbJYU;
ok 142 - 5.005_03 eq 5.00503
ok 143 - 1.23 eq "1.23"
ok 144 - "5.005_03" eq "5.005_03"
ok 145 - "v1.23" eq "v1.23"
ok 146 - 5.005 eq "5.005"
ok 147 - 5.006.001 eq v5.6.1
ok 148 - No leading v
ok 149 - alpha version 1.2.3_4 eq v1.2.3_4
ok 150 - Invalid version format (multiple underscores)
ok 151 - Invalid version format (underscores before decimal)
ok 152 - Invalid version format (alpha without decimal)
ok 153 - Invalid version format (non-numeric data)
ok 154 - Invalid version format (non-numeric data)
ok 155 - Invalid version format (non-numeric data)
ok 156 - boolean
ok 157 - The object isa tiwPbJYU
ok 158 - $version <=> $version == 0
ok 159 - $version == $version
ok 160 - $version == $version
ok 161 - $version < $new_version
ok 162 - $new_version > $version
ok 163 - $version != $new_version
ok 164 - $version < $new_version
ok 165 - $new_version > $version
ok 166 - $version != $new_version
ok 167 - $version->numify() == 5.006001
ok 168 - $version->numify() <= 5.006001
ok 169 - $version->numify() < 5.008
ok 170 - $version == "1.2.3"
ok 171 - $version->numify == 1.002003
ok 172 - $version == 2002.9.30.1
ok 173 - $version->numify == 2002.009030001
ok 174 - $version < $new_version
ok 175 - $new_version > $version
ok 176 - $version != $new_version
ok 177 - $version > $new_version
ok 178 - $new_version < $version
ok 179 - $version != $new_version
ok 180 - $version < $new_version
ok 181 - $new_version > $version
ok 182 - $version != $new_version
ok 183 - !$version->is_alpha
ok 184 - $new_version->is_alpha
ok 185 - $version > $new_version
ok 186 - $new_version < $version
ok 187 - $version != $new_version
ok 188 - $version > $new_version
ok 189 - $new_version < $version
ok 190 - $version != $new_version
ok 191 - $version == $new_version
ok 192 - $version == $new_version
ok 193 - $version < $new_version
ok 194 - $version < $new_version
ok 195 - $version > $new_version
ok 196 - noop ++
ok 197 - noop --
ok 198 - noop /
ok 199 - noop *
ok 200 - noop abs
ok 201 - declare("1.2") == "1.2.0"
ok 202 - declare(1.2) == "1.2.0"
ok 203 - The object isa tiwPbJYU
ok 204 - new from existing object
ok 205 - class->new(v1.2) identical
ok 206 - The object isa tiwPbJYU
ok 207 - version->new() doesn't clone
ok 208 - $version->$method("1.2.3") works too
ok 209 - qw$Revision: 1.2$ == 1.2.0
ok 210 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 211 - CPAN-style alpha version
ok 212 - 1.23_01 > 1.23
ok 213 - 1.23_01 < 1.24
ok 214 - Replacement eval works with exact version
ok 215 - Called as class method
ok 216 - Don't freak if the module doesn't even exist
ok 217 - Replacement eval works with incremented version
ok 218 - Replacement eval works with single digit
ok 219 - Replacement eval works with incremented digit
ok 220 - Replacement handles modules without package or VERSION
ok 221 - Replacement handles modules without package or VERSION
ok 222 - Called as class method
ok 223 - Replacement handles modules without VERSION
ok 224 - Replacement handles modules without VERSION
ok 225 - Replacement handles modules without VERSION
ok 226 - Replacement handles modules without VERSION
ok 227 - "$version" eq 1.2.3
ok 228 - $version == $new_version
ok 229 - v-string initialized $qv_declare()
ok 230 - "$version" eq "v1.2.3_4"
ok 231 - "$version" eq "v1.2.3_4" (from eval)
ok 232 - trailing zeros preserved
ok 233 - trailing zeros preserved
ok 234 - trailing zeros preserved
ok 235 - trailing zeros preserved
ok 236 - leading zero inferred
ok 237 - leading space ignored
ok 238 - Undef version comparison \#1
ok 239 - Undef version comparison \#2
ok 240 - Version string 'undef'
ok 241 - Version string 'undef'
ok 242 - Undef version comparison \#3
ok 243 - Undef version comparison \#4
ok 244 - No initializer at all
ok 245 - Undef version comparison \#5
ok 246 - Undef version comparison \#6
ok 247 - Very small version objects
ok 248 - Make sure very small versions don't freak
ok 249 - Comparing vs. version with no decimal
ok 250 - Comparing vs. version with decimal only
ok 251 - Make sure very small versions don't freak
ok 252 - Succeed - required == VERSION
ok 253 - No undef warnings
ok 254 - make sure we cleared declare() properly
ok 255 - make sure we exported declare() properly
ok 256 - The object isa tIMU1r8S
ok 257 - User typed numeric so we error with numeric
ok 258 - User typed extended so we error with extended
ok 259 # skip Cannot test locale handling without a comma locale
ok 260 # skip Cannot test locale handling without a comma locale
ok 261 # skip Cannot test locale handling without a comma locale
ok 262 # skip Cannot test locale handling without a comma locale
ok 263 - Invalid version format 1._1
ok 264 - Too large version
ok 265 - Too large version
ok 266 - Don't fall for Data::Dumper's tricks
ok 267 - Deal with badly serialized versions from YAML
ok 268 - Deal with badly serialized versions from YAML 
ok 269 - Correctly guesses this is not a v-string
ok 270 - Correctly guess that this is a v-string
ok 271 - Compare 3 and 4 digit v-strings
ok 272 - Compare 3 and 4 digit v-strings, leaving v
ok 273 - Compare 3 and 4 digit v-strings, quoted
ok 274 - Compare 3 and 4 digit v-strings, quoted leading v
ok 275 - use tiwPbJYU;
ok 276 - 5.005_03 eq 5.00503
ok 277 - 1.23 eq "1.23"
ok 278 - "5.005_03" eq "5.005_03"
ok 279 - "v1.23" eq "v1.23"
ok 280 - 5.005 eq "5.005"
ok 281 - 5.006.001 eq v5.6.1
ok 282 - No leading v
ok 283 - alpha version 1.2.3_4 eq v1.2.3_4
ok 284 - Invalid version format (multiple underscores)
ok 285 - Invalid version format (underscores before decimal)
ok 286 - Invalid version format (alpha without decimal)
ok 287 - Invalid version format (non-numeric data)
ok 288 - Invalid version format (non-numeric data)
ok 289 - Invalid version format (non-numeric data)
ok 290 - boolean
ok 291 - The object isa tiwPbJYU
ok 292 - $version <=> $version == 0
ok 293 - $version == $version
ok 294 - $version == $version
ok 295 - $version < $new_version
ok 296 - $new_version > $version
ok 297 - $version != $new_version
ok 298 - $version < $new_version
ok 299 - $new_version > $version
ok 300 - $version != $new_version
ok 301 - $version->numify() == 5.006001
ok 302 - $version->numify() <= 5.006001
ok 303 - $version->numify() < 5.008
ok 304 - $version == "1.2.3"
ok 305 - $version->numify == 1.002003
ok 306 - $version == 2002.9.30.1
ok 307 - $version->numify == 2002.009030001
ok 308 - $version < $new_version
ok 309 - $new_version > $version
ok 310 - $version != $new_version
ok 311 - $version > $new_version
ok 312 - $new_version < $version
ok 313 - $version != $new_version
ok 314 - $version < $new_version
ok 315 - $new_version > $version
ok 316 - $version != $new_version
ok 317 - !$version->is_alpha
ok 318 - $new_version->is_alpha
ok 319 - $version > $new_version
ok 320 - $new_version < $version
ok 321 - $version != $new_version
ok 322 - $version > $new_version
ok 323 - $new_version < $version
ok 324 - $version != $new_version
ok 325 - $version == $new_version
ok 326 - $version == $new_version
ok 327 - $version < $new_version
ok 328 - $version < $new_version
ok 329 - $version > $new_version
ok 330 - noop ++
ok 331 - noop --
ok 332 - noop /
ok 333 - noop *
ok 334 - noop abs
ok 335 - qv("1.2") == "1.2.0"
ok 336 - qv(1.2) == "1.2.0"
ok 337 - The object isa tiwPbJYU
ok 338 - new from existing object
ok 339 - class->parse(v1.2) identical
ok 340 - The object isa tiwPbJYU
ok 341 - version->parse() doesn't clone
ok 342 - $version->$method("1.2.3") works too
ok 343 - qw$Revision: 1.2$ == 1.2.0
ok 344 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 345 - CPAN-style alpha version
ok 346 - 1.23_01 > 1.23
ok 347 - 1.23_01 < 1.24
ok 348 - Replacement eval works with exact version
ok 349 - Called as class method
ok 350 - Don't freak if the module doesn't even exist
ok 351 - Replacement eval works with incremented version
ok 352 - Replacement eval works with single digit
ok 353 - Replacement eval works with incremented digit
ok 354 - Replacement handles modules without package or VERSION
ok 355 - Replacement handles modules without package or VERSION
ok 356 - Called as class method
ok 357 - Replacement handles modules without VERSION
ok 358 - Replacement handles modules without VERSION
ok 359 - Replacement handles modules without VERSION
ok 360 - Replacement handles modules without VERSION
ok 361 - "$version" eq 1.2.3
ok 362 - $version == $new_version
ok 363 - v-string initialized $qv_declare()
ok 364 - "$version" eq "v1.2.3_4"
ok 365 - "$version" eq "v1.2.3_4" (from eval)
ok 366 - trailing zeros preserved
ok 367 - trailing zeros preserved
ok 368 - trailing zeros preserved
ok 369 - trailing zeros preserved
ok 370 - leading zero inferred
ok 371 - leading space ignored
ok 372 - Undef version comparison \#1
ok 373 - Undef version comparison \#2
ok 374 - Version string 'undef'
ok 375 - Version string 'undef'
ok 376 - Undef version comparison \#3
ok 377 - Undef version comparison \#4
ok 378 - No initializer at all
ok 379 - Undef version comparison \#5
ok 380 - Undef version comparison \#6
ok 381 - Very small version objects
ok 382 - Make sure very small versions don't freak
ok 383 - Comparing vs. version with no decimal
ok 384 - Comparing vs. version with decimal only
ok 385 - Make sure very small versions don't freak
ok 386 - Succeed - required == VERSION
ok 387 - No undef warnings
ok 388 - make sure we cleared qv() properly
ok 389 - make sure we exported qv() properly
ok 390 - The object isa t1PVYJB0
ok 391 - User typed numeric so we error with numeric
ok 392 - User typed extended so we error with extended
ok 393 # skip Cannot test locale handling without a comma locale
ok 394 # skip Cannot test locale handling without a comma locale
ok 395 # skip Cannot test locale handling without a comma locale
ok 396 # skip Cannot test locale handling without a comma locale
ok 397 - Invalid version format 1._1
ok 398 - Too large version
ok 399 - Too large version
ok 400 - Don't fall for Data::Dumper's tricks
ok 401 - Deal with badly serialized versions from YAML
ok 402 - Deal with badly serialized versions from YAML 
ok 403 - Correctly guesses this is not a v-string
ok 404 - Correctly guess that this is a v-string
ok 405 - Compare 3 and 4 digit v-strings
ok 406 - Compare 3 and 4 digit v-strings, leaving v
ok 407 - Compare 3 and 4 digit v-strings, quoted
ok 408 - Compare 3 and 4 digit v-strings, quoted leading v
ok 409 - use tiwPbJYU;
ok 410 - 5.005_03 eq 5.00503
ok 411 - 1.23 eq "1.23"
ok 412 - "5.005_03" eq "5.005_03"
ok 413 - "v1.23" eq "v1.23"
ok 414 - 5.005 eq "5.005"
ok 415 - 5.006.001 eq v5.6.1
ok 416 - No leading v
ok 417 - alpha version 1.2.3_4 eq v1.2.3_4
ok 418 - Invalid version format (multiple underscores)
ok 419 - Invalid version format (underscores before decimal)
ok 420 - Invalid version format (alpha without decimal)
ok 421 - Invalid version format (non-numeric data)
ok 422 - Invalid version format (non-numeric data)
ok 423 - Invalid version format (non-numeric data)
ok 424 - boolean
ok 425 - The object isa tiwPbJYU
ok 426 - $version <=> $version == 0
ok 427 - $version == $version
ok 428 - $version == $version
ok 429 - $version < $new_version
ok 430 - $new_version > $version
ok 431 - $version != $new_version
ok 432 - $version < $new_version
ok 433 - $new_version > $version
ok 434 - $version != $new_version
ok 435 - $version->numify() == 5.006001
ok 436 - $version->numify() <= 5.006001
ok 437 - $version->numify() < 5.008
ok 438 - $version == "1.2.3"
ok 439 - $version->numify == 1.002003
ok 440 - $version == 2002.9.30.1
ok 441 - $version->numify == 2002.009030001
ok 442 - $version < $new_version
ok 443 - $new_version > $version
ok 444 - $version != $new_version
ok 445 - $version > $new_version
ok 446 - $new_version < $version
ok 447 - $version != $new_version
ok 448 - $version < $new_version
ok 449 - $new_version > $version
ok 450 - $version != $new_version
ok 451 - !$version->is_alpha
ok 452 - $new_version->is_alpha
ok 453 - $version > $new_version
ok 454 - $new_version < $version
ok 455 - $version != $new_version
ok 456 - $version > $new_version
ok 457 - $new_version < $version
ok 458 - $version != $new_version
ok 459 - $version == $new_version
ok 460 - $version == $new_version
ok 461 - $version < $new_version
ok 462 - $version < $new_version
ok 463 - $version > $new_version
ok 464 - noop ++
ok 465 - noop --
ok 466 - noop /
ok 467 - noop *
ok 468 - noop abs
ok 469 - declare("1.2") == "1.2.0"
ok 470 - declare(1.2) == "1.2.0"
ok 471 - The object isa tiwPbJYU
ok 472 - new from existing object
ok 473 - class->parse(v1.2) identical
ok 474 - The object isa tiwPbJYU
ok 475 - version->parse() doesn't clone
ok 476 - $version->$method("1.2.3") works too
ok 477 - qw$Revision: 1.2$ == 1.2.0
ok 478 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 479 - CPAN-style alpha version
ok 480 - 1.23_01 > 1.23
ok 481 - 1.23_01 < 1.24
ok 482 - Replacement eval works with exact version
ok 483 - Called as class method
ok 484 - Don't freak if the module doesn't even exist
ok 485 - Replacement eval works with incremented version
ok 486 - Replacement eval works with single digit
ok 487 - Replacement eval works with incremented digit
ok 488 - Replacement handles modules without package or VERSION
ok 489 - Replacement handles modules without package or VERSION
ok 490 - Called as class method
ok 491 - Replacement handles modules without VERSION
ok 492 - Replacement handles modules without VERSION
ok 493 - Replacement handles modules without VERSION
ok 494 - Replacement handles modules without VERSION
ok 495 - "$version" eq 1.2.3
ok 496 - $version == $new_version
ok 497 - v-string initialized $qv_declare()
ok 498 - "$version" eq "v1.2.3_4"
ok 499 - "$version" eq "v1.2.3_4" (from eval)
ok 500 - trailing zeros preserved
ok 501 - trailing zeros preserved
ok 502 - trailing zeros preserved
ok 503 - trailing zeros preserved
ok 504 - leading zero inferred
ok 505 - leading space ignored
ok 506 - Undef version comparison \#1
ok 507 - Undef version comparison \#2
ok 508 - Version string 'undef'
ok 509 - Version string 'undef'
ok 510 - Undef version comparison \#3
ok 511 - Undef version comparison \#4
ok 512 - No initializer at all
ok 513 - Undef version comparison \#5
ok 514 - Undef version comparison \#6
ok 515 - Very small version objects
ok 516 - Make sure very small versions don't freak
ok 517 - Comparing vs. version with no decimal
ok 518 - Comparing vs. version with decimal only
ok 519 - Make sure very small versions don't freak
ok 520 - Succeed - required == VERSION
ok 521 - No undef warnings
ok 522 - make sure we cleared declare() properly
ok 523 - make sure we exported declare() properly
ok 524 - The object isa tuZKTu_4
ok 525 - User typed numeric so we error with numeric
ok 526 - User typed extended so we error with extended
ok 527 # skip Cannot test locale handling without a comma locale
ok 528 # skip Cannot test locale handling without a comma locale
ok 529 # skip Cannot test locale handling without a comma locale
ok 530 # skip Cannot test locale handling without a comma locale
ok 531 - Invalid version format 1._1
ok 532 - Too large version
ok 533 - Too large version
ok 534 - Don't fall for Data::Dumper's tricks
ok 535 - Deal with badly serialized versions from YAML
ok 536 - Deal with badly serialized versions from YAML 
ok 537 - Correctly guesses this is not a v-string
ok 538 - Correctly guess that this is a v-string
ok 539 - Compare 3 and 4 digit v-strings
ok 540 - Compare 3 and 4 digit v-strings, leaving v
ok 541 - Compare 3 and 4 digit v-strings, quoted
ok 542 - Compare 3 and 4 digit v-strings, quoted leading v
ok 543 - The object isa version::Bad
ok 544 - Bad subclass numify
ok 545 - Bad subclass normal
ok 546 - Bad subclass stringify
ok 547 - Bad subclass vcmp
1..547
ok
t/03require.t ..... 
ok 1 - require version;
ok 2 - Make sure we have the correct class
ok 3 - We don't have the imported qv()
ok 4 - We don't have the imported declare()
ok 5 - 5.005_03 eq 5.00503
ok 6 - 1.23 eq "1.23"
ok 7 - "5.005_03" eq "5.005_03"
ok 8 - "v1.23" eq "v1.23"
ok 9 - 5.005 eq "5.005"
ok 10 - 5.006.001 eq v5.6.1
ok 11 - No leading v
ok 12 - alpha version 1.2.3_4 eq v1.2.3_4
ok 13 - Invalid version format (multiple underscores)
ok 14 - Invalid version format (underscores before decimal)
ok 15 - Invalid version format (alpha without decimal)
ok 16 - Invalid version format (non-numeric data)
ok 17 - Invalid version format (non-numeric data)
ok 18 - Invalid version format (non-numeric data)
ok 19 - boolean
ok 20 - The object isa version
ok 21 - $version <=> $version == 0
ok 22 - $version == $version
ok 23 - $version == $version
ok 24 - $version < $new_version
ok 25 - $new_version > $version
ok 26 - $version != $new_version
ok 27 - $version < $new_version
ok 28 - $new_version > $version
ok 29 - $version != $new_version
ok 30 - $version->numify() == 5.006001
ok 31 - $version->numify() <= 5.006001
ok 32 - $version->numify() < 5.008
ok 33 - $version == "1.2.3"
ok 34 - $version->numify == 1.002003
ok 35 - $version == 2002.9.30.1
ok 36 - $version->numify == 2002.009030001
ok 37 - $version < $new_version
ok 38 - $new_version > $version
ok 39 - $version != $new_version
ok 40 - $version > $new_version
ok 41 - $new_version < $version
ok 42 - $version != $new_version
ok 43 - $version < $new_version
ok 44 - $new_version > $version
ok 45 - $version != $new_version
ok 46 - !$version->is_alpha
ok 47 - $new_version->is_alpha
ok 48 - $version > $new_version
ok 49 - $new_version < $version
ok 50 - $version != $new_version
ok 51 - $version > $new_version
ok 52 - $new_version < $version
ok 53 - $version != $new_version
ok 54 - $version == $new_version
ok 55 - $version == $new_version
ok 56 - $version < $new_version
ok 57 - $version < $new_version
ok 58 - $version > $new_version
ok 59 - noop ++
ok 60 - noop --
ok 61 - noop /
ok 62 - noop *
ok 63 - noop abs
ok 64 # skip version require'd instead of use'd, cannot test 
ok 65 # skip version require'd instead of use'd, cannot test 
ok 66 # skip version require'd instead of use'd, cannot test 
ok 67 - new from existing object
ok 68 - class->new(v1.2.3) identical
ok 69 - The object isa version
ok 70 - version->new() doesn't clone
ok 71 - $version->$method("1.2.3") works too
ok 72 - qw$Revision: 1.2$ == 1.2.0
ok 73 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 74 - CPAN-style alpha version
ok 75 - 1.23_01 > 1.23
ok 76 - 1.23_01 < 1.24
ok 77 - Replacement eval works with exact version
ok 78 - Called as class method
ok 79 - Don't freak if the module doesn't even exist
ok 80 - Replacement eval works with incremented version
ok 81 - Replacement eval works with single digit
ok 82 - Replacement eval works with incremented digit
ok 83 - Replacement handles modules without package or VERSION
ok 84 - Replacement handles modules without package or VERSION
ok 85 - Called as class method
ok 86 - Replacement handles modules without VERSION
ok 87 - Replacement handles modules without VERSION
ok 88 - Replacement handles modules without VERSION
ok 89 - Replacement handles modules without VERSION
ok 90 - "$version" eq 1.2.3
ok 91 - $version == $new_version
ok 92 # skip version require'd instead of use'd, cannot test declare
ok 93 - "$version" eq "v1.2.3_4"
ok 94 - "$version" eq "v1.2.3_4" (from eval)
ok 95 - trailing zeros preserved
ok 96 - trailing zeros preserved
ok 97 - trailing zeros preserved
ok 98 - trailing zeros preserved
ok 99 - leading zero inferred
ok 100 - leading space ignored
ok 101 - Undef version comparison \#1
ok 102 - Undef version comparison \#2
ok 103 - Version string 'undef'
ok 104 - Version string 'undef'
ok 105 - Undef version comparison \#3
ok 106 - Undef version comparison \#4
ok 107 - No initializer at all
ok 108 - Undef version comparison \#5
ok 109 - Undef version comparison \#6
ok 110 - Very small version objects
ok 111 - Make sure very small versions don't freak
ok 112 - Comparing vs. version with no decimal
ok 113 - Comparing vs. version with decimal only
ok 114 - Make sure very small versions don't freak
ok 115 - Succeed - required == VERSION
ok 116 - No undef warnings
ok 117 # skip Cannot test "use base qw(version)"  when require is used
ok 118 # skip Cannot test "use base qw(version)"  when require is used
ok 119 # skip Cannot test "use base qw(version)"  when require is used
ok 120 - User typed numeric so we error with numeric
ok 121 - User typed extended so we error with extended
ok 122 # skip Cannot test locale handling without a comma locale
ok 123 # skip Cannot test locale handling without a comma locale
ok 124 # skip Cannot test locale handling without a comma locale
ok 125 # skip Cannot test locale handling without a comma locale
ok 126 - Invalid version format 1._1
ok 127 - Too large version
ok 128 - Too large version
ok 129 - Don't fall for Data::Dumper's tricks
ok 130 - Deal with badly serialized versions from YAML
ok 131 - Deal with badly serialized versions from YAML 
ok 132 - Correctly guesses this is not a v-string
ok 133 - Correctly guess that this is a v-string
ok 134 - Compare 3 and 4 digit v-strings
ok 135 - Compare 3 and 4 digit v-strings, leaving v
ok 136 - Compare 3 and 4 digit v-strings, quoted
ok 137 - Compare 3 and 4 digit v-strings, quoted leading v
ok 138 - 5.005_03 eq 5.00503
ok 139 - 1.23 eq "1.23"
ok 140 - "5.005_03" eq "5.005_03"
ok 141 - "v1.23" eq "v1.23"
ok 142 - 5.005 eq "5.005"
ok 143 - 5.006.001 eq v5.6.1
ok 144 - No leading v
ok 145 - alpha version 1.2.3_4 eq v1.2.3_4
ok 146 - Invalid version format (multiple underscores)
ok 147 - Invalid version format (underscores before decimal)
ok 148 - Invalid version format (alpha without decimal)
ok 149 - Invalid version format (non-numeric data)
ok 150 - Invalid version format (non-numeric data)
ok 151 - Invalid version format (non-numeric data)
ok 152 - boolean
ok 153 - The object isa version
ok 154 - $version <=> $version == 0
ok 155 - $version == $version
ok 156 - $version == $version
ok 157 - $version < $new_version
ok 158 - $new_version > $version
ok 159 - $version != $new_version
ok 160 - $version < $new_version
ok 161 - $new_version > $version
ok 162 - $version != $new_version
ok 163 - $version->numify() == 5.006001
ok 164 - $version->numify() <= 5.006001
ok 165 - $version->numify() < 5.008
ok 166 - $version == "1.2.3"
ok 167 - $version->numify == 1.002003
ok 168 - $version == 2002.9.30.1
ok 169 - $version->numify == 2002.009030001
ok 170 - $version < $new_version
ok 171 - $new_version > $version
ok 172 - $version != $new_version
ok 173 - $version > $new_version
ok 174 - $new_version < $version
ok 175 - $version != $new_version
ok 176 - $version < $new_version
ok 177 - $new_version > $version
ok 178 - $version != $new_version
ok 179 - !$version->is_alpha
ok 180 - $new_version->is_alpha
ok 181 - $version > $new_version
ok 182 - $new_version < $version
ok 183 - $version != $new_version
ok 184 - $version > $new_version
ok 185 - $new_version < $version
ok 186 - $version != $new_version
ok 187 - $version == $new_version
ok 188 - $version == $new_version
ok 189 - $version < $new_version
ok 190 - $version < $new_version
ok 191 - $version > $new_version
ok 192 - noop ++
ok 193 - noop --
ok 194 - noop /
ok 195 - noop *
ok 196 - noop abs
ok 197 # skip version require'd instead of use'd, cannot test 
ok 198 # skip version require'd instead of use'd, cannot test 
ok 199 # skip version require'd instead of use'd, cannot test 
ok 200 - new from existing object
ok 201 - class->parse(v1.2.3) identical
ok 202 - The object isa version
ok 203 - version->parse() doesn't clone
ok 204 - $version->$method("1.2.3") works too
ok 205 - qw$Revision: 1.2$ == 1.2.0
ok 206 - qw$Revision: 1.2.3.4$ == 1.2.3.4
ok 207 - CPAN-style alpha version
ok 208 - 1.23_01 > 1.23
ok 209 - 1.23_01 < 1.24
ok 210 - Replacement eval works with exact version
ok 211 - Called as class method
ok 212 - Don't freak if the module doesn't even exist
ok 213 - Replacement eval works with incremented version
ok 214 - Replacement eval works with single digit
ok 215 - Replacement eval works with incremented digit
ok 216 - Replacement handles modules without package or VERSION
ok 217 - Replacement handles modules without package or VERSION
ok 218 - Called as class method
ok 219 - Replacement handles modules without VERSION
ok 220 - Replacement handles modules without VERSION
ok 221 - Replacement handles modules without VERSION
ok 222 - Replacement handles modules without VERSION
ok 223 - "$version" eq 1.2.3
ok 224 - $version == $new_version
ok 225 # skip version require'd instead of use'd, cannot test declare
ok 226 - "$version" eq "v1.2.3_4"
ok 227 - "$version" eq "v1.2.3_4" (from eval)
ok 228 - trailing zeros preserved
ok 229 - trailing zeros preserved
ok 230 - trailing zeros preserved
ok 231 - trailing zeros preserved
ok 232 - leading zero inferred
ok 233 - leading space ignored
ok 234 - Undef version comparison \#1
ok 235 - Undef version comparison \#2
ok 236 - Version string 'undef'
ok 237 - Version string 'undef'
ok 238 - Undef version comparison \#3
ok 239 - Undef version comparison \#4
ok 240 - No initializer at all
ok 241 - Undef version comparison \#5
ok 242 - Undef version comparison \#6
ok 243 - Very small version objects
ok 244 - Make sure very small versions don't freak
ok 245 - Comparing vs. version with no decimal
ok 246 - Comparing vs. version with decimal only
ok 247 - Make sure very small versions don't freak
ok 248 - Succeed - required == VERSION
ok 249 - No undef warnings
ok 250 # skip Cannot test "use base qw(version)"  when require is used
ok 251 # skip Cannot test "use base qw(version)"  when require is used
ok 252 # skip Cannot test "use base qw(version)"  when require is used
ok 253 - User typed numeric so we error with numeric
ok 254 - User typed extended so we error with extended
ok 255 # skip Cannot test locale handling without a comma locale
ok 256 # skip Cannot test locale handling without a comma locale
ok 257 # skip Cannot test locale handling without a comma locale
ok 258 # skip Cannot test locale handling without a comma locale
ok 259 - Invalid version format 1._1
ok 260 - Too large version
ok 261 - Too large version
ok 262 - Don't fall for Data::Dumper's tricks
ok 263 - Deal with badly serialized versions from YAML
ok 264 - Deal with badly serialized versions from YAML 
ok 265 - Correctly guesses this is not a v-string
ok 266 - Correctly guess that this is a v-string
ok 267 - Compare 3 and 4 digit v-strings
ok 268 - Compare 3 and 4 digit v-strings, leaving v
ok 269 - Compare 3 and 4 digit v-strings, quoted
ok 270 - Compare 3 and 4 digit v-strings, quoted leading v
1..270
ok
t/04strict_lax.t .. 
ok 1 - is_strict(1.00) [pass]
ok 2 - version::is_strict(1.00) [pass]
ok 3 - is_lax(1.00) [pass]
ok 4 - version::is_lax(1.00) [pass]
ok 5 - is_strict(1.00001) [pass]
ok 6 - version::is_strict(1.00001) [pass]
ok 7 - is_lax(1.00001) [pass]
ok 8 - version::is_lax(1.00001) [pass]
ok 9 - is_strict(0.123) [pass]
ok 10 - version::is_strict(0.123) [pass]
ok 11 - is_lax(0.123) [pass]
ok 12 - version::is_lax(0.123) [pass]
ok 13 - is_strict(12.345) [pass]
ok 14 - version::is_strict(12.345) [pass]
ok 15 - is_lax(12.345) [pass]
ok 16 - version::is_lax(12.345) [pass]
ok 17 - is_strict(42) [pass]
ok 18 - version::is_strict(42) [pass]
ok 19 - is_lax(42) [pass]
ok 20 - version::is_lax(42) [pass]
ok 21 - is_strict(0) [pass]
ok 22 - version::is_strict(0) [pass]
ok 23 - is_lax(0) [pass]
ok 24 - version::is_lax(0) [pass]
ok 25 - is_strict(0.0) [pass]
ok 26 - version::is_strict(0.0) [pass]
ok 27 - is_lax(0.0) [pass]
ok 28 - version::is_lax(0.0) [pass]
ok 29 - is_strict(v1.2.3) [pass]
ok 30 - version::is_strict(v1.2.3) [pass]
ok 31 - is_lax(v1.2.3) [pass]
ok 32 - version::is_lax(v1.2.3) [pass]
ok 33 - is_strict(v1.2.3.4) [pass]
ok 34 - version::is_strict(v1.2.3.4) [pass]
ok 35 - is_lax(v1.2.3.4) [pass]
ok 36 - version::is_lax(v1.2.3.4) [pass]
ok 37 - is_strict(v0.1.2) [pass]
ok 38 - version::is_strict(v0.1.2) [pass]
ok 39 - is_lax(v0.1.2) [pass]
ok 40 - version::is_lax(v0.1.2) [pass]
ok 41 - is_strict(v0.0.0) [pass]
ok 42 - version::is_strict(v0.0.0) [pass]
ok 43 - is_lax(v0.0.0) [pass]
ok 44 - version::is_lax(v0.0.0) [pass]
ok 45 - is_strict(01) [fail]
ok 46 - version::is_strict(01) [fail]
ok 47 - is_lax(01) [pass]
ok 48 - version::is_lax(01) [pass]
ok 49 - is_strict(01.0203) [fail]
ok 50 - version::is_strict(01.0203) [fail]
ok 51 - is_lax(01.0203) [pass]
ok 52 - version::is_lax(01.0203) [pass]
ok 53 - is_strict(v01) [fail]
ok 54 - version::is_strict(v01) [fail]
ok 55 - is_lax(v01) [pass]
ok 56 - version::is_lax(v01) [pass]
ok 57 - is_strict(v01.02.03) [fail]
ok 58 - version::is_strict(v01.02.03) [fail]
ok 59 - is_lax(v01.02.03) [pass]
ok 60 - version::is_lax(v01.02.03) [pass]
ok 61 - is_strict(.1) [fail]
ok 62 - version::is_strict(.1) [fail]
ok 63 - is_lax(.1) [pass]
ok 64 - version::is_lax(.1) [pass]
ok 65 - is_strict(.1.2) [fail]
ok 66 - version::is_strict(.1.2) [fail]
ok 67 - is_lax(.1.2) [pass]
ok 68 - version::is_lax(.1.2) [pass]
ok 69 - is_strict(1.) [fail]
ok 70 - version::is_strict(1.) [fail]
ok 71 - is_lax(1.) [pass]
ok 72 - version::is_lax(1.) [pass]
ok 73 - is_strict(1.a) [fail]
ok 74 - version::is_strict(1.a) [fail]
ok 75 - is_lax(1.a) [fail]
ok 76 - version::is_lax(1.a) [fail]
ok 77 - is_strict(1._) [fail]
ok 78 - version::is_strict(1._) [fail]
ok 79 - is_lax(1._) [fail]
ok 80 - version::is_lax(1._) [fail]
ok 81 - is_strict(1.02_03) [fail]
ok 82 - version::is_strict(1.02_03) [fail]
ok 83 - is_lax(1.02_03) [pass]
ok 84 - version::is_lax(1.02_03) [pass]
ok 85 - is_strict(v1.2_3) [fail]
ok 86 - version::is_strict(v1.2_3) [fail]
ok 87 - is_lax(v1.2_3) [pass]
ok 88 - version::is_lax(v1.2_3) [pass]
ok 89 - is_strict(v1.02_03) [fail]
ok 90 - version::is_strict(v1.02_03) [fail]
ok 91 - is_lax(v1.02_03) [pass]
ok 92 - version::is_lax(v1.02_03) [pass]
ok 93 - is_strict(v1.2_3_4) [fail]
ok 94 - version::is_strict(v1.2_3_4) [fail]
ok 95 - is_lax(v1.2_3_4) [fail]
ok 96 - version::is_lax(v1.2_3_4) [fail]
ok 97 - is_strict(v1.2_3.4) [fail]
ok 98 - version::is_strict(v1.2_3.4) [fail]
ok 99 - is_lax(v1.2_3.4) [fail]
ok 100 - version::is_lax(v1.2_3.4) [fail]
ok 101 - is_strict(1.2_3.4) [fail]
ok 102 - version::is_strict(1.2_3.4) [fail]
ok 103 - is_lax(1.2_3.4) [fail]
ok 104 - version::is_lax(1.2_3.4) [fail]
ok 105 - is_strict(0_) [fail]
ok 106 - version::is_strict(0_) [fail]
ok 107 - is_lax(0_) [fail]
ok 108 - version::is_lax(0_) [fail]
ok 109 - is_strict(1_) [fail]
ok 110 - version::is_strict(1_) [fail]
ok 111 - is_lax(1_) [fail]
ok 112 - version::is_lax(1_) [fail]
ok 113 - is_strict(1_.) [fail]
ok 114 - version::is_strict(1_.) [fail]
ok 115 - is_lax(1_.) [fail]
ok 116 - version::is_lax(1_.) [fail]
ok 117 - is_strict(1.1_) [fail]
ok 118 - version::is_strict(1.1_) [fail]
ok 119 - is_lax(1.1_) [fail]
ok 120 - version::is_lax(1.1_) [fail]
ok 121 - is_strict(1.02_03_04) [fail]
ok 122 - version::is_strict(1.02_03_04) [fail]
ok 123 - is_lax(1.02_03_04) [fail]
ok 124 - version::is_lax(1.02_03_04) [fail]
ok 125 - is_strict(1.2.3) [fail]
ok 126 - version::is_strict(1.2.3) [fail]
ok 127 - is_lax(1.2.3) [pass]
ok 128 - version::is_lax(1.2.3) [pass]
ok 129 - is_strict(v1.2) [fail]
ok 130 - version::is_strict(v1.2) [fail]
ok 131 - is_lax(v1.2) [pass]
ok 132 - version::is_lax(v1.2) [pass]
ok 133 - is_strict(v0) [fail]
ok 134 - version::is_strict(v0) [fail]
ok 135 - is_lax(v0) [pass]
ok 136 - version::is_lax(v0) [pass]
ok 137 - is_strict(v1) [fail]
ok 138 - version::is_strict(v1) [fail]
ok 139 - is_lax(v1) [pass]
ok 140 - version::is_lax(v1) [pass]
ok 141 - is_strict(v.1.2.3) [fail]
ok 142 - version::is_strict(v.1.2.3) [fail]
ok 143 - is_lax(v.1.2.3) [fail]
ok 144 - version::is_lax(v.1.2.3) [fail]
ok 145 - is_strict(v) [fail]
ok 146 - version::is_strict(v) [fail]
ok 147 - is_lax(v) [fail]
ok 148 - version::is_lax(v) [fail]
ok 149 - is_strict(v1.2345.6) [fail]
ok 150 - version::is_strict(v1.2345.6) [fail]
ok 151 - is_lax(v1.2345.6) [pass]
ok 152 - version::is_lax(v1.2345.6) [pass]
ok 153 - is_strict(undef) [fail]
ok 154 - version::is_strict(undef) [fail]
ok 155 - is_lax(undef) [pass]
ok 156 - version::is_lax(undef) [pass]
ok 157 - is_strict(1a) [fail]
ok 158 - version::is_strict(1a) [fail]
ok 159 - is_lax(1a) [fail]
ok 160 - version::is_lax(1a) [fail]
ok 161 - is_strict(1.2a3) [fail]
ok 162 - version::is_strict(1.2a3) [fail]
ok 163 - is_lax(1.2a3) [fail]
ok 164 - version::is_lax(1.2a3) [fail]
ok 165 - is_strict(bar) [fail]
ok 166 - version::is_strict(bar) [fail]
ok 167 - is_lax(bar) [fail]
ok 168 - version::is_lax(bar) [fail]
ok 169 - is_strict(_) [fail]
ok 170 - version::is_strict(_) [fail]
ok 171 - is_lax(_) [fail]
ok 172 - version::is_lax(_) [fail]
1..172
ok
All tests successful.
Files=4, Tests=1524,  2 wallclock secs ( 0.23 usr +  0.00 sys =  0.23 CPU)
Result: PASS
	nmake test -nologo
'No tests defined for version::vxs extension.'
	cd ..
  JPEACOCK/version-0.88.tar.gz
  nmake test TEST_VERBOSE=1 -- OK
PPD for version-0.88 already made
Running make for D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed
Prepending C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Metadata-1.000004.tar.gz

>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

cp lib/Module/Metadata.pm blib\lib\Module\Metadata.pm
  DAGOLDEN/Module-Metadata-1.000004.tar.gz
  nmake -- OK
Prepending C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
>>> nmake test TEST_VERBOSE=1

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t
t/metadata.t .. 
1..99
ok 1 - require Module::Metadata;
ok 2 - find_module_by_name() succeeds
ok 3 - fail if can't find module by module name
ok 4 - fail if can't find module by file name
ok 5 - new_from_file() succeeds
ok 6 - new_from_module() succeeds
ok 7 - correct module version (expected '1.23')
ok 8 - no warnings from parsing
ok 9 - correct module version (expected '1.23')
ok 10 - no warnings from parsing
ok 11 - correct module version (expected '1.23_01')
ok 12 - no warnings from parsing
ok 13 - correct module version (expected 'v1.2.3')
ok 14 - no warnings from parsing
ok 15 - correct module version (expected 'v1.2_3')
ok 16 - no warnings from parsing
ok 17 - correct module version (expected '1.23')
ok 18 - no warnings from parsing
ok 19 - correct module version (expected '1.23')
ok 20 - no warnings from parsing
ok 21 - correct module version (expected '1.234')
ok 22 - no warnings from parsing
ok 23 - correct module version (expected '0')
ok 24 - no warnings from parsing
ok 25 - correct module version (expected '1.23')
ok 26 - no warnings from parsing
ok 27 - correct module version (expected '1.23')
ok 28 - no warnings from parsing
ok 29 - correct module version (expected '1.23')
ok 30 - no warnings from parsing
ok 31 - correct module version (expected '1.23')
ok 32 - no warnings from parsing
ok 33 - correct module version (expected '1.23')
ok 34 - no warnings from parsing
ok 35 - correct module version (expected '1.23')
ok 36 - no warnings from parsing
ok 37 - correct module version (expected '1.23')
ok 38 - no warnings from parsing
ok 39 - correct module version (expected '1.23')
ok 40 - no warnings from parsing
ok 41 - correct module version (expected '1.23')
ok 42 - no warnings from parsing
ok 43 - correct module version (expected '1.23')
ok 44 - no warnings from parsing
ok 45 - correct module version (expected '1.23')
ok 46 - no warnings from parsing
ok 47 - correct module version (expected '1.23')
ok 48 - no warnings from parsing
ok 49 - correct module version (expected '1.23')
ok 50 - no warnings from parsing
ok 51 - correct module version (expected '1.23')
ok 52 - no warnings from parsing
ok 53 - correct module version (expected '1.23')
ok 54 - no warnings from parsing
ok 55 - correct module version (expected '1.23')
ok 56 - no warnings from parsing
ok 57 - correct module version (expected '1.23')
ok 58 - no warnings from parsing
ok 59 - correct module version (expected '1.23')
ok 60 - no warnings from parsing
ok 61 - correct module version (expected '1.23')
ok 62 - no warnings from parsing
ok 63 - correct module version (expected '1.23')
ok 64 - no warnings from parsing
ok 65 - correct module version (expected '1.23')
ok 66 - no warnings from parsing
ok 67 - correct module version (expected '1.23')
ok 68 - no warnings from parsing
ok 69 - record only one occurence of each package
ok 70 - no default package
ok 71 - no version w/o default package
ok 72 - alpha version reported
ok 73 - alpha version greater than non
ok 74 - correct script version (1 of 8)
ok 75 - correct script version (2 of 8)
ok 76 - correct script version (3 of 8)
ok 77 - correct script version (4 of 8)
ok 78 - correct script version (5 of 8)
ok 79 - correct script version (6 of 8)
ok 80 - correct script version (7 of 8)
ok 81 - correct script version (8 of 8)
ok 82 - found default package
ok 83 - version for default package
ok 84 - version for secondary package
ok 85 - filename() returns valid path to module file
ok 86 - found correct number of packages
ok 87 - packages stored in order found
ok 88 - contains_pod() succeeds
ok 89 - found all pod sections
ok 90 - return undef() if pod section not present
ok 91 - return undef() if pod section not collected
ok 92 - collected pod section
ok 93 - found default package
ok 94 - version for default package
ok 95 - packages inside
ok 96 - found default package
ok 97 - version for default package
ok 98 - packages inside
ok 99 - version for embedded package
ok
All tests successful.
Files=1, Tests=99,  1 wallclock secs ( 0.01 usr +  0.00 sys =  0.01 CPU)
Result: PASS
  DAGOLDEN/Module-Metadata-1.000004.tar.gz
  nmake test TEST_VERBOSE=1 -- OK
PPD for Module-Metadata-1.000004 already made
Running test for module 'CPAN::Meta'
Running make for D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\D\DA\DAGOLDEN\CPAN-Meta-2.110930.tar.gz ok
CPAN-Meta-2.110930
CPAN-Meta-2.110930/Todo
CPAN-Meta-2.110930/README
CPAN-Meta-2.110930/Changes
CPAN-Meta-2.110930/LICENSE
CPAN-Meta-2.110930/dist.ini
CPAN-Meta-2.110930/META.yml
CPAN-Meta-2.110930/MANIFEST
CPAN-Meta-2.110930/META.json
CPAN-Meta-2.110930/t
CPAN-Meta-2.110930/t/prereqs.t
CPAN-Meta-2.110930/Makefile.PL
CPAN-Meta-2.110930/t/no-index.t
CPAN-Meta-2.110930/t/load-bad.t
CPAN-Meta-2.110930/t/meta-obj.t
CPAN-Meta-2.110930/t/save-load.t
CPAN-Meta-2.110930/t/validator.t
CPAN-Meta-2.110930/t/converter.t
CPAN-Meta-2.110930/t/repository.t
CPAN-Meta-2.110930/lib/CPAN
CPAN-Meta-2.110930/lib/CPAN/Meta.pm
CPAN-Meta-2.110930/t/converter-bad.t
CPAN-Meta-2.110930/t/prereqs-merge.t
CPAN-Meta-2.110930/t/converter-fail.t
CPAN-Meta-2.110930/t/data
CPAN-Meta-2.110930/t/data/gpl-1_4.yml
CPAN-Meta-2.110930/t/data/META-2.json
CPAN-Meta-2.110930/t/data/META-1_1.yml
CPAN-Meta-2.110930/t/data/META-1_0.yml
CPAN-Meta-2.110930/t/data/META-1_4.yml
CPAN-Meta-2.110930/t/data/META-1_2.yml
CPAN-Meta-2.110930/t/data/META-1_3.yml
CPAN-Meta-2.110930/t/prereqs-finalize.t
CPAN-Meta-2.110930/t/data/resources.yml
CPAN-Meta-2.110930/lib/CPAN/Meta
CPAN-Meta-2.110930/lib/CPAN/Meta/Spec.pm
CPAN-Meta-2.110930/t/data-bad
CPAN-Meta-2.110930/t/data-bad/META-2.json
CPAN-Meta-2.110930/t/data-bad/META-1_1.yml
CPAN-Meta-2.110930/t/data-bad/META-1_0.yml
CPAN-Meta-2.110930/t/data-bad/META-1_4.yml
CPAN-Meta-2.110930/t/data-bad/META-1_2.yml
CPAN-Meta-2.110930/t/data-bad/META-1_3.yml
CPAN-Meta-2.110930/t/data-fail
CPAN-Meta-2.110930/t/data-fail/META-2.json
CPAN-Meta-2.110930/xt/release
CPAN-Meta-2.110930/xt/release/pod-syntax.t
CPAN-Meta-2.110930/lib/CPAN/Meta/Feature.pm
CPAN-Meta-2.110930/lib/CPAN/Meta/History.pm
CPAN-Meta-2.110930/lib/CPAN/Meta/Prereqs.pm
CPAN-Meta-2.110930/t/data/restricted-2.json
CPAN-Meta-2.110930/t/data-fail/META-1_1.yml
CPAN-Meta-2.110930/t/data-fail/META-1_0.yml
CPAN-Meta-2.110930/t/data-fail/META-1_4.yml
CPAN-Meta-2.110930/t/data-fail/META-1_2.yml
CPAN-Meta-2.110930/t/data-fail/META-1_3.yml
CPAN-Meta-2.110930/history
CPAN-Meta-2.110930/history/META-spec-1_3.pod
CPAN-Meta-2.110930/history/META-spec-1_4.pod
CPAN-Meta-2.110930/history/META-spec-1_2.pod
CPAN-Meta-2.110930/history/META-spec-1_0.html
CPAN-Meta-2.110930/history/META-spec-1_1.html
CPAN-Meta-2.110930/lib/CPAN/Meta/Validator.pm
CPAN-Meta-2.110930/lib/CPAN/Meta/Converter.pm
CPAN-Meta-2.110930/t/data/restrictive-1_4.yml
CPAN-Meta-2.110930/t/data-bad/35478989-META.yml
CPAN-Meta-2.110930/t/data-bad/98042513-META.yml
CPAN-Meta-2.110930/t/data-bad/284247103-META.yml
CPAN-Meta-2.110930/t/data-bad/restrictive-2.json
CPAN-Meta-2.110930/t/data-bad/107650337-META.yml
CPAN-Meta-2.110930/t/data-bad/476602558-META.yml
CPAN-Meta-2.110930/t/data-bad/344981821-META.yml
CPAN-Meta-2.110930/t/data-bad/1985684504-META.yml
CPAN-Meta-2.110930/t/data-bad/2031017050-META.yml
CPAN-Meta-2.110930/t/data-bad/1927486199-META.yml
CPAN-Meta-2.110930/t/data-bad/1598804075-META.yml
CPAN-Meta-2.110930/t/data-bad/1206545041-META.yml
CPAN-Meta-2.110930/t/data-bad/1985980974-META.yml
CPAN-Meta-2.110930/t/data-bad/1122575719-META.yml
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
Warning: prerequisite CPAN::Meta::YAML 0.002 not found.
Warning: prerequisite JSON::PP 2.27103 not found. We have 2.27004.
Warning: prerequisite Parse::CPAN::Meta 1.4400 not found. We have 1.40.
Checking if your kit is complete...
Looks good
Writing Makefile for CPAN::Meta
---- Unsatisfied dependencies detected during ----
----    DAGOLDEN/CPAN-Meta-2.110930.tar.gz    ----
    Parse::CPAN::Meta [requires]
    CPAN::Meta::YAML [requires]
    JSON::PP [requires]
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
  Delayed until after prerequisites
Running test for module 'Parse::CPAN::Meta'
Running make for D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\D\DA\DAGOLDEN\Parse-CPAN-Meta-1.4401.tar.gz ok
Parse-CPAN-Meta-1.4401/
Parse-CPAN-Meta-1.4401/t/
Parse-CPAN-Meta-1.4401/t/data/
Parse-CPAN-Meta-1.4401/t/data/VR-META.yml
Parse-CPAN-Meta-1.4401/t/data/VR-META.json
Parse-CPAN-Meta-1.4401/t/01_compile.t
Parse-CPAN-Meta-1.4401/t/04_export.t
Parse-CPAN-Meta-1.4401/t/lib/
Parse-CPAN-Meta-1.4401/t/lib/Parse/
Parse-CPAN-Meta-1.4401/t/lib/Parse/CPAN/
Parse-CPAN-Meta-1.4401/t/lib/Parse/CPAN/Meta/
Parse-CPAN-Meta-1.4401/t/lib/Parse/CPAN/Meta/Test.pm
Parse-CPAN-Meta-1.4401/t/05_errors.t
Parse-CPAN-Meta-1.4401/t/03_functions.t
Parse-CPAN-Meta-1.4401/t/02_api.t
Parse-CPAN-Meta-1.4401/lib/
Parse-CPAN-Meta-1.4401/lib/Parse/
Parse-CPAN-Meta-1.4401/lib/Parse/CPAN/
Parse-CPAN-Meta-1.4401/lib/Parse/CPAN/Meta.pm
Parse-CPAN-Meta-1.4401/Changes
Parse-CPAN-Meta-1.4401/MANIFEST
Parse-CPAN-Meta-1.4401/Makefile.PL
Parse-CPAN-Meta-1.4401/META.yml
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
Warning: prerequisite CPAN::Meta::YAML 0.002 not found.
Warning: prerequisite JSON::PP 2.27103 not found. We have 2.27004.
Checking if your kit is complete...
Looks good
Writing Makefile for Parse::CPAN::Meta
---- Unsatisfied dependencies detected during ----
----  DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz  ----
    CPAN::Meta::YAML [requires]
    JSON::PP [requires]
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
  Delayed until after prerequisites
Running test for module 'CPAN::Meta::YAML'
Running make for D/DA/DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\D\DA\DAGOLDEN\CPAN-Meta-YAML-0.003.tar.gz ok
CPAN-Meta-YAML-0.003
CPAN-Meta-YAML-0.003/README
CPAN-Meta-YAML-0.003/Changes
CPAN-Meta-YAML-0.003/LICENSE
CPAN-Meta-YAML-0.003/META.yml
CPAN-Meta-YAML-0.003/MANIFEST
CPAN-Meta-YAML-0.003/META.json
CPAN-Meta-YAML-0.003/t
CPAN-Meta-YAML-0.003/t/18_tap.t
CPAN-Meta-YAML-0.003/t/21_bom.t
CPAN-Meta-YAML-0.003/Makefile.PL
CPAN-Meta-YAML-0.003/t/02_basic.t
CPAN-Meta-YAML-0.003/t/05_export.t
CPAN-Meta-YAML-0.003/t/04_scalar.t
CPAN-Meta-YAML-0.003/t/19_errors.t
CPAN-Meta-YAML-0.003/t/lib
CPAN-Meta-YAML-0.003/t/lib/Test.pm
CPAN-Meta-YAML-0.003/MANIFEST.SKIP
CPAN-Meta-YAML-0.003/t/12_plagger.t
CPAN-Meta-YAML-0.003/t/17_toolbar.t
CPAN-Meta-YAML-0.003/t/01_compile.t
CPAN-Meta-YAML-0.003/t/data
CPAN-Meta-YAML-0.003/t/data/one.yml
CPAN-Meta-YAML-0.003/t/data/two.yml
CPAN-Meta-YAML-0.003/t/16_nullrefs.t
CPAN-Meta-YAML-0.003/t/14_yaml_org.t
CPAN-Meta-YAML-0.003/t/22_comments.t
CPAN-Meta-YAML-0.003/t/20_subclass.t
CPAN-Meta-YAML-0.003/t/11_meta_yml.t
CPAN-Meta-YAML-0.003/t/15_multibyte.t
CPAN-Meta-YAML-0.003/t/13_perl_smith.t
CPAN-Meta-YAML-0.003/t/03_regression.t
CPAN-Meta-YAML-0.003/t/data/sample.yml
CPAN-Meta-YAML-0.003/t/data/vanilla.yml
CPAN-Meta-YAML-0.003/t/data/toolbar.yml
CPAN-Meta-YAML-0.003/t/data/multibyte.yml
CPAN-Meta-YAML-0.003/lib/CPAN/Meta
CPAN-Meta-YAML-0.003/lib/CPAN/Meta/YAML.pm
CPAN-Meta-YAML-0.003/xt/release
CPAN-Meta-YAML-0.003/xt/release/distmeta.t
CPAN-Meta-YAML-0.003/t/data/HTML-WebDAO.yml
CPAN-Meta-YAML-0.003/xt/release/pod-syntax.t
CPAN-Meta-YAML-0.003/t/data/utf_16_le_bom.yml
CPAN-Meta-YAML-0.003/t/data/Spreadsheet-Read.yml
CPAN-Meta-YAML-0.003/t/data/Template-Provider-Unicode-Japanese.yml
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for CPAN::Meta::YAML
>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

cp lib/CPAN/Meta/YAML.pm blib\lib\CPAN\Meta\YAML.pm
  DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz
  nmake -- OK
Prepending C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
>>> nmake test TEST_VERBOSE=1

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t
t/01_compile.t ..... 
1..3
ok 1 - Your perl is new enough
ok 2 - use CPAN::Meta::YAML;
ok 3 - use t::lib::Test;
ok
t/02_basic.t ....... 
1..1140
ok 1 - empty: YAML.pm saves without error
ok 2 - empty: YAML.pm serializes correctly
ok 3 - empty: YAML.pm round-trips without error
ok 4 - empty: YAML.pm round-trips correctly
ok 5 - empty: YAML.pm loads without error
ok 6 - empty: YAML.pm does not modify the input string
ok 7 - empty: YAML.pm parses correctly
ok 8 # skip Skipping YAML::Syck for unsupported feature
ok 9 # skip Skipping YAML::Syck for unsupported feature
ok 10 # skip Skipping YAML::Syck for unsupported feature
ok 11 # skip Skipping YAML::Syck for unsupported feature
ok 12 # skip Skipping YAML::Syck for unsupported feature
ok 13 # skip Skipping YAML::Syck for unsupported feature
ok 14 # skip Skipping YAML::Syck for unsupported feature
ok 15 - empty: YAML::XS saves without error
ok 16 - empty: YAML::XS serializes correctly
ok 17 - empty: YAML::XS round-trips without error
ok 18 - empty: YAML::XS round-trips correctly
ok 19 - empty: YAML::XS loads without error
ok 20 - empty: YAML::XS does not modify the input string
ok 21 - empty: YAML::XS parses correctly
ok 22 - empty: YAML::Perl saves without error
ok 23 - empty: YAML::Perl serializes correctly
ok 24 - empty: YAML::Perl round-trips without error
ok 25 - empty: YAML::Perl round-trips correctly
ok 26 - empty: YAML::Perl loads without error
ok 27 - empty: YAML::Perl does not modify the input string
ok 28 - empty: YAML::Perl parses correctly
ok 29 - empty: CPAN::Meta::YAML parses without error
ok 30 - empty: CPAN::Meta::YAML does not modify the input string
ok 31 - The object isa CPAN::Meta::YAML
ok 32 - empty: CPAN::Meta::YAML parses correctly
ok 33 - empty: CPAN::Meta::YAML serializes without error
ok 34 - empty: CPAN::Meta::YAML serializes correctly
ok 35 - empty: CPAN::Meta::YAML round-trips without error
ok 36 - The object isa CPAN::Meta::YAML
ok 37 - empty: CPAN::Meta::YAML round-trips correctly
ok 38 # skip Shortcutting perfect serialization tests
ok 39 - only_newlines: YAML.pm saves without error
ok 40 - only_newlines: YAML.pm serializes correctly
ok 41 - only_newlines: YAML.pm round-trips without error
ok 42 - only_newlines: YAML.pm round-trips correctly
ok 43 - only_newlines: YAML.pm loads without error
ok 44 - only_newlines: YAML.pm does not modify the input string
ok 45 - only_newlines: YAML.pm parses correctly
ok 46 # skip Skipping YAML::Syck for unsupported feature
ok 47 # skip Skipping YAML::Syck for unsupported feature
ok 48 # skip Skipping YAML::Syck for unsupported feature
ok 49 # skip Skipping YAML::Syck for unsupported feature
ok 50 # skip Skipping YAML::Syck for unsupported feature
ok 51 # skip Skipping YAML::Syck for unsupported feature
ok 52 # skip Skipping YAML::Syck for unsupported feature
ok 53 - only_newlines: YAML::XS saves without error
ok 54 - only_newlines: YAML::XS serializes correctly
ok 55 - only_newlines: YAML::XS round-trips without error
ok 56 - only_newlines: YAML::XS round-trips correctly
ok 57 - only_newlines: YAML::XS loads without error
ok 58 - only_newlines: YAML::XS does not modify the input string
ok 59 - only_newlines: YAML::XS parses correctly
ok 60 - only_newlines: YAML::Perl saves without error
ok 61 - only_newlines: YAML::Perl serializes correctly
ok 62 - only_newlines: YAML::Perl round-trips without error
ok 63 - only_newlines: YAML::Perl round-trips correctly
ok 64 - only_newlines: YAML::Perl loads without error
ok 65 - only_newlines: YAML::Perl does not modify the input string
ok 66 - only_newlines: YAML::Perl parses correctly
ok 67 - only_newlines: CPAN::Meta::YAML parses without error
ok 68 - only_newlines: CPAN::Meta::YAML does not modify the input string
ok 69 - The object isa CPAN::Meta::YAML
ok 70 - only_newlines: CPAN::Meta::YAML parses correctly
ok 71 - only_newlines: CPAN::Meta::YAML serializes without error
ok 72 - only_newlines: CPAN::Meta::YAML serializes correctly
ok 73 - only_newlines: CPAN::Meta::YAML round-trips without error
ok 74 - The object isa CPAN::Meta::YAML
ok 75 - only_newlines: CPAN::Meta::YAML round-trips correctly
ok 76 # skip Shortcutting perfect serialization tests
ok 77 - only_comment: YAML.pm saves without error
ok 78 - only_comment: YAML.pm serializes correctly
ok 79 - only_comment: YAML.pm round-trips without error
ok 80 - only_comment: YAML.pm round-trips correctly
ok 81 - only_comment: YAML.pm loads without error
ok 82 - only_comment: YAML.pm does not modify the input string
ok 83 - only_comment: YAML.pm parses correctly
ok 84 # skip Skipping YAML::Syck for unsupported feature
ok 85 # skip Skipping YAML::Syck for unsupported feature
ok 86 # skip Skipping YAML::Syck for unsupported feature
ok 87 # skip Skipping YAML::Syck for unsupported feature
ok 88 # skip Skipping YAML::Syck for unsupported feature
ok 89 # skip Skipping YAML::Syck for unsupported feature
ok 90 # skip Skipping YAML::Syck for unsupported feature
ok 91 - only_comment: YAML::XS saves without error
ok 92 - only_comment: YAML::XS serializes correctly
ok 93 - only_comment: YAML::XS round-trips without error
ok 94 - only_comment: YAML::XS round-trips correctly
ok 95 - only_comment: YAML::XS loads without error
ok 96 - only_comment: YAML::XS does not modify the input string
ok 97 - only_comment: YAML::XS parses correctly
ok 98 - only_comment: YAML::Perl saves without error
ok 99 - only_comment: YAML::Perl serializes correctly
ok 100 - only_comment: YAML::Perl round-trips without error
ok 101 - only_comment: YAML::Perl round-trips correctly
ok 102 - only_comment: YAML::Perl loads without error
ok 103 - only_comment: YAML::Perl does not modify the input string
ok 104 - only_comment: YAML::Perl parses correctly
ok 105 - only_comment: CPAN::Meta::YAML parses without error
ok 106 - only_comment: CPAN::Meta::YAML does not modify the input string
ok 107 - The object isa CPAN::Meta::YAML
ok 108 - only_comment: CPAN::Meta::YAML parses correctly
ok 109 - only_comment: CPAN::Meta::YAML serializes without error
ok 110 - only_comment: CPAN::Meta::YAML serializes correctly
ok 111 - only_comment: CPAN::Meta::YAML round-trips without error
ok 112 - The object isa CPAN::Meta::YAML
ok 113 - only_comment: CPAN::Meta::YAML round-trips correctly
ok 114 # skip Shortcutting perfect serialization tests
ok 115 - only_header: YAML.pm saves without error
ok 116 - only_header: YAML.pm serializes correctly
ok 117 - only_header: YAML.pm round-trips without error
ok 118 - only_header: YAML.pm round-trips correctly
ok 119 - only_header: YAML.pm loads without error
ok 120 - only_header: YAML.pm does not modify the input string
ok 121 - only_header: YAML.pm parses correctly
ok 122 - only_header: YAML::Syck saves without error
ok 123 - only_header: YAML::Syck serializes correctly
ok 124 - only_header: YAML::Syck round-trips without error
ok 125 - only_header: YAML::Syck round-trips correctly
ok 126 - only_header: YAML::Syck loads without error
ok 127 - only_header: YAML::Syck does not modify the input string
ok 128 - only_header: YAML::Syck parses correctly
ok 129 - only_header: YAML::XS saves without error
ok 130 - only_header: YAML::XS serializes correctly
ok 131 - only_header: YAML::XS round-trips without error
ok 132 - only_header: YAML::XS round-trips correctly
ok 133 - only_header: YAML::XS loads without error
ok 134 - only_header: YAML::XS does not modify the input string
ok 135 - only_header: YAML::XS parses correctly
ok 136 # skip Skipping YAML::Perl for known-broken feature
ok 137 # skip Skipping YAML::Perl for known-broken feature
ok 138 # skip Skipping YAML::Perl for known-broken feature
ok 139 # skip Skipping YAML::Perl for known-broken feature
ok 140 # skip Skipping YAML::Perl for known-broken feature
ok 141 # skip Skipping YAML::Perl for known-broken feature
ok 142 # skip Skipping YAML::Perl for known-broken feature
ok 143 - only_header: CPAN::Meta::YAML parses without error
ok 144 - only_header: CPAN::Meta::YAML does not modify the input string
ok 145 - The object isa CPAN::Meta::YAML
ok 146 - only_header: CPAN::Meta::YAML parses correctly
ok 147 - only_header: CPAN::Meta::YAML serializes without error
ok 148 - only_header: CPAN::Meta::YAML serializes correctly
ok 149 - only_header: CPAN::Meta::YAML round-trips without error
ok 150 - The object isa CPAN::Meta::YAML
ok 151 - only_header: CPAN::Meta::YAML round-trips correctly
ok 152 # skip Shortcutting perfect serialization tests
ok 153 - two_header: YAML.pm saves without error
ok 154 - two_header: YAML.pm serializes correctly
ok 155 - two_header: YAML.pm round-trips without error
ok 156 - two_header: YAML.pm round-trips correctly
ok 157 - two_header: YAML.pm loads without error
ok 158 - two_header: YAML.pm does not modify the input string
ok 159 - two_header: YAML.pm parses correctly
ok 160 # skip Skipping YAML::Syck for unsupported feature
ok 161 # skip Skipping YAML::Syck for unsupported feature
ok 162 # skip Skipping YAML::Syck for unsupported feature
ok 163 # skip Skipping YAML::Syck for unsupported feature
ok 164 # skip Skipping YAML::Syck for unsupported feature
ok 165 # skip Skipping YAML::Syck for unsupported feature
ok 166 # skip Skipping YAML::Syck for unsupported feature
ok 167 - two_header: YAML::XS saves without error
ok 168 - two_header: YAML::XS serializes correctly
ok 169 - two_header: YAML::XS round-trips without error
ok 170 - two_header: YAML::XS round-trips correctly
ok 171 - two_header: YAML::XS loads without error
ok 172 - two_header: YAML::XS does not modify the input string
ok 173 - two_header: YAML::XS parses correctly
ok 174 # skip Skipping YAML::Perl for known-broken feature
ok 175 # skip Skipping YAML::Perl for known-broken feature
ok 176 # skip Skipping YAML::Perl for known-broken feature
ok 177 # skip Skipping YAML::Perl for known-broken feature
ok 178 # skip Skipping YAML::Perl for known-broken feature
ok 179 # skip Skipping YAML::Perl for known-broken feature
ok 180 # skip Skipping YAML::Perl for known-broken feature
ok 181 - two_header: CPAN::Meta::YAML parses without error
ok 182 - two_header: CPAN::Meta::YAML does not modify the input string
ok 183 - The object isa CPAN::Meta::YAML
ok 184 - two_header: CPAN::Meta::YAML parses correctly
ok 185 - two_header: CPAN::Meta::YAML serializes without error
ok 186 - two_header: CPAN::Meta::YAML serializes correctly
ok 187 - two_header: CPAN::Meta::YAML round-trips without error
ok 188 - The object isa CPAN::Meta::YAML
ok 189 - two_header: CPAN::Meta::YAML round-trips correctly
ok 190 # skip Shortcutting perfect serialization tests
ok 191 - one_undef: YAML.pm saves without error
ok 192 - one_undef: YAML.pm serializes correctly
ok 193 - one_undef: YAML.pm round-trips without error
ok 194 - one_undef: YAML.pm round-trips correctly
ok 195 - one_undef: YAML.pm loads without error
ok 196 - one_undef: YAML.pm does not modify the input string
ok 197 - one_undef: YAML.pm parses correctly
ok 198 - one_undef: YAML::Syck saves without error
ok 199 - one_undef: YAML::Syck serializes correctly
ok 200 - one_undef: YAML::Syck round-trips without error
ok 201 - one_undef: YAML::Syck round-trips correctly
ok 202 - one_undef: YAML::Syck loads without error
ok 203 - one_undef: YAML::Syck does not modify the input string
ok 204 - one_undef: YAML::Syck parses correctly
ok 205 - one_undef: YAML::XS saves without error
ok 206 - one_undef: YAML::XS serializes correctly
ok 207 - one_undef: YAML::XS round-trips without error
ok 208 - one_undef: YAML::XS round-trips correctly
ok 209 - one_undef: YAML::XS loads without error
ok 210 - one_undef: YAML::XS does not modify the input string
ok 211 - one_undef: YAML::XS parses correctly
ok 212 # skip Skipping YAML::Perl for known-broken feature
ok 213 # skip Skipping YAML::Perl for known-broken feature
ok 214 # skip Skipping YAML::Perl for known-broken feature
ok 215 # skip Skipping YAML::Perl for known-broken feature
ok 216 # skip Skipping YAML::Perl for known-broken feature
ok 217 # skip Skipping YAML::Perl for known-broken feature
ok 218 # skip Skipping YAML::Perl for known-broken feature
ok 219 - one_undef: CPAN::Meta::YAML parses without error
ok 220 - one_undef: CPAN::Meta::YAML does not modify the input string
ok 221 - The object isa CPAN::Meta::YAML
ok 222 - one_undef: CPAN::Meta::YAML parses correctly
ok 223 - one_undef: CPAN::Meta::YAML serializes without error
ok 224 - one_undef: CPAN::Meta::YAML serializes correctly
ok 225 - one_undef: CPAN::Meta::YAML round-trips without error
ok 226 - The object isa CPAN::Meta::YAML
ok 227 - one_undef: CPAN::Meta::YAML round-trips correctly
ok 228 # skip Shortcutting perfect serialization tests
ok 229 - one_undef2: YAML.pm saves without error
ok 230 - one_undef2: YAML.pm serializes correctly
ok 231 - one_undef2: YAML.pm round-trips without error
ok 232 - one_undef2: YAML.pm round-trips correctly
ok 233 - one_undef2: YAML.pm loads without error
ok 234 - one_undef2: YAML.pm does not modify the input string
ok 235 - one_undef2: YAML.pm parses correctly
ok 236 - one_undef2: YAML::Syck saves without error
ok 237 - one_undef2: YAML::Syck serializes correctly
ok 238 - one_undef2: YAML::Syck round-trips without error
ok 239 - one_undef2: YAML::Syck round-trips correctly
ok 240 - one_undef2: YAML::Syck loads without error
ok 241 - one_undef2: YAML::Syck does not modify the input string
ok 242 - one_undef2: YAML::Syck parses correctly
ok 243 - one_undef2: YAML::XS saves without error
ok 244 - one_undef2: YAML::XS serializes correctly
ok 245 - one_undef2: YAML::XS round-trips without error
ok 246 - one_undef2: YAML::XS round-trips correctly
ok 247 - one_undef2: YAML::XS loads without error
ok 248 - one_undef2: YAML::XS does not modify the input string
ok 249 - one_undef2: YAML::XS parses correctly
ok 250 # skip Skipping YAML::Perl for known-broken feature
ok 251 # skip Skipping YAML::Perl for known-broken feature
ok 252 # skip Skipping YAML::Perl for known-broken feature
ok 253 # skip Skipping YAML::Perl for known-broken feature
ok 254 # skip Skipping YAML::Perl for known-broken feature
ok 255 # skip Skipping YAML::Perl for known-broken feature
ok 256 # skip Skipping YAML::Perl for known-broken feature
ok 257 - one_undef2: CPAN::Meta::YAML parses without error
ok 258 - one_undef2: CPAN::Meta::YAML does not modify the input string
ok 259 - The object isa CPAN::Meta::YAML
ok 260 - one_undef2: CPAN::Meta::YAML parses correctly
ok 261 - one_undef2: CPAN::Meta::YAML serializes without error
ok 262 - one_undef2: CPAN::Meta::YAML serializes correctly
ok 263 - one_undef2: CPAN::Meta::YAML round-trips without error
ok 264 - The object isa CPAN::Meta::YAML
ok 265 - one_undef2: CPAN::Meta::YAML round-trips correctly
ok 266 # skip Shortcutting perfect serialization tests
ok 267 - two_undef: YAML.pm saves without error
ok 268 - two_undef: YAML.pm serializes correctly
ok 269 - two_undef: YAML.pm round-trips without error
ok 270 - two_undef: YAML.pm round-trips correctly
ok 271 - two_undef: YAML.pm loads without error
ok 272 - two_undef: YAML.pm does not modify the input string
ok 273 - two_undef: YAML.pm parses correctly
ok 274 # skip Skipping YAML::Syck for unsupported feature
ok 275 # skip Skipping YAML::Syck for unsupported feature
ok 276 # skip Skipping YAML::Syck for unsupported feature
ok 277 # skip Skipping YAML::Syck for unsupported feature
ok 278 # skip Skipping YAML::Syck for unsupported feature
ok 279 # skip Skipping YAML::Syck for unsupported feature
ok 280 # skip Skipping YAML::Syck for unsupported feature
ok 281 - two_undef: YAML::XS saves without error
ok 282 - two_undef: YAML::XS serializes correctly
ok 283 - two_undef: YAML::XS round-trips without error
ok 284 - two_undef: YAML::XS round-trips correctly
ok 285 - two_undef: YAML::XS loads without error
ok 286 - two_undef: YAML::XS does not modify the input string
ok 287 - two_undef: YAML::XS parses correctly
ok 288 # skip Skipping YAML::Perl for known-broken feature
ok 289 # skip Skipping YAML::Perl for known-broken feature
ok 290 # skip Skipping YAML::Perl for known-broken feature
ok 291 # skip Skipping YAML::Perl for known-broken feature
ok 292 # skip Skipping YAML::Perl for known-broken feature
ok 293 # skip Skipping YAML::Perl for known-broken feature
ok 294 # skip Skipping YAML::Perl for known-broken feature
ok 295 - two_undef: CPAN::Meta::YAML parses without error
ok 296 - two_undef: CPAN::Meta::YAML does not modify the input string
ok 297 - The object isa CPAN::Meta::YAML
ok 298 - two_undef: CPAN::Meta::YAML parses correctly
ok 299 - two_undef: CPAN::Meta::YAML serializes without error
ok 300 - two_undef: CPAN::Meta::YAML serializes correctly
ok 301 - two_undef: CPAN::Meta::YAML round-trips without error
ok 302 - The object isa CPAN::Meta::YAML
ok 303 - two_undef: CPAN::Meta::YAML round-trips correctly
ok 304 # skip Shortcutting perfect serialization tests
ok 305 - one_scalar: YAML.pm saves without error
ok 306 - one_scalar: YAML.pm serializes correctly
ok 307 - one_scalar: YAML.pm round-trips without error
ok 308 - one_scalar: YAML.pm round-trips correctly
ok 309 - one_scalar: YAML.pm loads without error
ok 310 - one_scalar: YAML.pm does not modify the input string
ok 311 - one_scalar: YAML.pm parses correctly
ok 312 - one_scalar: YAML::Syck saves without error
ok 313 - one_scalar: YAML::Syck serializes correctly
ok 314 - one_scalar: YAML::Syck round-trips without error
ok 315 - one_scalar: YAML::Syck round-trips correctly
ok 316 - one_scalar: YAML::Syck loads without error
ok 317 - one_scalar: YAML::Syck does not modify the input string
ok 318 - one_scalar: YAML::Syck parses correctly
ok 319 - one_scalar: YAML::XS saves without error
ok 320 - one_scalar: YAML::XS serializes correctly
ok 321 - one_scalar: YAML::XS round-trips without error
ok 322 - one_scalar: YAML::XS round-trips correctly
ok 323 - one_scalar: YAML::XS loads without error
ok 324 - one_scalar: YAML::XS does not modify the input string
ok 325 - one_scalar: YAML::XS parses correctly
ok 326 - one_scalar: YAML::Perl saves without error
ok 327 - one_scalar: YAML::Perl serializes correctly
ok 328 - one_scalar: YAML::Perl round-trips without error
ok 329 - one_scalar: YAML::Perl round-trips correctly
ok 330 - one_scalar: YAML::Perl loads without error
ok 331 - one_scalar: YAML::Perl does not modify the input string
ok 332 - one_scalar: YAML::Perl parses correctly
ok 333 - one_scalar: CPAN::Meta::YAML parses without error
ok 334 - one_scalar: CPAN::Meta::YAML does not modify the input string
ok 335 - The object isa CPAN::Meta::YAML
ok 336 - one_scalar: CPAN::Meta::YAML parses correctly
ok 337 - one_scalar: CPAN::Meta::YAML serializes without error
ok 338 - one_scalar: CPAN::Meta::YAML serializes correctly
ok 339 - one_scalar: CPAN::Meta::YAML round-trips without error
ok 340 - The object isa CPAN::Meta::YAML
ok 341 - one_scalar: CPAN::Meta::YAML round-trips correctly
ok 342 # skip Shortcutting perfect serialization tests
ok 343 - one_scalar2: YAML.pm saves without error
ok 344 - one_scalar2: YAML.pm serializes correctly
ok 345 - one_scalar2: YAML.pm round-trips without error
ok 346 - one_scalar2: YAML.pm round-trips correctly
ok 347 - one_scalar2: YAML.pm loads without error
ok 348 - one_scalar2: YAML.pm does not modify the input string
ok 349 - one_scalar2: YAML.pm parses correctly
ok 350 - one_scalar2: YAML::Syck saves without error
ok 351 - one_scalar2: YAML::Syck serializes correctly
ok 352 - one_scalar2: YAML::Syck round-trips without error
ok 353 - one_scalar2: YAML::Syck round-trips correctly
ok 354 - one_scalar2: YAML::Syck loads without error
ok 355 - one_scalar2: YAML::Syck does not modify the input string
ok 356 - one_scalar2: YAML::Syck parses correctly
ok 357 - one_scalar2: YAML::XS saves without error
ok 358 - one_scalar2: YAML::XS serializes correctly
ok 359 - one_scalar2: YAML::XS round-trips without error
ok 360 - one_scalar2: YAML::XS round-trips correctly
ok 361 - one_scalar2: YAML::XS loads without error
ok 362 - one_scalar2: YAML::XS does not modify the input string
ok 363 - one_scalar2: YAML::XS parses correctly
ok 364 - one_scalar2: YAML::Perl saves without error
ok 365 - one_scalar2: YAML::Perl serializes correctly
ok 366 - one_scalar2: YAML::Perl round-trips without error
ok 367 - one_scalar2: YAML::Perl round-trips correctly
ok 368 - one_scalar2: YAML::Perl loads without error
ok 369 - one_scalar2: YAML::Perl does not modify the input string
ok 370 - one_scalar2: YAML::Perl parses correctly
ok 371 - one_scalar2: CPAN::Meta::YAML parses without error
ok 372 - one_scalar2: CPAN::Meta::YAML does not modify the input string
ok 373 - The object isa CPAN::Meta::YAML
ok 374 - one_scalar2: CPAN::Meta::YAML parses correctly
ok 375 - one_scalar2: CPAN::Meta::YAML serializes without error
ok 376 - one_scalar2: CPAN::Meta::YAML serializes correctly
ok 377 - one_scalar2: CPAN::Meta::YAML round-trips without error
ok 378 - The object isa CPAN::Meta::YAML
ok 379 - one_scalar2: CPAN::Meta::YAML round-trips correctly
ok 380 # skip Shortcutting perfect serialization tests
ok 381 - two_scalar: YAML.pm saves without error
ok 382 - two_scalar: YAML.pm serializes correctly
ok 383 - two_scalar: YAML.pm round-trips without error
ok 384 - two_scalar: YAML.pm round-trips correctly
ok 385 - two_scalar: YAML.pm loads without error
ok 386 - two_scalar: YAML.pm does not modify the input string
ok 387 - two_scalar: YAML.pm parses correctly
ok 388 # skip Skipping YAML::Syck for unsupported feature
ok 389 # skip Skipping YAML::Syck for unsupported feature
ok 390 # skip Skipping YAML::Syck for unsupported feature
ok 391 # skip Skipping YAML::Syck for unsupported feature
ok 392 # skip Skipping YAML::Syck for unsupported feature
ok 393 # skip Skipping YAML::Syck for unsupported feature
ok 394 # skip Skipping YAML::Syck for unsupported feature
ok 395 - two_scalar: YAML::XS saves without error
ok 396 - two_scalar: YAML::XS serializes correctly
ok 397 - two_scalar: YAML::XS round-trips without error
ok 398 - two_scalar: YAML::XS round-trips correctly
ok 399 - two_scalar: YAML::XS loads without error
ok 400 - two_scalar: YAML::XS does not modify the input string
ok 401 - two_scalar: YAML::XS parses correctly
ok 402 # skip Skipping YAML::Perl for known-broken feature
ok 403 # skip Skipping YAML::Perl for known-broken feature
ok 404 # skip Skipping YAML::Perl for known-broken feature
ok 405 # skip Skipping YAML::Perl for known-broken feature
ok 406 # skip Skipping YAML::Perl for known-broken feature
ok 407 # skip Skipping YAML::Perl for known-broken feature
ok 408 # skip Skipping YAML::Perl for known-broken feature
ok 409 - two_scalar: CPAN::Meta::YAML parses without error
ok 410 - two_scalar: CPAN::Meta::YAML does not modify the input string
ok 411 - The object isa CPAN::Meta::YAML
ok 412 - two_scalar: CPAN::Meta::YAML parses correctly
ok 413 - two_scalar: CPAN::Meta::YAML serializes without error
ok 414 - two_scalar: CPAN::Meta::YAML serializes correctly
ok 415 - two_scalar: CPAN::Meta::YAML round-trips without error
ok 416 - The object isa CPAN::Meta::YAML
ok 417 - two_scalar: CPAN::Meta::YAML round-trips correctly
ok 418 # skip Shortcutting perfect serialization tests
ok 419 - one_list1: YAML.pm saves without error
ok 420 - one_list1: YAML.pm serializes correctly
ok 421 - one_list1: YAML.pm round-trips without error
ok 422 - one_list1: YAML.pm round-trips correctly
ok 423 - one_list1: YAML.pm loads without error
ok 424 - one_list1: YAML.pm does not modify the input string
ok 425 - one_list1: YAML.pm parses correctly
ok 426 - one_list1: YAML::Syck saves without error
ok 427 - one_list1: YAML::Syck serializes correctly
ok 428 - one_list1: YAML::Syck round-trips without error
ok 429 - one_list1: YAML::Syck round-trips correctly
ok 430 - one_list1: YAML::Syck loads without error
ok 431 - one_list1: YAML::Syck does not modify the input string
ok 432 - one_list1: YAML::Syck parses correctly
ok 433 - one_list1: YAML::XS saves without error
ok 434 - one_list1: YAML::XS serializes correctly
ok 435 - one_list1: YAML::XS round-trips without error
ok 436 - one_list1: YAML::XS round-trips correctly
ok 437 - one_list1: YAML::XS loads without error
ok 438 - one_list1: YAML::XS does not modify the input string
ok 439 - one_list1: YAML::XS parses correctly
ok 440 - one_list1: YAML::Perl saves without error
ok 441 - one_list1: YAML::Perl serializes correctly
ok 442 - one_list1: YAML::Perl round-trips without error
ok 443 - one_list1: YAML::Perl round-trips correctly
ok 444 - one_list1: YAML::Perl loads without error
ok 445 - one_list1: YAML::Perl does not modify the input string
ok 446 - one_list1: YAML::Perl parses correctly
ok 447 - one_list1: CPAN::Meta::YAML parses without error
ok 448 - one_list1: CPAN::Meta::YAML does not modify the input string
ok 449 - The object isa CPAN::Meta::YAML
ok 450 - one_list1: CPAN::Meta::YAML parses correctly
ok 451 - one_list1: CPAN::Meta::YAML serializes without error
ok 452 - one_list1: CPAN::Meta::YAML serializes correctly
ok 453 - one_list1: CPAN::Meta::YAML round-trips without error
ok 454 - The object isa CPAN::Meta::YAML
ok 455 - one_list1: CPAN::Meta::YAML round-trips correctly
ok 456 # skip Shortcutting perfect serialization tests
ok 457 - one_list2: YAML.pm saves without error
ok 458 - one_list2: YAML.pm serializes correctly
ok 459 - one_list2: YAML.pm round-trips without error
ok 460 - one_list2: YAML.pm round-trips correctly
ok 461 - one_list2: YAML.pm loads without error
ok 462 - one_list2: YAML.pm does not modify the input string
ok 463 - one_list2: YAML.pm parses correctly
ok 464 - one_list2: YAML::Syck saves without error
ok 465 - one_list2: YAML::Syck serializes correctly
ok 466 - one_list2: YAML::Syck round-trips without error
ok 467 - one_list2: YAML::Syck round-trips correctly
ok 468 - one_list2: YAML::Syck loads without error
ok 469 - one_list2: YAML::Syck does not modify the input string
ok 470 - one_list2: YAML::Syck parses correctly
ok 471 - one_list2: YAML::XS saves without error
ok 472 - one_list2: YAML::XS serializes correctly
ok 473 - one_list2: YAML::XS round-trips without error
ok 474 - one_list2: YAML::XS round-trips correctly
ok 475 - one_list2: YAML::XS loads without error
ok 476 - one_list2: YAML::XS does not modify the input string
ok 477 - one_list2: YAML::XS parses correctly
ok 478 - one_list2: YAML::Perl saves without error
ok 479 - one_list2: YAML::Perl serializes correctly
ok 480 - one_list2: YAML::Perl round-trips without error
ok 481 - one_list2: YAML::Perl round-trips correctly
ok 482 - one_list2: YAML::Perl loads without error
ok 483 - one_list2: YAML::Perl does not modify the input string
ok 484 - one_list2: YAML::Perl parses correctly
ok 485 - one_list2: CPAN::Meta::YAML parses without error
ok 486 - one_list2: CPAN::Meta::YAML does not modify the input string
ok 487 - The object isa CPAN::Meta::YAML
ok 488 - one_list2: CPAN::Meta::YAML parses correctly
ok 489 - one_list2: CPAN::Meta::YAML serializes without error
ok 490 - one_list2: CPAN::Meta::YAML serializes correctly
ok 491 - one_list2: CPAN::Meta::YAML round-trips without error
ok 492 - The object isa CPAN::Meta::YAML
ok 493 - one_list2: CPAN::Meta::YAML round-trips correctly
ok 494 # skip Shortcutting perfect serialization tests
ok 495 - one_listundef: YAML.pm saves without error
ok 496 - one_listundef: YAML.pm serializes correctly
ok 497 - one_listundef: YAML.pm round-trips without error
ok 498 - one_listundef: YAML.pm round-trips correctly
ok 499 - one_listundef: YAML.pm loads without error
ok 500 - one_listundef: YAML.pm does not modify the input string
ok 501 - one_listundef: YAML.pm parses correctly
ok 502 - one_listundef: YAML::Syck saves without error
ok 503 - one_listundef: YAML::Syck serializes correctly
ok 504 - one_listundef: YAML::Syck round-trips without error
ok 505 - one_listundef: YAML::Syck round-trips correctly
ok 506 - one_listundef: YAML::Syck loads without error
ok 507 - one_listundef: YAML::Syck does not modify the input string
ok 508 - one_listundef: YAML::Syck parses correctly
ok 509 - one_listundef: YAML::XS saves without error
ok 510 - one_listundef: YAML::XS serializes correctly
ok 511 - one_listundef: YAML::XS round-trips without error
ok 512 - one_listundef: YAML::XS round-trips correctly
ok 513 - one_listundef: YAML::XS loads without error
ok 514 - one_listundef: YAML::XS does not modify the input string
ok 515 - one_listundef: YAML::XS parses correctly
ok 516 # skip Skipping YAML::Perl for known-broken feature
ok 517 # skip Skipping YAML::Perl for known-broken feature
ok 518 # skip Skipping YAML::Perl for known-broken feature
ok 519 # skip Skipping YAML::Perl for known-broken feature
ok 520 # skip Skipping YAML::Perl for known-broken feature
ok 521 # skip Skipping YAML::Perl for known-broken feature
ok 522 # skip Skipping YAML::Perl for known-broken feature
ok 523 - one_listundef: CPAN::Meta::YAML parses without error
ok 524 - one_listundef: CPAN::Meta::YAML does not modify the input string
ok 525 - The object isa CPAN::Meta::YAML
ok 526 - one_listundef: CPAN::Meta::YAML parses correctly
ok 527 - one_listundef: CPAN::Meta::YAML serializes without error
ok 528 - one_listundef: CPAN::Meta::YAML serializes correctly
ok 529 - one_listundef: CPAN::Meta::YAML round-trips without error
ok 530 - The object isa CPAN::Meta::YAML
ok 531 - one_listundef: CPAN::Meta::YAML round-trips correctly
ok 532 # skip Shortcutting perfect serialization tests
ok 533 - one_hash1: YAML.pm saves without error
ok 534 - one_hash1: YAML.pm serializes correctly
ok 535 - one_hash1: YAML.pm round-trips without error
ok 536 - one_hash1: YAML.pm round-trips correctly
ok 537 - one_hash1: YAML.pm loads without error
ok 538 - one_hash1: YAML.pm does not modify the input string
ok 539 - one_hash1: YAML.pm parses correctly
ok 540 - one_hash1: YAML::Syck saves without error
ok 541 - one_hash1: YAML::Syck serializes correctly
ok 542 - one_hash1: YAML::Syck round-trips without error
ok 543 - one_hash1: YAML::Syck round-trips correctly
ok 544 - one_hash1: YAML::Syck loads without error
ok 545 - one_hash1: YAML::Syck does not modify the input string
ok 546 - one_hash1: YAML::Syck parses correctly
ok 547 - one_hash1: YAML::XS saves without error
ok 548 - one_hash1: YAML::XS serializes correctly
ok 549 - one_hash1: YAML::XS round-trips without error
ok 550 - one_hash1: YAML::XS round-trips correctly
ok 551 - one_hash1: YAML::XS loads without error
ok 552 - one_hash1: YAML::XS does not modify the input string
ok 553 - one_hash1: YAML::XS parses correctly
ok 554 - one_hash1: YAML::Perl saves without error
ok 555 - one_hash1: YAML::Perl serializes correctly
ok 556 - one_hash1: YAML::Perl round-trips without error
ok 557 - one_hash1: YAML::Perl round-trips correctly
ok 558 - one_hash1: YAML::Perl loads without error
ok 559 - one_hash1: YAML::Perl does not modify the input string
ok 560 - one_hash1: YAML::Perl parses correctly
ok 561 - one_hash1: CPAN::Meta::YAML parses without error
ok 562 - one_hash1: CPAN::Meta::YAML does not modify the input string
ok 563 - The object isa CPAN::Meta::YAML
ok 564 - one_hash1: CPAN::Meta::YAML parses correctly
ok 565 - one_hash1: CPAN::Meta::YAML serializes without error
ok 566 - one_hash1: CPAN::Meta::YAML serializes correctly
ok 567 - one_hash1: CPAN::Meta::YAML round-trips without error
ok 568 - The object isa CPAN::Meta::YAML
ok 569 - one_hash1: CPAN::Meta::YAML round-trips correctly
ok 570 # skip Shortcutting perfect serialization tests
ok 571 - one_hash2: YAML.pm saves without error
ok 572 - one_hash2: YAML.pm serializes correctly
ok 573 - one_hash2: YAML.pm round-trips without error
ok 574 - one_hash2: YAML.pm round-trips correctly
ok 575 - one_hash2: YAML.pm loads without error
ok 576 - one_hash2: YAML.pm does not modify the input string
ok 577 - one_hash2: YAML.pm parses correctly
ok 578 - one_hash2: YAML::Syck saves without error
ok 579 - one_hash2: YAML::Syck serializes correctly
ok 580 - one_hash2: YAML::Syck round-trips without error
ok 581 - one_hash2: YAML::Syck round-trips correctly
ok 582 - one_hash2: YAML::Syck loads without error
ok 583 - one_hash2: YAML::Syck does not modify the input string
ok 584 - one_hash2: YAML::Syck parses correctly
ok 585 - one_hash2: YAML::XS saves without error
ok 586 - one_hash2: YAML::XS serializes correctly
ok 587 - one_hash2: YAML::XS round-trips without error
ok 588 - one_hash2: YAML::XS round-trips correctly
ok 589 - one_hash2: YAML::XS loads without error
ok 590 - one_hash2: YAML::XS does not modify the input string
ok 591 - one_hash2: YAML::XS parses correctly
ok 592 # skip Skipping YAML::Perl for known-broken feature
ok 593 # skip Skipping YAML::Perl for known-broken feature
ok 594 # skip Skipping YAML::Perl for known-broken feature
ok 595 # skip Skipping YAML::Perl for known-broken feature
ok 596 # skip Skipping YAML::Perl for known-broken feature
ok 597 # skip Skipping YAML::Perl for known-broken feature
ok 598 # skip Skipping YAML::Perl for known-broken feature
ok 599 - one_hash2: CPAN::Meta::YAML parses without error
ok 600 - one_hash2: CPAN::Meta::YAML does not modify the input string
ok 601 - The object isa CPAN::Meta::YAML
ok 602 - one_hash2: CPAN::Meta::YAML parses correctly
ok 603 - one_hash2: CPAN::Meta::YAML serializes without error
ok 604 - one_hash2: CPAN::Meta::YAML serializes correctly
ok 605 - one_hash2: CPAN::Meta::YAML round-trips without error
ok 606 - The object isa CPAN::Meta::YAML
ok 607 - one_hash2: CPAN::Meta::YAML round-trips correctly
ok 608 # skip Shortcutting perfect serialization tests
ok 609 - array_in_hash: YAML.pm saves without error
ok 610 - array_in_hash: YAML.pm serializes correctly
ok 611 - array_in_hash: YAML.pm round-trips without error
ok 612 - array_in_hash: YAML.pm round-trips correctly
ok 613 - array_in_hash: YAML.pm loads without error
ok 614 - array_in_hash: YAML.pm does not modify the input string
ok 615 - array_in_hash: YAML.pm parses correctly
ok 616 - array_in_hash: YAML::Syck saves without error
ok 617 - array_in_hash: YAML::Syck serializes correctly
ok 618 - array_in_hash: YAML::Syck round-trips without error
ok 619 - array_in_hash: YAML::Syck round-trips correctly
ok 620 - array_in_hash: YAML::Syck loads without error
ok 621 - array_in_hash: YAML::Syck does not modify the input string
ok 622 - array_in_hash: YAML::Syck parses correctly
ok 623 - array_in_hash: YAML::XS saves without error
ok 624 - array_in_hash: YAML::XS serializes correctly
ok 625 - array_in_hash: YAML::XS round-trips without error
ok 626 - array_in_hash: YAML::XS round-trips correctly
ok 627 - array_in_hash: YAML::XS loads without error
ok 628 - array_in_hash: YAML::XS does not modify the input string
ok 629 - array_in_hash: YAML::XS parses correctly
ok 630 # skip Skipping YAML::Perl for known-broken feature
ok 631 # skip Skipping YAML::Perl for known-broken feature
ok 632 # skip Skipping YAML::Perl for known-broken feature
ok 633 # skip Skipping YAML::Perl for known-broken feature
ok 634 # skip Skipping YAML::Perl for known-broken feature
ok 635 # skip Skipping YAML::Perl for known-broken feature
ok 636 # skip Skipping YAML::Perl for known-broken feature
ok 637 - array_in_hash: CPAN::Meta::YAML parses without error
ok 638 - array_in_hash: CPAN::Meta::YAML does not modify the input string
ok 639 - The object isa CPAN::Meta::YAML
ok 640 - array_in_hash: CPAN::Meta::YAML parses correctly
ok 641 - array_in_hash: CPAN::Meta::YAML serializes without error
ok 642 - array_in_hash: CPAN::Meta::YAML serializes correctly
ok 643 - array_in_hash: CPAN::Meta::YAML round-trips without error
ok 644 - The object isa CPAN::Meta::YAML
ok 645 - array_in_hash: CPAN::Meta::YAML round-trips correctly
ok 646 # skip Shortcutting perfect serialization tests
ok 647 - hash_in_hash: YAML.pm saves without error
ok 648 - hash_in_hash: YAML.pm serializes correctly
ok 649 - hash_in_hash: YAML.pm round-trips without error
ok 650 - hash_in_hash: YAML.pm round-trips correctly
ok 651 - hash_in_hash: YAML.pm loads without error
ok 652 - hash_in_hash: YAML.pm does not modify the input string
ok 653 - hash_in_hash: YAML.pm parses correctly
ok 654 - hash_in_hash: YAML::Syck saves without error
ok 655 - hash_in_hash: YAML::Syck serializes correctly
ok 656 - hash_in_hash: YAML::Syck round-trips without error
ok 657 - hash_in_hash: YAML::Syck round-trips correctly
ok 658 - hash_in_hash: YAML::Syck loads without error
ok 659 - hash_in_hash: YAML::Syck does not modify the input string
ok 660 - hash_in_hash: YAML::Syck parses correctly
ok 661 - hash_in_hash: YAML::XS saves without error
ok 662 - hash_in_hash: YAML::XS serializes correctly
ok 663 - hash_in_hash: YAML::XS round-trips without error
ok 664 - hash_in_hash: YAML::XS round-trips correctly
ok 665 - hash_in_hash: YAML::XS loads without error
ok 666 - hash_in_hash: YAML::XS does not modify the input string
ok 667 - hash_in_hash: YAML::XS parses correctly
ok 668 # skip Skipping YAML::Perl for known-broken feature
ok 669 # skip Skipping YAML::Perl for known-broken feature
ok 670 # skip Skipping YAML::Perl for known-broken feature
ok 671 # skip Skipping YAML::Perl for known-broken feature
ok 672 # skip Skipping YAML::Perl for known-broken feature
ok 673 # skip Skipping YAML::Perl for known-broken feature
ok 674 # skip Skipping YAML::Perl for known-broken feature
ok 675 - hash_in_hash: CPAN::Meta::YAML parses without error
ok 676 - hash_in_hash: CPAN::Meta::YAML does not modify the input string
ok 677 - The object isa CPAN::Meta::YAML
ok 678 - hash_in_hash: CPAN::Meta::YAML parses correctly
ok 679 - hash_in_hash: CPAN::Meta::YAML serializes without error
ok 680 - hash_in_hash: CPAN::Meta::YAML serializes correctly
ok 681 - hash_in_hash: CPAN::Meta::YAML round-trips without error
ok 682 - The object isa CPAN::Meta::YAML
ok 683 - hash_in_hash: CPAN::Meta::YAML round-trips correctly
ok 684 # skip Shortcutting perfect serialization tests
ok 685 - hash_in_array: YAML.pm saves without error
ok 686 - hash_in_array: YAML.pm serializes correctly
ok 687 - hash_in_array: YAML.pm round-trips without error
ok 688 - hash_in_array: YAML.pm round-trips correctly
ok 689 - hash_in_array: YAML.pm loads without error
ok 690 - hash_in_array: YAML.pm does not modify the input string
ok 691 - hash_in_array: YAML.pm parses correctly
ok 692 - hash_in_array: YAML::Syck saves without error
ok 693 - hash_in_array: YAML::Syck serializes correctly
ok 694 - hash_in_array: YAML::Syck round-trips without error
ok 695 - hash_in_array: YAML::Syck round-trips correctly
ok 696 - hash_in_array: YAML::Syck loads without error
ok 697 - hash_in_array: YAML::Syck does not modify the input string
ok 698 - hash_in_array: YAML::Syck parses correctly
ok 699 - hash_in_array: YAML::XS saves without error
ok 700 - hash_in_array: YAML::XS serializes correctly
ok 701 - hash_in_array: YAML::XS round-trips without error
ok 702 - hash_in_array: YAML::XS round-trips correctly
ok 703 - hash_in_array: YAML::XS loads without error
ok 704 - hash_in_array: YAML::XS does not modify the input string
ok 705 - hash_in_array: YAML::XS parses correctly
ok 706 # skip Skipping YAML::Perl for known-broken feature
ok 707 # skip Skipping YAML::Perl for known-broken feature
ok 708 # skip Skipping YAML::Perl for known-broken feature
ok 709 # skip Skipping YAML::Perl for known-broken feature
ok 710 # skip Skipping YAML::Perl for known-broken feature
ok 711 # skip Skipping YAML::Perl for known-broken feature
ok 712 # skip Skipping YAML::Perl for known-broken feature
ok 713 - hash_in_array: CPAN::Meta::YAML parses without error
ok 714 - hash_in_array: CPAN::Meta::YAML does not modify the input string
ok 715 - The object isa CPAN::Meta::YAML
ok 716 - hash_in_array: CPAN::Meta::YAML parses correctly
ok 717 - hash_in_array: CPAN::Meta::YAML serializes without error
ok 718 - hash_in_array: CPAN::Meta::YAML serializes correctly
ok 719 - hash_in_array: CPAN::Meta::YAML round-trips without error
ok 720 - The object isa CPAN::Meta::YAML
ok 721 - hash_in_array: CPAN::Meta::YAML round-trips correctly
ok 722 # skip Shortcutting perfect serialization tests
ok 723 - single_quote1: YAML.pm saves without error
ok 724 - single_quote1: YAML.pm serializes correctly
ok 725 - single_quote1: YAML.pm round-trips without error
ok 726 - single_quote1: YAML.pm round-trips correctly
ok 727 - single_quote1: YAML.pm loads without error
ok 728 - single_quote1: YAML.pm does not modify the input string
ok 729 - single_quote1: YAML.pm parses correctly
ok 730 - single_quote1: YAML::Syck saves without error
ok 731 - single_quote1: YAML::Syck serializes correctly
ok 732 - single_quote1: YAML::Syck round-trips without error
ok 733 - single_quote1: YAML::Syck round-trips correctly
ok 734 - single_quote1: YAML::Syck loads without error
ok 735 - single_quote1: YAML::Syck does not modify the input string
ok 736 - single_quote1: YAML::Syck parses correctly
ok 737 - single_quote1: YAML::XS saves without error
ok 738 - single_quote1: YAML::XS serializes correctly
ok 739 - single_quote1: YAML::XS round-trips without error
ok 740 - single_quote1: YAML::XS round-trips correctly
ok 741 - single_quote1: YAML::XS loads without error
ok 742 - single_quote1: YAML::XS does not modify the input string
ok 743 - single_quote1: YAML::XS parses correctly
ok 744 - single_quote1: YAML::Perl saves without error
ok 745 - single_quote1: YAML::Perl serializes correctly
ok 746 - single_quote1: YAML::Perl round-trips without error
ok 747 - single_quote1: YAML::Perl round-trips correctly
ok 748 - single_quote1: YAML::Perl loads without error
ok 749 - single_quote1: YAML::Perl does not modify the input string
ok 750 - single_quote1: YAML::Perl parses correctly
ok 751 - single_quote1: CPAN::Meta::YAML parses without error
ok 752 - single_quote1: CPAN::Meta::YAML does not modify the input string
ok 753 - The object isa CPAN::Meta::YAML
ok 754 - single_quote1: CPAN::Meta::YAML parses correctly
ok 755 - single_quote1: CPAN::Meta::YAML serializes without error
ok 756 - single_quote1: CPAN::Meta::YAML serializes correctly
ok 757 - single_quote1: CPAN::Meta::YAML round-trips without error
ok 758 - The object isa CPAN::Meta::YAML
ok 759 - single_quote1: CPAN::Meta::YAML round-trips correctly
ok 760 # skip Shortcutting perfect serialization tests
ok 761 - single_spaces: YAML.pm saves without error
ok 762 - single_spaces: YAML.pm serializes correctly
ok 763 - single_spaces: YAML.pm round-trips without error
ok 764 - single_spaces: YAML.pm round-trips correctly
ok 765 - single_spaces: YAML.pm loads without error
ok 766 - single_spaces: YAML.pm does not modify the input string
ok 767 - single_spaces: YAML.pm parses correctly
ok 768 - single_spaces: YAML::Syck saves without error
ok 769 - single_spaces: YAML::Syck serializes correctly
ok 770 - single_spaces: YAML::Syck round-trips without error
ok 771 - single_spaces: YAML::Syck round-trips correctly
ok 772 - single_spaces: YAML::Syck loads without error
ok 773 - single_spaces: YAML::Syck does not modify the input string
ok 774 - single_spaces: YAML::Syck parses correctly
ok 775 - single_spaces: YAML::XS saves without error
ok 776 - single_spaces: YAML::XS serializes correctly
ok 777 - single_spaces: YAML::XS round-trips without error
ok 778 - single_spaces: YAML::XS round-trips correctly
ok 779 - single_spaces: YAML::XS loads without error
ok 780 - single_spaces: YAML::XS does not modify the input string
ok 781 - single_spaces: YAML::XS parses correctly
ok 782 - single_spaces: YAML::Perl saves without error
ok 783 - single_spaces: YAML::Perl serializes correctly
ok 784 - single_spaces: YAML::Perl round-trips without error
ok 785 - single_spaces: YAML::Perl round-trips correctly
ok 786 - single_spaces: YAML::Perl loads without error
ok 787 - single_spaces: YAML::Perl does not modify the input string
ok 788 - single_spaces: YAML::Perl parses correctly
ok 789 - single_spaces: CPAN::Meta::YAML parses without error
ok 790 - single_spaces: CPAN::Meta::YAML does not modify the input string
ok 791 - The object isa CPAN::Meta::YAML
ok 792 - single_spaces: CPAN::Meta::YAML parses correctly
ok 793 - single_spaces: CPAN::Meta::YAML serializes without error
ok 794 - single_spaces: CPAN::Meta::YAML serializes correctly
ok 795 - single_spaces: CPAN::Meta::YAML round-trips without error
ok 796 - The object isa CPAN::Meta::YAML
ok 797 - single_spaces: CPAN::Meta::YAML round-trips correctly
ok 798 # skip Shortcutting perfect serialization tests
ok 799 - single_null: YAML.pm saves without error
ok 800 - single_null: YAML.pm serializes correctly
ok 801 - single_null: YAML.pm round-trips without error
ok 802 - single_null: YAML.pm round-trips correctly
ok 803 - single_null: YAML.pm loads without error
ok 804 - single_null: YAML.pm does not modify the input string
ok 805 - single_null: YAML.pm parses correctly
ok 806 - single_null: YAML::Syck saves without error
ok 807 - single_null: YAML::Syck serializes correctly
ok 808 - single_null: YAML::Syck round-trips without error
ok 809 - single_null: YAML::Syck round-trips correctly
ok 810 - single_null: YAML::Syck loads without error
ok 811 - single_null: YAML::Syck does not modify the input string
ok 812 - single_null: YAML::Syck parses correctly
ok 813 - single_null: YAML::XS saves without error
ok 814 - single_null: YAML::XS serializes correctly
ok 815 - single_null: YAML::XS round-trips without error
ok 816 - single_null: YAML::XS round-trips correctly
ok 817 - single_null: YAML::XS loads without error
ok 818 - single_null: YAML::XS does not modify the input string
ok 819 - single_null: YAML::XS parses correctly
ok 820 - single_null: YAML::Perl saves without error
ok 821 - single_null: YAML::Perl serializes correctly
ok 822 - single_null: YAML::Perl round-trips without error
ok 823 - single_null: YAML::Perl round-trips correctly
ok 824 - single_null: YAML::Perl loads without error
ok 825 - single_null: YAML::Perl does not modify the input string
ok 826 - single_null: YAML::Perl parses correctly
ok 827 - single_null: CPAN::Meta::YAML parses without error
ok 828 - single_null: CPAN::Meta::YAML does not modify the input string
ok 829 - The object isa CPAN::Meta::YAML
ok 830 - single_null: CPAN::Meta::YAML parses correctly
ok 831 - single_null: CPAN::Meta::YAML serializes without error
ok 832 - single_null: CPAN::Meta::YAML serializes correctly
ok 833 - single_null: CPAN::Meta::YAML round-trips without error
ok 834 - The object isa CPAN::Meta::YAML
ok 835 - single_null: CPAN::Meta::YAML round-trips correctly
ok 836 # skip Shortcutting perfect serialization tests
ok 837 # skip Skipping YAML.pm for known-broken feature
ok 838 # skip Skipping YAML.pm for known-broken feature
ok 839 # skip Skipping YAML.pm for known-broken feature
ok 840 # skip Skipping YAML.pm for known-broken feature
ok 841 # skip Skipping YAML.pm for known-broken feature
ok 842 # skip Skipping YAML.pm for known-broken feature
ok 843 # skip Skipping YAML.pm for known-broken feature
ok 844 - only_spaces: YAML::Syck saves without error
ok 845 - only_spaces: YAML::Syck serializes correctly
ok 846 - only_spaces: YAML::Syck round-trips without error
ok 847 - only_spaces: YAML::Syck round-trips correctly
ok 848 - only_spaces: YAML::Syck loads without error
ok 849 - only_spaces: YAML::Syck does not modify the input string
ok 850 - only_spaces: YAML::Syck parses correctly
ok 851 - only_spaces: YAML::XS saves without error
ok 852 - only_spaces: YAML::XS serializes correctly
ok 853 - only_spaces: YAML::XS round-trips without error
ok 854 - only_spaces: YAML::XS round-trips correctly
ok 855 - only_spaces: YAML::XS loads without error
ok 856 - only_spaces: YAML::XS does not modify the input string
ok 857 - only_spaces: YAML::XS parses correctly
ok 858 # skip Skipping YAML::Perl for known-broken feature
ok 859 # skip Skipping YAML::Perl for known-broken feature
ok 860 # skip Skipping YAML::Perl for known-broken feature
ok 861 # skip Skipping YAML::Perl for known-broken feature
ok 862 # skip Skipping YAML::Perl for known-broken feature
ok 863 # skip Skipping YAML::Perl for known-broken feature
ok 864 # skip Skipping YAML::Perl for known-broken feature
ok 865 - only_spaces: CPAN::Meta::YAML parses without error
ok 866 - only_spaces: CPAN::Meta::YAML does not modify the input string
ok 867 - The object isa CPAN::Meta::YAML
ok 868 - only_spaces: CPAN::Meta::YAML parses correctly
ok 869 - only_spaces: CPAN::Meta::YAML serializes without error
ok 870 - only_spaces: CPAN::Meta::YAML serializes correctly
ok 871 - only_spaces: CPAN::Meta::YAML round-trips without error
ok 872 - The object isa CPAN::Meta::YAML
ok 873 - only_spaces: CPAN::Meta::YAML round-trips correctly
ok 874 # skip Shortcutting perfect serialization tests
ok 875 # skip Skipping YAML.pm for known-broken feature
ok 876 # skip Skipping YAML.pm for known-broken feature
ok 877 # skip Skipping YAML.pm for known-broken feature
ok 878 # skip Skipping YAML.pm for known-broken feature
ok 879 # skip Skipping YAML.pm for known-broken feature
ok 880 # skip Skipping YAML.pm for known-broken feature
ok 881 # skip Skipping YAML.pm for known-broken feature
ok 882 # skip Skipping YAML::Syck for unsupported feature
ok 883 # skip Skipping YAML::Syck for unsupported feature
ok 884 # skip Skipping YAML::Syck for unsupported feature
ok 885 # skip Skipping YAML::Syck for unsupported feature
ok 886 # skip Skipping YAML::Syck for unsupported feature
ok 887 # skip Skipping YAML::Syck for unsupported feature
ok 888 # skip Skipping YAML::Syck for unsupported feature
ok 889 - leading_trailing_spaces: YAML::XS saves without error
ok 890 - leading_trailing_spaces: YAML::XS serializes correctly
ok 891 - leading_trailing_spaces: YAML::XS round-trips without error
ok 892 - leading_trailing_spaces: YAML::XS round-trips correctly
ok 893 - leading_trailing_spaces: YAML::XS loads without error
ok 894 - leading_trailing_spaces: YAML::XS does not modify the input string
ok 895 - leading_trailing_spaces: YAML::XS parses correctly
ok 896 # skip Skipping YAML::Perl for known-broken feature
ok 897 # skip Skipping YAML::Perl for known-broken feature
ok 898 # skip Skipping YAML::Perl for known-broken feature
ok 899 # skip Skipping YAML::Perl for known-broken feature
ok 900 # skip Skipping YAML::Perl for known-broken feature
ok 901 # skip Skipping YAML::Perl for known-broken feature
ok 902 # skip Skipping YAML::Perl for known-broken feature
ok 903 - leading_trailing_spaces: CPAN::Meta::YAML parses without error
ok 904 - leading_trailing_spaces: CPAN::Meta::YAML does not modify the input string
ok 905 - The object isa CPAN::Meta::YAML
ok 906 - leading_trailing_spaces: CPAN::Meta::YAML parses correctly
ok 907 - leading_trailing_spaces: CPAN::Meta::YAML serializes without error
ok 908 - leading_trailing_spaces: CPAN::Meta::YAML serializes correctly
ok 909 - leading_trailing_spaces: CPAN::Meta::YAML round-trips without error
ok 910 - The object isa CPAN::Meta::YAML
ok 911 - leading_trailing_spaces: CPAN::Meta::YAML round-trips correctly
ok 912 # skip Shortcutting perfect serialization tests
ok 913 - implicit_hash: YAML.pm saves without error
ok 914 - implicit_hash: YAML.pm serializes correctly
ok 915 - implicit_hash: YAML.pm round-trips without error
ok 916 - implicit_hash: YAML.pm round-trips correctly
ok 917 - implicit_hash: YAML.pm loads without error
ok 918 - implicit_hash: YAML.pm does not modify the input string
ok 919 - implicit_hash: YAML.pm parses correctly
ok 920 - implicit_hash: YAML::Syck saves without error
ok 921 - implicit_hash: YAML::Syck serializes correctly
ok 922 - implicit_hash: YAML::Syck round-trips without error
ok 923 - implicit_hash: YAML::Syck round-trips correctly
ok 924 - implicit_hash: YAML::Syck loads without error
ok 925 - implicit_hash: YAML::Syck does not modify the input string
ok 926 - implicit_hash: YAML::Syck parses correctly
ok 927 - implicit_hash: YAML::XS saves without error
ok 928 - implicit_hash: YAML::XS serializes correctly
ok 929 - implicit_hash: YAML::XS round-trips without error
ok 930 - implicit_hash: YAML::XS round-trips correctly
ok 931 - implicit_hash: YAML::XS loads without error
ok 932 - implicit_hash: YAML::XS does not modify the input string
ok 933 - implicit_hash: YAML::XS parses correctly
ok 934 - implicit_hash: YAML::Perl saves without error
ok 935 - implicit_hash: YAML::Perl serializes correctly
ok 936 - implicit_hash: YAML::Perl round-trips without error
ok 937 - implicit_hash: YAML::Perl round-trips correctly
ok 938 - implicit_hash: YAML::Perl loads without error
ok 939 - implicit_hash: YAML::Perl does not modify the input string
ok 940 - implicit_hash: YAML::Perl parses correctly
ok 941 - implicit_hash: CPAN::Meta::YAML parses without error
ok 942 - implicit_hash: CPAN::Meta::YAML does not modify the input string
ok 943 - The object isa CPAN::Meta::YAML
ok 944 - implicit_hash: CPAN::Meta::YAML parses correctly
ok 945 - implicit_hash: CPAN::Meta::YAML serializes without error
ok 946 - implicit_hash: CPAN::Meta::YAML serializes correctly
ok 947 - implicit_hash: CPAN::Meta::YAML round-trips without error
ok 948 - The object isa CPAN::Meta::YAML
ok 949 - implicit_hash: CPAN::Meta::YAML round-trips correctly
ok 950 # skip Shortcutting perfect serialization tests
ok 951 - implicit_array: YAML.pm saves without error
ok 952 - implicit_array: YAML.pm serializes correctly
ok 953 - implicit_array: YAML.pm round-trips without error
ok 954 - implicit_array: YAML.pm round-trips correctly
ok 955 - implicit_array: YAML.pm loads without error
ok 956 - implicit_array: YAML.pm does not modify the input string
ok 957 - implicit_array: YAML.pm parses correctly
ok 958 - implicit_array: YAML::Syck saves without error
ok 959 - implicit_array: YAML::Syck serializes correctly
ok 960 - implicit_array: YAML::Syck round-trips without error
ok 961 - implicit_array: YAML::Syck round-trips correctly
ok 962 - implicit_array: YAML::Syck loads without error
ok 963 - implicit_array: YAML::Syck does not modify the input string
ok 964 - implicit_array: YAML::Syck parses correctly
ok 965 - implicit_array: YAML::XS saves without error
ok 966 - implicit_array: YAML::XS serializes correctly
ok 967 - implicit_array: YAML::XS round-trips without error
ok 968 - implicit_array: YAML::XS round-trips correctly
ok 969 - implicit_array: YAML::XS loads without error
ok 970 - implicit_array: YAML::XS does not modify the input string
ok 971 - implicit_array: YAML::XS parses correctly
ok 972 - implicit_array: YAML::Perl saves without error
ok 973 - implicit_array: YAML::Perl serializes correctly
ok 974 - implicit_array: YAML::Perl round-trips without error
ok 975 - implicit_array: YAML::Perl round-trips correctly
ok 976 - implicit_array: YAML::Perl loads without error
ok 977 - implicit_array: YAML::Perl does not modify the input string
ok 978 - implicit_array: YAML::Perl parses correctly
ok 979 - implicit_array: CPAN::Meta::YAML parses without error
ok 980 - implicit_array: CPAN::Meta::YAML does not modify the input string
ok 981 - The object isa CPAN::Meta::YAML
ok 982 - implicit_array: CPAN::Meta::YAML parses correctly
ok 983 - implicit_array: CPAN::Meta::YAML serializes without error
ok 984 - implicit_array: CPAN::Meta::YAML serializes correctly
ok 985 - implicit_array: CPAN::Meta::YAML round-trips without error
ok 986 - The object isa CPAN::Meta::YAML
ok 987 - implicit_array: CPAN::Meta::YAML round-trips correctly
ok 988 # skip Shortcutting perfect serialization tests
ok 989 - inline_nested_hash: YAML.pm saves without error
ok 990 - inline_nested_hash: YAML.pm serializes correctly
ok 991 - inline_nested_hash: YAML.pm round-trips without error
ok 992 - inline_nested_hash: YAML.pm round-trips correctly
ok 993 - inline_nested_hash: YAML.pm loads without error
ok 994 - inline_nested_hash: YAML.pm does not modify the input string
ok 995 - inline_nested_hash: YAML.pm parses correctly
ok 996 - inline_nested_hash: YAML::Syck saves without error
ok 997 - inline_nested_hash: YAML::Syck serializes correctly
ok 998 - inline_nested_hash: YAML::Syck round-trips without error
ok 999 - inline_nested_hash: YAML::Syck round-trips correctly
ok 1000 - inline_nested_hash: YAML::Syck loads without error
ok 1001 - inline_nested_hash: YAML::Syck does not modify the input string
ok 1002 - inline_nested_hash: YAML::Syck parses correctly
ok 1003 - inline_nested_hash: YAML::XS saves without error
ok 1004 - inline_nested_hash: YAML::XS serializes correctly
ok 1005 - inline_nested_hash: YAML::XS round-trips without error
ok 1006 - inline_nested_hash: YAML::XS round-trips correctly
ok 1007 - inline_nested_hash: YAML::XS loads without error
ok 1008 - inline_nested_hash: YAML::XS does not modify the input string
ok 1009 - inline_nested_hash: YAML::XS parses correctly
ok 1010 # skip Skipping YAML::Perl for known-broken feature
ok 1011 # skip Skipping YAML::Perl for known-broken feature
ok 1012 # skip Skipping YAML::Perl for known-broken feature
ok 1013 # skip Skipping YAML::Perl for known-broken feature
ok 1014 # skip Skipping YAML::Perl for known-broken feature
ok 1015 # skip Skipping YAML::Perl for known-broken feature
ok 1016 # skip Skipping YAML::Perl for known-broken feature
ok 1017 - inline_nested_hash: CPAN::Meta::YAML parses without error
ok 1018 - inline_nested_hash: CPAN::Meta::YAML does not modify the input string
ok 1019 - The object isa CPAN::Meta::YAML
ok 1020 - inline_nested_hash: CPAN::Meta::YAML parses correctly
ok 1021 - inline_nested_hash: CPAN::Meta::YAML serializes without error
ok 1022 - inline_nested_hash: CPAN::Meta::YAML serializes correctly
ok 1023 - inline_nested_hash: CPAN::Meta::YAML round-trips without error
ok 1024 - The object isa CPAN::Meta::YAML
ok 1025 - inline_nested_hash: CPAN::Meta::YAML round-trips correctly
ok 1026 # skip Shortcutting perfect serialization tests
ok 1027 - empty_comment_in_list: YAML.pm saves without error
ok 1028 - empty_comment_in_list: YAML.pm serializes correctly
ok 1029 - empty_comment_in_list: YAML.pm round-trips without error
ok 1030 - empty_comment_in_list: YAML.pm round-trips correctly
ok 1031 - empty_comment_in_list: YAML.pm loads without error
ok 1032 - empty_comment_in_list: YAML.pm does not modify the input string
ok 1033 - empty_comment_in_list: YAML.pm parses correctly
ok 1034 - empty_comment_in_list: YAML::Syck saves without error
ok 1035 - empty_comment_in_list: YAML::Syck serializes correctly
ok 1036 - empty_comment_in_list: YAML::Syck round-trips without error
ok 1037 - empty_comment_in_list: YAML::Syck round-trips correctly
ok 1038 - empty_comment_in_list: YAML::Syck loads without error
ok 1039 - empty_comment_in_list: YAML::Syck does not modify the input string
ok 1040 - empty_comment_in_list: YAML::Syck parses correctly
ok 1041 - empty_comment_in_list: YAML::XS saves without error
ok 1042 - empty_comment_in_list: YAML::XS serializes correctly
ok 1043 - empty_comment_in_list: YAML::XS round-trips without error
ok 1044 - empty_comment_in_list: YAML::XS round-trips correctly
ok 1045 - empty_comment_in_list: YAML::XS loads without error
ok 1046 - empty_comment_in_list: YAML::XS does not modify the input string
ok 1047 - empty_comment_in_list: YAML::XS parses correctly
ok 1048 - empty_comment_in_list: YAML::Perl saves without error
ok 1049 - empty_comment_in_list: YAML::Perl serializes correctly
ok 1050 - empty_comment_in_list: YAML::Perl round-trips without error
ok 1051 - empty_comment_in_list: YAML::Perl round-trips correctly
ok 1052 - empty_comment_in_list: YAML::Perl loads without error
ok 1053 - empty_comment_in_list: YAML::Perl does not modify the input string
ok 1054 - empty_comment_in_list: YAML::Perl parses correctly
ok 1055 - empty_comment_in_list: CPAN::Meta::YAML parses without error
ok 1056 - empty_comment_in_list: CPAN::Meta::YAML does not modify the input string
ok 1057 - The object isa CPAN::Meta::YAML
ok 1058 - empty_comment_in_list: CPAN::Meta::YAML parses correctly
ok 1059 - empty_comment_in_list: CPAN::Meta::YAML serializes without error
ok 1060 - empty_comment_in_list: CPAN::Meta::YAML serializes correctly
ok 1061 - empty_comment_in_list: CPAN::Meta::YAML round-trips without error
ok 1062 - The object isa CPAN::Meta::YAML
ok 1063 - empty_comment_in_list: CPAN::Meta::YAML round-trips correctly
ok 1064 # skip Shortcutting perfect serialization tests
ok 1065 - empty_comment_in_hash: YAML.pm saves without error
ok 1066 - empty_comment_in_hash: YAML.pm serializes correctly
ok 1067 - empty_comment_in_hash: YAML.pm round-trips without error
ok 1068 - empty_comment_in_hash: YAML.pm round-trips correctly
ok 1069 - empty_comment_in_hash: YAML.pm loads without error
ok 1070 - empty_comment_in_hash: YAML.pm does not modify the input string
ok 1071 - empty_comment_in_hash: YAML.pm parses correctly
ok 1072 - empty_comment_in_hash: YAML::Syck saves without error
ok 1073 - empty_comment_in_hash: YAML::Syck serializes correctly
ok 1074 - empty_comment_in_hash: YAML::Syck round-trips without error
ok 1075 - empty_comment_in_hash: YAML::Syck round-trips correctly
ok 1076 - empty_comment_in_hash: YAML::Syck loads without error
ok 1077 - empty_comment_in_hash: YAML::Syck does not modify the input string
ok 1078 - empty_comment_in_hash: YAML::Syck parses correctly
ok 1079 - empty_comment_in_hash: YAML::XS saves without error
ok 1080 - empty_comment_in_hash: YAML::XS serializes correctly
ok 1081 - empty_comment_in_hash: YAML::XS round-trips without error
ok 1082 - empty_comment_in_hash: YAML::XS round-trips correctly
ok 1083 - empty_comment_in_hash: YAML::XS loads without error
ok 1084 - empty_comment_in_hash: YAML::XS does not modify the input string
ok 1085 - empty_comment_in_hash: YAML::XS parses correctly
ok 1086 - empty_comment_in_hash: YAML::Perl saves without error
ok 1087 - empty_comment_in_hash: YAML::Perl serializes correctly
ok 1088 - empty_comment_in_hash: YAML::Perl round-trips without error
ok 1089 - empty_comment_in_hash: YAML::Perl round-trips correctly
ok 1090 - empty_comment_in_hash: YAML::Perl loads without error
ok 1091 - empty_comment_in_hash: YAML::Perl does not modify the input string
ok 1092 - empty_comment_in_hash: YAML::Perl parses correctly
ok 1093 - empty_comment_in_hash: CPAN::Meta::YAML parses without error
ok 1094 - empty_comment_in_hash: CPAN::Meta::YAML does not modify the input string
ok 1095 - The object isa CPAN::Meta::YAML
ok 1096 - empty_comment_in_hash: CPAN::Meta::YAML parses correctly
ok 1097 - empty_comment_in_hash: CPAN::Meta::YAML serializes without error
ok 1098 - empty_comment_in_hash: CPAN::Meta::YAML serializes correctly
ok 1099 - empty_comment_in_hash: CPAN::Meta::YAML round-trips without error
ok 1100 - The object isa CPAN::Meta::YAML
ok 1101 - empty_comment_in_hash: CPAN::Meta::YAML round-trips correctly
ok 1102 # skip Shortcutting perfect serialization tests
ok 1103 - key_with_whitespace: YAML.pm saves without error
ok 1104 - key_with_whitespace: YAML.pm serializes correctly
ok 1105 - key_with_whitespace: YAML.pm round-trips without error
ok 1106 - key_with_whitespace: YAML.pm round-trips correctly
ok 1107 - key_with_whitespace: YAML.pm loads without error
ok 1108 - key_with_whitespace: YAML.pm does not modify the input string
ok 1109 - key_with_whitespace: YAML.pm parses correctly
ok 1110 - key_with_whitespace: YAML::Syck saves without error
ok 1111 - key_with_whitespace: YAML::Syck serializes correctly
ok 1112 - key_with_whitespace: YAML::Syck round-trips without error
ok 1113 - key_with_whitespace: YAML::Syck round-trips correctly
ok 1114 - key_with_whitespace: YAML::Syck loads without error
ok 1115 - key_with_whitespace: YAML::Syck does not modify the input string
ok 1116 - key_with_whitespace: YAML::Syck parses correctly
ok 1117 - key_with_whitespace: YAML::XS saves without error
ok 1118 - key_with_whitespace: YAML::XS serializes correctly
ok 1119 - key_with_whitespace: YAML::XS round-trips without error
ok 1120 - key_with_whitespace: YAML::XS round-trips correctly
ok 1121 - key_with_whitespace: YAML::XS loads without error
ok 1122 - key_with_whitespace: YAML::XS does not modify the input string
ok 1123 - key_with_whitespace: YAML::XS parses correctly
ok 1124 - key_with_whitespace: YAML::Perl saves without error
ok 1125 - key_with_whitespace: YAML::Perl serializes correctly
ok 1126 - key_with_whitespace: YAML::Perl round-trips without error
ok 1127 - key_with_whitespace: YAML::Perl round-trips correctly
ok 1128 - key_with_whitespace: YAML::Perl loads without error
ok 1129 - key_with_whitespace: YAML::Perl does not modify the input string
ok 1130 - key_with_whitespace: YAML::Perl parses correctly
ok 1131 - key_with_whitespace: CPAN::Meta::YAML parses without error
ok 1132 - key_with_whitespace: CPAN::Meta::YAML does not modify the input string
ok 1133 - The object isa CPAN::Meta::YAML
ok 1134 - key_with_whitespace: CPAN::Meta::YAML parses correctly
ok 1135 - key_with_whitespace: CPAN::Meta::YAML serializes without error
ok 1136 - key_with_whitespace: CPAN::Meta::YAML serializes correctly
ok 1137 - key_with_whitespace: CPAN::Meta::YAML round-trips without error
ok 1138 - The object isa CPAN::Meta::YAML
ok 1139 - key_with_whitespace: CPAN::Meta::YAML round-trips correctly
ok 1140 # skip Shortcutting perfect serialization tests
ok
t/03_regression.t .. 
1..1418
ok 1 - Found exported Load function
ok 2 - Found exported Dump function
ok 3 - Found exported LoadFile function
ok 4 - Found exported DumpFile function
ok 5 - Found exported freeze function
ok 6 - Found exported thaw functiona
ok 7 - module_hash_key: YAML.pm saves without error
ok 8 - module_hash_key: YAML.pm serializes correctly
ok 9 - module_hash_key: YAML.pm round-trips without error
ok 10 - module_hash_key: YAML.pm round-trips correctly
ok 11 - module_hash_key: YAML.pm loads without error
ok 12 - module_hash_key: YAML.pm does not modify the input string
ok 13 - module_hash_key: YAML.pm parses correctly
ok 14 - module_hash_key: YAML::Syck saves without error
ok 15 - module_hash_key: YAML::Syck serializes correctly
ok 16 - module_hash_key: YAML::Syck round-trips without error
ok 17 - module_hash_key: YAML::Syck round-trips correctly
ok 18 - module_hash_key: YAML::Syck loads without error
ok 19 - module_hash_key: YAML::Syck does not modify the input string
ok 20 - module_hash_key: YAML::Syck parses correctly
ok 21 - module_hash_key: YAML::XS saves without error
ok 22 - module_hash_key: YAML::XS serializes correctly
ok 23 - module_hash_key: YAML::XS round-trips without error
ok 24 - module_hash_key: YAML::XS round-trips correctly
ok 25 - module_hash_key: YAML::XS loads without error
ok 26 - module_hash_key: YAML::XS does not modify the input string
ok 27 - module_hash_key: YAML::XS parses correctly
ok 28 - module_hash_key: YAML::Perl saves without error
ok 29 - module_hash_key: YAML::Perl serializes correctly
ok 30 - module_hash_key: YAML::Perl round-trips without error
ok 31 - module_hash_key: YAML::Perl round-trips correctly
ok 32 - module_hash_key: YAML::Perl loads without error
ok 33 - module_hash_key: YAML::Perl does not modify the input string
ok 34 - module_hash_key: YAML::Perl parses correctly
ok 35 - module_hash_key: CPAN::Meta::YAML parses without error
ok 36 - module_hash_key: CPAN::Meta::YAML does not modify the input string
ok 37 - The object isa CPAN::Meta::YAML
ok 38 - module_hash_key: CPAN::Meta::YAML parses correctly
ok 39 - module_hash_key: CPAN::Meta::YAML serializes without error
ok 40 - module_hash_key: CPAN::Meta::YAML serializes correctly
ok 41 - module_hash_key: CPAN::Meta::YAML round-trips without error
ok 42 - The object isa CPAN::Meta::YAML
ok 43 - module_hash_key: CPAN::Meta::YAML round-trips correctly
ok 44 # skip Shortcutting perfect serialization tests
ok 45 - hash_indented: YAML.pm saves without error
ok 46 - hash_indented: YAML.pm serializes correctly
ok 47 - hash_indented: YAML.pm round-trips without error
ok 48 - hash_indented: YAML.pm round-trips correctly
ok 49 - hash_indented: YAML.pm loads without error
ok 50 - hash_indented: YAML.pm does not modify the input string
ok 51 - hash_indented: YAML.pm parses correctly
ok 52 - hash_indented: YAML::Syck saves without error
ok 53 - hash_indented: YAML::Syck serializes correctly
ok 54 - hash_indented: YAML::Syck round-trips without error
ok 55 - hash_indented: YAML::Syck round-trips correctly
ok 56 - hash_indented: YAML::Syck loads without error
ok 57 - hash_indented: YAML::Syck does not modify the input string
ok 58 - hash_indented: YAML::Syck parses correctly
ok 59 - hash_indented: YAML::XS saves without error
ok 60 - hash_indented: YAML::XS serializes correctly
ok 61 - hash_indented: YAML::XS round-trips without error
ok 62 - hash_indented: YAML::XS round-trips correctly
ok 63 - hash_indented: YAML::XS loads without error
ok 64 - hash_indented: YAML::XS does not modify the input string
ok 65 - hash_indented: YAML::XS parses correctly
ok 66 - hash_indented: YAML::Perl saves without error
ok 67 - hash_indented: YAML::Perl serializes correctly
ok 68 - hash_indented: YAML::Perl round-trips without error
ok 69 - hash_indented: YAML::Perl round-trips correctly
ok 70 - hash_indented: YAML::Perl loads without error
ok 71 - hash_indented: YAML::Perl does not modify the input string
ok 72 - hash_indented: YAML::Perl parses correctly
ok 73 - hash_indented: CPAN::Meta::YAML parses without error
ok 74 - hash_indented: CPAN::Meta::YAML does not modify the input string
ok 75 - The object isa CPAN::Meta::YAML
ok 76 - hash_indented: CPAN::Meta::YAML parses correctly
ok 77 - hash_indented: CPAN::Meta::YAML serializes without error
ok 78 - hash_indented: CPAN::Meta::YAML serializes correctly
ok 79 - hash_indented: CPAN::Meta::YAML round-trips without error
ok 80 - The object isa CPAN::Meta::YAML
ok 81 - hash_indented: CPAN::Meta::YAML round-trips correctly
ok 82 # skip Shortcutting perfect serialization tests
ok 83 - simple_multiline: YAML.pm saves without error
ok 84 - simple_multiline: YAML.pm serializes correctly
ok 85 - simple_multiline: YAML.pm round-trips without error
ok 86 - simple_multiline: YAML.pm round-trips correctly
ok 87 - simple_multiline: YAML.pm loads without error
ok 88 - simple_multiline: YAML.pm does not modify the input string
ok 89 - simple_multiline: YAML.pm parses correctly
ok 90 - simple_multiline: YAML::Syck saves without error
ok 91 - simple_multiline: YAML::Syck serializes correctly
ok 92 - simple_multiline: YAML::Syck round-trips without error
ok 93 - simple_multiline: YAML::Syck round-trips correctly
ok 94 - simple_multiline: YAML::Syck loads without error
ok 95 - simple_multiline: YAML::Syck does not modify the input string
ok 96 - simple_multiline: YAML::Syck parses correctly
ok 97 - simple_multiline: YAML::XS saves without error
ok 98 - simple_multiline: YAML::XS serializes correctly
ok 99 - simple_multiline: YAML::XS round-trips without error
ok 100 - simple_multiline: YAML::XS round-trips correctly
ok 101 - simple_multiline: YAML::XS loads without error
ok 102 - simple_multiline: YAML::XS does not modify the input string
ok 103 - simple_multiline: YAML::XS parses correctly
ok 104 - simple_multiline: YAML::Perl saves without error
ok 105 - simple_multiline: YAML::Perl serializes correctly
ok 106 - simple_multiline: YAML::Perl round-trips without error
ok 107 - simple_multiline: YAML::Perl round-trips correctly
ok 108 - simple_multiline: YAML::Perl loads without error
ok 109 - simple_multiline: YAML::Perl does not modify the input string
ok 110 - simple_multiline: YAML::Perl parses correctly
ok 111 - simple_multiline: CPAN::Meta::YAML parses without error
ok 112 - simple_multiline: CPAN::Meta::YAML does not modify the input string
ok 113 - The object isa CPAN::Meta::YAML
ok 114 - simple_multiline: CPAN::Meta::YAML parses correctly
ok 115 - simple_multiline: CPAN::Meta::YAML serializes without error
ok 116 - simple_multiline: CPAN::Meta::YAML serializes correctly
ok 117 - simple_multiline: CPAN::Meta::YAML round-trips without error
ok 118 - The object isa CPAN::Meta::YAML
ok 119 - simple_multiline: CPAN::Meta::YAML round-trips correctly
ok 120 # skip Shortcutting perfect serialization tests
ok 121 - indented: YAML.pm saves without error
ok 122 - indented: YAML.pm serializes correctly
ok 123 - indented: YAML.pm round-trips without error
ok 124 - indented: YAML.pm round-trips correctly
ok 125 - indented: YAML.pm loads without error
ok 126 - indented: YAML.pm does not modify the input string
ok 127 - indented: YAML.pm parses correctly
ok 128 - indented: YAML::Syck saves without error
ok 129 - indented: YAML::Syck serializes correctly
ok 130 - indented: YAML::Syck round-trips without error
ok 131 - indented: YAML::Syck round-trips correctly
ok 132 - indented: YAML::Syck loads without error
ok 133 - indented: YAML::Syck does not modify the input string
ok 134 - indented: YAML::Syck parses correctly
ok 135 - indented: YAML::XS saves without error
ok 136 - indented: YAML::XS serializes correctly
ok 137 - indented: YAML::XS round-trips without error
ok 138 - indented: YAML::XS round-trips correctly
ok 139 - indented: YAML::XS loads without error
ok 140 - indented: YAML::XS does not modify the input string
ok 141 - indented: YAML::XS parses correctly
ok 142 - indented: YAML::Perl saves without error
ok 143 - indented: YAML::Perl serializes correctly
ok 144 - indented: YAML::Perl round-trips without error
ok 145 - indented: YAML::Perl round-trips correctly
ok 146 - indented: YAML::Perl loads without error
ok 147 - indented: YAML::Perl does not modify the input string
ok 148 - indented: YAML::Perl parses correctly
ok 149 - indented: CPAN::Meta::YAML parses without error
ok 150 - indented: CPAN::Meta::YAML does not modify the input string
ok 151 - The object isa CPAN::Meta::YAML
ok 152 - indented: CPAN::Meta::YAML parses correctly
ok 153 - indented: CPAN::Meta::YAML serializes without error
ok 154 - indented: CPAN::Meta::YAML serializes correctly
ok 155 - indented: CPAN::Meta::YAML round-trips without error
ok 156 - The object isa CPAN::Meta::YAML
ok 157 - indented: CPAN::Meta::YAML round-trips correctly
ok 158 # skip Shortcutting perfect serialization tests
ok 159 - indented: YAML.pm saves without error
ok 160 - indented: YAML.pm serializes correctly
ok 161 - indented: YAML.pm round-trips without error
ok 162 - indented: YAML.pm round-trips correctly
ok 163 - indented: YAML.pm loads without error
ok 164 - indented: YAML.pm does not modify the input string
ok 165 - indented: YAML.pm parses correctly
ok 166 - indented: YAML::Syck saves without error
ok 167 - indented: YAML::Syck serializes correctly
ok 168 - indented: YAML::Syck round-trips without error
ok 169 - indented: YAML::Syck round-trips correctly
ok 170 - indented: YAML::Syck loads without error
ok 171 - indented: YAML::Syck does not modify the input string
ok 172 - indented: YAML::Syck parses correctly
ok 173 - indented: YAML::XS saves without error
ok 174 - indented: YAML::XS serializes correctly
ok 175 - indented: YAML::XS round-trips without error
ok 176 - indented: YAML::XS round-trips correctly
ok 177 - indented: YAML::XS loads without error
ok 178 - indented: YAML::XS does not modify the input string
ok 179 - indented: YAML::XS parses correctly
ok 180 - indented: YAML::Perl saves without error
ok 181 - indented: YAML::Perl serializes correctly
ok 182 - indented: YAML::Perl round-trips without error
ok 183 - indented: YAML::Perl round-trips correctly
ok 184 - indented: YAML::Perl loads without error
ok 185 - indented: YAML::Perl does not modify the input string
ok 186 - indented: YAML::Perl parses correctly
ok 187 - indented: CPAN::Meta::YAML parses without error
ok 188 - indented: CPAN::Meta::YAML does not modify the input string
ok 189 - The object isa CPAN::Meta::YAML
ok 190 - indented: CPAN::Meta::YAML parses correctly
ok 191 - indented: CPAN::Meta::YAML serializes without error
ok 192 - indented: CPAN::Meta::YAML serializes correctly
ok 193 - indented: CPAN::Meta::YAML round-trips without error
ok 194 - The object isa CPAN::Meta::YAML
ok 195 - indented: CPAN::Meta::YAML round-trips correctly
ok 196 # skip Shortcutting perfect serialization tests
ok 197 - simple_doctype_comment: YAML.pm saves without error
ok 198 - simple_doctype_comment: YAML.pm serializes correctly
ok 199 - simple_doctype_comment: YAML.pm round-trips without error
ok 200 - simple_doctype_comment: YAML.pm round-trips correctly
ok 201 - simple_doctype_comment: YAML.pm loads without error
ok 202 - simple_doctype_comment: YAML.pm does not modify the input string
ok 203 - simple_doctype_comment: YAML.pm parses correctly
ok 204 # skip Skipping YAML::Syck for known-broken feature
ok 205 # skip Skipping YAML::Syck for known-broken feature
ok 206 # skip Skipping YAML::Syck for known-broken feature
ok 207 # skip Skipping YAML::Syck for known-broken feature
ok 208 # skip Skipping YAML::Syck for known-broken feature
ok 209 # skip Skipping YAML::Syck for known-broken feature
ok 210 # skip Skipping YAML::Syck for known-broken feature
ok 211 - simple_doctype_comment: YAML::XS saves without error
ok 212 - simple_doctype_comment: YAML::XS serializes correctly
ok 213 - simple_doctype_comment: YAML::XS round-trips without error
ok 214 - simple_doctype_comment: YAML::XS round-trips correctly
ok 215 - simple_doctype_comment: YAML::XS loads without error
ok 216 - simple_doctype_comment: YAML::XS does not modify the input string
ok 217 - simple_doctype_comment: YAML::XS parses correctly
ok 218 - simple_doctype_comment: YAML::Perl saves without error
ok 219 - simple_doctype_comment: YAML::Perl serializes correctly
ok 220 - simple_doctype_comment: YAML::Perl round-trips without error
ok 221 - simple_doctype_comment: YAML::Perl round-trips correctly
ok 222 - simple_doctype_comment: YAML::Perl loads without error
ok 223 - simple_doctype_comment: YAML::Perl does not modify the input string
ok 224 - simple_doctype_comment: YAML::Perl parses correctly
ok 225 - simple_doctype_comment: CPAN::Meta::YAML parses without error
ok 226 - simple_doctype_comment: CPAN::Meta::YAML does not modify the input string
ok 227 - The object isa CPAN::Meta::YAML
ok 228 - simple_doctype_comment: CPAN::Meta::YAML parses correctly
ok 229 - simple_doctype_comment: CPAN::Meta::YAML serializes without error
ok 230 - simple_doctype_comment: CPAN::Meta::YAML serializes correctly
ok 231 - simple_doctype_comment: CPAN::Meta::YAML round-trips without error
ok 232 - The object isa CPAN::Meta::YAML
ok 233 - simple_doctype_comment: CPAN::Meta::YAML round-trips correctly
ok 234 # skip Shortcutting perfect serialization tests
ok 235 # skip Skipping YAML.pm for known-broken feature
ok 236 # skip Skipping YAML.pm for known-broken feature
ok 237 # skip Skipping YAML.pm for known-broken feature
ok 238 # skip Skipping YAML.pm for known-broken feature
ok 239 # skip Skipping YAML.pm for known-broken feature
ok 240 # skip Skipping YAML.pm for known-broken feature
ok 241 # skip Skipping YAML.pm for known-broken feature
ok 242 - simple_doctype_percent: YAML::Syck saves without error
ok 243 - simple_doctype_percent: YAML::Syck serializes correctly
ok 244 - simple_doctype_percent: YAML::Syck round-trips without error
ok 245 - simple_doctype_percent: YAML::Syck round-trips correctly
ok 246 - simple_doctype_percent: YAML::Syck loads without error
ok 247 - simple_doctype_percent: YAML::Syck does not modify the input string
ok 248 - simple_doctype_percent: YAML::Syck parses correctly
ok 249 # skip Skipping YAML::XS for known-broken feature
ok 250 # skip Skipping YAML::XS for known-broken feature
ok 251 # skip Skipping YAML::XS for known-broken feature
ok 252 # skip Skipping YAML::XS for known-broken feature
ok 253 # skip Skipping YAML::XS for known-broken feature
ok 254 # skip Skipping YAML::XS for known-broken feature
ok 255 # skip Skipping YAML::XS for known-broken feature
ok 256 # skip Skipping YAML::Perl for known-broken feature
ok 257 # skip Skipping YAML::Perl for known-broken feature
ok 258 # skip Skipping YAML::Perl for known-broken feature
ok 259 # skip Skipping YAML::Perl for known-broken feature
ok 260 # skip Skipping YAML::Perl for known-broken feature
ok 261 # skip Skipping YAML::Perl for known-broken feature
ok 262 # skip Skipping YAML::Perl for known-broken feature
ok 263 - simple_doctype_percent: CPAN::Meta::YAML parses without error
ok 264 - simple_doctype_percent: CPAN::Meta::YAML does not modify the input string
ok 265 - The object isa CPAN::Meta::YAML
ok 266 - simple_doctype_percent: CPAN::Meta::YAML parses correctly
ok 267 - simple_doctype_percent: CPAN::Meta::YAML serializes without error
ok 268 - simple_doctype_percent: CPAN::Meta::YAML serializes correctly
ok 269 - simple_doctype_percent: CPAN::Meta::YAML round-trips without error
ok 270 - The object isa CPAN::Meta::YAML
ok 271 - simple_doctype_percent: CPAN::Meta::YAML round-trips correctly
ok 272 # skip Shortcutting perfect serialization tests
ok 273 # skip Skipping YAML.pm for known-broken feature
ok 274 # skip Skipping YAML.pm for known-broken feature
ok 275 # skip Skipping YAML.pm for known-broken feature
ok 276 # skip Skipping YAML.pm for known-broken feature
ok 277 # skip Skipping YAML.pm for known-broken feature
ok 278 # skip Skipping YAML.pm for known-broken feature
ok 279 # skip Skipping YAML.pm for known-broken feature
ok 280 # skip Skipping YAML::Syck for known-broken feature
ok 281 # skip Skipping YAML::Syck for known-broken feature
ok 282 # skip Skipping YAML::Syck for known-broken feature
ok 283 # skip Skipping YAML::Syck for known-broken feature
ok 284 # skip Skipping YAML::Syck for known-broken feature
ok 285 # skip Skipping YAML::Syck for known-broken feature
ok 286 # skip Skipping YAML::Syck for known-broken feature
ok 287 # skip Skipping YAML::XS for known-broken feature
ok 288 # skip Skipping YAML::XS for known-broken feature
ok 289 # skip Skipping YAML::XS for known-broken feature
ok 290 # skip Skipping YAML::XS for known-broken feature
ok 291 # skip Skipping YAML::XS for known-broken feature
ok 292 # skip Skipping YAML::XS for known-broken feature
ok 293 # skip Skipping YAML::XS for known-broken feature
ok 294 # skip Skipping YAML::Perl for known-broken feature
ok 295 # skip Skipping YAML::Perl for known-broken feature
ok 296 # skip Skipping YAML::Perl for known-broken feature
ok 297 # skip Skipping YAML::Perl for known-broken feature
ok 298 # skip Skipping YAML::Perl for known-broken feature
ok 299 # skip Skipping YAML::Perl for known-broken feature
ok 300 # skip Skipping YAML::Perl for known-broken feature
ok 301 - predocument_1_0: CPAN::Meta::YAML parses without error
ok 302 - predocument_1_0: CPAN::Meta::YAML does not modify the input string
ok 303 - The object isa CPAN::Meta::YAML
ok 304 - predocument_1_0: CPAN::Meta::YAML parses correctly
ok 305 - predocument_1_0: CPAN::Meta::YAML serializes without error
ok 306 - predocument_1_0: CPAN::Meta::YAML serializes correctly
ok 307 - predocument_1_0: CPAN::Meta::YAML round-trips without error
ok 308 - The object isa CPAN::Meta::YAML
ok 309 - predocument_1_0: CPAN::Meta::YAML round-trips correctly
ok 310 # skip Shortcutting perfect serialization tests
ok 311 # skip Skipping YAML.pm for known-broken feature
ok 312 # skip Skipping YAML.pm for known-broken feature
ok 313 # skip Skipping YAML.pm for known-broken feature
ok 314 # skip Skipping YAML.pm for known-broken feature
ok 315 # skip Skipping YAML.pm for known-broken feature
ok 316 # skip Skipping YAML.pm for known-broken feature
ok 317 # skip Skipping YAML.pm for known-broken feature
ok 318 # skip Skipping YAML::Syck for known-broken feature
ok 319 # skip Skipping YAML::Syck for known-broken feature
ok 320 # skip Skipping YAML::Syck for known-broken feature
ok 321 # skip Skipping YAML::Syck for known-broken feature
ok 322 # skip Skipping YAML::Syck for known-broken feature
ok 323 # skip Skipping YAML::Syck for known-broken feature
ok 324 # skip Skipping YAML::Syck for known-broken feature
ok 325 - predocument_1_1: YAML::XS saves without error
ok 326 - predocument_1_1: YAML::XS serializes correctly
ok 327 - predocument_1_1: YAML::XS round-trips without error
ok 328 - predocument_1_1: YAML::XS round-trips correctly
ok 329 - predocument_1_1: YAML::XS loads without error
ok 330 - predocument_1_1: YAML::XS does not modify the input string
ok 331 - predocument_1_1: YAML::XS parses correctly
ok 332 # skip Skipping YAML::Perl for known-broken feature
ok 333 # skip Skipping YAML::Perl for known-broken feature
ok 334 # skip Skipping YAML::Perl for known-broken feature
ok 335 # skip Skipping YAML::Perl for known-broken feature
ok 336 # skip Skipping YAML::Perl for known-broken feature
ok 337 # skip Skipping YAML::Perl for known-broken feature
ok 338 # skip Skipping YAML::Perl for known-broken feature
ok 339 - predocument_1_1: CPAN::Meta::YAML parses without error
ok 340 - predocument_1_1: CPAN::Meta::YAML does not modify the input string
ok 341 - The object isa CPAN::Meta::YAML
ok 342 - predocument_1_1: CPAN::Meta::YAML parses correctly
ok 343 - predocument_1_1: CPAN::Meta::YAML serializes without error
ok 344 - predocument_1_1: CPAN::Meta::YAML serializes correctly
ok 345 - predocument_1_1: CPAN::Meta::YAML round-trips without error
ok 346 - The object isa CPAN::Meta::YAML
ok 347 - predocument_1_1: CPAN::Meta::YAML round-trips correctly
ok 348 # skip Shortcutting perfect serialization tests
ok 349 - multi_doctype_comment: YAML.pm saves without error
ok 350 - multi_doctype_comment: YAML.pm serializes correctly
ok 351 - multi_doctype_comment: YAML.pm round-trips without error
ok 352 - multi_doctype_comment: YAML.pm round-trips correctly
ok 353 - multi_doctype_comment: YAML.pm loads without error
ok 354 - multi_doctype_comment: YAML.pm does not modify the input string
ok 355 - multi_doctype_comment: YAML.pm parses correctly
ok 356 # skip Skipping YAML::Syck for unsupported feature
ok 357 # skip Skipping YAML::Syck for unsupported feature
ok 358 # skip Skipping YAML::Syck for unsupported feature
ok 359 # skip Skipping YAML::Syck for unsupported feature
ok 360 # skip Skipping YAML::Syck for unsupported feature
ok 361 # skip Skipping YAML::Syck for unsupported feature
ok 362 # skip Skipping YAML::Syck for unsupported feature
ok 363 - multi_doctype_comment: YAML::XS saves without error
ok 364 - multi_doctype_comment: YAML::XS serializes correctly
ok 365 - multi_doctype_comment: YAML::XS round-trips without error
ok 366 - multi_doctype_comment: YAML::XS round-trips correctly
ok 367 - multi_doctype_comment: YAML::XS loads without error
ok 368 - multi_doctype_comment: YAML::XS does not modify the input string
ok 369 - multi_doctype_comment: YAML::XS parses correctly
ok 370 - multi_doctype_comment: YAML::Perl saves without error
ok 371 - multi_doctype_comment: YAML::Perl serializes correctly
ok 372 - multi_doctype_comment: YAML::Perl round-trips without error
ok 373 - multi_doctype_comment: YAML::Perl round-trips correctly
ok 374 - multi_doctype_comment: YAML::Perl loads without error
ok 375 - multi_doctype_comment: YAML::Perl does not modify the input string
ok 376 - multi_doctype_comment: YAML::Perl parses correctly
ok 377 - multi_doctype_comment: CPAN::Meta::YAML parses without error
ok 378 - multi_doctype_comment: CPAN::Meta::YAML does not modify the input string
ok 379 - The object isa CPAN::Meta::YAML
ok 380 - multi_doctype_comment: CPAN::Meta::YAML parses correctly
ok 381 - multi_doctype_comment: CPAN::Meta::YAML serializes without error
ok 382 - multi_doctype_comment: CPAN::Meta::YAML serializes correctly
ok 383 - multi_doctype_comment: CPAN::Meta::YAML round-trips without error
ok 384 - The object isa CPAN::Meta::YAML
ok 385 - multi_doctype_comment: CPAN::Meta::YAML round-trips correctly
ok 386 # skip Shortcutting perfect serialization tests
ok 387 # skip Skipping YAML.pm for known-broken feature
ok 388 # skip Skipping YAML.pm for known-broken feature
ok 389 # skip Skipping YAML.pm for known-broken feature
ok 390 # skip Skipping YAML.pm for known-broken feature
ok 391 # skip Skipping YAML.pm for known-broken feature
ok 392 # skip Skipping YAML.pm for known-broken feature
ok 393 # skip Skipping YAML.pm for known-broken feature
ok 394 # skip Skipping YAML::Syck for known-broken feature
ok 395 # skip Skipping YAML::Syck for known-broken feature
ok 396 # skip Skipping YAML::Syck for known-broken feature
ok 397 # skip Skipping YAML::Syck for known-broken feature
ok 398 # skip Skipping YAML::Syck for known-broken feature
ok 399 # skip Skipping YAML::Syck for known-broken feature
ok 400 # skip Skipping YAML::Syck for known-broken feature
ok 401 - predocument_percent: YAML::XS saves without error
ok 402 - predocument_percent: YAML::XS serializes correctly
ok 403 - predocument_percent: YAML::XS round-trips without error
ok 404 - predocument_percent: YAML::XS round-trips correctly
ok 405 - predocument_percent: YAML::XS loads without error
ok 406 - predocument_percent: YAML::XS does not modify the input string
ok 407 - predocument_percent: YAML::XS parses correctly
ok 408 # skip Skipping YAML::Perl for known-broken feature
ok 409 # skip Skipping YAML::Perl for known-broken feature
ok 410 # skip Skipping YAML::Perl for known-broken feature
ok 411 # skip Skipping YAML::Perl for known-broken feature
ok 412 # skip Skipping YAML::Perl for known-broken feature
ok 413 # skip Skipping YAML::Perl for known-broken feature
ok 414 # skip Skipping YAML::Perl for known-broken feature
ok 415 - predocument_percent: CPAN::Meta::YAML parses without error
ok 416 - predocument_percent: CPAN::Meta::YAML does not modify the input string
ok 417 - The object isa CPAN::Meta::YAML
ok 418 - predocument_percent: CPAN::Meta::YAML parses correctly
ok 419 - predocument_percent: CPAN::Meta::YAML serializes without error
ok 420 - predocument_percent: CPAN::Meta::YAML serializes correctly
ok 421 - predocument_percent: CPAN::Meta::YAML round-trips without error
ok 422 - The object isa CPAN::Meta::YAML
ok 423 - predocument_percent: CPAN::Meta::YAML round-trips correctly
ok 424 # skip Shortcutting perfect serialization tests
ok 425 - predocument_comment: YAML.pm saves without error
ok 426 - predocument_comment: YAML.pm serializes correctly
ok 427 - predocument_comment: YAML.pm round-trips without error
ok 428 - predocument_comment: YAML.pm round-trips correctly
ok 429 - predocument_comment: YAML.pm loads without error
ok 430 - predocument_comment: YAML.pm does not modify the input string
ok 431 - predocument_comment: YAML.pm parses correctly
ok 432 - predocument_comment: YAML::Syck saves without error
ok 433 - predocument_comment: YAML::Syck serializes correctly
ok 434 - predocument_comment: YAML::Syck round-trips without error
ok 435 - predocument_comment: YAML::Syck round-trips correctly
ok 436 - predocument_comment: YAML::Syck loads without error
ok 437 - predocument_comment: YAML::Syck does not modify the input string
ok 438 - predocument_comment: YAML::Syck parses correctly
ok 439 - predocument_comment: YAML::XS saves without error
ok 440 - predocument_comment: YAML::XS serializes correctly
ok 441 - predocument_comment: YAML::XS round-trips without error
ok 442 - predocument_comment: YAML::XS round-trips correctly
ok 443 - predocument_comment: YAML::XS loads without error
ok 444 - predocument_comment: YAML::XS does not modify the input string
ok 445 - predocument_comment: YAML::XS parses correctly
ok 446 - predocument_comment: YAML::Perl saves without error
ok 447 - predocument_comment: YAML::Perl serializes correctly
ok 448 - predocument_comment: YAML::Perl round-trips without error
ok 449 - predocument_comment: YAML::Perl round-trips correctly
ok 450 - predocument_comment: YAML::Perl loads without error
ok 451 - predocument_comment: YAML::Perl does not modify the input string
ok 452 - predocument_comment: YAML::Perl parses correctly
ok 453 - predocument_comment: CPAN::Meta::YAML parses without error
ok 454 - predocument_comment: CPAN::Meta::YAML does not modify the input string
ok 455 - The object isa CPAN::Meta::YAML
ok 456 - predocument_comment: CPAN::Meta::YAML parses correctly
ok 457 - predocument_comment: CPAN::Meta::YAML serializes without error
ok 458 - predocument_comment: CPAN::Meta::YAML serializes correctly
ok 459 - predocument_comment: CPAN::Meta::YAML round-trips without error
ok 460 - The object isa CPAN::Meta::YAML
ok 461 - predocument_comment: CPAN::Meta::YAML round-trips correctly
ok 462 # skip Shortcutting perfect serialization tests
ok 463 - hitchhiker scalar: YAML.pm saves without error
ok 464 - hitchhiker scalar: YAML.pm serializes correctly
ok 465 - hitchhiker scalar: YAML.pm round-trips without error
ok 466 - hitchhiker scalar: YAML.pm round-trips correctly
ok 467 - hitchhiker scalar: YAML.pm loads without error
ok 468 - hitchhiker scalar: YAML.pm does not modify the input string
ok 469 - hitchhiker scalar: YAML.pm parses correctly
ok 470 - hitchhiker scalar: YAML::Syck saves without error
ok 471 - hitchhiker scalar: YAML::Syck serializes correctly
ok 472 - hitchhiker scalar: YAML::Syck round-trips without error
ok 473 - hitchhiker scalar: YAML::Syck round-trips correctly
ok 474 - hitchhiker scalar: YAML::Syck loads without error
ok 475 - hitchhiker scalar: YAML::Syck does not modify the input string
ok 476 - hitchhiker scalar: YAML::Syck parses correctly
ok 477 - hitchhiker scalar: YAML::XS saves without error
ok 478 - hitchhiker scalar: YAML::XS serializes correctly
ok 479 - hitchhiker scalar: YAML::XS round-trips without error
ok 480 - hitchhiker scalar: YAML::XS round-trips correctly
ok 481 - hitchhiker scalar: YAML::XS loads without error
ok 482 - hitchhiker scalar: YAML::XS does not modify the input string
ok 483 - hitchhiker scalar: YAML::XS parses correctly
ok 484 - hitchhiker scalar: YAML::Perl saves without error
ok 485 - hitchhiker scalar: YAML::Perl serializes correctly
ok 486 - hitchhiker scalar: YAML::Perl round-trips without error
ok 487 - hitchhiker scalar: YAML::Perl round-trips correctly
ok 488 - hitchhiker scalar: YAML::Perl loads without error
ok 489 - hitchhiker scalar: YAML::Perl does not modify the input string
ok 490 - hitchhiker scalar: YAML::Perl parses correctly
ok 491 - hitchhiker scalar: CPAN::Meta::YAML parses without error
ok 492 - hitchhiker scalar: CPAN::Meta::YAML does not modify the input string
ok 493 - The object isa CPAN::Meta::YAML
ok 494 - hitchhiker scalar: CPAN::Meta::YAML parses correctly
ok 495 - hitchhiker scalar: CPAN::Meta::YAML serializes without error
ok 496 - hitchhiker scalar: CPAN::Meta::YAML serializes correctly
ok 497 - hitchhiker scalar: CPAN::Meta::YAML round-trips without error
ok 498 - The object isa CPAN::Meta::YAML
ok 499 - hitchhiker scalar: CPAN::Meta::YAML round-trips correctly
ok 500 - Serializes ok
ok 501 - null hash in array: YAML.pm saves without error
ok 502 - null hash in array: YAML.pm serializes correctly
ok 503 - null hash in array: YAML.pm round-trips without error
ok 504 - null hash in array: YAML.pm round-trips correctly
ok 505 - null hash in array: YAML.pm loads without error
ok 506 - null hash in array: YAML.pm does not modify the input string
ok 507 - null hash in array: YAML.pm parses correctly
ok 508 - null hash in array: YAML::Syck saves without error
ok 509 - null hash in array: YAML::Syck serializes correctly
ok 510 - null hash in array: YAML::Syck round-trips without error
ok 511 - null hash in array: YAML::Syck round-trips correctly
ok 512 - null hash in array: YAML::Syck loads without error
ok 513 - null hash in array: YAML::Syck does not modify the input string
ok 514 - null hash in array: YAML::Syck parses correctly
ok 515 - null hash in array: YAML::XS saves without error
ok 516 - null hash in array: YAML::XS serializes correctly
ok 517 - null hash in array: YAML::XS round-trips without error
ok 518 - null hash in array: YAML::XS round-trips correctly
ok 519 - null hash in array: YAML::XS loads without error
ok 520 - null hash in array: YAML::XS does not modify the input string
ok 521 - null hash in array: YAML::XS parses correctly
ok 522 - null hash in array: YAML::Perl saves without error
ok 523 - null hash in array: YAML::Perl serializes correctly
ok 524 - null hash in array: YAML::Perl round-trips without error
ok 525 - null hash in array: YAML::Perl round-trips correctly
ok 526 - null hash in array: YAML::Perl loads without error
ok 527 - null hash in array: YAML::Perl does not modify the input string
ok 528 - null hash in array: YAML::Perl parses correctly
ok 529 - null hash in array: CPAN::Meta::YAML parses without error
ok 530 - null hash in array: CPAN::Meta::YAML does not modify the input string
ok 531 - The object isa CPAN::Meta::YAML
ok 532 - null hash in array: CPAN::Meta::YAML parses correctly
ok 533 - null hash in array: CPAN::Meta::YAML serializes without error
ok 534 - null hash in array: CPAN::Meta::YAML serializes correctly
ok 535 - null hash in array: CPAN::Meta::YAML round-trips without error
ok 536 - The object isa CPAN::Meta::YAML
ok 537 - null hash in array: CPAN::Meta::YAML round-trips correctly
ok 538 # skip Shortcutting perfect serialization tests
ok 539 - null array in array: YAML.pm saves without error
ok 540 - null array in array: YAML.pm serializes correctly
ok 541 - null array in array: YAML.pm round-trips without error
ok 542 - null array in array: YAML.pm round-trips correctly
ok 543 - null array in array: YAML.pm loads without error
ok 544 - null array in array: YAML.pm does not modify the input string
ok 545 - null array in array: YAML.pm parses correctly
ok 546 - null array in array: YAML::Syck saves without error
ok 547 - null array in array: YAML::Syck serializes correctly
ok 548 - null array in array: YAML::Syck round-trips without error
ok 549 - null array in array: YAML::Syck round-trips correctly
ok 550 - null array in array: YAML::Syck loads without error
ok 551 - null array in array: YAML::Syck does not modify the input string
ok 552 - null array in array: YAML::Syck parses correctly
ok 553 - null array in array: YAML::XS saves without error
ok 554 - null array in array: YAML::XS serializes correctly
ok 555 - null array in array: YAML::XS round-trips without error
ok 556 - null array in array: YAML::XS round-trips correctly
ok 557 - null array in array: YAML::XS loads without error
ok 558 - null array in array: YAML::XS does not modify the input string
ok 559 - null array in array: YAML::XS parses correctly
ok 560 - null array in array: YAML::Perl saves without error
ok 561 - null array in array: YAML::Perl serializes correctly
ok 562 - null array in array: YAML::Perl round-trips without error
ok 563 - null array in array: YAML::Perl round-trips correctly
ok 564 - null array in array: YAML::Perl loads without error
ok 565 - null array in array: YAML::Perl does not modify the input string
ok 566 - null array in array: YAML::Perl parses correctly
ok 567 - null array in array: CPAN::Meta::YAML parses without error
ok 568 - null array in array: CPAN::Meta::YAML does not modify the input string
ok 569 - The object isa CPAN::Meta::YAML
ok 570 - null array in array: CPAN::Meta::YAML parses correctly
ok 571 - null array in array: CPAN::Meta::YAML serializes without error
ok 572 - null array in array: CPAN::Meta::YAML serializes correctly
ok 573 - null array in array: CPAN::Meta::YAML round-trips without error
ok 574 - The object isa CPAN::Meta::YAML
ok 575 - null array in array: CPAN::Meta::YAML round-trips correctly
ok 576 # skip Shortcutting perfect serialization tests
ok 577 - null hash in hash: YAML.pm saves without error
ok 578 - null hash in hash: YAML.pm serializes correctly
ok 579 - null hash in hash: YAML.pm round-trips without error
ok 580 - null hash in hash: YAML.pm round-trips correctly
ok 581 - null hash in hash: YAML.pm loads without error
ok 582 - null hash in hash: YAML.pm does not modify the input string
ok 583 - null hash in hash: YAML.pm parses correctly
ok 584 - null hash in hash: YAML::Syck saves without error
ok 585 - null hash in hash: YAML::Syck serializes correctly
ok 586 - null hash in hash: YAML::Syck round-trips without error
ok 587 - null hash in hash: YAML::Syck round-trips correctly
ok 588 - null hash in hash: YAML::Syck loads without error
ok 589 - null hash in hash: YAML::Syck does not modify the input string
ok 590 - null hash in hash: YAML::Syck parses correctly
ok 591 - null hash in hash: YAML::XS saves without error
ok 592 - null hash in hash: YAML::XS serializes correctly
ok 593 - null hash in hash: YAML::XS round-trips without error
ok 594 - null hash in hash: YAML::XS round-trips correctly
ok 595 - null hash in hash: YAML::XS loads without error
ok 596 - null hash in hash: YAML::XS does not modify the input string
ok 597 - null hash in hash: YAML::XS parses correctly
ok 598 - null hash in hash: YAML::Perl saves without error
ok 599 - null hash in hash: YAML::Perl serializes correctly
ok 600 - null hash in hash: YAML::Perl round-trips without error
ok 601 - null hash in hash: YAML::Perl round-trips correctly
ok 602 - null hash in hash: YAML::Perl loads without error
ok 603 - null hash in hash: YAML::Perl does not modify the input string
ok 604 - null hash in hash: YAML::Perl parses correctly
ok 605 - null hash in hash: CPAN::Meta::YAML parses without error
ok 606 - null hash in hash: CPAN::Meta::YAML does not modify the input string
ok 607 - The object isa CPAN::Meta::YAML
ok 608 - null hash in hash: CPAN::Meta::YAML parses correctly
ok 609 - null hash in hash: CPAN::Meta::YAML serializes without error
ok 610 - null hash in hash: CPAN::Meta::YAML serializes correctly
ok 611 - null hash in hash: CPAN::Meta::YAML round-trips without error
ok 612 - The object isa CPAN::Meta::YAML
ok 613 - null hash in hash: CPAN::Meta::YAML round-trips correctly
ok 614 # skip Shortcutting perfect serialization tests
ok 615 - null array in hash: YAML.pm saves without error
ok 616 - null array in hash: YAML.pm serializes correctly
ok 617 - null array in hash: YAML.pm round-trips without error
ok 618 - null array in hash: YAML.pm round-trips correctly
ok 619 - null array in hash: YAML.pm loads without error
ok 620 - null array in hash: YAML.pm does not modify the input string
ok 621 - null array in hash: YAML.pm parses correctly
ok 622 - null array in hash: YAML::Syck saves without error
ok 623 - null array in hash: YAML::Syck serializes correctly
ok 624 - null array in hash: YAML::Syck round-trips without error
ok 625 - null array in hash: YAML::Syck round-trips correctly
ok 626 - null array in hash: YAML::Syck loads without error
ok 627 - null array in hash: YAML::Syck does not modify the input string
ok 628 - null array in hash: YAML::Syck parses correctly
ok 629 - null array in hash: YAML::XS saves without error
ok 630 - null array in hash: YAML::XS serializes correctly
ok 631 - null array in hash: YAML::XS round-trips without error
ok 632 - null array in hash: YAML::XS round-trips correctly
ok 633 - null array in hash: YAML::XS loads without error
ok 634 - null array in hash: YAML::XS does not modify the input string
ok 635 - null array in hash: YAML::XS parses correctly
ok 636 - null array in hash: YAML::Perl saves without error
ok 637 - null array in hash: YAML::Perl serializes correctly
ok 638 - null array in hash: YAML::Perl round-trips without error
ok 639 - null array in hash: YAML::Perl round-trips correctly
ok 640 - null array in hash: YAML::Perl loads without error
ok 641 - null array in hash: YAML::Perl does not modify the input string
ok 642 - null array in hash: YAML::Perl parses correctly
ok 643 - null array in hash: CPAN::Meta::YAML parses without error
ok 644 - null array in hash: CPAN::Meta::YAML does not modify the input string
ok 645 - The object isa CPAN::Meta::YAML
ok 646 - null array in hash: CPAN::Meta::YAML parses correctly
ok 647 - null array in hash: CPAN::Meta::YAML serializes without error
ok 648 - null array in hash: CPAN::Meta::YAML serializes correctly
ok 649 - null array in hash: CPAN::Meta::YAML round-trips without error
ok 650 - The object isa CPAN::Meta::YAML
ok 651 - null array in hash: CPAN::Meta::YAML round-trips correctly
ok 652 # skip Shortcutting perfect serialization tests
ok 653 - trailing whitespace: YAML.pm saves without error
ok 654 - trailing whitespace: YAML.pm serializes correctly
ok 655 - trailing whitespace: YAML.pm round-trips without error
ok 656 - trailing whitespace: YAML.pm round-trips correctly
ok 657 - trailing whitespace: YAML.pm loads without error
ok 658 - trailing whitespace: YAML.pm does not modify the input string
ok 659 - trailing whitespace: YAML.pm parses correctly
ok 660 - trailing whitespace: YAML::Syck saves without error
ok 661 - trailing whitespace: YAML::Syck serializes correctly
ok 662 - trailing whitespace: YAML::Syck round-trips without error
ok 663 - trailing whitespace: YAML::Syck round-trips correctly
ok 664 - trailing whitespace: YAML::Syck loads without error
ok 665 - trailing whitespace: YAML::Syck does not modify the input string
ok 666 - trailing whitespace: YAML::Syck parses correctly
ok 667 - trailing whitespace: YAML::XS saves without error
ok 668 - trailing whitespace: YAML::XS serializes correctly
ok 669 - trailing whitespace: YAML::XS round-trips without error
ok 670 - trailing whitespace: YAML::XS round-trips correctly
ok 671 - trailing whitespace: YAML::XS loads without error
ok 672 - trailing whitespace: YAML::XS does not modify the input string
ok 673 - trailing whitespace: YAML::XS parses correctly
ok 674 # skip Skipping YAML::Perl for known-broken feature
ok 675 # skip Skipping YAML::Perl for known-broken feature
ok 676 # skip Skipping YAML::Perl for known-broken feature
ok 677 # skip Skipping YAML::Perl for known-broken feature
ok 678 # skip Skipping YAML::Perl for known-broken feature
ok 679 # skip Skipping YAML::Perl for known-broken feature
ok 680 # skip Skipping YAML::Perl for known-broken feature
ok 681 - trailing whitespace: CPAN::Meta::YAML parses without error
ok 682 - trailing whitespace: CPAN::Meta::YAML does not modify the input string
ok 683 - The object isa CPAN::Meta::YAML
ok 684 - trailing whitespace: CPAN::Meta::YAML parses correctly
ok 685 - trailing whitespace: CPAN::Meta::YAML serializes without error
ok 686 - trailing whitespace: CPAN::Meta::YAML serializes correctly
ok 687 - trailing whitespace: CPAN::Meta::YAML round-trips without error
ok 688 - The object isa CPAN::Meta::YAML
ok 689 - trailing whitespace: CPAN::Meta::YAML round-trips correctly
ok 690 # skip Shortcutting perfect serialization tests
ok 691 - hash-like quote: YAML.pm saves without error
ok 692 - hash-like quote: YAML.pm serializes correctly
ok 693 - hash-like quote: YAML.pm round-trips without error
ok 694 - hash-like quote: YAML.pm round-trips correctly
ok 695 - hash-like quote: YAML.pm loads without error
ok 696 - hash-like quote: YAML.pm does not modify the input string
ok 697 - hash-like quote: YAML.pm parses correctly
ok 698 - hash-like quote: YAML::Syck saves without error
ok 699 - hash-like quote: YAML::Syck serializes correctly
ok 700 - hash-like quote: YAML::Syck round-trips without error
ok 701 - hash-like quote: YAML::Syck round-trips correctly
ok 702 - hash-like quote: YAML::Syck loads without error
ok 703 - hash-like quote: YAML::Syck does not modify the input string
ok 704 - hash-like quote: YAML::Syck parses correctly
ok 705 - hash-like quote: YAML::XS saves without error
ok 706 - hash-like quote: YAML::XS serializes correctly
ok 707 - hash-like quote: YAML::XS round-trips without error
ok 708 - hash-like quote: YAML::XS round-trips correctly
ok 709 - hash-like quote: YAML::XS loads without error
ok 710 - hash-like quote: YAML::XS does not modify the input string
ok 711 - hash-like quote: YAML::XS parses correctly
ok 712 - hash-like quote: YAML::Perl saves without error
ok 713 - hash-like quote: YAML::Perl serializes correctly
ok 714 - hash-like quote: YAML::Perl round-trips without error
ok 715 - hash-like quote: YAML::Perl round-trips correctly
ok 716 - hash-like quote: YAML::Perl loads without error
ok 717 - hash-like quote: YAML::Perl does not modify the input string
ok 718 - hash-like quote: YAML::Perl parses correctly
ok 719 - hash-like quote: CPAN::Meta::YAML parses without error
ok 720 - hash-like quote: CPAN::Meta::YAML does not modify the input string
ok 721 - The object isa CPAN::Meta::YAML
ok 722 - hash-like quote: CPAN::Meta::YAML parses correctly
ok 723 - hash-like quote: CPAN::Meta::YAML serializes without error
ok 724 - hash-like quote: CPAN::Meta::YAML serializes correctly
ok 725 - hash-like quote: CPAN::Meta::YAML round-trips without error
ok 726 - The object isa CPAN::Meta::YAML
ok 727 - hash-like quote: CPAN::Meta::YAML round-trips correctly
ok 728 # skip Shortcutting perfect serialization tests
ok 729 - single quote subtleties: YAML.pm saves without error
ok 730 - single quote subtleties: YAML.pm serializes correctly
ok 731 - single quote subtleties: YAML.pm round-trips without error
ok 732 - single quote subtleties: YAML.pm round-trips correctly
ok 733 - single quote subtleties: YAML.pm loads without error
ok 734 - single quote subtleties: YAML.pm does not modify the input string
ok 735 - single quote subtleties: YAML.pm parses correctly
ok 736 - single quote subtleties: YAML::Syck saves without error
ok 737 - single quote subtleties: YAML::Syck serializes correctly
ok 738 - single quote subtleties: YAML::Syck round-trips without error
ok 739 - single quote subtleties: YAML::Syck round-trips correctly
ok 740 - single quote subtleties: YAML::Syck loads without error
ok 741 - single quote subtleties: YAML::Syck does not modify the input string
ok 742 - single quote subtleties: YAML::Syck parses correctly
ok 743 - single quote subtleties: YAML::XS saves without error
ok 744 - single quote subtleties: YAML::XS serializes correctly
ok 745 - single quote subtleties: YAML::XS round-trips without error
ok 746 - single quote subtleties: YAML::XS round-trips correctly
ok 747 - single quote subtleties: YAML::XS loads without error
ok 748 - single quote subtleties: YAML::XS does not modify the input string
ok 749 - single quote subtleties: YAML::XS parses correctly
ok 750 - single quote subtleties: YAML::Perl saves without error
ok 751 - single quote subtleties: YAML::Perl serializes correctly
ok 752 - single quote subtleties: YAML::Perl round-trips without error
ok 753 - single quote subtleties: YAML::Perl round-trips correctly
ok 754 - single quote subtleties: YAML::Perl loads without error
ok 755 - single quote subtleties: YAML::Perl does not modify the input string
ok 756 - single quote subtleties: YAML::Perl parses correctly
ok 757 - single quote subtleties: CPAN::Meta::YAML parses without error
ok 758 - single quote subtleties: CPAN::Meta::YAML does not modify the input string
ok 759 - The object isa CPAN::Meta::YAML
ok 760 - single quote subtleties: CPAN::Meta::YAML parses correctly
ok 761 - single quote subtleties: CPAN::Meta::YAML serializes without error
ok 762 - single quote subtleties: CPAN::Meta::YAML serializes correctly
ok 763 - single quote subtleties: CPAN::Meta::YAML round-trips without error
ok 764 - The object isa CPAN::Meta::YAML
ok 765 - single quote subtleties: CPAN::Meta::YAML round-trips correctly
ok 766 # skip Shortcutting perfect serialization tests
ok 767 - single quote subtleties: YAML.pm saves without error
ok 768 - single quote subtleties: YAML.pm serializes correctly
ok 769 - single quote subtleties: YAML.pm round-trips without error
ok 770 - single quote subtleties: YAML.pm round-trips correctly
ok 771 - single quote subtleties: YAML.pm loads without error
ok 772 - single quote subtleties: YAML.pm does not modify the input string
ok 773 - single quote subtleties: YAML.pm parses correctly
ok 774 - single quote subtleties: YAML::Syck saves without error
ok 775 - single quote subtleties: YAML::Syck serializes correctly
ok 776 - single quote subtleties: YAML::Syck round-trips without error
ok 777 - single quote subtleties: YAML::Syck round-trips correctly
ok 778 - single quote subtleties: YAML::Syck loads without error
ok 779 - single quote subtleties: YAML::Syck does not modify the input string
ok 780 - single quote subtleties: YAML::Syck parses correctly
ok 781 - single quote subtleties: YAML::XS saves without error
ok 782 - single quote subtleties: YAML::XS serializes correctly
ok 783 - single quote subtleties: YAML::XS round-trips without error
ok 784 - single quote subtleties: YAML::XS round-trips correctly
ok 785 - single quote subtleties: YAML::XS loads without error
ok 786 - single quote subtleties: YAML::XS does not modify the input string
ok 787 - single quote subtleties: YAML::XS parses correctly
ok 788 - single quote subtleties: YAML::Perl saves without error
ok 789 - single quote subtleties: YAML::Perl serializes correctly
ok 790 - single quote subtleties: YAML::Perl round-trips without error
ok 791 - single quote subtleties: YAML::Perl round-trips correctly
ok 792 - single quote subtleties: YAML::Perl loads without error
ok 793 - single quote subtleties: YAML::Perl does not modify the input string
ok 794 - single quote subtleties: YAML::Perl parses correctly
ok 795 - single quote subtleties: CPAN::Meta::YAML parses without error
ok 796 - single quote subtleties: CPAN::Meta::YAML does not modify the input string
ok 797 - The object isa CPAN::Meta::YAML
ok 798 - single quote subtleties: CPAN::Meta::YAML parses correctly
ok 799 - single quote subtleties: CPAN::Meta::YAML serializes without error
ok 800 - single quote subtleties: CPAN::Meta::YAML serializes correctly
ok 801 - single quote subtleties: CPAN::Meta::YAML round-trips without error
ok 802 - The object isa CPAN::Meta::YAML
ok 803 - single quote subtleties: CPAN::Meta::YAML round-trips correctly
ok 804 # skip Shortcutting perfect serialization tests
ok 805 # skip Skipping YAML.pm for known-broken feature
ok 806 # skip Skipping YAML.pm for known-broken feature
ok 807 # skip Skipping YAML.pm for known-broken feature
ok 808 # skip Skipping YAML.pm for known-broken feature
ok 809 # skip Skipping YAML.pm for known-broken feature
ok 810 # skip Skipping YAML.pm for known-broken feature
ok 811 # skip Skipping YAML.pm for known-broken feature
ok 812 - empty hash keys: YAML::Syck saves without error
ok 813 - empty hash keys: YAML::Syck serializes correctly
ok 814 - empty hash keys: YAML::Syck round-trips without error
ok 815 - empty hash keys: YAML::Syck round-trips correctly
ok 816 - empty hash keys: YAML::Syck loads without error
ok 817 - empty hash keys: YAML::Syck does not modify the input string
ok 818 - empty hash keys: YAML::Syck parses correctly
ok 819 - empty hash keys: YAML::XS saves without error
ok 820 - empty hash keys: YAML::XS serializes correctly
ok 821 - empty hash keys: YAML::XS round-trips without error
ok 822 - empty hash keys: YAML::XS round-trips correctly
ok 823 - empty hash keys: YAML::XS loads without error
ok 824 - empty hash keys: YAML::XS does not modify the input string
ok 825 - empty hash keys: YAML::XS parses correctly
ok 826 # skip Skipping YAML::Perl for known-broken feature
ok 827 # skip Skipping YAML::Perl for known-broken feature
ok 828 # skip Skipping YAML::Perl for known-broken feature
ok 829 # skip Skipping YAML::Perl for known-broken feature
ok 830 # skip Skipping YAML::Perl for known-broken feature
ok 831 # skip Skipping YAML::Perl for known-broken feature
ok 832 # skip Skipping YAML::Perl for known-broken feature
ok 833 - empty hash keys: CPAN::Meta::YAML parses without error
ok 834 - empty hash keys: CPAN::Meta::YAML does not modify the input string
ok 835 - The object isa CPAN::Meta::YAML
ok 836 - empty hash keys: CPAN::Meta::YAML parses correctly
ok 837 - empty hash keys: CPAN::Meta::YAML serializes without error
ok 838 - empty hash keys: CPAN::Meta::YAML serializes correctly
ok 839 - empty hash keys: CPAN::Meta::YAML round-trips without error
ok 840 - The object isa CPAN::Meta::YAML
ok 841 - empty hash keys: CPAN::Meta::YAML round-trips correctly
ok 842 # skip Shortcutting perfect serialization tests
ok 843 # skip Skipping YAML.pm for known-broken feature
ok 844 # skip Skipping YAML.pm for known-broken feature
ok 845 # skip Skipping YAML.pm for known-broken feature
ok 846 # skip Skipping YAML.pm for known-broken feature
ok 847 # skip Skipping YAML.pm for known-broken feature
ok 848 # skip Skipping YAML.pm for known-broken feature
ok 849 # skip Skipping YAML.pm for known-broken feature
ok 850 - empty array keys: YAML::Syck saves without error
ok 851 - empty array keys: YAML::Syck serializes correctly
ok 852 - empty array keys: YAML::Syck round-trips without error
ok 853 - empty array keys: YAML::Syck round-trips correctly
ok 854 - empty array keys: YAML::Syck loads without error
ok 855 - empty array keys: YAML::Syck does not modify the input string
ok 856 - empty array keys: YAML::Syck parses correctly
ok 857 - empty array keys: YAML::XS saves without error
ok 858 - empty array keys: YAML::XS serializes correctly
ok 859 - empty array keys: YAML::XS round-trips without error
ok 860 - empty array keys: YAML::XS round-trips correctly
ok 861 - empty array keys: YAML::XS loads without error
ok 862 - empty array keys: YAML::XS does not modify the input string
ok 863 - empty array keys: YAML::XS parses correctly
ok 864 # skip Skipping YAML::Perl for known-broken feature
ok 865 # skip Skipping YAML::Perl for known-broken feature
ok 866 # skip Skipping YAML::Perl for known-broken feature
ok 867 # skip Skipping YAML::Perl for known-broken feature
ok 868 # skip Skipping YAML::Perl for known-broken feature
ok 869 # skip Skipping YAML::Perl for known-broken feature
ok 870 # skip Skipping YAML::Perl for known-broken feature
ok 871 - empty array keys: CPAN::Meta::YAML parses without error
ok 872 - empty array keys: CPAN::Meta::YAML does not modify the input string
ok 873 - The object isa CPAN::Meta::YAML
ok 874 - empty array keys: CPAN::Meta::YAML parses correctly
ok 875 - empty array keys: CPAN::Meta::YAML serializes without error
ok 876 - empty array keys: CPAN::Meta::YAML serializes correctly
ok 877 - empty array keys: CPAN::Meta::YAML round-trips without error
ok 878 - The object isa CPAN::Meta::YAML
ok 879 - empty array keys: CPAN::Meta::YAML round-trips correctly
ok 880 # skip Shortcutting perfect serialization tests
ok 881 # skip Skipping YAML.pm for known-broken feature
ok 882 # skip Skipping YAML.pm for known-broken feature
ok 883 # skip Skipping YAML.pm for known-broken feature
ok 884 # skip Skipping YAML.pm for known-broken feature
ok 885 # skip Skipping YAML.pm for known-broken feature
ok 886 # skip Skipping YAML.pm for known-broken feature
ok 887 # skip Skipping YAML.pm for known-broken feature
ok 888 - comment header: YAML::Syck saves without error
ok 889 - comment header: YAML::Syck serializes correctly
ok 890 - comment header: YAML::Syck round-trips without error
ok 891 - comment header: YAML::Syck round-trips correctly
ok 892 - comment header: YAML::Syck loads without error
ok 893 - comment header: YAML::Syck does not modify the input string
ok 894 - comment header: YAML::Syck parses correctly
ok 895 - comment header: YAML::XS saves without error
ok 896 - comment header: YAML::XS serializes correctly
ok 897 - comment header: YAML::XS round-trips without error
ok 898 - comment header: YAML::XS round-trips correctly
ok 899 - comment header: YAML::XS loads without error
ok 900 - comment header: YAML::XS does not modify the input string
ok 901 - comment header: YAML::XS parses correctly
ok 902 # skip Skipping YAML::Perl for known-broken feature
ok 903 # skip Skipping YAML::Perl for known-broken feature
ok 904 # skip Skipping YAML::Perl for known-broken feature
ok 905 # skip Skipping YAML::Perl for known-broken feature
ok 906 # skip Skipping YAML::Perl for known-broken feature
ok 907 # skip Skipping YAML::Perl for known-broken feature
ok 908 # skip Skipping YAML::Perl for known-broken feature
ok 909 - comment header: CPAN::Meta::YAML parses without error
ok 910 - comment header: CPAN::Meta::YAML does not modify the input string
ok 911 - The object isa CPAN::Meta::YAML
ok 912 - comment header: CPAN::Meta::YAML parses correctly
ok 913 - comment header: CPAN::Meta::YAML serializes without error
ok 914 - comment header: CPAN::Meta::YAML serializes correctly
ok 915 - comment header: CPAN::Meta::YAML round-trips without error
ok 916 - The object isa CPAN::Meta::YAML
ok 917 - comment header: CPAN::Meta::YAML round-trips correctly
ok 918 # skip Shortcutting perfect serialization tests
ok 919 - special characters: YAML.pm saves without error
ok 920 - special characters: YAML.pm serializes correctly
ok 921 - special characters: YAML.pm round-trips without error
ok 922 - special characters: YAML.pm round-trips correctly
ok 923 - special characters: YAML.pm loads without error
ok 924 - special characters: YAML.pm does not modify the input string
ok 925 - special characters: YAML.pm parses correctly
ok 926 - special characters: YAML::Syck saves without error
ok 927 - special characters: YAML::Syck serializes correctly
ok 928 - special characters: YAML::Syck round-trips without error
ok 929 - special characters: YAML::Syck round-trips correctly
ok 930 - special characters: YAML::Syck loads without error
ok 931 - special characters: YAML::Syck does not modify the input string
ok 932 - special characters: YAML::Syck parses correctly
ok 933 - special characters: YAML::XS saves without error
ok 934 - special characters: YAML::XS serializes correctly
ok 935 - special characters: YAML::XS round-trips without error
ok 936 - special characters: YAML::XS round-trips correctly
ok 937 - special characters: YAML::XS loads without error
ok 938 - special characters: YAML::XS does not modify the input string
ok 939 - special characters: YAML::XS parses correctly
ok 940 - special characters: YAML::Perl saves without error
ok 941 - special characters: YAML::Perl serializes correctly
ok 942 - special characters: YAML::Perl round-trips without error
ok 943 - special characters: YAML::Perl round-trips correctly
ok 944 - special characters: YAML::Perl loads without error
ok 945 - special characters: YAML::Perl does not modify the input string
ok 946 - special characters: YAML::Perl parses correctly
ok 947 - special characters: CPAN::Meta::YAML parses without error
ok 948 - special characters: CPAN::Meta::YAML does not modify the input string
ok 949 - The object isa CPAN::Meta::YAML
ok 950 - special characters: CPAN::Meta::YAML parses correctly
ok 951 - special characters: CPAN::Meta::YAML serializes without error
ok 952 - special characters: CPAN::Meta::YAML serializes correctly
ok 953 - special characters: CPAN::Meta::YAML round-trips without error
ok 954 - The object isa CPAN::Meta::YAML
ok 955 - special characters: CPAN::Meta::YAML round-trips correctly
ok 956 # skip Shortcutting perfect serialization tests
ok 957 - The object isa CPAN::Meta::YAML
ok 958 - ->write_string does not return a value
ok 959 - Error string is defined
ok 960 - Got the expected error message
ok 961 - synopsis: YAML.pm saves without error
ok 962 - synopsis: YAML.pm serializes correctly
ok 963 - synopsis: YAML.pm round-trips without error
ok 964 - synopsis: YAML.pm round-trips correctly
ok 965 - synopsis: YAML.pm loads without error
ok 966 - synopsis: YAML.pm does not modify the input string
ok 967 - synopsis: YAML.pm parses correctly
ok 968 - synopsis: YAML::Syck saves without error
ok 969 - synopsis: YAML::Syck serializes correctly
ok 970 - synopsis: YAML::Syck round-trips without error
ok 971 - synopsis: YAML::Syck round-trips correctly
ok 972 - synopsis: YAML::Syck loads without error
ok 973 - synopsis: YAML::Syck does not modify the input string
ok 974 - synopsis: YAML::Syck parses correctly
ok 975 - synopsis: YAML::XS saves without error
ok 976 - synopsis: YAML::XS serializes correctly
ok 977 - synopsis: YAML::XS round-trips without error
ok 978 - synopsis: YAML::XS round-trips correctly
ok 979 - synopsis: YAML::XS loads without error
ok 980 - synopsis: YAML::XS does not modify the input string
ok 981 - synopsis: YAML::XS parses correctly
ok 982 # skip Skipping YAML::Perl for known-broken feature
ok 983 # skip Skipping YAML::Perl for known-broken feature
ok 984 # skip Skipping YAML::Perl for known-broken feature
ok 985 # skip Skipping YAML::Perl for known-broken feature
ok 986 # skip Skipping YAML::Perl for known-broken feature
ok 987 # skip Skipping YAML::Perl for known-broken feature
ok 988 # skip Skipping YAML::Perl for known-broken feature
ok 989 - synopsis: CPAN::Meta::YAML parses without error
ok 990 - synopsis: CPAN::Meta::YAML does not modify the input string
ok 991 - The object isa CPAN::Meta::YAML
ok 992 - synopsis: CPAN::Meta::YAML parses correctly
ok 993 - synopsis: CPAN::Meta::YAML serializes without error
ok 994 - synopsis: CPAN::Meta::YAML serializes correctly
ok 995 - synopsis: CPAN::Meta::YAML round-trips without error
ok 996 - The object isa CPAN::Meta::YAML
ok 997 - synopsis: CPAN::Meta::YAML round-trips correctly
ok 998 # skip Shortcutting perfect serialization tests
ok 999 - unprintable: YAML.pm saves without error
ok 1000 - unprintable: YAML.pm serializes correctly
ok 1001 - unprintable: YAML.pm round-trips without error
ok 1002 - unprintable: YAML.pm round-trips correctly
ok 1003 - unprintable: YAML.pm loads without error
ok 1004 - unprintable: YAML.pm does not modify the input string
ok 1005 - unprintable: YAML.pm parses correctly
ok 1006 - unprintable: YAML::Syck saves without error
ok 1007 - unprintable: YAML::Syck serializes correctly
ok 1008 - unprintable: YAML::Syck round-trips without error
ok 1009 - unprintable: YAML::Syck round-trips correctly
ok 1010 - unprintable: YAML::Syck loads without error
ok 1011 - unprintable: YAML::Syck does not modify the input string
ok 1012 - unprintable: YAML::Syck parses correctly
ok 1013 - unprintable: YAML::XS saves without error
ok 1014 - unprintable: YAML::XS serializes correctly
ok 1015 - unprintable: YAML::XS round-trips without error
ok 1016 - unprintable: YAML::XS round-trips correctly
ok 1017 - unprintable: YAML::XS loads without error
ok 1018 - unprintable: YAML::XS does not modify the input string
ok 1019 - unprintable: YAML::XS parses correctly
ok 1020 - unprintable: YAML::Perl saves without error
ok 1021 - unprintable: YAML::Perl serializes correctly
ok 1022 - unprintable: YAML::Perl round-trips without error
ok 1023 - unprintable: YAML::Perl round-trips correctly
ok 1024 - unprintable: YAML::Perl loads without error
ok 1025 - unprintable: YAML::Perl does not modify the input string
ok 1026 - unprintable: YAML::Perl parses correctly
ok 1027 - unprintable: CPAN::Meta::YAML parses without error
ok 1028 - unprintable: CPAN::Meta::YAML does not modify the input string
ok 1029 - The object isa CPAN::Meta::YAML
ok 1030 - unprintable: CPAN::Meta::YAML parses correctly
ok 1031 - unprintable: CPAN::Meta::YAML serializes without error
ok 1032 - unprintable: CPAN::Meta::YAML serializes correctly
ok 1033 - unprintable: CPAN::Meta::YAML round-trips without error
ok 1034 - The object isa CPAN::Meta::YAML
ok 1035 - unprintable: CPAN::Meta::YAML round-trips correctly
ok 1036 # skip Shortcutting perfect serialization tests
ok 1037 - unnamed: YAML.pm saves without error
ok 1038 - unnamed: YAML.pm serializes correctly
ok 1039 - unnamed: YAML.pm round-trips without error
ok 1040 - unnamed: YAML.pm round-trips correctly
ok 1041 - unnamed: YAML.pm loads without error
ok 1042 - unnamed: YAML.pm does not modify the input string
ok 1043 - unnamed: YAML.pm parses correctly
ok 1044 - unnamed: YAML::Syck saves without error
ok 1045 - unnamed: YAML::Syck serializes correctly
ok 1046 - unnamed: YAML::Syck round-trips without error
ok 1047 - unnamed: YAML::Syck round-trips correctly
ok 1048 - unnamed: YAML::Syck loads without error
ok 1049 - unnamed: YAML::Syck does not modify the input string
ok 1050 - unnamed: YAML::Syck parses correctly
ok 1051 - unnamed: YAML::XS saves without error
ok 1052 - unnamed: YAML::XS serializes correctly
ok 1053 - unnamed: YAML::XS round-trips without error
ok 1054 - unnamed: YAML::XS round-trips correctly
ok 1055 - unnamed: YAML::XS loads without error
ok 1056 - unnamed: YAML::XS does not modify the input string
ok 1057 - unnamed: YAML::XS parses correctly
ok 1058 - unnamed: YAML::Perl saves without error
ok 1059 - unnamed: YAML::Perl serializes correctly
ok 1060 - unnamed: YAML::Perl round-trips without error
ok 1061 - unnamed: YAML::Perl round-trips correctly
ok 1062 - unnamed: YAML::Perl loads without error
ok 1063 - unnamed: YAML::Perl does not modify the input string
ok 1064 - unnamed: YAML::Perl parses correctly
ok 1065 - unnamed: CPAN::Meta::YAML parses without error
ok 1066 - unnamed: CPAN::Meta::YAML does not modify the input string
ok 1067 - The object isa CPAN::Meta::YAML
ok 1068 - unnamed: CPAN::Meta::YAML parses correctly
ok 1069 - unnamed: CPAN::Meta::YAML serializes without error
ok 1070 - unnamed: CPAN::Meta::YAML serializes correctly
ok 1071 - unnamed: CPAN::Meta::YAML round-trips without error
ok 1072 - The object isa CPAN::Meta::YAML
ok 1073 - unnamed: CPAN::Meta::YAML round-trips correctly
ok 1074 # skip Shortcutting perfect serialization tests
ok 1075 - Indentation after empty hash value: YAML.pm saves without error
ok 1076 - Indentation after empty hash value: YAML.pm serializes correctly
ok 1077 - Indentation after empty hash value: YAML.pm round-trips without error
ok 1078 - Indentation after empty hash value: YAML.pm round-trips correctly
ok 1079 - Indentation after empty hash value: YAML.pm loads without error
ok 1080 - Indentation after empty hash value: YAML.pm does not modify the input string
ok 1081 - Indentation after empty hash value: YAML.pm parses correctly
ok 1082 - Indentation after empty hash value: YAML::Syck saves without error
ok 1083 - Indentation after empty hash value: YAML::Syck serializes correctly
ok 1084 - Indentation after empty hash value: YAML::Syck round-trips without error
ok 1085 - Indentation after empty hash value: YAML::Syck round-trips correctly
ok 1086 - Indentation after empty hash value: YAML::Syck loads without error
ok 1087 - Indentation after empty hash value: YAML::Syck does not modify the input string
ok 1088 - Indentation after empty hash value: YAML::Syck parses correctly
ok 1089 - Indentation after empty hash value: YAML::XS saves without error
ok 1090 - Indentation after empty hash value: YAML::XS serializes correctly
ok 1091 - Indentation after empty hash value: YAML::XS round-trips without error
ok 1092 - Indentation after empty hash value: YAML::XS round-trips correctly
ok 1093 - Indentation after empty hash value: YAML::XS loads without error
ok 1094 - Indentation after empty hash value: YAML::XS does not modify the input string
ok 1095 - Indentation after empty hash value: YAML::XS parses correctly
ok 1096 # skip Skipping YAML::Perl for known-broken feature
ok 1097 # skip Skipping YAML::Perl for known-broken feature
ok 1098 # skip Skipping YAML::Perl for known-broken feature
ok 1099 # skip Skipping YAML::Perl for known-broken feature
ok 1100 # skip Skipping YAML::Perl for known-broken feature
ok 1101 # skip Skipping YAML::Perl for known-broken feature
ok 1102 # skip Skipping YAML::Perl for known-broken feature
ok 1103 - Indentation after empty hash value: CPAN::Meta::YAML parses without error
ok 1104 - Indentation after empty hash value: CPAN::Meta::YAML does not modify the input string
ok 1105 - The object isa CPAN::Meta::YAML
ok 1106 - Indentation after empty hash value: CPAN::Meta::YAML parses correctly
ok 1107 - Indentation after empty hash value: CPAN::Meta::YAML serializes without error
ok 1108 - Indentation after empty hash value: CPAN::Meta::YAML serializes correctly
ok 1109 - Indentation after empty hash value: CPAN::Meta::YAML round-trips without error
ok 1110 - The object isa CPAN::Meta::YAML
ok 1111 - Indentation after empty hash value: CPAN::Meta::YAML round-trips correctly
ok 1112 # skip Shortcutting perfect serialization tests
ok 1113 - unnamed: YAML.pm saves without error
ok 1114 - unnamed: YAML.pm serializes correctly
ok 1115 - unnamed: YAML.pm round-trips without error
ok 1116 - unnamed: YAML.pm round-trips correctly
ok 1117 - unnamed: YAML.pm loads without error
ok 1118 - unnamed: YAML.pm does not modify the input string
ok 1119 - unnamed: YAML.pm parses correctly
ok 1120 - unnamed: YAML::Syck saves without error
ok 1121 - unnamed: YAML::Syck serializes correctly
ok 1122 - unnamed: YAML::Syck round-trips without error
ok 1123 - unnamed: YAML::Syck round-trips correctly
ok 1124 - unnamed: YAML::Syck loads without error
ok 1125 - unnamed: YAML::Syck does not modify the input string
ok 1126 - unnamed: YAML::Syck parses correctly
ok 1127 - unnamed: YAML::XS saves without error
ok 1128 - unnamed: YAML::XS serializes correctly
ok 1129 - unnamed: YAML::XS round-trips without error
ok 1130 - unnamed: YAML::XS round-trips correctly
ok 1131 - unnamed: YAML::XS loads without error
ok 1132 - unnamed: YAML::XS does not modify the input string
ok 1133 - unnamed: YAML::XS parses correctly
ok 1134 - unnamed: YAML::Perl saves without error
ok 1135 - unnamed: YAML::Perl serializes correctly
ok 1136 - unnamed: YAML::Perl round-trips without error
ok 1137 - unnamed: YAML::Perl round-trips correctly
ok 1138 - unnamed: YAML::Perl loads without error
ok 1139 - unnamed: YAML::Perl does not modify the input string
ok 1140 - unnamed: YAML::Perl parses correctly
ok 1141 - unnamed: CPAN::Meta::YAML parses without error
ok 1142 - unnamed: CPAN::Meta::YAML does not modify the input string
ok 1143 - The object isa CPAN::Meta::YAML
ok 1144 - unnamed: CPAN::Meta::YAML parses correctly
ok 1145 - unnamed: CPAN::Meta::YAML serializes without error
ok 1146 - unnamed: CPAN::Meta::YAML serializes correctly
ok 1147 - unnamed: CPAN::Meta::YAML round-trips without error
ok 1148 - The object isa CPAN::Meta::YAML
ok 1149 - unnamed: CPAN::Meta::YAML round-trips correctly
ok 1150 # skip Shortcutting perfect serialization tests
ok 1151 - Pathological >< case: YAML.pm saves without error
ok 1152 - Pathological >< case: YAML.pm serializes correctly
ok 1153 - Pathological >< case: YAML.pm round-trips without error
ok 1154 - Pathological >< case: YAML.pm round-trips correctly
ok 1155 - Pathological >< case: YAML.pm loads without error
ok 1156 - Pathological >< case: YAML.pm does not modify the input string
ok 1157 - Pathological >< case: YAML.pm parses correctly
ok 1158 - Pathological >< case: YAML::Syck saves without error
ok 1159 - Pathological >< case: YAML::Syck serializes correctly
ok 1160 - Pathological >< case: YAML::Syck round-trips without error
ok 1161 - Pathological >< case: YAML::Syck round-trips correctly
ok 1162 - Pathological >< case: YAML::Syck loads without error
ok 1163 - Pathological >< case: YAML::Syck does not modify the input string
ok 1164 - Pathological >< case: YAML::Syck parses correctly
ok 1165 - Pathological >< case: YAML::XS saves without error
ok 1166 - Pathological >< case: YAML::XS serializes correctly
ok 1167 - Pathological >< case: YAML::XS round-trips without error
ok 1168 - Pathological >< case: YAML::XS round-trips correctly
ok 1169 - Pathological >< case: YAML::XS loads without error
ok 1170 - Pathological >< case: YAML::XS does not modify the input string
ok 1171 - Pathological >< case: YAML::XS parses correctly
ok 1172 - Pathological >< case: YAML::Perl saves without error
ok 1173 - Pathological >< case: YAML::Perl serializes correctly
ok 1174 - Pathological >< case: YAML::Perl round-trips without error
ok 1175 - Pathological >< case: YAML::Perl round-trips correctly
ok 1176 - Pathological >< case: YAML::Perl loads without error
ok 1177 - Pathological >< case: YAML::Perl does not modify the input string
ok 1178 - Pathological >< case: YAML::Perl parses correctly
ok 1179 - Pathological >< case: CPAN::Meta::YAML parses without error
ok 1180 - Pathological >< case: CPAN::Meta::YAML does not modify the input string
ok 1181 - The object isa CPAN::Meta::YAML
ok 1182 - Pathological >< case: CPAN::Meta::YAML parses correctly
ok 1183 - Pathological >< case: CPAN::Meta::YAML serializes without error
ok 1184 - Pathological >< case: CPAN::Meta::YAML serializes correctly
ok 1185 - Pathological >< case: CPAN::Meta::YAML round-trips without error
ok 1186 - The object isa CPAN::Meta::YAML
ok 1187 - Pathological >< case: CPAN::Meta::YAML round-trips correctly
ok 1188 # skip Shortcutting perfect serialization tests
ok 1189 # skip Skipping YAML.pm for known-broken feature
ok 1190 # skip Skipping YAML.pm for known-broken feature
ok 1191 # skip Skipping YAML.pm for known-broken feature
ok 1192 # skip Skipping YAML.pm for known-broken feature
ok 1193 # skip Skipping YAML.pm for known-broken feature
ok 1194 # skip Skipping YAML.pm for known-broken feature
ok 1195 # skip Skipping YAML.pm for known-broken feature
ok 1196 - Non-indenting sub-list: YAML::Syck saves without error
ok 1197 - Non-indenting sub-list: YAML::Syck serializes correctly
ok 1198 - Non-indenting sub-list: YAML::Syck round-trips without error
ok 1199 - Non-indenting sub-list: YAML::Syck round-trips correctly
ok 1200 - Non-indenting sub-list: YAML::Syck loads without error
ok 1201 - Non-indenting sub-list: YAML::Syck does not modify the input string
ok 1202 - Non-indenting sub-list: YAML::Syck parses correctly
ok 1203 - Non-indenting sub-list: YAML::XS saves without error
ok 1204 - Non-indenting sub-list: YAML::XS serializes correctly
ok 1205 - Non-indenting sub-list: YAML::XS round-trips without error
ok 1206 - Non-indenting sub-list: YAML::XS round-trips correctly
ok 1207 - Non-indenting sub-list: YAML::XS loads without error
ok 1208 - Non-indenting sub-list: YAML::XS does not modify the input string
ok 1209 - Non-indenting sub-list: YAML::XS parses correctly
ok 1210 # skip Skipping YAML::Perl for known-broken feature
ok 1211 # skip Skipping YAML::Perl for known-broken feature
ok 1212 # skip Skipping YAML::Perl for known-broken feature
ok 1213 # skip Skipping YAML::Perl for known-broken feature
ok 1214 # skip Skipping YAML::Perl for known-broken feature
ok 1215 # skip Skipping YAML::Perl for known-broken feature
ok 1216 # skip Skipping YAML::Perl for known-broken feature
ok 1217 - Non-indenting sub-list: CPAN::Meta::YAML parses without error
ok 1218 - Non-indenting sub-list: CPAN::Meta::YAML does not modify the input string
ok 1219 - The object isa CPAN::Meta::YAML
ok 1220 - Non-indenting sub-list: CPAN::Meta::YAML parses correctly
ok 1221 - Non-indenting sub-list: CPAN::Meta::YAML serializes without error
ok 1222 - Non-indenting sub-list: CPAN::Meta::YAML serializes correctly
ok 1223 - Non-indenting sub-list: CPAN::Meta::YAML round-trips without error
ok 1224 - The object isa CPAN::Meta::YAML
ok 1225 - Non-indenting sub-list: CPAN::Meta::YAML round-trips correctly
ok 1226 # skip Shortcutting perfect serialization tests
ok 1227 - Multiple escaping of quote ok: YAML.pm saves without error
ok 1228 - Multiple escaping of quote ok: YAML.pm serializes correctly
ok 1229 - Multiple escaping of quote ok: YAML.pm round-trips without error
ok 1230 - Multiple escaping of quote ok: YAML.pm round-trips correctly
ok 1231 - Multiple escaping of quote ok: YAML.pm loads without error
ok 1232 - Multiple escaping of quote ok: YAML.pm does not modify the input string
ok 1233 - Multiple escaping of quote ok: YAML.pm parses correctly
ok 1234 - Multiple escaping of quote ok: YAML::Syck saves without error
ok 1235 - Multiple escaping of quote ok: YAML::Syck serializes correctly
ok 1236 - Multiple escaping of quote ok: YAML::Syck round-trips without error
ok 1237 - Multiple escaping of quote ok: YAML::Syck round-trips correctly
ok 1238 - Multiple escaping of quote ok: YAML::Syck loads without error
ok 1239 - Multiple escaping of quote ok: YAML::Syck does not modify the input string
ok 1240 - Multiple escaping of quote ok: YAML::Syck parses correctly
ok 1241 - Multiple escaping of quote ok: YAML::XS saves without error
ok 1242 - Multiple escaping of quote ok: YAML::XS serializes correctly
ok 1243 - Multiple escaping of quote ok: YAML::XS round-trips without error
ok 1244 - Multiple escaping of quote ok: YAML::XS round-trips correctly
ok 1245 - Multiple escaping of quote ok: YAML::XS loads without error
ok 1246 - Multiple escaping of quote ok: YAML::XS does not modify the input string
ok 1247 - Multiple escaping of quote ok: YAML::XS parses correctly
ok 1248 - Multiple escaping of quote ok: YAML::Perl saves without error
ok 1249 - Multiple escaping of quote ok: YAML::Perl serializes correctly
ok 1250 - Multiple escaping of quote ok: YAML::Perl round-trips without error
ok 1251 - Multiple escaping of quote ok: YAML::Perl round-trips correctly
ok 1252 - Multiple escaping of quote ok: YAML::Perl loads without error
ok 1253 - Multiple escaping of quote ok: YAML::Perl does not modify the input string
ok 1254 - Multiple escaping of quote ok: YAML::Perl parses correctly
ok 1255 - Multiple escaping of quote ok: CPAN::Meta::YAML parses without error
ok 1256 - Multiple escaping of quote ok: CPAN::Meta::YAML does not modify the input string
ok 1257 - The object isa CPAN::Meta::YAML
ok 1258 - Multiple escaping of quote ok: CPAN::Meta::YAML parses correctly
ok 1259 - Multiple escaping of quote ok: CPAN::Meta::YAML serializes without error
ok 1260 - Multiple escaping of quote ok: CPAN::Meta::YAML serializes correctly
ok 1261 - Multiple escaping of quote ok: CPAN::Meta::YAML round-trips without error
ok 1262 - The object isa CPAN::Meta::YAML
ok 1263 - Multiple escaping of quote ok: CPAN::Meta::YAML round-trips correctly
ok 1264 # skip Shortcutting perfect serialization tests
ok 1265 - Multiple escaping of escape ok: YAML.pm saves without error
ok 1266 - Multiple escaping of escape ok: YAML.pm serializes correctly
ok 1267 - Multiple escaping of escape ok: YAML.pm round-trips without error
ok 1268 - Multiple escaping of escape ok: YAML.pm round-trips correctly
ok 1269 - Multiple escaping of escape ok: YAML.pm loads without error
ok 1270 - Multiple escaping of escape ok: YAML.pm does not modify the input string
ok 1271 - Multiple escaping of escape ok: YAML.pm parses correctly
ok 1272 - Multiple escaping of escape ok: YAML::Syck saves without error
ok 1273 - Multiple escaping of escape ok: YAML::Syck serializes correctly
ok 1274 - Multiple escaping of escape ok: YAML::Syck round-trips without error
ok 1275 - Multiple escaping of escape ok: YAML::Syck round-trips correctly
ok 1276 - Multiple escaping of escape ok: YAML::Syck loads without error
ok 1277 - Multiple escaping of escape ok: YAML::Syck does not modify the input string
ok 1278 - Multiple escaping of escape ok: YAML::Syck parses correctly
ok 1279 - Multiple escaping of escape ok: YAML::XS saves without error
ok 1280 - Multiple escaping of escape ok: YAML::XS serializes correctly
ok 1281 - Multiple escaping of escape ok: YAML::XS round-trips without error
ok 1282 - Multiple escaping of escape ok: YAML::XS round-trips correctly
ok 1283 - Multiple escaping of escape ok: YAML::XS loads without error
ok 1284 - Multiple escaping of escape ok: YAML::XS does not modify the input string
ok 1285 - Multiple escaping of escape ok: YAML::XS parses correctly
ok 1286 - Multiple escaping of escape ok: YAML::Perl saves without error
ok 1287 - Multiple escaping of escape ok: YAML::Perl serializes correctly
ok 1288 - Multiple escaping of escape ok: YAML::Perl round-trips without error
ok 1289 - Multiple escaping of escape ok: YAML::Perl round-trips correctly
ok 1290 - Multiple escaping of escape ok: YAML::Perl loads without error
ok 1291 - Multiple escaping of escape ok: YAML::Perl does not modify the input string
ok 1292 - Multiple escaping of escape ok: YAML::Perl parses correctly
ok 1293 - Multiple escaping of escape ok: CPAN::Meta::YAML parses without error
ok 1294 - Multiple escaping of escape ok: CPAN::Meta::YAML does not modify the input string
ok 1295 - The object isa CPAN::Meta::YAML
ok 1296 - Multiple escaping of escape ok: CPAN::Meta::YAML parses correctly
ok 1297 - Multiple escaping of escape ok: CPAN::Meta::YAML serializes without error
ok 1298 - Multiple escaping of escape ok: CPAN::Meta::YAML serializes correctly
ok 1299 - Multiple escaping of escape ok: CPAN::Meta::YAML round-trips without error
ok 1300 - The object isa CPAN::Meta::YAML
ok 1301 - Multiple escaping of escape ok: CPAN::Meta::YAML round-trips correctly
ok 1302 # skip Shortcutting perfect serialization tests
ok 1303 - Multiple escaping of escape with whitespace ok: YAML.pm saves without error
ok 1304 - Multiple escaping of escape with whitespace ok: YAML.pm serializes correctly
ok 1305 - Multiple escaping of escape with whitespace ok: YAML.pm round-trips without error
ok 1306 - Multiple escaping of escape with whitespace ok: YAML.pm round-trips correctly
ok 1307 - Multiple escaping of escape with whitespace ok: YAML.pm loads without error
ok 1308 - Multiple escaping of escape with whitespace ok: YAML.pm does not modify the input string
ok 1309 - Multiple escaping of escape with whitespace ok: YAML.pm parses correctly
ok 1310 - Multiple escaping of escape with whitespace ok: YAML::Syck saves without error
ok 1311 - Multiple escaping of escape with whitespace ok: YAML::Syck serializes correctly
ok 1312 - Multiple escaping of escape with whitespace ok: YAML::Syck round-trips without error
ok 1313 - Multiple escaping of escape with whitespace ok: YAML::Syck round-trips correctly
ok 1314 - Multiple escaping of escape with whitespace ok: YAML::Syck loads without error
ok 1315 - Multiple escaping of escape with whitespace ok: YAML::Syck does not modify the input string
ok 1316 - Multiple escaping of escape with whitespace ok: YAML::Syck parses correctly
ok 1317 - Multiple escaping of escape with whitespace ok: YAML::XS saves without error
ok 1318 - Multiple escaping of escape with whitespace ok: YAML::XS serializes correctly
ok 1319 - Multiple escaping of escape with whitespace ok: YAML::XS round-trips without error
ok 1320 - Multiple escaping of escape with whitespace ok: YAML::XS round-trips correctly
ok 1321 - Multiple escaping of escape with whitespace ok: YAML::XS loads without error
ok 1322 - Multiple escaping of escape with whitespace ok: YAML::XS does not modify the input string
ok 1323 - Multiple escaping of escape with whitespace ok: YAML::XS parses correctly
ok 1324 - Multiple escaping of escape with whitespace ok: YAML::Perl saves without error
ok 1325 - Multiple escaping of escape with whitespace ok: YAML::Perl serializes correctly
ok 1326 - Multiple escaping of escape with whitespace ok: YAML::Perl round-trips without error
ok 1327 - Multiple escaping of escape with whitespace ok: YAML::Perl round-trips correctly
ok 1328 - Multiple escaping of escape with whitespace ok: YAML::Perl loads without error
ok 1329 - Multiple escaping of escape with whitespace ok: YAML::Perl does not modify the input string
ok 1330 - Multiple escaping of escape with whitespace ok: YAML::Perl parses correctly
ok 1331 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML parses without error
ok 1332 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML does not modify the input string
ok 1333 - The object isa CPAN::Meta::YAML
ok 1334 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML parses correctly
ok 1335 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML serializes without error
ok 1336 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML serializes correctly
ok 1337 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML round-trips without error
ok 1338 - The object isa CPAN::Meta::YAML
ok 1339 - Multiple escaping of escape with whitespace ok: CPAN::Meta::YAML round-trips correctly
ok 1340 # skip Shortcutting perfect serialization tests
ok 1341 - Bang in a quote: YAML.pm saves without error
ok 1342 - Bang in a quote: YAML.pm serializes correctly
ok 1343 - Bang in a quote: YAML.pm round-trips without error
ok 1344 - Bang in a quote: YAML.pm round-trips correctly
ok 1345 - Bang in a quote: YAML.pm loads without error
ok 1346 - Bang in a quote: YAML.pm does not modify the input string
ok 1347 - Bang in a quote: YAML.pm parses correctly
ok 1348 - Bang in a quote: YAML::Syck saves without error
ok 1349 - Bang in a quote: YAML::Syck serializes correctly
ok 1350 - Bang in a quote: YAML::Syck round-trips without error
ok 1351 - Bang in a quote: YAML::Syck round-trips correctly
ok 1352 - Bang in a quote: YAML::Syck loads without error
ok 1353 - Bang in a quote: YAML::Syck does not modify the input string
ok 1354 - Bang in a quote: YAML::Syck parses correctly
ok 1355 - Bang in a quote: YAML::XS saves without error
ok 1356 - Bang in a quote: YAML::XS serializes correctly
ok 1357 - Bang in a quote: YAML::XS round-trips without error
ok 1358 - Bang in a quote: YAML::XS round-trips correctly
ok 1359 - Bang in a quote: YAML::XS loads without error
ok 1360 - Bang in a quote: YAML::XS does not modify the input string
ok 1361 - Bang in a quote: YAML::XS parses correctly
ok 1362 - Bang in a quote: YAML::Perl saves without error
ok 1363 - Bang in a quote: YAML::Perl serializes correctly
ok 1364 - Bang in a quote: YAML::Perl round-trips without error
ok 1365 - Bang in a quote: YAML::Perl round-trips correctly
ok 1366 - Bang in a quote: YAML::Perl loads without error
ok 1367 - Bang in a quote: YAML::Perl does not modify the input string
ok 1368 - Bang in a quote: YAML::Perl parses correctly
ok 1369 - Bang in a quote: CPAN::Meta::YAML parses without error
ok 1370 - Bang in a quote: CPAN::Meta::YAML does not modify the input string
ok 1371 - The object isa CPAN::Meta::YAML
ok 1372 - Bang in a quote: CPAN::Meta::YAML parses correctly
ok 1373 - Bang in a quote: CPAN::Meta::YAML serializes without error
ok 1374 - Bang in a quote: CPAN::Meta::YAML serializes correctly
ok 1375 - Bang in a quote: CPAN::Meta::YAML round-trips without error
ok 1376 - The object isa CPAN::Meta::YAML
ok 1377 - Bang in a quote: CPAN::Meta::YAML round-trips correctly
ok 1378 # skip Shortcutting perfect serialization tests
ok 1379 - Ampersand in a quote: YAML.pm saves without error
ok 1380 - Ampersand in a quote: YAML.pm serializes correctly
ok 1381 - Ampersand in a quote: YAML.pm round-trips without error
ok 1382 - Ampersand in a quote: YAML.pm round-trips correctly
ok 1383 - Ampersand in a quote: YAML.pm loads without error
ok 1384 - Ampersand in a quote: YAML.pm does not modify the input string
ok 1385 - Ampersand in a quote: YAML.pm parses correctly
ok 1386 - Ampersand in a quote: YAML::Syck saves without error
ok 1387 - Ampersand in a quote: YAML::Syck serializes correctly
ok 1388 - Ampersand in a quote: YAML::Syck round-trips without error
ok 1389 - Ampersand in a quote: YAML::Syck round-trips correctly
ok 1390 - Ampersand in a quote: YAML::Syck loads without error
ok 1391 - Ampersand in a quote: YAML::Syck does not modify the input string
ok 1392 - Ampersand in a quote: YAML::Syck parses correctly
ok 1393 - Ampersand in a quote: YAML::XS saves without error
ok 1394 - Ampersand in a quote: YAML::XS serializes correctly
ok 1395 - Ampersand in a quote: YAML::XS round-trips without error
ok 1396 - Ampersand in a quote: YAML::XS round-trips correctly
ok 1397 - Ampersand in a quote: YAML::XS loads without error
ok 1398 - Ampersand in a quote: YAML::XS does not modify the input string
ok 1399 - Ampersand in a quote: YAML::XS parses correctly
ok 1400 - Ampersand in a quote: YAML::Perl saves without error
ok 1401 - Ampersand in a quote: YAML::Perl serializes correctly
ok 1402 - Ampersand in a quote: YAML::Perl round-trips without error
ok 1403 - Ampersand in a quote: YAML::Perl round-trips correctly
ok 1404 - Ampersand in a quote: YAML::Perl loads without error
ok 1405 - Ampersand in a quote: YAML::Perl does not modify the input string
ok 1406 - Ampersand in a quote: YAML::Perl parses correctly
ok 1407 - Ampersand in a quote: CPAN::Meta::YAML parses without error
ok 1408 - Ampersand in a quote: CPAN::Meta::YAML does not modify the input string
ok 1409 - The object isa CPAN::Meta::YAML
ok 1410 - Ampersand in a quote: CPAN::Meta::YAML parses correctly
ok 1411 - Ampersand in a quote: CPAN::Meta::YAML serializes without error
ok 1412 - Ampersand in a quote: CPAN::Meta::YAML serializes correctly
ok 1413 - Ampersand in a quote: CPAN::Meta::YAML round-trips without error
ok 1414 - The object isa CPAN::Meta::YAML
ok 1415 - Ampersand in a quote: CPAN::Meta::YAML round-trips correctly
ok 1416 # skip Shortcutting perfect serialization tests
ok 1417 - Idiomatic trivial boolean string is escaped
ok 1418
ok
t/04_scalar.t ...... 
1..18
ok 1 - one: Parsed correctly
ok 2 - one: List context matches
ok 3 - two: Parsed correctly
ok 4 - two: List context matches
ok 5 - one: Parsed correctly
ok 6 - one: Scalar context matches
ok 7 - two: Parsed correctly
ok 8 - two: Scalar context matches
ok 9 - Found t\data\one.yml
ok 10 - Found t\data\two.yml
ok 11 - one: Parsed correctly
ok 12 - one: List context matches
ok 13 - two: Parsed correctly
ok 14 - two: List context matches
ok 15 - one: Parsed correctly
ok 16 - one: Scalar context matches
ok 17 - two: Parsed correctly
ok 18 - two: Scalar context matches
ok
t/05_export.t ...... 
1..6
ok 1 - Load is exported
ok 2 - Dump is exported
ok 3 - Load is exported
ok 4 - Dump is exported
ok 5 - Load is CPAN::Meta::YAML
ok 6 - Dump is CPAN::Meta::YAML
ok
t/11_meta_yml.t .... 
1..316
ok 1 - CPAN::Meta::YAML: YAML.pm saves without error
ok 2 - CPAN::Meta::YAML: YAML.pm serializes correctly
ok 3 - CPAN::Meta::YAML: YAML.pm round-trips without error
ok 4 - CPAN::Meta::YAML: YAML.pm round-trips correctly
ok 5 - CPAN::Meta::YAML: YAML.pm loads without error
ok 6 - CPAN::Meta::YAML: YAML.pm does not modify the input string
ok 7 - CPAN::Meta::YAML: YAML.pm parses correctly
ok 8 - CPAN::Meta::YAML: YAML::Syck saves without error
ok 9 - CPAN::Meta::YAML: YAML::Syck serializes correctly
ok 10 - CPAN::Meta::YAML: YAML::Syck round-trips without error
ok 11 - CPAN::Meta::YAML: YAML::Syck round-trips correctly
ok 12 - CPAN::Meta::YAML: YAML::Syck loads without error
ok 13 - CPAN::Meta::YAML: YAML::Syck does not modify the input string
ok 14 - CPAN::Meta::YAML: YAML::Syck parses correctly
ok 15 - CPAN::Meta::YAML: YAML::XS saves without error
ok 16 - CPAN::Meta::YAML: YAML::XS serializes correctly
ok 17 - CPAN::Meta::YAML: YAML::XS round-trips without error
ok 18 - CPAN::Meta::YAML: YAML::XS round-trips correctly
ok 19 - CPAN::Meta::YAML: YAML::XS loads without error
ok 20 - CPAN::Meta::YAML: YAML::XS does not modify the input string
ok 21 - CPAN::Meta::YAML: YAML::XS parses correctly
ok 22 - CPAN::Meta::YAML: YAML::Perl saves without error
ok 23 - CPAN::Meta::YAML: YAML::Perl serializes correctly
ok 24 - CPAN::Meta::YAML: YAML::Perl round-trips without error
ok 25 - CPAN::Meta::YAML: YAML::Perl round-trips correctly
ok 26 - CPAN::Meta::YAML: YAML::Perl loads without error
ok 27 - CPAN::Meta::YAML: YAML::Perl does not modify the input string
ok 28 - CPAN::Meta::YAML: YAML::Perl parses correctly
ok 29 - CPAN::Meta::YAML: CPAN::Meta::YAML parses without error
ok 30 - CPAN::Meta::YAML: CPAN::Meta::YAML does not modify the input string
ok 31 - The object isa CPAN::Meta::YAML
ok 32 - CPAN::Meta::YAML: CPAN::Meta::YAML parses correctly
ok 33 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes without error
ok 34 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes correctly
ok 35 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips without error
ok 36 - The object isa CPAN::Meta::YAML
ok 37 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips correctly
ok 38 # skip Shortcutting perfect serialization tests
ok 39 - CPAN::Meta::YAML: YAML.pm saves without error
ok 40 - CPAN::Meta::YAML: YAML.pm serializes correctly
ok 41 - CPAN::Meta::YAML: YAML.pm round-trips without error
ok 42 - CPAN::Meta::YAML: YAML.pm round-trips correctly
ok 43 - CPAN::Meta::YAML: YAML.pm loads without error
ok 44 - CPAN::Meta::YAML: YAML.pm does not modify the input string
ok 45 - CPAN::Meta::YAML: YAML.pm parses correctly
ok 46 - CPAN::Meta::YAML: YAML::Syck saves without error
ok 47 - CPAN::Meta::YAML: YAML::Syck serializes correctly
ok 48 - CPAN::Meta::YAML: YAML::Syck round-trips without error
ok 49 - CPAN::Meta::YAML: YAML::Syck round-trips correctly
ok 50 - CPAN::Meta::YAML: YAML::Syck loads without error
ok 51 - CPAN::Meta::YAML: YAML::Syck does not modify the input string
ok 52 - CPAN::Meta::YAML: YAML::Syck parses correctly
ok 53 - CPAN::Meta::YAML: YAML::XS saves without error
ok 54 - CPAN::Meta::YAML: YAML::XS serializes correctly
ok 55 - CPAN::Meta::YAML: YAML::XS round-trips without error
ok 56 - CPAN::Meta::YAML: YAML::XS round-trips correctly
ok 57 - CPAN::Meta::YAML: YAML::XS loads without error
ok 58 - CPAN::Meta::YAML: YAML::XS does not modify the input string
ok 59 - CPAN::Meta::YAML: YAML::XS parses correctly
ok 60 - CPAN::Meta::YAML: YAML::Perl saves without error
ok 61 - CPAN::Meta::YAML: YAML::Perl serializes correctly
ok 62 - CPAN::Meta::YAML: YAML::Perl round-trips without error
ok 63 - CPAN::Meta::YAML: YAML::Perl round-trips correctly
ok 64 - CPAN::Meta::YAML: YAML::Perl loads without error
ok 65 - CPAN::Meta::YAML: YAML::Perl does not modify the input string
ok 66 - CPAN::Meta::YAML: YAML::Perl parses correctly
ok 67 - CPAN::Meta::YAML: CPAN::Meta::YAML parses without error
ok 68 - CPAN::Meta::YAML: CPAN::Meta::YAML does not modify the input string
ok 69 - The object isa CPAN::Meta::YAML
ok 70 - CPAN::Meta::YAML: CPAN::Meta::YAML parses correctly
ok 71 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes without error
ok 72 - CPAN::Meta::YAML: CPAN::Meta::YAML serializes correctly
ok 73 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips without error
ok 74 - The object isa CPAN::Meta::YAML
ok 75 - CPAN::Meta::YAML: CPAN::Meta::YAML round-trips correctly
ok 76 # skip Shortcutting perfect serialization tests
ok 77 - Games-Nintendo-Wii-Mii: YAML.pm saves without error
ok 78 - Games-Nintendo-Wii-Mii: YAML.pm serializes correctly
ok 79 - Games-Nintendo-Wii-Mii: YAML.pm round-trips without error
ok 80 - Games-Nintendo-Wii-Mii: YAML.pm round-trips correctly
ok 81 - Games-Nintendo-Wii-Mii: YAML.pm loads without error
ok 82 - Games-Nintendo-Wii-Mii: YAML.pm does not modify the input string
ok 83 - Games-Nintendo-Wii-Mii: YAML.pm parses correctly
ok 84 - Games-Nintendo-Wii-Mii: YAML::Syck saves without error
ok 85 - Games-Nintendo-Wii-Mii: YAML::Syck serializes correctly
ok 86 - Games-Nintendo-Wii-Mii: YAML::Syck round-trips without error
ok 87 - Games-Nintendo-Wii-Mii: YAML::Syck round-trips correctly
ok 88 - Games-Nintendo-Wii-Mii: YAML::Syck loads without error
ok 89 - Games-Nintendo-Wii-Mii: YAML::Syck does not modify the input string
ok 90 - Games-Nintendo-Wii-Mii: YAML::Syck parses correctly
ok 91 - Games-Nintendo-Wii-Mii: YAML::XS saves without error
ok 92 - Games-Nintendo-Wii-Mii: YAML::XS serializes correctly
ok 93 - Games-Nintendo-Wii-Mii: YAML::XS round-trips without error
ok 94 - Games-Nintendo-Wii-Mii: YAML::XS round-trips correctly
ok 95 - Games-Nintendo-Wii-Mii: YAML::XS loads without error
ok 96 - Games-Nintendo-Wii-Mii: YAML::XS does not modify the input string
ok 97 - Games-Nintendo-Wii-Mii: YAML::XS parses correctly
ok 98 - Games-Nintendo-Wii-Mii: YAML::Perl saves without error
ok 99 - Games-Nintendo-Wii-Mii: YAML::Perl serializes correctly
ok 100 - Games-Nintendo-Wii-Mii: YAML::Perl round-trips without error
ok 101 - Games-Nintendo-Wii-Mii: YAML::Perl round-trips correctly
ok 102 - Games-Nintendo-Wii-Mii: YAML::Perl loads without error
ok 103 - Games-Nintendo-Wii-Mii: YAML::Perl does not modify the input string
ok 104 - Games-Nintendo-Wii-Mii: YAML::Perl parses correctly
ok 105 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML parses without error
ok 106 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML does not modify the input string
ok 107 - The object isa CPAN::Meta::YAML
ok 108 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML parses correctly
ok 109 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML serializes without error
ok 110 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML serializes correctly
ok 111 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML round-trips without error
ok 112 - The object isa CPAN::Meta::YAML
ok 113 - Games-Nintendo-Wii-Mii: CPAN::Meta::YAML round-trips correctly
ok 114 # skip Shortcutting perfect serialization tests
ok 115 - Acme-Time-Baby: YAML.pm saves without error
ok 116 - Acme-Time-Baby: YAML.pm serializes correctly
ok 117 - Acme-Time-Baby: YAML.pm round-trips without error
ok 118 - Acme-Time-Baby: YAML.pm round-trips correctly
ok 119 - Acme-Time-Baby: YAML.pm loads without error
ok 120 - Acme-Time-Baby: YAML.pm does not modify the input string
ok 121 - Acme-Time-Baby: YAML.pm parses correctly
ok 122 - Acme-Time-Baby: YAML::Syck saves without error
ok 123 - Acme-Time-Baby: YAML::Syck serializes correctly
ok 124 - Acme-Time-Baby: YAML::Syck round-trips without error
ok 125 - Acme-Time-Baby: YAML::Syck round-trips correctly
ok 126 - Acme-Time-Baby: YAML::Syck loads without error
ok 127 - Acme-Time-Baby: YAML::Syck does not modify the input string
ok 128 - Acme-Time-Baby: YAML::Syck parses correctly
ok 129 - Acme-Time-Baby: YAML::XS saves without error
ok 130 - Acme-Time-Baby: YAML::XS serializes correctly
ok 131 - Acme-Time-Baby: YAML::XS round-trips without error
ok 132 - Acme-Time-Baby: YAML::XS round-trips correctly
ok 133 - Acme-Time-Baby: YAML::XS loads without error
ok 134 - Acme-Time-Baby: YAML::XS does not modify the input string
ok 135 - Acme-Time-Baby: YAML::XS parses correctly
ok 136 # skip Skipping YAML::Perl for known-broken feature
ok 137 # skip Skipping YAML::Perl for known-broken feature
ok 138 # skip Skipping YAML::Perl for known-broken feature
ok 139 # skip Skipping YAML::Perl for known-broken feature
ok 140 # skip Skipping YAML::Perl for known-broken feature
ok 141 # skip Skipping YAML::Perl for known-broken feature
ok 142 # skip Skipping YAML::Perl for known-broken feature
ok 143 - Acme-Time-Baby: CPAN::Meta::YAML parses without error
ok 144 - Acme-Time-Baby: CPAN::Meta::YAML does not modify the input string
ok 145 - The object isa CPAN::Meta::YAML
ok 146 - Acme-Time-Baby: CPAN::Meta::YAML parses correctly
ok 147 - Acme-Time-Baby: CPAN::Meta::YAML serializes without error
ok 148 - Acme-Time-Baby: CPAN::Meta::YAML serializes correctly
ok 149 - Acme-Time-Baby: CPAN::Meta::YAML round-trips without error
ok 150 - The object isa CPAN::Meta::YAML
ok 151 - Acme-Time-Baby: CPAN::Meta::YAML round-trips correctly
ok 152 # skip Shortcutting perfect serialization tests
ok 153 - Data-Swap: YAML.pm saves without error
ok 154 - Data-Swap: YAML.pm serializes correctly
ok 155 - Data-Swap: YAML.pm round-trips without error
ok 156 - Data-Swap: YAML.pm round-trips correctly
ok 157 - Data-Swap: YAML.pm loads without error
ok 158 - Data-Swap: YAML.pm does not modify the input string
ok 159 - Data-Swap: YAML.pm parses correctly
ok 160 # skip Skipping YAML::Syck for known-broken feature
ok 161 # skip Skipping YAML::Syck for known-broken feature
ok 162 # skip Skipping YAML::Syck for known-broken feature
ok 163 # skip Skipping YAML::Syck for known-broken feature
ok 164 # skip Skipping YAML::Syck for known-broken feature
ok 165 # skip Skipping YAML::Syck for known-broken feature
ok 166 # skip Skipping YAML::Syck for known-broken feature
ok 167 - Data-Swap: YAML::XS saves without error
ok 168 - Data-Swap: YAML::XS serializes correctly
ok 169 - Data-Swap: YAML::XS round-trips without error
ok 170 - Data-Swap: YAML::XS round-trips correctly
ok 171 - Data-Swap: YAML::XS loads without error
ok 172 - Data-Swap: YAML::XS does not modify the input string
ok 173 - Data-Swap: YAML::XS parses correctly
ok 174 - Data-Swap: YAML::Perl saves without error
ok 175 - Data-Swap: YAML::Perl serializes correctly
ok 176 - Data-Swap: YAML::Perl round-trips without error
ok 177 - Data-Swap: YAML::Perl round-trips correctly
ok 178 - Data-Swap: YAML::Perl loads without error
ok 179 - Data-Swap: YAML::Perl does not modify the input string
ok 180 - Data-Swap: YAML::Perl parses correctly
ok 181 - Data-Swap: CPAN::Meta::YAML parses without error
ok 182 - Data-Swap: CPAN::Meta::YAML does not modify the input string
ok 183 - The object isa CPAN::Meta::YAML
ok 184 - Data-Swap: CPAN::Meta::YAML parses correctly
ok 185 - Data-Swap: CPAN::Meta::YAML serializes without error
ok 186 - Data-Swap: CPAN::Meta::YAML serializes correctly
ok 187 - Data-Swap: CPAN::Meta::YAML round-trips without error
ok 188 - The object isa CPAN::Meta::YAML
ok 189 - Data-Swap: CPAN::Meta::YAML round-trips correctly
ok 190 # skip Shortcutting perfect serialization tests
ok 191 - Found Template-Provider-Unicode-Japanese.yml
ok 192 - Can read Template-Provider-Unicode-Japanese.yml
ok 193 - Loaded Template-Provider-Unicode-Japanese.yml
ok 194 - Content of Template-Provider-Unicode-Japanese.yml larger than 100 bytes
ok 195 - Template-Provider-Unicode-Japanese: YAML.pm saves without error
ok 196 - Template-Provider-Unicode-Japanese: YAML.pm serializes correctly
ok 197 - Template-Provider-Unicode-Japanese: YAML.pm round-trips without error
ok 198 - Template-Provider-Unicode-Japanese: YAML.pm round-trips correctly
ok 199 - Template-Provider-Unicode-Japanese: YAML.pm loads without error
ok 200 - Template-Provider-Unicode-Japanese: YAML.pm does not modify the input string
ok 201 - Template-Provider-Unicode-Japanese: YAML.pm parses correctly
ok 202 - Template-Provider-Unicode-Japanese: YAML::Syck saves without error
ok 203 - Template-Provider-Unicode-Japanese: YAML::Syck serializes correctly
ok 204 - Template-Provider-Unicode-Japanese: YAML::Syck round-trips without error
ok 205 - Template-Provider-Unicode-Japanese: YAML::Syck round-trips correctly
ok 206 - Template-Provider-Unicode-Japanese: YAML::Syck loads without error
ok 207 - Template-Provider-Unicode-Japanese: YAML::Syck does not modify the input string
ok 208 - Template-Provider-Unicode-Japanese: YAML::Syck parses correctly
ok 209 - Template-Provider-Unicode-Japanese: YAML::XS saves without error
ok 210 - Template-Provider-Unicode-Japanese: YAML::XS serializes correctly
ok 211 - Template-Provider-Unicode-Japanese: YAML::XS round-trips without error
ok 212 - Template-Provider-Unicode-Japanese: YAML::XS round-trips correctly
ok 213 - Template-Provider-Unicode-Japanese: YAML::XS loads without error
ok 214 - Template-Provider-Unicode-Japanese: YAML::XS does not modify the input string
ok 215 - Template-Provider-Unicode-Japanese: YAML::XS parses correctly
ok 216 # skip Skipping YAML::Perl for known-broken feature
ok 217 # skip Skipping YAML::Perl for known-broken feature
ok 218 # skip Skipping YAML::Perl for known-broken feature
ok 219 # skip Skipping YAML::Perl for known-broken feature
ok 220 # skip Skipping YAML::Perl for known-broken feature
ok 221 # skip Skipping YAML::Perl for known-broken feature
ok 222 # skip Skipping YAML::Perl for known-broken feature
ok 223 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML parses without error
ok 224 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML does not modify the input string
ok 225 - The object isa CPAN::Meta::YAML
ok 226 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML parses correctly
ok 227 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML serializes without error
ok 228 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML serializes correctly
ok 229 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML round-trips without error
ok 230 - The object isa CPAN::Meta::YAML
ok 231 - Template-Provider-Unicode-Japanese: CPAN::Meta::YAML round-trips correctly
ok 232 # skip Shortcutting perfect serialization tests
ok 233 - Found HTML-WebDAO.yml
ok 234 - Can read HTML-WebDAO.yml
ok 235 - Loaded HTML-WebDAO.yml
ok 236 - Content of HTML-WebDAO.yml larger than 100 bytes
ok 237 - HTML-WebDAO: YAML.pm saves without error
ok 238 - HTML-WebDAO: YAML.pm serializes correctly
ok 239 - HTML-WebDAO: YAML.pm round-trips without error
ok 240 - HTML-WebDAO: YAML.pm round-trips correctly
ok 241 - HTML-WebDAO: YAML.pm loads without error
ok 242 - HTML-WebDAO: YAML.pm does not modify the input string
ok 243 - HTML-WebDAO: YAML.pm parses correctly
ok 244 # skip Skipping YAML::Syck for known-broken feature
ok 245 # skip Skipping YAML::Syck for known-broken feature
ok 246 # skip Skipping YAML::Syck for known-broken feature
ok 247 # skip Skipping YAML::Syck for known-broken feature
ok 248 # skip Skipping YAML::Syck for known-broken feature
ok 249 # skip Skipping YAML::Syck for known-broken feature
ok 250 # skip Skipping YAML::Syck for known-broken feature
ok 251 - HTML-WebDAO: YAML::XS saves without error
ok 252 - HTML-WebDAO: YAML::XS serializes correctly
ok 253 - HTML-WebDAO: YAML::XS round-trips without error
ok 254 - HTML-WebDAO: YAML::XS round-trips correctly
ok 255 - HTML-WebDAO: YAML::XS loads without error
ok 256 - HTML-WebDAO: YAML::XS does not modify the input string
ok 257 - HTML-WebDAO: YAML::XS parses correctly
ok 258 - HTML-WebDAO: YAML::Perl saves without error
ok 259 - HTML-WebDAO: YAML::Perl serializes correctly
ok 260 - HTML-WebDAO: YAML::Perl round-trips without error
ok 261 - HTML-WebDAO: YAML::Perl round-trips correctly
ok 262 - HTML-WebDAO: YAML::Perl loads without error
ok 263 - HTML-WebDAO: YAML::Perl does not modify the input string
ok 264 - HTML-WebDAO: YAML::Perl parses correctly
ok 265 - HTML-WebDAO: CPAN::Meta::YAML parses without error
ok 266 - HTML-WebDAO: CPAN::Meta::YAML does not modify the input string
ok 267 - The object isa CPAN::Meta::YAML
ok 268 - HTML-WebDAO: CPAN::Meta::YAML parses correctly
ok 269 - HTML-WebDAO: CPAN::Meta::YAML serializes without error
ok 270 - HTML-WebDAO: CPAN::Meta::YAML serializes correctly
ok 271 - HTML-WebDAO: CPAN::Meta::YAML round-trips without error
ok 272 - The object isa CPAN::Meta::YAML
ok 273 - HTML-WebDAO: CPAN::Meta::YAML round-trips correctly
ok 274 # skip Shortcutting perfect serialization tests
ok 275 - Found Spreadsheet-Read.yml
ok 276 - Can read Spreadsheet-Read.yml
ok 277 - Loaded Spreadsheet-Read.yml
ok 278 - Content of Spreadsheet-Read.yml larger than 100 bytes
ok 279 # skip Skipping YAML.pm for known-broken feature
ok 280 # skip Skipping YAML.pm for known-broken feature
ok 281 # skip Skipping YAML.pm for known-broken feature
ok 282 # skip Skipping YAML.pm for known-broken feature
ok 283 # skip Skipping YAML.pm for known-broken feature
ok 284 # skip Skipping YAML.pm for known-broken feature
ok 285 # skip Skipping YAML.pm for known-broken feature
ok 286 - Spreadsheet-Read: YAML::Syck saves without error
ok 287 - Spreadsheet-Read: YAML::Syck serializes correctly
ok 288 - Spreadsheet-Read: YAML::Syck round-trips without error
ok 289 - Spreadsheet-Read: YAML::Syck round-trips correctly
ok 290 - Spreadsheet-Read: YAML::Syck loads without error
ok 291 - Spreadsheet-Read: YAML::Syck does not modify the input string
ok 292 - Spreadsheet-Read: YAML::Syck parses correctly
ok 293 - Spreadsheet-Read: YAML::XS saves without error
ok 294 - Spreadsheet-Read: YAML::XS serializes correctly
ok 295 - Spreadsheet-Read: YAML::XS round-trips without error
ok 296 - Spreadsheet-Read: YAML::XS round-trips correctly
ok 297 - Spreadsheet-Read: YAML::XS loads without error
ok 298 - Spreadsheet-Read: YAML::XS does not modify the input string
ok 299 - Spreadsheet-Read: YAML::XS parses correctly
ok 300 # skip Skipping YAML::Perl for known-broken feature
ok 301 # skip Skipping YAML::Perl for known-broken feature
ok 302 # skip Skipping YAML::Perl for known-broken feature
ok 303 # skip Skipping YAML::Perl for known-broken feature
ok 304 # skip Skipping YAML::Perl for known-broken feature
ok 305 # skip Skipping YAML::Perl for known-broken feature
ok 306 # skip Skipping YAML::Perl for known-broken feature
ok 307 - Spreadsheet-Read: CPAN::Meta::YAML parses without error
ok 308 - Spreadsheet-Read: CPAN::Meta::YAML does not modify the input string
ok 309 - The object isa CPAN::Meta::YAML
ok 310 - Spreadsheet-Read: CPAN::Meta::YAML parses correctly
ok 311 - Spreadsheet-Read: CPAN::Meta::YAML serializes without error
ok 312 - Spreadsheet-Read: CPAN::Meta::YAML serializes correctly
ok 313 - Spreadsheet-Read: CPAN::Meta::YAML round-trips without error
ok 314 - The object isa CPAN::Meta::YAML
ok 315 - Spreadsheet-Read: CPAN::Meta::YAML round-trips correctly
ok 316 # skip Shortcutting perfect serialization tests
ok
t/12_plagger.t ..... 
1..76
ok 1 - Plagger: YAML.pm saves without error
ok 2 - Plagger: YAML.pm serializes correctly
ok 3 - Plagger: YAML.pm round-trips without error
ok 4 - Plagger: YAML.pm round-trips correctly
ok 5 - Plagger: YAML.pm loads without error
ok 6 - Plagger: YAML.pm does not modify the input string
ok 7 - Plagger: YAML.pm parses correctly
ok 8 - Plagger: YAML::Syck saves without error
ok 9 - Plagger: YAML::Syck serializes correctly
ok 10 - Plagger: YAML::Syck round-trips without error
ok 11 - Plagger: YAML::Syck round-trips correctly
ok 12 - Plagger: YAML::Syck loads without error
ok 13 - Plagger: YAML::Syck does not modify the input string
ok 14 - Plagger: YAML::Syck parses correctly
ok 15 - Plagger: YAML::XS saves without error
ok 16 - Plagger: YAML::XS serializes correctly
ok 17 - Plagger: YAML::XS round-trips without error
ok 18 - Plagger: YAML::XS round-trips correctly
ok 19 - Plagger: YAML::XS loads without error
ok 20 - Plagger: YAML::XS does not modify the input string
ok 21 - Plagger: YAML::XS parses correctly
ok 22 - Plagger: YAML::Perl saves without error
ok 23 - Plagger: YAML::Perl serializes correctly
ok 24 - Plagger: YAML::Perl round-trips without error
ok 25 - Plagger: YAML::Perl round-trips correctly
ok 26 - Plagger: YAML::Perl loads without error
ok 27 - Plagger: YAML::Perl does not modify the input string
ok 28 - Plagger: YAML::Perl parses correctly
ok 29 - Plagger: CPAN::Meta::YAML parses without error
ok 30 - Plagger: CPAN::Meta::YAML does not modify the input string
ok 31 - The object isa CPAN::Meta::YAML
ok 32 - Plagger: CPAN::Meta::YAML parses correctly
ok 33 - Plagger: CPAN::Meta::YAML serializes without error
ok 34 - Plagger: CPAN::Meta::YAML serializes correctly
ok 35 - Plagger: CPAN::Meta::YAML round-trips without error
ok 36 - The object isa CPAN::Meta::YAML
ok 37 - Plagger: CPAN::Meta::YAML round-trips correctly
ok 38 # skip Shortcutting perfect serialization tests
ok 39 - plagger2: YAML.pm saves without error
ok 40 - plagger2: YAML.pm serializes correctly
ok 41 - plagger2: YAML.pm round-trips without error
ok 42 - plagger2: YAML.pm round-trips correctly
ok 43 - plagger2: YAML.pm loads without error
ok 44 - plagger2: YAML.pm does not modify the input string
ok 45 - plagger2: YAML.pm parses correctly
ok 46 - plagger2: YAML::Syck saves without error
ok 47 - plagger2: YAML::Syck serializes correctly
ok 48 - plagger2: YAML::Syck round-trips without error
ok 49 - plagger2: YAML::Syck round-trips correctly
ok 50 - plagger2: YAML::Syck loads without error
ok 51 - plagger2: YAML::Syck does not modify the input string
ok 52 - plagger2: YAML::Syck parses correctly
ok 53 - plagger2: YAML::XS saves without error
ok 54 - plagger2: YAML::XS serializes correctly
ok 55 - plagger2: YAML::XS round-trips without error
ok 56 - plagger2: YAML::XS round-trips correctly
ok 57 - plagger2: YAML::XS loads without error
ok 58 - plagger2: YAML::XS does not modify the input string
ok 59 - plagger2: YAML::XS parses correctly
ok 60 - plagger2: YAML::Perl saves without error
ok 61 - plagger2: YAML::Perl serializes correctly
ok 62 - plagger2: YAML::Perl round-trips without error
ok 63 - plagger2: YAML::Perl round-trips correctly
ok 64 - plagger2: YAML::Perl loads without error
ok 65 - plagger2: YAML::Perl does not modify the input string
ok 66 - plagger2: YAML::Perl parses correctly
ok 67 - plagger2: CPAN::Meta::YAML parses without error
ok 68 - plagger2: CPAN::Meta::YAML does not modify the input string
ok 69 - The object isa CPAN::Meta::YAML
ok 70 - plagger2: CPAN::Meta::YAML parses correctly
ok 71 - plagger2: CPAN::Meta::YAML serializes without error
ok 72 - plagger2: CPAN::Meta::YAML serializes correctly
ok 73 - plagger2: CPAN::Meta::YAML round-trips without error
ok 74 - The object isa CPAN::Meta::YAML
ok 75 - plagger2: CPAN::Meta::YAML round-trips correctly
ok 76 # skip Shortcutting perfect serialization tests
ok
t/13_perl_smith.t .. 
1..42
ok 1 - Found yanilla.yml
ok 2 - Can read yanilla.yml
ok 3 - Loaded yanilla.yml
ok 4 - Content of yanilla.yml larger than 1000 bytes
ok 5 - vanilla.yml: YAML.pm saves without error
ok 6 - vanilla.yml: YAML.pm serializes correctly
ok 7 - vanilla.yml: YAML.pm round-trips without error
ok 8 - vanilla.yml: YAML.pm round-trips correctly
ok 9 - vanilla.yml: YAML.pm loads without error
ok 10 - vanilla.yml: YAML.pm does not modify the input string
ok 11 - vanilla.yml: YAML.pm parses correctly
ok 12 # skip Skipping YAML::Syck for known-broken feature
ok 13 # skip Skipping YAML::Syck for known-broken feature
ok 14 # skip Skipping YAML::Syck for known-broken feature
ok 15 # skip Skipping YAML::Syck for known-broken feature
ok 16 # skip Skipping YAML::Syck for known-broken feature
ok 17 # skip Skipping YAML::Syck for known-broken feature
ok 18 # skip Skipping YAML::Syck for known-broken feature
ok 19 - vanilla.yml: YAML::XS saves without error
ok 20 - vanilla.yml: YAML::XS serializes correctly
ok 21 - vanilla.yml: YAML::XS round-trips without error
ok 22 - vanilla.yml: YAML::XS round-trips correctly
ok 23 - vanilla.yml: YAML::XS loads without error
ok 24 - vanilla.yml: YAML::XS does not modify the input string
ok 25 - vanilla.yml: YAML::XS parses correctly
ok 26 # skip Skipping YAML::Perl for known-broken feature
ok 27 # skip Skipping YAML::Perl for known-broken feature
ok 28 # skip Skipping YAML::Perl for known-broken feature
ok 29 # skip Skipping YAML::Perl for known-broken feature
ok 30 # skip Skipping YAML::Perl for known-broken feature
ok 31 # skip Skipping YAML::Perl for known-broken feature
ok 32 # skip Skipping YAML::Perl for known-broken feature
ok 33 - vanilla.yml: CPAN::Meta::YAML parses without error
ok 34 - vanilla.yml: CPAN::Meta::YAML does not modify the input string
ok 35 - The object isa CPAN::Meta::YAML
ok 36 - vanilla.yml: CPAN::Meta::YAML parses correctly
ok 37 - vanilla.yml: CPAN::Meta::YAML serializes without error
ok 38 - vanilla.yml: CPAN::Meta::YAML serializes correctly
ok 39 - vanilla.yml: CPAN::Meta::YAML round-trips without error
ok 40 - The object isa CPAN::Meta::YAML
ok 41 - vanilla.yml: CPAN::Meta::YAML round-trips correctly
ok 42 # skip Shortcutting perfect serialization tests
ok
t/14_yaml_org.t .... 
1..42
ok 1 - Found sample.yml
ok 2 - Can read sample.yml
ok 3 - Loaded sample.yml
ok 4 - Content of sample.yml larger than 500 bytes
ok 5 - sample.yml: YAML.pm saves without error
ok 6 - sample.yml: YAML.pm serializes correctly
ok 7 - sample.yml: YAML.pm round-trips without error
ok 8 - sample.yml: YAML.pm round-trips correctly
ok 9 - sample.yml: YAML.pm loads without error
ok 10 - sample.yml: YAML.pm does not modify the input string
ok 11 - sample.yml: YAML.pm parses correctly
ok 12 - sample.yml: YAML::Syck saves without error
ok 13 - sample.yml: YAML::Syck serializes correctly
ok 14 - sample.yml: YAML::Syck round-trips without error
ok 15 - sample.yml: YAML::Syck round-trips correctly
ok 16 - sample.yml: YAML::Syck loads without error
ok 17 - sample.yml: YAML::Syck does not modify the input string
ok 18 - sample.yml: YAML::Syck parses correctly
ok 19 - sample.yml: YAML::XS saves without error
ok 20 - sample.yml: YAML::XS serializes correctly
ok 21 - sample.yml: YAML::XS round-trips without error
ok 22 - sample.yml: YAML::XS round-trips correctly
ok 23 - sample.yml: YAML::XS loads without error
ok 24 - sample.yml: YAML::XS does not modify the input string
ok 25 - sample.yml: YAML::XS parses correctly
ok 26 - sample.yml: YAML::Perl saves without error
ok 27 - sample.yml: YAML::Perl serializes correctly
ok 28 - sample.yml: YAML::Perl round-trips without error
ok 29 - sample.yml: YAML::Perl round-trips correctly
ok 30 - sample.yml: YAML::Perl loads without error
ok 31 - sample.yml: YAML::Perl does not modify the input string
ok 32 - sample.yml: YAML::Perl parses correctly
ok 33 - sample.yml: CPAN::Meta::YAML parses without error
ok 34 - sample.yml: CPAN::Meta::YAML does not modify the input string
ok 35 - The object isa CPAN::Meta::YAML
ok 36 - sample.yml: CPAN::Meta::YAML parses correctly
ok 37 - sample.yml: CPAN::Meta::YAML serializes without error
ok 38 - sample.yml: CPAN::Meta::YAML serializes correctly
ok 39 - sample.yml: CPAN::Meta::YAML round-trips without error
ok 40 - The object isa CPAN::Meta::YAML
ok 41 - sample.yml: CPAN::Meta::YAML round-trips correctly
ok 42 # skip Shortcutting perfect serialization tests
ok
t/15_multibyte.t ... 
1..9
ok 1 - Found multibyte.yml
ok 2 - Can read multibyte.yml
ok 3 - Loaded multibyte.yml
ok 4 - Content of multibyte.yml larger than 450 bytes
ok 5 - multibyte: CPAN::Meta::YAML parses without error
ok 6 - multibyte: CPAN::Meta::YAML does not modify the input string
ok 7 - The object isa CPAN::Meta::YAML
ok 8 - build_requires ok
ok 9 - utf8 decoded
ok
t/16_nullrefs.t .... 
1..38
ok 1 - Empty references: YAML.pm saves without error
ok 2 - Empty references: YAML.pm serializes correctly
ok 3 - Empty references: YAML.pm round-trips without error
ok 4 - Empty references: YAML.pm round-trips correctly
ok 5 - Empty references: YAML.pm loads without error
ok 6 - Empty references: YAML.pm does not modify the input string
ok 7 - Empty references: YAML.pm parses correctly
ok 8 # skip Skipping YAML::Syck for unsupported feature
ok 9 # skip Skipping YAML::Syck for unsupported feature
ok 10 # skip Skipping YAML::Syck for unsupported feature
ok 11 # skip Skipping YAML::Syck for unsupported feature
ok 12 # skip Skipping YAML::Syck for unsupported feature
ok 13 # skip Skipping YAML::Syck for unsupported feature
ok 14 # skip Skipping YAML::Syck for unsupported feature
ok 15 - Empty references: YAML::XS saves without error
ok 16 - Empty references: YAML::XS serializes correctly
ok 17 - Empty references: YAML::XS round-trips without error
ok 18 - Empty references: YAML::XS round-trips correctly
ok 19 - Empty references: YAML::XS loads without error
ok 20 - Empty references: YAML::XS does not modify the input string
ok 21 - Empty references: YAML::XS parses correctly
ok 22 - Empty references: YAML::Perl saves without error
ok 23 - Empty references: YAML::Perl serializes correctly
ok 24 - Empty references: YAML::Perl round-trips without error
ok 25 - Empty references: YAML::Perl round-trips correctly
ok 26 - Empty references: YAML::Perl loads without error
ok 27 - Empty references: YAML::Perl does not modify the input string
ok 28 - Empty references: YAML::Perl parses correctly
ok 29 - Empty references: CPAN::Meta::YAML parses without error
ok 30 - Empty references: CPAN::Meta::YAML does not modify the input string
ok 31 - The object isa CPAN::Meta::YAML
ok 32 - Empty references: CPAN::Meta::YAML parses correctly
ok 33 - Empty references: CPAN::Meta::YAML serializes without error
ok 34 - Empty references: CPAN::Meta::YAML serializes correctly
ok 35 - Empty references: CPAN::Meta::YAML round-trips without error
ok 36 - The object isa CPAN::Meta::YAML
ok 37 - Empty references: CPAN::Meta::YAML round-trips correctly
ok 38 # skip Shortcutting perfect serialization tests
ok
t/17_toolbar.t ..... 
1..42
ok 1 - Found toolbar.yml
ok 2 - Can read toolbar.yml
ok 3 - Loaded toolbar.yml
ok 4 - Content of toolbar.yml larger than 100 bytes
ok 5 - toolbar.yml: YAML.pm saves without error
ok 6 - toolbar.yml: YAML.pm serializes correctly
ok 7 - toolbar.yml: YAML.pm round-trips without error
ok 8 - toolbar.yml: YAML.pm round-trips correctly
ok 9 - toolbar.yml: YAML.pm loads without error
ok 10 - toolbar.yml: YAML.pm does not modify the input string
ok 11 - toolbar.yml: YAML.pm parses correctly
ok 12 - toolbar.yml: YAML::Syck saves without error
ok 13 - toolbar.yml: YAML::Syck serializes correctly
ok 14 - toolbar.yml: YAML::Syck round-trips without error
ok 15 - toolbar.yml: YAML::Syck round-trips correctly
ok 16 - toolbar.yml: YAML::Syck loads without error
ok 17 - toolbar.yml: YAML::Syck does not modify the input string
ok 18 - toolbar.yml: YAML::Syck parses correctly
ok 19 - toolbar.yml: YAML::XS saves without error
ok 20 - toolbar.yml: YAML::XS serializes correctly
ok 21 - toolbar.yml: YAML::XS round-trips without error
ok 22 - toolbar.yml: YAML::XS round-trips correctly
ok 23 - toolbar.yml: YAML::XS loads without error
ok 24 - toolbar.yml: YAML::XS does not modify the input string
ok 25 - toolbar.yml: YAML::XS parses correctly
ok 26 # skip Skipping YAML::Perl for known-broken feature
ok 27 # skip Skipping YAML::Perl for known-broken feature
ok 28 # skip Skipping YAML::Perl for known-broken feature
ok 29 # skip Skipping YAML::Perl for known-broken feature
ok 30 # skip Skipping YAML::Perl for known-broken feature
ok 31 # skip Skipping YAML::Perl for known-broken feature
ok 32 # skip Skipping YAML::Perl for known-broken feature
ok 33 - toolbar.yml: CPAN::Meta::YAML parses without error
ok 34 - toolbar.yml: CPAN::Meta::YAML does not modify the input string
ok 35 - The object isa CPAN::Meta::YAML
ok 36 - toolbar.yml: CPAN::Meta::YAML parses correctly
ok 37 - toolbar.yml: CPAN::Meta::YAML serializes without error
ok 38 - toolbar.yml: CPAN::Meta::YAML serializes correctly
ok 39 - toolbar.yml: CPAN::Meta::YAML round-trips without error
ok 40 - The object isa CPAN::Meta::YAML
ok 41 - toolbar.yml: CPAN::Meta::YAML round-trips correctly
ok 42 # skip Shortcutting perfect serialization tests
ok
t/18_tap.t ......... 
1..190
ok 1 - x-foo key: YAML.pm saves without error
ok 2 - x-foo key: YAML.pm serializes correctly
ok 3 - x-foo key: YAML.pm round-trips without error
ok 4 - x-foo key: YAML.pm round-trips correctly
ok 5 - x-foo key: YAML.pm loads without error
ok 6 - x-foo key: YAML.pm does not modify the input string
ok 7 - x-foo key: YAML.pm parses correctly
ok 8 - x-foo key: YAML::Syck saves without error
ok 9 - x-foo key: YAML::Syck serializes correctly
ok 10 - x-foo key: YAML::Syck round-trips without error
ok 11 - x-foo key: YAML::Syck round-trips correctly
ok 12 - x-foo key: YAML::Syck loads without error
ok 13 - x-foo key: YAML::Syck does not modify the input string
ok 14 - x-foo key: YAML::Syck parses correctly
ok 15 - x-foo key: YAML::XS saves without error
ok 16 - x-foo key: YAML::XS serializes correctly
ok 17 - x-foo key: YAML::XS round-trips without error
ok 18 - x-foo key: YAML::XS round-trips correctly
ok 19 - x-foo key: YAML::XS loads without error
ok 20 - x-foo key: YAML::XS does not modify the input string
ok 21 - x-foo key: YAML::XS parses correctly
ok 22 - x-foo key: YAML::Perl saves without error
ok 23 - x-foo key: YAML::Perl serializes correctly
ok 24 - x-foo key: YAML::Perl round-trips without error
ok 25 - x-foo key: YAML::Perl round-trips correctly
ok 26 - x-foo key: YAML::Perl loads without error
ok 27 - x-foo key: YAML::Perl does not modify the input string
ok 28 - x-foo key: YAML::Perl parses correctly
ok 29 - x-foo key: CPAN::Meta::YAML parses without error
ok 30 - x-foo key: CPAN::Meta::YAML does not modify the input string
ok 31 - The object isa CPAN::Meta::YAML
ok 32 - x-foo key: CPAN::Meta::YAML parses correctly
ok 33 - x-foo key: CPAN::Meta::YAML serializes without error
ok 34 - x-foo key: CPAN::Meta::YAML serializes correctly
ok 35 - x-foo key: CPAN::Meta::YAML round-trips without error
ok 36 - The object isa CPAN::Meta::YAML
ok 37 - x-foo key: CPAN::Meta::YAML round-trips correctly
ok 38 # skip Shortcutting perfect serialization tests
ok 39 # skip Skipping YAML.pm for known-broken feature
ok 40 # skip Skipping YAML.pm for known-broken feature
ok 41 # skip Skipping YAML.pm for known-broken feature
ok 42 # skip Skipping YAML.pm for known-broken feature
ok 43 # skip Skipping YAML.pm for known-broken feature
ok 44 # skip Skipping YAML.pm for known-broken feature
ok 45 # skip Skipping YAML.pm for known-broken feature
ok 46 # skip Skipping YAML::Syck for known-broken feature
ok 47 # skip Skipping YAML::Syck for known-broken feature
ok 48 # skip Skipping YAML::Syck for known-broken feature
ok 49 # skip Skipping YAML::Syck for known-broken feature
ok 50 # skip Skipping YAML::Syck for known-broken feature
ok 51 # skip Skipping YAML::Syck for known-broken feature
ok 52 # skip Skipping YAML::Syck for known-broken feature
ok 53 - document_end_hash: YAML::XS saves without error
ok 54 - document_end_hash: YAML::XS serializes correctly
ok 55 - document_end_hash: YAML::XS round-trips without error
ok 56 - document_end_hash: YAML::XS round-trips correctly
ok 57 - document_end_hash: YAML::XS loads without error
ok 58 - document_end_hash: YAML::XS does not modify the input string
ok 59 - document_end_hash: YAML::XS parses correctly
ok 60 # skip Skipping YAML::Perl for known-broken feature
ok 61 # skip Skipping YAML::Perl for known-broken feature
ok 62 # skip Skipping YAML::Perl for known-broken feature
ok 63 # skip Skipping YAML::Perl for known-broken feature
ok 64 # skip Skipping YAML::Perl for known-broken feature
ok 65 # skip Skipping YAML::Perl for known-broken feature
ok 66 # skip Skipping YAML::Perl for known-broken feature
ok 67 - document_end_hash: CPAN::Meta::YAML parses without error
ok 68 - document_end_hash: CPAN::Meta::YAML does not modify the input string
ok 69 - The object isa CPAN::Meta::YAML
ok 70 - document_end_hash: CPAN::Meta::YAML parses correctly
ok 71 - document_end_hash: CPAN::Meta::YAML serializes without error
ok 72 - document_end_hash: CPAN::Meta::YAML serializes correctly
ok 73 - document_end_hash: CPAN::Meta::YAML round-trips without error
ok 74 - The object isa CPAN::Meta::YAML
ok 75 - document_end_hash: CPAN::Meta::YAML round-trips correctly
ok 76 # skip Shortcutting perfect serialization tests
ok 77 # skip Skipping YAML.pm for known-broken feature
ok 78 # skip Skipping YAML.pm for known-broken feature
ok 79 # skip Skipping YAML.pm for known-broken feature
ok 80 # skip Skipping YAML.pm for known-broken feature
ok 81 # skip Skipping YAML.pm for known-broken feature
ok 82 # skip Skipping YAML.pm for known-broken feature
ok 83 # skip Skipping YAML.pm for known-broken feature
ok 84 - document_end_array: YAML::Syck saves without error
ok 85 - document_end_array: YAML::Syck serializes correctly
ok 86 - document_end_array: YAML::Syck round-trips without error
ok 87 - document_end_array: YAML::Syck round-trips correctly
ok 88 - document_end_array: YAML::Syck loads without error
ok 89 - document_end_array: YAML::Syck does not modify the input string
ok 90 - document_end_array: YAML::Syck parses correctly
ok 91 - document_end_array: YAML::XS saves without error
ok 92 - document_end_array: YAML::XS serializes correctly
ok 93 - document_end_array: YAML::XS round-trips without error
ok 94 - document_end_array: YAML::XS round-trips correctly
ok 95 - document_end_array: YAML::XS loads without error
ok 96 - document_end_array: YAML::XS does not modify the input string
ok 97 - document_end_array: YAML::XS parses correctly
ok 98 # skip Skipping YAML::Perl for known-broken feature
ok 99 # skip Skipping YAML::Perl for known-broken feature
ok 100 # skip Skipping YAML::Perl for known-broken feature
ok 101 # skip Skipping YAML::Perl for known-broken feature
ok 102 # skip Skipping YAML::Perl for known-broken feature
ok 103 # skip Skipping YAML::Perl for known-broken feature
ok 104 # skip Skipping YAML::Perl for known-broken feature
ok 105 - document_end_array: CPAN::Meta::YAML parses without error
ok 106 - document_end_array: CPAN::Meta::YAML does not modify the input string
ok 107 - The object isa CPAN::Meta::YAML
ok 108 - document_end_array: CPAN::Meta::YAML parses correctly
ok 109 - document_end_array: CPAN::Meta::YAML serializes without error
ok 110 - document_end_array: CPAN::Meta::YAML serializes correctly
ok 111 - document_end_array: CPAN::Meta::YAML round-trips without error
ok 112 - The object isa CPAN::Meta::YAML
ok 113 - document_end_array: CPAN::Meta::YAML round-trips correctly
ok 114 # skip Shortcutting perfect serialization tests
ok 115 # skip Skipping YAML.pm for known-broken feature
ok 116 # skip Skipping YAML.pm for known-broken feature
ok 117 # skip Skipping YAML.pm for known-broken feature
ok 118 # skip Skipping YAML.pm for known-broken feature
ok 119 # skip Skipping YAML.pm for known-broken feature
ok 120 # skip Skipping YAML.pm for known-broken feature
ok 121 # skip Skipping YAML.pm for known-broken feature
ok 122 # skip Skipping YAML::Syck for unsupported feature
ok 123 # skip Skipping YAML::Syck for unsupported feature
ok 124 # skip Skipping YAML::Syck for unsupported feature
ok 125 # skip Skipping YAML::Syck for unsupported feature
ok 126 # skip Skipping YAML::Syck for unsupported feature
ok 127 # skip Skipping YAML::Syck for unsupported feature
ok 128 # skip Skipping YAML::Syck for unsupported feature
ok 129 - multi_document_simple: YAML::XS saves without error
ok 130 - multi_document_simple: YAML::XS serializes correctly
ok 131 - multi_document_simple: YAML::XS round-trips without error
ok 132 - multi_document_simple: YAML::XS round-trips correctly
ok 133 - multi_document_simple: YAML::XS loads without error
ok 134 - multi_document_simple: YAML::XS does not modify the input string
ok 135 - multi_document_simple: YAML::XS parses correctly
ok 136 # skip Skipping YAML::Perl for known-broken feature
ok 137 # skip Skipping YAML::Perl for known-broken feature
ok 138 # skip Skipping YAML::Perl for known-broken feature
ok 139 # skip Skipping YAML::Perl for known-broken feature
ok 140 # skip Skipping YAML::Perl for known-broken feature
ok 141 # skip Skipping YAML::Perl for known-broken feature
ok 142 # skip Skipping YAML::Perl for known-broken feature
ok 143 - multi_document_simple: CPAN::Meta::YAML parses without error
ok 144 - multi_document_simple: CPAN::Meta::YAML does not modify the input string
ok 145 - The object isa CPAN::Meta::YAML
ok 146 - multi_document_simple: CPAN::Meta::YAML parses correctly
ok 147 - multi_document_simple: CPAN::Meta::YAML serializes without error
ok 148 - multi_document_simple: CPAN::Meta::YAML serializes correctly
ok 149 - multi_document_simple: CPAN::Meta::YAML round-trips without error
ok 150 - The object isa CPAN::Meta::YAML
ok 151 - multi_document_simple: CPAN::Meta::YAML round-trips correctly
ok 152 # skip Shortcutting perfect serialization tests
ok 153 # skip Skipping YAML.pm for known-broken feature
ok 154 # skip Skipping YAML.pm for known-broken feature
ok 155 # skip Skipping YAML.pm for known-broken feature
ok 156 # skip Skipping YAML.pm for known-broken feature
ok 157 # skip Skipping YAML.pm for known-broken feature
ok 158 # skip Skipping YAML.pm for known-broken feature
ok 159 # skip Skipping YAML.pm for known-broken feature
ok 160 # skip Skipping YAML::Syck for unsupported feature
ok 161 # skip Skipping YAML::Syck for unsupported feature
ok 162 # skip Skipping YAML::Syck for unsupported feature
ok 163 # skip Skipping YAML::Syck for unsupported feature
ok 164 # skip Skipping YAML::Syck for unsupported feature
ok 165 # skip Skipping YAML::Syck for unsupported feature
ok 166 # skip Skipping YAML::Syck for unsupported feature
ok 167 - multi_document_space: YAML::XS saves without error
ok 168 - multi_document_space: YAML::XS serializes correctly
ok 169 - multi_document_space: YAML::XS round-trips without error
ok 170 - multi_document_space: YAML::XS round-trips correctly
ok 171 - multi_document_space: YAML::XS loads without error
ok 172 - multi_document_space: YAML::XS does not modify the input string
ok 173 - multi_document_space: YAML::XS parses correctly
ok 174 # skip Skipping YAML::Perl for known-broken feature
ok 175 # skip Skipping YAML::Perl for known-broken feature
ok 176 # skip Skipping YAML::Perl for known-broken feature
ok 177 # skip Skipping YAML::Perl for known-broken feature
ok 178 # skip Skipping YAML::Perl for known-broken feature
ok 179 # skip Skipping YAML::Perl for known-broken feature
ok 180 # skip Skipping YAML::Perl for known-broken feature
ok 181 - multi_document_space: CPAN::Meta::YAML parses without error
ok 182 - multi_document_space: CPAN::Meta::YAML does not modify the input string
ok 183 - The object isa CPAN::Meta::YAML
ok 184 - multi_document_space: CPAN::Meta::YAML parses correctly
ok 185 - multi_document_space: CPAN::Meta::YAML serializes without error
ok 186 - multi_document_space: CPAN::Meta::YAML serializes correctly
ok 187 - multi_document_space: CPAN::Meta::YAML round-trips without error
ok 188 - The object isa CPAN::Meta::YAML
ok 189 - multi_document_space: CPAN::Meta::YAML round-trips correctly
ok 190 # skip Shortcutting perfect serialization tests
ok
t/19_errors.t ...... 
1..20
ok 1 - ->read_string returns undef
ok 2 - Got expected error
ok 3 - ->read_string returns undef
ok 4 - Got expected error
ok 5 - ->read_string returns undef
ok 6 - Got expected error
ok 7 - ->read_string returns undef
ok 8 - Got expected error
ok 9 - ->read_string returns undef
ok 10 - Got expected error
ok 11 - ->read_string returns undef
ok 12 - Got expected error
ok 13 - ->read_string returns undef
ok 14 - Got expected error
ok 15 - ->read_string returns undef
ok 16 - Got expected error
ok 17 - ->read_string returns undef
ok 18 - Got expected error
ok 19 - ->read_string returns undef
ok 20 - Got expected error
ok
t/20_subclass.t .... 
1..1
ok 1 - Subclassing works
ok
t/21_bom.t ......... 
1..8
ok 1 - Found utf_16_le_bom.yml
ok 2 - Can read utf_16_le_bom.yml
ok 3 - Loaded utf_16_le_bom.yml
ok 4 - Content of utf_16_le_bom.yml larger than 3 bytes
ok 5 - utf-16: CPAN::Meta::YAML parses without error
ok 6 - utf-16: CPAN::Meta::YAML does not modify the input string
ok 7 - file not parsed
ok 8 - correct error
ok
t/22_comments.t .... 
1..76
ok 1 # skip Skipping YAML.pm for known-broken feature
ok 2 # skip Skipping YAML.pm for known-broken feature
ok 3 # skip Skipping YAML.pm for known-broken feature
ok 4 # skip Skipping YAML.pm for known-broken feature
ok 5 # skip Skipping YAML.pm for known-broken feature
ok 6 # skip Skipping YAML.pm for known-broken feature
ok 7 # skip Skipping YAML.pm for known-broken feature
ok 8 - Properly ignore comments: YAML::Syck saves without error
ok 9 - Properly ignore comments: YAML::Syck serializes correctly
ok 10 - Properly ignore comments: YAML::Syck round-trips without error
ok 11 - Properly ignore comments: YAML::Syck round-trips correctly
ok 12 - Properly ignore comments: YAML::Syck loads without error
ok 13 - Properly ignore comments: YAML::Syck does not modify the input string
ok 14 - Properly ignore comments: YAML::Syck parses correctly
ok 15 - Properly ignore comments: YAML::XS saves without error
ok 16 - Properly ignore comments: YAML::XS serializes correctly
ok 17 - Properly ignore comments: YAML::XS round-trips without error
ok 18 - Properly ignore comments: YAML::XS round-trips correctly
ok 19 - Properly ignore comments: YAML::XS loads without error
ok 20 - Properly ignore comments: YAML::XS does not modify the input string
ok 21 - Properly ignore comments: YAML::XS parses correctly
ok 22 - Properly ignore comments: YAML::Perl saves without error
ok 23 - Properly ignore comments: YAML::Perl serializes correctly
ok 24 - Properly ignore comments: YAML::Perl round-trips without error
ok 25 - Properly ignore comments: YAML::Perl round-trips correctly
ok 26 - Properly ignore comments: YAML::Perl loads without error
ok 27 - Properly ignore comments: YAML::Perl does not modify the input string
ok 28 - Properly ignore comments: YAML::Perl parses correctly
ok 29 - Properly ignore comments: CPAN::Meta::YAML parses without error
ok 30 - Properly ignore comments: CPAN::Meta::YAML does not modify the input string
ok 31 - The object isa CPAN::Meta::YAML
ok 32 - Properly ignore comments: CPAN::Meta::YAML parses correctly
ok 33 - Properly ignore comments: CPAN::Meta::YAML serializes without error
ok 34 - Properly ignore comments: CPAN::Meta::YAML serializes correctly
ok 35 - Properly ignore comments: CPAN::Meta::YAML round-trips without error
ok 36 - The object isa CPAN::Meta::YAML
ok 37 - Properly ignore comments: CPAN::Meta::YAML round-trips correctly
ok 38 # skip Shortcutting perfect serialization tests
ok 39 # skip Skipping YAML.pm for known-broken feature
ok 40 # skip Skipping YAML.pm for known-broken feature
ok 41 # skip Skipping YAML.pm for known-broken feature
ok 42 # skip Skipping YAML.pm for known-broken feature
ok 43 # skip Skipping YAML.pm for known-broken feature
ok 44 # skip Skipping YAML.pm for known-broken feature
ok 45 # skip Skipping YAML.pm for known-broken feature
ok 46 - Properly ignore comments (with otherwise illegal characters): YAML::Syck saves without error
ok 47 - Properly ignore comments (with otherwise illegal characters): YAML::Syck serializes correctly
ok 48 - Properly ignore comments (with otherwise illegal characters): YAML::Syck round-trips without error
ok 49 - Properly ignore comments (with otherwise illegal characters): YAML::Syck round-trips correctly
ok 50 - Properly ignore comments (with otherwise illegal characters): YAML::Syck loads without error
ok 51 - Properly ignore comments (with otherwise illegal characters): YAML::Syck does not modify the input string
ok 52 - Properly ignore comments (with otherwise illegal characters): YAML::Syck parses correctly
ok 53 - Properly ignore comments (with otherwise illegal characters): YAML::XS saves without error
ok 54 - Properly ignore comments (with otherwise illegal characters): YAML::XS serializes correctly
ok 55 - Properly ignore comments (with otherwise illegal characters): YAML::XS round-trips without error
ok 56 - Properly ignore comments (with otherwise illegal characters): YAML::XS round-trips correctly
ok 57 - Properly ignore comments (with otherwise illegal characters): YAML::XS loads without error
ok 58 - Properly ignore comments (with otherwise illegal characters): YAML::XS does not modify the input string
ok 59 - Properly ignore comments (with otherwise illegal characters): YAML::XS parses correctly
ok 60 - Properly ignore comments (with otherwise illegal characters): YAML::Perl saves without error
ok 61 - Properly ignore comments (with otherwise illegal characters): YAML::Perl serializes correctly
ok 62 - Properly ignore comments (with otherwise illegal characters): YAML::Perl round-trips without error
ok 63 - Properly ignore comments (with otherwise illegal characters): YAML::Perl round-trips correctly
ok 64 - Properly ignore comments (with otherwise illegal characters): YAML::Perl loads without error
ok 65 - Properly ignore comments (with otherwise illegal characters): YAML::Perl does not modify the input string
ok 66 - Properly ignore comments (with otherwise illegal characters): YAML::Perl parses correctly
ok 67 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML parses without error
ok 68 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML does not modify the input string
ok 69 - The object isa CPAN::Meta::YAML
ok 70 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML parses correctly
ok 71 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML serializes without error
ok 72 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML serializes correctly
ok 73 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML round-trips without error
ok 74 - The object isa CPAN::Meta::YAML
ok 75 - Properly ignore comments (with otherwise illegal characters): CPAN::Meta::YAML round-trips correctly
ok 76 # skip Shortcutting perfect serialization tests
ok
All tests successful.
Files=17, Tests=3445,  8 wallclock secs ( 0.30 usr +  0.05 sys =  0.34 CPU)
Result: PASS
  DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz
  nmake test TEST_VERBOSE=1 -- OK
PPD for CPAN-Meta-YAML-0.003 already made
Running test for module 'JSON::PP'
Running make for M/MA/MAKAMAKA/JSON-PP-2.27105.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
Checksum for C:\cpanfly-5.12\var\cpan\sources\authors\id\M\MA\MAKAMAKA\JSON-PP-2.27105.tar.gz ok
JSON-PP-2.27105/
JSON-PP-2.27105/lib/
JSON-PP-2.27105/lib/JSON/
JSON-PP-2.27105/lib/JSON/PP/
JSON-PP-2.27105/lib/JSON/PP/Boolean.pm
JSON-PP-2.27105/lib/JSON/PP.pm
JSON-PP-2.27105/Makefile.PL
JSON-PP-2.27105/README
JSON-PP-2.27105/t/
JSON-PP-2.27105/t/012_blessed.t
JSON-PP-2.27105/t/014_latin1.t
JSON-PP-2.27105/t/108_decode.t
JSON-PP-2.27105/t/008_pc_base.t
JSON-PP-2.27105/t/107_allow_singlequote.t
JSON-PP-2.27105/t/009_pc_extra_number.t
JSON-PP-2.27105/t/011_pc_expo.t
JSON-PP-2.27105/t/113_overloaded_eq.t
JSON-PP-2.27105/t/021_evans_bugrep.t
JSON-PP-2.27105/t/114_decode_prefix.t
JSON-PP-2.27105/t/003_types.t
JSON-PP-2.27105/t/015_prefix.t
JSON-PP-2.27105/t/007_pc_esc.t
JSON-PP-2.27105/t/016_tied.t
JSON-PP-2.27105/t/106_allow_barekey.t
JSON-PP-2.27105/t/010_pc_keysort.t
JSON-PP-2.27105/t/022_comment_at_eof.t
JSON-PP-2.27105/t/110_bignum.t
JSON-PP-2.27105/t/001_utf8.t
JSON-PP-2.27105/t/013_limit.t
JSON-PP-2.27105/t/006_pc_pretty.t
JSON-PP-2.27105/t/000_load.t
JSON-PP-2.27105/t/_unicode_handling.pm
JSON-PP-2.27105/t/109_encode.t
JSON-PP-2.27105/t/104_sortby.t
JSON-PP-2.27105/t/112_upgrade.t
JSON-PP-2.27105/t/020_unknown.t
JSON-PP-2.27105/t/019_incr.t
JSON-PP-2.27105/t/018_json_checker.t
JSON-PP-2.27105/t/017_relaxed.t
JSON-PP-2.27105/t/105_esc_slash.t
JSON-PP-2.27105/t/115_tie_ixhash.t
JSON-PP-2.27105/t/002_error.t
JSON-PP-2.27105/t/099_binary.t
JSON-PP-2.27105/MANIFEST
JSON-PP-2.27105/META.yml
JSON-PP-2.27105/bin/
JSON-PP-2.27105/bin/json_pp
JSON-PP-2.27105/Changes
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build M/MA/MAKAMAKA/JSON-PP-2.27105.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for JSON::PP
>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

cp lib/JSON/PP.pm blib\lib\JSON\PP.pm
cp lib/JSON/PP/Boolean.pm blib\lib\JSON\PP\Boolean.pm
	C:\Perl-5.12\bin\perl.exe -MExtUtils::Command -e "cp" -- bin/json_pp blib\script\json_pp
	pl2bat.bat blib\script\json_pp
  MAKAMAKA/JSON-PP-2.27105.tar.gz
  nmake -- OK
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
>>> nmake test TEST_VERBOSE=1

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t
t/000_load.t ............... 
1..1
ok 1
ok
t/001_utf8.t ............... 
1..9
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok
t/002_error.t .............. 
1..31
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/003_types.t .............. 
1..76
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok
t/006_pc_pretty.t .......... 
1..9
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6 - nospace
ok 7 - after
ok 8 - both
ok 9 - before
ok
t/007_pc_esc.t ............. 
1..17
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - {"id":"abc\ndef"}
ok 16 - {"id":"abc\\ndef"}
ok 17 - {"id":"abc\\\ndef"}
ok
t/008_pc_base.t ............ 
1..20
ok 1 - {}
ok 2 - []
ok 3
ok 4 - {"foo":"bar"}
ok 5 - {"foo":""}
ok 6 - {"foo":" "}
ok 7 - {"foo":"0"} - autoencode (default)
ok 8 - {"foo":"0 0"}
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - invalid value (coderef)
ok 20 - invalid value (ref)
ok
t/009_pc_extra_number.t .... 
1..6
ok 1 - normal 0
ok 2 - normal 0.1
ok 3 - normal 10
ok 4 - normal -10
ok 5 - normal 0
ok 6 - normal 0.1
ok
t/010_pc_keysort.t ......... 
1..1
ok 1
ok
t/011_pc_expo.t ............ 
1..8
ok 1 - digit -12.34
ok 2 - digit -12.34
ok 3 - digit -1.234e5
ok 4 - digit -1.234e5
ok 5 - digit 1.23E-4
ok 6 - digit 1.23E-4
ok 7 - digit 1.01e+67
ok 8 - digit 1.01e+67
ok
t/012_blessed.t ............ 
1..16
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/013_limit.t .............. 
1..11
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok
t/014_latin1.t ............. 
1..4
ok 1
ok 2
ok 3
ok 4
ok
t/015_prefix.t ............. 
1..4
ok 1
ok 2
ok 3
ok 4
ok
t/016_tied.t ............... 
1..2
ok 1
ok 2
ok
t/017_relaxed.t ............ 
1..8
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/018_json_checker.t ....... 
1..39
ok 1 - fail1.json
#  (JSON text must be an object or array (but found number, string, true, false or null, use allow_nonref to allow this) at t/018_json_checker.t line 28
# )
ok 2 - fail10.json
#  (garbage after JSON object, at character offset 35 (before "misplaced quoted val...") at t/018_json_checker.t line 28
# )
ok 3 - fail11.json
#  (, or } expected while parsing object/hash, at character offset 25 (before "+ 2}") at t/018_json_checker.t line 28
# )
ok 4 - fail12.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 23 (before "alert()}") at t/018_json_checker.t line 28
# )
ok 5 - fail13.json
#  (malformed number (leading zero must not be followed by another digit), at character offset 40 (before "13}") at t/018_json_checker.t line 28
# )
ok 6 - fail14.json
#  (malformed number (leading zero must not be followed by another digit), at character offset 27 (before "x14}") at t/018_json_checker.t line 28
# )
ok 7 - fail15.json
#  (illegal backslash escape sequence in string, at character offset 28 (before "\\x15"]") at t/018_json_checker.t line 28
# )
ok 8 - fail16.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 1 (before "\\naked]") at t/018_json_checker.t line 28
# )
ok 9 - fail17.json
#  (illegal backslash escape sequence in string, at character offset 28 (before "\\017"]") at t/018_json_checker.t line 28
# )
ok 10 - fail18.json
#  (json text or perl structure exceeds maximum nesting level (max_depth set too low?), at character offset 33 (before ""Too deep"]]]]]]]]]]...") at t/018_json_checker.t line 28
# )
ok 11 - fail19.json
#  (':' expected, at character offset 17 (before "null}") at t/018_json_checker.t line 28
# )
ok 12 - fail2.json
#  (, or ] expected while parsing array, at character offset 17 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 13 - fail20.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 16 (before ": null}") at t/018_json_checker.t line 28
# )
ok 14 - fail21.json
#  (':' expected, at character offset 25 (before ", null}") at t/018_json_checker.t line 28
# )
ok 15 - fail22.json
#  (, or ] expected while parsing array, at character offset 26 (before " false]") at t/018_json_checker.t line 28
# )
ok 16 - fail23.json
#  ('true' expected, at character offset 14 (before "truth]") at t/018_json_checker.t line 28
# )
ok 17 - fail24.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 1 (before "'single quote']") at t/018_json_checker.t line 28
# )
ok 18 - fail25.json
#  (invalid character encountered while parsing JSON string, at character offset 2 (before "\ttab\tcharacter\tin...") at t/018_json_checker.t line 28
# )
ok 19 - fail26.json
#  (illegal backslash escape sequence in string, at character offset 5 (before "\\   character\\   i...") at t/018_json_checker.t line 28
# )
ok 20 - fail27.json
#  (invalid character encountered while parsing JSON string, at character offset 6 (before "\nbreak"]") at t/018_json_checker.t line 28
# )
ok 21 - fail28.json
#  (illegal backslash escape sequence in string, at character offset 6 (before "\\\nbreak"]") at t/018_json_checker.t line 28
# )
ok 22 - fail29.json
#  (malformed number (no digits after exp sign), at character offset 4 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 23 - fail3.json
#  (unexpected end of string while parsing JSON string, at character offset 2 (before "nquoted_key: "keys m...") at t/018_json_checker.t line 28
# )
ok 24 - fail30.json
#  (malformed number (no digits after exp sign), at character offset 5 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 25 - fail31.json
#  (malformed number (no digits after exp sign), at character offset 5 (before "1]") at t/018_json_checker.t line 28
# )
ok 26 - fail32.json
#  (, or } expected while parsing object/hash, at character offset 39 (before ",") at t/018_json_checker.t line 28
# )
ok 27 - fail33.json
#  (, or ] expected while parsing array, at character offset 12 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 28 - fail4.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 15 (before "]") at t/018_json_checker.t line 28
# )
ok 29 - fail5.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 22 (before ",]") at t/018_json_checker.t line 28
# )
ok 30 - fail6.json
#  (malformed JSON string, neither array, object, number, string or atom, at character offset 4 (before ", "<-- missing value...") at t/018_json_checker.t line 28
# )
ok 31 - fail7.json
#  (garbage after JSON object, at character offset 26 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 32 - fail8.json
#  (garbage after JSON object, at character offset 16 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 33 - fail9.json
#  (unexpected end of string while parsing JSON string, at character offset 22 (before "(end of string)") at t/018_json_checker.t line 28
# )
ok 34 - pass1.json
# 
ok 35
ok 36 - pass2.json
# 
ok 37
ok 38 - pass3.json
# 
ok 39
ok
t/019_incr.t ............... 
1..697
ok 1
ok 2 - data
ok 3 - tailws
ok 4
ok 5 - data
ok 6 - tailws
ok 7
ok 8 - data
ok 9 - tailws
ok 10
ok 11 - data
ok 12 - tailws
ok 13
ok 14 - data
ok 15 - tailws
ok 16
ok 17 - data
ok 18 - tailws
ok 19
ok 20 - data
ok 21 - tailws
ok 22
ok 23 - data
ok 24 - tailws
ok 25
ok 26 - data
ok 27 - tailws
ok 28
ok 29 - data
ok 30 - tailws
ok 31
ok 32 - data
ok 33 - tailws
ok 34
ok 35 - data
ok 36 - tailws
ok 37
ok 38 - data
ok 39 - tailws
ok 40
ok 41 - data
ok 42 - tailws
ok 43
ok 44 - data
ok 45 - tailws
ok 46
ok 47 - data
ok 48 - tailws
ok 49
ok 50 - data
ok 51 - tailws
ok 52
ok 53 - data
ok 54 - tailws
ok 55
ok 56 - data
ok 57 - tailws
ok 58
ok 59 - data
ok 60 - tailws
ok 61
ok 62 - data
ok 63 - tailws
ok 64
ok 65 - data
ok 66 - tailws
ok 67
ok 68 - data
ok 69 - tailws
ok 70
ok 71 - data
ok 72 - tailws
ok 73
ok 74 - data
ok 75 - tailws
ok 76
ok 77 - data
ok 78 - tailws
ok 79
ok 80 - data
ok 81 - tailws
ok 82
ok 83 - data
ok 84 - tailws
ok 85
ok 86 - data
ok 87 - tailws
ok 88
ok 89 - data
ok 90 - tailws
ok 91
ok 92 - data
ok 93 - tailws
ok 94
ok 95 - data
ok 96 - tailws
ok 97
ok 98 - data
ok 99 - tailws
ok 100
ok 101 - data
ok 102 - tailws
ok 103
ok 104 - data
ok 105 - tailws
ok 106
ok 107 - data
ok 108 - tailws
ok 109
ok 110 - data
ok 111 - tailws
ok 112
ok 113 - data
ok 114 - tailws
ok 115
ok 116 - data
ok 117 - tailws
ok 118
ok 119 - data
ok 120 - tailws
ok 121
ok 122 - data
ok 123 - tailws
ok 124
ok 125 - data
ok 126 - tailws
ok 127
ok 128 - data
ok 129 - tailws
ok 130
ok 131 - data
ok 132 - tailws
ok 133
ok 134 - data
ok 135 - tailws
ok 136
ok 137 - data
ok 138 - tailws
ok 139
ok 140 - data
ok 141 - tailws
ok 142
ok 143 - data
ok 144 - tailws
ok 145
ok 146 - data
ok 147 - tailws
ok 148
ok 149 - data
ok 150 - tailws
ok 151
ok 152 - data
ok 153 - tailws
ok 154
ok 155 - data
ok 156 - tailws
ok 157
ok 158 - data
ok 159 - tailws
ok 160
ok 161 - data
ok 162 - tailws
ok 163
ok 164 - data
ok 165 - tailws
ok 166
ok 167 - data
ok 168 - tailws
ok 169
ok 170 - data
ok 171 - tailws
ok 172
ok 173 - data
ok 174 - tailws
ok 175
ok 176 - data
ok 177 - tailws
ok 178
ok 179 - data
ok 180 - tailws
ok 181
ok 182 - data
ok 183 - tailws
ok 184
ok 185 - data
ok 186 - tailws
ok 187
ok 188 - data
ok 189 - tailws
ok 190
ok 191 - data
ok 192 - tailws
ok 193
ok 194 - data
ok 195 - tailws
ok 196
ok 197 - data
ok 198 - tailws
ok 199
ok 200 - data
ok 201 - tailws
ok 202
ok 203 - data
ok 204 - tailws
ok 205
ok 206 - data
ok 207 - tailws
ok 208
ok 209 - data
ok 210 - tailws
ok 211
ok 212 - data
ok 213 - tailws
ok 214
ok 215 - data
ok 216 - tailws
ok 217
ok 218 - data
ok 219 - tailws
ok 220
ok 221 - data
ok 222 - tailws
ok 223
ok 224 - data
ok 225 - tailws
ok 226
ok 227 - data
ok 228 - tailws
ok 229
ok 230 - data
ok 231 - tailws
ok 232
ok 233 - data
ok 234 - tailws
ok 235
ok 236 - data
ok 237 - tailws
ok 238
ok 239 - data
ok 240 - tailws
ok 241
ok 242 - data
ok 243 - tailws
ok 244
ok 245 - data
ok 246 - tailws
ok 247
ok 248 - data
ok 249 - tailws
ok 250
ok 251 - data
ok 252 - tailws
ok 253
ok 254 - data
ok 255 - tailws
ok 256
ok 257 - data
ok 258 - tailws
ok 259
ok 260 - data
ok 261 - tailws
ok 262
ok 263 - data
ok 264 - tailws
ok 265
ok 266 - data
ok 267 - tailws
ok 268
ok 269 - data
ok 270 - tailws
ok 271
ok 272 - data
ok 273 - tailws
ok 274
ok 275 - data
ok 276 - tailws
ok 277
ok 278 - data
ok 279 - tailws
ok 280
ok 281 - data
ok 282 - tailws
ok 283
ok 284 - data
ok 285 - tailws
ok 286
ok 287 - data
ok 288 - tailws
ok 289
ok 290 - data
ok 291 - tailws
ok 292
ok 293 - data
ok 294 - tailws
ok 295
ok 296 - data
ok 297 - tailws
ok 298
ok 299 - data
ok 300 - tailws
ok 301
ok 302 - data
ok 303 - tailws
ok 304
ok 305 - data
ok 306 - tailws
ok 307
ok 308 - data
ok 309 - tailws
ok 310
ok 311 - data
ok 312 - tailws
ok 313
ok 314 - data
ok 315 - tailws
ok 316
ok 317 - data
ok 318 - tailws
ok 319
ok 320 - data
ok 321 - tailws
ok 322
ok 323 - data
ok 324 - tailws
ok 325
ok 326 - data
ok 327 - tailws
ok 328
ok 329 - data
ok 330 - tailws
ok 331
ok 332 - data
ok 333 - tailws
ok 334
ok 335 - data
ok 336 - tailws
ok 337 - cskip1
ok 338 - cskip2
ok 339 - cskip3
ok 340 - cskip4
ok 341 - cskip5
ok 342 - cjson1
ok 343 - cjson2
ok 344 - cjson3
ok 345 - cjson4
ok 346 - cjson5
ok 347 - cskip1
ok 348 - cskip2
ok 349 - cskip3
ok 350 - cskip4
ok 351 - cskip5
ok 352 - cjson1
ok 353 - cjson2
ok 354 - cjson3
ok 355 - cjson4
ok 356 - cjson5
ok 357 - cskip1
ok 358 - cskip2
ok 359 - cskip3
ok 360 - cskip4
ok 361 - cskip5
ok 362 - cjson1
ok 363 - cjson2
ok 364 - cjson3
ok 365 - cjson4
ok 366 - cjson5
ok 367 - cskip1
ok 368 - cskip2
ok 369 - cskip3
ok 370 - cskip4
ok 371 - cskip5
ok 372 - cjson1
ok 373 - cjson2
ok 374 - cjson3
ok 375 - cjson4
ok 376 - cjson5
ok 377 - cskip1
ok 378 - cskip2
ok 379 - cskip3
ok 380 - cskip4
ok 381 - cskip5
ok 382 - cjson1
ok 383 - cjson2
ok 384 - cjson3
ok 385 - cjson4
ok 386 - cjson5
ok 387 - cskip1
ok 388 - cskip2
ok 389 - cskip3
ok 390 - cskip4
ok 391 - cskip5
ok 392 - cjson1
ok 393 - cjson2
ok 394 - cjson3
ok 395 - cjson4
ok 396 - cjson5
ok 397 - cskip1
ok 398 - cskip2
ok 399 - cskip3
ok 400 - cskip4
ok 401 - cskip5
ok 402 - cjson1
ok 403 - cjson2
ok 404 - cjson3
ok 405 - cjson4
ok 406 - cjson5
ok 407 - cskip1
ok 408 - cskip2
ok 409 - cskip3
ok 410 - cskip4
ok 411 - cskip5
ok 412 - cjson1
ok 413 - cjson2
ok 414 - cjson3
ok 415 - cjson4
ok 416 - cjson5
ok 417 - cskip1
ok 418 - cskip2
ok 419 - cskip3
ok 420 - cskip4
ok 421 - cskip5
ok 422 - cjson1
ok 423 - cjson2
ok 424 - cjson3
ok 425 - cjson4
ok 426 - cjson5
ok 427 - cskip1
ok 428 - cskip2
ok 429 - cskip3
ok 430 - cskip4
ok 431 - cskip5
ok 432 - cjson1
ok 433 - cjson2
ok 434 - cjson3
ok 435 - cjson4
ok 436 - cjson5
ok 437 - cskip1
ok 438 - cskip2
ok 439 - cskip3
ok 440 - cskip4
ok 441 - cskip5
ok 442 - cjson1
ok 443 - cjson2
ok 444 - cjson3
ok 445 - cjson4
ok 446 - cjson5
ok 447 - cskip1
ok 448 - cskip2
ok 449 - cskip3
ok 450 - cskip4
ok 451 - cskip5
ok 452 - cjson1
ok 453 - cjson2
ok 454 - cjson3
ok 455 - cjson4
ok 456 - cjson5
ok 457 - cskip1
ok 458 - cskip2
ok 459 - cskip3
ok 460 - cskip4
ok 461 - cskip5
ok 462 - cjson1
ok 463 - cjson2
ok 464 - cjson3
ok 465 - cjson4
ok 466 - cjson5
ok 467 - cskip1
ok 468 - cskip2
ok 469 - cskip3
ok 470 - cskip4
ok 471 - cskip5
ok 472 - cjson1
ok 473 - cjson2
ok 474 - cjson3
ok 475 - cjson4
ok 476 - cjson5
ok 477 - cskip1
ok 478 - cskip2
ok 479 - cskip3
ok 480 - cskip4
ok 481 - cskip5
ok 482 - cjson1
ok 483 - cjson2
ok 484 - cjson3
ok 485 - cjson4
ok 486 - cjson5
ok 487 - cskip1
ok 488 - cskip2
ok 489 - cskip3
ok 490 - cskip4
ok 491 - cskip5
ok 492 - cjson1
ok 493 - cjson2
ok 494 - cjson3
ok 495 - cjson4
ok 496 - cjson5
ok 497 - cskip1
ok 498 - cskip2
ok 499 - cskip3
ok 500 - cskip4
ok 501 - cskip5
ok 502 - cjson1
ok 503 - cjson2
ok 504 - cjson3
ok 505 - cjson4
ok 506 - cjson5
ok 507 - cskip1
ok 508 - cskip2
ok 509 - cskip3
ok 510 - cskip4
ok 511 - cskip5
ok 512 - cjson1
ok 513 - cjson2
ok 514 - cjson3
ok 515 - cjson4
ok 516 - cjson5
ok 517 - cskip1
ok 518 - cskip2
ok 519 - cskip3
ok 520 - cskip4
ok 521 - cskip5
ok 522 - cjson1
ok 523 - cjson2
ok 524 - cjson3
ok 525 - cjson4
ok 526 - cjson5
ok 527 - cskip1
ok 528 - cskip2
ok 529 - cskip3
ok 530 - cskip4
ok 531 - cskip5
ok 532 - cjson1
ok 533 - cjson2
ok 534 - cjson3
ok 535 - cjson4
ok 536 - cjson5
ok 537 - cskip1
ok 538 - cskip2
ok 539 - cskip3
ok 540 - cskip4
ok 541 - cskip5
ok 542 - cjson1
ok 543 - cjson2
ok 544 - cjson3
ok 545 - cjson4
ok 546 - cjson5
ok 547 - cskip1
ok 548 - cskip2
ok 549 - cskip3
ok 550 - cskip4
ok 551 - cskip5
ok 552 - cjson1
ok 553 - cjson2
ok 554 - cjson3
ok 555 - cjson4
ok 556 - cjson5
ok 557 - cskip1
ok 558 - cskip2
ok 559 - cskip3
ok 560 - cskip4
ok 561 - cskip5
ok 562 - cjson1
ok 563 - cjson2
ok 564 - cjson3
ok 565 - cjson4
ok 566 - cjson5
ok 567 - cskip1
ok 568 - cskip2
ok 569 - cskip3
ok 570 - cskip4
ok 571 - cskip5
ok 572 - cjson1
ok 573 - cjson2
ok 574 - cjson3
ok 575 - cjson4
ok 576 - cjson5
ok 577 - cskip1
ok 578 - cskip2
ok 579 - cskip3
ok 580 - cskip4
ok 581 - cskip5
ok 582 - cjson1
ok 583 - cjson2
ok 584 - cjson3
ok 585 - cjson4
ok 586 - cjson5
ok 587 - cskip1
ok 588 - cskip2
ok 589 - cskip3
ok 590 - cskip4
ok 591 - cskip5
ok 592 - cjson1
ok 593 - cjson2
ok 594 - cjson3
ok 595 - cjson4
ok 596 - cjson5
ok 597 - cskip1
ok 598 - cskip2
ok 599 - cskip3
ok 600 - cskip4
ok 601 - cskip5
ok 602 - cjson1
ok 603 - cjson2
ok 604 - cjson3
ok 605 - cjson4
ok 606 - cjson5
ok 607 - cskip1
ok 608 - cskip2
ok 609 - cskip3
ok 610 - cskip4
ok 611 - cskip5
ok 612 - cjson1
ok 613 - cjson2
ok 614 - cjson3
ok 615 - cjson4
ok 616 - cjson5
ok 617 - cskip1
ok 618 - cskip2
ok 619 - cskip3
ok 620 - cskip4
ok 621 - cskip5
ok 622 - cjson1
ok 623 - cjson2
ok 624 - cjson3
ok 625 - cjson4
ok 626 - cjson5
ok 627 - cskip1
ok 628 - cskip2
ok 629 - cskip3
ok 630 - cskip4
ok 631 - cskip5
ok 632 - cjson1
ok 633 - cjson2
ok 634 - cjson3
ok 635 - cjson4
ok 636 - cjson5
ok 637 - cskip1
ok 638 - cskip2
ok 639 - cskip3
ok 640 - cskip4
ok 641 - cskip5
ok 642 - cjson1
ok 643 - cjson2
ok 644 - cjson3
ok 645 - cjson4
ok 646 - cjson5
ok 647 - cskip1
ok 648 - cskip2
ok 649 - cskip3
ok 650 - cskip4
ok 651 - cskip5
ok 652 - cjson1
ok 653 - cjson2
ok 654 - cjson3
ok 655 - cjson4
ok 656 - cjson5
ok 657 - cskip1
ok 658 - cskip2
ok 659 - cskip3
ok 660 - cskip4
ok 661 - cskip5
ok 662 - cjson1
ok 663 - cjson2
ok 664 - cjson3
ok 665 - cjson4
ok 666 - cjson5
ok 667 - cskip1
ok 668 - cskip2
ok 669 - cskip3
ok 670 - cskip4
ok 671 - cskip5
ok 672 - cjson1
ok 673 - cjson2
ok 674 - cjson3
ok 675 - cjson4
ok 676 - cjson5
ok 677 - cskip1
ok 678 - cskip2
ok 679 - cskip3
ok 680 - cskip4
ok 681 - cskip5
ok 682 - cjson1
ok 683 - cjson2
ok 684 - cjson3
ok 685 - cjson4
ok 686 - cjson5
ok 687 - sparse1
ok 688 - sparse2
ok 689 - sparse3
ok 690 - incsize1
ok 691 - incsize2 attempted decode of JSON text of 6 bytes size, but max_size is set to 5 at (eval 41) line 1
# 
ok 692 - incdepth1
ok 693 - incdepth2 json text or perl structure exceeds maximum nesting level (max_depth set too low?) at (eval 42) line 1
# 
ok 694 - unbalanced bracket
ok 695 - got error
ok 696 - malformed json string error
ok 697 - valid data after incr_skip
ok
t/020_unknown.t ............ 
1..10
ok 1 - encountered CODE(0x1a73b1c), but JSON can only represent references to arrays or hashes at (eval 40) line 1
# 
ok 2 - cannot encode reference to scalar at (eval 41) line 1
# 
ok 3 - cannot encode reference to scalar at (eval 42) line 1
# 
ok 4 - cannot encode reference to scalar at (eval 43) line 1
# 
ok 5
ok 6
ok 7
ok 8
ok 9 - encountered GLOB(0x18bf48c), but JSON can only represent references to arrays or hashes at (eval 48) line 1
# 
ok 10
ok
t/021_evans_bugrep.t ....... 
1..6
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok
t/022_comment_at_eof.t ..... 
1..13
ok 1 - array baseline
ok 2 - space ignored before array
ok 3 - newline ignored before array
ok 4 - comment ignored before array
ok 5 - comment ignored before array
ok 6 - comment ignored before array
ok 7 - comment ignored inside array
ok 8 - eof baseline
ok 9 - space ignored before eof
ok 10 - newline ignored before eof
ok 11 - comment ignored before eof
ok 12 - comment ignored before eof
ok 13 - array and string in multiple lines
ok
t/099_binary.t ............. 
1..2432
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517
ok 518
ok 519
ok 520
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561
ok 562
ok 563
ok 564
ok 565
ok 566
ok 567
ok 568
ok 569
ok 570
ok 571
ok 572
ok 573
ok 574
ok 575
ok 576
ok 577
ok 578
ok 579
ok 580
ok 581
ok 582
ok 583
ok 584
ok 585
ok 586
ok 587
ok 588
ok 589
ok 590
ok 591
ok 592
ok 593
ok 594
ok 595
ok 596
ok 597
ok 598
ok 599
ok 600
ok 601
ok 602
ok 603
ok 604
ok 605
ok 606
ok 607
ok 608
ok 609
ok 610
ok 611
ok 612
ok 613
ok 614
ok 615
ok 616
ok 617
ok 618
ok 619
ok 620
ok 621
ok 622
ok 623
ok 624
ok 625
ok 626
ok 627
ok 628
ok 629
ok 630
ok 631
ok 632
ok 633
ok 634
ok 635
ok 636
ok 637
ok 638
ok 639
ok 640
ok 641
ok 642
ok 643
ok 644
ok 645
ok 646
ok 647
ok 648
ok 649
ok 650
ok 651
ok 652
ok 653
ok 654
ok 655
ok 656
ok 657
ok 658
ok 659
ok 660
ok 661
ok 662
ok 663
ok 664
ok 665
ok 666
ok 667
ok 668
ok 669
ok 670
ok 671
ok 672
ok 673
ok 674
ok 675
ok 676
ok 677
ok 678
ok 679
ok 680
ok 681
ok 682
ok 683
ok 684
ok 685
ok 686
ok 687
ok 688
ok 689
ok 690
ok 691
ok 692
ok 693
ok 694
ok 695
ok 696
ok 697
ok 698
ok 699
ok 700
ok 701
ok 702
ok 703
ok 704
ok 705
ok 706
ok 707
ok 708
ok 709
ok 710
ok 711
ok 712
ok 713
ok 714
ok 715
ok 716
ok 717
ok 718
ok 719
ok 720
ok 721
ok 722
ok 723
ok 724
ok 725
ok 726
ok 727
ok 728
ok 729
ok 730
ok 731
ok 732
ok 733
ok 734
ok 735
ok 736
ok 737
ok 738
ok 739
ok 740
ok 741
ok 742
ok 743
ok 744
ok 745
ok 746
ok 747
ok 748
ok 749
ok 750
ok 751
ok 752
ok 753
ok 754
ok 755
ok 756
ok 757
ok 758
ok 759
ok 760
ok 761
ok 762
ok 763
ok 764
ok 765
ok 766
ok 767
ok 768
ok 769
ok 770
ok 771
ok 772
ok 773
ok 774
ok 775
ok 776
ok 777
ok 778
ok 779
ok 780
ok 781
ok 782
ok 783
ok 784
ok 785
ok 786
ok 787
ok 788
ok 789
ok 790
ok 791
ok 792
ok 793
ok 794
ok 795
ok 796
ok 797
ok 798
ok 799
ok 800
ok 801
ok 802
ok 803
ok 804
ok 805
ok 806
ok 807
ok 808
ok 809
ok 810
ok 811
ok 812
ok 813
ok 814
ok 815
ok 816
ok 817
ok 818
ok 819
ok 820
ok 821
ok 822
ok 823
ok 824
ok 825
ok 826
ok 827
ok 828
ok 829
ok 830
ok 831
ok 832
ok 833
ok 834
ok 835
ok 836
ok 837
ok 838
ok 839
ok 840
ok 841
ok 842
ok 843
ok 844
ok 845
ok 846
ok 847
ok 848
ok 849
ok 850
ok 851
ok 852
ok 853
ok 854
ok 855
ok 856
ok 857
ok 858
ok 859
ok 860
ok 861
ok 862
ok 863
ok 864
ok 865
ok 866
ok 867
ok 868
ok 869
ok 870
ok 871
ok 872
ok 873
ok 874
ok 875
ok 876
ok 877
ok 878
ok 879
ok 880
ok 881
ok 882
ok 883
ok 884
ok 885
ok 886
ok 887
ok 888
ok 889
ok 890
ok 891
ok 892
ok 893
ok 894
ok 895
ok 896
ok 897
ok 898
ok 899
ok 900
ok 901
ok 902
ok 903
ok 904
ok 905
ok 906
ok 907
ok 908
ok 909
ok 910
ok 911
ok 912
ok 913
ok 914
ok 915
ok 916
ok 917
ok 918
ok 919
ok 920
ok 921
ok 922
ok 923
ok 924
ok 925
ok 926
ok 927
ok 928
ok 929
ok 930
ok 931
ok 932
ok 933
ok 934
ok 935
ok 936
ok 937
ok 938
ok 939
ok 940
ok 941
ok 942
ok 943
ok 944
ok 945
ok 946
ok 947
ok 948
ok 949
ok 950
ok 951
ok 952
ok 953
ok 954
ok 955
ok 956
ok 957
ok 958
ok 959
ok 960
ok 961
ok 962
ok 963
ok 964
ok 965
ok 966
ok 967
ok 968
ok 969
ok 970
ok 971
ok 972
ok 973
ok 974
ok 975
ok 976
ok 977
ok 978
ok 979
ok 980
ok 981
ok 982
ok 983
ok 984
ok 985
ok 986
ok 987
ok 988
ok 989
ok 990
ok 991
ok 992
ok 993
ok 994
ok 995
ok 996
ok 997
ok 998
ok 999
ok 1000
ok 1001
ok 1002
ok 1003
ok 1004
ok 1005
ok 1006
ok 1007
ok 1008
ok 1009
ok 1010
ok 1011
ok 1012
ok 1013
ok 1014
ok 1015
ok 1016
ok 1017
ok 1018
ok 1019
ok 1020
ok 1021
ok 1022
ok 1023
ok 1024
ok 1025
ok 1026
ok 1027
ok 1028
ok 1029
ok 1030
ok 1031
ok 1032
ok 1033
ok 1034
ok 1035
ok 1036
ok 1037
ok 1038
ok 1039
ok 1040
ok 1041
ok 1042
ok 1043
ok 1044
ok 1045
ok 1046
ok 1047
ok 1048
ok 1049
ok 1050
ok 1051
ok 1052
ok 1053
ok 1054
ok 1055
ok 1056
ok 1057
ok 1058
ok 1059
ok 1060
ok 1061
ok 1062
ok 1063
ok 1064
ok 1065
ok 1066
ok 1067
ok 1068
ok 1069
ok 1070
ok 1071
ok 1072
ok 1073
ok 1074
ok 1075
ok 1076
ok 1077
ok 1078
ok 1079
ok 1080
ok 1081
ok 1082
ok 1083
ok 1084
ok 1085
ok 1086
ok 1087
ok 1088
ok 1089
ok 1090
ok 1091
ok 1092
ok 1093
ok 1094
ok 1095
ok 1096
ok 1097
ok 1098
ok 1099
ok 1100
ok 1101
ok 1102
ok 1103
ok 1104
ok 1105
ok 1106
ok 1107
ok 1108
ok 1109
ok 1110
ok 1111
ok 1112
ok 1113
ok 1114
ok 1115
ok 1116
ok 1117
ok 1118
ok 1119
ok 1120
ok 1121
ok 1122
ok 1123
ok 1124
ok 1125
ok 1126
ok 1127
ok 1128
ok 1129
ok 1130
ok 1131
ok 1132
ok 1133
ok 1134
ok 1135
ok 1136
ok 1137
ok 1138
ok 1139
ok 1140
ok 1141
ok 1142
ok 1143
ok 1144
ok 1145
ok 1146
ok 1147
ok 1148
ok 1149
ok 1150
ok 1151
ok 1152
ok 1153
ok 1154
ok 1155
ok 1156
ok 1157
ok 1158
ok 1159
ok 1160
ok 1161
ok 1162
ok 1163
ok 1164
ok 1165
ok 1166
ok 1167
ok 1168
ok 1169
ok 1170
ok 1171
ok 1172
ok 1173
ok 1174
ok 1175
ok 1176
ok 1177
ok 1178
ok 1179
ok 1180
ok 1181
ok 1182
ok 1183
ok 1184
ok 1185
ok 1186
ok 1187
ok 1188
ok 1189
ok 1190
ok 1191
ok 1192
ok 1193
ok 1194
ok 1195
ok 1196
ok 1197
ok 1198
ok 1199
ok 1200
ok 1201
ok 1202
ok 1203
ok 1204
ok 1205
ok 1206
ok 1207
ok 1208
ok 1209
ok 1210
ok 1211
ok 1212
ok 1213
ok 1214
ok 1215
ok 1216
ok 1217
ok 1218
ok 1219
ok 1220
ok 1221
ok 1222
ok 1223
ok 1224
ok 1225
ok 1226
ok 1227
ok 1228
ok 1229
ok 1230
ok 1231
ok 1232
ok 1233
ok 1234
ok 1235
ok 1236
ok 1237
ok 1238
ok 1239
ok 1240
ok 1241
ok 1242
ok 1243
ok 1244
ok 1245
ok 1246
ok 1247
ok 1248
ok 1249
ok 1250
ok 1251
ok 1252
ok 1253
ok 1254
ok 1255
ok 1256
ok 1257
ok 1258
ok 1259
ok 1260
ok 1261
ok 1262
ok 1263
ok 1264
ok 1265
ok 1266
ok 1267
ok 1268
ok 1269
ok 1270
ok 1271
ok 1272
ok 1273
ok 1274
ok 1275
ok 1276
ok 1277
ok 1278
ok 1279
ok 1280
ok 1281
ok 1282
ok 1283
ok 1284
ok 1285
ok 1286
ok 1287
ok 1288
ok 1289
ok 1290
ok 1291
ok 1292
ok 1293
ok 1294
ok 1295
ok 1296
ok 1297
ok 1298
ok 1299
ok 1300
ok 1301
ok 1302
ok 1303
ok 1304
ok 1305
ok 1306
ok 1307
ok 1308
ok 1309
ok 1310
ok 1311
ok 1312
ok 1313
ok 1314
ok 1315
ok 1316
ok 1317
ok 1318
ok 1319
ok 1320
ok 1321
ok 1322
ok 1323
ok 1324
ok 1325
ok 1326
ok 1327
ok 1328
ok 1329
ok 1330
ok 1331
ok 1332
ok 1333
ok 1334
ok 1335
ok 1336
ok 1337
ok 1338
ok 1339
ok 1340
ok 1341
ok 1342
ok 1343
ok 1344
ok 1345
ok 1346
ok 1347
ok 1348
ok 1349
ok 1350
ok 1351
ok 1352
ok 1353
ok 1354
ok 1355
ok 1356
ok 1357
ok 1358
ok 1359
ok 1360
ok 1361
ok 1362
ok 1363
ok 1364
ok 1365
ok 1366
ok 1367
ok 1368
ok 1369
ok 1370
ok 1371
ok 1372
ok 1373
ok 1374
ok 1375
ok 1376
ok 1377
ok 1378
ok 1379
ok 1380
ok 1381
ok 1382
ok 1383
ok 1384
ok 1385
ok 1386
ok 1387
ok 1388
ok 1389
ok 1390
ok 1391
ok 1392
ok 1393
ok 1394
ok 1395
ok 1396
ok 1397
ok 1398
ok 1399
ok 1400
ok 1401
ok 1402
ok 1403
ok 1404
ok 1405
ok 1406
ok 1407
ok 1408
ok 1409
ok 1410
ok 1411
ok 1412
ok 1413
ok 1414
ok 1415
ok 1416
ok 1417
ok 1418
ok 1419
ok 1420
ok 1421
ok 1422
ok 1423
ok 1424
ok 1425
ok 1426
ok 1427
ok 1428
ok 1429
ok 1430
ok 1431
ok 1432
ok 1433
ok 1434
ok 1435
ok 1436
ok 1437
ok 1438
ok 1439
ok 1440
ok 1441
ok 1442
ok 1443
ok 1444
ok 1445
ok 1446
ok 1447
ok 1448
ok 1449
ok 1450
ok 1451
ok 1452
ok 1453
ok 1454
ok 1455
ok 1456
ok 1457
ok 1458
ok 1459
ok 1460
ok 1461
ok 1462
ok 1463
ok 1464
ok 1465
ok 1466
ok 1467
ok 1468
ok 1469
ok 1470
ok 1471
ok 1472
ok 1473
ok 1474
ok 1475
ok 1476
ok 1477
ok 1478
ok 1479
ok 1480
ok 1481
ok 1482
ok 1483
ok 1484
ok 1485
ok 1486
ok 1487
ok 1488
ok 1489
ok 1490
ok 1491
ok 1492
ok 1493
ok 1494
ok 1495
ok 1496
ok 1497
ok 1498
ok 1499
ok 1500
ok 1501
ok 1502
ok 1503
ok 1504
ok 1505
ok 1506
ok 1507
ok 1508
ok 1509
ok 1510
ok 1511
ok 1512
ok 1513
ok 1514
ok 1515
ok 1516
ok 1517
ok 1518
ok 1519
ok 1520
ok 1521
ok 1522
ok 1523
ok 1524
ok 1525
ok 1526
ok 1527
ok 1528
ok 1529
ok 1530
ok 1531
ok 1532
ok 1533
ok 1534
ok 1535
ok 1536
ok 1537
ok 1538
ok 1539
ok 1540
ok 1541
ok 1542
ok 1543
ok 1544
ok 1545
ok 1546
ok 1547
ok 1548
ok 1549
ok 1550
ok 1551
ok 1552
ok 1553
ok 1554
ok 1555
ok 1556
ok 1557
ok 1558
ok 1559
ok 1560
ok 1561
ok 1562
ok 1563
ok 1564
ok 1565
ok 1566
ok 1567
ok 1568
ok 1569
ok 1570
ok 1571
ok 1572
ok 1573
ok 1574
ok 1575
ok 1576
ok 1577
ok 1578
ok 1579
ok 1580
ok 1581
ok 1582
ok 1583
ok 1584
ok 1585
ok 1586
ok 1587
ok 1588
ok 1589
ok 1590
ok 1591
ok 1592
ok 1593
ok 1594
ok 1595
ok 1596
ok 1597
ok 1598
ok 1599
ok 1600
ok 1601
ok 1602
ok 1603
ok 1604
ok 1605
ok 1606
ok 1607
ok 1608
ok 1609
ok 1610
ok 1611
ok 1612
ok 1613
ok 1614
ok 1615
ok 1616
ok 1617
ok 1618
ok 1619
ok 1620
ok 1621
ok 1622
ok 1623
ok 1624
ok 1625
ok 1626
ok 1627
ok 1628
ok 1629
ok 1630
ok 1631
ok 1632
ok 1633
ok 1634
ok 1635
ok 1636
ok 1637
ok 1638
ok 1639
ok 1640
ok 1641
ok 1642
ok 1643
ok 1644
ok 1645
ok 1646
ok 1647
ok 1648
ok 1649
ok 1650
ok 1651
ok 1652
ok 1653
ok 1654
ok 1655
ok 1656
ok 1657
ok 1658
ok 1659
ok 1660
ok 1661
ok 1662
ok 1663
ok 1664
ok 1665
ok 1666
ok 1667
ok 1668
ok 1669
ok 1670
ok 1671
ok 1672
ok 1673
ok 1674
ok 1675
ok 1676
ok 1677
ok 1678
ok 1679
ok 1680
ok 1681
ok 1682
ok 1683
ok 1684
ok 1685
ok 1686
ok 1687
ok 1688
ok 1689
ok 1690
ok 1691
ok 1692
ok 1693
ok 1694
ok 1695
ok 1696
ok 1697
ok 1698
ok 1699
ok 1700
ok 1701
ok 1702
ok 1703
ok 1704
ok 1705
ok 1706
ok 1707
ok 1708
ok 1709
ok 1710
ok 1711
ok 1712
ok 1713
ok 1714
ok 1715
ok 1716
ok 1717
ok 1718
ok 1719
ok 1720
ok 1721
ok 1722
ok 1723
ok 1724
ok 1725
ok 1726
ok 1727
ok 1728
ok 1729
ok 1730
ok 1731
ok 1732
ok 1733
ok 1734
ok 1735
ok 1736
ok 1737
ok 1738
ok 1739
ok 1740
ok 1741
ok 1742
ok 1743
ok 1744
ok 1745
ok 1746
ok 1747
ok 1748
ok 1749
ok 1750
ok 1751
ok 1752
ok 1753
ok 1754
ok 1755
ok 1756
ok 1757
ok 1758
ok 1759
ok 1760
ok 1761
ok 1762
ok 1763
ok 1764
ok 1765
ok 1766
ok 1767
ok 1768
ok 1769
ok 1770
ok 1771
ok 1772
ok 1773
ok 1774
ok 1775
ok 1776
ok 1777
ok 1778
ok 1779
ok 1780
ok 1781
ok 1782
ok 1783
ok 1784
ok 1785
ok 1786
ok 1787
ok 1788
ok 1789
ok 1790
ok 1791
ok 1792
ok 1793
ok 1794
ok 1795
ok 1796
ok 1797
ok 1798
ok 1799
ok 1800
ok 1801
ok 1802
ok 1803
ok 1804
ok 1805
ok 1806
ok 1807
ok 1808
ok 1809
ok 1810
ok 1811
ok 1812
ok 1813
ok 1814
ok 1815
ok 1816
ok 1817
ok 1818
ok 1819
ok 1820
ok 1821
ok 1822
ok 1823
ok 1824
ok 1825
ok 1826
ok 1827
ok 1828
ok 1829
ok 1830
ok 1831
ok 1832
ok 1833
ok 1834
ok 1835
ok 1836
ok 1837
ok 1838
ok 1839
ok 1840
ok 1841
ok 1842
ok 1843
ok 1844
ok 1845
ok 1846
ok 1847
ok 1848
ok 1849
ok 1850
ok 1851
ok 1852
ok 1853
ok 1854
ok 1855
ok 1856
ok 1857
ok 1858
ok 1859
ok 1860
ok 1861
ok 1862
ok 1863
ok 1864
ok 1865
ok 1866
ok 1867
ok 1868
ok 1869
ok 1870
ok 1871
ok 1872
ok 1873
ok 1874
ok 1875
ok 1876
ok 1877
ok 1878
ok 1879
ok 1880
ok 1881
ok 1882
ok 1883
ok 1884
ok 1885
ok 1886
ok 1887
ok 1888
ok 1889
ok 1890
ok 1891
ok 1892
ok 1893
ok 1894
ok 1895
ok 1896
ok 1897
ok 1898
ok 1899
ok 1900
ok 1901
ok 1902
ok 1903
ok 1904
ok 1905
ok 1906
ok 1907
ok 1908
ok 1909
ok 1910
ok 1911
ok 1912
ok 1913
ok 1914
ok 1915
ok 1916
ok 1917
ok 1918
ok 1919
ok 1920
ok 1921
ok 1922
ok 1923
ok 1924
ok 1925
ok 1926
ok 1927
ok 1928
ok 1929
ok 1930
ok 1931
ok 1932
ok 1933
ok 1934
ok 1935
ok 1936
ok 1937
ok 1938
ok 1939
ok 1940
ok 1941
ok 1942
ok 1943
ok 1944
ok 1945
ok 1946
ok 1947
ok 1948
ok 1949
ok 1950
ok 1951
ok 1952
ok 1953
ok 1954
ok 1955
ok 1956
ok 1957
ok 1958
ok 1959
ok 1960
ok 1961
ok 1962
ok 1963
ok 1964
ok 1965
ok 1966
ok 1967
ok 1968
ok 1969
ok 1970
ok 1971
ok 1972
ok 1973
ok 1974
ok 1975
ok 1976
ok 1977
ok 1978
ok 1979
ok 1980
ok 1981
ok 1982
ok 1983
ok 1984
ok 1985
ok 1986
ok 1987
ok 1988
ok 1989
ok 1990
ok 1991
ok 1992
ok 1993
ok 1994
ok 1995
ok 1996
ok 1997
ok 1998
ok 1999
ok 2000
ok 2001
ok 2002
ok 2003
ok 2004
ok 2005
ok 2006
ok 2007
ok 2008
ok 2009
ok 2010
ok 2011
ok 2012
ok 2013
ok 2014
ok 2015
ok 2016
ok 2017
ok 2018
ok 2019
ok 2020
ok 2021
ok 2022
ok 2023
ok 2024
ok 2025
ok 2026
ok 2027
ok 2028
ok 2029
ok 2030
ok 2031
ok 2032
ok 2033
ok 2034
ok 2035
ok 2036
ok 2037
ok 2038
ok 2039
ok 2040
ok 2041
ok 2042
ok 2043
ok 2044
ok 2045
ok 2046
ok 2047
ok 2048
ok 2049
ok 2050
ok 2051
ok 2052
ok 2053
ok 2054
ok 2055
ok 2056
ok 2057
ok 2058
ok 2059
ok 2060
ok 2061
ok 2062
ok 2063
ok 2064
ok 2065
ok 2066
ok 2067
ok 2068
ok 2069
ok 2070
ok 2071
ok 2072
ok 2073
ok 2074
ok 2075
ok 2076
ok 2077
ok 2078
ok 2079
ok 2080
ok 2081
ok 2082
ok 2083
ok 2084
ok 2085
ok 2086
ok 2087
ok 2088
ok 2089
ok 2090
ok 2091
ok 2092
ok 2093
ok 2094
ok 2095
ok 2096
ok 2097
ok 2098
ok 2099
ok 2100
ok 2101
ok 2102
ok 2103
ok 2104
ok 2105
ok 2106
ok 2107
ok 2108
ok 2109
ok 2110
ok 2111
ok 2112
ok 2113
ok 2114
ok 2115
ok 2116
ok 2117
ok 2118
ok 2119
ok 2120
ok 2121
ok 2122
ok 2123
ok 2124
ok 2125
ok 2126
ok 2127
ok 2128
ok 2129
ok 2130
ok 2131
ok 2132
ok 2133
ok 2134
ok 2135
ok 2136
ok 2137
ok 2138
ok 2139
ok 2140
ok 2141
ok 2142
ok 2143
ok 2144
ok 2145
ok 2146
ok 2147
ok 2148
ok 2149
ok 2150
ok 2151
ok 2152
ok 2153
ok 2154
ok 2155
ok 2156
ok 2157
ok 2158
ok 2159
ok 2160
ok 2161
ok 2162
ok 2163
ok 2164
ok 2165
ok 2166
ok 2167
ok 2168
ok 2169
ok 2170
ok 2171
ok 2172
ok 2173
ok 2174
ok 2175
ok 2176
ok 2177
ok 2178
ok 2179
ok 2180
ok 2181
ok 2182
ok 2183
ok 2184
ok 2185
ok 2186
ok 2187
ok 2188
ok 2189
ok 2190
ok 2191
ok 2192
ok 2193
ok 2194
ok 2195
ok 2196
ok 2197
ok 2198
ok 2199
ok 2200
ok 2201
ok 2202
ok 2203
ok 2204
ok 2205
ok 2206
ok 2207
ok 2208
ok 2209
ok 2210
ok 2211
ok 2212
ok 2213
ok 2214
ok 2215
ok 2216
ok 2217
ok 2218
ok 2219
ok 2220
ok 2221
ok 2222
ok 2223
ok 2224
ok 2225
ok 2226
ok 2227
ok 2228
ok 2229
ok 2230
ok 2231
ok 2232
ok 2233
ok 2234
ok 2235
ok 2236
ok 2237
ok 2238
ok 2239
ok 2240
ok 2241
ok 2242
ok 2243
ok 2244
ok 2245
ok 2246
ok 2247
ok 2248
ok 2249
ok 2250
ok 2251
ok 2252
ok 2253
ok 2254
ok 2255
ok 2256
ok 2257
ok 2258
ok 2259
ok 2260
ok 2261
ok 2262
ok 2263
ok 2264
ok 2265
ok 2266
ok 2267
ok 2268
ok 2269
ok 2270
ok 2271
ok 2272
ok 2273
ok 2274
ok 2275
ok 2276
ok 2277
ok 2278
ok 2279
ok 2280
ok 2281
ok 2282
ok 2283
ok 2284
ok 2285
ok 2286
ok 2287
ok 2288
ok 2289
ok 2290
ok 2291
ok 2292
ok 2293
ok 2294
ok 2295
ok 2296
ok 2297
ok 2298
ok 2299
ok 2300
ok 2301
ok 2302
ok 2303
ok 2304
ok 2305
ok 2306
ok 2307
ok 2308
ok 2309
ok 2310
ok 2311
ok 2312
ok 2313
ok 2314
ok 2315
ok 2316
ok 2317
ok 2318
ok 2319
ok 2320
ok 2321
ok 2322
ok 2323
ok 2324
ok 2325
ok 2326
ok 2327
ok 2328
ok 2329
ok 2330
ok 2331
ok 2332
ok 2333
ok 2334
ok 2335
ok 2336
ok 2337
ok 2338
ok 2339
ok 2340
ok 2341
ok 2342
ok 2343
ok 2344
ok 2345
ok 2346
ok 2347
ok 2348
ok 2349
ok 2350
ok 2351
ok 2352
ok 2353
ok 2354
ok 2355
ok 2356
ok 2357
ok 2358
ok 2359
ok 2360
ok 2361
ok 2362
ok 2363
ok 2364
ok 2365
ok 2366
ok 2367
ok 2368
ok 2369
ok 2370
ok 2371
ok 2372
ok 2373
ok 2374
ok 2375
ok 2376
ok 2377
ok 2378
ok 2379
ok 2380
ok 2381
ok 2382
ok 2383
ok 2384
ok 2385
ok 2386
ok 2387
ok 2388
ok 2389
ok 2390
ok 2391
ok 2392
ok 2393
ok 2394
ok 2395
ok 2396
ok 2397
ok 2398
ok 2399
ok 2400
ok 2401
ok 2402
ok 2403
ok 2404
ok 2405
ok 2406
ok 2407
ok 2408
ok 2409
ok 2410
ok 2411
ok 2412
ok 2413
ok 2414
ok 2415
ok 2416
ok 2417
ok 2418
ok 2419
ok 2420
ok 2421
ok 2422
ok 2423
ok 2424
ok 2425
ok 2426
ok 2427
ok 2428
ok 2429
ok 2430
ok 2431
ok 2432
ok
t/104_sortby.t ............. 
1..3
ok 1
ok 2
ok 3
ok
t/105_esc_slash.t .......... 
1..2
ok 1
ok 2
ok
t/106_allow_barekey.t ...... 
1..2
ok 1
ok 2
ok
t/107_allow_singlequote.t .. 
1..4
ok 1
ok 2
ok 3
ok 4
ok
t/108_decode.t ............. 
1..6
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok
t/109_encode.t ............. 
1..7
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok
t/110_bignum.t ............. 
1..6
ok 1 - The object isa Math::BigInt
ok 2
ok 3
ok 4 - The object isa Math::BigFloat
ok 5
ok 6
ok
t/112_upgrade.t ............ 
1..3
ok 1
ok 2
ok 3
ok
t/113_overloaded_eq.t ...... 
1..4
ok 1
ok 2
ok 3
ok 4
ok
t/114_decode_prefix.t ...... 
1..8
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/115_tie_ixhash.t ......... 
1..2
ok 1
ok 2
ok
All tests successful.
Files=33, Tests=3467, 10 wallclock secs ( 0.44 usr +  0.02 sys =  0.45 CPU)
Result: PASS
  MAKAMAKA/JSON-PP-2.27105.tar.gz
  nmake test TEST_VERBOSE=1 -- OK
PPD for JSON-PP-2.27105 already made
Running make for D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP
Prepending C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz

>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

cp lib/Parse/CPAN/Meta.pm blib\lib\Parse\CPAN\Meta.pm
  DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz
  nmake -- OK
Prepending C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
>>> nmake test TEST_VERBOSE=1

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t
t/01_compile.t .... 
1..3
ok 1 - Your perl is new enough
ok 2 - use Parse::CPAN::Meta;
ok 3 - use Parse::CPAN::Meta::Test;
ok
t/02_api.t ........ 
ok 1 - yaml_backend()
ok 2 - load from YAML file results in expected data
ok 3 - Found VR-META.yml
ok 4 - Can read VR-META.yml
ok 5 - Loaded VR-META.yml
ok 6 - Content of VR-META.yml larger than 100 bytes
ok 7 - load from YAML str results in expected data
ok 8 - yaml_backend()
ok 9 - Found VR-META.yml
ok 10 - Can read VR-META.yml
ok 11 - Loaded VR-META.yml
ok 12 - Content of VR-META.yml larger than 100 bytes
ok 13 - load_yaml_string using PERL_YAML_BACKEND
ok 14 - json_backend()
ok 15 - load from JSON file results in expected data
ok 16 - Found VR-META.json
ok 17 - Can read VR-META.json
ok 18 - Loaded VR-META.json
ok 19 - Content of VR-META.json larger than 100 bytes
ok 20 - load from JSON str results in expected data
ok 21 - Found VR-META.json
ok 22 - Can read VR-META.json
ok 23 - Loaded VR-META.json
ok 24 - Content of VR-META.json larger than 100 bytes
ok 25 - load_json_string with PERL_JSON_BACKEND = 0
ok 26 - Found VR-META.json
ok 27 - Can read VR-META.json
ok 28 - Loaded VR-META.json
ok 29 - Content of VR-META.json larger than 100 bytes
ok 30 - load_json_string with PERL_JSON_BACKEND = 'JSON::PP'
ok 31 # skip JSON module version 2.5 not installed
ok 32 # skip JSON module version 2.5 not installed
1..32
ok
t/03_functions.t .. 
1..2
ok 1 - one: Parsed correctly
ok 2 - two: Parsed correctly
ok
t/04_export.t ..... 
1..4
ok 1 - Load is not exported
ok 2 - Dump is not exported
ok 3 - LoadFile is not exported
ok 4 - DumpFile is not exported
ok
t/05_errors.t ..... 
1..1
ok 1 - error causes exception
ok
All tests successful.
Files=5, Tests=42,  1 wallclock secs ( 0.03 usr +  0.01 sys =  0.05 CPU)
Result: PASS
  DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz
  nmake test TEST_VERBOSE=1 -- OK
PPD for Parse-CPAN-Meta-1.4401 already made
Running test for module 'CPAN::Meta::YAML'
Running make for D/DA/DAGOLDEN/CPAN-Meta-YAML-0.003.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'
  Has already been made
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
  Has already been tested successfully
Running test for module 'JSON::PP'
Running make for M/MA/MAKAMAKA/JSON-PP-2.27105.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'
  Has already been made
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
  Has already been tested successfully
Running make for D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/CPAN-Meta-2.110930.tar.gz

>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

cp lib/CPAN/Meta.pm blib\lib\CPAN\Meta.pm
cp lib/CPAN/Meta/Prereqs.pm blib\lib\CPAN\Meta\Prereqs.pm
cp lib/CPAN/Meta/History.pm blib\lib\CPAN\Meta\History.pm
cp lib/CPAN/Meta/Converter.pm blib\lib\CPAN\Meta\Converter.pm
cp lib/CPAN/Meta/Validator.pm blib\lib\CPAN\Meta\Validator.pm
cp lib/CPAN/Meta/Feature.pm blib\lib\CPAN\Meta\Feature.pm
cp lib/CPAN/Meta/Spec.pm blib\lib\CPAN\Meta\Spec.pm
  DAGOLDEN/CPAN-Meta-2.110930.tar.gz
  nmake -- OK
Prepending C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB for 'test'
Running make test
>>> nmake test TEST_VERBOSE=1

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\Perl-5.12\bin\perl.exe "-MExtUtils::Command::MM" "-e" "test_harness(1, 'blib\lib', 'blib\arch')" t/*.t
t/converter-bad.t ..... 
ok 1 - loaded restrictive-2.json
ok 2 - down converted spec version 2 to spec version 1.2
ok 3 - down converted META is valid
ok 4 - down converted spec version 2 to spec version 1.0
ok 5 - down converted META is valid
ok 6 - loaded META-2.json
ok 7 - down converted spec version 2 to spec version 1.2
ok 8 - down converted META is valid
ok 9 - down converted spec version 2 to spec version 1.0
ok 10 - down converted META is valid
ok 11 - loaded META-1_4.yml
ok 12 - up converted spec version 1.4 to spec version 2
ok 13 - up converted META is valid
ok 14 - down converted spec version 1.4 to spec version 1.2
ok 15 - down converted META is valid
ok 16 - down converted spec version 1.4 to spec version 1.0
ok 17 - down converted META is valid
ok 18 - loaded META-1_3.yml
ok 19 - up converted spec version 1.3 to spec version 2
ok 20 - up converted META is valid
ok 21 - up converted spec version 1.3 to spec version 1.4
ok 22 - up converted META is valid
ok 23 - down converted spec version 1.3 to spec version 1.2
ok 24 - down converted META is valid
ok 25 - down converted spec version 1.3 to spec version 1.0
ok 26 - down converted META is valid
ok 27 - loaded META-1_2.yml
ok 28 - up converted spec version 1.2 to spec version 2
ok 29 - up converted META is valid
ok 30 - up converted spec version 1.2 to spec version 1.4
ok 31 - up converted META is valid
ok 32 - down converted spec version 1.2 to spec version 1.0
ok 33 - down converted META is valid
ok 34 - loaded META-1_1.yml
ok 35 - up converted spec version 1.1 to spec version 2
ok 36 - up converted META is valid
ok 37 - up converted spec version 1.1 to spec version 1.4
ok 38 - up converted META is valid
ok 39 - down converted spec version 1.1 to spec version 1.0
ok 40 - down converted META is valid
ok 41 - loaded META-1_0.yml
ok 42 - up converted spec version 1.0 to spec version 2
ok 43 - up converted META is valid
ok 44 - up converted spec version 1.0 to spec version 1.4
ok 45 - up converted META is valid
ok 46 - loaded 98042513-META.yml
ok 47 - up converted spec version 1.0 to spec version 2
ok 48 - up converted META is valid
ok 49 - up converted spec version 1.0 to spec version 1.4
ok 50 - up converted META is valid
ok 51 - loaded 476602558-META.yml
ok 52 - up converted spec version 1.4 to spec version 2
ok 53 - up converted META is valid
ok 54 - down converted spec version 1.4 to spec version 1.2
ok 55 - down converted META is valid
ok 56 - down converted spec version 1.4 to spec version 1.0
ok 57 - down converted META is valid
ok 58 - loaded 35478989-META.yml
ok 59 - up converted spec version 1.3 to spec version 2
ok 60 - up converted META is valid
ok 61 - up converted spec version 1.3 to spec version 1.4
ok 62 - up converted META is valid
ok 63 - down converted spec version 1.3 to spec version 1.2
ok 64 - down converted META is valid
ok 65 - down converted spec version 1.3 to spec version 1.0
ok 66 - down converted META is valid
ok 67 - loaded 344981821-META.yml
ok 68 - up converted spec version 1.3 to spec version 2
ok 69 - up converted META is valid
ok 70 - up converted spec version 1.3 to spec version 1.4
ok 71 - up converted META is valid
ok 72 - down converted spec version 1.3 to spec version 1.2
ok 73 - down converted META is valid
ok 74 - down converted spec version 1.3 to spec version 1.0
ok 75 - down converted META is valid
ok 76 - loaded 284247103-META.yml
ok 77 - up converted spec version 1.2 to spec version 2
ok 78 - up converted META is valid
ok 79 - up converted spec version 1.2 to spec version 1.4
ok 80 - up converted META is valid
ok 81 - down converted spec version 1.2 to spec version 1.0
ok 82 - down converted META is valid
ok 83 - loaded 2031017050-META.yml
ok 84 - up converted spec version 1.4 to spec version 2
ok 85 - up converted META is valid
ok 86 - down converted spec version 1.4 to spec version 1.2
ok 87 - down converted META is valid
ok 88 - down converted spec version 1.4 to spec version 1.0
ok 89 - down converted META is valid
ok 90 - loaded 1985980974-META.yml
ok 91 - up converted spec version 1.4 to spec version 2
ok 92 - up converted META is valid
ok 93 - down converted spec version 1.4 to spec version 1.2
ok 94 - down converted META is valid
ok 95 - down converted spec version 1.4 to spec version 1.0
ok 96 - down converted META is valid
ok 97 - loaded 1985684504-META.yml
ok 98 - up converted spec version 1.2 to spec version 2
ok 99 - up converted META is valid
ok 100 - up converted spec version 1.2 to spec version 1.4
ok 101 - up converted META is valid
ok 102 - down converted spec version 1.2 to spec version 1.0
ok 103 - down converted META is valid
ok 104 - loaded 1927486199-META.yml
ok 105 - up converted spec version 1.0 to spec version 2
ok 106 - up converted META is valid
ok 107 - up converted spec version 1.0 to spec version 1.4
ok 108 - up converted META is valid
ok 109 - loaded 1598804075-META.yml
ok 110 - up converted spec version 1.0 to spec version 2
ok 111 - up converted META is valid
ok 112 - up converted spec version 1.0 to spec version 1.4
ok 113 - up converted META is valid
ok 114 - loaded 1206545041-META.yml
ok 115 - up converted spec version 1.0 to spec version 2
ok 116 - up converted META is valid
ok 117 - up converted spec version 1.0 to spec version 1.4
ok 118 - up converted META is valid
ok 119 - loaded 1122575719-META.yml
ok 120 - up converted spec version 1.4 to spec version 2
ok 121 - up converted META is valid
ok 122 - down converted spec version 1.4 to spec version 1.2
ok 123 - down converted META is valid
ok 124 - down converted spec version 1.4 to spec version 1.0
ok 125 - down converted META is valid
ok 126 - loaded 107650337-META.yml
ok 127 - up converted spec version 1.2 to spec version 2
ok 128 - up converted META is valid
ok 129 - up converted spec version 1.2 to spec version 1.4
ok 130 - up converted META is valid
ok 131 - down converted spec version 1.2 to spec version 1.0
ok 132 - down converted META is valid
1..132
ok
t/converter-fail.t .... 
ok 1 - loaded invalid META-2.json
ok 2 - error thrown down converting
ok 3 - loaded invalid META-1_4.yml
ok 4 - error thrown up converting
ok 5 - error thrown down converting
ok 6 - loaded invalid META-1_3.yml
ok 7 - error thrown up converting
ok 8 - error thrown down converting
ok 9 - loaded invalid META-1_2.yml
ok 10 - error thrown up converting
ok 11 - error thrown down converting
ok 12 - loaded invalid META-1_1.yml
ok 13 - error thrown up converting
ok 14 - error thrown down converting
ok 15 - loaded invalid META-1_0.yml
ok 16 - error thrown up converting
1..16
ok
t/converter.t ......... 
ok 1 - loaded restrictive-1_4.yml
ok 2 - up converted spec version 1.4 to spec version 2
ok 3 - up converted META is valid
ok 4 - up converted spec version 1.4 to spec version 1.4
ok 5 - up converted META is valid
ok 6 - down converted spec version 1.4 to spec version 1.2
ok 7 - down converted META is valid
ok 8 - down converted spec version 1.4 to spec version 1.0
ok 9 - down converted META is valid
ok 10 - added converter mark to generated_by
ok 11 - loaded restricted-2.json
ok 12 - up converted spec version 2 to spec version 2
ok 13 - up converted META is valid
ok 14 - down converted spec version 2 to spec version 1.2
ok 15 - down converted META is valid
ok 16 - downconversion from 2 merge test and build requirements
ok 17 - down converted spec version 2 to spec version 1.0
ok 18 - down converted META is valid
ok 19 - added converter mark to generated_by
ok 20 - loaded resources.yml
ok 21 - up converted spec version 1.4 to spec version 2
ok 22 - up converted META is valid
ok 23 - up converted spec version 1.4 to spec version 1.4
ok 24 - up converted META is valid
ok 25 - down converted spec version 1.4 to spec version 1.2
ok 26 - down converted META is valid
ok 27 - down converted spec version 1.4 to spec version 1.0
ok 28 - down converted META is valid
ok 29 - added converter mark to generated_by
ok 30 - loaded gpl-1_4.yml
ok 31 - up converted spec version 1.4 to spec version 2
ok 32 - up converted META is valid
ok 33 - up converted spec version 1.4 to spec version 1.4
ok 34 - up converted META is valid
ok 35 - down converted spec version 1.4 to spec version 1.2
ok 36 - down converted META is valid
ok 37 - down converted spec version 1.4 to spec version 1.0
ok 38 - down converted META is valid
ok 39 - added converter mark to generated_by
ok 40 - loaded META-2.json
ok 41 - up converted spec version 2 to spec version 2
ok 42 - up converted META is valid
ok 43 - down converted spec version 2 to spec version 1.2
ok 44 - down converted META is valid
ok 45 - downconversion from 2 merge test and build requirements
ok 46 - down converted spec version 2 to spec version 1.0
ok 47 - down converted META is valid
ok 48 - added converter mark to generated_by
ok 49 - loaded META-1_4.yml
ok 50 - up converted spec version 1.4 to spec version 2
ok 51 - up converted META is valid
ok 52 - up converted spec version 1.4 to spec version 1.4
ok 53 - up converted META is valid
ok 54 - down converted spec version 1.4 to spec version 1.2
ok 55 - down converted META is valid
ok 56 - down converted spec version 1.4 to spec version 1.0
ok 57 - down converted META is valid
ok 58 - added converter mark to generated_by
ok 59 - loaded META-1_3.yml
ok 60 - up converted spec version 1.3 to spec version 2
ok 61 - up converted META is valid
ok 62 - up converted spec version 1.3 to spec version 1.4
ok 63 - up converted META is valid
ok 64 - down converted spec version 1.3 to spec version 1.2
ok 65 - down converted META is valid
ok 66 - down converted spec version 1.3 to spec version 1.0
ok 67 - down converted META is valid
ok 68 - added converter mark to generated_by
ok 69 - loaded META-1_2.yml
ok 70 - up converted spec version 1.2 to spec version 2
ok 71 - up converted META is valid
ok 72 - up converted spec version 1.2 to spec version 1.4
ok 73 - up converted META is valid
ok 74 - down converted spec version 1.2 to spec version 1.2
ok 75 - down converted META is valid
ok 76 - down converted spec version 1.2 to spec version 1.0
ok 77 - down converted META is valid
ok 78 - added converter mark to generated_by
ok 79 - loaded META-1_1.yml
ok 80 - up converted spec version 1.1 to spec version 2
ok 81 - up converted META is valid
ok 82 - up converted spec version 1.1 to spec version 1.4
ok 83 - up converted META is valid
ok 84 - down converted spec version 1.1 to spec version 1.0
ok 85 - down converted META is valid
ok 86 - added converter mark to generated_by
ok 87 - loaded META-1_0.yml
ok 88 - up converted spec version 1.0 to spec version 2
ok 89 - up converted META is valid
ok 90 - up converted spec version 1.0 to spec version 1.4
ok 91 - up converted META is valid
ok 92 - down converted spec version 1.0 to spec version 1.0
ok 93 - down converted META is valid
ok 94 - loaded META-1_4.yml
ok 95 - up converted 'x-' to 'x_'
ok 96 - up converted 'x_' as 'x_'
ok 97 - up converted 'XFoo' to 'x_Foo'
ok 98 - loaded META-2.json
ok 99 - down converted 'x_' as 'x_'
ok 100 - loaded gpl-1_4.yml
ok 101 - up converted 'gpl' to 'open_source'
ok 102 - loaded resources.yml
ok 103 - upconversion of resources
1..103
ok
t/load-bad.t .......... 
ok 1 - load_file('107650337-META.yml')
ok 2 - load_yaml_string(slurp('107650337-META.yml'))
ok 3 - load_file('1122575719-META.yml')
ok 4 - load_yaml_string(slurp('1122575719-META.yml'))
ok 5 - load_file('1206545041-META.yml')
ok 6 - load_yaml_string(slurp('1206545041-META.yml'))
ok 7 - load_file('1598804075-META.yml')
ok 8 - load_yaml_string(slurp('1598804075-META.yml'))
ok 9 - load_file('1927486199-META.yml')
ok 10 - load_yaml_string(slurp('1927486199-META.yml'))
ok 11 - load_file('1985684504-META.yml')
ok 12 - load_yaml_string(slurp('1985684504-META.yml'))
ok 13 - load_file('1985980974-META.yml')
ok 14 - load_yaml_string(slurp('1985980974-META.yml'))
ok 15 - load_file('2031017050-META.yml')
ok 16 - load_yaml_string(slurp('2031017050-META.yml'))
ok 17 - load_file('284247103-META.yml')
ok 18 - load_yaml_string(slurp('284247103-META.yml'))
ok 19 - load_file('344981821-META.yml')
ok 20 - load_yaml_string(slurp('344981821-META.yml'))
ok 21 - load_file('35478989-META.yml')
ok 22 - load_yaml_string(slurp('35478989-META.yml'))
ok 23 - load_file('476602558-META.yml')
ok 24 - load_yaml_string(slurp('476602558-META.yml'))
ok 25 - load_file('98042513-META.yml')
ok 26 - load_yaml_string(slurp('98042513-META.yml'))
ok 27 - load_file('META-1_0.yml')
ok 28 - load_yaml_string(slurp('META-1_0.yml'))
ok 29 - load_file('META-1_1.yml')
ok 30 - load_yaml_string(slurp('META-1_1.yml'))
ok 31 - load_file('META-1_2.yml')
ok 32 - load_yaml_string(slurp('META-1_2.yml'))
ok 33 - load_file('META-1_3.yml')
ok 34 - load_yaml_string(slurp('META-1_3.yml'))
ok 35 - load_file('META-1_4.yml')
ok 36 - load_yaml_string(slurp('META-1_4.yml'))
ok 37 - load_file('META-2.json')
ok 38 - load_json_string(slurp('META-2.json'))
ok 39 - load_file('restrictive-2.json')
ok 40 - load_json_string(slurp('restrictive-2.json'))
1..40
ok
t/meta-obj.t .......... 
ok 1 - the result of ->as_struct is unblessed
ok 2 - ->as_struct (deep comparison)
ok 3 - ->as_struct (is a deep clone)
ok 4 - ->as_struct (downconversion)
ok 5 - ->resource (map values are deep cloned)
ok 6 - ->name
ok 7 - ->abstract
ok 8 - ->description
ok 9 - ->version
ok 10 - ->dynamic_config
ok 11 - ->author
ok 12 - ->authors
ok 13 - ->license
ok 14 - ->licenses
ok 15 - ->keywords
ok 16 - ->resources
ok 17 - ->meta_spec
ok 18 - ->meta_spec_version
ok 19 - ->generated_by
ok 20 - ->effective_prereqs()
ok 21 - ->custom_keys
ok 22 - ->custom(X)
ok 23 - ->custom(X) [is_deeply]
ok 24 - ->custom(x) [is a deep clone]
ok 25 - ->effective_prereqs([ qw(domination) ])
ok 26 - we got one feature
ok 27 - The object isa CPAN::Meta::Feature
ok 28 - $feature->identifier
ok 29 - $feature->description
ok 30 - $feature->prereqs
ok 31 - The object isa CPAN::Meta::Feature
ok 32 - $feature->identifier
ok 33 - $feature->description
ok 34 - $feature->prereqs
1..34
ok
t/no-index.t .......... 
ok 1 - we index any old package, without a no_index rule
ok 2 - we index any old file, without a no_index rule
ok 3 - exclude a specific package
ok 4 - namespace X does not exclude package X
ok 5 - exclude something under a namespace
ok 6 - exclude a specific file
ok 7 - do not exclude a file with a name like an excluded dir
ok 8 - exclude something under a directory
1..8
ok
t/prereqs-finalize.t .. 
ok 1 - The object isa CPAN::Meta::Prereqs
ok 2 - cloned obj is not finalized
ok 3 - ...and still round-trip
ok 4 - ...we can add a minimum if it has no effect
ok 5 - ...but we die if it would alter a finalized prereqs
ok 6 - ...we can get a V:R object for a previously unconfigured phase
ok 7 - ...but we die if we try to put anything in it
ok 8 - cloned prereqs obj isa CPAN::Meta::Prereqs
ok 9 - cloned obj is not finalized
ok 10 - ...it still round-trips
ok 11 - ...we can add minimum if it has no effect
ok 12 - ...or if it has an effect
ok 13 - ...we can get a V:R object for a previously unconfigured phase
ok 14 - ...and we can add stuff to it
1..14
ok
t/prereqs-merge.t ..... 
ok 1 - first prereq isa CPAN::Meta::Prereqs
ok 2 - ...and it round trips
ok 3 - second prereq isa CPAN::Meta::Prereqs
ok 4 - ...and it round trips
ok 5 - we get the right result of merging two prereqs
ok 6 - ...and the merge works the same in reverse
1..6
ok
t/prereqs.t ........... 
ok 1 - The object isa CPAN::Meta::Prereqs
ok 2 - round-trip okay
ok 3 - we got the runtime requirements
ok 4 - ...but not the runtime recommendations
ok 5 - ...nor the build requirements
ok 6 - we got the runtime requirements
ok 7 - ...and the runtime recommendations
ok 8 - ...but not the build requirements
ok 9 - empty set of runtime/suggests requirements
ok 10 - empty set of develop/suggests requirements
ok 11 - we can accumulate new requirements on a prereq object
1..11
ok
t/repository.t ........ 
ok 1 - (version 1.4) old repository winds up in 'url'
ok 2 - (version 2  ) http in web passed through unchanged
ok 3 - (version 2  ) http in url passed through unchanged
ok 4 - (version 2  ) svn in url adds svn type
ok 5 - (version 2  ) git in url adds svn type
ok 6 - (version 2  ) pre-existing type preserved
1..6
ok
t/save-load.t ......... 
ok 1 - save returns true
ok 2 - save meta to file
ok 3 - load saved file
ok 4 - name correct
ok 5 - load META-1.4
ok 6 - name correct
ok 7 - save meta to META.yml with conversion
ok 8 - load saved file
ok 9 - name correct
ok 10 - prereq correct
1..10
ok
t/validator.t ......... 
ok 1 - META-1_0.yml validates
ok 2 - META-1_1.yml validates
ok 3 - META-1_2.yml validates
ok 4 - META-1_3.yml validates
ok 5 - META-1_4.yml validates
ok 6 - META-2.json validates
ok 7 - gpl-1_4.yml validates
ok 8 - resources.yml validates
ok 9 - restricted-2.json validates
ok 10 - restrictive-1_4.yml validates
ok 11 - invalid META-1_0.yml doesn't validate
ok 12 - invalid META-1_1.yml doesn't validate
ok 13 - invalid META-1_2.yml doesn't validate
ok 14 - invalid META-1_3.yml doesn't validate
ok 15 - invalid META-1_4.yml doesn't validate
ok 16 - invalid META-2.json doesn't validate
1..16
ok
All tests successful.
Files=12, Tests=396,  4 wallclock secs ( 0.08 usr +  0.02 sys =  0.09 CPU)
Result: PASS
  DAGOLDEN/CPAN-Meta-2.110930.tar.gz
  nmake test TEST_VERBOSE=1 -- OK
PPD for CPAN-Meta-2.110930 already made
Running test for module 'Parse::CPAN::Meta'
Running make for D/DA/DAGOLDEN/Parse-CPAN-Meta-1.4401.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'make'
  Has already been made
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'test'
Running make test
  Has already been tested successfully
Running test for module 'version'
Running make for J/JP/JPEACOCK/version-0.88.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'make'
  Has already been made
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'test'
Running make test
  Has already been tested successfully
Running make for D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\Module-Build-0.3800-8j1oKu
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'make'

  CPAN.pm: Going to build D/DA/DAGOLDEN/Module-Build-0.3800.tar.gz

>>> nmake

Microsoft (R) Program Maintenance Utility   Version 7.00.8882
Copyright (C) Microsoft Corp 1988-2000. All rights reserved.

	C:\Perl-5.12\bin\perl.exe Build --makefile_env_macros 1
version version 0.87 required--this is only version 0.82 at lib/Module/Build/Version.pm line 6.
BEGIN failed--compilation aborted at lib/Module/Build/Version.pm line 6.
Compilation failed in require at lib/Module/Build/Base.pm line 26.
BEGIN failed--compilation aborted at lib/Module/Build/Base.pm line 26.
Compilation failed in require at lib/Module/Build.pm line 15.
BEGIN failed--compilation aborted at lib/Module/Build.pm line 15.
Compilation failed in require at Build line 43.
BEGIN failed--compilation aborted at Build line 43.
NMAKE : fatal error U1077: 'C:\Perl-5.12\bin\perl.exe' : return code '0xff'
Stop.
  DAGOLDEN/Module-Build-0.3800.tar.gz
  nmake -- NOT OK
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'test'
Running make test
  Can't test without successful make
Running make for C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'get'
Warning: Prerequisite 'Module::Build => 0.38' for 'CJFIELDS/BioPerl-1.6.901.tar.gz' failed when processing 'DAGOLDEN/Module-Build-0.3800.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited.
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'make'

  CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz

>>> C:\Perl-5.12\bin\perl.exe Build.PL 
could not find ParserDetails.ini in C:/cpanfly-5.12/var/megalib/XML/SAX
Checking prerequisites...
  requires:
    !  DB_File is not installed
  recommends:
    *  Convert::Binary::C is not installed
    *  GraphViz is not installed

Checking optional features...
DB_File Tests.........disabled
  requires:
    ! DB_File is not installed
EntrezGene............disabled
  requires:
    ! Bio::ASN1::EntrezGene is not installed
Pg Tests..............disabled
  requires:
    ! DBD::Pg is not installed

ERRORS/WARNINGS FOUND IN PREREQUISITES.  You may wish to install the versions
of the modules indicated above before proceeding with this installation

############################# WARNING #############################

Bio::ASN1::EntrezGene not found. This is an *optional* module;
however, because it has a circular dependency with BioPerl we do not
include it on our list of recommended modules.

If you require EntrezGene functionality, you can install
Bio::ASN1::EntrezGene after BioPerl has finished installing.  

############################# WARNING #############################

Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n]   - will not run the BioDBGFF or BioDBSeqFeature live database tests

Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a]   - will install all scripts

Do you want to run tests that require connection to servers across the internet
(likely to cause some failures)? y/n [n]   - will not run internet-requiring tests
Creating new 'MYMETA.yml' with configuration results
Creating new 'Build' script for 'BioPerl' version '1.006901'
---- Unsatisfied dependencies detected during ----
----      CJFIELDS/BioPerl-1.6.901.tar.gz     ----
    DB_File [requires]
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'test'
Running Build test
  Delayed until after prerequisites
Running test for module 'DB_File'

______________________ D i s t r o P r e f s ______________________
                           DB_File.yml[0]                           
Running make for P/PM/PMQS/DB_File-1.822.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'get'
Disabled via prefs file 'C:\cpanfly-5.12\etc\distroprefs\DB_File.yml' doc 0
  PMQS/DB_File-1.822.tar.gz
  [disabled] -- NA Disabled via prefs file 'C:\cpanfly-5.12\etc\distroprefs\DB_File.yml' doc 0
Running Build for C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'get'
  Has already been unwrapped into directory C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'make'

  CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz

Warning: Prerequisite 'DB_File => 0' for 'CJFIELDS/BioPerl-1.6.901.tar.gz' failed when processing 'PMQS/DB_File-1.822.tar.gz' with 'unwrapped => NO Disabled via prefs file 'C:\cpanfly-5.12\etc\distroprefs\DB_File.yml' doc 0'. Continuing, but chances to succeed are limited.
>>> C:\Perl-5.12\bin\perl.exe ./Build
./Build: blib\script\bp_bulk_load_gff.pl: cannot resolve L<fast_load_gff.pl> in paragraph 25.
./Build: blib\script\bp_bulk_load_gff.pl: cannot resolve L<load_gff.pl> in paragraph 25.
./Build: blib\script\bp_process_wormbase.pl: cannot resolve L<bulk_load_gff.pl> in paragraph 44.
./Build: blib\script\bp_process_wormbase.pl: cannot resolve L<load_gff.pl> in paragraph 44.
./Build: blib\script\bp_process_sgd.pl: cannot resolve L<bulk_load_gff.pl> in paragraph 29.
./Build: blib\script\bp_process_sgd.pl: cannot resolve L<load_gff.pl> in paragraph 29.
./Build: blib\script\bp_load_gff.pl: cannot resolve L<bulk_load_gff.pl> in paragraph 20.
./Build: blib\script\bp_load_gff.pl: cannot resolve L<load_gff.pl> in paragraph 20.
./Build: blib\script\bp_fast_load_gff.pl: cannot resolve L<bulk_load_gff.pl> in paragraph 25.
./Build: blib\script\bp_fast_load_gff.pl: cannot resolve L<load_gff.pl> in paragraph 25.
./Build: blib\script\bp_genbank2gff.pl: cannot resolve L<bulk_load_gff.pl> in paragraph 15.
./Build: blib\script\bp_genbank2gff.pl: cannot resolve L<load_gff.pl> in paragraph 15.
./Build: blib\script\bp_seqconvert.pl: cannot resolve L<bp_sreformat.PLS> in paragraph 19.
./Build: blib\script\bp_process_gadfly.pl: cannot resolve L<bulk_load_gff.pl> in paragraph 39.
./Build: blib\script\bp_process_gadfly.pl: cannot resolve L<load_gff.pl> in paragraph 39.
./Build: blib\lib\Bio\Tools\Run\WrapperBase\CommandExts.pm: cannot resolve L<bioperl-l@bioperl.org> in paragraph 94.
./Build: blib\lib\Bio\DB\GFF\Adaptor\ace.pm: cannot resolve L<bioperl> in paragraph 8.
./Build: blib\lib\Bio\Search\Hit\hmmer3Hit.pm: cannot resolve L<bioperl-l@bioperl.org> in paragraph 15.
./Build: blib\lib\Bio\Search\Hit\hmmer3Hit.pm: cannot resolve L<score()|score> in paragraph 45.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlace.pm: cannot resolve L<bioperl> in paragraph 8.
./Build: blib\lib\Bio\Variation\IO.pm: cannot resolve L<perltie> in paragraph 66.
./Build: blib\lib\Bio\SeqIO.pm: cannot resolve L<perltie> in paragraph 74.
./Build: blib\lib\Bio\SearchIO\hmmer3.pm: cannot resolve L<bioperl-l@bioperl.org> in paragraph 15.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysql.pm: cannot resolve L<bioperl> in paragraph 165.
./Build: blib\lib\Bio\DB\SeqFeature.pm: cannot resolve L<bioperl> in paragraph 107.
./Build: blib\lib\Bio\Restriction\Enzyme.pm: cannot resolve L<non_ambiguous_length> in paragraph 214.
./Build: blib\lib\Bio\DB\SeqFeature\NormalizedTableFeatureI.pm: cannot resolve L<bioperl> in paragraph 12.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.pm: cannot resolve L<mailto:bioperl-l@lists.open-bio.org> in paragraph 44.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\pg_fts.pm: cannot resolve L<mailto:gmod-gbrowse@lists.sourceforge.net> in paragraph 44.
./Build: blib\lib\Bio\DB\GFF\Featname.pm: cannot resolve L<bioperl> in paragraph 44.
./Build: blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm: cannot resolve L<remote_database> in paragraph 77.
./Build: blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm: cannot resolve L<remote_database> in paragraph 86.
./Build: blib\lib\Bio\SearchIO\Writer\HTMLResultWriter.pm: cannot resolve L<remote_database> in paragraph 97.
./Build: blib\lib\Bio\SeqIO\embldriver.pm: cannot resolve L<annotation()|annotation> in paragraph 23.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<get_quality_scalar()|get_quality_scalar> in paragraph 83.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<get_quality_array()|get_quality_array> in paragraph 89.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<get_contigs()|get_contigs> in paragraph 100.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<get_contigs()|get_contigs> in paragraph 105.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<get_contigs()|get_contigs> in paragraph 110.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<get_contigs()|get_contigs> in paragraph 115.
./Build: blib\lib\Bio\Tools\Alignment\Consed.pm: cannot resolve L<sum_lets()|sum_lets> in paragraph 222.
./Build: blib\lib\Bio\SeqIO\embl.pm: cannot resolve L<annotation()|annotation> in paragraph 23.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm: cannot resolve L<bioperl> in paragraph 183.
./Build: blib\lib\Bio\ClusterIO.pm: cannot resolve L<perltie> in paragraph 29.
./Build: blib\lib\Bio\Search\Hit\HMMERHit.pm: cannot resolve L<score()|score> in paragraph 70.
./Build: blib\lib\Bio\Search\Hit\HMMERHit.pm: cannot resolve L<hsp()|hsp> in paragraph 78.
./Build: blib\lib\Bio\Search\Hit\PullHitI.pm: cannot resolve L<expect()|expect> in paragraph 142.
./Build: blib\lib\Bio\Search\Hit\PullHitI.pm: cannot resolve L<signif()|signif> in paragraph 142.
./Build: blib\lib\Bio\Seq\Quality.pm: cannot resolve L<force_flush> in paragraph 26.
./Build: blib\lib\Bio\Search\Tiling\MapTiling.pm: cannot resolve L<ALIGNMENTS/get_tiled_alns> in paragraph 20.
./Build: blib\lib\Bio\Align\Graphics.pm: cannot resolve L<GD> in paragraph 205.
./Build: blib\lib\Bio\DB\GFF\Adaptor\memory.pm: cannot resolve L<bioperl> in paragraph 22.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm: cannot resolve L<DBI> in paragraph 56.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\caching_handle.pm: cannot resolve L<bioperl> in paragraph 56.
./Build: blib\lib\Bio\Search\Hit\HmmpfamHit.pm: cannot resolve L<num_hsps> in paragraph 76.
./Build: blib\lib\Bio\DB\SeqFeature\Store\Loader.pm: cannot resolve L<bioperl> in paragraph 187.
./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L<expect()|expect> in paragraph 126.
./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L<signif()|signif> in paragraph 126.
./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L<frac_aligned_query()|frac_aligned_query> in paragraph 136.
./Build: blib\lib\Bio\Search\Hit\HitI.pm: cannot resolve L<frac_aligned_hit()|frac_aligned_hit> in paragraph 136.
./Build: blib\lib\Bio\FeatureIO.pm: cannot resolve L<perltie> in paragraph 55.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\oracleace.pm: cannot resolve L<bioperl> in paragraph 8.
./Build: blib\lib\Bio\Tools\Run\RemoteBlast.pm: cannot resolve L<FEEDBACK> in paragraph 36.
./Build: blib\lib\Bio\Search\Result\HMMERResult.pm: cannot resolve L<next_models> in paragraph 9.
./Build: blib\lib\Bio\Search\Hit\GenericHit.pm: cannot resolve L<expect()|expect> in paragraph 134.
./Build: blib\lib\Bio\SeqIO\genbank.pm: cannot resolve L<annotation()|annotation> in paragraph 22.
./Build: blib\lib\Bio\Structure\IO.pm: cannot resolve L<perltie> in paragraph 56.
./Build: blib\lib\Bio\Search\Hit\ModelHit.pm: cannot resolve L<expect()|expect> in paragraph 104.
./Build: blib\lib\Bio\Search\Hit\ModelHit.pm: cannot resolve L<signif()|signif> in paragraph 104.
./Build: blib\lib\Bio\Search\Result\hmmer3Result.pm: cannot resolve L<bioperl-l@bioperl.org> in paragraph 15.
./Build: blib\lib\Bio\DB\SeqFeature\Store\berkeleydb3.pm: cannot resolve L<bioperl> in paragraph 15.
./Build: blib\lib\Bio\DB\Fasta.pm: cannot resolve L<bioperl> in paragraph 123.
./Build: blib\lib\Bio\DB\SeqFeature\Store\berkeleydb.pm: cannot resolve L<bioperl> in paragraph 264.
./Build: blib\lib\Bio\DB\SeqFeature\Store\LoadHelper.pm: cannot resolve L<bioperl> in paragraph 9.
./Build: blib\lib\Bio\DB\DBFetch.pm: cannot resolve L<http:E<sol>E<sol>www.ebi.ac.ukE<sol>cgi-binE<sol>dbfetch> in paragraph 8.
./Build: blib\lib\Bio\DB\SeqFeature\NormalizedFeature.pm: cannot resolve L<bioperl> in paragraph 159.
./Build: blib\lib\Bio\Search\Hit\BlastPullHit.pm: cannot resolve L<num_hsps> in paragraph 74.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi.pm: cannot resolve L<bioperl> in paragraph 496.
./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L<Error> in paragraph 21.
./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L<Error> in paragraph 22.
./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L<Error> in paragraph 22.
./Build: blib\lib\Bio\Root\Root.pm: cannot resolve L<Error> in paragraph 36.
./Build: blib\lib\Bio\Search\SearchUtils.pm: cannot resolve L<_adjust_contigs> in paragraph 16.
./Build: blib\lib\Bio\DB\SeqFeature\Store\memory.pm: cannot resolve L<bioperl> in paragraph 125.
./Build: blib\lib\Bio\DB\GFF\Homol.pm: cannot resolve L<bioperl> in paragraph 28.
./Build: blib\lib\Bio\DB\GFF\RelSegment.pm: cannot resolve L<bioperl> in paragraph 251.
./Build: blib\lib\Bio\DB\GFF\Segment.pm: cannot resolve L<bioperl> in paragraph 229.
./Build: blib\lib\Bio\Seq\MetaI.pm: cannot resolve L<names_submeta> in paragraph 14.
./Build: blib\lib\Bio\SeqEvolution\DNAPoint.pm: cannot resolve L<reset_sequence_counter> in paragraph 9.
./Build: blib\lib\Bio\Assembly\IO\sam.pm: cannot resolve L<bioperl-l@bioperl.org> in paragraph 44.
./Build: blib\lib\Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm: cannot resolve L<bioperl> in paragraph 8.
./Build: blib\lib\Bio\AlignIO.pm: cannot resolve L<print> in paragraph 51.
./Build: blib\lib\Bio\AlignIO.pm: cannot resolve L<perltie> in paragraph 66.
./Build: blib\lib\Bio\Search\HSP\ModelHSP.pm: cannot resolve L<seq_str()|seq_str> in paragraph 52.
./Build: blib\lib\Bio\DB\GFF\Typename.pm: cannot resolve L<bioperl> in paragraph 49.
./Build: blib\lib\Bio\DB\GFF\Adaptor\berkeleydb.pm: cannot resolve L<bioperl> in paragraph 33.
./Build: blib\lib\Bio\DB\SeqFeature\NormalizedFeatureI.pm: cannot resolve L<bioperl> in paragraph 12.
./Build: blib\lib\Bio\DB\GFF\Feature.pm: cannot resolve L<bioperl> in paragraph 295.
./Build: blib\lib\Bio\Assembly\Contig.pm: cannot resolve L<Coordinate_Systems> in paragraph 120.
./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L<Error.pm try|Error/try> in paragraph .
./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L<Error.pm try|Error/try> in paragraph 12.
./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L<Error> in paragraph 40.
./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L<Error> in paragraph 46.
./Build: blib\lib\Bio\Root\Exception.pm: cannot resolve L<pretty_format()|pretty_format> in paragraph 91.
./Build: blib\lib\Bio\Search\HSP\hmmer3HSP.pm: cannot resolve L<bioperl-l@bioperl.org> in paragraph 15.
./Build: blib\lib\Bio\DB\SeqFeature\Segment.pm: cannot resolve L<bioperl> in paragraph 121.
./Build: blib\lib\Bio\SeqIO\swiss.pm: cannot resolve L<annotation()|annotation> in paragraph 45.
./Build: blib\lib\Bio\DB\SeqFeature\Store\GFF2Loader.pm: cannot resolve L<bioperl> in paragraph 181.
Building BioPerl
  CJFIELDS/BioPerl-1.6.901.tar.gz
  C:\Perl-5.12\bin\perl.exe ./Build -- OK
Prepending C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib to PERL5LIB; %BUILDDIR%=C:/cpanfly-5.12/var/cpan/build for 'test'
Running Build test
>>> C:\Perl-5.12\bin\perl.exe ./Build test verbose=1
Copying scripts\utilities\search2alnblocks.PLS -> blib\script\search2alnblocks.PLS
Changing sharpbang in blib\script\search2alnblocks.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\search2alnblocks.PLS.bak
Copying scripts\DB\bioflat_index.PLS -> blib\script\bioflat_index.PLS
Changing sharpbang in blib\script\bioflat_index.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bioflat_index.PLS.bak
Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_gff3.PLS -> blib\script\bp_seqfeature_gff3.PLS
Copying scripts\utilities\mask_by_search.PLS -> blib\script\mask_by_search.PLS
Changing sharpbang in blib\script\mask_by_search.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\mask_by_search.PLS.bak
Copying scripts\utilities\bp_mrtrans.PLS -> blib\script\bp_mrtrans.PLS
Changing sharpbang in blib\script\bp_mrtrans.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_mrtrans.PLS.bak
Copying scripts\utilities\bp_sreformat.PLS -> blib\script\bp_sreformat.PLS
Changing sharpbang in blib\script\bp_sreformat.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_sreformat.PLS.bak
Copying scripts\utilities\search2gff.PLS -> blib\script\search2gff.PLS
Changing sharpbang in blib\script\search2gff.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\search2gff.PLS.bak
Copying scripts\searchio\hmmer_to_table.PLS -> blib\script\hmmer_to_table.PLS
Changing sharpbang in blib\script\hmmer_to_table.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\hmmer_to_table.PLS.bak
Copying scripts\seq\seqconvert.PLS -> blib\script\seqconvert.PLS
Changing sharpbang in blib\script\seqconvert.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\seqconvert.PLS.bak
Copying scripts\DB\flanks.PLS -> blib\script\flanks.PLS
Changing sharpbang in blib\script\flanks.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\flanks.PLS.bak
Copying scripts\utilities\seq_length.PLS -> blib\script\seq_length.PLS
Changing sharpbang in blib\script\seq_length.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\seq_length.PLS.bak
Copying scripts\DB-HIV\hivq.PLS -> blib\script\hivq.PLS
Changing sharpbang in blib\script\hivq.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\hivq.PLS.bak
Copying scripts\Bio-DB-GFF\genbank2gff.PLS -> blib\script\genbank2gff.PLS
Changing sharpbang in blib\script\genbank2gff.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\genbank2gff.PLS.bak
Copying scripts\Bio-DB-EUtilities\einfo.PLS -> blib\script\einfo.PLS
Changing sharpbang in blib\script\einfo.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\einfo.PLS.bak
Copying scripts\Bio-DB-GFF\process_gadfly.PLS -> blib\script\process_gadfly.PLS
Changing sharpbang in blib\script\process_gadfly.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\process_gadfly.PLS.bak
Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_delete.PLS -> blib\script\bp_seqfeature_delete.PLS
Changing sharpbang in blib\script\bp_seqfeature_delete.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_seqfeature_delete.PLS.bak
Copying scripts\seq\extract_feature_seq.PLS -> blib\script\extract_feature_seq.PLS
Changing sharpbang in blib\script\extract_feature_seq.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\extract_feature_seq.PLS.bak
Copying scripts\seq\make_mrna_protein.PLS -> blib\script\make_mrna_protein.PLS
Changing sharpbang in blib\script\make_mrna_protein.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\make_mrna_protein.PLS.bak
Copying scripts\DB\biofetch_genbank_proxy.PLS -> blib\script\biofetch_genbank_proxy.PLS
Changing sharpbang in blib\script\biofetch_genbank_proxy.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\biofetch_genbank_proxy.PLS.bak
Copying scripts\tree\nexus2nh.PLS -> blib\script\nexus2nh.PLS
Changing sharpbang in blib\script\nexus2nh.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\nexus2nh.PLS.bak
Copying scripts\searchio\filter_search.PLS -> blib\script\filter_search.PLS
Changing sharpbang in blib\script\filter_search.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\filter_search.PLS.bak
Copying scripts\tree\tree2pag.PLS -> blib\script\tree2pag.PLS
Changing sharpbang in blib\script\tree2pag.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\tree2pag.PLS.bak
Copying scripts\taxa\local_taxonomydb_query.PLS -> blib\script\local_taxonomydb_query.PLS
Changing sharpbang in blib\script\local_taxonomydb_query.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\local_taxonomydb_query.PLS.bak
Copying scripts\utilities\search2BSML.PLS -> blib\script\search2BSML.PLS
Changing sharpbang in blib\script\search2BSML.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\search2BSML.PLS.bak
Copying scripts\Bio-DB-GFF\process_sgd.PLS -> blib\script\process_sgd.PLS
Changing sharpbang in blib\script\process_sgd.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\process_sgd.PLS.bak
Copying scripts\utilities\search2tribe.PLS -> blib\script\search2tribe.PLS
Changing sharpbang in blib\script\search2tribe.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\search2tribe.PLS.bak
Copying scripts\Bio-DB-GFF\generate_histogram.PLS -> blib\script\generate_histogram.PLS
Changing sharpbang in blib\script\generate_histogram.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\generate_histogram.PLS.bak
Copying scripts\taxa\query_entrez_taxa.PLS -> blib\script\query_entrez_taxa.PLS
Changing sharpbang in blib\script\query_entrez_taxa.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\query_entrez_taxa.PLS.bak
Copying scripts\utilities\dbsplit.PLS -> blib\script\dbsplit.PLS
Changing sharpbang in blib\script\dbsplit.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\dbsplit.PLS.bak
Copying scripts\tree\blast2tree.PLS -> blib\script\blast2tree.PLS
Changing sharpbang in blib\script\blast2tree.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\blast2tree.PLS.bak
Copying scripts\Bio-DB-GFF\load_gff.PLS -> blib\script\load_gff.PLS
Changing sharpbang in blib\script\load_gff.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\load_gff.PLS.bak
Copying scripts\das\das_server.pl -> blib\script\das_server.pl
Changing sharpbang in blib\script\das_server.pl to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\das_server.pl.bak
Copying scripts\utilities\mutate.PLS -> blib\script\mutate.PLS
Changing sharpbang in blib\script\mutate.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\mutate.PLS.bak
Copying scripts\seq\unflatten_seq.PLS -> blib\script\unflatten_seq.PLS
Changing sharpbang in blib\script\unflatten_seq.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\unflatten_seq.PLS.bak
Copying scripts\seqstats\chaos_plot.PLS -> blib\script\chaos_plot.PLS
Changing sharpbang in blib\script\chaos_plot.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\chaos_plot.PLS.bak
Copying scripts\Bio-DB-GFF\bulk_load_gff.PLS -> blib\script\bulk_load_gff.PLS
Changing sharpbang in blib\script\bulk_load_gff.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bulk_load_gff.PLS.bak
Copying scripts\Bio-DB-GFF\fast_load_gff.PLS -> blib\script\fast_load_gff.PLS
Changing sharpbang in blib\script\fast_load_gff.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\fast_load_gff.PLS.bak
Copying scripts\utilities\revtrans-motif.PLS -> blib\script\revtrans-motif.PLS
Changing sharpbang in blib\script\revtrans-motif.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\revtrans-motif.PLS.bak
Copying scripts\searchio\search2table.PLS -> blib\script\search2table.PLS
Changing sharpbang in blib\script\search2table.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\search2table.PLS.bak
Copying scripts\index\bp_seqret.PLS -> blib\script\bp_seqret.PLS
Changing sharpbang in blib\script\bp_seqret.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_seqret.PLS.bak
Copying scripts\popgen\composite_LD.PLS -> blib\script\composite_LD.PLS
Changing sharpbang in blib\script\composite_LD.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\composite_LD.PLS.bak
Copying scripts\biblio\biblio.PLS -> blib\script\biblio.PLS
Changing sharpbang in blib\script\biblio.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\biblio.PLS.bak
Copying scripts\seq\split_seq.PLS -> blib\script\split_seq.PLS
Changing sharpbang in blib\script\split_seq.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\split_seq.PLS.bak
Copying scripts\searchio\parse_hmmsearch.PLS -> blib\script\parse_hmmsearch.PLS
Changing sharpbang in blib\script\parse_hmmsearch.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\parse_hmmsearch.PLS.bak
Copying scripts\Bio-DB-GFF\process_wormbase.PLS -> blib\script\process_wormbase.PLS
Changing sharpbang in blib\script\process_wormbase.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\process_wormbase.PLS.bak
Copying scripts\utilities\download_query_genbank.PLS -> blib\script\download_query_genbank.PLS
Changing sharpbang in blib\script\download_query_genbank.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\download_query_genbank.PLS.bak
Copying scripts\seqstats\aacomp.PLS -> blib\script\aacomp.PLS
Changing sharpbang in blib\script\aacomp.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\aacomp.PLS.bak
Copying scripts\utilities\bp_nrdb.PLS -> blib\script\bp_nrdb.PLS
Changing sharpbang in blib\script\bp_nrdb.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_nrdb.PLS.bak
Copying scripts\popgen\heterogeneity_test.PLS -> blib\script\heterogeneity_test.PLS
Changing sharpbang in blib\script\heterogeneity_test.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\heterogeneity_test.PLS.bak
Copying scripts\index\bp_fetch.PLS -> blib\script\bp_fetch.PLS
Changing sharpbang in blib\script\bp_fetch.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_fetch.PLS.bak
Copying scripts\taxa\taxid4species.PLS -> blib\script\taxid4species.PLS
Changing sharpbang in blib\script\taxid4species.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\taxid4species.PLS.bak
Copying scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_load.PLS -> blib\script\bp_seqfeature_load.PLS
Changing sharpbang in blib\script\bp_seqfeature_load.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_seqfeature_load.PLS.bak
Copying scripts\taxa\taxonomy2tree.PLS -> blib\script\taxonomy2tree.PLS
Changing sharpbang in blib\script\taxonomy2tree.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\taxonomy2tree.PLS.bak
Copying scripts\Bio-DB-GFF\genbank2gff3.PLS -> blib\script\genbank2gff3.PLS
Changing sharpbang in blib\script\genbank2gff3.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\genbank2gff3.PLS.bak
Copying scripts\Bio-DB-GFF\meta_gff.PLS -> blib\script\meta_gff.PLS
Changing sharpbang in blib\script\meta_gff.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\meta_gff.PLS.bak
Copying scripts\seqstats\oligo_count.PLS -> blib\script\oligo_count.PLS
Changing sharpbang in blib\script\oligo_count.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\oligo_count.PLS.bak
Copying scripts\seq\seqretsplit.PLS -> blib\script\seqretsplit.PLS
Changing sharpbang in blib\script\seqretsplit.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\seqretsplit.PLS.bak
Copying scripts\index\bp_index.PLS -> blib\script\bp_index.PLS
Changing sharpbang in blib\script\bp_index.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_index.PLS.bak
Copying scripts\utilities\bp_netinstall.PLS -> blib\script\bp_netinstall.PLS
Changing sharpbang in blib\script\bp_netinstall.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\bp_netinstall.PLS.bak
Copying scripts\seqstats\gccalc.PLS -> blib\script\gccalc.PLS
Changing sharpbang in blib\script\gccalc.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\gccalc.PLS.bak
Copying scripts\DB\biogetseq.PLS -> blib\script\biogetseq.PLS
Changing sharpbang in blib\script\biogetseq.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\biogetseq.PLS.bak
Copying scripts\seq\translate_seq.PLS -> blib\script\translate_seq.PLS
Changing sharpbang in blib\script\translate_seq.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\translate_seq.PLS.bak
Copying scripts\searchio\fastam9_to_table.PLS -> blib\script\fastam9_to_table.PLS
Changing sharpbang in blib\script\fastam9_to_table.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\fastam9_to_table.PLS.bak
Copying scripts\taxa\classify_hits_kingdom.PLS -> blib\script\classify_hits_kingdom.PLS
Changing sharpbang in blib\script\classify_hits_kingdom.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\classify_hits_kingdom.PLS.bak
Copying scripts\utilities\remote_blast.PLS -> blib\script\remote_blast.PLS
Changing sharpbang in blib\script\remote_blast.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\remote_blast.PLS.bak
Copying scripts\utilities\pairwise_kaks.PLS -> blib\script\pairwise_kaks.PLS
Changing sharpbang in blib\script\pairwise_kaks.PLS to C:\Perl-5.12\bin\perl.exe
Deleting blib\script\pairwise_kaks.PLS.bak
t/Align/AlignStats.t ......................... 
1..45
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::AlignIO;
ok 4 - The object isa Bio::Align::AlignI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - The object isa Bio::Align::AlignI
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - The object isa Bio::Align::AlignI
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - The object isa Bio::Align::AlignI
ok 38 - The object isa Bio::Matrix::PhylipDist
ok 39
ok 40
ok 41
ok 42 - The object isa Bio::PrimarySeqI
ok 43
ok 44 - Warn if seqs don't overlap
ok 45
ok
t/Align/AlignUtil.t .......................... 
1..33
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqIO;
ok 4 - The object isa Bio::Align::AlignI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok
t/Align/Graphics.t ........................... 
1..41
ok 1 - use Bio::Align::Graphics;
ok 2 - require Bio::Align::Graphics;
ok 3 - Bio::Align::Graphics->can(...)
ok 4 - input is defined
ok 5 - AlignIO object is defined
ok 6 - The object isa Bio::AlignIO
ok 7 - alignment is there and defined
ok 8 - all starts are present
ok 9 - all ends are present
ok 10 - all colors are present
ok 11 - first end is further than first start
ok 12 - second end is further than second start
ok 13 - third end is further than third start
ok 14 - domain labels are present
ok 15 - domain starts are present
ok 16 - domain ends are present
ok 17 - domain colors are present
ok 18 - label - first end is further than first start
ok 19 - label - second end is further than second start
ok 20 - label - third end is further than third start
ok 21 - first label start is within domain range
ok 22 - second label start is within domain range
ok 23 - third label start is within domain range
ok 24 - first label end is within domain range
ok 25 - second label end is within domain range
ok 26 - third label end is within domain range
ok 27 - individual labels work
ok 28 - The object isa Bio::Align::Graphics
ok 29 - new object is defined
ok 30 -   pad_bottom is right
ok 31 -   default pad_top is right
ok 32 -   start point loaded
ok 33 -   end point loaded
ok 34 -   color of domain loaded
ok 35 -   domain labels loaded
ok 36 -   label starts loaded
ok 37 -   label ends loaded
ok 38 -   label colors loaded
ok 39 -   labels loaded
ok 40 -   output file is png
ok 41 -   wrapping length is not zero
ok
t/Align/SimpleAlign.t ........................ 
1..199
ok 1 - use Bio::SimpleAlign;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Location::Simple;
ok 5 - use Bio::Location::Split;
ok 6 - The object isa Bio::AlignIO
ok 7 - pfam input test
ok 8 - match_line
ok 9 - The object isa Bio::Align::AlignI
ok 10 - num_sequences
ok 11 - num_sequences
ok 12 - select_noncont
ok 13 - select_noncont
ok 14 - num_sequences
ok 15 - select_noncont
ok 16 - select_noncont
ok 17 - each_seq
ok 18 - get_nse
ok 19 - id
ok 20 - num_gaps
ok 21 - each_alphabetically
ok 22 - column_from_residue_number
ok 23 - display_name get/set
ok 24 - display_name get
ok 25 - consensus_string
ok 26 - consensus_string
ok 27 - consensus_string
ok 28
ok 29 - each_seq_with_id
ok 30 - is_flush
ok 31 - id get/set
ok 32 - length
ok 33 - num_residues
ok 34 - num_sequences
ok 35 - overall_percentage_identity
ok 36 - overall_percentage_identity (align)
ok 37 - overall_percentage_identity (short)
ok 38 - overall_percentage_identity (long)
ok 39 - average_percentage_identity
ok 40
ok 41 - set_displayname_count
ok 42
ok 43 - set_displayname_flat
ok 44
ok 45 - set_displayname_normal
ok 46
ok 47
ok 48 - uppercase, map_chars
ok 49 - match_line
ok 50 - remove_seqs
ok 51 - remove_seqs
ok 52 - add_seq
ok 53 - add_seq
ok 54 - get_seq_by_pos
ok 55 - get_seq_by_pos
ok 56
ok 57
ok 58
ok 59 - purge
ok 60 - purge
ok 61 - IO::String consensus_iupac
ok 62 - IO::String write_aln normal
ok 63 - IO::String write_aln slice
ok 64 - IO::String write_aln slice
ok 65 - IO::String write_aln slice
ok 66 - IO::String write_aln slice
ok 67 - IO::String write_aln slice
ok 68
ok 69 - remove_columns by position
ok 70 - remove_columns by position (wrong order)
ok 71 - cigar_line
ok 72 - cigar_line
ok 73 - cigar_line
ok 74 - cigar_line
ok 75 - sort_alphabetically - before
ok 76
ok 77 - sort_alphabetically - after
ok 78 - remove_gaps
ok 79 - remove_gaps all_gaps_only
ok 80 - set_new_reference
ok 81 - set_new_reference
ok 82 - uniq_seq
ok 83 - bug 2099
ok 84 - bug 2099
ok 85 - bug 2793
ok 86 - bug 2793
ok 87 - bug 2793
ok 88 - bug 2793
ok 89 - Bad sequence, bad!
ok 90 - added 3 seqs
ok 91 - first 2 features added
ok 92 - 3rd feature added
not ok 93 # TODO This should pass but dies; see bug 2842

#   Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 1.  
# Overriding value [0] with value 1 for Bio::LocatableSeq::end().
# ?
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 94 - slice 1 len
ok 95 - correct masked seq
ok 96 - correct masked seq
ok 97 - correct masked seq
not ok 98 # TODO This should pass but dies; see bug 2842

#   Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 3.  
# Overriding value [2] with value 3 for Bio::LocatableSeq::end().
# ?
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 99 - slice 2 len
ok 100 - correct masked seq
ok 101 - correct masked seq
ok 102 - correct masked seq
not ok 103 # TODO This should pass but dies; see bug 2842

#   Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 3.  
# Overriding value [1] with value 3 for Bio::LocatableSeq::end().
# ??
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 104 - slice 3 len
ok 105 - correct masked seq
ok 106 - correct masked seq
ok 107 - correct masked seq
not ok 108 # TODO This should pass but dies; see bug 2842

#   Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 6.  
# Overriding value [4] with value 6 for Bio::LocatableSeq::end().
# ??
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 109 - slice 4 len
ok 110 - correct masked seq
ok 111 - correct masked seq
ok 112 - correct masked seq
ok 113 - initial display id ok
ok 114 - safe display id ok
ok 115 - restored display id ok
ok 116 - sort by list ok
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123 - BIC:GGATCCATT[C/C]CTACT
ok 124 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT
ok 125 - BIC:G[G/C]ATCCATT[C/G]CTACT
ok 126 - BIC:GGATCCATT[C/G]CTACT
ok 127 - BIC:GGATCCATT[C/G]CTAC[T/A]
ok 128 - BIC:GGATCCATT[C/G]CTA[C/G][T/A]
ok 129 - BIC:GGATCCATT[C/G]CTACT
ok 130 - BIC:GGATCCATT{C.C}CTACT
ok 131 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT
ok 132 - BIC:G{G.C}ATCCATT{C.G}CTACT
ok 133 - BIC:GGATCCATT{C.G}CTACT
ok 134 - BIC:GGATCCATT{C.G}CTAC{T.A}
ok 135 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A}
ok 136 - BIC:GGATCCATT{C.G}CTACT
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194 - The object isa Bio::SimpleAlign
ok 195 - consensus string looks ok
ok 196 - looks like correct unmasked alignment (from clustalw)
ok 197 - looks like correct masked alignment (from clustalw)
ok 198
ok 199 - align after looks ok
ok
t/Align/TreeBuild.t .......................... 
1..13
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::Align::Utilities;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Tree::DistanceFactory;
ok 6 - use Bio::TreeIO;
ok 7 - SimpleAlign object parsed out isa Bio::SimpleAlign
ok 8 - Protein distance matrix retrieved isa Bio::Matrix::MatrixI
ok 9 - Tree object gotten back isa Bio::Tree::TreeI
ok 10 - NJ calculated Branch length
ok 11 - NJ calculated Branch length
ok 12 - Make sure two nodes are sister
ok 13 - 10 replicates formulated
ok
t/Align/Utilities.t .......................... 
1..13
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::SimpleAlign;
ok 3 - use Bio::PrimarySeq;
ok 4 - use Bio::LocatableSeq;
ok 5 - use Bio::AlignIO;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok
Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 96, <GEN24> line 86.
Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 128, <GEN24> line 86.
Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 153, <GEN24> line 86.
Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 174, <GEN24> line 86.
Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 199, <GEN24> line 86.
Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 229, <GEN24> line 86.
Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 265, <GEN24> line 86.
Subroutine new redefined at Bio\Seq\Meta.pm line 225, <GEN52> line 64.
Subroutine meta redefined at Bio\Seq\Meta.pm line 269, <GEN52> line 64.
Subroutine meta_text redefined at Bio\Seq\Meta.pm line 284, <GEN52> line 64.
Subroutine named_meta redefined at Bio\Seq\Meta.pm line 300, <GEN52> line 64.
Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 347, <GEN52> line 64.
Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 377, <GEN52> line 64.
Subroutine submeta redefined at Bio\Seq\Meta.pm line 409, <GEN52> line 64.
Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 425, <GEN52> line 64.
Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 444, <GEN52> line 64.
Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 503, <GEN52> line 64.
Subroutine meta_names redefined at Bio\Seq\Meta.pm line 518, <GEN52> line 64.
Subroutine meta_length redefined at Bio\Seq\Meta.pm line 540, <GEN52> line 64.
Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 556, <GEN52> line 64.
Subroutine force_flush redefined at Bio\Seq\Meta.pm line 577, <GEN52> line 64.
Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 604, <GEN52> line 64.
Subroutine is_flush redefined at Bio\Seq\Meta.pm line 637, <GEN52> line 64.
Subroutine revcom redefined at Bio\Seq\Meta.pm line 679, <GEN52> line 64.
Subroutine trunc redefined at Bio\Seq\Meta.pm line 702, <GEN52> line 64.
Subroutine to_string redefined at Bio\Seq\Meta.pm line 726, <GEN52> line 64.
t/AlignIO/AlignIO.t .......................... 
1..28
ok 1 - use Bio::AlignIO;
ok 2 - input filehandle method test : metafasta
ok 3 - input filehandle method test : po
ok 4 - input filehandle method test : nexus
ok 5 - input filehandle method test : clustalw
ok 6 - input filehandle method test : prodom
ok 7 - input filehandle method test : fasta
ok 8 - input filehandle method test : arp
ok 9 - input filehandle method test : xmfa
ok 10 - input filehandle method test : mase
ok 11 - input filehandle method test : psi
ok 12 - input filehandle method test : phylip
ok 13 - input filehandle method test : pfam
ok 14 - input filehandle method test : selex
ok 15 - input filehandle method test : stockholm
ok 16 - input filehandle method test : msf
ok 17 - filehandle output test : metafasta
ok 18 - filehandle output test : po
ok 19 - filehandle output test : nexus
ok 20 - filehandle output test : clustalw
ok 21 - filehandle output test : fasta
ok 22 - filehandle output test : xmfa
ok 23 - filehandle output test : psi
ok 24 - filehandle output test : phylip
ok 25 - filehandle output test : pfam
ok 26 - filehandle output test : selex
ok 27 - filehandle output test : stockholm
ok 28 - filehandle output test : msf
ok
Subroutine next_aln redefined at Bio\AlignIO\arp.pm line 116.
Subroutine write_aln redefined at Bio\AlignIO\arp.pm line 199.
Subroutine _process_sequence redefined at Bio\AlignIO\arp.pm line 206.
Subroutine _process_annotation redefined at Bio\AlignIO\arp.pm line 218.
Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 96, <GEN0> line 86.
Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 128, <GEN0> line 86.
Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 153, <GEN0> line 86.
Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 174, <GEN0> line 86.
Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 199, <GEN0> line 86.
Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 229, <GEN0> line 86.
Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 265, <GEN0> line 86.
t/AlignIO/arp.t .............................. 
1..48
ok 1 - use Bio::AlignIO::arp;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4 - ARP get_nse()
ok 5
ok 6 - ARP num_sequences()
ok 7 - ARP id()
ok 8 - ARP description()
ok 9 - The object isa Bio::AnnotationCollectionI
ok 10 - The object isa Bio::AnnotationI
ok 11
ok 12
ok 13
ok 14
ok 15 - The object isa Bio::AlignIO
ok 16 - The object isa Bio::Align::AlignI
ok 17 - ARP get_nse()
ok 18 - ARP num_sequences()
ok 19 - ARP id()
ok 20 - ARP description()
ok 21 - The object isa Bio::AnnotationCollectionI
ok 22 - The object isa Bio::AnnotationI
ok 23
ok 24
ok 25
ok 26
ok 27 - The object isa Bio::Align::AlignI
ok 28 - ARP get_nse()
ok 29 - ARP num_sequences()
ok 30 - ARP id()
ok 31 - ARP description()
ok 32 - The object isa Bio::AnnotationCollectionI
ok 33 - The object isa Bio::AnnotationI
ok 34
ok 35
ok 36
ok 37
ok 38 - The object isa Bio::Align::AlignI
ok 39 - ARP get_nse()
ok 40 - ARP num_sequences()
ok 41 - ARP id()
ok 42 - ARP description()
ok 43 - The object isa Bio::AnnotationCollectionI
ok 44 - The object isa Bio::AnnotationI
ok 45
ok 46
ok 47
ok 48
ok
Subroutine _initialize redefined at Bio\AlignIO\bl2seq.pm line 124.
Subroutine next_aln redefined at Bio\AlignIO\bl2seq.pm line 142.
Subroutine write_aln redefined at Bio\AlignIO\bl2seq.pm line 184.
Subroutine report_type redefined at Bio\AlignIO\bl2seq.pm line 200.
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN0> line 64.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN0> line 64.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN0> line 64.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN0> line 64.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN0> line 64.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN0> line 64.
t/AlignIO/bl2seq.t ........................... 
1..3
ok 1 - use Bio::AlignIO::bl2seq;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - BLAST bl2seq format test
ok
Subroutine _initialize redefined at Bio\AlignIO\clustalw.pm line 100.
Subroutine next_aln redefined at Bio\AlignIO\clustalw.pm line 121.
Subroutine write_aln redefined at Bio\AlignIO\clustalw.pm line 233.
Subroutine percentages redefined at Bio\AlignIO\clustalw.pm line 332.
Subroutine line_length redefined at Bio\AlignIO\clustalw.pm line 351.
t/AlignIO/clustalw.t ......................... 
1..6
ok 1 - use Bio::AlignIO::clustalw;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - clustalw consensus_string test
ok 4 - clustalw (.aln) output test
ok 5 - The object isa Bio::Align::AlignI
ok 6 - clustalw (.aln) input test
ok
Subroutine _initialize redefined at Bio\AlignIO\emboss.pm line 92.
Subroutine next_aln redefined at Bio\AlignIO\emboss.pm line 109.
Subroutine write_aln redefined at Bio\AlignIO\emboss.pm line 252.
t/AlignIO/emboss.t ........................... 
1..37
ok 1 - use Bio::AlignIO::emboss;
ok 2 - The object isa Bio::Align::AlignI
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - The object isa Bio::Align::AlignI
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Align::AlignI
ok 15
ok 16
ok 17
ok 18 - The object isa Bio::Align::AlignI
ok 19
ok 20
ok 21 - The object isa Bio::Align::AlignI
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - The object isa Bio::Align::AlignI
ok 33
ok 34
ok 35
ok 36
ok 37
ok
Subroutine next_aln redefined at Bio\AlignIO\fasta.pm line 80.
Subroutine write_aln redefined at Bio\AlignIO\fasta.pm line 185.
Subroutine _get_len redefined at Bio\AlignIO\fasta.pm line 228.
Subroutine width redefined at Bio\AlignIO\fasta.pm line 247.
t/AlignIO/fasta.t ............................ 
1..10
ok 1 - use Bio::AlignIO::fasta;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - fasta input test 
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for end
ok 7 - fasta input test for description
ok 8 - fasta output test
ok 9 - filehandle input test  
ok 10 - filehandle output test
ok
Subroutine _initialize redefined at Bio\AlignIO\largemultifasta.pm line 81.
Subroutine next_seq redefined at Bio\AlignIO\largemultifasta.pm line 102.
Subroutine next_aln redefined at Bio\AlignIO\largemultifasta.pm line 143.
Subroutine write_aln redefined at Bio\AlignIO\largemultifasta.pm line 176.
t/AlignIO/largemultifasta.t .................. 
1..7
ok 1 - use Bio::AlignIO::largemultifasta;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - fasta input test 
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for description
ok 7 - fasta output test
ok
Subroutine _initialize redefined at Bio\AlignIO\maf.pm line 102.
Subroutine next_aln redefined at Bio\AlignIO\maf.pm line 121.
Subroutine write_aln redefined at Bio\AlignIO\maf.pm line 187.
t/AlignIO/maf.t .............................. 
1..11
ok 1 - use Bio::AlignIO::maf;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - maf input test
ok 4
ok 5 - The object isa Bio::Align::AlignI
ok 6 - maf input test
ok 7
ok 8 - maf input test
ok 9
ok 10 - maf input test
ok 11
ok
Subroutine next_aln redefined at Bio\AlignIO\mase.pm line 82.
Subroutine write_aln redefined at Bio\AlignIO\mase.pm line 158.
t/AlignIO/mase.t ............................. 
1..3
ok 1 - use Bio::AlignIO::mase;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - mase input test 
ok
Subroutine next_aln redefined at Bio\AlignIO\mega.pm line 115.
Subroutine write_aln redefined at Bio\AlignIO\mega.pm line 188.
t/AlignIO/mega.t ............................. 
1..6
ok 1 - use Bio::AlignIO::mega;
ok 2 - The object isa Bio::Align::AlignI
ok 3
ok 4
ok 5
ok 6 - mega output test
ok
Subroutine next_aln redefined at Bio\AlignIO\meme.pm line 104.
Subroutine write_aln redefined at Bio\AlignIO\meme.pm line 198.
Subroutine _initialize redefined at Bio\AlignIO\meme.pm line 207.
t/AlignIO/meme.t ............................. 
1..14
ok 1 - use Bio::AlignIO::meme;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6
ok 7
ok 8 - The object isa Bio::AlignIO
ok 9 - The object isa Bio::Align::AlignI
ok 10
ok 11
ok 12
ok 13
ok 14
ok
Subroutine _initialize redefined at Bio\AlignIO\metafasta.pm line 89.
Subroutine next_aln redefined at Bio\AlignIO\metafasta.pm line 107.
Subroutine write_aln redefined at Bio\AlignIO\metafasta.pm line 181.
Subroutine width redefined at Bio\AlignIO\metafasta.pm line 225.
t/AlignIO/metafasta.t ........................ 
1..4
ok 1 - use Bio::AlignIO::metafasta;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - consensus_string on metafasta
ok 4 - symbol_chars() using metafasta
ok
Subroutine next_aln redefined at Bio\AlignIO\msf.pm line 90.
Subroutine write_aln redefined at Bio\AlignIO\msf.pm line 173.
t/AlignIO/msf.t .............................. 
1..4
ok 1 - use Bio::AlignIO::msf;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - msf input test
ok 4 - msf output test
ok
# WARNING: NeXML parsing for NeXML v0.9 is currently very experimental support
t/AlignIO/nexml.t ............................ 
1..125
ok 1 - use Bio::AlignIO::nexml;
ok 2 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 3 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 4 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 5 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 6 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 7 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 8 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 9 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 10 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 11 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 12 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 13 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 14 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 15 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 16 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 17 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 18 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 19 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 20 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 21 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 22 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 23 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 24 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 25 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 26 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 27 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 28 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 29 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 30 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 31 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 32 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 33 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 34 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 35 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 36 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 37 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 38 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 39 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 40 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 41 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 42 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 43 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 44 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 45 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 46 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 47 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 48 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 49 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 50 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 51 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 52 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 53 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 54 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 55 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 56 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 57 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 58 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 59 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 60 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 61 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 62 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 63 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 64 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 65 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 66 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 67 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 68 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 69 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 70 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 71 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 72 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 73 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 74 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 75 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 76 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 77 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 78 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 79 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 80 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 81 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 82 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 83 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 84 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 85 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 86 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 87 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 88 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 89 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 90 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 91 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 92 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 93 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 94 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 95 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 96 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 97 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 98 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 99 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 100 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 101 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 102 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 103 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 104 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 105 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 106 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 107 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 108 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 109 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 110 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 111 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 112 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 113 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 114 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 115 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 116 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 117 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 118 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 119 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 120 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 121 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 122 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 123 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 124 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 125 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok
Subroutine _initialize redefined at Bio\AlignIO\nexus.pm line 103.
Subroutine next_aln redefined at Bio\AlignIO\nexus.pm line 142.
Subroutine _read_taxlabels redefined at Bio\AlignIO\nexus.pm line 339.
Subroutine write_aln redefined at Bio\AlignIO\nexus.pm line 367.
Subroutine flag redefined at Bio\AlignIO\nexus.pm line 463.
t/AlignIO/nexus.t ............................ 
1..43
ok 1 - use Bio::AlignIO::nexus;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - nexus output test
ok 6 - The object isa Bio::AlignIO
ok 7 - The object isa Bio::Align::AlignI
ok 8 - The object isa Bio::AlignIO
ok 9 - The object isa Bio::Align::AlignI
ok 10 - The object isa Bio::AlignIO
ok 11 - The object isa Bio::Align::AlignI
ok 12 - The object isa Bio::AlignIO
ok 13 - The object isa Bio::Align::AlignI
ok 14 - The object isa Bio::AlignIO
ok 15 - The object isa Bio::Align::AlignI
ok 16 - The object isa Bio::AlignIO
ok 17 - The object isa Bio::Align::AlignI
ok 18 - The object isa Bio::AlignIO
ok 19 - The object isa Bio::Align::AlignI
ok 20 - The object isa Bio::AlignIO
ok 21 - The object isa Bio::Align::AlignI
ok 22 - The object isa Bio::AlignIO
ok 23 - The object isa Bio::Align::AlignI
ok 24 - The object isa Bio::AlignIO
ok 25 - The object isa Bio::Align::AlignI
ok 26 - The object isa Bio::AlignIO
ok 27 - The object isa Bio::Align::AlignI
ok 28 - The object isa Bio::AlignIO
ok 29 - The object isa Bio::Align::AlignI
ok 30 - The object isa Bio::AlignIO
ok 31 - The object isa Bio::Align::AlignI
ok 32 - The object isa Bio::AlignIO
ok 33 - The object isa Bio::Align::AlignI
ok 34 - The object isa Bio::AlignIO
ok 35 - The object isa Bio::Align::AlignI
ok 36 - The object isa Bio::AlignIO
ok 37 - The object isa Bio::Align::AlignI
ok 38 - The object isa Bio::AlignIO
ok 39 - The object isa Bio::Align::AlignI
ok 40 - The object isa Bio::AlignIO
ok 41 - The object isa Bio::Align::AlignI
ok 42 - The object isa Bio::AlignIO
ok 43 - The object isa Bio::Align::AlignI
ok
Subroutine next_aln redefined at Bio\AlignIO\pfam.pm line 81.
Subroutine write_aln redefined at Bio\AlignIO\pfam.pm line 140.
t/AlignIO/pfam.t ............................. 
1..5
ok 1 - use Bio::AlignIO::pfam;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 -  pfam output test
ok
Subroutine _initialize redefined at Bio\AlignIO\phylip.pm line 134.
Subroutine next_aln redefined at Bio\AlignIO\phylip.pm line 171.
Subroutine write_aln redefined at Bio\AlignIO\phylip.pm line 323.
Subroutine interleaved redefined at Bio\AlignIO\phylip.pm line 443.
Subroutine flag_SI redefined at Bio\AlignIO\phylip.pm line 466.
Subroutine idlength redefined at Bio\AlignIO\phylip.pm line 486.
Subroutine line_length redefined at Bio\AlignIO\phylip.pm line 505.
Subroutine tag_length redefined at Bio\AlignIO\phylip.pm line 526.
Subroutine id_linebreak redefined at Bio\AlignIO\phylip.pm line 546.
Subroutine wrap_sequential redefined at Bio\AlignIO\phylip.pm line 566.
Subroutine longid redefined at Bio\AlignIO\phylip.pm line 585.
t/AlignIO/phylip.t ........................... 
1..16
ok 1 - use Bio::AlignIO::phylip;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - phylip output test
ok 6
ok 7
ok 8
not ok 9 # TODO problems with default strand, length?

#   Failed (TODO) test at t/AlignIO/phylip.t line 44.
#          got: undef
#     expected: '0'
not ok 10 # TODO problems with default strand, length?

#   Failed (TODO) test at t/AlignIO/phylip.t line 45.
#          got: '50'
#     expected: '47'
ok 11 - The object isa Bio::Align::AlignI
ok 12
ok 13 - The object isa Bio::AlignIO
ok 14 - The object isa Bio::Align::AlignI
ok 15
ok 16
ok
Subroutine next_aln redefined at Bio\AlignIO\po.pm line 83.
Subroutine write_aln redefined at Bio\AlignIO\po.pm line 228.
t/AlignIO/po.t ............................... 
1..11
ok 1 - use Bio::AlignIO::po;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - The object isa Bio::AlignIO
ok 6 - The object isa Bio::Align::AlignI
ok 7 - po output test
ok 8 - The object isa Bio::AlignIO
ok 9 - The object isa Bio::Align::AlignI
ok 10
ok 11
ok
Subroutine next_aln redefined at Bio\AlignIO\prodom.pm line 81.
Subroutine write_aln redefined at Bio\AlignIO\prodom.pm line 134.
t/AlignIO/prodom.t ........................... 
1..3
ok 1 - use Bio::AlignIO::prodom;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - prodom input test 
ok
Subroutine next_aln redefined at Bio\AlignIO\psi.pm line 107.
Subroutine write_aln redefined at Bio\AlignIO\psi.pm line 147.
t/AlignIO/psi.t .............................. 
1..5
ok 1 - use Bio::AlignIO::psi;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok
Subroutine next_aln redefined at Bio\AlignIO\selex.pm line 95.
Subroutine write_aln redefined at Bio\AlignIO\selex.pm line 162.
t/AlignIO/selex.t ............................ 
1..4
ok 1 - use Bio::AlignIO::selex;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - selex format test 
ok 4 - selex output test
ok
Subroutine _initialize redefined at Bio\AlignIO\stockholm.pm line 354.
Subroutine next_aln redefined at Bio\AlignIO\stockholm.pm line 379.
Subroutine write_aln redefined at Bio\AlignIO\stockholm.pm line 514.
Subroutine line_length redefined at Bio\AlignIO\stockholm.pm line 660.
Subroutine spaces redefined at Bio\AlignIO\stockholm.pm line 679.
Subroutine alignhandler redefined at Bio\AlignIO\stockholm.pm line 695.
Subroutine _print_seqs redefined at Bio\AlignIO\stockholm.pm line 707.
Subroutine new redefined at Bio\Seq\Meta.pm line 225, <GEN0> line 64.
Subroutine meta redefined at Bio\Seq\Meta.pm line 269, <GEN0> line 64.
Subroutine meta_text redefined at Bio\Seq\Meta.pm line 284, <GEN0> line 64.
Subroutine named_meta redefined at Bio\Seq\Meta.pm line 300, <GEN0> line 64.
Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 347, <GEN0> line 64.
Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 377, <GEN0> line 64.
Subroutine submeta redefined at Bio\Seq\Meta.pm line 409, <GEN0> line 64.
Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 425, <GEN0> line 64.
Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 444, <GEN0> line 64.
Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 503, <GEN0> line 64.
Subroutine meta_names redefined at Bio\Seq\Meta.pm line 518, <GEN0> line 64.
Subroutine meta_length redefined at Bio\Seq\Meta.pm line 540, <GEN0> line 64.
Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 556, <GEN0> line 64.
Subroutine force_flush redefined at Bio\Seq\Meta.pm line 577, <GEN0> line 64.
Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 604, <GEN0> line 64.
Subroutine is_flush redefined at Bio\Seq\Meta.pm line 637, <GEN0> line 64.
Subroutine revcom redefined at Bio\Seq\Meta.pm line 679, <GEN0> line 64.
Subroutine trunc redefined at Bio\Seq\Meta.pm line 702, <GEN0> line 64.
Subroutine to_string redefined at Bio\Seq\Meta.pm line 726, <GEN0> line 64.
t/AlignIO/stockholm.t ........................ 
1..84
ok 1 - use Bio::AlignIO::stockholm;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - The object isa Bio::Annotation::Comment
ok 10 - Stockholm annotation
ok 11 - Stockholm annotation
ok 12 - stockholm output test
ok 13 - The object isa Bio::Align::AlignI
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20 - Stockholm annotation isa Bio::Annotation::Reference
ok 21 - Stockholm annotation
ok 22 - Stockholm annotation
ok 23 - Stockholm annotation
ok 24 - Stockholm annotation
ok 25 - The object isa Bio::Seq::MetaI
ok 26 - Rfam meta data
ok 27 - Rfam meta data
ok 28
ok 29 - The object isa Bio::Align::AlignI
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35 - The object isa Bio::Seq::MetaI
ok 36 - Rfam meta data
ok 37 - Rfam meta data
ok 38 - The object isa Bio::AlignIO
ok 39
ok 40 - The object isa Bio::Align::AlignI
ok 41
ok 42
ok 43
ok 44
ok 45 - The object isa Bio::Annotation::SimpleValue
ok 46 - Pfam annotation
ok 47
ok 48 - The object isa Bio::Align::AlignI
ok 49
ok 50
ok 51
ok 52
ok 53 - The object isa Bio::Align::AlignI
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - The object isa Bio::Seq::MetaI
ok 60 - Pfam aln meta data
ok 61 - Pfam aln meta data
ok 62 - Pfam aln meta data
ok 63 - Pfam aln meta data
ok 64 - Pfam aln meta data
ok 65 - Pfam aln meta data
ok 66 - Pfam seq meta data
ok 67 - Pfam seq meta data
ok 68 - Pfam seq meta data
ok 69 - Pfam seq meta data
ok 70
ok 71 - The object isa Bio::SeqFeatureI
ok 72 - The object isa Bio::Seq::Meta
ok 73 - The object isa Bio::AnnotationI
ok 74 - The object isa Bio::Annotation::DBLink
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok
Subroutine next_aln redefined at Bio\AlignIO\xmfa.pm line 87.
Subroutine write_aln redefined at Bio\AlignIO\xmfa.pm line 141.
Subroutine _get_len redefined at Bio\AlignIO\xmfa.pm line 194.
Subroutine width redefined at Bio\AlignIO\xmfa.pm line 212.
Subroutine _process_seq redefined at Bio\AlignIO\xmfa.pm line 221.
t/AlignIO/xmfa.t ............................. 
1..30
ok 1 - use Bio::AlignIO::xmfa;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - xmfa input test 
ok 4 - xmfa input test for start
ok 5 - xmfa input test for end
ok 6 - xmfa strand test
ok 7 - xmfa input test for id
ok 8 - xmfa input test for id
ok 9 - xmfa input test 
ok 10 - xmfa input test for start
ok 11 - xmfa input test for end
ok 12 - xmfa strand test
ok 13 - xmfa input test for id
ok 14 - xmfa input test for id
ok 15 - xmfa input test 
ok 16 - xmfa input test for start
ok 17 - xmfa input test for end
ok 18 - xmfa strand test
ok 19 - xmfa input test for id
ok 20 - xmfa input test for id
ok 21 - xmfa alignment score
ok 22 - The object isa Bio::Align::AlignI
ok 23 - xmfa input test 
ok 24 - xmfa strand
ok 25 - xmfa input test for description
ok 26 - xmfa input test for id
ok 27 - xmfa input test for end
ok 28 - xmfa input test for end
ok 29 - xmfa alignment score
ok 30 - xmfa output test
ok
t/Alphabet.t ................................. 
1..100
ok 1 - use Bio::Symbol::Alphabet;
ok 2 - use Bio::Symbol::Symbol;
ok 3 - use Bio::Symbol::DNAAlphabet;
ok 4 - use Bio::Symbol::ProteinAlphabet;
ok 5 - The object isa Bio::Symbol::Alphabet
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - The object isa Bio::Symbol::AlphabetI
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - The object isa Bio::Symbol::AlphabetI
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok
Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 96.
Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 128.
Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 153.
Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 174.
Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 199.
Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 229.
Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 265.
Subroutine new redefined at Bio\Annotation\OntologyTerm.pm line 128.
Subroutine as_text redefined at Bio\Annotation\OntologyTerm.pm line 172.
Subroutine display_text redefined at Bio\Annotation\OntologyTerm.pm line 197.
Subroutine hash_tree redefined at Bio\Annotation\OntologyTerm.pm line 218.
Subroutine tagname redefined at Bio\Annotation\OntologyTerm.pm line 246.
Subroutine term redefined at Bio\Annotation\OntologyTerm.pm line 274.
Subroutine identifier redefined at Bio\Annotation\OntologyTerm.pm line 297.
Subroutine name redefined at Bio\Annotation\OntologyTerm.pm line 313.
Subroutine definition redefined at Bio\Annotation\OntologyTerm.pm line 330.
Subroutine ontology redefined at Bio\Annotation\OntologyTerm.pm line 348.
Subroutine is_obsolete redefined at Bio\Annotation\OntologyTerm.pm line 364.
Subroutine comment redefined at Bio\Annotation\OntologyTerm.pm line 380.
Subroutine get_synonyms redefined at Bio\Annotation\OntologyTerm.pm line 394.
Subroutine add_synonym redefined at Bio\Annotation\OntologyTerm.pm line 410.
Subroutine remove_synonyms redefined at Bio\Annotation\OntologyTerm.pm line 425.
Subroutine get_dblinks redefined at Bio\Annotation\OntologyTerm.pm line 441.
Subroutine get_dbxrefs redefined at Bio\Annotation\OntologyTerm.pm line 457.
Subroutine add_dblink redefined at Bio\Annotation\OntologyTerm.pm line 477.
Subroutine add_dbxref redefined at Bio\Annotation\OntologyTerm.pm line 496.
Subroutine remove_dblinks redefined at Bio\Annotation\OntologyTerm.pm line 512.
Subroutine remove_dbxrefs redefined at Bio\Annotation\OntologyTerm.pm line 528.
Subroutine get_secondary_ids redefined at Bio\Annotation\OntologyTerm.pm line 546.
Subroutine add_secondary_id redefined at Bio\Annotation\OntologyTerm.pm line 563.
Subroutine remove_secondary_ids redefined at Bio\Annotation\OntologyTerm.pm line 578.
Subroutine new redefined at Bio\Annotation\Comment.pm line 64.
Subroutine as_text redefined at Bio\Annotation\Comment.pm line 92.
Subroutine display_text redefined at Bio\Annotation\Comment.pm line 117.
Subroutine hash_tree redefined at Bio\Annotation\Comment.pm line 138.
Subroutine tagname redefined at Bio\Annotation\Comment.pm line 166.
Subroutine text redefined at Bio\Annotation\Comment.pm line 193.
Subroutine type redefined at Bio\Annotation\Comment.pm line 231.
Subroutine Bio::Annotation::Comment::value redefined at Bio\Annotation\Comment.pm line 215.
Subroutine new redefined at Bio\Annotation\Target.pm line 67.
Subroutine as_text redefined at Bio\Annotation\Target.pm line 104.
Subroutine display_text redefined at Bio\Annotation\Target.pm line 134.
Subroutine tagname redefined at Bio\Annotation\Target.pm line 163.
Subroutine target_id redefined at Bio\Annotation\Target.pm line 198.
Subroutine new redefined at Bio\Tree\Tree.pm line 131.
Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179.
Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196.
Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230.
Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245.
Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269.
Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283.
Subroutine id redefined at Bio\Tree\Tree.pm line 306.
Subroutine score redefined at Bio\Tree\Tree.pm line 327.
Subroutine as_text redefined at Bio\Tree\Tree.pm line 375.
Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411.
Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432.
Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452.
Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472.
Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488.
Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504.
Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520.
Subroutine clone redefined at Bio\Tree\Tree.pm line 540.
Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558.
Subroutine new redefined at Bio\Tree\Node.pm line 110.
Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163.
Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221.
Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259.
Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322.
Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357.
Subroutine ancestor redefined at Bio\Tree\Node.pm line 396.
Subroutine branch_length redefined at Bio\Tree\Node.pm line 437.
Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461.
Subroutine description redefined at Bio\Tree\Node.pm line 482.
Subroutine id redefined at Bio\Tree\Node.pm line 511.
Subroutine internal_id redefined at Bio\Tree\Node.pm line 553.
Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567.
Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588.
Subroutine height redefined at Bio\Tree\Node.pm line 606.
Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631.
Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652.
Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674.
Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695.
Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715.
Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731.
Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749.
Subroutine has_tag redefined at Bio\Tree\Node.pm line 765.
Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770.
Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800.
Subroutine new redefined at Bio\Annotation\Tree.pm line 73.
Subroutine as_text redefined at Bio\Annotation\Tree.pm line 114.
Subroutine display_text redefined at Bio\Annotation\Tree.pm line 141.
Subroutine hash_tree redefined at Bio\Annotation\Tree.pm line 161.
Subroutine tagname redefined at Bio\Annotation\Tree.pm line 185.
Subroutine tree_id redefined at Bio\Annotation\Tree.pm line 206.
Subroutine tree redefined at Bio\Annotation\Tree.pm line 223.
Subroutine new redefined at Bio\Annotation\TagTree.pm line 139.
Subroutine as_text redefined at Bio\Annotation\TagTree.pm line 178.
Subroutine display_text redefined at Bio\Annotation\TagTree.pm line 202.
Subroutine hash_tree redefined at Bio\Annotation\TagTree.pm line 223.
Subroutine tagname redefined at Bio\Annotation\TagTree.pm line 243.
Subroutine value redefined at Bio\Annotation\TagTree.pm line 265.
Subroutine tagformat redefined at Bio\Annotation\TagTree.pm line 313.
Subroutine node redefined at Bio\Annotation\TagTree.pm line 336.
Subroutine element redefined at Bio\Annotation\TagTree.pm line 378.
Subroutine data redefined at Bio\Annotation\TagTree.pm line 394.
Subroutine children redefined at Bio\Annotation\TagTree.pm line 418.
Subroutine subnodes redefined at Bio\Annotation\TagTree.pm line 436.
Subroutine get redefined at Bio\Annotation\TagTree.pm line 453.
Subroutine find redefined at Bio\Annotation\TagTree.pm line 470.
Subroutine findnode redefined at Bio\Annotation\TagTree.pm line 487.
Subroutine findval redefined at Bio\Annotation\TagTree.pm line 503.
Subroutine addchild redefined at Bio\Annotation\TagTree.pm line 526.
Subroutine add redefined at Bio\Annotation\TagTree.pm line 561.
Subroutine set redefined at Bio\Annotation\TagTree.pm line 583.
Subroutine unset redefined at Bio\Annotation\TagTree.pm line 604.
Subroutine free redefined at Bio\Annotation\TagTree.pm line 619.
Subroutine hash redefined at Bio\Annotation\TagTree.pm line 635.
Subroutine pairs redefined at Bio\Annotation\TagTree.pm line 652.
Subroutine qmatch redefined at Bio\Annotation\TagTree.pm line 668.
Subroutine tnodes redefined at Bio\Annotation\TagTree.pm line 683.
Subroutine ntnodes redefined at Bio\Annotation\TagTree.pm line 698.
Subroutine get_all_values redefined at Bio\Annotation\TagTree.pm line 721.
t/Annotation/Annotation.t .................... 
1..159
ok 1 - use Bio::Annotation::Collection;
ok 2 - use Bio::Annotation::DBLink;
ok 3 - use Bio::Annotation::Comment;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6 - use Bio::Annotation::Target;
ok 7 - use Bio::Annotation::AnnotationFactory;
ok 8 - use Bio::Annotation::StructuredValue;
ok 9 - use Bio::Annotation::TagTree;
ok 10 - use Bio::Annotation::Tree;
ok 11 - use Bio::Seq;
ok 12 - use Bio::SimpleAlign;
ok 13 - use Bio::Cluster::UniGene;
ok 14 - The object isa Bio::AnnotationI
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21 - The object isa Bio::AnnotationI
ok 22
ok 23
ok 24
ok 25 - The object isa Bio::AnnotationCollectionI
ok 26
ok 27
ok 28 - The object isa Bio::AnnotationI
ok 29
ok 30 - The object isa Bio::AnnotationI
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53 - The object isa Bio::AnnotationI
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68 - The object isa Bio::AnnotationCollectionI
ok 69
ok 70
ok 71
ok 72
ok 73 - The object isa Bio::Annotation::StructuredValue
ok 74
ok 75
ok 76
ok 77
ok 78 - use Bio::Annotation::OntologyTerm;
ok 79 - The object isa Bio::Ontology::Term
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85 - The object isa Bio::AnnotatableI
ok 86 - isa SeqFeatureI isa Bio::SeqFeatureI
ok 87 - isa AnnotatableI isa Bio::AnnotatableI
ok 88 - isa SeqFeatureI isa Bio::SeqFeatureI
ok 89 - isa AnnotatableI isa Bio::AnnotatableI
ok 90 - The object isa Bio::AnnotatableI
ok 91 - The object isa Bio::AnnotatableI
ok 92 - The object isa Bio::Factory::ObjectFactoryI
ok 93 - The object isa Bio::Annotation::SimpleValue
ok 94
ok 95 - The object isa Bio::Annotation::OntologyTerm
ok 96 - Bio::Annotation::Comment
ok 97 - The object isa Bio::Annotation::Comment
ok 98
ok 99 - Bio::Annotation::Comment
ok 100 - The object isa Bio::Annotation::Comment
ok 101 - Bio::Annotation::Comment
ok 102 - The object isa Bio::Annotation::Comment
ok 103
ok 104 - The object isa Bio::Annotation::Target
ok 105
ok 106
ok 107 - The object isa Bio::AnnotationI
ok 108 - tree_id()
ok 109 - tagname()
ok 110 - The object isa Bio::AnnotatableI
ok 111
ok 112 - add tree to AlignI
ok 113 - get seq from node id
ok 114
ok 115 - The object isa Bio::Annotation::Tree
ok 116 - The object isa Bio::AnnotationI
ok 117 - default itext
ok 118 - roundtrip
ok 119 - itext
ok 120 - spxr
ok 121 - indent
ok 122 - xml
ok 123 - The object isa Data::Stag::StagI
ok 124
ok 125 - child changes
ok 126 - The object isa Data::Stag::StagI
ok 127
ok 128 - child changes
ok 129 - The object isa Data::Stag::StagI
ok 130
ok 131 - child changes
ok 132 - child changes in parent node
ok 133 - no tags
ok 134 - before Stag node
ok 135 - after Stag node
ok 136 - both stag nodes
ok 137 - different instances
ok 138 - before TagTree
ok 139 - after TagTree
ok 140 - both stag nodes
ok 141 - different instances
ok 142 - before TagTree
ok 143 - after TagTree
ok 144 - stag nodes
ok 145 - same instance
ok 146 - before TagTree
ok 147 - after TagTree
ok 148 - stag nodes
ok 149 - different instance
ok 150 - The object isa Bio::AnnotationI
ok 151 - The object isa Data::Stag::StagI
ok 152 - child changes
ok 153 - The object isa Data::Stag::StagI
ok 154 - child changes
ok 155 - The object isa Data::Stag::StagI
ok 156 - child changes
ok 157
ok 158
ok 159 - The object isa Bio::Annotation::TagTree
ok
t/Annotation/AnnotationAdaptor.t ............. 
1..23
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::SeqFeature::AnnotationAdaptor;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
Bio::Assembly::IO: could not load tigr - for more details on supported formats please see the Assembly::IO docs
Exception 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::Assembly::IO::tigr. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio/SeqFeature/Collection.pm line 146.
BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146.
Compilation failed in require at Bio/Assembly/Singlet.pm line 91.
BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91.
Compilation failed in require at Bio\Assembly\IO\tigr.pm line 237.
BEGIN failed--compilation aborted at Bio\Assembly\IO\tigr.pm line 237.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:296
STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:138
STACK: t/Assembly/ContigSpectrum.t:12
-----------------------------------------------------------


#   Failed test 'The thing isa Bio::Assembly::IO'
#   at t/Assembly/ContigSpectrum.t line 16.
#     The thing isn't defined
Can't call method "next_assembly" on an undefined value at t/Assembly/ContigSpectrum.t line 17.
# Looks like you planned 236 tests but ran 3.
# Looks like you failed 1 test of 3 run.
# Looks like your test exited with 2 just after 3.
t/Assembly/ContigSpectrum.t .................. 
1..236
ok 1 - use Bio::Assembly::IO;
ok 2 - use Bio::Assembly::Tools::ContigSpectrum;
not ok 3 - The thing isa Bio::Assembly::IO
Dubious, test returned 2 (wstat 512, 0x200)
Failed 234/236 subtests 
t/Assembly/IO/bowtie.t ....................... skipped: The optional module DB_File (or dependencies thereof) was not installed
t/Assembly/IO/sam.t .......................... skipped: The optional module DB_File (or dependencies thereof) was not installed
t/Assembly/core.t ............................ skipped: The optional module DB_File (or dependencies thereof) was not installed
t/Biblio/Biblio.t ............................ 
1..24
ok 1 - use Bio::Biblio;
ok 2 - use Bio::Biblio::IO;
ok 3
ok 4
ok 5 - citation 1
ok 6 - citation 2
ok 7 - citation 3
ok 8 - in callback
ok 9 - in callback
ok 10 - in callback
ok 11 - calling callback
ok 12 - citation 1
ok 13 - citation 2
ok 14 - citation 1
ok 15 - citation 2
ok 16
ok 17 - citation 1
ok 18 - citation 2
ok 19 - citation 3
ok 20 - citation 4
ok 21 - filehandle test
ok 22 - filehandle test
ok 23 - filehandle test
ok 24 - filehandle test
ok
t/Biblio/References.t ........................ 
1..537
ok 1 - use Bio::Biblio::Article;
ok 2 - use Bio::Biblio::Book;
ok 3 - use Bio::Biblio::BookArticle;
ok 4 - use Bio::Biblio::Journal;
ok 5 - use Bio::Biblio::JournalArticle;
ok 6 - use Bio::Biblio::MedlineArticle;
ok 7 - use Bio::Biblio::MedlineBook;
ok 8 - use Bio::Biblio::MedlineBookArticle;
ok 9 - use Bio::Biblio::MedlineJournal;
ok 10 - use Bio::Biblio::MedlineJournalArticle;
ok 11 - use Bio::Biblio::Organisation;
ok 12 - use Bio::Biblio::Patent;
ok 13 - use Bio::Biblio::Person;
ok 14 - use Bio::Biblio::Proceeding;
ok 15 - use Bio::Biblio::Provider;
ok 16 - use Bio::Biblio::Ref;
ok 17 - use Bio::Biblio::Service;
ok 18 - use Bio::Biblio::TechReport;
ok 19 - use Bio::Biblio::Thesis;
ok 20 - use Bio::Biblio::WebResource;
ok 21 - use Bio::Biblio::PubmedArticle;
ok 22 - use Bio::Biblio::PubmedBookArticle;
ok 23 - use Bio::Biblio::PubmedJournalArticle;
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47 - set 'abstract'
ok 48 - get 'abstract'
ok 49 - set 'abstract_language'
ok 50 - get 'abstract_language'
ok 51 - set 'abstract_type'
ok 52 - get 'abstract_type'
ok 53 - set 'author_list_complete'
ok 54 - get 'author_list_complete'
ok 55 - set 'cross_references_list_complete'
ok 56 - get 'cross_references_list_complete'
ok 57 - set 'date'
ok 58 - get 'date'
ok 59 - set 'date_completed'
ok 60 - get 'date_completed'
ok 61 - set 'date_created'
ok 62 - get 'date_created'
ok 63 - set 'date_revised'
ok 64 - get 'date_revised'
ok 65 - set 'format'
ok 66 - get 'format'
ok 67 - set 'identifier'
ok 68 - get 'identifier'
ok 69 - set 'language'
ok 70 - get 'language'
ok 71 - set 'last_modified_date'
ok 72 - get 'last_modified_date'
ok 73 - set 'repository_subset'
ok 74 - get 'repository_subset'
ok 75 - set 'rights'
ok 76 - get 'rights'
ok 77 - set 'spatial_location'
ok 78 - get 'spatial_location'
ok 79 - set 'subject_headings_source'
ok 80 - get 'subject_headings_source'
ok 81 - set 'temporal_period'
ok 82 - get 'temporal_period'
ok 83 - set 'title'
ok 84 - get 'title'
ok 85 - set 'toc'
ok 86 - get 'toc'
ok 87 - set 'toc_type'
ok 88 - get 'toc_type'
ok 89 - set 'type'
ok 90 - get 'type'
ok 91 - set 'first_page'
ok 92 - get 'first_page'
ok 93 - set 'last_page'
ok 94 - get 'last_page'
ok 95 - set 'issue'
ok 96 - get 'issue'
ok 97 - set 'issue_supplement'
ok 98 - get 'issue_supplement'
ok 99 - set 'volume'
ok 100 - get 'volume'
ok 101 - set 'affiliation'
ok 102 - get 'affiliation'
ok 103 - set 'citation_owner'
ok 104 - get 'citation_owner'
ok 105 - set 'date_of_electronic_publication'
ok 106 - get 'date_of_electronic_publication'
ok 107 - set 'gene_symbols'
ok 108 - get 'gene_symbols'
ok 109 - set 'grant_list_complete'
ok 110 - get 'grant_list_complete'
ok 111 - set 'medline_date'
ok 112 - get 'medline_date'
ok 113 - set 'medline_id'
ok 114 - get 'medline_id'
ok 115 - set 'medline_page'
ok 116 - get 'medline_page'
ok 117 - set 'number_of_references'
ok 118 - get 'number_of_references'
ok 119 - set 'other_languages'
ok 120 - get 'other_languages'
ok 121 - set 'pmid'
ok 122 - get 'pmid'
ok 123 - set 'season'
ok 124 - get 'season'
ok 125 - set 'status'
ok 126 - get 'status'
ok 127 - set 'vernacular_title'
ok 128 - get 'vernacular_title'
ok 129
ok 130 - abstract
ok 131 - abstract_language
ok 132 - abstract_type
ok 133 - author_list_complete
ok 134 - cross_references_list_complete
ok 135 - date
ok 136 - date_completed
ok 137 - date_created
ok 138 - date_revised
ok 139 - format
ok 140 - identifier
ok 141 - language
ok 142 - last_modified_date
ok 143 - repository_subset
ok 144 - rights
ok 145 - spatial_location
ok 146 - subject_headings_source
ok 147 - temporal_period
ok 148 - title
ok 149 - toc
ok 150 - toc_type
ok 151 - type
ok 152 - first_page
ok 153 - last_page
ok 154 - issue
ok 155 - issue_supplement
ok 156 - volume
ok 157 - affiliation
ok 158 - citation_owner
ok 159 - date_of_electronic_publication
ok 160 - gene_symbols
ok 161 - grant_list_complete
ok 162 - medline_date
ok 163 - medline_id
ok 164 - medline_page
ok 165 - number_of_references
ok 166 - other_languages
ok 167 - pmid
ok 168 - season
ok 169 - status
ok 170 - vernacular_title
ok 171 - get 'authors'
ok 172 - get 'cross_references'
ok 173 - get 'codes'
ok 174 - get 'contributors'
ok 175 - get 'keywords'
ok 176 - get 'publisher'
ok 177 - get 'subject_headings'
ok 178 - get 'journal'
ok 179 - get 'chemicals'
ok 180 - get 'comment_ins'
ok 181 - get 'comment_ons'
ok 182 - get 'erratum_fors'
ok 183 - get 'erratum_ins'
ok 184 - get 'general_notes'
ok 185 - get 'grants'
ok 186 - get 'mesh_headings'
ok 187 - get 'original_report_ins'
ok 188 - get 'other_abstracts'
ok 189 - get 'other_ids'
ok 190 - get 'republished_froms'
ok 191 - get 'republished_ins'
ok 192 - get 'retraction_ins'
ok 193 - get 'retraction_ofs'
ok 194 - get 'summary_for_patients_ins'
ok 195 - get 'update_ins'
ok 196 - get 'update_ofs'
ok 197 - get 'journal'
ok 198 - add_author 1
ok 199 - add_author 2
ok 200 - get authors
ok 201 - add_contributor 1
ok 202 - add_contributor 2
ok 203 - get contributors
ok 204 - add_cross_reference 1
ok 205 - add_cross_reference 2
ok 206 - get cross_references
ok 207 - get cross_references
ok 208 - set 'abstract'
ok 209 - get 'abstract'
ok 210 - set 'abstract_language'
ok 211 - get 'abstract_language'
ok 212 - set 'abstract_type'
ok 213 - get 'abstract_type'
ok 214 - set 'author_list_complete'
ok 215 - get 'author_list_complete'
ok 216 - set 'cross_references_list_complete'
ok 217 - get 'cross_references_list_complete'
ok 218 - set 'date'
ok 219 - get 'date'
ok 220 - set 'date_completed'
ok 221 - get 'date_completed'
ok 222 - set 'date_created'
ok 223 - get 'date_created'
ok 224 - set 'date_revised'
ok 225 - get 'date_revised'
ok 226 - set 'format'
ok 227 - get 'format'
ok 228 - set 'identifier'
ok 229 - get 'identifier'
ok 230 - set 'language'
ok 231 - get 'language'
ok 232 - set 'last_modified_date'
ok 233 - get 'last_modified_date'
ok 234 - set 'repository_subset'
ok 235 - get 'repository_subset'
ok 236 - set 'rights'
ok 237 - get 'rights'
ok 238 - set 'spatial_location'
ok 239 - get 'spatial_location'
ok 240 - set 'subject_headings_source'
ok 241 - get 'subject_headings_source'
ok 242 - set 'temporal_period'
ok 243 - get 'temporal_period'
ok 244 - set 'title'
ok 245 - get 'title'
ok 246 - set 'toc'
ok 247 - get 'toc'
ok 248 - set 'toc_type'
ok 249 - get 'toc_type'
ok 250 - set 'type'
ok 251 - get 'type'
ok 252 - set 'first_page'
ok 253 - get 'first_page'
ok 254 - set 'last_page'
ok 255 - get 'last_page'
ok 256 - set 'affiliation'
ok 257 - get 'affiliation'
ok 258 - set 'citation_owner'
ok 259 - get 'citation_owner'
ok 260 - set 'date_of_electronic_publication'
ok 261 - get 'date_of_electronic_publication'
ok 262 - set 'gene_symbols'
ok 263 - get 'gene_symbols'
ok 264 - set 'grant_list_complete'
ok 265 - get 'grant_list_complete'
ok 266 - set 'medline_date'
ok 267 - get 'medline_date'
ok 268 - set 'medline_id'
ok 269 - get 'medline_id'
ok 270 - set 'medline_page'
ok 271 - get 'medline_page'
ok 272 - set 'number_of_references'
ok 273 - get 'number_of_references'
ok 274 - set 'other_languages'
ok 275 - get 'other_languages'
ok 276 - set 'pmid'
ok 277 - get 'pmid'
ok 278 - set 'season'
ok 279 - get 'season'
ok 280 - set 'status'
ok 281 - get 'status'
ok 282 - set 'vernacular_title'
ok 283 - get 'vernacular_title'
ok 284
ok 285 - abstract
ok 286 - abstract_language
ok 287 - abstract_type
ok 288 - author_list_complete
ok 289 - cross_references_list_complete
ok 290 - date
ok 291 - date_completed
ok 292 - date_created
ok 293 - date_revised
ok 294 - format
ok 295 - identifier
ok 296 - language
ok 297 - last_modified_date
ok 298 - repository_subset
ok 299 - rights
ok 300 - spatial_location
ok 301 - subject_headings_source
ok 302 - temporal_period
ok 303 - title
ok 304 - toc
ok 305 - toc_type
ok 306 - type
ok 307 - first_page
ok 308 - last_page
ok 309 - affiliation
ok 310 - citation_owner
ok 311 - date_of_electronic_publication
ok 312 - gene_symbols
ok 313 - grant_list_complete
ok 314 - medline_date
ok 315 - medline_id
ok 316 - medline_page
ok 317 - number_of_references
ok 318 - other_languages
ok 319 - pmid
ok 320 - season
ok 321 - status
ok 322 - vernacular_title
ok 323 - get 'authors'
ok 324 - get 'cross_references'
ok 325 - get 'codes'
ok 326 - get 'contributors'
ok 327 - get 'keywords'
ok 328 - get 'publisher'
ok 329 - get 'subject_headings'
ok 330 - get 'book'
ok 331 - get 'chemicals'
ok 332 - get 'comment_ins'
ok 333 - get 'comment_ons'
ok 334 - get 'erratum_fors'
ok 335 - get 'erratum_ins'
ok 336 - get 'general_notes'
ok 337 - get 'grants'
ok 338 - get 'mesh_headings'
ok 339 - get 'original_report_ins'
ok 340 - get 'other_abstracts'
ok 341 - get 'other_ids'
ok 342 - get 'republished_froms'
ok 343 - get 'republished_ins'
ok 344 - get 'retraction_ins'
ok 345 - get 'retraction_ofs'
ok 346 - get 'summary_for_patients_ins'
ok 347 - get 'update_ins'
ok 348 - get 'update_ofs'
ok 349 - get 'book'
ok 350 - set 'abstract'
ok 351 - get 'abstract'
ok 352 - set 'abstract_language'
ok 353 - get 'abstract_language'
ok 354 - set 'abstract_type'
ok 355 - get 'abstract_type'
ok 356 - set 'author_list_complete'
ok 357 - get 'author_list_complete'
ok 358 - set 'cross_references_list_complete'
ok 359 - get 'cross_references_list_complete'
ok 360 - set 'date'
ok 361 - get 'date'
ok 362 - set 'date_completed'
ok 363 - get 'date_completed'
ok 364 - set 'date_created'
ok 365 - get 'date_created'
ok 366 - set 'date_revised'
ok 367 - get 'date_revised'
ok 368 - set 'format'
ok 369 - get 'format'
ok 370 - set 'identifier'
ok 371 - get 'identifier'
ok 372 - set 'language'
ok 373 - get 'language'
ok 374 - set 'last_modified_date'
ok 375 - get 'last_modified_date'
ok 376 - set 'repository_subset'
ok 377 - get 'repository_subset'
ok 378 - set 'rights'
ok 379 - get 'rights'
ok 380 - set 'spatial_location'
ok 381 - get 'spatial_location'
ok 382 - set 'subject_headings_source'
ok 383 - get 'subject_headings_source'
ok 384 - set 'temporal_period'
ok 385 - get 'temporal_period'
ok 386 - set 'title'
ok 387 - get 'title'
ok 388 - set 'toc'
ok 389 - get 'toc'
ok 390 - set 'toc_type'
ok 391 - get 'toc_type'
ok 392 - set 'type'
ok 393 - get 'type'
ok 394 - set 'edition'
ok 395 - get 'edition'
ok 396 - set 'isbn'
ok 397 - get 'isbn'
ok 398 - set 'series'
ok 399 - get 'series'
ok 400 - set 'volume'
ok 401 - get 'volume'
ok 402
ok 403 - abstract
ok 404 - abstract_language
ok 405 - abstract_type
ok 406 - author_list_complete
ok 407 - cross_references_list_complete
ok 408 - date
ok 409 - date_completed
ok 410 - date_created
ok 411 - date_revised
ok 412 - format
ok 413 - identifier
ok 414 - language
ok 415 - last_modified_date
ok 416 - repository_subset
ok 417 - rights
ok 418 - spatial_location
ok 419 - subject_headings_source
ok 420 - temporal_period
ok 421 - title
ok 422 - toc
ok 423 - toc_type
ok 424 - type
ok 425 - edition
ok 426 - isbn
ok 427 - series
ok 428 - volume
ok 429 - get 'authors'
ok 430 - get 'cross_references'
ok 431 - get 'codes'
ok 432 - get 'contributors'
ok 433 - get 'keywords'
ok 434 - get 'publisher'
ok 435 - get 'subject_headings'
ok 436 - get 'editor'
ok 437 - set 'abbreviation'
ok 438 - get 'abbreviation'
ok 439 - set 'issn'
ok 440 - get 'issn'
ok 441 - set 'name'
ok 442 - get 'name'
ok 443 - set 'coden'
ok 444 - get 'coden'
ok 445 - set 'country'
ok 446 - get 'country'
ok 447 - set 'medline_code'
ok 448 - get 'medline_code'
ok 449 - set 'medline_ta'
ok 450 - get 'medline_ta'
ok 451 - set 'nlm_unique_id'
ok 452 - get 'nlm_unique_id'
ok 453
ok 454 - abbreviation
ok 455 - issn
ok 456 - name
ok 457 - coden
ok 458 - country
ok 459 - medline_code
ok 460 - medline_ta
ok 461 - nlm_unique_id
ok 462 - set 'doc_number'
ok 463 - get 'doc_number'
ok 464 - set 'doc_office'
ok 465 - get 'doc_office'
ok 466 - set 'doc_type'
ok 467 - get 'doc_type'
ok 468
ok 469 - doc_number
ok 470 - doc_office
ok 471 - doc_type
ok 472 - get 'applicants'
ok 473 - set 'url'
ok 474 - get 'url'
ok 475 - set 'estimated_size'
ok 476 - get 'estimated_size'
ok 477 - set 'cost'
ok 478 - get 'cost'
ok 479
ok 480 - url
ok 481 - estimated_size
ok 482 - cost
ok 483 - set 'type'
ok 484 - get 'type'
ok 485 - set 'affiliation'
ok 486 - get 'affiliation'
ok 487 - set 'email'
ok 488 - get 'email'
ok 489 - set 'firstname'
ok 490 - get 'firstname'
ok 491 - set 'forename'
ok 492 - get 'forename'
ok 493 - set 'initials'
ok 494 - get 'initials'
ok 495 - set 'lastname'
ok 496 - get 'lastname'
ok 497 - set 'middlename'
ok 498 - get 'middlename'
ok 499 - set 'postal_address'
ok 500 - get 'postal_address'
ok 501 - set 'suffix'
ok 502 - get 'suffix'
ok 503
ok 504 - type
ok 505 - affiliation
ok 506 - email
ok 507 - firstname
ok 508 - forename
ok 509 - initials
ok 510 - lastname
ok 511 - middlename
ok 512 - postal_address
ok 513 - suffix
ok 514 - set 'type'
ok 515 - get 'type'
ok 516 - set 'name'
ok 517 - get 'name'
ok 518
ok 519 - type
ok 520 - name
ok 521 - set 'type'
ok 522 - get 'type'
ok 523 - set 'name'
ok 524 - get 'name'
ok 525
ok 526 - type
ok 527 - name
ok 528 - set 'pubmed_status'
ok 529 - get 'pubmed_status'
ok 530 - set 'pubmed_provider_id'
ok 531 - get 'pubmed_provider_id'
ok 532
ok 533 - pubmed_status
ok 534 - pubmed_provider_id
ok 535 - get 'pubmed_history_list'
ok 536 - get 'pubmed_article_id_list'
ok 537 - get 'pubmed_url_list'
ok
t/Biblio/biofetch.t .......................... skipped: Network tests have not been requested
t/Biblio/eutils.t ............................ skipped: Network tests have not been requested
t/ClusterIO/ClusterIO.t ...................... 
1..12
ok 1 - use Bio::ClusterIO;
ok 2 - use Bio::Cluster::ClusterFactory;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - The object isa Bio::Cluster::UniGeneI
ok 12 - The object isa Bio::Cluster::UniGeneI
ok
t/ClusterIO/SequenceFamily.t ................. 
1..19
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Cluster::SequenceFamily;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
Subroutine new redefined at Bio\Cluster\UniGene.pm line 258.
Subroutine unigene_id redefined at Bio\Cluster\UniGene.pm line 320.
Subroutine title redefined at Bio\Cluster\UniGene.pm line 342.
Subroutine gene redefined at Bio\Cluster\UniGene.pm line 363.
Subroutine cytoband redefined at Bio\Cluster\UniGene.pm line 381.
Subroutine mgi redefined at Bio\Cluster\UniGene.pm line 398.
Subroutine locuslink redefined at Bio\Cluster\UniGene.pm line 426.
Subroutine homol redefined at Bio\Cluster\UniGene.pm line 455.
Subroutine restr_expr redefined at Bio\Cluster\UniGene.pm line 472.
Subroutine gnm_terminus redefined at Bio\Cluster\UniGene.pm line 490.
Subroutine scount redefined at Bio\Cluster\UniGene.pm line 506.
Subroutine express redefined at Bio\Cluster\UniGene.pm line 528.
Subroutine chromosome redefined at Bio\Cluster\UniGene.pm line 546.
Subroutine sts redefined at Bio\Cluster\UniGene.pm line 564.
Subroutine txmap redefined at Bio\Cluster\UniGene.pm line 582.
Subroutine protsim redefined at Bio\Cluster\UniGene.pm line 600.
Subroutine sequences redefined at Bio\Cluster\UniGene.pm line 623.
Subroutine species redefined at Bio\Cluster\UniGene.pm line 643.
Subroutine display_id redefined at Bio\Cluster\UniGene.pm line 675.
Subroutine description redefined at Bio\Cluster\UniGene.pm line 692.
Subroutine size redefined at Bio\Cluster\UniGene.pm line 710.
Subroutine cluster_score redefined at Bio\Cluster\UniGene.pm line 742.
Subroutine get_members redefined at Bio\Cluster\UniGene.pm line 765.
Subroutine annotation redefined at Bio\Cluster\UniGene.pm line 814.
Subroutine add_member redefined at Bio\Cluster\UniGene.pm line 846.
Subroutine remove_members redefined at Bio\Cluster\UniGene.pm line 876.
Subroutine next_locuslink redefined at Bio\Cluster\UniGene.pm line 905.
Subroutine next_express redefined at Bio\Cluster\UniGene.pm line 931.
Subroutine next_chromosome redefined at Bio\Cluster\UniGene.pm line 958.
Subroutine next_protsim redefined at Bio\Cluster\UniGene.pm line 985.
Subroutine next_sts redefined at Bio\Cluster\UniGene.pm line 1012.
Subroutine next_txmap redefined at Bio\Cluster\UniGene.pm line 1039.
Subroutine _next_element redefined at Bio\Cluster\UniGene.pm line 1052.
Subroutine object_id redefined at Bio\Cluster\UniGene.pm line 1089.
Subroutine version redefined at Bio\Cluster\UniGene.pm line 1111.
Subroutine authority redefined at Bio\Cluster\UniGene.pm line 1133.
Subroutine namespace redefined at Bio\Cluster\UniGene.pm line 1155.
Subroutine display_name redefined at Bio\Cluster\UniGene.pm line 1183.
Subroutine next_seq redefined at Bio\Cluster\UniGene.pm line 1234.
Subroutine sequence_factory redefined at Bio\Cluster\UniGene.pm line 1292.
Subroutine _annotation_value redefined at Bio\Cluster\UniGene.pm line 1320.
Subroutine _annotation_value_ary redefined at Bio\Cluster\UniGene.pm line 1361.
Subroutine _annotation_dblink redefined at Bio\Cluster\UniGene.pm line 1397.
Subroutine _remove_dblink redefined at Bio\Cluster\UniGene.pm line 1432.
Subroutine Bio::Cluster::UniGene::sequence redefined at Bio\Cluster\UniGene.pm line 1456.
t/ClusterIO/unigene.t ........................ 
1..73
ok 1 - use Bio::ClusterIO;
ok 2 - new Bio::ClusterIO object defined
ok 3
ok 4 - The object isa Bio::Cluster::UniGeneI
ok 5 - The object isa Bio::ClusterI
ok 6 - The object isa Bio::IdentifiableI
ok 7 - The object isa Bio::DescribableI
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48 - The object isa Bio::PrimarySeqI
ok 49
ok 50
ok 51 - annotation object defined
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66 - The object isa Bio::PrimarySeqI
ok 67
ok 68 - next cluster
ok 69
ok 70
ok 71
ok 72
ok 73
ok
t/Coordinate/CoordinateBoundaryTest.t ........ 
1..174
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3
ok 4 - The object isa Bio::Location::Simple
ok 5
ok 6 - The object isa Bio::Location::Simple
ok 7
ok 8 - The object isa Bio::Location::Simple
ok 9
ok 10 - The object isa Bio::Coordinate::Pair
ok 11
ok 12 - The object isa Bio::Coordinate::Pair
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - The object isa Bio::LocationI
ok 33
ok 34 - The object isa Bio::Coordinate::Result
ok 35
ok 36 - The object isa Bio::Coordinate::Result
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - The object isa Bio::LocationI
ok 51
ok 52 - The object isa Bio::Coordinate::Result
ok 53
ok 54 - The object isa Bio::Coordinate::Result
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68 - The object isa Bio::LocationI
ok 69
ok 70 - The object isa Bio::Coordinate::Result
ok 71
ok 72 - The object isa Bio::Coordinate::Result
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88 - The object isa Bio::LocationI
ok 89
ok 90 - The object isa Bio::Coordinate::Result
ok 91
ok 92 - The object isa Bio::Coordinate::Result
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108 - The object isa Bio::Location::Simple
ok 109
ok 110 - The object isa Bio::Location::Simple
ok 111
ok 112 - The object isa Bio::Location::Simple
ok 113
ok 114 - The object isa Bio::Coordinate::Pair
ok 115
ok 116 - The object isa Bio::Coordinate::Pair
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132 - The object isa Bio::Coordinate::Result
ok 133
ok 134 - The object isa Bio::Coordinate::Result
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142 - The object isa Bio::Coordinate::Result
ok 143
ok 144 - The object isa Bio::Coordinate::Result
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152 - The object isa Bio::Coordinate::Result
ok 153
ok 154 - The object isa Bio::Coordinate::Result
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164 - The object isa Bio::Coordinate::Result
ok 165
ok 166 - The object isa Bio::Coordinate::Result
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok
t/Coordinate/CoordinateGraph.t ............... 
1..7
ok 1 - use Bio::Coordinate::Graph;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok
t/Coordinate/CoordinateMapper.t .............. 
1..175
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3 - use Bio::Coordinate::Result::Match;
ok 4 - use Bio::Coordinate::Result::Gap;
ok 5 - use Bio::Coordinate::Chain;
ok 6 - use Bio::Coordinate::Collection;
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Coordinate::Result
ok 15 - The object isa Bio::Location::SplitLocationI
ok 16
ok 17
ok 18
ok 19 - The object isa Bio::LocationI
ok 20 - The object isa Bio::Coordinate::Result::Match
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - The object isa Bio::Coordinate::Result::Gap
ok 38 - The object isa Bio::LocationI
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106 - The object isa Bio::Coordinate::Result::Match
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138 - Match: |314696| Test: 314696|
ok 139
ok 140
ok 141
ok 142 - Match: |341| Test: 341|
ok 143
ok 144
ok 145
ok 146 - Match: |315843| Test: 315843|
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152 - Match: |627011| Test: 627011|
ok 153
ok 154
ok 155
ok 156 - Match: |chr1| Test: chr1|
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok
t/Coordinate/GeneCoordinateMapper.t .......... 
1..116
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3 - use Bio::Coordinate::ExtrapolatingPair;
ok 4 - use Bio::Coordinate::GeneMapper;
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Location::Simple
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75 - The object isa Bio::Location::Simple
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok
t/Draw/Pictogram.t ........................... 
1..6
ok 1 - use Bio::Draw::Pictogram;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::Matrix::PSM::IO;
ok 4 - The object isa Bio::Draw::Pictogram
ok 5
ok 6
ok
t/LiveSeq/Chain.t ............................ 
1..45
ok 1 - use Bio::LiveSeq::Chain;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok
t/LiveSeq/LiveSeq.t .......................... 
1..48
ok 1 - use Bio::LiveSeq::IO::BioPerl;
ok 2
ok 3
ok 4 - Bio::LiveSeq::Gene
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok
t/LiveSeq/Mutation.t ......................... 
1..19
ok 1 - use Bio::LiveSeq::Mutation;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/LiveSeq/Mutator.t .......................... 
1..24
ok 1 - use Bio::LiveSeq::Mutator;
ok 2 - use Bio::LiveSeq::IO::BioPerl;
ok 3 - use Bio::Variation::IO;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/LocalDB/BioDBGFF.t ......................... skipped: Not compatible with your Operating System
t/LocalDB/DBFasta.t .......................... 
1..17
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8 - bug 3126
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - threw Regexp ((?-xism:FASTA header doesn't match))
ok
t/LocalDB/DBQual.t ........................... 
1..38
ok 1 - use Bio::Root::IO;
ok 2 - use File::Copy;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13 - The object isa Bio::Seq::PrimaryQual
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - The object isa Bio::Seq::PrimaryQual
ok 26
ok 27
ok 28 - The object isa Bio::Seq::PrimaryQual
ok 29
ok 30
ok 31
ok 32 - The object isa Bio::Seq::PrimaryQual
ok 33
ok 34 - The object isa Bio::Seq::PrimaryQual
ok 35
ok 36
ok 37
ok 38
ok
t/LocalDB/Flat.t ............................. skipped: The optional module DB_File (or dependencies thereof) was not installed
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
t/LocalDB/Index/Blast.t ...................... 
1..26
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::Blast;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok

--------------------- WARNING ---------------------
MSG: overwriting a current value stored for SP130_MOUSE

---------------------------------------------------

--------------------- WARNING ---------------------
MSG: overwriting a current value stored for SDS3_MOUSE

---------------------------------------------------

--------------------- WARNING ---------------------
MSG: overwriting a current value stored for IKZF1_MOUSE

---------------------------------------------------
t/LocalDB/Index/BlastTable.t ................. 
1..27
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::BlastTable;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/LocalDB/Index/Index.t ...................... skipped: The optional module DB_File (or dependencies thereof) was not installed
t/LocalDB/Registry.t ......................... 
1..14
ok 1 - use Bio::DB::Registry;
ok 2 - use Bio::DB::Flat;
ok 3
ok 4 # skip The optional module DB_File (or dependencies thereof) was not installed
ok 5 # skip The optional module DB_File (or dependencies thereof) was not installed
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok

#   Failed test 'use Bio::DB::SeqFeature::Store::GFF3Loader;'
#   in t/LocalDB/SeqFeature.t at line 16.
#     Tried to use 'Bio::DB::SeqFeature::Store::GFF3Loader'.
#     Error:  Can't locate DB_File.pm in @INC (@INC contains: . .. ./t/lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio/DB/SeqFeature/Store/LoadHelper.pm line 38.
# BEGIN failed--compilation aborted at t/LocalDB/SeqFeature.t line 16.
# Compilation failed in require at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72.
# Compilation failed in require at (eval 58) line 2.
# BEGIN failed--compilation aborted at (eval 58) line 2.
# Looks like you planned 116 tests but ran 1 extra.
# Looks like you failed 1 test of 117 run.
t/LocalDB/SeqFeature.t ....................... 
1..116
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::DB::SeqFeature::Store;
not ok 3 - use Bio::DB::SeqFeature::Store::GFF3Loader;
ok 4 - use Bio::Root::IO;
ok 5 - use Bio::DB::Fasta;
ok 6 - use File::Copy;
ok 7 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 8 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 9 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 10 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 11 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 12 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 13 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 14 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 15 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 16 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 17 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 18 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 19 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 20 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 21 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 22 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 23 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 24 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 25 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 26 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 27 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 28 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 29 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 30 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 31 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 32 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 33 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 34 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 35 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 36 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 37 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 38 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 39 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 40 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 41 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 42 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 43 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 44 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 45 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 46 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 47 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 48 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 49 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 50 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 51 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 52 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 53 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 54 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 55 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 56 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 57 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 58 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 59 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 60 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 61 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 62 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 63 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 64 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 65 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 66 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 67 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 68 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 69 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 70 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 71 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 72 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 73 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 74 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 75 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 76 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 77 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 78 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 79 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 80 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 81 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 82 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 83 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 84 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 85 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 86 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 87 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 88 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 89 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 90 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 91 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 92 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 93 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 94 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 95 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 96 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 97 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 98 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 99 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 100 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 101 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 102 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 103 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 104 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 105 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 106 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 107 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 108 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 109 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 110 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 111 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 112 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 113 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 114 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 115 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 116 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
ok 117 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 74) line 2.
#  at t/LocalDB/SeqFeature.t line 32
# 
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/116 subtests 
	(less 111 skipped subtests: 4 okay)

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio\DB\Taxonomy\flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/LocalDB/transfac_pro.t:18
-----------------------------------------------------------
Bio::DB::Taxonomy: flatfile cannot be found
Exception 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio\DB\Taxonomy\flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/LocalDB/transfac_pro.t:18
-----------------------------------------------------------

For more information about the Bio::DB::Taxonomy system please see
the Bio::DB::Taxonomy docs.  This includes ways of checking for 
formats at compile time, not run time.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio\DB\TFBS\transfac_pro.pm line 118.
BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151
STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130
STACK: t/LocalDB/transfac_pro.t:25
-----------------------------------------------------------
Bio::DB::TFBS: transfac_pro cannot be found
Exception 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio\DB\TFBS\transfac_pro.pm line 118.
BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151
STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130
STACK: t/LocalDB/transfac_pro.t:25
-----------------------------------------------------------

For more information about the Bio::DB::TFBS system please see
the Bio::DB::TFBS docs.  This includes ways of checking for 
formats at compile time, not run time.

#   Failed test at t/LocalDB/transfac_pro.t line 25.
Can't call method "get_reference_ids" on an undefined value at t/LocalDB/transfac_pro.t line 33.
# Looks like you planned 115 tests but ran 4.
# Looks like you failed 1 test of 4 run.
# Looks like your test exited with 2 just after 4.
t/LocalDB/transfac_pro.t ..................... 
1..115
ok 1 - use Bio::Matrix::PSM::IO;
ok 2 - use Bio::DB::TFBS;
ok 3 - use Bio::DB::Taxonomy;
not ok 4
Dubious, test returned 2 (wstat 512, 0x200)
Failed 112/115 subtests 
t/Map/Cyto.t ................................. 
1..110
ok 1 - use Bio::Map::CytoMap;
ok 2 - use Bio::Map::CytoPosition;
ok 3 - use Bio::Map::CytoMarker;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Map::CytoPosition
ok 15
ok 16
ok 17
ok 18 - The object isa Bio::Range
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok
t/Map/Linkage.t .............................. 
1..18
ok 1 - use Bio::Map::LinkagePosition;
ok 2 - use Bio::Map::Microsatellite;
ok 3 - use Bio::Map::LinkageMap;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/Map/Map.t .................................. 
1..267
ok 1 - use Bio::Map::SimpleMap;
ok 2 - use Bio::Map::Marker;
ok 3 - use Bio::Map::Position;
ok 4 - use Bio::Map::Relative;
ok 5 - use Bio::Map::Mappable;
ok 6
ok 7
ok 8
ok 9
ok 10 - Length is 0
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151 - use Bio::Map::Gene;
ok 152 - use Bio::Map::GeneMap;
ok 153 - use Bio::Map::TranscriptionFactor;
ok 154 - use Bio::Map::GeneRelative;
ok 155 - use Bio::Map::GenePosition;
ok 156 - use Bio::Map::Prediction;
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok
t/Map/MapIO.t ................................ 
1..51
ok 1 - use Bio::MapIO;
ok 2
ok 3 - The object isa Bio::Map::MapI
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok
t/Map/MicrosatelliteMarker.t ................. 
1..8
ok 1 - use Bio::Map::SimpleMap;
ok 2 - use Bio::Map::Position;
ok 3 - use Bio::Map::Microsatellite;
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Map/Physical.t ............................. 
1..39
ok 1 - use Bio::Map::Physical;
ok 2 - use Bio::MapIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - code holds and returns a string, definition requires a boolean
ok 13 - code holds and returns a string, definition requires a boolean
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok
t/Matrix/IO/masta.t .......................... 
1..16
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/Matrix/IO/psm.t ............................ 
1..63
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok
t/Matrix/InstanceSite.t ...................... 
1..6
ok 1 - use Bio::Matrix::PSM::InstanceSite;
ok 2
ok 3
ok 4
ok 5
ok 6
ok
t/Matrix/Matrix.t ............................ 
1..77
ok 1 - use Bio::Matrix::Generic;
ok 2 - use Bio::Matrix::IO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30 - The object isa Bio::Matrix::Scoring
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - The object isa Bio::Matrix::Scoring
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok
t/Matrix/ProtMatrix.t ........................ 
1..14
ok 1 - use Bio::Matrix::PSM::ProtMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Matrix/ProtPsm.t ........................... 
1..14
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5 # skip TODO: Module incomplete
ok 6 # skip TODO: Module incomplete
ok 7 # skip TODO: Module incomplete
ok 8 # skip TODO: Module incomplete
ok 9 # skip TODO: Module incomplete
ok 10 # skip TODO: Module incomplete
ok 11 # skip TODO: Module incomplete
ok 12 # skip TODO: Module incomplete
ok 13 # skip TODO: Module incomplete
ok 14 # skip TODO: Module incomplete
ok
t/Matrix/SiteMatrix.t ........................ 
1..14
ok 1 - use Bio::Matrix::PSM::SiteMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Ontology/GOterm.t .......................... 
1..62
ok 1 - use Bio::Ontology::GOterm;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - The object isa Bio::Ontology::GOterm
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok
t/Ontology/GraphAdaptor.t .................... 
1..28
ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok
t/Ontology/IO/go.t ........................... 
1..102
ok 1 - use Bio::OntologyIO;
ok 2
ok 3 - The object isa Bio::Ontology::OntologyI
ok 4
ok 5 - The object isa Bio::Ontology::OntologyEngineI
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/Ontology/IO/interpro.t ..................... 
1..69
ok 1 - use Bio::OntologyIO;
ok 2 - The object isa Bio::OntologyIO::InterProParser
ok 3
ok 4 - get_dbxrefs on leaf terms is non-empty
ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty
ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty
ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty
ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty
ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty
ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty
ok 11 - get_members on leaf terms is non-empty
ok 12 - class_list on leaf terms is non-empty
ok 13 - get_examples on leaf terms is non-empty
ok 14 - get_external_documents on leaf terms is non-empty
ok 15 - get_references on leaf terms is non-empty
ok 16 - protein_count on leaf terms is non-empty
ok 17 - to_string looks reasonable
ok 18 - There are 8 root InterPro terms
ok 19 - The object isa Bio::Ontology::Ontology
ok 20 - term Integrins alpha chain in ontology InterPro
ok 21 - The object isa Bio::Ontology::Ontology
ok 22 - term post-translational modification in ontology InterPro
ok 23 - The object isa Bio::Ontology::Ontology
ok 24 - term Repeat in ontology InterPro
ok 25 - The object isa Bio::Ontology::Ontology
ok 26 - term Binding Site in ontology InterPro
ok 27 - The object isa Bio::Ontology::Ontology
ok 28 - term Cdc20/Fizzy in ontology InterPro
ok 29 - The object isa Bio::Ontology::Ontology
ok 30 - term Conserved Site in ontology InterPro
ok 31 - The object isa Bio::Ontology::Ontology
ok 32 - term Region in ontology InterPro
ok 33 - The object isa Bio::Ontology::Ontology
ok 34 - term Kringle in ontology InterPro
ok 35 - The object isa Bio::Ontology::Ontology
ok 36 - term Helix-turn-helix, AraC type  in ontology InterPro
ok 37 - The object isa Bio::Ontology::Ontology
ok 38 - term Active Site in ontology InterPro
ok 39 - The object isa Bio::Ontology::Ontology
ok 40 - term Active Site in ontology InterPro
ok 41 - The object isa Bio::Ontology::Ontology
ok 42 - term Binding Site in ontology InterPro
ok 43 - The object isa Bio::Ontology::Ontology
ok 44 - term Conserved Site in ontology InterPro
ok 45 - The object isa Bio::Ontology::Ontology
ok 46 - term Domain in ontology InterPro
ok 47 - The object isa Bio::Ontology::Ontology
ok 48 - term Family in ontology InterPro
ok 49 - The object isa Bio::Ontology::Ontology
ok 50 - term Region in ontology InterPro
ok 51 - The object isa Bio::Ontology::Ontology
ok 52 - term Repeat in ontology InterPro
ok 53 - The object isa Bio::Ontology::Ontology
ok 54 - term post-translational modification in ontology InterPro
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 - Integrins alpha chain term has one parent
ok 62 - Integrins alpha chain term has one ancestor
ok 63 - Cdc20/Fizzy term has one parent
ok 64 - Cdc20/Fizzy term has one ancestor
ok 65 - Kringle term has one parent
ok 66 - Kringle term has one ancestor
ok 67 - Helix-turn-helix, AraC type  term has one parent
ok 68 - Helix-turn-helix, AraC type  term has one ancestor
ok 69 - secondary accession map has 2 keys
ok
t/Ontology/IO/obo.t .......................... 
1..92
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - got a ontology IO handler isa Bio::OntologyIO
ok 47 - got ontology parser2 isa Bio::Ontology::Ontology
ok 48 - got OBO engine object isa Bio::Ontology::OBOEngine
ok 49 - got ontology parser2 isa Bio::Ontology::Ontology
ok 50 - got OBO engine object isa Bio::Ontology::OBOEngine
ok 51 - got ontology parser2 isa Bio::Ontology::Ontology
ok 52 - got OBO engine object isa Bio::Ontology::OBOEngine
ok 53 - Gene ontology
ok 54 - biological process
ok 55 - molecular function
ok 56 - Got root
ok 57 - Got root
ok 58 - Got regulates
# 	 from gene_ontology
ok 59 - Got
# 	 positively regulates from gene_ontology
ok 60 - Got
# 	  regulates from biological_process
ok 61 - Got
# 	 positively regulates from biological_process
ok 62 - Got predicates for gene_ontology
ok 63 - Got predicates for biological_process
ok 64 - Got regulates predicate
ok 65 - Got positively regulates predicate
ok 66 - Got relationships for biological_process
ok 67 - Got relationships for molecular_function
ok 68 - Got is a relationship from
# 	 molecular_function
ok 69 - Got term object isa Bio::Ontology::Term
ok 70 - Got term id
ok 71 - Got term name
ok 72 - Got regulated object isa Bio::Ontology::Term
ok 73 - Got regulated term1 id
ok 74 - Got term1 object isa Bio::Ontology::Term
ok 75 - Got back the child
ok 76 - Got term object isa Bio::Ontology::Term
ok 77 - Got term id
ok 78 - Got term name
ok 79 - Got regulated object isa Bio::Ontology::Term
ok 80 - Got regulated term1 id
ok 81 - Got identical regulation
ok 82 - Got term1 object isa Bio::Ontology::Term
ok 83 - Got back the child
ok 84 - got a ontology IO handler isa Bio::OntologyIO
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok
t/Ontology/Ontology.t ........................ 
1..55
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3 - The object isa Bio::Ontology::Ontology
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53 - Interpro XML file interpro.xml can be parsed
ok 54 - Interpro XML file interpro_sample.xml can be parsed
ok 55 - Interpro XML file interpro_relationship.xml can be parsed
ok
Subroutine new redefined at Bio\Ontology\Relationship.pm line 139.
Subroutine init redefined at Bio\Ontology\Relationship.pm line 190.
Subroutine identifier redefined at Bio\Ontology\Relationship.pm line 215.
Subroutine subject_term redefined at Bio\Ontology\Relationship.pm line 245.
Subroutine object_term redefined at Bio\Ontology\Relationship.pm line 276.
Subroutine predicate_term redefined at Bio\Ontology\Relationship.pm line 307.
Subroutine ontology redefined at Bio\Ontology\Relationship.pm line 333.
Subroutine to_string redefined at Bio\Ontology\Relationship.pm line 361.
Subroutine _check_class redefined at Bio\Ontology\Relationship.pm line 383.
Subroutine Bio::Ontology::Relationship::child_term redefined at Bio\Ontology\Relationship.pm line 409.
Subroutine Bio::Ontology::Relationship::parent_term redefined at Bio\Ontology\Relationship.pm line 410.
Subroutine Bio::Ontology::Relationship::relationship_type redefined at Bio\Ontology\Relationship.pm line 411.
t/Ontology/OntologyEngine.t .................. 
1..31
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::Relationship;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - use Bio::Ontology::SimpleOntologyEngine;
ok 5 - use Bio::Ontology::Ontology;
ok 6 - The object isa Bio::Ontology::OntologyEngineI
ok 7
ok 8 - adding a relationship with an undef object term fails
ok 9 - adding a relationship with an undef object term fails
ok 10 - adding a relationship with an undef subject term fails
ok 11 - adding a relationship with an undef subject term fails
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/Ontology/OntologyStore.t ................... skipped: Network tests have not been requested
t/Ontology/Relationship.t .................... 
1..12
ok 1 - use Bio::Ontology::Relationship;
ok 2 - use Bio::Ontology::GOterm;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - The object isa Bio::Ontology::RelationshipType
ok 5 - The object isa Bio::Ontology::GOterm
ok 6 - The object isa Bio::Ontology::GOterm
ok 7 - The object isa Bio::Ontology::Relationship
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/Ontology/RelationshipType.t ................ 
1..23
ok 1 - use Bio::Ontology::RelationshipType;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - The object isa Bio::Ontology::RelationshipType
ok 4 - The object isa Bio::Ontology::TermI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
Constant subroutine Bio::Ontology::Term::TRUE redefined at C:\cpanfly-5.12\var\megalib/constant.pm line 131.
Constant subroutine Bio::Ontology::Term::FALSE redefined at C:\cpanfly-5.12\var\megalib/constant.pm line 131.
Subroutine new redefined at Bio\Ontology\Term.pm line 145.
Subroutine init redefined at Bio\Ontology\Term.pm line 176.
Subroutine identifier redefined at Bio\Ontology\Term.pm line 207.
Subroutine name redefined at Bio\Ontology\Term.pm line 227.
Subroutine definition redefined at Bio\Ontology\Term.pm line 247.
Subroutine ontology redefined at Bio\Ontology\Term.pm line 275.
Subroutine version redefined at Bio\Ontology\Term.pm line 305.
Subroutine is_obsolete redefined at Bio\Ontology\Term.pm line 324.
Subroutine comment redefined at Bio\Ontology\Term.pm line 344.
Subroutine get_synonyms redefined at Bio\Ontology\Term.pm line 361.
Subroutine add_synonym redefined at Bio\Ontology\Term.pm line 381.
Subroutine remove_synonyms redefined at Bio\Ontology\Term.pm line 405.
Subroutine get_dblinks redefined at Bio\Ontology\Term.pm line 428.
Subroutine get_dbxrefs redefined at Bio\Ontology\Term.pm line 454.
Subroutine get_dblink_context redefined at Bio\Ontology\Term.pm line 479.
Subroutine get_dbxref_context redefined at Bio\Ontology\Term.pm line 495.
Subroutine add_dblink redefined at Bio\Ontology\Term.pm line 515.
Subroutine add_dbxref redefined at Bio\Ontology\Term.pm line 542.
Subroutine has_dblink redefined at Bio\Ontology\Term.pm line 581.
Subroutine has_dbxref redefined at Bio\Ontology\Term.pm line 599.
Subroutine add_dblink_context redefined at Bio\Ontology\Term.pm line 630.
Subroutine remove_dblinks redefined at Bio\Ontology\Term.pm line 651.
Subroutine remove_dbxrefs redefined at Bio\Ontology\Term.pm line 668.
Subroutine get_references redefined at Bio\Ontology\Term.pm line 690.
Subroutine add_reference redefined at Bio\Ontology\Term.pm line 706.
Subroutine remove_references redefined at Bio\Ontology\Term.pm line 729.
Subroutine get_secondary_ids redefined at Bio\Ontology\Term.pm line 750.
Subroutine add_secondary_id redefined at Bio\Ontology\Term.pm line 770.
Subroutine remove_secondary_ids redefined at Bio\Ontology\Term.pm line 794.
Subroutine _is_true_or_false redefined at Bio\Ontology\Term.pm line 808.
Subroutine object_id redefined at Bio\Ontology\Term.pm line 833.
Subroutine authority redefined at Bio\Ontology\Term.pm line 854.
Subroutine namespace redefined at Bio\Ontology\Term.pm line 883.
Subroutine display_name redefined at Bio\Ontology\Term.pm line 907.
Subroutine description redefined at Bio\Ontology\Term.pm line 931.
Subroutine each_dblink redefined at Bio\Ontology\Term.pm line 945.
Subroutine add_dblinks redefined at Bio\Ontology\Term.pm line 946.
Subroutine Bio::Ontology::Term::add_dbxrefs redefined at Bio\Ontology\Term.pm line 566.
Subroutine Bio::Ontology::Term::each_synonym redefined at Bio\Ontology\Term.pm line 947.
Subroutine Bio::Ontology::Term::add_synonyms redefined at Bio\Ontology\Term.pm line 948.
t/Ontology/Term.t ............................ 
1..54
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::TermFactory;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - The object isa Bio::Ontology::TermI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - The object isa Bio::Ontology::TermI
ok 45
ok 46 - The object isa Bio::Ontology::TermI
ok 47 - The object isa Bio::Ontology::GOterm
ok 48
ok 49
ok 50 - The object isa Bio::Ontology::TermI
ok 51 - The object isa Bio::AnnotationI
ok 52
ok 53
ok 54
ok
t/Perl.t ..................................... 
1..31
ok 1 - use Bio::Perl;
ok 2
ok 3 - The object isa Bio::SeqI
ok 4
ok 5 - The object isa Bio::SeqI
ok 6
ok 7 - The object isa Bio::SeqI
ok 8 - The object isa Bio::SeqI
ok 9
ok 10
ok 11 - The object isa Bio::SeqI
ok 12
ok 13 - The object isa Bio::SeqI
ok 14
ok 15 - The object isa Bio::PrimarySeqI
ok 16
ok 17
ok 18
ok 19
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok
t/Phenotype/Correlate.t ...................... 
1..17
ok 1 - use Bio::Phenotype::Correlate;
ok 2 - use Bio::Species;
ok 3 - The object isa Bio::Phenotype::Correlate
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok
t/Phenotype/MeSH.t ........................... 
1..24
ok 1 - use Bio::Phenotype::MeSH::Term;
ok 2 - use Bio::Phenotype::MeSH::Twig;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/Phenotype/Measure.t ........................ 
1..21
ok 1 - use Bio::Phenotype::Measure;
ok 2 - The object isa Bio::Phenotype::Measure
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok
t/Phenotype/MiniMIMentry.t ................... 
1..15
ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry;
ok 2 - The object isa Bio::Phenotype::OMIM::MiniMIMentry
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/Phenotype/OMIMentry.t ...................... 
1..153
ok 1 - use Bio::Phenotype::OMIM::OMIMentry;
ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry;
ok 3 - use Bio::Species;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Map::CytoPosition;
ok 6 - use Bio::Phenotype::Correlate;
ok 7 - use Bio::Phenotype::Measure;
ok 8 - use Bio::Annotation::DBLink;
ok 9 - The object isa Bio::Phenotype::OMIM::OMIMentry
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79 - operator overloading in AnnotationI is deprecated
ok 80 - operator overloading in AnnotationI is deprecated
ok 81
ok 82
ok 83 - operator overloading in AnnotationI is deprecated
ok 84 - operator overloading in AnnotationI is deprecated
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136 - operator overloading in AnnotationI is deprecated
ok 137 - operator overloading in AnnotationI is deprecated
ok 138
ok 139
ok 140 - operator overloading in AnnotationI is deprecated
ok 141 - operator overloading in AnnotationI is deprecated
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok
t/Phenotype/OMIMentryAllelicVariant.t ........ 
1..27
ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant;
ok 2 - The object isa Bio::Phenotype::OMIM::OMIMentryAllelicVariant
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/Phenotype/OMIMparser.t ..................... 
1..175
ok 1 - use Bio::Phenotype::OMIM::OMIMparser;
ok 2 - The object isa Bio::Phenotype::OMIM::OMIMparser
ok 3 - The object isa Bio::Phenotype::OMIM::OMIMentry
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - The object isa Bio::Phenotype::OMIM::MiniMIMentry
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - The object isa Bio::Phenotype::OMIM::OMIMentry
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105 - The object isa Bio::Phenotype::OMIM::MiniMIMentry
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - missing linebreak caught
ok
t/Phenotype/Phenotype.t ...................... 
1..116
ok 1 - use Bio::Phenotype::Phenotype;
ok 2 - use Bio::Species;
ok 3 - use Bio::Annotation::Reference;
ok 4 - use Bio::Map::CytoPosition;
ok 5 - use Bio::Phenotype::Correlate;
ok 6 - use Bio::Phenotype::Measure;
ok 7 - use Bio::Annotation::DBLink;
ok 8 - The object isa Bio::Phenotype::PhenotypeI
ok 9 - The object isa Bio::Phenotype::Phenotype
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - operator overloading in AnnotationI is deprecated
ok 43 - operator overloading in AnnotationI is deprecated
ok 44
ok 45
ok 46 - operator overloading in AnnotationI is deprecated
ok 47 - operator overloading in AnnotationI is deprecated
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - operator overloading in AnnotationI is deprecated
ok 100 - operator overloading in AnnotationI is deprecated
ok 101
ok 102
ok 103 - operator overloading in AnnotationI is deprecated
ok 104 - operator overloading in AnnotationI is deprecated
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok
t/PodSyntax.t ................................ 
1..1011
ok 1 - POD test for Bio\AlignIO.pm
ok 2 - POD test for Bio\AnalysisI.pm
ok 3 - POD test for Bio\AnalysisParserI.pm
ok 4 - POD test for Bio\AnalysisResultI.pm
ok 5 - POD test for Bio\AnnotatableI.pm
ok 6 - POD test for Bio\AnnotationCollectionI.pm
ok 7 - POD test for Bio\AnnotationI.pm
ok 8 - POD test for Bio\Biblio.pm
ok 9 - POD test for Bio\ClusterI.pm
ok 10 - POD test for Bio\ClusterIO.pm
ok 11 - POD test for Bio\DasI.pm
ok 12 - POD test for Bio\DBLinkContainerI.pm
ok 13 - POD test for Bio\DescribableI.pm
ok 14 - POD test for Bio\FeatureHolderI.pm
ok 15 - POD test for Bio\FeatureIO.pm
ok 16 - POD test for Bio\HandlerBaseI.pm
ok 17 - POD test for Bio\IdCollectionI.pm
ok 18 - POD test for Bio\IdentifiableI.pm
ok 19 - POD test for Bio\LocatableSeq.pm
ok 20 - POD test for Bio\LocationI.pm
ok 21 - POD test for Bio\MapIO.pm
ok 22 - POD test for Bio\NexmlIO.pm
ok 23 - POD test for Bio\OntologyIO.pm
ok 24 - POD test for Bio\ParameterBaseI.pm
ok 25 - POD test for Bio\Perl.pm
ok 26 - POD test for Bio\PhyloNetwork.pm
ok 27 - POD test for Bio\PrimarySeq.pm
ok 28 - POD test for Bio\PrimarySeqI.pm
ok 29 - POD test for Bio\PullParserI.pm
ok 30 - POD test for Bio\Range.pm
ok 31 - POD test for Bio\RangeI.pm
ok 32 - POD test for Bio\SearchDist.pm
ok 33 - POD test for Bio\SearchIO.pm
ok 34 - POD test for Bio\Seq.pm
ok 35 - POD test for Bio\SeqAnalysisParserI.pm
ok 36 - POD test for Bio\SeqFeatureI.pm
ok 37 - POD test for Bio\SeqI.pm
ok 38 - POD test for Bio\SeqIO.pm
ok 39 - POD test for Bio\SeqUtils.pm
ok 40 - POD test for Bio\SimpleAlign.pm
ok 41 - POD test for Bio\SimpleAnalysisI.pm
ok 42 - POD test for Bio\Species.pm
ok 43 - POD test for Bio\Taxon.pm
ok 44 - POD test for Bio\Taxonomy.pm
ok 45 - POD test for Bio\TreeIO.pm
ok 46 - POD test for Bio\UpdateableSeqI.pm
ok 47 - POD test for Bio\WebAgent.pm
ok 48 - POD test for examples\bioperl.pl (no pod)
ok 49 - POD test for examples\generate_random_seq.pl (no pod)
ok 50 - POD test for examples\longorf.pl
ok 51 - POD test for examples\make_primers.pl (no pod)
ok 52 - POD test for examples\revcom_dir.pl (no pod)
ok 53 - POD test for examples\rev_and_trans.pl (no pod)
ok 54 - POD test for examples\subsequence.cgi (no pod)
ok 55 - POD test for maintenance\authors.pl
ok 56 - POD test for maintenance\check_NAME.pl
ok 57 - POD test for maintenance\check_URLs.pl
ok 58 - POD test for maintenance\cvs2cl_by_file.pl
ok 59 - POD test for maintenance\dependencies.pl
ok 60 - POD test for maintenance\deprecated.pl
ok 61 - POD test for maintenance\find_mod_deps.pl
ok 62 - POD test for maintenance\modules.pl
ok 63 - POD test for maintenance\module_usage.pl (no pod)
ok 64 - POD test for maintenance\ncbi_blast_switches.pl (no pod)
ok 65 - POD test for maintenance\pod.pl
ok 66 - POD test for maintenance\symlink_script.pl
ok 67 - POD test for maintenance\version.pl
ok 68 - POD test for Bio\Align\AlignI.pm
ok 69 - POD test for Bio\Align\DNAStatistics.pm
ok 70 - POD test for Bio\Align\Graphics.pm
ok 71 - POD test for Bio\Align\PairwiseStatistics.pm
ok 72 - POD test for Bio\Align\ProteinStatistics.pm
ok 73 - POD test for Bio\Align\StatisticsI.pm
ok 74 - POD test for Bio\Align\Utilities.pm
ok 75 - POD test for Bio\AlignIO\arp.pm
ok 76 - POD test for Bio\AlignIO\bl2seq.pm
ok 77 - POD test for Bio\AlignIO\clustalw.pm
ok 78 - POD test for Bio\AlignIO\emboss.pm
ok 79 - POD test for Bio\AlignIO\fasta.pm
ok 80 - POD test for Bio\AlignIO\largemultifasta.pm
ok 81 - POD test for Bio\AlignIO\maf.pm
ok 82 - POD test for Bio\AlignIO\mase.pm
ok 83 - POD test for Bio\AlignIO\mega.pm
ok 84 - POD test for Bio\AlignIO\meme.pm
ok 85 - POD test for Bio\AlignIO\metafasta.pm
ok 86 - POD test for Bio\AlignIO\msf.pm
ok 87 - POD test for Bio\AlignIO\nexml.pm
ok 88 - POD test for Bio\AlignIO\nexus.pm
ok 89 - POD test for Bio\AlignIO\pfam.pm
ok 90 - POD test for Bio\AlignIO\phylip.pm
ok 91 - POD test for Bio\AlignIO\po.pm
ok 92 - POD test for Bio\AlignIO\proda.pm
ok 93 - POD test for Bio\AlignIO\prodom.pm
ok 94 - POD test for Bio\AlignIO\psi.pm
ok 95 - POD test for Bio\AlignIO\selex.pm
ok 96 - POD test for Bio\AlignIO\stockholm.pm
ok 97 - POD test for Bio\AlignIO\xmfa.pm
ok 98 - POD test for Bio\Annotation\AnnotationFactory.pm
ok 99 - POD test for Bio\Annotation\Collection.pm
ok 100 - POD test for Bio\Annotation\Comment.pm
ok 101 - POD test for Bio\Annotation\DBLink.pm
ok 102 - POD test for Bio\Annotation\OntologyTerm.pm
ok 103 - POD test for Bio\Annotation\Reference.pm
ok 104 - POD test for Bio\Annotation\Relation.pm
ok 105 - POD test for Bio\Annotation\SimpleValue.pm
ok 106 - POD test for Bio\Annotation\StructuredValue.pm
ok 107 - POD test for Bio\Annotation\TagTree.pm
ok 108 - POD test for Bio\Annotation\Target.pm
ok 109 - POD test for Bio\Annotation\Tree.pm
ok 110 - POD test for Bio\Annotation\TypeManager.pm
ok 111 - POD test for Bio\Assembly\Contig.pm
ok 112 - POD test for Bio\Assembly\ContigAnalysis.pm
ok 113 - POD test for Bio\Assembly\IO.pm
ok 114 - POD test for Bio\Assembly\Scaffold.pm
ok 115 - POD test for Bio\Assembly\ScaffoldI.pm
ok 116 - POD test for Bio\Assembly\Singlet.pm
ok 117 - POD test for Bio\Biblio\Article.pm
ok 118 - POD test for Bio\Biblio\BiblioBase.pm
ok 119 - POD test for Bio\Biblio\Book.pm
ok 120 - POD test for Bio\Biblio\BookArticle.pm
ok 121 - POD test for Bio\Biblio\IO.pm
ok 122 - POD test for Bio\Biblio\Journal.pm
ok 123 - POD test for Bio\Biblio\JournalArticle.pm
ok 124 - POD test for Bio\Biblio\MedlineArticle.pm
ok 125 - POD test for Bio\Biblio\MedlineBook.pm
ok 126 - POD test for Bio\Biblio\MedlineBookArticle.pm
ok 127 - POD test for Bio\Biblio\MedlineJournal.pm
ok 128 - POD test for Bio\Biblio\MedlineJournalArticle.pm
ok 129 - POD test for Bio\Biblio\Organisation.pm
ok 130 - POD test for Bio\Biblio\Patent.pm
ok 131 - POD test for Bio\Biblio\Person.pm
ok 132 - POD test for Bio\Biblio\Proceeding.pm
ok 133 - POD test for Bio\Biblio\Provider.pm
ok 134 - POD test for Bio\Biblio\PubmedArticle.pm
ok 135 - POD test for Bio\Biblio\PubmedBookArticle.pm
ok 136 - POD test for Bio\Biblio\PubmedJournalArticle.pm
ok 137 - POD test for Bio\Biblio\Ref.pm
ok 138 - POD test for Bio\Biblio\Service.pm
ok 139 - POD test for Bio\Biblio\TechReport.pm
ok 140 - POD test for Bio\Biblio\Thesis.pm
ok 141 - POD test for Bio\Biblio\WebResource.pm
ok 142 - POD test for Bio\Cluster\ClusterFactory.pm
ok 143 - POD test for Bio\Cluster\FamilyI.pm
ok 144 - POD test for Bio\Cluster\SequenceFamily.pm
ok 145 - POD test for Bio\Cluster\UniGene.pm
ok 146 - POD test for Bio\Cluster\UniGeneI.pm
ok 147 - POD test for Bio\ClusterIO\dbsnp.pm
ok 148 - POD test for Bio\ClusterIO\unigene.pm
ok 149 - POD test for Bio\CodonUsage\IO.pm
ok 150 - POD test for Bio\CodonUsage\Table.pm
ok 151 - POD test for Bio\Coordinate\Chain.pm
ok 152 - POD test for Bio\Coordinate\Collection.pm
ok 153 - POD test for Bio\Coordinate\ExtrapolatingPair.pm
ok 154 - POD test for Bio\Coordinate\GeneMapper.pm
ok 155 - POD test for Bio\Coordinate\Graph.pm
ok 156 - POD test for Bio\Coordinate\MapperI.pm
ok 157 - POD test for Bio\Coordinate\Pair.pm
ok 158 - POD test for Bio\Coordinate\Result.pm
ok 159 - POD test for Bio\Coordinate\ResultI.pm
ok 160 - POD test for Bio\Coordinate\Utils.pm
ok 161 - POD test for Bio\Das\FeatureTypeI.pm
ok 162 - POD test for Bio\Das\SegmentI.pm
ok 163 - POD test for Bio\DB\Ace.pm
ok 164 - POD test for Bio\DB\BiblioI.pm
ok 165 - POD test for Bio\DB\BioFetch.pm
ok 166 - POD test for Bio\DB\CUTG.pm
ok 167 - POD test for Bio\DB\DBFetch.pm
ok 168 - POD test for Bio\DB\EMBL.pm
ok 169 - POD test for Bio\DB\EntrezGene.pm
ok 170 - POD test for Bio\DB\EUtilities.pm
ok 171 - POD test for Bio\DB\Expression.pm
ok 172 - POD test for Bio\DB\Failover.pm
ok 173 - POD test for Bio\DB\Fasta.pm
ok 174 - POD test for Bio\DB\FileCache.pm
ok 175 - POD test for Bio\DB\Flat.pm
ok 176 - POD test for Bio\DB\GenBank.pm
ok 177 - POD test for Bio\DB\GenericWebAgent.pm
ok 178 - POD test for Bio\DB\GenPept.pm
ok 179 - POD test for Bio\DB\GFF.pm
ok 180 - POD test for Bio\DB\HIV.pm
ok 181 - POD test for Bio\DB\InMemoryCache.pm
ok 182 - POD test for Bio\DB\LocationI.pm
ok 183 - POD test for Bio\DB\MeSH.pm
ok 184 - POD test for Bio\DB\NCBIHelper.pm
ok 185 - POD test for Bio\DB\Qual.pm
ok 186 - POD test for Bio\DB\QueryI.pm
ok 187 - POD test for Bio\DB\RandomAccessI.pm
ok 188 - POD test for Bio\DB\ReferenceI.pm
ok 189 - POD test for Bio\DB\RefSeq.pm
ok 190 - POD test for Bio\DB\Registry.pm
ok 191 - POD test for Bio\DB\SeqFeature.pm
ok 192 - POD test for Bio\DB\SeqHound.pm
ok 193 - POD test for Bio\DB\SeqI.pm
ok 194 - POD test for Bio\DB\SeqVersion.pm
ok 195 - POD test for Bio\DB\SwissProt.pm
ok 196 - POD test for Bio\DB\Taxonomy.pm
ok 197 - POD test for Bio\DB\TFBS.pm
ok 198 - POD test for Bio\DB\Universal.pm
ok 199 - POD test for Bio\DB\UpdateableSeqI.pm
ok 200 - POD test for Bio\DB\WebDBSeqI.pm
ok 201 - POD test for Bio\Draw\Pictogram.pm
ok 202 - POD test for Bio\Event\EventGeneratorI.pm
ok 203 - POD test for Bio\Event\EventHandlerI.pm
ok 204 - POD test for Bio\Factory\AnalysisI.pm
ok 205 - POD test for Bio\Factory\ApplicationFactoryI.pm
ok 206 - POD test for Bio\Factory\DriverFactory.pm
ok 207 - POD test for Bio\Factory\FTLocationFactory.pm
ok 208 - POD test for Bio\Factory\LocationFactoryI.pm
ok 209 - POD test for Bio\Factory\MapFactoryI.pm
ok 210 - POD test for Bio\Factory\ObjectBuilderI.pm
ok 211 - POD test for Bio\Factory\ObjectFactory.pm
ok 212 - POD test for Bio\Factory\ObjectFactoryI.pm
ok 213 - POD test for Bio\Factory\SeqAnalysisParserFactory.pm
ok 214 - POD test for Bio\Factory\SeqAnalysisParserFactoryI.pm
ok 215 - POD test for Bio\Factory\SequenceFactoryI.pm
ok 216 - POD test for Bio\Factory\SequenceProcessorI.pm
ok 217 - POD test for Bio\Factory\SequenceStreamI.pm
ok 218 - POD test for Bio\Factory\TreeFactoryI.pm
ok 219 - POD test for Bio\FeatureIO\bed.pm
ok 220 - POD test for Bio\FeatureIO\gff.pm
ok 221 - POD test for Bio\FeatureIO\gtf.pm
ok 222 - POD test for Bio\FeatureIO\interpro.pm
ok 223 - POD test for Bio\FeatureIO\ptt.pm
ok 224 - POD test for Bio\FeatureIO\vecscreen_simple.pm
ok 225 - POD test for Bio\Index\Abstract.pm
ok 226 - POD test for Bio\Index\AbstractSeq.pm
ok 227 - POD test for Bio\Index\Blast.pm
ok 228 - POD test for Bio\Index\BlastTable.pm
ok 229 - POD test for Bio\Index\EMBL.pm
ok 230 - POD test for Bio\Index\Fasta.pm
ok 231 - POD test for Bio\Index\Fastq.pm
ok 232 - POD test for Bio\Index\GenBank.pm
ok 233 - POD test for Bio\Index\Hmmer.pm
ok 234 - POD test for Bio\Index\Qual.pm
ok 235 - POD test for Bio\Index\Stockholm.pm
ok 236 - POD test for Bio\Index\SwissPfam.pm
ok 237 - POD test for Bio\Index\Swissprot.pm
ok 238 - POD test for Bio\LiveSeq\AARange.pm
ok 239 - POD test for Bio\LiveSeq\Chain.pm
ok 240 - POD test for Bio\LiveSeq\ChainI.pm
ok 241 - POD test for Bio\LiveSeq\DNA.pm
ok 242 - POD test for Bio\LiveSeq\Exon.pm
ok 243 - POD test for Bio\LiveSeq\Gene.pm
ok 244 - POD test for Bio\LiveSeq\Intron.pm
ok 245 - POD test for Bio\LiveSeq\Mutation.pm
ok 246 - POD test for Bio\LiveSeq\Mutator.pm
ok 247 - POD test for Bio\LiveSeq\Prim_Transcript.pm
ok 248 - POD test for Bio\LiveSeq\Range.pm
ok 249 - POD test for Bio\LiveSeq\Repeat_Region.pm
ok 250 - POD test for Bio\LiveSeq\Repeat_Unit.pm
ok 251 - POD test for Bio\LiveSeq\SeqI.pm
ok 252 - POD test for Bio\LiveSeq\Transcript.pm
ok 253 - POD test for Bio\LiveSeq\Translation.pm
ok 254 - POD test for Bio\Location\Atomic.pm
ok 255 - POD test for Bio\Location\AvWithinCoordPolicy.pm
ok 256 - POD test for Bio\Location\CoordinatePolicyI.pm
ok 257 - POD test for Bio\Location\Fuzzy.pm
ok 258 - POD test for Bio\Location\FuzzyLocationI.pm
ok 259 - POD test for Bio\Location\NarrowestCoordPolicy.pm
ok 260 - POD test for Bio\Location\Simple.pm
ok 261 - POD test for Bio\Location\Split.pm
ok 262 - POD test for Bio\Location\SplitLocationI.pm
ok 263 - POD test for Bio\Location\WidestCoordPolicy.pm
ok 264 - POD test for Bio\Map\Clone.pm
ok 265 - POD test for Bio\Map\Contig.pm
ok 266 - POD test for Bio\Map\CytoMap.pm
ok 267 - POD test for Bio\Map\CytoMarker.pm
ok 268 - POD test for Bio\Map\CytoPosition.pm
ok 269 - POD test for Bio\Map\EntityI.pm
ok 270 - POD test for Bio\Map\FPCMarker.pm
ok 271 - POD test for Bio\Map\Gene.pm
ok 272 - POD test for Bio\Map\GeneMap.pm
ok 273 - POD test for Bio\Map\GenePosition.pm
ok 274 - POD test for Bio\Map\GeneRelative.pm
ok 275 - POD test for Bio\Map\LinkageMap.pm
ok 276 - POD test for Bio\Map\LinkagePosition.pm
ok 277 - POD test for Bio\Map\MapI.pm
ok 278 - POD test for Bio\Map\Mappable.pm
ok 279 - POD test for Bio\Map\MappableI.pm
ok 280 - POD test for Bio\Map\Marker.pm
ok 281 - POD test for Bio\Map\MarkerI.pm
ok 282 - POD test for Bio\Map\Microsatellite.pm
ok 283 - POD test for Bio\Map\OrderedPosition.pm
ok 284 - POD test for Bio\Map\OrderedPositionWithDistance.pm
ok 285 - POD test for Bio\Map\Physical.pm
ok 286 - POD test for Bio\Map\Position.pm
ok 287 - POD test for Bio\Map\PositionHandler.pm
ok 288 - POD test for Bio\Map\PositionHandlerI.pm
ok 289 - POD test for Bio\Map\PositionI.pm
ok 290 - POD test for Bio\Map\PositionWithSequence.pm
ok 291 - POD test for Bio\Map\Prediction.pm
ok 292 - POD test for Bio\Map\Relative.pm
ok 293 - POD test for Bio\Map\RelativeI.pm
ok 294 - POD test for Bio\Map\SimpleMap.pm
ok 295 - POD test for Bio\Map\TranscriptionFactor.pm
ok 296 - POD test for Bio\MapIO\fpc.pm
ok 297 - POD test for Bio\MapIO\mapmaker.pm
ok 298 - POD test for Bio\Matrix\Generic.pm
ok 299 - POD test for Bio\Matrix\IO.pm
ok 300 - POD test for Bio\Matrix\MatrixI.pm
ok 301 - POD test for Bio\Matrix\Mlagan.pm
ok 302 - POD test for Bio\Matrix\PhylipDist.pm
ok 303 - POD test for Bio\Matrix\Scoring.pm
ok 304 - POD test for Bio\MolEvol\CodonModel.pm
ok 305 - POD test for Bio\Nexml\Factory.pm
ok 306 - POD test for Bio\Ontology\DocumentRegistry.pm
ok 307 - POD test for Bio\Ontology\GOterm.pm
ok 308 - POD test for Bio\Ontology\InterProTerm.pm
ok 309 - POD test for Bio\Ontology\OBOEngine.pm
ok 310 - POD test for Bio\Ontology\OBOterm.pm
ok 311 - POD test for Bio\Ontology\Ontology.pm
ok 312 - POD test for Bio\Ontology\OntologyEngineI.pm
ok 313 - POD test for Bio\Ontology\OntologyI.pm
ok 314 - POD test for Bio\Ontology\OntologyStore.pm
ok 315 - POD test for Bio\Ontology\Path.pm
ok 316 - POD test for Bio\Ontology\PathI.pm
ok 317 - POD test for Bio\Ontology\Relationship.pm
ok 318 - POD test for Bio\Ontology\RelationshipFactory.pm
ok 319 - POD test for Bio\Ontology\RelationshipI.pm
ok 320 - POD test for Bio\Ontology\RelationshipType.pm
ok 321 - POD test for Bio\Ontology\SimpleOntologyEngine.pm
ok 322 - POD test for Bio\Ontology\Term.pm
ok 323 - POD test for Bio\Ontology\TermFactory.pm
ok 324 - POD test for Bio\Ontology\TermI.pm
ok 325 - POD test for Bio\OntologyIO\dagflat.pm
ok 326 - POD test for Bio\OntologyIO\goflat.pm
ok 327 - POD test for Bio\OntologyIO\InterProParser.pm
ok 328 - POD test for Bio\OntologyIO\obo.pm
ok 329 - POD test for Bio\OntologyIO\simplehierarchy.pm
ok 330 - POD test for Bio\OntologyIO\soflat.pm
ok 331 - POD test for Bio\Phenotype\Correlate.pm
ok 332 - POD test for Bio\Phenotype\Measure.pm
ok 333 - POD test for Bio\Phenotype\Phenotype.pm
ok 334 - POD test for Bio\Phenotype\PhenotypeI.pm
ok 335 - POD test for Bio\PhyloNetwork\Factory.pm
ok 336 - POD test for Bio\PhyloNetwork\FactoryX.pm
ok 337 - POD test for Bio\PhyloNetwork\GraphViz.pm
ok 338 - POD test for Bio\PhyloNetwork\muVector.pm
ok 339 - POD test for Bio\PhyloNetwork\RandomFactory.pm
ok 340 - POD test for Bio\PhyloNetwork\TreeFactory.pm
ok 341 - POD test for Bio\PhyloNetwork\TreeFactoryMulti.pm
ok 342 - POD test for Bio\PhyloNetwork\TreeFactoryX.pm
ok 343 - POD test for Bio\PopGen\Genotype.pm
ok 344 - POD test for Bio\PopGen\GenotypeI.pm
ok 345 - POD test for Bio\PopGen\HtSNP.pm
ok 346 - POD test for Bio\PopGen\Individual.pm
ok 347 - POD test for Bio\PopGen\IndividualI.pm
ok 348 - POD test for Bio\PopGen\IO.pm
ok 349 - POD test for Bio\PopGen\Marker.pm
ok 350 - POD test for Bio\PopGen\MarkerI.pm
ok 351 - POD test for Bio\PopGen\PopStats.pm
ok 352 - POD test for Bio\PopGen\Population.pm
ok 353 - POD test for Bio\PopGen\PopulationI.pm
ok 354 - POD test for Bio\PopGen\Statistics.pm
ok 355 - POD test for Bio\PopGen\TagHaplotype.pm
ok 356 - POD test for Bio\PopGen\Utilities.pm
ok 357 - POD test for Bio\Restriction\Analysis.pm
ok 358 - POD test for Bio\Restriction\Enzyme.pm
ok 359 - POD test for Bio\Restriction\EnzymeCollection.pm
ok 360 - POD test for Bio\Restriction\EnzymeI.pm
ok 361 - POD test for Bio\Restriction\IO.pm
ok 362 - POD test for Bio\Root\Build.pm
ok 363 - POD test for Bio\Root\Exception.pm
ok 364 - POD test for Bio\Root\HTTPget.pm
ok 365 - POD test for Bio\Root\IO.pm
ok 366 - POD test for Bio\Root\Root.pm
ok 367 - POD test for Bio\Root\RootI.pm
ok 368 - POD test for Bio\Root\Storable.pm
ok 369 - POD test for Bio\Root\Test.pm
ok 370 - POD test for Bio\Root\Utilities.pm
ok 371 - POD test for Bio\Root\Version.pm
ok 372 - POD test for Bio\Search\BlastStatistics.pm
ok 373 - POD test for Bio\Search\BlastUtils.pm
ok 374 - POD test for Bio\Search\DatabaseI.pm
ok 375 - POD test for Bio\Search\GenericDatabase.pm
ok 376 - POD test for Bio\Search\GenericStatistics.pm
ok 377 - POD test for Bio\Search\Processor.pm
ok 378 - POD test for Bio\Search\SearchUtils.pm
ok 379 - POD test for Bio\Search\StatisticsI.pm
ok 380 - POD test for Bio\SearchIO\axt.pm
ok 381 - POD test for Bio\SearchIO\blast.pm
ok 382 - POD test for Bio\SearchIO\blasttable.pm
ok 383 - POD test for Bio\SearchIO\blastxml.pm
ok 384 - POD test for Bio\SearchIO\blast_pull.pm
ok 385 - POD test for Bio\SearchIO\cross_match.pm
ok 386 - POD test for Bio\SearchIO\erpin.pm
ok 387 - POD test for Bio\SearchIO\EventHandlerI.pm
ok 388 - POD test for Bio\SearchIO\exonerate.pm
ok 389 - POD test for Bio\SearchIO\fasta.pm
ok 390 - POD test for Bio\SearchIO\FastHitEventBuilder.pm
ok 391 - POD test for Bio\SearchIO\gmap_f9.pm
ok 392 - POD test for Bio\SearchIO\hmmer.pm
ok 393 - POD test for Bio\SearchIO\hmmer2.pm
ok 394 - POD test for Bio\SearchIO\hmmer3.pm
ok 395 - POD test for Bio\SearchIO\hmmer_pull.pm
ok 396 - POD test for Bio\SearchIO\infernal.pm
ok 397 - POD test for Bio\SearchIO\IteratedSearchResultEventBuilder.pm
ok 398 - POD test for Bio\SearchIO\megablast.pm
ok 399 - POD test for Bio\SearchIO\psl.pm
ok 400 - POD test for Bio\SearchIO\rnamotif.pm
ok 401 - POD test for Bio\SearchIO\SearchResultEventBuilder.pm
ok 402 - POD test for Bio\SearchIO\SearchWriterI.pm
ok 403 - POD test for Bio\SearchIO\sim4.pm
ok 404 - POD test for Bio\SearchIO\waba.pm
ok 405 - POD test for Bio\SearchIO\wise.pm
ok 406 - POD test for Bio\Seq\BaseSeqProcessor.pm
ok 407 - POD test for Bio\Seq\EncodedSeq.pm
ok 408 - POD test for Bio\Seq\LargeLocatableSeq.pm
ok 409 - POD test for Bio\Seq\LargePrimarySeq.pm
ok 410 - POD test for Bio\Seq\LargeSeq.pm
ok 411 - POD test for Bio\Seq\LargeSeqI.pm
ok 412 - POD test for Bio\Seq\Meta.pm
ok 413 - POD test for Bio\Seq\MetaI.pm
ok 414 - POD test for Bio\Seq\PrimaryQual.pm
ok 415 - POD test for Bio\Seq\PrimedSeq.pm
ok 416 - POD test for Bio\Seq\QualI.pm
ok 417 - POD test for Bio\Seq\Quality.pm
ok 418 - POD test for Bio\Seq\RichSeq.pm
ok 419 - POD test for Bio\Seq\RichSeqI.pm
ok 420 - POD test for Bio\Seq\SeqBuilder.pm
ok 421 - POD test for Bio\Seq\SeqFactory.pm
ok 422 - POD test for Bio\Seq\SeqFastaSpeedFactory.pm
ok 423 - POD test for Bio\Seq\SequenceTrace.pm
ok 424 - POD test for Bio\Seq\SeqWithQuality.pm
ok 425 - POD test for Bio\Seq\TraceI.pm
ok 426 - POD test for Bio\SeqEvolution\DNAPoint.pm
ok 427 - POD test for Bio\SeqEvolution\EvolutionI.pm
ok 428 - POD test for Bio\SeqEvolution\Factory.pm
ok 429 - POD test for Bio\SeqFeature\Annotated.pm
ok 430 - POD test for Bio\SeqFeature\AnnotationAdaptor.pm
ok 431 - POD test for Bio\SeqFeature\Collection.pm
ok 432 - POD test for Bio\SeqFeature\CollectionI.pm
ok 433 - POD test for Bio\SeqFeature\Computation.pm
ok 434 - POD test for Bio\SeqFeature\FeaturePair.pm
ok 435 - POD test for Bio\SeqFeature\Generic.pm
ok 436 - POD test for Bio\SeqFeature\Lite.pm
ok 437 - POD test for Bio\SeqFeature\PositionProxy.pm
ok 438 - POD test for Bio\SeqFeature\Primer.pm
ok 439 - POD test for Bio\SeqFeature\Similarity.pm
ok 440 - POD test for Bio\SeqFeature\SimilarityPair.pm
ok 441 - POD test for Bio\SeqFeature\TypedSeqFeatureI.pm
ok 442 - POD test for Bio\SeqIO\abi.pm
ok 443 - POD test for Bio\SeqIO\ace.pm
ok 444 - POD test for Bio\SeqIO\agave.pm
ok 445 - POD test for Bio\SeqIO\alf.pm
ok 446 - POD test for Bio\SeqIO\asciitree.pm
ok 447 - POD test for Bio\SeqIO\bsml.pm
ok 448 - POD test for Bio\SeqIO\bsml_sax.pm
ok 449 - POD test for Bio\SeqIO\chadoxml.pm
ok 450 - POD test for Bio\SeqIO\chaos.pm
ok 451 - POD test for Bio\SeqIO\chaosxml.pm
ok 452 - POD test for Bio\SeqIO\ctf.pm
ok 453 - POD test for Bio\SeqIO\embl.pm
ok 454 - POD test for Bio\SeqIO\embldriver.pm
ok 455 - POD test for Bio\SeqIO\entrezgene.pm
ok 456 - POD test for Bio\SeqIO\excel.pm
ok 457 - POD test for Bio\SeqIO\exp.pm
ok 458 - POD test for Bio\SeqIO\fasta.pm
ok 459 - POD test for Bio\SeqIO\fastq.pm
ok 460 - POD test for Bio\SeqIO\flybase_chadoxml.pm
ok 461 - POD test for Bio\SeqIO\FTHelper.pm
ok 462 - POD test for Bio\SeqIO\game.pm
ok 463 - POD test for Bio\SeqIO\gbdriver.pm
ok 464 - POD test for Bio\SeqIO\gbxml.pm
ok 465 - POD test for Bio\SeqIO\gcg.pm
ok 466 - POD test for Bio\SeqIO\genbank.pm
ok 467 - POD test for Bio\SeqIO\interpro.pm
ok 468 - POD test for Bio\SeqIO\kegg.pm
ok 469 - POD test for Bio\SeqIO\largefasta.pm
ok 470 - POD test for Bio\SeqIO\lasergene.pm
ok 471 - POD test for Bio\SeqIO\locuslink.pm
ok 472 - POD test for Bio\SeqIO\mbsout.pm
ok 473 - POD test for Bio\SeqIO\metafasta.pm
ok 474 - POD test for Bio\SeqIO\msout.pm
ok 475 - POD test for Bio\SeqIO\MultiFile.pm
ok 476 - POD test for Bio\SeqIO\nexml.pm
ok 477 - POD test for Bio\SeqIO\phd.pm
ok 478 - POD test for Bio\SeqIO\pir.pm
ok 479 - POD test for Bio\SeqIO\pln.pm
ok 480 - POD test for Bio\SeqIO\qual.pm
ok 481 - POD test for Bio\SeqIO\raw.pm
ok 482 - POD test for Bio\SeqIO\scf.pm
ok 483 - POD test for Bio\SeqIO\seqxml.pm
ok 484 - POD test for Bio\SeqIO\strider.pm
ok 485 - POD test for Bio\SeqIO\swiss.pm
ok 486 - POD test for Bio\SeqIO\swissdriver.pm
ok 487 - POD test for Bio\SeqIO\tab.pm
ok 488 - POD test for Bio\SeqIO\table.pm
ok 489 - POD test for Bio\SeqIO\tigr.pm
ok 490 - POD test for Bio\SeqIO\tigrxml.pm
ok 491 - POD test for Bio\SeqIO\tinyseq.pm
ok 492 - POD test for Bio\SeqIO\ztr.pm
ok 493 - POD test for Bio\Structure\Atom.pm
ok 494 - POD test for Bio\Structure\Chain.pm
ok 495 - POD test for Bio\Structure\Entry.pm
ok 496 - POD test for Bio\Structure\IO.pm
ok 497 - POD test for Bio\Structure\Model.pm
ok 498 - POD test for Bio\Structure\Residue.pm
ok 499 - POD test for Bio\Structure\StructureI.pm
ok 500 - POD test for Bio\Symbol\Alphabet.pm
ok 501 - POD test for Bio\Symbol\AlphabetI.pm
ok 502 - POD test for Bio\Symbol\DNAAlphabet.pm
ok 503 - POD test for Bio\Symbol\ProteinAlphabet.pm
ok 504 - POD test for Bio\Symbol\Symbol.pm
ok 505 - POD test for Bio\Symbol\SymbolI.pm
ok 506 - POD test for Bio\Taxonomy\FactoryI.pm
ok 507 - POD test for Bio\Taxonomy\Node.pm
ok 508 - POD test for Bio\Taxonomy\Taxon.pm
ok 509 - POD test for Bio\Taxonomy\Tree.pm
ok 510 - POD test for Bio\Tools\AlignFactory.pm
ok 511 - POD test for Bio\Tools\AnalysisResult.pm
ok 512 - POD test for Bio\Tools\Blat.pm
ok 513 - POD test for Bio\Tools\CodonTable.pm
ok 514 - POD test for Bio\Tools\Coil.pm
ok 515 - POD test for Bio\Tools\dpAlign.pm
ok 516 - POD test for Bio\Tools\ECnumber.pm
ok 517 - POD test for Bio\Tools\EPCR.pm
ok 518 - POD test for Bio\Tools\Eponine.pm
ok 519 - POD test for Bio\Tools\ERPIN.pm
ok 520 - POD test for Bio\Tools\Est2Genome.pm
ok 521 - POD test for Bio\Tools\ESTScan.pm
ok 522 - POD test for Bio\Tools\EUtilities.pm
ok 523 - POD test for Bio\Tools\Fgenesh.pm
ok 524 - POD test for Bio\Tools\FootPrinter.pm
ok 525 - POD test for Bio\Tools\Gel.pm
ok 526 - POD test for Bio\Tools\Geneid.pm
ok 527 - POD test for Bio\Tools\Genemark.pm
ok 528 - POD test for Bio\Tools\Genewise.pm
ok 529 - POD test for Bio\Tools\Genomewise.pm
ok 530 - POD test for Bio\Tools\Genscan.pm
ok 531 - POD test for Bio\Tools\GFF.pm
ok 532 - POD test for Bio\Tools\Glimmer.pm
ok 533 - POD test for Bio\Tools\Grail.pm
ok 534 - POD test for Bio\Tools\GuessSeqFormat.pm
ok 535 - POD test for Bio\Tools\Hmmpfam.pm
ok 536 - POD test for Bio\Tools\Infernal.pm
ok 537 - POD test for Bio\Tools\ipcress.pm
ok 538 - POD test for Bio\Tools\isPcr.pm
ok 539 - POD test for Bio\Tools\IUPAC.pm
ok 540 - POD test for Bio\Tools\Lucy.pm
ok 541 - POD test for Bio\Tools\Match.pm
ok 542 - POD test for Bio\Tools\MZEF.pm
ok 543 - POD test for Bio\Tools\OddCodes.pm
ok 544 - POD test for Bio\Tools\pICalculator.pm
ok 545 - POD test for Bio\Tools\Primer3.pm
ok 546 - POD test for Bio\Tools\Prints.pm
ok 547 - POD test for Bio\Tools\Profile.pm
ok 548 - POD test for Bio\Tools\Promoterwise.pm
ok 549 - POD test for Bio\Tools\PrositeScan.pm
ok 550 - POD test for Bio\Tools\Protparam.pm
ok 551 - POD test for Bio\Tools\Pseudowise.pm
ok 552 - POD test for Bio\Tools\pSW.pm
ok 553 - POD test for Bio\Tools\QRNA.pm
ok 554 - POD test for Bio\Tools\RandomDistFunctions.pm
ok 555 - POD test for Bio\Tools\RepeatMasker.pm
ok 556 - POD test for Bio\Tools\RNAMotif.pm
ok 557 - POD test for Bio\Tools\Seg.pm
ok 558 - POD test for Bio\Tools\SeqPattern.pm
ok 559 - POD test for Bio\Tools\SeqStats.pm
ok 560 - POD test for Bio\Tools\SeqWords.pm
ok 561 - POD test for Bio\Tools\Sigcleave.pm
ok 562 - POD test for Bio\Tools\Signalp.pm
ok 563 - POD test for Bio\Tools\SiRNA.pm
ok 564 - POD test for Bio\Tools\TandemRepeatsFinder.pm
ok 565 - POD test for Bio\Tools\TargetP.pm
ok 566 - POD test for Bio\Tools\Tmhmm.pm
ok 567 - POD test for Bio\Tools\tRNAscanSE.pm
ok 568 - POD test for Bio\Tree\AlleleNode.pm
ok 569 - POD test for Bio\Tree\AnnotatableNode.pm
ok 570 - POD test for Bio\Tree\Compatible.pm
ok 571 - POD test for Bio\Tree\DistanceFactory.pm
ok 572 - POD test for Bio\Tree\Node.pm
ok 573 - POD test for Bio\Tree\NodeI.pm
ok 574 - POD test for Bio\Tree\NodeNHX.pm
ok 575 - POD test for Bio\Tree\RandomFactory.pm
ok 576 - POD test for Bio\Tree\Statistics.pm
ok 577 - POD test for Bio\Tree\Tree.pm
ok 578 - POD test for Bio\Tree\TreeFunctionsI.pm
ok 579 - POD test for Bio\Tree\TreeI.pm
ok 580 - POD test for Bio\TreeIO\cluster.pm
ok 581 - POD test for Bio\TreeIO\lintree.pm
ok 582 - POD test for Bio\TreeIO\newick.pm
ok 583 - POD test for Bio\TreeIO\NewickParser.pm
ok 584 - POD test for Bio\TreeIO\nexml.pm
ok 585 - POD test for Bio\TreeIO\nexus.pm
ok 586 - POD test for Bio\TreeIO\nhx.pm
ok 587 - POD test for Bio\TreeIO\pag.pm
ok 588 - POD test for Bio\TreeIO\phyloxml.pm
ok 589 - POD test for Bio\TreeIO\svggraph.pm
ok 590 - POD test for Bio\TreeIO\tabtree.pm
ok 591 - POD test for Bio\TreeIO\TreeEventBuilder.pm
ok 592 - POD test for Bio\Variation\AAChange.pm
ok 593 - POD test for Bio\Variation\AAReverseMutate.pm
ok 594 - POD test for Bio\Variation\Allele.pm
ok 595 - POD test for Bio\Variation\DNAMutation.pm
ok 596 - POD test for Bio\Variation\IO.pm
ok 597 - POD test for Bio\Variation\RNAChange.pm
ok 598 - POD test for Bio\Variation\SeqDiff.pm
ok 599 - POD test for Bio\Variation\SNP.pm
ok 600 - POD test for Bio\Variation\VariantI.pm
ok 601 - POD test for scripts\biblio\biblio.PLS
ok 602 - POD test for scripts\Bio-DB-EUtilities\einfo.PLS
ok 603 - POD test for scripts\Bio-DB-GFF\bulk_load_gff.PLS
ok 604 - POD test for scripts\Bio-DB-GFF\fast_load_gff.PLS
ok 605 - POD test for scripts\Bio-DB-GFF\genbank2gff.PLS
ok 606 - POD test for scripts\Bio-DB-GFF\genbank2gff3.PLS
ok 607 - POD test for scripts\Bio-DB-GFF\generate_histogram.PLS
ok 608 - POD test for scripts\Bio-DB-GFF\load_gff.PLS
ok 609 - POD test for scripts\Bio-DB-GFF\meta_gff.PLS
ok 610 - POD test for scripts\Bio-DB-GFF\process_gadfly.PLS
ok 611 - POD test for scripts\Bio-DB-GFF\process_sgd.PLS
ok 612 - POD test for scripts\Bio-DB-GFF\process_wormbase.PLS
ok 613 - POD test for scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_delete.PLS (no pod)
ok 614 - POD test for scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_gff3.PLS (no pod)
ok 615 - POD test for scripts\Bio-DB-SeqFeature-Store\bp_seqfeature_load.PLS
ok 616 - POD test for scripts\das\das_server.pl (no pod)
ok 617 - POD test for scripts\DB\biofetch_genbank_proxy.PLS
ok 618 - POD test for scripts\DB\bioflat_index.PLS
ok 619 - POD test for scripts\DB\biogetseq.PLS
ok 620 - POD test for scripts\DB\flanks.PLS
ok 621 - POD test for scripts\DB-HIV\hivq.PLS
ok 622 - POD test for scripts\index\bp_fetch.PLS
ok 623 - POD test for scripts\index\bp_index.PLS
ok 624 - POD test for scripts\index\bp_seqret.PLS
ok 625 - POD test for scripts\popgen\composite_LD.PLS
ok 626 - POD test for scripts\popgen\heterogeneity_test.PLS
ok 627 - POD test for scripts\searchio\fastam9_to_table.PLS
ok 628 - POD test for scripts\searchio\filter_search.PLS
ok 629 - POD test for scripts\searchio\hmmer_to_table.PLS
ok 630 - POD test for scripts\searchio\parse_hmmsearch.PLS
ok 631 - POD test for scripts\searchio\search2table.PLS
ok 632 - POD test for scripts\seq\extract_feature_seq.PLS
ok 633 - POD test for scripts\seq\make_mrna_protein.PLS
ok 634 - POD test for scripts\seq\seqconvert.PLS
ok 635 - POD test for scripts\seq\seqretsplit.PLS
ok 636 - POD test for scripts\seq\split_seq.PLS
ok 637 - POD test for scripts\seq\translate_seq.PLS
ok 638 - POD test for scripts\seq\unflatten_seq.PLS
ok 639 - POD test for scripts\seqstats\aacomp.PLS
ok 640 - POD test for scripts\seqstats\chaos_plot.PLS
ok 641 - POD test for scripts\seqstats\gccalc.PLS
ok 642 - POD test for scripts\seqstats\oligo_count.PLS
ok 643 - POD test for scripts\taxa\classify_hits_kingdom.PLS
ok 644 - POD test for scripts\taxa\local_taxonomydb_query.PLS
ok 645 - POD test for scripts\taxa\query_entrez_taxa.PLS
ok 646 - POD test for scripts\taxa\taxid4species.PLS
ok 647 - POD test for scripts\taxa\taxonomy2tree.PLS
ok 648 - POD test for scripts\tree\blast2tree.PLS
ok 649 - POD test for scripts\tree\nexus2nh.PLS
ok 650 - POD test for scripts\tree\tree2pag.PLS
ok 651 - POD test for scripts\utilities\bp_mrtrans.PLS
ok 652 - POD test for scripts\utilities\bp_netinstall.PLS
ok 653 - POD test for scripts\utilities\bp_nrdb.PLS
ok 654 - POD test for scripts\utilities\bp_sreformat.PLS
ok 655 - POD test for scripts\utilities\dbsplit.PLS
ok 656 - POD test for scripts\utilities\download_query_genbank.PLS
ok 657 - POD test for scripts\utilities\mask_by_search.PLS
ok 658 - POD test for scripts\utilities\mutate.PLS
ok 659 - POD test for scripts\utilities\pairwise_kaks.PLS
ok 660 - POD test for scripts\utilities\remote_blast.PLS
ok 661 - POD test for scripts\utilities\revtrans-motif.PLS
ok 662 - POD test for scripts\utilities\search2alnblocks.PLS
ok 663 - POD test for scripts\utilities\search2BSML.PLS
ok 664 - POD test for scripts\utilities\search2gff.PLS
ok 665 - POD test for scripts\utilities\search2tribe.PLS
ok 666 - POD test for scripts\utilities\seq_length.PLS
ok 667 - POD test for examples\align\aligntutorial.pl (no pod)
ok 668 - POD test for examples\align\align_on_codons.pl (no pod)
ok 669 - POD test for examples\align\clustalw.pl (no pod)
ok 670 - POD test for examples\align\simplealign.pl (no pod)
ok 671 - POD test for examples\biblio\biblio-eutils-example.pl
ok 672 - POD test for examples\biblio\biblio-soap-example.pl
ok 673 - POD test for examples\biblio\biblio_soap.pl (no pod)
ok 674 - POD test for examples\Bio-DB-GFF\load_ucsc.pl (no pod)
ok 675 - POD test for examples\cluster\dbsnp.pl (no pod)
ok 676 - POD test for examples\contributed\nmrpdb_parse.pl (no pod)
ok 677 - POD test for examples\contributed\prosite2perl.pl (no pod)
ok 678 - POD test for examples\contributed\rebase2list.pl (no pod)
ok 679 - POD test for examples\db\dbfetch
ok 680 - POD test for examples\db\est_tissue_query.pl (no pod)
ok 681 - POD test for examples\db\gb2features.pl (no pod)
ok 682 - POD test for examples\db\getGenBank.pl (no pod)
ok 683 - POD test for examples\db\get_seqs.pl (no pod)
ok 684 - POD test for examples\db\rfetch.pl (no pod)
ok 685 - POD test for examples\db\use_registry.pl (no pod)
ok 686 - POD test for examples\liveseq\change_gene.pl (no pod)
ok 687 - POD test for examples\popgen\parse_calc_stats.pl (no pod)
ok 688 - POD test for examples\quality\svgtrace.pl (no pod)
ok 689 - POD test for examples\root\exceptions1.pl (no pod)
ok 690 - POD test for examples\root\exceptions2.pl (no pod)
ok 691 - POD test for examples\root\exceptions3.pl (no pod)
ok 692 - POD test for examples\root\exceptions4.pl (no pod)
ok 693 - POD test for examples\searchio\blast_example.pl (no pod)
ok 694 - POD test for examples\searchio\custom_writer.pl (no pod)
ok 695 - POD test for examples\searchio\hitwriter.pl (no pod)
ok 696 - POD test for examples\searchio\hspwriter.pl (no pod)
ok 697 - POD test for examples\searchio\htmlwriter.pl (no pod)
ok 698 - POD test for examples\searchio\psiblast_features.pl (no pod)
ok 699 - POD test for examples\searchio\psiblast_iterations.pl (no pod)
ok 700 - POD test for examples\searchio\rawwriter.pl (no pod)
ok 701 - POD test for examples\searchio\resultwriter.pl (no pod)
ok 702 - POD test for examples\searchio\waba2gff.pl (no pod)
ok 703 - POD test for examples\searchio\waba2gff3.pl
ok 704 - POD test for examples\sirna\rnai_finder.cgi
ok 705 - POD test for examples\structure\structure-io.pl (no pod)
ok 706 - POD test for examples\tk\gsequence.pl (no pod)
ok 707 - POD test for examples\tk\hitdisplay.pl (no pod)
ok 708 - POD test for examples\tools\extract_genes.pl
ok 709 - POD test for examples\tools\gb_to_gff.pl (no pod)
ok 710 - POD test for examples\tools\gff2ps.pl
ok 711 - POD test for examples\tools\parse_codeml.pl (no pod)
ok 712 - POD test for examples\tools\psw.pl (no pod)
ok 713 - POD test for examples\tools\reverse-translate.pl
ok 714 - POD test for examples\tools\run_genscan.pl (no pod)
ok 715 - POD test for examples\tools\run_primer3.pl
ok 716 - POD test for examples\tools\seq_pattern.pl (no pod)
ok 717 - POD test for examples\tools\standaloneblast.pl (no pod)
ok 718 - POD test for examples\tree\paup2phylip.pl (no pod)
ok 719 - POD test for Bio\AlignIO\Handler\GenericAlignHandler.pm
ok 720 - POD test for Bio\Assembly\IO\ace.pm
ok 721 - POD test for Bio\Assembly\IO\bowtie.pm
ok 722 - POD test for Bio\Assembly\IO\maq.pm
ok 723 - POD test for Bio\Assembly\IO\phrap.pm
ok 724 - POD test for Bio\Assembly\IO\sam.pm
ok 725 - POD test for Bio\Assembly\IO\tigr.pm
ok 726 - POD test for Bio\Assembly\Tools\ContigSpectrum.pm
ok 727 - POD test for Bio\Biblio\IO\medline2ref.pm
ok 728 - POD test for Bio\Biblio\IO\medlinexml.pm
ok 729 - POD test for Bio\Biblio\IO\pubmed2ref.pm
ok 730 - POD test for Bio\Biblio\IO\pubmedxml.pm
ok 731 - POD test for Bio\Coordinate\Result\Gap.pm
ok 732 - POD test for Bio\Coordinate\Result\Match.pm
ok 733 - POD test for Bio\DB\Biblio\biofetch.pm
ok 734 - POD test for Bio\DB\Biblio\eutils.pm
ok 735 - POD test for Bio\DB\Biblio\soap.pm
ok 736 - POD test for Bio\DB\Expression\geo.pm
ok 737 - POD test for Bio\DB\Flat\BDB.pm
ok 738 - POD test for Bio\DB\Flat\BinarySearch.pm
ok 739 - POD test for Bio\DB\GFF\Aggregator.pm
ok 740 - POD test for Bio\DB\GFF\Featname.pm
ok 741 - POD test for Bio\DB\GFF\Feature.pm
ok 742 - POD test for Bio\DB\GFF\Homol.pm
ok 743 - POD test for Bio\DB\GFF\RelSegment.pm
ok 744 - POD test for Bio\DB\GFF\Segment.pm
ok 745 - POD test for Bio\DB\GFF\Typename.pm
ok 746 - POD test for Bio\DB\HIV\HIVAnnotProcessor.pm
ok 747 - POD test for Bio\DB\HIV\HIVQueryHelper.pm
ok 748 - POD test for Bio\DB\Query\GenBank.pm
ok 749 - POD test for Bio\DB\Query\HIVQuery.pm
ok 750 - POD test for Bio\DB\Query\WebQuery.pm
ok 751 - POD test for Bio\DB\SeqFeature\NormalizedFeature.pm
ok 752 - POD test for Bio\DB\SeqFeature\NormalizedFeatureI.pm
ok 753 - POD test for Bio\DB\SeqFeature\NormalizedTableFeatureI.pm
ok 754 - POD test for Bio\DB\SeqFeature\Segment.pm
ok 755 - POD test for Bio\DB\SeqFeature\Store.pm
ok 756 - POD test for Bio\DB\SeqVersion\gi.pm
ok 757 - POD test for Bio\DB\Taxonomy\entrez.pm
ok 758 - POD test for Bio\DB\Taxonomy\flatfile.pm
ok 759 - POD test for Bio\DB\Taxonomy\list.pm
ok 760 - POD test for Bio\DB\TFBS\transfac_pro.pm
ok 761 - POD test for Bio\LiveSeq\IO\BioPerl.pm
ok 762 - POD test for Bio\LiveSeq\IO\Loader.pm
ok 763 - POD test for Bio\Matrix\IO\mlagan.pm
ok 764 - POD test for Bio\Matrix\IO\phylip.pm
ok 765 - POD test for Bio\Matrix\IO\scoring.pm
ok 766 - POD test for Bio\Matrix\PSM\InstanceSite.pm
ok 767 - POD test for Bio\Matrix\PSM\InstanceSiteI.pm
ok 768 - POD test for Bio\Matrix\PSM\IO.pm
ok 769 - POD test for Bio\Matrix\PSM\ProtMatrix.pm
ok 770 - POD test for Bio\Matrix\PSM\ProtPsm.pm
ok 771 - POD test for Bio\Matrix\PSM\Psm.pm
ok 772 - POD test for Bio\Matrix\PSM\PsmHeader.pm
ok 773 - POD test for Bio\Matrix\PSM\PsmHeaderI.pm
ok 774 - POD test for Bio\Matrix\PSM\PsmI.pm
ok 775 - POD test for Bio\Matrix\PSM\SiteMatrix.pm
ok 776 - POD test for Bio\Matrix\PSM\SiteMatrixI.pm
ok 777 - POD test for Bio\Ontology\SimpleGOEngine\GraphAdaptor.pm
ok 778 - POD test for Bio\Ontology\SimpleGOEngine\GraphAdaptor02.pm
ok 779 - POD test for Bio\OntologyIO\Handlers\BaseSAXHandler.pm
ok 780 - POD test for Bio\OntologyIO\Handlers\InterProHandler.pm
ok 781 - POD test for Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm
ok 782 - POD test for Bio\Phenotype\MeSH\Term.pm
ok 783 - POD test for Bio\Phenotype\MeSH\Twig.pm
ok 784 - POD test for Bio\Phenotype\OMIM\MiniMIMentry.pm
ok 785 - POD test for Bio\Phenotype\OMIM\OMIMentry.pm
ok 786 - POD test for Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm
ok 787 - POD test for Bio\Phenotype\OMIM\OMIMparser.pm
ok 788 - POD test for Bio\PopGen\IO\csv.pm
ok 789 - POD test for Bio\PopGen\IO\hapmap.pm
ok 790 - POD test for Bio\PopGen\IO\phase.pm
ok 791 - POD test for Bio\PopGen\IO\prettybase.pm
ok 792 - POD test for Bio\PopGen\Simulation\Coalescent.pm
ok 793 - POD test for Bio\PopGen\Simulation\GeneticDrift.pm
ok 794 - POD test for Bio\Restriction\Enzyme\MultiCut.pm
ok 795 - POD test for Bio\Restriction\Enzyme\MultiSite.pm
ok 796 - POD test for Bio\Restriction\IO\bairoch.pm
ok 797 - POD test for Bio\Restriction\IO\base.pm
ok 798 - POD test for Bio\Restriction\IO\itype2.pm
ok 799 - POD test for Bio\Restriction\IO\prototype.pm
ok 800 - POD test for Bio\Restriction\IO\withrefm.pm
ok 801 - POD test for Bio\Root\Test\Warn.pm
ok 802 - POD test for Bio\Search\Hit\BlastHit.pm
ok 803 - POD test for Bio\Search\Hit\BlastPullHit.pm
ok 804 - POD test for Bio\Search\Hit\Fasta.pm
ok 805 - POD test for Bio\Search\Hit\GenericHit.pm
ok 806 - POD test for Bio\Search\Hit\HitFactory.pm
ok 807 - POD test for Bio\Search\Hit\HitI.pm
ok 808 - POD test for Bio\Search\Hit\hmmer3Hit.pm
ok 809 - POD test for Bio\Search\Hit\HMMERHit.pm
ok 810 - POD test for Bio\Search\Hit\HmmpfamHit.pm
ok 811 - POD test for Bio\Search\Hit\ModelHit.pm
ok 812 - POD test for Bio\Search\Hit\PsiBlastHit.pm
ok 813 - POD test for Bio\Search\Hit\PullHitI.pm
ok 814 - POD test for Bio\Search\HSP\BlastHSP.pm
ok 815 - POD test for Bio\Search\HSP\BlastPullHSP.pm
ok 816 - POD test for Bio\Search\HSP\FastaHSP.pm
ok 817 - POD test for Bio\Search\HSP\GenericHSP.pm
ok 818 - POD test for Bio\Search\HSP\hmmer3HSP.pm
ok 819 - POD test for Bio\Search\HSP\HMMERHSP.pm
ok 820 - POD test for Bio\Search\HSP\HmmpfamHSP.pm
ok 821 - POD test for Bio\Search\HSP\HSPFactory.pm
ok 822 - POD test for Bio\Search\HSP\HSPI.pm
ok 823 - POD test for Bio\Search\HSP\ModelHSP.pm
ok 824 - POD test for Bio\Search\HSP\PsiBlastHSP.pm
ok 825 - POD test for Bio\Search\HSP\PSLHSP.pm
ok 826 - POD test for Bio\Search\HSP\PullHSPI.pm
ok 827 - POD test for Bio\Search\HSP\WABAHSP.pm
ok 828 - POD test for Bio\Search\Iteration\GenericIteration.pm
ok 829 - POD test for Bio\Search\Iteration\IterationI.pm
ok 830 - POD test for Bio\Search\Result\BlastPullResult.pm
ok 831 - POD test for Bio\Search\Result\BlastResult.pm
ok 832 - POD test for Bio\Search\Result\CrossMatchResult.pm
ok 833 - POD test for Bio\Search\Result\GenericResult.pm
ok 834 - POD test for Bio\Search\Result\hmmer3Result.pm
ok 835 - POD test for Bio\Search\Result\HMMERResult.pm
ok 836 - POD test for Bio\Search\Result\HmmpfamResult.pm
ok 837 - POD test for Bio\Search\Result\PullResultI.pm
ok 838 - POD test for Bio\Search\Result\ResultFactory.pm
ok 839 - POD test for Bio\Search\Result\ResultI.pm
ok 840 - POD test for Bio\Search\Result\WABAResult.pm
ok 841 - POD test for Bio\Search\Tiling\MapTileUtils.pm
ok 842 - POD test for Bio\Search\Tiling\MapTiling.pm
ok 843 - POD test for Bio\Search\Tiling\TilingI.pm
ok 844 - POD test for Bio\SearchIO\Writer\BSMLResultWriter.pm
ok 845 - POD test for Bio\SearchIO\Writer\GbrowseGFF.pm
ok 846 - POD test for Bio\SearchIO\Writer\HitTableWriter.pm
ok 847 - POD test for Bio\SearchIO\Writer\HSPTableWriter.pm
ok 848 - POD test for Bio\SearchIO\Writer\HTMLResultWriter.pm
ok 849 - POD test for Bio\SearchIO\Writer\ResultTableWriter.pm
ok 850 - POD test for Bio\SearchIO\Writer\TextResultWriter.pm
ok 851 - POD test for Bio\SearchIO\XML\BlastHandler.pm
ok 852 - POD test for Bio\SearchIO\XML\PsiBlastHandler.pm
ok 853 - POD test for Bio\Seq\Meta\Array.pm
ok 854 - POD test for Bio\SeqFeature\Gene\Exon.pm
ok 855 - POD test for Bio\SeqFeature\Gene\ExonI.pm
ok 856 - POD test for Bio\SeqFeature\Gene\GeneStructure.pm
ok 857 - POD test for Bio\SeqFeature\Gene\GeneStructureI.pm
ok 858 - POD test for Bio\SeqFeature\Gene\Intron.pm
ok 859 - POD test for Bio\SeqFeature\Gene\NC_Feature.pm
ok 860 - POD test for Bio\SeqFeature\Gene\Poly_A_site.pm
ok 861 - POD test for Bio\SeqFeature\Gene\Promoter.pm
ok 862 - POD test for Bio\SeqFeature\Gene\Transcript.pm
ok 863 - POD test for Bio\SeqFeature\Gene\TranscriptI.pm
ok 864 - POD test for Bio\SeqFeature\Gene\UTR.pm
ok 865 - POD test for Bio\SeqFeature\SiRNA\Oligo.pm
ok 866 - POD test for Bio\SeqFeature\SiRNA\Pair.pm
ok 867 - POD test for Bio\SeqFeature\Tools\FeatureNamer.pm
ok 868 - POD test for Bio\SeqFeature\Tools\IDHandler.pm
ok 869 - POD test for Bio\SeqFeature\Tools\TypeMapper.pm
ok 870 - POD test for Bio\SeqFeature\Tools\Unflattener.pm
ok 871 - POD test for Bio\SeqIO\game\featHandler.pm
ok 872 - POD test for Bio\SeqIO\game\gameHandler.pm
ok 873 - POD test for Bio\SeqIO\game\gameSubs.pm
ok 874 - POD test for Bio\SeqIO\game\gameWriter.pm
ok 875 - POD test for Bio\SeqIO\game\seqHandler.pm
ok 876 - POD test for Bio\SeqIO\Handler\GenericRichSeqHandler.pm
ok 877 - POD test for Bio\SeqIO\tinyseq\tinyseqHandler.pm
ok 878 - POD test for Bio\Structure\IO\pdb.pm
ok 879 - POD test for Bio\Tools\Alignment\Consed.pm
ok 880 - POD test for Bio\Tools\Alignment\Trim.pm
ok 881 - POD test for Bio\Tools\Analysis\SimpleAnalysisBase.pm
ok 882 - POD test for Bio\Tools\EMBOSS\Palindrome.pm
ok 883 - POD test for Bio\Tools\EUtilities\EUtilDataI.pm
ok 884 - POD test for Bio\Tools\EUtilities\EUtilParameters.pm
ok 885 - POD test for Bio\Tools\EUtilities\History.pm
ok 886 - POD test for Bio\Tools\EUtilities\HistoryI.pm
ok 887 - POD test for Bio\Tools\EUtilities\Info.pm
ok 888 - POD test for Bio\Tools\EUtilities\Link.pm
ok 889 - POD test for Bio\Tools\EUtilities\Query.pm
ok 890 - POD test for Bio\Tools\EUtilities\Summary.pm
ok 891 - POD test for Bio\Tools\HMMER\Domain.pm
ok 892 - POD test for Bio\Tools\HMMER\Results.pm
ok 893 - POD test for Bio\Tools\HMMER\Set.pm
ok 894 - POD test for Bio\Tools\Phylo\Gerp.pm
ok 895 - POD test for Bio\Tools\Phylo\Gumby.pm
ok 896 - POD test for Bio\Tools\Phylo\Molphy.pm
ok 897 - POD test for Bio\Tools\Phylo\PAML.pm
ok 898 - POD test for Bio\Tools\Prediction\Exon.pm
ok 899 - POD test for Bio\Tools\Prediction\Gene.pm
ok 900 - POD test for Bio\Tools\Primer\AssessorI.pm
ok 901 - POD test for Bio\Tools\Primer\Feature.pm
ok 902 - POD test for Bio\Tools\Primer\Pair.pm
ok 903 - POD test for Bio\Tools\Run\GenericParameters.pm
ok 904 - POD test for Bio\Tools\Run\hmmer3.pm (no pod)
ok 905 - POD test for Bio\Tools\Run\ParametersI.pm
ok 906 - POD test for Bio\Tools\Run\RemoteBlast.pm
ok 907 - POD test for Bio\Tools\Run\StandAloneBlast.pm
ok 908 - POD test for Bio\Tools\Run\StandAloneNCBIBlast.pm
ok 909 - POD test for Bio\Tools\Run\StandAloneWUBlast.pm
ok 910 - POD test for Bio\Tools\Run\WrapperBase.pm
ok 911 - POD test for Bio\Tools\SeqPattern\Backtranslate.pm
ok 912 - POD test for Bio\Tools\Signalp\ExtendedSignalp.pm
ok 913 - POD test for Bio\Tools\Sim4\Exon.pm
ok 914 - POD test for Bio\Tools\Sim4\Results.pm
ok 915 - POD test for Bio\Tools\Spidey\Exon.pm
ok 916 - POD test for Bio\Tools\Spidey\Results.pm
ok 917 - POD test for Bio\Tree\Draw\Cladogram.pm
ok 918 - POD test for Bio\Variation\IO\flat.pm
ok 919 - POD test for Bio\Variation\IO\xml.pm
ok 920 - POD test for examples\root\lib\TestInterface.pm
ok 921 - POD test for examples\root\lib\TestObject.pm
ok 922 - POD test for Bio\DB\Flat\BDB\embl.pm
ok 923 - POD test for Bio\DB\Flat\BDB\fasta.pm
ok 924 - POD test for Bio\DB\Flat\BDB\genbank.pm
ok 925 - POD test for Bio\DB\Flat\BDB\swiss.pm
ok 926 - POD test for Bio\DB\GFF\Adaptor\ace.pm
ok 927 - POD test for Bio\DB\GFF\Adaptor\berkeleydb.pm
ok 928 - POD test for Bio\DB\GFF\Adaptor\biofetch.pm
ok 929 - POD test for Bio\DB\GFF\Adaptor\biofetch_oracle.pm
ok 930 - POD test for Bio\DB\GFF\Adaptor\dbi.pm
ok 931 - POD test for Bio\DB\GFF\Adaptor\memory.pm
ok 932 - POD test for Bio\DB\GFF\Aggregator\alignment.pm
ok 933 - POD test for Bio\DB\GFF\Aggregator\clone.pm
ok 934 - POD test for Bio\DB\GFF\Aggregator\coding.pm
ok 935 - POD test for Bio\DB\GFF\Aggregator\gene.pm
ok 936 - POD test for Bio\DB\GFF\Aggregator\match.pm
ok 937 - POD test for Bio\DB\GFF\Aggregator\none.pm
ok 938 - POD test for Bio\DB\GFF\Aggregator\orf.pm
ok 939 - POD test for Bio\DB\GFF\Aggregator\processed_transcript.pm
ok 940 - POD test for Bio\DB\GFF\Aggregator\so_transcript.pm
ok 941 - POD test for Bio\DB\GFF\Aggregator\transcript.pm
ok 942 - POD test for Bio\DB\GFF\Aggregator\ucsc_acembly.pm
ok 943 - POD test for Bio\DB\GFF\Aggregator\ucsc_ensgene.pm
ok 944 - POD test for Bio\DB\GFF\Aggregator\ucsc_genscan.pm
ok 945 - POD test for Bio\DB\GFF\Aggregator\ucsc_refgene.pm
ok 946 - POD test for Bio\DB\GFF\Aggregator\ucsc_sanger22.pm
ok 947 - POD test for Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm
ok 948 - POD test for Bio\DB\GFF\Aggregator\ucsc_softberry.pm
ok 949 - POD test for Bio\DB\GFF\Aggregator\ucsc_twinscan.pm
ok 950 - POD test for Bio\DB\GFF\Aggregator\ucsc_unigene.pm
ok 951 - POD test for Bio\DB\GFF\Util\Binning.pm
ok 952 - POD test for Bio\DB\GFF\Util\Rearrange.pm
ok 953 - POD test for Bio\DB\SeqFeature\Store\bdb.pm
ok 954 - POD test for Bio\DB\SeqFeature\Store\berkeleydb.pm
ok 955 - POD test for Bio\DB\SeqFeature\Store\berkeleydb3.pm
ok 956 - POD test for Bio\DB\SeqFeature\Store\FeatureFileLoader.pm
ok 957 - POD test for Bio\DB\SeqFeature\Store\GFF2Loader.pm
ok 958 - POD test for Bio\DB\SeqFeature\Store\GFF3Loader.pm
ok 959 - POD test for Bio\DB\SeqFeature\Store\Loader.pm
ok 960 - POD test for Bio\DB\SeqFeature\Store\LoadHelper.pm
ok 961 - POD test for Bio\DB\SeqFeature\Store\memory.pm
ok 962 - POD test for Bio\Matrix\PSM\IO\mast.pm
ok 963 - POD test for Bio\Matrix\PSM\IO\masta.pm
ok 964 - POD test for Bio\Matrix\PSM\IO\meme.pm
ok 965 - POD test for Bio\Matrix\PSM\IO\psiblast.pm
ok 966 - POD test for Bio\Matrix\PSM\IO\transfac.pm
ok 967 - POD test for Bio\Structure\SecStr\DSSP\Res.pm
ok 968 - POD test for Bio\Structure\SecStr\STRIDE\Res.pm
ok 969 - POD test for Bio\Tools\Analysis\DNA\ESEfinder.pm
ok 970 - POD test for Bio\Tools\Analysis\Protein\Domcut.pm
ok 971 - POD test for Bio\Tools\Analysis\Protein\ELM.pm
ok 972 - POD test for Bio\Tools\Analysis\Protein\GOR4.pm
ok 973 - POD test for Bio\Tools\Analysis\Protein\HNN.pm
ok 974 - POD test for Bio\Tools\Analysis\Protein\Mitoprot.pm
ok 975 - POD test for Bio\Tools\Analysis\Protein\NetPhos.pm
ok 976 - POD test for Bio\Tools\Analysis\Protein\Scansite.pm
ok 977 - POD test for Bio\Tools\Analysis\Protein\Sopma.pm
ok 978 - POD test for Bio\Tools\EUtilities\Info\FieldInfo.pm
ok 979 - POD test for Bio\Tools\EUtilities\Info\LinkInfo.pm
ok 980 - POD test for Bio\Tools\EUtilities\Link\LinkSet.pm
ok 981 - POD test for Bio\Tools\EUtilities\Link\UrlLink.pm
ok 982 - POD test for Bio\Tools\EUtilities\Query\GlobalQuery.pm
ok 983 - POD test for Bio\Tools\EUtilities\Summary\DocSum.pm
ok 984 - POD test for Bio\Tools\EUtilities\Summary\Item.pm
ok 985 - POD test for Bio\Tools\EUtilities\Summary\ItemContainerI.pm
ok 986 - POD test for Bio\Tools\Phylo\Molphy\Result.pm
ok 987 - POD test for Bio\Tools\Phylo\PAML\Codeml.pm
ok 988 - POD test for Bio\Tools\Phylo\PAML\ModelResult.pm
ok 989 - POD test for Bio\Tools\Phylo\PAML\Result.pm
ok 990 - POD test for Bio\Tools\Phylo\Phylip\ProtDist.pm
ok 991 - POD test for Bio\Tools\Primer\Assessor\Base.pm
ok 992 - POD test for Bio\Tools\Run\WrapperBase\CommandExts.pm
ok 993 - POD test for Bio\Tools\SiRNA\Ruleset\saigo.pm
ok 994 - POD test for Bio\Tools\SiRNA\Ruleset\tuschl.pm
ok 995 - POD test for Bio\DB\GFF\Adaptor\berkeleydb\iterator.pm
ok 996 - POD test for Bio\DB\GFF\Adaptor\dbi\caching_handle.pm
ok 997 - POD test for Bio\DB\GFF\Adaptor\dbi\iterator.pm
ok 998 - POD test for Bio\DB\GFF\Adaptor\dbi\mysql.pm
ok 999 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlace.pm
ok 1000 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm
ok 1001 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm
ok 1002 - POD test for Bio\DB\GFF\Adaptor\dbi\oracle.pm
ok 1003 - POD test for Bio\DB\GFF\Adaptor\dbi\oracleace.pm
ok 1004 - POD test for Bio\DB\GFF\Adaptor\dbi\pg.pm
ok 1005 - POD test for Bio\DB\GFF\Adaptor\dbi\pg_fts.pm
ok 1006 - POD test for Bio\DB\GFF\Adaptor\memory\feature_serializer.pm
ok 1007 - POD test for Bio\DB\GFF\Adaptor\memory\iterator.pm
ok 1008 - POD test for Bio\DB\SeqFeature\Store\DBI\Iterator.pm
ok 1009 - POD test for Bio\DB\SeqFeature\Store\DBI\mysql.pm
ok 1010 - POD test for Bio\DB\SeqFeature\Store\DBI\Pg.pm
ok 1011 - POD test for Bio\DB\SeqFeature\Store\DBI\SQLite.pm
ok
Subroutine new redefined at Bio\Tree\Tree.pm line 131.
Subroutine nodelete redefined at Bio\Tree\Tree.pm line 179.
Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 196.
Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 230.
Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 245.
Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 269.
Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 283.
Subroutine id redefined at Bio\Tree\Tree.pm line 306.
Subroutine score redefined at Bio\Tree\Tree.pm line 327.
Subroutine as_text redefined at Bio\Tree\Tree.pm line 375.
Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 411.
Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 432.
Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 452.
Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 472.
Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 488.
Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 504.
Subroutine has_tag redefined at Bio\Tree\Tree.pm line 520.
Subroutine clone redefined at Bio\Tree\Tree.pm line 540.
Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 558.
Subroutine new redefined at Bio\Tree\Node.pm line 110.
Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 163.
Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 221.
Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 259.
Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 322.
Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 357.
Subroutine ancestor redefined at Bio\Tree\Node.pm line 396.
Subroutine branch_length redefined at Bio\Tree\Node.pm line 437.
Subroutine bootstrap redefined at Bio\Tree\Node.pm line 461.
Subroutine description redefined at Bio\Tree\Node.pm line 482.
Subroutine id redefined at Bio\Tree\Node.pm line 511.
Subroutine internal_id redefined at Bio\Tree\Node.pm line 553.
Subroutine _creation_id redefined at Bio\Tree\Node.pm line 567.
Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 588.
Subroutine height redefined at Bio\Tree\Node.pm line 606.
Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 631.
Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 652.
Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 674.
Subroutine remove_tag redefined at Bio\Tree\Node.pm line 695.
Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 715.
Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 731.
Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 749.
Subroutine has_tag redefined at Bio\Tree\Node.pm line 765.
Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 770.
Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 800.
t/PopGen/Coalescent.t ........................ 
1..13
ok 1 - use Bio::PopGen::Simulation::Coalescent;
ok 2 - use Bio::PopGen::Statistics;
ok 3 - use Bio::TreeIO;
ok 4
ok 5
ok 6 - pi
ok 7 - theta
ok 8 - tajimaD
ok 9 - all the mutations should be polymorphic (by definition)
ok 10 - fu and li D
ok 11 - fu and li D*
ok 12 - fu and li F
ok 13 - fu and li F
ok
t/PopGen/HtSNP.t ............................. 
1..8
ok 1 - use Bio::PopGen::HtSNP;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/PopGen/MK.t ................................ 
1..46
ok 1 - use Bio::AlignIO;
ok 2 - use Bio::PopGen::Statistics;
ok 3 - use Bio::PopGen::Utilities;
ok 4 - The object isa Bio::PopGen::Statistics
ok 5 - The object isa Bio::SimpleAlign
ok 6 - The object isa Bio::PopGen::Population
ok 7 - Marker Names
ok 8 - Number of Inds
ok 9 - number of ingroup sequences
ok 10 - number of outgroup1 sequences
ok 11 - number of outgroup2 sequences
ok 12 - NSpoly
ok 13 - NSfixed
ok 14 - Spoly
ok 15 - Sfixed
ok 16 - McDonald Kreitman
ok 17 - NSpoly
ok 18 - NSfixed
ok 19 - Spoly
ok 20 - Sfixed
ok 21 - McDonald Kreitman
ok 22 - NSpoly
ok 23 - NSfixed
ok 24 - Spoly
ok 25 - Sfixed
ok 26 - The object isa Bio::SimpleAlign
ok 27 - The object isa Bio::PopGen::Population
ok 28 - Marker Names
ok 29 - Number of Inds
ok 30 - number of ingroup sequences
ok 31 - number of outgroup1 sequences
ok 32 - number of outgroup2 sequences
ok 33 - NSpoly
ok 34 - NSfixed
ok 35 - Spoly
ok 36 - Sfixed
ok 37 - McDonald Kreitman
ok 38 - NSpoly
ok 39 - NSfixed
ok 40 - Spoly
ok 41 - Sfixed
ok 42 - McDonald Kreitman
ok 43 - NSpoly
ok 44 - NSfixed
ok 45 - Spoly
ok 46 - Sfixed
ok
t/PopGen/PopGen.t ............................ 
1..100
ok 1 - use Bio::PopGen::Individual;
ok 2 - use Bio::PopGen::Genotype;
ok 3 - use Bio::PopGen::Population;
ok 4 - use Bio::PopGen::IO;
ok 5 - use Bio::PopGen::PopStats;
ok 6 - use Bio::AlignIO;
ok 7 - use Bio::PopGen::Statistics;
ok 8 - use Bio::PopGen::Utilities;
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - mrsa,mssa aflp1
ok 38 - all pops, aflp1
ok 39 - mrsa,envpop aflp1,aflp2
ok 40
ok 41
ok 42
ok 43 - mssa,mrsa all_bands
ok 44 - env,mssa mkr1
ok 45 - env,mssa,mrsa all bands
ok 46 - env,mssa,mrsa mkr2
ok 47 - mrsa,nc all_bands
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - Pi on 3-allele data
ok 100 - Theta on 3-allele data
ok
t/PopGen/PopGenSims.t ........................ 
1..23
ok 1 - use Bio::PopGen::Simulation::GeneticDrift;
ok 2 - Allele freqs should sum to 1
ok 3 - Allele freqs should sum to 1
ok 4 - Allele freqs should sum to 1
ok 5 - Allele freqs should sum to 1
ok 6 - Allele freqs should sum to 1
ok 7 - Allele freqs should sum to 1
ok 8 - Allele freqs should sum to 1
ok 9 - Allele freqs should sum to 1
ok 10 - Allele freqs should sum to 1
ok 11 - Allele freqs should sum to 1
ok 12
ok 13 - All frequencies should be <= 1
ok 14 - Allele freqs should sum to 1
ok 15 - Allele freqs should sum to 1
ok 16 - Allele freqs should sum to 1
ok 17 - Allele freqs should sum to 1
ok 18 - Allele freqs should sum to 1
ok 19 - Allele freqs should sum to 1
ok 20 - Allele freqs should sum to 1
ok 21 - Allele freqs should sum to 1
ok 22 - Allele freqs should sum to 1
ok 23 - Allele freqs should sum to 1
ok
t/PopGen/TagHaplotype.t ...................... 
1..3
ok 1 - use Bio::PopGen::TagHaplotype;
ok 2
ok 3
ok
t/RemoteDB/BioFetch.t ........................ skipped: Network tests have not been requested
t/RemoteDB/CUTG.t ............................ 
1..37
ok 1 - use Bio::DB::CUTG;
ok 2 - use Bio::CodonUsage::Table;
ok 3 - use Bio::CodonUsage::IO;
ok 4 - use Bio::SeqIO;
ok 5 - use Bio::Tools::SeqStats;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok
t/RemoteDB/EMBL.t ............................ skipped: Network tests have not been requested
t/RemoteDB/EUtilities.t ...................... skipped: Valid email not provided; required for tests
t/RemoteDB/EntrezGene.t ...................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed
t/RemoteDB/GenBank.t ......................... skipped: Network tests have not been requested
t/RemoteDB/GenPept.t ......................... skipped: Network tests have not been requested
t/RemoteDB/HIV/HIV.t ......................... 
1..30
ok 1 - use Bio::DB::HIV;
ok 2 - use Bio::DB::WebDBSeqI;
ok 3 - use Bio::DB::HIV::HIVAnnotProcessor;
ok 4 - The object isa Bio::DB::HIV
ok 5 - The object isa Bio::Root::Root
ok 6 - Bio::DB::HIV->can(...)
ok 7 - Bio::DB::HIV->can(...)
ok 8 - Bio::DB::HIV->can(...)
ok 9 - lanl_base set in default object
ok 10 - map_db set in default object
ok 11 - make_search_if set in default object
ok 12 - search_ set in default object
ok 13 - url_base_address set in default object
ok 14 - default sequence request format (fasta)
ok 15 - sorry till implemented
ok 16 - sorry till implemented
ok 17 - HIVQuery type exception check
ok 18 # skip Network tests have not been requested
ok 19 # skip Network tests have not been requested
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok
t/RemoteDB/HIV/HIVAnnotProcessor.t ........... 
1..11
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::DB::HIV::HIVAnnotProcessor;
ok 4 - The object isa Bio::DB::HIV::HIVAnnotProcessor
ok 5 - The object isa Bio::Root::Root
ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...)
ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query')
ok 8 - bad type set exception
ok 9 - attach stream
ok 10 - write exception
ok 11 - access stream
ok
Use of uninitialized value $rest[0] in join or string at (eval 75) line 15.
t/RemoteDB/HIV/HIVQuery.t .................... 
1..41
ok 1 - use Bio::DB::Query::HIVQuery;
ok 2 - use Bio::DB::HIV;
ok 3 - use Bio::Annotation::Collection;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::Reference;
ok 6 - use Bio::DB::HIV::HIVQueryHelper;
ok 7 - The object isa Bio::DB::Query::HIVQuery
ok 8 - The object isa Bio::Root::Root
ok 9 - Bio::DB::Query::HIVQuery->can(...)
ok 10 - Bio::DB::Query::HIVQuery->can(...)
ok 11 - Bio::DB::Query::HIVQuery->can(...)
ok 12 - _map_db_uri set in default object
ok 13 - _make_search_if_uri set in default object
ok 14 - _search_uri set in default object
ok 15 - _schema_file set in default object
ok 16 - _run_option set in default object
ok 17 - annotations container available
ok 18 - query syntax check 1
ok 19 - query syntax check 2
ok 20 - query syntax check 3
ok 21 - query parser check
ok 22 - multiquery parse check
ok 23 - use HTML::Parser;
ok 24 - help html to file
ok 25 - help html parsed
ok 26 - bad field exception check
ok 27 - bad match data exception check
ok 28 - empty field not ok exception check
ok 29 - uninitialized schema exception check
ok 30 - query not run (level 1) warning check
ok 31 - query not run (level 2) warning check
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok 38 # skip Network tests have not been requested
ok 39 # skip Network tests have not been requested
ok 40 # skip Network tests have not been requested
ok 41 # skip Network tests have not been requested
ok
t/RemoteDB/HIV/HIVQueryHelper.t .............. 
1..40
ok 1 - use Bio::DB::HIV::HIVQueryHelper;
ok 2 - The object isa HIVSchema
ok 3 - The object isa QRY
ok 4 - The object isa R
ok 5 - The object isa Q
ok 6 - schema load
ok 7 - HIVSchema->can(...)
ok 8 - fields complete
ok 9 - tables complete
ok 10 - aliases complete
ok 11
ok 12 - test field syntax ok
ok 13 - test field syntax ok
ok 14 - test alias by field name
ok 15 - correct primary key for SequenceEntry
ok 16 - correct number of foreign keys for AUthor
ok 17 - correct foreign table for au_pub_id
ok 18 - correct annotation key hash
ok 19 - QRY->can(...)
ok 20 - R->can(...)
ok 21 - Q->can(...)
ok 22 - null QRY
ok 23 - null R (request object)
ok 24 - null Q (atomic query object)
ok 25 - R obj create and init (1)
ok 26 - R obj create and init (2)
ok 27 - R::In
ok 28 - !R::In
ok 29 - R::Eq
ok 30 - QRY obj create and init (1)
ok 31 - QRY obj create and init (2)
ok 32 - QRY obj create and init (3)
ok 33 - QRY overload |
ok 34 - QRY overload &
ok 35 - QRY nontrivial &
ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]} 
ok 37 - make: 2 queries returned
ok 38 - {annotation fields} parsed correctly
ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]} 
ok 40 - above query is null
ok
t/RemoteDB/MeSH.t ............................ skipped: Network tests have not been requested
t/RemoteDB/Query/GenBank.t ................... skipped: Network tests have not been requested
t/RemoteDB/RefSeq.t .......................... 
1..16
ok 1 - use Bio::DB::RefSeq;
ok 2 - use Bio::DB::GenBank;
ok 3 - use Bio::DB::EMBL;
ok 4
ok 5
ok 6
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok 15 # skip Network tests have not been requested
ok 16 # skip Network tests have not been requested
ok
t/RemoteDB/SeqHound.t ........................ skipped: Network tests have not been requested
t/RemoteDB/SeqRead_fail.t .................... skipped: Network tests have not been requested
t/RemoteDB/SeqVersion.t ...................... 
1..10
ok 1 - use Bio::DB::SeqVersion;
ok 2
ok 3 # skip Network tests have not been requested
ok 4 # skip Network tests have not been requested
ok 5 # skip Network tests have not been requested
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok
t/RemoteDB/SwissProt.t ....................... skipped: Network tests have not been requested

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio\DB\Taxonomy\flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/RemoteDB/Taxonomy.t:24
-----------------------------------------------------------
Bio::DB::Taxonomy: flatfile cannot be found
Exception 
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\lib C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU\blib\arch C:/cpanfly-5.12/var/cpan/build/BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\BioPerl-1.6.901-7OQIOU C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph\blib\lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP\blib\lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M\blib\lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC\blib\lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed\blib\lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep\blib\lib C:\cpanfly-5.12\var\megalib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-2.110930-HXjFph/blib/lib C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/arch C:\cpanfly-5.12\var\cpan\build\Parse-CPAN-Meta-1.4401-pEGxBP/blib/lib C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/arch C:\cpanfly-5.12\var\cpan\build\JSON-PP-2.27105-bq1h3M/blib/lib C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/arch C:\cpanfly-5.12\var\cpan\build\CPAN-Meta-YAML-0.003-3PSKiC/blib/lib C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/arch C:\cpanfly-5.12\var\cpan\build\Module-Metadata-1.000004-XeLWed/blib/lib C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/arch C:\cpanfly-5.12\var\cpan\build\version-0.88-AoT3Ep/blib/lib C:/cpanfly-5.12/var/megalib C:/Perl-5.12/site/lib C:/Perl-5.12/lib) at Bio\DB\Taxonomy\flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.

STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/RemoteDB/Taxonomy.t:24
-----------------------------------------------------------

For more information about the Bio::DB::Taxonomy system please see
the Bio::DB::Taxonomy docs.  This includes ways of checking for 
formats at compile time, not run time.

#   Failed test at t/RemoteDB/Taxonomy.t line 24.
Use of uninitialized value $db in string eq at t/RemoteDB/Taxonomy.t line 32.
Can't call method "get_taxon" on an undefined value at t/RemoteDB/Taxonomy.t line 124.
# Looks like you planned 103 tests but ran 82.
# Looks like you failed 1 test of 82 run.
# Looks like your test exited with 255 just after 82.
t/RemoteDB/Taxonomy.t ........................ 
1..103
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
not ok 4
ok 5 # skip Network tests have not been requested
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok 15 # skip Network tests have not been requested
ok 16 # skip Network tests have not been requested
ok 17 # skip Network tests have not been requested
ok 18 # skip Network tests have not been requested
ok 19 # skip Network tests have not been requested
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok 38 # skip Network tests have not been requested
ok 39 # skip Network tests have not been requested
ok 40 # skip Network tests have not been requested
ok 41 # skip Network tests have not been requested
ok 42 # skip Network tests have not been requested
ok 43 # skip Unable to connect to entrez database; no network or server busy?
ok 44 # skip Unable to connect to entrez database; no network or server busy?
ok 45 # skip Unable to connect to entrez database; no network or server busy?
ok 46 # skip Unable to connect to entrez database; no network or server busy?
ok 47 # skip Unable to connect to entrez database; no network or server busy?
ok 48 # skip Unable to connect to entrez database; no network or server busy?
ok 49 # skip Unable to connect to entrez database; no network or server busy?
ok 50 # skip Unable to connect to entrez database; no network or server busy?
ok 51 # skip Unable to connect to entrez database; no network or server busy?
ok 52 # skip Unable to connect to entrez database; no network or server busy?
ok 53 # skip Unable to connect to entrez database; no network or server busy?
ok 54 # skip Unable to connect to entrez database; no network or server busy?
ok 55 # skip Unable to connect to entrez database; no network or server busy?
ok 56 # skip Unable to connect to entrez database; no network or server busy?
ok 57 # skip Unable to connect to entrez database; no network or server busy?
ok 58 # skip Unable to connect to entrez database; no network or server busy?
ok 59 # skip Unable to connect to entrez database; no network or server busy?
ok 60 # skip Unable to connect to entrez database; no network or server busy?
ok 61 # skip Unable to connect to entrez database; no network or server busy?
ok 62 # skip Unable to connect to entrez database; no network or server busy?
ok 63 # skip Unable to connect to entrez database; no network or server busy?
ok 64 # skip Unable to connect to entrez database; no network or server busy?
ok 65 # skip Unable to connect to entrez database; no network or server busy?
ok 66 # skip Unable to connect to entrez database; no network or server busy?
ok 67 # skip Unable to connect to entrez database; no network or server busy?
ok 68 # skip Unable to connect to entrez database; no network or server busy?
ok 69 # skip Unable to connect to entrez database; no network or server busy?
ok 70 # skip Unable to connect to entrez database; no network or server busy?
ok 71 # skip Unable to connect to entrez database; no network or server busy?
ok 72 # skip Unable to connect to entrez database; no network or server busy?
ok 73 # skip Unable to connect to entrez database; no network or server busy?
ok 74 # skip Unable to connect to entrez database; no network or server busy?
ok 75 # skip Unable to connect to entrez database; no network or server busy?
ok 76 # skip Unable to connect to entrez database; no network or server busy?
ok 77 # skip Unable to connect to entrez database; no network or server busy?
ok 78 # skip Unable to connect to entrez database; no network or server busy?
ok 79 # skip Unable to connect to entrez database; no network or server busy?
ok 80 # skip Unable to connect to entrez database; no network or server busy?
ok 81
ok 82
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 22/103 subtests 
	(less 76 skipped subtests: 5 okay)
t/Restriction/Analysis-refac.t ............... 
1..91
ok 1 - use Bio::Restriction::IO;
ok 2 - use Bio::Restriction::Analysis;
ok 3 - use Bio::Restriction::EnzymeCollection;
ok 4 - use Bio::Restriction::Enzyme;
ok 5 - read withrefm file
ok 6 - parse withrefm file
ok 7 - HindIII: nonambiguous intrasite cutter
ok 8 - AarI: nonambiguous extrasite cutter
ok 9 - AasI: ambiguous intrasite cutter
ok 10 - BceSI: ambiguous extrasite cutter
ok 11 - AjuI: cutter with central recog site
ok 12 - TaqII: multi-extrasite cutter
ok 13
ok 14 - HindIII plus
ok 15 - HindIII minus
ok 16 - AasI plus
ok 17 - AasI  minus
ok 18 - AarI plus
ok 19 - AarI  minus
ok 20 - BceSI plus
ok 21 - BceSI  minus
ok 22 - AjuI plus
ok 23 - AjuI minus
ok 24 - TaqII plus
ok 25 - TaqII minus
ok 26 - build real B:R::Analysis object
ok 27 - 13 fragments
ok 28 - circularize
ok 29 - recut
ok 30 - circ: AasI
# site at origin
ok 31 - circ: still 13 fragments (cut site at origin)
ok 32 - use Bio::Restriction::IO;
ok 33 - use Bio::Restriction::Analysis;
ok 34 - read withrefm file
ok 35 - parse withrefm file
ok 36 - Collection initiated
ok 37 - AbeI: found ok into collection
ok 38 - AccBSI: found ok into collection
ok 39 - AciI: found ok into collection
ok 40 - Asp26HI: found ok into collection
ok 41 - BmgBI: found ok into collection
ok 42 - AbeI plus
ok 43 - AbeI minus
ok 44 - AbeI fragment
ok 45 - AbeI positions
ok 46 - AbeI Overhang
ok 47 - AbeI name
ok 48 - AbeI site
ok 49 - AbeI revcom_site
ok 50 - AbeI cut
ok 51 - AbeI complementary_cut
ok 52 - AccBSI plus
ok 53 - AccBSI minus
ok 54 - AccBSI fragment
ok 55 - AccBSI positions
ok 56 - AccBSI Overhang
ok 57 - AccBSI name
ok 58 - AccBSI site
ok 59 - AccBSI revcom_site
ok 60 - AccBSI cut
ok 61 - AccBSI complementary_cut
ok 62 - AciI plus
ok 63 - AciI minus
ok 64 - AciI fragment
ok 65 - AciI positions
ok 66 - AciI Overhang
ok 67 - AciI name
ok 68 - AciI site
ok 69 - AciI revcom_site
ok 70 - AciI cut
ok 71 - AciI complementary_cut
ok 72 - Asp26HI plus
ok 73 - Asp26HI minus
ok 74 - Asp26HI fragment
ok 75 - Asp26HI positions
ok 76 - Asp26HI Overhang
ok 77 - Asp26HI name
ok 78 - Asp26HI site
ok 79 - Asp26HI revcom_site
ok 80 - Asp26HI cut
ok 81 - Asp26HI complementary_cut
ok 82 - BmgBI plus
ok 83 - BmgBI minus
ok 84 - BmgBI fragment
ok 85 - BmgBI positions
ok 86 - BmgBI Overhang
ok 87 - BmgBI name
ok 88 - BmgBI site
ok 89 - BmgBI revcom_site
ok 90 - BmgBI cut
ok 91 - BmgBI complementary_cut
ok
t/Restriction/Analysis.t ..................... 
1..182
ok 1 - use Bio::Restriction::Enzyme;
ok 2 - use Bio::Restriction::Enzyme::MultiCut;
ok 3 - use Bio::Restriction::Enzyme::MultiSite;
ok 4 - use Bio::Restriction::EnzymeCollection;
ok 5 - use Bio::Restriction::Analysis;
ok 6 - use Bio::SeqIO;
ok 7
ok 8 - The object isa Bio::Restriction::EnzymeI
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - The object isa Bio::PrimarySeqI
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - bug 2179
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76 - The object isa Bio::Restriction::EnzymeI
ok 77 - The object isa Bio::Restriction::EnzymeI
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87 - The object isa Bio::Restriction::EnzymeI
ok 88 - The object isa Bio::Restriction::EnzymeI
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - The object isa Bio::Restriction::Enzyme
ok 100
ok 101
ok 102 - The object isa Bio::Restriction::Enzyme
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118 - number of unique cutters
ok 119 - number of RsaI fragments
ok 120 - number of maximum cutters
ok 121 - number of zero cutters
ok 122 - number of cutters
ok 123 - number of 3x cutters
ok 124 - 4 MseI fragments
ok 125 - 3 MseI cut sites
ok 126 - expected 2 PspEI fragments
ok 127
ok 128
ok 129 - expected 2 sizes for PspEI
ok 130
ok 131 - expected 2 sizes for PspEI
ok 132
ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut
ok 134
ok 135
ok 136 - number of RsaI fragments
ok 137 - 3 circular MseI fragments
ok 138 - 3 circular MseI cut sites
ok 139 - number for AciI a non-palindromic enzyme
ok 140 - 1 fragment for MwoI as it cuts across the circ point
ok 141
ok 142
ok 143
ok 144
ok 145 - 7 fragments in the multiple digest
ok 146 - 7 positions in the multiple digest
ok 147 - 7 sizes in the multiple digest
ok 148
ok 149 -  expected 9 cuts for HindI
ok 150 - expect 9 fragment maps for HindI
ok 151 - sequence for GT
ok 152 - start at 40
ok 153 - end at 41
ok 154 - sequence for GGATTAAAAAAAGAGT
ok 155 - start at 42
ok 156 - end at 57
ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT
ok 158 - start at 58
ok 159 - end at 92
ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA
ok 161 - start at 93
ok 162 - end at 123
ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA
ok 164 - start at 124
ok 165 - end at 155
ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA
ok 167 - start at 156
ok 168 - end at 181
ok 169 - sequence for CAACATCCATGAAACGCATTAGCA
ok 170 - start at 182
ok 171 - end at 205
ok 172 - sequence for CCA
ok 173 - start at 206
ok 174 - end at 208
ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT
ok 176 - start at 209
ok 177 - end at 39
ok 178
ok 179 - bug 2139
ok 180 - number of HindIII fragments
ok 181 - number of EcoRI fragments
ok 182 - number of RsaI fragments
ok
t/Restriction/Gel.t .......................... 
1..9
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Restriction::Analysis;
ok 3 - use Bio::Tools::Gel;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok
Subroutine new redefined at Bio/Restriction/IO/base.pm line 90, <DATA> line 532.
Subroutine _initialize redefined at Bio/Restriction/IO/base.pm line 114, <DATA> line 532.
Subroutine read redefined at Bio/Restriction/IO/base.pm line 144, <DATA> line 532.
Subroutine _xln_sub redefined at Bio/Restriction/IO/base.pm line 172, <DATA> line 532.
Subroutine write redefined at Bio/Restriction/IO/base.pm line 189, <DATA> line 532.
Subroutine verify_prototype redefined at Bio/Restriction/IO/base.pm line 221, <DATA> line 532.
Subroutine _cuts_from_site redefined at Bio/Restriction/IO/base.pm line 258, <DATA> line 532.
Subroutine _meth redefined at Bio/Restriction/IO/base.pm line 279, <DATA> line 532.
Subroutine _coordinate_shift_to_cut redefined at Bio/Restriction/IO/base.pm line 305, <DATA> line 532.
Subroutine _make_multisites redefined at Bio/Restriction/IO/base.pm line 327, <DATA> line 532.
Subroutine _make_multicuts redefined at Bio/Restriction/IO/base.pm line 412, <DATA> line 532.
Subroutine _companies redefined at Bio/Restriction/IO/base.pm line 441, <DATA> line 532.
t/Restriction/IO.t ........................... 
1..18
ok 1 - use Bio::Restriction::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT!

#   Failed (TODO) test at t/Restriction/IO.t line 31.
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 # skip Network tests have not been requested
ok 17 # skip Network tests have not been requested
ok 18 # skip Network tests have not been requested
ok
t/Root/Exception.t ........................... 
1..8
ok 1 - use TestObject;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Root/HTTPget.t ............................. skipped: Network tests have not been requested
t/Root/RootI.t ............................... 
1..63
ok 1 - use Bio::Root::Root;
ok 2 - use Bio::Seq;
ok 3
ok 4 - The object isa Bio::Root::RootI
ok 5 - threw Regexp ((?-xism:Testing throw))
ok 6 - threw Regexp ((?-xism:EXCEPTION: Bio::Root::NotImplemented))
ok 7 - threw Regexp ((?-xism:EXCEPTION ))
ok 8 - threw Regexp ((?-xism:Testing throw))
ok 9
ok 10 - threw Regexp ((?-xism:Testing throw))
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - simple
ok 17 - simple
ok 18 - warns for versions below current version 1.006901
ok 19 - warns for versions below current version 1.006901
ok 20 - throws for versions above 1.006901
ok 21 - throws for versions above 1.006901
ok 22 - throws for versions equal to 1.006901
ok 23 - simple
ok 24 - simple
ok 25 - warns for versions below current version 1.006901
ok 26 - warns for versions below current version 1.006901
ok 27 - throws for versions above 1.006901
ok 28 - throws for versions above 1.006901
ok 29 - arg callable since method was created
ok 30 - mal-formed arg callable since method was created with good name
ok 31 - Bio::Foo2->can('t3')
ok 32 - Methods don't pollute original Bio::Root::Root namespace
ok 33 - Bio::Foo2->can('test_4')
ok 34 - Methods don't pollute original Bio::Root::Root namespace
ok 35 - Bio::Foo3->can('t5')
ok 36 - arg not in method list not created
ok 37 - Bio::Foo3->can('t5')
ok 38 - Methods don't pollute original Bio::Root::Root namespace
ok 39 - verbose was set correctly
ok 40 - synonym was set correctly
ok 41 - real method of synonym was set correctly
ok 42 - mal-formed arg correctly resolved to created method
ok 43 - synonym of set method was set correctly
ok 44 - Bio::Foo4->can('t7')
ok 45 - Methods don't pollute original Bio::Root::Root namespace
ok 46 - Bio::Foo4->can('test7')
ok 47 - Methods don't pollute original Bio::Root::Root namespace
ok 48 - Bio::Foo4->can('test_8')
ok 49 - Methods don't pollute original Bio::Root::Root namespace
ok 50 - Bio::Foo4->can('t8')
ok 51 - Methods don't pollute original Bio::Root::Root namespace
ok 52 - clone
ok 53 - clone
ok 54 - clone
ok 55 - clone changed, original didn't
ok 56 - parameters passed to clone() modify object
ok 57 - original is not modified
ok 58 - must use proper versioning scheme
ok 59 - warns for versions >= 1.006901
ok 60 - warns for versions >= 1.006901
ok 61 - throws for versions >= 1.006901
ok 62 - throws for versions >= 1.006901
ok 63 - No warnings/exceptions below 1.006901
ok

#   Failed test 'executable file'
#   at t/Root/RootIO.t line 55.
Can't do inplace edit without backup at Bio/Root/IO.pm line 513.
# Looks like you planned 67 tests but ran 43.
# Looks like you failed 1 test of 43 run.
# Looks like your test exited with 25 just after 43.
Error removing C:\cpanfly-5.12\var\tmp\3Q_KSEOxAU at C:\cpanfly-5.12\var\megalib/File/Temp.pm line 890.
t/Root/RootIO.t .............................. 
1..67
ok 1 - use Bio::Root::IO;
ok 2
ok 3 - throw()
ok 4 - throw() verbose(-1)
ok 5 - warn()
ok 6 - throw() verbose(1)
ok 7 - stack_trace()
ok 8 - set verbosity to 1
ok 9
ok 10
not ok 11 - executable file
ok 12 - non-executable file
ok 13 - executable dir
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - filename, read
ok 20
ok 21
ok 22 - filename, write
ok 23
ok 24
ok 25
ok 26
ok 27 - handle, read
ok 28
ok 29
ok 30 - handle, write
ok 31
ok 32 - is a write handle
ok 33 - no warnings
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - _print
ok 43
Dubious, test returned 25 (wstat 6400, 0x1900)
Failed 25/67 subtests 
t/Root/Storable.t ............................ 
1..35
ok 1 - use Bio::Root::Storable;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok
t/Root/Tempfile.t ............................ 
1..18
ok 1 - use Bio::Root::IO;
ok 2
ok 3 - The object isa Bio::Root::IO
ok 4
ok 5
ok 6 - auto UNLINK => 1
ok 7
ok 8
ok 9 - tempfile deleted
ok 10
ok 11 - UNLINK => 0
ok 12
ok 13
ok 14
ok 15 - tempfile suffix
ok 16
ok 17 - tempfile() in scalar context
ok 18
ok
t/Root/Utilities.t ........................... 
1..56
ok 1 - use Bio::Root::Utilities;
ok 2 - The object isa Bio::Root::Utilities
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - file_date()
ok 38 - unix (\n or 012 or ^J)
ok 39 - date format
ok 40 - date format
ok 41 - date format
ok 42 - date format
ok 43 - date format
ok 44
ok 45 # skip gzip not found, skipping gzip tests
ok 46 # skip gzip not found, skipping gzip tests
ok 47 # skip gzip not found, skipping gzip tests
ok 48 # skip gzip not found, skipping gzip tests
ok 49 # skip gzip not found, skipping gzip tests
ok 50 # skip gzip not found, skipping gzip tests
ok 51 # skip gzip not found, skipping gzip tests
ok 52 # skip gzip not found, skipping gzip tests
ok 53 # skip gzip not found, skipping gzip tests
ok 54 # skip gzip not found, skipping gzip tests
ok 55 # skip gzip not found, skipping gzip tests
ok 56 # skip gzip not found, skipping gzip tests
ok
t/SearchDist.t ............................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 434.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 434.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 434.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 434.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 434.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 434.
t/SearchIO/CigarString.t ..................... 
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/SearchIO.t ........................ 
1..19
ok 1 - use Bio::SearchIO;
ok 2 - blastxml for f.blastxml
ok 3 - fasta for f.fy
ok 4 - exonerate for f.exonerate
ok 5 - blast for f.tblx
ok 6 - fasta for f.fx
ok 7 - fasta for f.osearch
ok 8 - blast for filename.bls
ok 9 - exonerate for f.exon
ok 10 - fasta for f.SSEARCH.m9
ok 11 - blast for filename.blast
ok 12 - fasta for f.m9
ok 13 - blast for f.blx
ok 14 - blastxml for f.xml
ok 15 - fasta for f.fasta
ok 16 - fasta for f.fa
ok 17 - blast for fast.bls
ok 18 - fasta for f.ssearch
ok 19 - fasta for f.psearch
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN2> line 434.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN2> line 434.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN2> line 434.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN2> line 434.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN2> line 434.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN2> line 434.
t/SearchIO/SimilarityPair.t .................. 
1..12
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SeqIO;
ok 3
ok 4 - The object isa Bio::SeqI
ok 5
ok 6 - The object isa Bio::SearchIO
ok 7
ok 8 - The object isa Bio::Search::Hit::HitI
ok 9
ok 10 - The object isa Bio::SeqFeatureI
ok 11
ok 12
ok
Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 127.
Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 204.
Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 228.
Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 248.
Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 268.
Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 288.
Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 308.
Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 333.
Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 355.
Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 385.
Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 400.
Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 430.
Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 458.
Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 494.
Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 517.
Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 538.
Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 564.
Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 576.
Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 605.
Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 652.
Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 694.
Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 740.
Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 786.
Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 849.
Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 887.
Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 948.
Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1025.
Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1093.
Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1150.
Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1226.
Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1274.
Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1310.
Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1364.
Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1400.
Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1442.
Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1473.
Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1535.
Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1574.
Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1590.
Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1618.
Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1666.
Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1683.
Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1701.
Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1732.
Subroutine iteration redefined at Bio\Search\Hit\GenericHit.pm line 1772.
Subroutine found_again redefined at Bio\Search\Hit\GenericHit.pm line 1807.
Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1333.
Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1341.
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\Search\Hit\BlastHit.pm line 105.
Subroutine iteration redefined at Bio\Search\Hit\BlastHit.pm line 134.
Subroutine found_again redefined at Bio\Search\Hit\BlastHit.pm line 169.
Subroutine expect redefined at Bio\Search\Hit\BlastHit.pm line 176.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 2564.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 2564.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 2564.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 2564.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 2564.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 2564.
t/SearchIO/Tiling.t .......................... 
1..1141
ok 1 - use Bio::Search::Tiling::MapTiling;
ok 2 - use Bio::Search::Tiling::MapTileUtils;
ok 3 - use Bio::SearchIO;
ok 4 - use Bio::Search::Hit::BlastHit;
ok 5 - use File::Spec;
ok 6 - parse data file
ok 7 - got test hit
ok 8 - create tiling
ok 9 - The object isa Bio::Search::Tiling::TilingI
ok 10 - implements 'next_tiling'
ok 11 - implements 'rewind_tilings'
ok 12 - implements 'identities'
ok 13 - implements 'conserved'
ok 14 - implements 'length'
ok 15 - identities regression test
ok 16 - conserved regression test
ok 17 - tiling iterator regression test(1)
ok 18 - tiling iterator regression test(2)
ok 19 - tiling iterator regression test(3, rewind)
ok 20 - ecolitst.wublastp
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - dnaEbsub_ecoli.wublastx
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36 - tricky.wublast
ok 37 - tricky.wublast(1)
ok 38 - tricky.wublast(2)
ok 39 - tricky.wublast(3)
ok 40 - tricky.wublast(4)
ok 41 - ecolitst.bls
ok 42 - tile ecolitst.bls hit 1 \#hsps 1
ok 43 - q id: est (0.98293) = fast (0.98293)
ok 44 - q cn: est (0.98293) = fast (0.98293)
ok 45 - h id: est (0.98293) = fast (0.98293)
ok 46 - h cn: est (0.98293) = fast (0.98293)
ok 47 - tile ecolitst.bls hit 2 \#hsps 1
ok 48 - q id: est (0.30074) = fast (0.30074)
ok 49 - q cn: est (0.49876) = fast (0.49876)
ok 50 - h id: est (0.30759) = fast (0.30759)
ok 51 - h cn: est (0.51013) = fast (0.51013)
ok 52 - tile ecolitst.bls hit 3 \#hsps 1
ok 53 - q id: est (0.31004) = fast (0.31004)
ok 54 - q cn: est (0.49782) = fast (0.49782)
ok 55 - h id: est (0.32054) = fast (0.32054)
ok 56 - h cn: est (0.51467) = fast (0.51467)
ok 57 - tile ecolitst.bls hit 4 \#hsps 1
ok 58 - q id: est (0.30435) = fast (0.30435)
ok 59 - q cn: est (0.47826) = fast (0.47826)
ok 60 - h id: est (0.29787) = fast (0.29787)
ok 61 - h cn: est (0.46809) = fast (0.46809)
ok 62 - tricky.wublast
ok 63 - tile tricky.wublast hit 1 \#hsps 7
ok 64 - q id: exact (0.22153) ~ est (0.22153)
ok 65 - q id: exact (0.22153) <= max (0.22153)
ok 66 - q cn: exact (0.42760) ~ est (0.42760)
ok 67 - q cn: exact (0.42760) <= max (0.42760)
ok 68 - h id: exact (0.22704) ~ est (0.22704)
ok 69 - h id: exact (0.22704) <= max (0.22704)
ok 70 - h cn: exact (0.43335) ~ est (0.43335)
ok 71 - h cn: exact (0.43335) <= max (0.43335)
ok 72 - a_thaliana.blastn
ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1
ok 74 - q id: est (0.96667) = fast (0.96667)
ok 75 - q cn: est (0.96667) = fast (0.96667)
ok 76 - h id: est (0.98305) = fast (0.98305)
ok 77 - h cn: est (0.98305) = fast (0.98305)
ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1
ok 79 - q id: est (0.96667) = fast (0.96667)
ok 80 - q cn: est (0.96667) = fast (0.96667)
ok 81 - h id: est (0.98305) = fast (0.98305)
ok 82 - h cn: est (0.98305) = fast (0.98305)
ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1
ok 84 - q id: est (1.00000) = fast (1.00000)
ok 85 - q cn: est (1.00000) = fast (1.00000)
ok 86 - h id: est (1.00000) = fast (1.00000)
ok 87 - h cn: est (1.00000) = fast (1.00000)
ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1
ok 89 - q id: est (1.00000) = fast (1.00000)
ok 90 - q cn: est (1.00000) = fast (1.00000)
ok 91 - h id: est (1.00000) = fast (1.00000)
ok 92 - h cn: est (1.00000) = fast (1.00000)
ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1
ok 94 - q id: est (0.92308) = fast (0.92308)
ok 95 - q cn: est (0.92308) = fast (0.92308)
ok 96 - h id: est (0.92308) = fast (0.92308)
ok 97 - h cn: est (0.92308) = fast (0.92308)
ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1
ok 99 - q id: est (1.00000) = fast (1.00000)
ok 100 - q cn: est (1.00000) = fast (1.00000)
ok 101 - h id: est (1.00000) = fast (1.00000)
ok 102 - h cn: est (1.00000) = fast (1.00000)
ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1
ok 104 - q id: est (1.00000) = fast (1.00000)
ok 105 - q cn: est (1.00000) = fast (1.00000)
ok 106 - h id: est (1.00000) = fast (1.00000)
ok 107 - h cn: est (1.00000) = fast (1.00000)
ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1
ok 109 - q id: est (1.00000) = fast (1.00000)
ok 110 - q cn: est (1.00000) = fast (1.00000)
ok 111 - h id: est (1.00000) = fast (1.00000)
ok 112 - h cn: est (1.00000) = fast (1.00000)
ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1
ok 114 - q id: est (1.00000) = fast (1.00000)
ok 115 - q cn: est (1.00000) = fast (1.00000)
ok 116 - h id: est (1.00000) = fast (1.00000)
ok 117 - h cn: est (1.00000) = fast (1.00000)
ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1
ok 119 - q id: est (1.00000) = fast (1.00000)
ok 120 - q cn: est (1.00000) = fast (1.00000)
ok 121 - h id: est (1.00000) = fast (1.00000)
ok 122 - h cn: est (1.00000) = fast (1.00000)
ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1
ok 124 - q id: est (1.00000) = fast (1.00000)
ok 125 - q cn: est (1.00000) = fast (1.00000)
ok 126 - h id: est (1.00000) = fast (1.00000)
ok 127 - h cn: est (1.00000) = fast (1.00000)
ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1
ok 129 - q id: est (1.00000) = fast (1.00000)
ok 130 - q cn: est (1.00000) = fast (1.00000)
ok 131 - h id: est (1.00000) = fast (1.00000)
ok 132 - h cn: est (1.00000) = fast (1.00000)
ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1
ok 134 - q id: est (1.00000) = fast (1.00000)
ok 135 - q cn: est (1.00000) = fast (1.00000)
ok 136 - h id: est (1.00000) = fast (1.00000)
ok 137 - h cn: est (1.00000) = fast (1.00000)
ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1
ok 139 - q id: est (1.00000) = fast (1.00000)
ok 140 - q cn: est (1.00000) = fast (1.00000)
ok 141 - h id: est (1.00000) = fast (1.00000)
ok 142 - h cn: est (1.00000) = fast (1.00000)
ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1
ok 144 - q id: est (1.00000) = fast (1.00000)
ok 145 - q cn: est (1.00000) = fast (1.00000)
ok 146 - h id: est (1.00000) = fast (1.00000)
ok 147 - h cn: est (1.00000) = fast (1.00000)
ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1
ok 149 - q id: est (1.00000) = fast (1.00000)
ok 150 - q cn: est (1.00000) = fast (1.00000)
ok 151 - h id: est (1.00000) = fast (1.00000)
ok 152 - h cn: est (1.00000) = fast (1.00000)
ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1
ok 154 - q id: est (1.00000) = fast (1.00000)
ok 155 - q cn: est (1.00000) = fast (1.00000)
ok 156 - h id: est (1.00000) = fast (1.00000)
ok 157 - h cn: est (1.00000) = fast (1.00000)
ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1
ok 159 - q id: est (1.00000) = fast (1.00000)
ok 160 - q cn: est (1.00000) = fast (1.00000)
ok 161 - h id: est (1.00000) = fast (1.00000)
ok 162 - h cn: est (1.00000) = fast (1.00000)
ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1
ok 164 - q id: est (1.00000) = fast (1.00000)
ok 165 - q cn: est (1.00000) = fast (1.00000)
ok 166 - h id: est (1.00000) = fast (1.00000)
ok 167 - h cn: est (1.00000) = fast (1.00000)
ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1
ok 169 - q id: est (0.95238) = fast (0.95238)
ok 170 - q cn: est (0.95238) = fast (0.95238)
ok 171 - h id: est (0.95238) = fast (0.95238)
ok 172 - h cn: est (0.95238) = fast (0.95238)
ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1
ok 174 - q id: est (1.00000) = fast (1.00000)
ok 175 - q cn: est (1.00000) = fast (1.00000)
ok 176 - h id: est (1.00000) = fast (1.00000)
ok 177 - h cn: est (1.00000) = fast (1.00000)
ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1
ok 179 - q id: est (0.95238) = fast (0.95238)
ok 180 - q cn: est (0.95238) = fast (0.95238)
ok 181 - h id: est (0.95238) = fast (0.95238)
ok 182 - h cn: est (0.95238) = fast (0.95238)
ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1
ok 184 - q id: est (1.00000) = fast (1.00000)
ok 185 - q cn: est (1.00000) = fast (1.00000)
ok 186 - h id: est (1.00000) = fast (1.00000)
ok 187 - h cn: est (1.00000) = fast (1.00000)
ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1
ok 189 - q id: est (0.95238) = fast (0.95238)
ok 190 - q cn: est (0.95238) = fast (0.95238)
ok 191 - h id: est (0.95238) = fast (0.95238)
ok 192 - h cn: est (0.95238) = fast (0.95238)
ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1
ok 194 - q id: est (1.00000) = fast (1.00000)
ok 195 - q cn: est (1.00000) = fast (1.00000)
ok 196 - h id: est (1.00000) = fast (1.00000)
ok 197 - h cn: est (1.00000) = fast (1.00000)
ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1
ok 199 - q id: est (1.00000) = fast (1.00000)
ok 200 - q cn: est (1.00000) = fast (1.00000)
ok 201 - h id: est (1.00000) = fast (1.00000)
ok 202 - h cn: est (1.00000) = fast (1.00000)
ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1
ok 204 - q id: est (1.00000) = fast (1.00000)
ok 205 - q cn: est (1.00000) = fast (1.00000)
ok 206 - h id: est (1.00000) = fast (1.00000)
ok 207 - h cn: est (1.00000) = fast (1.00000)
ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1
ok 209 - q id: est (1.00000) = fast (1.00000)
ok 210 - q cn: est (1.00000) = fast (1.00000)
ok 211 - h id: est (1.00000) = fast (1.00000)
ok 212 - h cn: est (1.00000) = fast (1.00000)
ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1
ok 214 - q id: est (1.00000) = fast (1.00000)
ok 215 - q cn: est (1.00000) = fast (1.00000)
ok 216 - h id: est (1.00000) = fast (1.00000)
ok 217 - h cn: est (1.00000) = fast (1.00000)
ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1
ok 219 - q id: est (1.00000) = fast (1.00000)
ok 220 - q cn: est (1.00000) = fast (1.00000)
ok 221 - h id: est (1.00000) = fast (1.00000)
ok 222 - h cn: est (1.00000) = fast (1.00000)
ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1
ok 224 - q id: est (1.00000) = fast (1.00000)
ok 225 - q cn: est (1.00000) = fast (1.00000)
ok 226 - h id: est (1.00000) = fast (1.00000)
ok 227 - h cn: est (1.00000) = fast (1.00000)
ok 228 - brassica_ATH.WUBLASTN
ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3
ok 230 - q id: exact (0.82465) ~ est (0.82343)
ok 231 - q id: exact (0.82465) <= max (0.83333)
ok 232 - q cn: exact (0.85590) ~ est (0.85312)
ok 233 - q cn: exact (0.85590) <= max (0.86458)
ok 234 - h id: exact (0.83920) ~ est (0.83920)
ok 235 - h id: exact (0.83920) <= max (0.83920)
ok 236 - h cn: exact (0.86935) ~ est (0.86935)
ok 237 - h cn: exact (0.86935) <= max (0.86935)
ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2
ok 239 - q id: exact (0.82486) ~ est (0.82486)
ok 240 - q id: exact (0.82486) <= max (0.82486)
ok 241 - q cn: exact (0.85122) ~ est (0.85122)
ok 242 - q cn: exact (0.85122) <= max (0.85122)
ok 243 - h id: exact (0.82955) ~ est (0.82955)
ok 244 - h id: exact (0.82955) <= max (0.82955)
ok 245 - h cn: exact (0.85606) ~ est (0.85606)
ok 246 - h cn: exact (0.85606) <= max (0.85606)
ok 247 - no_hsps.blastp
ok 248 - tile no_hsps.blastp hit 1 \#hsps 0
ok 249 - tile no_hsps.blastp hit 2 \#hsps 0
ok 250 - tile no_hsps.blastp hit 3 \#hsps 0
ok 251 - tile no_hsps.blastp hit 4 \#hsps 0
ok 252 - tile no_hsps.blastp hit 5 \#hsps 0
ok 253 - tile no_hsps.blastp hit 6 \#hsps 0
ok 254 - tile no_hsps.blastp hit 7 \#hsps 0
ok 255 - tile no_hsps.blastp hit 8 \#hsps 0
ok 256 - tile no_hsps.blastp hit 9 \#hsps 0
ok 257 - tile no_hsps.blastp hit 10 \#hsps 0
ok 258 - tile no_hsps.blastp hit 11 \#hsps 0
ok 259 - tile no_hsps.blastp hit 12 \#hsps 0
ok 260 - tile no_hsps.blastp hit 13 \#hsps 0
ok 261 - tile no_hsps.blastp hit 14 \#hsps 0
ok 262 - tile no_hsps.blastp hit 15 \#hsps 0
ok 263 - tile no_hsps.blastp hit 16 \#hsps 0
ok 264 - tile no_hsps.blastp hit 17 \#hsps 0
ok 265 - tile no_hsps.blastp hit 18 \#hsps 0
ok 266 - tile no_hsps.blastp hit 19 \#hsps 0
ok 267 - tile no_hsps.blastp hit 20 \#hsps 0
ok 268 - tile no_hsps.blastp hit 21 \#hsps 0
ok 269 - tile no_hsps.blastp hit 22 \#hsps 0
ok 270 - tile no_hsps.blastp hit 23 \#hsps 0
ok 271 - tile no_hsps.blastp hit 24 \#hsps 0
ok 272 - tile no_hsps.blastp hit 25 \#hsps 0
ok 273 - tile no_hsps.blastp hit 26 \#hsps 0
ok 274 - tile no_hsps.blastp hit 27 \#hsps 0
ok 275 - tile no_hsps.blastp hit 28 \#hsps 0
ok 276 - tile no_hsps.blastp hit 29 \#hsps 0
ok 277 - tile no_hsps.blastp hit 30 \#hsps 0
ok 278 - tile no_hsps.blastp hit 31 \#hsps 0
ok 279 - tile no_hsps.blastp hit 32 \#hsps 0
ok 280 - tile no_hsps.blastp hit 33 \#hsps 0
ok 281 - tile no_hsps.blastp hit 34 \#hsps 0
ok 282 - tile no_hsps.blastp hit 35 \#hsps 0
ok 283 - tile no_hsps.blastp hit 36 \#hsps 0
ok 284 - tile no_hsps.blastp hit 37 \#hsps 0
ok 285 - tile no_hsps.blastp hit 38 \#hsps 0
ok 286 - tile no_hsps.blastp hit 39 \#hsps 0
ok 287 - tile no_hsps.blastp hit 40 \#hsps 0
ok 288 - tile no_hsps.blastp hit 41 \#hsps 0
ok 289 - tile no_hsps.blastp hit 42 \#hsps 0
ok 290 - tile no_hsps.blastp hit 43 \#hsps 0
ok 291 - tile no_hsps.blastp hit 44 \#hsps 0
ok 292 - tile no_hsps.blastp hit 45 \#hsps 0
ok 293 - tile no_hsps.blastp hit 46 \#hsps 0
ok 294 - tile no_hsps.blastp hit 47 \#hsps 0
ok 295 - tile no_hsps.blastp hit 48 \#hsps 0
ok 296 - tile no_hsps.blastp hit 49 \#hsps 0
ok 297 - tile no_hsps.blastp hit 50 \#hsps 0
ok 298 - tile no_hsps.blastp hit 51 \#hsps 0
ok 299 - tile no_hsps.blastp hit 52 \#hsps 0
ok 300 - tile no_hsps.blastp hit 53 \#hsps 0
ok 301 - tile no_hsps.blastp hit 54 \#hsps 0
ok 302 - tile no_hsps.blastp hit 55 \#hsps 0
ok 303 - tile no_hsps.blastp hit 56 \#hsps 0
ok 304 - tile no_hsps.blastp hit 57 \#hsps 0
ok 305 - tile no_hsps.blastp hit 58 \#hsps 0
ok 306 - tile no_hsps.blastp hit 59 \#hsps 0
ok 307 - tile no_hsps.blastp hit 60 \#hsps 0
ok 308 - tile no_hsps.blastp hit 61 \#hsps 0
ok 309 - tile no_hsps.blastp hit 62 \#hsps 0
ok 310 - tile no_hsps.blastp hit 63 \#hsps 0
ok 311 - tile no_hsps.blastp hit 64 \#hsps 0
ok 312 - tile no_hsps.blastp hit 65 \#hsps 0
ok 313 - tile no_hsps.blastp hit 66 \#hsps 0
ok 314 - tile no_hsps.blastp hit 67 \#hsps 0
ok 315 - tile no_hsps.blastp hit 68 \#hsps 0
ok 316 - tile no_hsps.blastp hit 69 \#hsps 0
ok 317 - tile no_hsps.blastp hit 70 \#hsps 0
ok 318 - tile no_hsps.blastp hit 71 \#hsps 0
ok 319 - tile no_hsps.blastp hit 72 \#hsps 0
ok 320 - tile no_hsps.blastp hit 73 \#hsps 0
ok 321 - tile no_hsps.blastp hit 74 \#hsps 0
ok 322 - tile no_hsps.blastp hit 75 \#hsps 0
ok 323 - tile no_hsps.blastp hit 76 \#hsps 0
ok 324 - tile no_hsps.blastp hit 77 \#hsps 0
ok 325 - tile no_hsps.blastp hit 78 \#hsps 0
ok 326 - tile no_hsps.blastp hit 79 \#hsps 0
ok 327 - tile no_hsps.blastp hit 80 \#hsps 0
ok 328 - tile no_hsps.blastp hit 81 \#hsps 0
ok 329 - tile no_hsps.blastp hit 82 \#hsps 0
ok 330 - tile no_hsps.blastp hit 83 \#hsps 0
ok 331 - tile no_hsps.blastp hit 84 \#hsps 0
ok 332 - tile no_hsps.blastp hit 85 \#hsps 0
ok 333 - tile no_hsps.blastp hit 86 \#hsps 0
ok 334 - tile no_hsps.blastp hit 87 \#hsps 0
ok 335 - tile no_hsps.blastp hit 88 \#hsps 0
ok 336 - tile no_hsps.blastp hit 89 \#hsps 0
ok 337 - tile no_hsps.blastp hit 90 \#hsps 0
ok 338 - tile no_hsps.blastp hit 91 \#hsps 0
ok 339 - tile no_hsps.blastp hit 92 \#hsps 0
ok 340 - tile no_hsps.blastp hit 93 \#hsps 0
ok 341 - tile no_hsps.blastp hit 94 \#hsps 0
ok 342 - tile no_hsps.blastp hit 95 \#hsps 0
ok 343 - tile no_hsps.blastp hit 96 \#hsps 0
ok 344 - tile no_hsps.blastp hit 97 \#hsps 0
ok 345 - tile no_hsps.blastp hit 98 \#hsps 0
ok 346 - tile no_hsps.blastp hit 99 \#hsps 0
ok 347 - tile no_hsps.blastp hit 100 \#hsps 0
ok 348 - tile no_hsps.blastp hit 101 \#hsps 0
ok 349 - tile no_hsps.blastp hit 102 \#hsps 0
ok 350 - tile no_hsps.blastp hit 103 \#hsps 0
ok 351 - tile no_hsps.blastp hit 104 \#hsps 0
ok 352 - tile no_hsps.blastp hit 105 \#hsps 0
ok 353 - tile no_hsps.blastp hit 106 \#hsps 0
ok 354 - tile no_hsps.blastp hit 107 \#hsps 0
ok 355 - tile no_hsps.blastp hit 108 \#hsps 0
ok 356 - tile no_hsps.blastp hit 109 \#hsps 0
ok 357 - tile no_hsps.blastp hit 110 \#hsps 0
ok 358 - tile no_hsps.blastp hit 111 \#hsps 0
ok 359 - tile no_hsps.blastp hit 112 \#hsps 0
ok 360 - tile no_hsps.blastp hit 113 \#hsps 0
ok 361 - tile no_hsps.blastp hit 114 \#hsps 0
ok 362 - tile no_hsps.blastp hit 115 \#hsps 0
ok 363 - tile no_hsps.blastp hit 116 \#hsps 0
ok 364 - tile no_hsps.blastp hit 117 \#hsps 0
ok 365 - tile no_hsps.blastp hit 118 \#hsps 0
ok 366 - tile no_hsps.blastp hit 119 \#hsps 0
ok 367 - tile no_hsps.blastp hit 120 \#hsps 0
ok 368 - tile no_hsps.blastp hit 121 \#hsps 0
ok 369 - tile no_hsps.blastp hit 122 \#hsps 0
ok 370 - tile no_hsps.blastp hit 123 \#hsps 0
ok 371 - tile no_hsps.blastp hit 124 \#hsps 0
ok 372 - tile no_hsps.blastp hit 125 \#hsps 0
ok 373 - tile no_hsps.blastp hit 126 \#hsps 0
ok 374 - tile no_hsps.blastp hit 127 \#hsps 0
ok 375 - tile no_hsps.blastp hit 128 \#hsps 0
ok 376 - tile no_hsps.blastp hit 129 \#hsps 0
ok 377 - tile no_hsps.blastp hit 130 \#hsps 0
ok 378 - tile no_hsps.blastp hit 131 \#hsps 0
ok 379 - tile no_hsps.blastp hit 132 \#hsps 0
ok 380 - tile no_hsps.blastp hit 133 \#hsps 0
ok 381 - tile no_hsps.blastp hit 134 \#hsps 0
ok 382 - tile no_hsps.blastp hit 135 \#hsps 0
ok 383 - tile no_hsps.blastp hit 136 \#hsps 0
ok 384 - tile no_hsps.blastp hit 137 \#hsps 0
ok 385 - tile no_hsps.blastp hit 138 \#hsps 0
ok 386 - tile no_hsps.blastp hit 139 \#hsps 0
ok 387 - tile no_hsps.blastp hit 140 \#hsps 0
ok 388 - tile no_hsps.blastp hit 141 \#hsps 0
ok 389 - tile no_hsps.blastp hit 142 \#hsps 0
ok 390 - tile no_hsps.blastp hit 143 \#hsps 0
ok 391 - tile no_hsps.blastp hit 144 \#hsps 0
ok 392 - tile no_hsps.blastp hit 145 \#hsps 0
ok 393 - tile no_hsps.blastp hit 146 \#hsps 0
ok 394 - tile no_hsps.blastp hit 147 \#hsps 0
ok 395 - tile no_hsps.blastp hit 148 \#hsps 0
ok 396 - tile no_hsps.blastp hit 149 \#hsps 0
ok 397 - tile no_hsps.blastp hit 150 \#hsps 0
ok 398 - tile no_hsps.blastp hit 151 \#hsps 0
ok 399 - tile no_hsps.blastp hit 152 \#hsps 0
ok 400 - tile no_hsps.blastp hit 153 \#hsps 0
ok 401 - tile no_hsps.blastp hit 154 \#hsps 0
ok 402 - tile no_hsps.blastp hit 155 \#hsps 0
ok 403 - tile no_hsps.blastp hit 156 \#hsps 0
ok 404 - tile no_hsps.blastp hit 157 \#hsps 0
ok 405 - tile no_hsps.blastp hit 158 \#hsps 0
ok 406 - tile no_hsps.blastp hit 159 \#hsps 0
ok 407 - tile no_hsps.blastp hit 160 \#hsps 0
ok 408 - tile no_hsps.blastp hit 161 \#hsps 0
ok 409 - tile no_hsps.blastp hit 162 \#hsps 0
ok 410 - tile no_hsps.blastp hit 163 \#hsps 0
ok 411 - tile no_hsps.blastp hit 164 \#hsps 0
ok 412 - tile no_hsps.blastp hit 165 \#hsps 0
ok 413 - tile no_hsps.blastp hit 166 \#hsps 0
ok 414 - tile no_hsps.blastp hit 167 \#hsps 0
ok 415 - tile no_hsps.blastp hit 168 \#hsps 0
ok 416 - tile no_hsps.blastp hit 169 \#hsps 0
ok 417 - tile no_hsps.blastp hit 170 \#hsps 0
ok 418 - tile no_hsps.blastp hit 171 \#hsps 0
ok 419 - tile no_hsps.blastp hit 172 \#hsps 0
ok 420 - tile no_hsps.blastp hit 173 \#hsps 0
ok 421 - tile no_hsps.blastp hit 174 \#hsps 0
ok 422 - tile no_hsps.blastp hit 175 \#hsps 0
ok 423 - tile no_hsps.blastp hit 176 \#hsps 0
ok 424 - tile no_hsps.blastp hit 177 \#hsps 0
ok 425 - tile no_hsps.blastp hit 178 \#hsps 0
ok 426 - tile no_hsps.blastp hit 179 \#hsps 0
ok 427 - tile no_hsps.blastp hit 180 \#hsps 0
ok 428 - tile no_hsps.blastp hit 181 \#hsps 0
ok 429 - tile no_hsps.blastp hit 182 \#hsps 0
ok 430 - tile no_hsps.blastp hit 183 \#hsps 0
ok 431 - tile no_hsps.blastp hit 184 \#hsps 0
ok 432 - tile no_hsps.blastp hit 185 \#hsps 0
ok 433 - tile no_hsps.blastp hit 186 \#hsps 0
ok 434 - tile no_hsps.blastp hit 187 \#hsps 0
ok 435 - tile no_hsps.blastp hit 188 \#hsps 0
ok 436 - tile no_hsps.blastp hit 189 \#hsps 0
ok 437 - tile no_hsps.blastp hit 190 \#hsps 0
ok 438 - tile no_hsps.blastp hit 191 \#hsps 0
ok 439 - tile no_hsps.blastp hit 192 \#hsps 0
ok 440 - tile no_hsps.blastp hit 193 \#hsps 0
ok 441 - tile no_hsps.blastp hit 194 \#hsps 0
ok 442 - tile no_hsps.blastp hit 195 \#hsps 0
ok 443 - tile no_hsps.blastp hit 196 \#hsps 0
ok 444 - tile no_hsps.blastp hit 197 \#hsps 0
ok 445 - tile no_hsps.blastp hit 198 \#hsps 0
ok 446 - tile no_hsps.blastp hit 199 \#hsps 0
ok 447 - tile no_hsps.blastp hit 200 \#hsps 0
ok 448 - tile no_hsps.blastp hit 201 \#hsps 0
ok 449 - tile no_hsps.blastp hit 202 \#hsps 0
ok 450 - tile no_hsps.blastp hit 203 \#hsps 0
ok 451 - tile no_hsps.blastp hit 204 \#hsps 0
ok 452 - tile no_hsps.blastp hit 205 \#hsps 0
ok 453 - tile no_hsps.blastp hit 206 \#hsps 0
ok 454 - tile no_hsps.blastp hit 207 \#hsps 0
ok 455 - tile no_hsps.blastp hit 208 \#hsps 0
ok 456 - tile no_hsps.blastp hit 209 \#hsps 0
ok 457 - tile no_hsps.blastp hit 210 \#hsps 0
ok 458 - tile no_hsps.blastp hit 211 \#hsps 0
ok 459 - tile no_hsps.blastp hit 212 \#hsps 0
ok 460 - tile no_hsps.blastp hit 213 \#hsps 0
ok 461 - tile no_hsps.blastp hit 214 \#hsps 0
ok 462 - tile no_hsps.blastp hit 215 \#hsps 0
ok 463 - tile no_hsps.blastp hit 216 \#hsps 0
ok 464 - tile no_hsps.blastp hit 217 \#hsps 0
ok 465 - tile no_hsps.blastp hit 218 \#hsps 0
ok 466 - tile no_hsps.blastp hit 219 \#hsps 0
ok 467 - tile no_hsps.blastp hit 220 \#hsps 0
ok 468 - tile no_hsps.blastp hit 221 \#hsps 0
ok 469 - tile no_hsps.blastp hit 222 \#hsps 0
ok 470 - tile no_hsps.blastp hit 223 \#hsps 0
ok 471 - tile no_hsps.blastp hit 224 \#hsps 0
ok 472 - tile no_hsps.blastp hit 225 \#hsps 0
ok 473 - tile no_hsps.blastp hit 226 \#hsps 0
ok 474 - tile no_hsps.blastp hit 227 \#hsps 0
ok 475 - tile no_hsps.blastp hit 228 \#hsps 0
ok 476 - tile no_hsps.blastp hit 229 \#hsps 0
ok 477 - tile no_hsps.blastp hit 230 \#hsps 0
ok 478 - tile no_hsps.blastp hit 231 \#hsps 0
ok 479 - tile no_hsps.blastp hit 232 \#hsps 0
ok 480 - tile no_hsps.blastp hit 233 \#hsps 0
ok 481 - tile no_hsps.blastp hit 234 \#hsps 0
ok 482 - tile no_hsps.blastp hit 235 \#hsps 0
ok 483 - tile no_hsps.blastp hit 236 \#hsps 0
ok 484 - tile no_hsps.blastp hit 237 \#hsps 0
ok 485 - tile no_hsps.blastp hit 238 \#hsps 0
ok 486 - tile no_hsps.blastp hit 239 \#hsps 0
ok 487 - tile no_hsps.blastp hit 240 \#hsps 0
ok 488 - tile no_hsps.blastp hit 241 \#hsps 0
ok 489 - tile no_hsps.blastp hit 242 \#hsps 0
ok 490 - tile no_hsps.blastp hit 243 \#hsps 0
ok 491 - tile no_hsps.blastp hit 244 \#hsps 0
ok 492 - tile no_hsps.blastp hit 245 \#hsps 0
ok 493 - tile no_hsps.blastp hit 246 \#hsps 0
ok 494 - tile no_hsps.blastp hit 247 \#hsps 0
ok 495 - tile no_hsps.blastp hit 248 \#hsps 0
ok 496 - tile no_hsps.blastp hit 249 \#hsps 0
ok 497 - tile no_hsps.blastp hit 250 \#hsps 0
ok 498 - tile no_hsps.blastp hit 251 \#hsps 0
ok 499 - tile no_hsps.blastp hit 252 \#hsps 0
ok 500 - tile no_hsps.blastp hit 253 \#hsps 0
ok 501 - tile no_hsps.blastp hit 254 \#hsps 0
ok 502 - tile no_hsps.blastp hit 255 \#hsps 0
ok 503 - tile no_hsps.blastp hit 256 \#hsps 0
ok 504 - tile no_hsps.blastp hit 257 \#hsps 0
ok 505 - tile no_hsps.blastp hit 258 \#hsps 0
ok 506 - tile no_hsps.blastp hit 259 \#hsps 0
ok 507 - tile no_hsps.blastp hit 260 \#hsps 0
ok 508 - tile no_hsps.blastp hit 261 \#hsps 0
ok 509 - tile no_hsps.blastp hit 262 \#hsps 0
ok 510 - tile no_hsps.blastp hit 263 \#hsps 0
ok 511 - tile no_hsps.blastp hit 264 \#hsps 0
ok 512 - tile no_hsps.blastp hit 265 \#hsps 0
ok 513 - tile no_hsps.blastp hit 266 \#hsps 0
ok 514 - tile no_hsps.blastp hit 267 \#hsps 0
ok 515 - tile no_hsps.blastp hit 268 \#hsps 0
ok 516 - tile no_hsps.blastp hit 269 \#hsps 0
ok 517 - tile no_hsps.blastp hit 270 \#hsps 0
ok 518 - tile no_hsps.blastp hit 271 \#hsps 0
ok 519 - tile no_hsps.blastp hit 272 \#hsps 0
ok 520 - tile no_hsps.blastp hit 273 \#hsps 0
ok 521 - tile no_hsps.blastp hit 274 \#hsps 0
ok 522 - tile no_hsps.blastp hit 275 \#hsps 0
ok 523 - tile no_hsps.blastp hit 276 \#hsps 0
ok 524 - tile no_hsps.blastp hit 277 \#hsps 0
ok 525 - tile no_hsps.blastp hit 278 \#hsps 0
ok 526 - tile no_hsps.blastp hit 279 \#hsps 0
ok 527 - tile no_hsps.blastp hit 280 \#hsps 0
ok 528 - tile no_hsps.blastp hit 281 \#hsps 0
ok 529 - tile no_hsps.blastp hit 282 \#hsps 0
ok 530 - tile no_hsps.blastp hit 283 \#hsps 0
ok 531 - tile no_hsps.blastp hit 284 \#hsps 0
ok 532 - tile no_hsps.blastp hit 285 \#hsps 0
ok 533 - tile no_hsps.blastp hit 286 \#hsps 0
ok 534 - tile no_hsps.blastp hit 287 \#hsps 0
ok 535 - tile no_hsps.blastp hit 288 \#hsps 0
ok 536 - tile no_hsps.blastp hit 289 \#hsps 0
ok 537 - tile no_hsps.blastp hit 290 \#hsps 0
ok 538 - tile no_hsps.blastp hit 291 \#hsps 0
ok 539 - tile no_hsps.blastp hit 292 \#hsps 0
ok 540 - tile no_hsps.blastp hit 293 \#hsps 0
ok 541 - tile no_hsps.blastp hit 294 \#hsps 0
ok 542 - tile no_hsps.blastp hit 295 \#hsps 0
ok 543 - tile no_hsps.blastp hit 296 \#hsps 0
ok 544 - tile no_hsps.blastp hit 297 \#hsps 0
ok 545 - tile no_hsps.blastp hit 298 \#hsps 0
ok 546 - tile no_hsps.blastp hit 299 \#hsps 0
ok 547 - tile no_hsps.blastp hit 300 \#hsps 0
ok 548 - tile no_hsps.blastp hit 301 \#hsps 0
ok 549 - tile no_hsps.blastp hit 302 \#hsps 0
ok 550 - tile no_hsps.blastp hit 303 \#hsps 0
ok 551 - tile no_hsps.blastp hit 304 \#hsps 0
ok 552 - tile no_hsps.blastp hit 305 \#hsps 0
ok 553 - tile no_hsps.blastp hit 306 \#hsps 0
ok 554 - tile no_hsps.blastp hit 307 \#hsps 0
ok 555 - tile no_hsps.blastp hit 308 \#hsps 0
ok 556 - tile no_hsps.blastp hit 309 \#hsps 0
ok 557 - tile no_hsps.blastp hit 310 \#hsps 0
ok 558 - tile no_hsps.blastp hit 311 \#hsps 0
ok 559 - tile no_hsps.blastp hit 312 \#hsps 0
ok 560 - tile no_hsps.blastp hit 313 \#hsps 0
ok 561 - tile no_hsps.blastp hit 314 \#hsps 0
ok 562 - tile no_hsps.blastp hit 315 \#hsps 0
ok 563 - tile no_hsps.blastp hit 316 \#hsps 0
ok 564 - tile no_hsps.blastp hit 317 \#hsps 0
ok 565 - tile no_hsps.blastp hit 318 \#hsps 0
ok 566 - tile no_hsps.blastp hit 319 \#hsps 0
ok 567 - tile no_hsps.blastp hit 320 \#hsps 0
ok 568 - tile no_hsps.blastp hit 321 \#hsps 0
ok 569 - tile no_hsps.blastp hit 322 \#hsps 0
ok 570 - tile no_hsps.blastp hit 323 \#hsps 0
ok 571 - tile no_hsps.blastp hit 324 \#hsps 0
ok 572 - tile no_hsps.blastp hit 325 \#hsps 0
ok 573 - tile no_hsps.blastp hit 326 \#hsps 0
ok 574 - tile no_hsps.blastp hit 327 \#hsps 0
ok 575 - tile no_hsps.blastp hit 328 \#hsps 0
ok 576 - tile no_hsps.blastp hit 329 \#hsps 0
ok 577 - tile no_hsps.blastp hit 330 \#hsps 0
ok 578 - tile no_hsps.blastp hit 331 \#hsps 0
ok 579 - tile no_hsps.blastp hit 332 \#hsps 0
ok 580 - tile no_hsps.blastp hit 333 \#hsps 0
ok 581 - tile no_hsps.blastp hit 334 \#hsps 0
ok 582 - tile no_hsps.blastp hit 335 \#hsps 0
ok 583 - tile no_hsps.blastp hit 336 \#hsps 0
ok 584 - tile no_hsps.blastp hit 337 \#hsps 0
ok 585 - tile no_hsps.blastp hit 338 \#hsps 0
ok 586 - tile no_hsps.blastp hit 339 \#hsps 0
ok 587 - tile no_hsps.blastp hit 340 \#hsps 0
ok 588 - tile no_hsps.blastp hit 341 \#hsps 0
ok 589 - tile no_hsps.blastp hit 342 \#hsps 0
ok 590 - tile no_hsps.blastp hit 343 \#hsps 0
ok 591 - tile no_hsps.blastp hit 344 \#hsps 0
ok 592 - tile no_hsps.blastp hit 345 \#hsps 0
ok 593 - tile no_hsps.blastp hit 346 \#hsps 0
ok 594 - tile no_hsps.blastp hit 347 \#hsps 0
ok 595 - tile no_hsps.blastp hit 348 \#hsps 0
ok 596 - tile no_hsps.blastp hit 349 \#hsps 0
ok 597 - tile no_hsps.blastp hit 350 \#hsps 0
ok 598 - tile no_hsps.blastp hit 351 \#hsps 0
ok 599 - tile no_hsps.blastp hit 352 \#hsps 0
ok 600 - tile no_hsps.blastp hit 353 \#hsps 0
ok 601 - tile no_hsps.blastp hit 354 \#hsps 0
ok 602 - tile no_hsps.blastp hit 355 \#hsps 0
ok 603 - tile no_hsps.blastp hit 356 \#hsps 0
ok 604 - tile no_hsps.blastp hit 357 \#hsps 0
ok 605 - tile no_hsps.blastp hit 358 \#hsps 0
ok 606 - tile no_hsps.blastp hit 359 \#hsps 0
ok 607 - tile no_hsps.blastp hit 360 \#hsps 0
ok 608 - tile no_hsps.blastp hit 361 \#hsps 0
ok 609 - tile no_hsps.blastp hit 362 \#hsps 0
ok 610 - tile no_hsps.blastp hit 363 \#hsps 0
ok 611 - tile no_hsps.blastp hit 364 \#hsps 0
ok 612 - tile no_hsps.blastp hit 365 \#hsps 0
ok 613 - tile no_hsps.blastp hit 366 \#hsps 0
ok 614 - tile no_hsps.blastp hit 367 \#hsps 0
ok 615 - tile no_hsps.blastp hit 368 \#hsps 0
ok 616 - tile no_hsps.blastp hit 369 \#hsps 0
ok 617 - tile no_hsps.blastp hit 370 \#hsps 0
ok 618 - tile no_hsps.blastp hit 371 \#hsps 0
ok 619 - tile no_hsps.blastp hit 372 \#hsps 0
ok 620 - tile no_hsps.blastp hit 373 \#hsps 0
ok 621 - tile no_hsps.blastp hit 374 \#hsps 0
ok 622 - tile no_hsps.blastp hit 375 \#hsps 0
ok 623 - tile no_hsps.blastp hit 376 \#hsps 0
ok 624 - tile no_hsps.blastp hit 377 \#hsps 0
ok 625 - tile no_hsps.blastp hit 378 \#hsps 0
ok 626 - tile no_hsps.blastp hit 379 \#hsps 0
ok 627 - tile no_hsps.blastp hit 380 \#hsps 0
ok 628 - tile no_hsps.blastp hit 381 \#hsps 0
ok 629 - tile no_hsps.blastp hit 382 \#hsps 0
ok 630 - tile no_hsps.blastp hit 383 \#hsps 0
ok 631 - tile no_hsps.blastp hit 384 \#hsps 0
ok 632 - tile no_hsps.blastp hit 385 \#hsps 0
ok 633 - tile no_hsps.blastp hit 386 \#hsps 0
ok 634 - tile no_hsps.blastp hit 387 \#hsps 0
ok 635 - tile no_hsps.blastp hit 388 \#hsps 0
ok 636 - tile no_hsps.blastp hit 389 \#hsps 0
ok 637 - tile no_hsps.blastp hit 390 \#hsps 0
ok 638 - tile no_hsps.blastp hit 391 \#hsps 0
ok 639 - tile no_hsps.blastp hit 392 \#hsps 0
ok 640 - tile no_hsps.blastp hit 393 \#hsps 0
ok 641 - tile no_hsps.blastp hit 394 \#hsps 0
ok 642 - tile no_hsps.blastp hit 395 \#hsps 0
ok 643 - tile no_hsps.blastp hit 396 \#hsps 0
ok 644 - tile no_hsps.blastp hit 397 \#hsps 0
ok 645 - tile no_hsps.blastp hit 398 \#hsps 0
ok 646 - tile no_hsps.blastp hit 399 \#hsps 0
ok 647 - tile no_hsps.blastp hit 400 \#hsps 0
ok 648 - tile no_hsps.blastp hit 401 \#hsps 0
ok 649 - tile no_hsps.blastp hit 402 \#hsps 0
ok 650 - tile no_hsps.blastp hit 403 \#hsps 0
ok 651 - tile no_hsps.blastp hit 404 \#hsps 0
ok 652 - tile no_hsps.blastp hit 405 \#hsps 0
ok 653 - tile no_hsps.blastp hit 406 \#hsps 0
ok 654 - tile no_hsps.blastp hit 407 \#hsps 0
ok 655 - tile no_hsps.blastp hit 408 \#hsps 0
ok 656 - tile no_hsps.blastp hit 409 \#hsps 0
ok 657 - tile no_hsps.blastp hit 410 \#hsps 0
ok 658 - tile no_hsps.blastp hit 411 \#hsps 0
ok 659 - tile no_hsps.blastp hit 412 \#hsps 0
ok 660 - tile no_hsps.blastp hit 413 \#hsps 0
ok 661 - tile no_hsps.blastp hit 414 \#hsps 0
ok 662 - tile no_hsps.blastp hit 415 \#hsps 0
ok 663 - catalase-webblast.BLASTP
ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1
ok 665 - q id: est (1.00000) = fast (1.00000)
ok 666 - q cn: est (1.00000) = fast (1.00000)
ok 667 - h id: est (1.00000) = fast (1.00000)
ok 668 - h cn: est (1.00000) = fast (1.00000)
ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1
ok 670 - q id: est (0.80973) = fast (0.80973)
ok 671 - q cn: est (0.89006) = fast (0.89006)
ok 672 - h id: est (0.82543) = fast (0.82543)
ok 673 - h cn: est (0.90733) = fast (0.90733)
ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1
ok 675 - q id: est (0.71670) = fast (0.71670)
ok 676 - q cn: est (0.84144) = fast (0.84144)
ok 677 - h id: est (0.72747) = fast (0.72747)
ok 678 - h cn: est (0.85408) = fast (0.85408)
ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1
ok 680 - q id: est (0.58910) = fast (0.58910)
ok 681 - q cn: est (0.70860) = fast (0.70860)
ok 682 - h id: est (0.65654) = fast (0.65654)
ok 683 - h cn: est (0.78972) = fast (0.78972)
ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1
ok 685 - q id: est (0.49245) = fast (0.49245)
ok 686 - q cn: est (0.65257) = fast (0.65257)
ok 687 - h id: est (0.49544) = fast (0.49544)
ok 688 - h cn: est (0.65653) = fast (0.65653)
ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1
ok 690 - q id: est (0.44366) = fast (0.44366)
ok 691 - q cn: est (0.58920) = fast (0.58920)
ok 692 - h id: est (0.44787) = fast (0.44787)
ok 693 - h cn: est (0.59479) = fast (0.59479)
ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1
ok 695 - q id: est (0.42564) = fast (0.42564)
ok 696 - q cn: est (0.61282) = fast (0.61282)
ok 697 - h id: est (0.43229) = fast (0.43229)
ok 698 - h cn: est (0.62240) = fast (0.62240)
ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1
ok 700 - q id: est (0.48358) = fast (0.48358)
ok 701 - q cn: est (0.63881) = fast (0.63881)
ok 702 - h id: est (0.48943) = fast (0.48943)
ok 703 - h cn: est (0.64653) = fast (0.64653)
ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1
ok 705 - q id: est (0.42308) = fast (0.42308)
ok 706 - q cn: est (0.61282) = fast (0.61282)
ok 707 - h id: est (0.42969) = fast (0.42969)
ok 708 - h cn: est (0.62240) = fast (0.62240)
ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1
ok 710 - q id: est (0.39675) = fast (0.39675)
ok 711 - q cn: est (0.58933) = fast (0.58933)
ok 712 - h id: est (0.39767) = fast (0.39767)
ok 713 - h cn: est (0.59070) = fast (0.59070)
ok 714 - dcr1_sp.WUBLASTP
ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1
ok 716 - q id: est (1.00000) = fast (1.00000)
ok 717 - q cn: est (1.00000) = fast (1.00000)
ok 718 - h id: est (1.00000) = fast (1.00000)
ok 719 - h cn: est (1.00000) = fast (1.00000)
ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4
ok 721 - q id: exact (0.36876) ~ est (0.36973)
ok 722 - q id: exact (0.36876) <= max (0.37070)
ok 723 - q cn: exact (0.55022) ~ est (0.55041)
ok 724 - q cn: exact (0.55022) <= max (0.55105)
ok 725 - h id: exact (0.35111) ~ est (0.35111)
ok 726 - h id: exact (0.35111) <= max (0.35111)
ok 727 - h cn: exact (0.52305) ~ est (0.52305)
ok 728 - h cn: exact (0.52305) <= max (0.52305)
ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1
ok 730 - q id: est (0.38685) = fast (0.38685)
ok 731 - q cn: est (0.55397) = fast (0.55397)
ok 732 - h id: est (0.37613) = fast (0.37613)
ok 733 - h cn: est (0.53863) = fast (0.53863)
ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1
ok 735 - q id: est (0.38247) = fast (0.38247)
ok 736 - q cn: est (0.55068) = fast (0.55068)
ok 737 - h id: est (0.37306) = fast (0.37306)
ok 738 - h cn: est (0.53715) = fast (0.53715)
ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5
ok 740 - q id: exact (0.35010) ~ est (0.35010)
ok 741 - q id: exact (0.35010) <= max (0.35010)
ok 742 - q cn: exact (0.53183) ~ est (0.53183)
ok 743 - q cn: exact (0.53183) <= max (0.53183)
ok 744 - h id: exact (0.35082) ~ est (0.35082)
ok 745 - h id: exact (0.35082) <= max (0.35082)
ok 746 - h cn: exact (0.53292) ~ est (0.53292)
ok 747 - h cn: exact (0.53292) <= max (0.53292)
ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8
ok 749 - q id: exact (0.30547) ~ est (0.30659)
ok 750 - q id: exact (0.30547) <= max (0.30623)
ok 751 - q cn: exact (0.50076) ~ est (0.50205)
ok 752 - q cn: exact (0.50076) <= max (0.50076)
ok 753 - h id: exact (0.31390) ~ est (0.31179)
ok 754 - h id: exact (0.31390) <= max (0.31795)
ok 755 - h cn: exact (0.50531) ~ est (0.50557)
ok 756 - h cn: exact (0.50531) <= max (0.51091)
ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7
ok 758 - q id: exact (0.30136) ~ est (0.30184)
ok 759 - q id: exact (0.30136) <= max (0.30498)
ok 760 - q cn: exact (0.48688) ~ est (0.48742)
ok 761 - q cn: exact (0.48688) <= max (0.49140)
ok 762 - h id: exact (0.30944) ~ est (0.31034)
ok 763 - h id: exact (0.30944) <= max (0.30988)
ok 764 - h cn: exact (0.50178) ~ est (0.50277)
ok 765 - h cn: exact (0.50178) <= max (0.50223)
ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10
ok 767 - q id: exact (0.28918) ~ est (0.28961)
ok 768 - q id: exact (0.28918) <= max (0.28955)
ok 769 - q cn: exact (0.46418) ~ est (0.46247)
ok 770 - q cn: exact (0.46418) <= max (0.46866)
ok 771 - h id: exact (0.30166) ~ est (0.30299)
ok 772 - h id: exact (0.30166) <= max (0.30800)
ok 773 - h cn: exact (0.48179) ~ est (0.48439)
ok 774 - h cn: exact (0.48179) <= max (0.48535)
ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8
ok 776 - q id: exact (0.30289) ~ est (0.30238)
ok 777 - q id: exact (0.30289) <= max (0.30651)
ok 778 - q cn: exact (0.49955) ~ est (0.49787)
ok 779 - q cn: exact (0.49955) <= max (0.50362)
ok 780 - h id: exact (0.31395) ~ est (0.31347)
ok 781 - h id: exact (0.31395) <= max (0.31721)
ok 782 - h cn: exact (0.51535) ~ est (0.51578)
ok 783 - h cn: exact (0.51535) <= max (0.51814)
ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5
ok 785 - q id: exact (0.29334) ~ est (0.29534)
ok 786 - q id: exact (0.29334) <= max (0.29810)
ok 787 - q cn: exact (0.46617) ~ est (0.46719)
ok 788 - q cn: exact (0.46617) <= max (0.47040)
ok 789 - h id: exact (0.31176) ~ est (0.31176)
ok 790 - h id: exact (0.31176) <= max (0.31176)
ok 791 - h cn: exact (0.49299) ~ est (0.49299)
ok 792 - h cn: exact (0.49299) <= max (0.49299)
ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7
ok 794 - q id: exact (0.30456) ~ est (0.30514)
ok 795 - q id: exact (0.30456) <= max (0.30650)
ok 796 - q cn: exact (0.48739) ~ est (0.48879)
ok 797 - q cn: exact (0.48739) <= max (0.49370)
ok 798 - h id: exact (0.32062) ~ est (0.31987)
ok 799 - h id: exact (0.32062) <= max (0.32932)
ok 800 - h cn: exact (0.51071) ~ est (0.51306)
ok 801 - h cn: exact (0.51071) <= max (0.52410)
ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8
ok 803 - q id: exact (0.29615) ~ est (0.29879)
ok 804 - q id: exact (0.29615) <= max (0.30009)
ok 805 - q cn: exact (0.47419) ~ est (0.47394)
ok 806 - q cn: exact (0.47419) <= max (0.48119)
ok 807 - h id: exact (0.31611) ~ est (0.31482)
ok 808 - h id: exact (0.31611) <= max (0.32227)
ok 809 - h cn: exact (0.49779) ~ est (0.49788)
ok 810 - h cn: exact (0.49779) <= max (0.50616)
ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8
ok 812 - q id: exact (0.30390) ~ est (0.30440)
ok 813 - q id: exact (0.30390) <= max (0.30701)
ok 814 - q cn: exact (0.45874) ~ est (0.45993)
ok 815 - q cn: exact (0.45874) <= max (0.45963)
ok 816 - h id: exact (0.32282) ~ est (0.32324)
ok 817 - h id: exact (0.32282) <= max (0.32560)
ok 818 - h cn: exact (0.48052) ~ est (0.48136)
ok 819 - h cn: exact (0.48052) <= max (0.48330)
ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6
ok 821 - q id: exact (0.29769) ~ est (0.29851)
ok 822 - q id: exact (0.29769) <= max (0.29769)
ok 823 - q cn: exact (0.48480) ~ est (0.48628)
ok 824 - q cn: exact (0.48480) <= max (0.48637)
ok 825 - h id: exact (0.30704) ~ est (0.30810)
ok 826 - h id: exact (0.30704) <= max (0.30917)
ok 827 - h cn: exact (0.50107) ~ est (0.50292)
ok 828 - h cn: exact (0.50107) <= max (0.50320)
ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6
ok 830 - q id: exact (0.27854) ~ est (0.27854)
ok 831 - q id: exact (0.27854) <= max (0.27854)
ok 832 - q cn: exact (0.48174) ~ est (0.48174)
ok 833 - q cn: exact (0.48174) <= max (0.48174)
ok 834 - h id: exact (0.28514) ~ est (0.28623)
ok 835 - h id: exact (0.28514) <= max (0.28594)
ok 836 - h cn: exact (0.49197) ~ est (0.49154)
ok 837 - h cn: exact (0.49197) <= max (0.49237)
ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8
ok 839 - q id: exact (0.30362) ~ est (0.30824)
ok 840 - q id: exact (0.30362) <= max (0.30852)
ok 841 - q cn: exact (0.47111) ~ est (0.47587)
ok 842 - q cn: exact (0.47111) <= max (0.47405)
ok 843 - h id: exact (0.32347) ~ est (0.32392)
ok 844 - h id: exact (0.32347) <= max (0.32643)
ok 845 - h cn: exact (0.49310) ~ est (0.49360)
ok 846 - h cn: exact (0.49310) <= max (0.49606)
ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4
ok 848 - q id: exact (0.29174) ~ est (0.29174)
ok 849 - q id: exact (0.29174) <= max (0.29174)
ok 850 - q cn: exact (0.46230) ~ est (0.46230)
ok 851 - q cn: exact (0.46230) <= max (0.46230)
ok 852 - h id: exact (0.30204) ~ est (0.30204)
ok 853 - h id: exact (0.30204) <= max (0.30204)
ok 854 - h cn: exact (0.47862) ~ est (0.47862)
ok 855 - h cn: exact (0.47862) <= max (0.47862)
ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6
ok 857 - q id: exact (0.29064) ~ est (0.29089)
ok 858 - q id: exact (0.29064) <= max (0.29115)
ok 859 - q cn: exact (0.48765) ~ est (0.48670)
ok 860 - q cn: exact (0.48765) <= max (0.48868)
ok 861 - h id: exact (0.29848) ~ est (0.29887)
ok 862 - h id: exact (0.29848) <= max (0.29902)
ok 863 - h cn: exact (0.50108) ~ est (0.50116)
ok 864 - h cn: exact (0.50108) <= max (0.50163)
ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5
ok 866 - q id: exact (0.29510) ~ est (0.29505)
ok 867 - q id: exact (0.29510) <= max (0.29510)
ok 868 - q cn: exact (0.48982) ~ est (0.49039)
ok 869 - q cn: exact (0.48982) <= max (0.49029)
ok 870 - h id: exact (0.30019) ~ est (0.30019)
ok 871 - h id: exact (0.30019) <= max (0.30019)
ok 872 - h cn: exact (0.49906) ~ est (0.49906)
ok 873 - h cn: exact (0.49906) <= max (0.49906)
ok 874 - 503384.MEGABLAST.2
ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5
ok 876 - q id: exact (0.91435) ~ est (0.91435)
ok 877 - q id: exact (0.91435) <= max (0.91435)
ok 878 - q cn: exact (0.91435) ~ est (0.91435)
ok 879 - q cn: exact (0.91435) <= max (0.91435)
ok 880 - h id: exact (0.91157) ~ est (0.91157)
ok 881 - h id: exact (0.91157) <= max (0.91157)
ok 882 - h cn: exact (0.91157) ~ est (0.91157)
ok 883 - h cn: exact (0.91157) <= max (0.91157)
ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9
ok 885 - q id: exact (0.92895) ~ est (0.92895)
ok 886 - q id: exact (0.92895) <= max (0.92895)
ok 887 - q cn: exact (0.92895) ~ est (0.92895)
ok 888 - q cn: exact (0.92895) <= max (0.92895)
ok 889 - h id: exact (0.92854) ~ est (0.92854)
ok 890 - h id: exact (0.92854) <= max (0.92854)
ok 891 - h cn: exact (0.92854) ~ est (0.92854)
ok 892 - h cn: exact (0.92854) <= max (0.92854)
ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3
ok 894 - q id: exact (0.93516) ~ est (0.93516)
ok 895 - q id: exact (0.93516) <= max (0.93516)
ok 896 - q cn: exact (0.93516) ~ est (0.93516)
ok 897 - q cn: exact (0.93516) <= max (0.93516)
ok 898 - h id: exact (0.93651) ~ est (0.93651)
ok 899 - h id: exact (0.93651) <= max (0.93651)
ok 900 - h cn: exact (0.93651) ~ est (0.93651)
ok 901 - h cn: exact (0.93651) <= max (0.93651)
ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3
ok 903 - q id: exact (0.93064) ~ est (0.93064)
ok 904 - q id: exact (0.93064) <= max (0.93064)
ok 905 - q cn: exact (0.93064) ~ est (0.93064)
ok 906 - q cn: exact (0.93064) <= max (0.93064)
ok 907 - h id: exact (0.92885) ~ est (0.92885)
ok 908 - h id: exact (0.92885) <= max (0.92885)
ok 909 - h cn: exact (0.92885) ~ est (0.92885)
ok 910 - h cn: exact (0.92885) <= max (0.92885)
ok 911 - bl2seq.blastx.out
ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6
ok 913 - q id: est (0.71429) = fast (0.71429)
ok 914 - q cn: est (1.00000) = fast (1.00000)
ok 915 - q id: exact (0.70536) ~ est (0.70495)
ok 916 - q id: exact (0.70536) <= max (0.94286)
ok 917 - q cn: exact (0.78810) ~ est (0.78803)
ok 918 - q cn: exact (0.78810) <= max (0.96429)
ok 919 - q id: est (0.35714) = fast (0.35714)
ok 920 - q cn: est (0.57143) = fast (0.57143)
ok 921 - h id: exact (0.61923) ~ est (0.61955)
ok 922 - h id: exact (0.61923) <= max (0.64231)
ok 923 - h cn: exact (0.73077) ~ est (0.73077)
ok 924 - h cn: exact (0.73077) <= max (0.75000)
ok 925 - dnaEbsub_ecoli.wublastx
ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1
ok 927 - q id: est (0.36386) = fast (0.36386)
ok 928 - q cn: est (0.53735) = fast (0.53735)
ok 929 - h id: est (0.36562) = fast (0.36562)
ok 930 - h cn: est (0.53995) = fast (0.53995)
ok 931 - tblastn.out
ok 932 - tile tblastn.out hit 1 \#hsps 2
ok 933 - q id: exact (0.31250) ~ est (0.33325)
ok 934 - q id: exact (0.31250) <= max (0.33333)
ok 935 - q cn: exact (0.44792) ~ est (0.47055)
ok 936 - q cn: exact (0.44792) <= max (0.45833)
ok 937 - h id: exact (0.33333) ~ est (0.33333)
ok 938 - h id: exact (0.33333) <= max (0.33333)
ok 939 - h cn: exact (0.47059) ~ est (0.47059)
ok 940 - h cn: exact (0.47059) <= max (0.47059)
ok 941 - tile tblastn.out hit 2 \#hsps 2
ok 942 - q id: exact (0.68750) ~ est (0.68750)
ok 943 - q id: exact (0.68750) <= max (0.68750)
ok 944 - q cn: exact (0.81250) ~ est (0.81250)
ok 945 - q cn: exact (0.81250) <= max (0.81250)
ok 946 - h id: est (0.66667) = fast (0.66667)
ok 947 - h cn: est (0.77778) = fast (0.77778)
ok 948 - h id: est (0.71429) = fast (0.71429)
ok 949 - h cn: est (0.85714) = fast (0.85714)
ok 950 - dnaEbsub_ecoli.wutblastn
ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1
ok 952 - q id: est (0.36386) = fast (0.36386)
ok 953 - q cn: est (0.53735) = fast (0.53735)
ok 954 - h id: est (0.36562) = fast (0.36562)
ok 955 - h cn: est (0.53995) = fast (0.53995)
ok 956 - HUMBETGLOA.tblastx
ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1
ok 958 - q id: est (0.42308) = fast (0.42308)
ok 959 - q cn: est (0.61538) = fast (0.61538)
ok 960 - h id: est (0.42308) = fast (0.42308)
ok 961 - h cn: est (0.61538) = fast (0.61538)
ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1
ok 963 - q id: est (0.47059) = fast (0.47059)
ok 964 - q cn: est (0.76471) = fast (0.76471)
ok 965 - h id: est (0.47059) = fast (0.47059)
ok 966 - h cn: est (0.76471) = fast (0.76471)
ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1
ok 968 - q id: est (0.36000) = fast (0.36000)
ok 969 - q cn: est (0.56000) = fast (0.56000)
ok 970 - h id: est (0.36000) = fast (0.36000)
ok 971 - h cn: est (0.56000) = fast (0.56000)
ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1
ok 973 - q id: est (0.29268) = fast (0.29268)
ok 974 - q cn: est (0.58537) = fast (0.58537)
ok 975 - h id: est (0.29268) = fast (0.29268)
ok 976 - h cn: est (0.58537) = fast (0.58537)
ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1
ok 978 - q id: est (0.38889) = fast (0.38889)
ok 979 - q cn: est (0.55556) = fast (0.55556)
ok 980 - h id: est (0.38889) = fast (0.38889)
ok 981 - h cn: est (0.55556) = fast (0.55556)
ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1
ok 983 - q id: est (0.43590) = fast (0.43590)
ok 984 - q cn: est (0.51282) = fast (0.51282)
ok 985 - h id: est (0.43590) = fast (0.43590)
ok 986 - h cn: est (0.51282) = fast (0.51282)
ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1
ok 988 - q id: est (0.35714) = fast (0.35714)
ok 989 - q cn: est (0.42857) = fast (0.42857)
ok 990 - h id: est (0.35714) = fast (0.35714)
ok 991 - h cn: est (0.42857) = fast (0.42857)
ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1
ok 993 - q id: est (0.33333) = fast (0.33333)
ok 994 - q cn: est (0.66667) = fast (0.66667)
ok 995 - h id: est (0.33333) = fast (0.33333)
ok 996 - h cn: est (0.66667) = fast (0.66667)
ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2
ok 998 - q id: exact (0.40541) ~ est (0.40541)
ok 999 - q id: exact (0.40541) <= max (0.40541)
ok 1000 - q cn: exact (0.56757) ~ est (0.56757)
ok 1001 - q cn: exact (0.56757) <= max (0.56757)
ok 1002 - h id: est (0.36364) = fast (0.36364)
ok 1003 - h cn: est (0.63636) = fast (0.63636)
ok 1004 - h id: est (0.42308) = fast (0.42308)
ok 1005 - h cn: est (0.53846) = fast (0.53846)
ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1
ok 1007 - q id: est (0.29167) = fast (0.29167)
ok 1008 - q cn: est (0.39583) = fast (0.39583)
ok 1009 - h id: est (0.29167) = fast (0.29167)
ok 1010 - h cn: est (0.39583) = fast (0.39583)
ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1
ok 1012 - q id: est (0.60000) = fast (0.60000)
ok 1013 - q cn: est (0.65000) = fast (0.65000)
ok 1014 - h id: est (0.60000) = fast (0.60000)
ok 1015 - h cn: est (0.65000) = fast (0.65000)
ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1
ok 1017 - q id: est (0.50000) = fast (0.50000)
ok 1018 - q cn: est (0.68182) = fast (0.68182)
ok 1019 - h id: est (0.50000) = fast (0.50000)
ok 1020 - h cn: est (0.68182) = fast (0.68182)
ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1
ok 1022 - q id: est (0.29630) = fast (0.29630)
ok 1023 - q cn: est (0.48148) = fast (0.48148)
ok 1024 - h id: est (0.29630) = fast (0.29630)
ok 1025 - h cn: est (0.48148) = fast (0.48148)
ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1
ok 1027 - q id: est (0.47826) = fast (0.47826)
ok 1028 - q cn: est (0.52174) = fast (0.52174)
ok 1029 - h id: est (0.47826) = fast (0.47826)
ok 1030 - h cn: est (0.52174) = fast (0.52174)
ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1
ok 1032 - q id: est (0.47368) = fast (0.47368)
ok 1033 - q cn: est (0.63158) = fast (0.63158)
ok 1034 - h id: est (0.47368) = fast (0.47368)
ok 1035 - h cn: est (0.63158) = fast (0.63158)
ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1
ok 1037 - q id: est (0.44444) = fast (0.44444)
ok 1038 - q cn: est (0.55556) = fast (0.55556)
ok 1039 - h id: est (0.44444) = fast (0.44444)
ok 1040 - h cn: est (0.55556) = fast (0.55556)
ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1
ok 1042 - q id: est (0.47059) = fast (0.47059)
ok 1043 - q cn: est (0.70588) = fast (0.70588)
ok 1044 - h id: est (0.47059) = fast (0.47059)
ok 1045 - h cn: est (0.70588) = fast (0.70588)
ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1
ok 1047 - q id: est (0.38889) = fast (0.38889)
ok 1048 - q cn: est (0.66667) = fast (0.66667)
ok 1049 - h id: est (0.38889) = fast (0.38889)
ok 1050 - h cn: est (0.66667) = fast (0.66667)
ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1
ok 1052 - q id: est (0.27660) = fast (0.27660)
ok 1053 - q cn: est (0.48936) = fast (0.48936)
ok 1054 - h id: est (0.27660) = fast (0.27660)
ok 1055 - h cn: est (0.48936) = fast (0.48936)
ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1
ok 1057 - q id: est (0.40000) = fast (0.40000)
ok 1058 - q cn: est (0.60000) = fast (0.60000)
ok 1059 - h id: est (0.40000) = fast (0.40000)
ok 1060 - h cn: est (0.60000) = fast (0.60000)
ok 1061 - dnaEbsub_ecoli.wutblastx
ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12
ok 1063 - q id: exact (0.40224) ~ est (0.40912)
ok 1064 - q id: exact (0.40224) <= max (0.42628)
ok 1065 - q cn: exact (0.58494) ~ est (0.58968)
ok 1066 - q cn: exact (0.58494) <= max (0.62179)
ok 1067 - q id: est (0.25352) = fast (0.25352)
ok 1068 - q cn: est (0.47887) = fast (0.47887)
ok 1069 - q id: est (0.37500) = fast (0.37500)
ok 1070 - q cn: est (0.62500) = fast (0.62500)
ok 1071 - q id: exact (0.44118) ~ est (0.44118)
ok 1072 - q id: exact (0.44118) <= max (0.44118)
ok 1073 - q cn: exact (0.54412) ~ est (0.54412)
ok 1074 - q cn: exact (0.54412) <= max (0.54412)
ok 1075 - h id: est (0.25352) = fast (0.25352)
ok 1076 - h cn: est (0.47887) = fast (0.47887)
ok 1077 - h id: exact (0.39848) ~ est (0.40304)
ok 1078 - h id: exact (0.39848) <= max (0.40355)
ok 1079 - h cn: exact (0.58376) ~ est (0.58889)
ok 1080 - h cn: exact (0.58376) <= max (0.58883)
ok 1081 - h id: exact (0.44118) ~ est (0.44118)
ok 1082 - h id: exact (0.44118) <= max (0.44118)
ok 1083 - h cn: exact (0.54412) ~ est (0.54412)
ok 1084 - h cn: exact (0.54412) <= max (0.54412)
ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2
ok 1086 - q id: exact (0.41818) ~ est (0.41818)
ok 1087 - q id: exact (0.41818) <= max (0.41818)
ok 1088 - q cn: exact (0.52727) ~ est (0.52727)
ok 1089 - q cn: exact (0.52727) <= max (0.52727)
ok 1090 - h id: est (0.53333) = fast (0.53333)
ok 1091 - h cn: est (0.66667) = fast (0.66667)
ok 1092 - h id: est (0.37500) = fast (0.37500)
ok 1093 - h cn: est (0.47500) = fast (0.47500)
ok 1094 - bug2942: query m0: range correct
ok 1095 - bug2942: query m1: range correct
ok 1096 - bug2942: query m2: range correct
ok 1097 - bug2942: subject all : range correct
ok 1098 - get_tiled_alns
ok 1099 - got all alns
ok 1100
ok 1101 - aln and qfeat lengths correspond
ok 1102 - q length correct
ok 1103
ok 1104 - features on q and s correspond
ok 1105 - aln and hfeat lengths correspond
ok 1106 - s length correct
ok 1107
ok 1108 - aln and qfeat lengths correspond
ok 1109 - q length correct
ok 1110
ok 1111 - features on q and s correspond
ok 1112 - aln and hfeat lengths correspond
ok 1113 - s length correct
ok 1114
ok 1115 - aln and qfeat lengths correspond
ok 1116 - q length correct
ok 1117
ok 1118 - features on q and s correspond
ok 1119 - aln and hfeat lengths correspond
ok 1120 - s length correct
ok 1121
ok 1122 - aln and qfeat lengths correspond
ok 1123 - q length correct
ok 1124
ok 1125 - features on q and s correspond
ok 1126 - aln and hfeat lengths correspond
ok 1127 - s length correct
ok 1128
ok 1129 - aln and qfeat lengths correspond
ok 1130 - q length correct
ok 1131
ok 1132 - features on q and s correspond
ok 1133 - aln and hfeat lengths correspond
ok 1134 - s length correct
ok 1135
ok 1136 - aln and qfeat lengths correspond
ok 1137 - q length correct
ok 1138
ok 1139 - features on q and s correspond
ok 1140 - aln and hfeat lengths correspond
ok 1141 - s length correct
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 193.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 193.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 193.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 193.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 193.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 193.
t/SearchIO/Writer/GbrowseGFF.t ............... 
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 353.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 353.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 353.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 353.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 353.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 353.
t/SearchIO/Writer/HSPTableWriter.t ........... 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HSPTableWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 353.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 353.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 353.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 353.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 353.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 353.
t/SearchIO/Writer/HTMLWriter.t ............... 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 353.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 353.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 353.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 353.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 353.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 353.
t/SearchIO/Writer/HitTableWriter.t ........... 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HitTableWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 353.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 353.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 353.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 353.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 353.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 353.
t/SearchIO/Writer/TextWriter.t ............... 
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::TextResultWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 7.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 7.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 7.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 7.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 7.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 7.
t/SearchIO/axt.t ............................. 
1..19
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 245.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 245.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 245.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 245.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 245.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 245.
t/SearchIO/blast.t ........................... 
1..1348
ok 1 - use Bio::SearchIO;
ok 2
ok 3 - database_name()
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
not ok 411 # TODO frac_identical & frac_conserved are still too wrong

#   Failed (TODO) test at t/SearchIO/blast.t line 584.
#     '0.852'
#         >
#     '0.9'
not ok 412 # TODO frac_identical & frac_conserved are still too wrong

#   Failed (TODO) test at t/SearchIO/blast.t line 585.
#     '1.599'
#         <=
#     '1'
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517
ok 518
ok 519
ok 520
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561
ok 562
ok 563
ok 564
ok 565
ok 566
ok 567
ok 568
ok 569
ok 570
ok 571
ok 572
ok 573
ok 574
ok 575
ok 576
ok 577
ok 578
ok 579
ok 580
ok 581
ok 582
ok 583
ok 584
ok 585
ok 586
ok 587
ok 588
ok 589
ok 590
ok 591
ok 592
ok 593 - Multiblast query test
ok 594
ok 595 - Multiblast query test
ok 596
ok 597 - Multiblast query test
ok 598
ok 599 - Multiblast query test
ok 600
ok 601
ok 602
ok 603
ok 604
ok 605
ok 606
ok 607
ok 608
ok 609
ok 610
ok 611
ok 612
ok 613
ok 614
ok 615
ok 616
ok 617
ok 618
ok 619
ok 620
ok 621
ok 622
ok 623
ok 624
ok 625
ok 626
ok 627
ok 628
ok 629
ok 630
ok 631
ok 632
ok 633
ok 634
ok 635
ok 636
ok 637
ok 638
ok 639
ok 640
ok 641
ok 642
ok 643
ok 644
ok 645
ok 646
ok 647
ok 648
ok 649
ok 650
ok 651
ok 652
ok 653
ok 654
ok 655
ok 656
ok 657
ok 658
ok 659
ok 660
ok 661
ok 662
ok 663
ok 664
ok 665
ok 666
ok 667
ok 668
ok 669
ok 670
ok 671
ok 672
ok 673
ok 674
ok 675
ok 676
ok 677
ok 678
ok 679
ok 680
ok 681
ok 682
ok 683
ok 684
ok 685
ok 686
ok 687
ok 688
ok 689
ok 690
ok 691
ok 692
ok 693
ok 694
ok 695
ok 696
ok 697
ok 698
ok 699
ok 700
ok 701
ok 702
ok 703
ok 704
ok 705
ok 706
ok 707
ok 708
ok 709
ok 710
ok 711
ok 712
ok 713
ok 714
ok 715
ok 716
ok 717
ok 718
ok 719
ok 720
ok 721
ok 722
ok 723
ok 724
ok 725
ok 726
ok 727
ok 728
ok 729
ok 730
ok 731
ok 732
ok 733
ok 734
ok 735
ok 736
ok 737
ok 738
ok 739
ok 740
ok 741
ok 742
ok 743
ok 744
ok 745
ok 746
ok 747
ok 748
ok 749
ok 750
ok 751
ok 752
ok 753
ok 754
ok 755
ok 756
ok 757
ok 758
ok 759
ok 760
ok 761
ok 762
ok 763
ok 764
ok 765
ok 766
ok 767
ok 768
ok 769
ok 770
ok 771
ok 772
ok 773
ok 774
ok 775
ok 776
ok 777
ok 778
ok 779
ok 780
ok 781
ok 782
ok 783
ok 784
ok 785
ok 786
ok 787
ok 788
ok 789
ok 790
ok 791
ok 792
ok 793
ok 794
ok 795
ok 796
ok 797
ok 798
ok 799
ok 800
ok 801
ok 802
ok 803
ok 804
ok 805
ok 806
ok 807
ok 808
ok 809
ok 810
ok 811
ok 812
ok 813
ok 814
ok 815
ok 816
ok 817
ok 818
ok 819
ok 820
ok 821
ok 822
ok 823
ok 824
ok 825
ok 826
ok 827
ok 828
ok 829
ok 830
ok 831
ok 832
ok 833
ok 834
ok 835
ok 836
ok 837
ok 838
ok 839
ok 840
ok 841
ok 842
ok 843
ok 844
ok 845
ok 846
ok 847
ok 848
ok 849
ok 850
ok 851
ok 852
ok 853
ok 854
ok 855
ok 856
ok 857
ok 858
ok 859
ok 860
ok 861
ok 862
ok 863
ok 864
ok 865
ok 866
ok 867
ok 868
ok 869
ok 870
ok 871
ok 872
ok 873
ok 874
ok 875
ok 876
ok 877
ok 878
ok 879 - The object isa Bio::Search::Result::ResultI
ok 880
ok 881
ok 882
ok 883
ok 884
ok 885
ok 886
ok 887
ok 888
ok 889
ok 890
ok 891
ok 892
ok 893
ok 894
ok 895
ok 896
ok 897
ok 898
ok 899 - The object isa Bio::Search::Result::ResultI
ok 900
ok 901
ok 902
ok 903
ok 904
ok 905
ok 906
ok 907
ok 908
ok 909
ok 910
ok 911
ok 912
ok 913
ok 914
ok 915
ok 916
ok 917
ok 918
ok 919
ok 920
ok 921
ok 922
ok 923 - The object isa Bio::Search::Result::ResultI
ok 924
ok 925
ok 926
ok 927
ok 928
ok 929
ok 930
ok 931
ok 932
ok 933
ok 934
ok 935
ok 936
ok 937
ok 938
ok 939
ok 940
ok 941
ok 942
ok 943
ok 944
ok 945
ok 946
ok 947 - The object isa Bio::Search::Result::ResultI
ok 948
ok 949
ok 950
ok 951
ok 952
ok 953
ok 954
ok 955
ok 956
ok 957
ok 958
ok 959
ok 960
ok 961
ok 962
ok 963
ok 964
ok 965
ok 966
ok 967
ok 968
ok 969
ok 970
ok 971
ok 972 - The object isa Bio::Search::Result::ResultI
ok 973
ok 974
ok 975
ok 976
ok 977
ok 978
ok 979
ok 980
ok 981
ok 982
ok 983
ok 984
ok 985
ok 986
ok 987
ok 988
ok 989
ok 990
ok 991
ok 992
ok 993
ok 994
ok 995
ok 996
ok 997
ok 998
ok 999
ok 1000 - The object isa Bio::Search::Result::ResultI
ok 1001
ok 1002
ok 1003
ok 1004
ok 1005
ok 1006
ok 1007
ok 1008
ok 1009
ok 1010
ok 1011
ok 1012
ok 1013
ok 1014
ok 1015
ok 1016
ok 1017
ok 1018
ok 1019
ok 1020
ok 1021
ok 1022
ok 1023
ok 1024
ok 1025
ok 1026
ok 1027
ok 1028
ok 1029 - The object isa Bio::Search::Result::ResultI
ok 1030
ok 1031
ok 1032
ok 1033
ok 1034
ok 1035
ok 1036
ok 1037
ok 1038
ok 1039
ok 1040
ok 1041
ok 1042
ok 1043
ok 1044
ok 1045
ok 1046
ok 1047
ok 1048 - blastxml for f.blastxml
ok 1049 - fasta for f.fy
ok 1050 - exonerate for f.exonerate
ok 1051 - blast for f.tblx
ok 1052 - fasta for f.fx
ok 1053 - fasta for f.osearch
ok 1054 - blast for filename.bls
ok 1055 - exonerate for f.exon
ok 1056 - fasta for f.SSEARCH.m9
ok 1057 - blast for filename.blast
ok 1058 - fasta for f.m9
ok 1059 - blast for f.blx
ok 1060 - blastxml for f.xml
ok 1061 - fasta for f.fasta
ok 1062 - fasta for f.fa
ok 1063 - blast for fast.bls
ok 1064 - fasta for f.ssearch
ok 1065 - fasta for f.psearch
ok 1066
ok 1067
ok 1068
ok 1069
ok 1070
ok 1071
ok 1072
ok 1073
ok 1074
ok 1075
ok 1076
ok 1077
ok 1078
ok 1079
ok 1080
ok 1081 - full hit name
ok 1082 - hit accession
ok 1083
ok 1084
ok 1085 - query start
ok 1086 - query start
ok 1087
ok 1088
ok 1089
ok 1090
ok 1091
ok 1092
ok 1093
ok 1094
ok 1095
ok 1096
ok 1097
ok 1098
ok 1099
ok 1100
ok 1101
ok 1102
ok 1103
ok 1104
ok 1105
ok 1106
ok 1107
ok 1108
ok 1109
ok 1110
ok 1111
ok 1112
ok 1113
ok 1114
ok 1115
ok 1116
ok 1117
ok 1118
ok 1119
ok 1120
ok 1121
ok 1122
ok 1123
ok 1124
ok 1125
ok 1126
ok 1127
ok 1128
ok 1129
ok 1130
ok 1131
ok 1132
ok 1133
ok 1134
ok 1135
ok 1136
ok 1137
ok 1138
ok 1139
ok 1140
ok 1141
ok 1142
ok 1143
ok 1144
ok 1145
ok 1146
ok 1147
ok 1148
ok 1149
ok 1150
ok 1151
ok 1152
ok 1153
ok 1154
ok 1155
ok 1156
ok 1157
ok 1158
ok 1159
ok 1160
ok 1161
ok 1162
ok 1163
ok 1164
ok 1165
ok 1166
ok 1167
ok 1168
ok 1169
ok 1170
ok 1171
ok 1172
ok 1173
ok 1174
ok 1175
ok 1176
ok 1177
ok 1178
ok 1179
ok 1180
ok 1181
ok 1182
ok 1183
ok 1184
ok 1185
ok 1186
ok 1187
ok 1188
ok 1189
ok 1190
ok 1191
ok 1192
ok 1193
ok 1194
ok 1195
ok 1196
ok 1197
ok 1198
ok 1199
ok 1200
ok 1201
ok 1202
ok 1203
ok 1204
ok 1205
ok 1206
ok 1207
ok 1208
ok 1209
ok 1210
ok 1211
ok 1212
ok 1213
ok 1214
ok 1215
ok 1216
ok 1217
ok 1218
ok 1219
ok 1220
ok 1221
ok 1222
ok 1223
ok 1224
ok 1225
ok 1226
ok 1227
ok 1228
ok 1229
ok 1230
ok 1231
ok 1232
ok 1233
ok 1234
ok 1235
ok 1236
ok 1237
ok 1238
ok 1239
ok 1240
ok 1241
ok 1242
ok 1243
ok 1244
ok 1245
ok 1246
ok 1247
ok 1248
ok 1249
ok 1250
ok 1251
ok 1252
ok 1253
ok 1254
ok 1255
ok 1256
ok 1257
ok 1258
ok 1259
ok 1260
ok 1261
ok 1262
ok 1263
ok 1264
ok 1265
ok 1266
ok 1267
ok 1268
ok 1269
ok 1270
ok 1271
ok 1272
ok 1273
ok 1274
ok 1275
ok 1276
ok 1277
ok 1278
ok 1279
ok 1280
ok 1281
ok 1282
ok 1283
ok 1284
ok 1285
ok 1286
ok 1287
ok 1288
ok 1289
ok 1290
ok 1291
ok 1292
ok 1293
ok 1294
ok 1295
ok 1296
ok 1297
ok 1298
ok 1299
ok 1300
ok 1301
ok 1302
ok 1303
ok 1304
ok 1305
ok 1306
ok 1307
ok 1308
ok 1309
ok 1310
ok 1311
ok 1312
ok 1313
ok 1314
ok 1315
ok 1316
ok 1317
ok 1318
ok 1319
ok 1320
ok 1321
ok 1322
ok 1323
ok 1324
ok 1325
ok 1326
ok 1327
ok 1328
ok 1329
ok 1330
ok 1331
ok 1332
ok 1333
ok 1334
ok 1335
ok 1336
ok 1337
ok 1338
ok 1339
ok 1340
ok 1341
ok 1342
ok 1343
ok 1344
ok 1345
ok 1346
ok 1347
ok 1348
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 46.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 46.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 46.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 46.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 46.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 46.
t/SearchIO/blast_pull.t ...................... 
1..289
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - database_name()
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
not ok 191 # TODO frac_identical failing!

#   Failed (TODO) test at t/SearchIO/blast_pull.t line 260.
#          got: '0.946'
#     expected: '0.943'
ok 192
ok 193
ok 194
ok 195
ok 196 - Multiblast query test
ok 197 - Multiblast query test
ok 198 - Multiblast query test
ok 199 - Multiblast query test
ok 200
ok 201
ok 202
ok 203 - full hit name
ok 204 - hit accession
ok 205
ok 206 - query start
ok 207 - query start
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio/Search/Hit/GenericHit.pm line 127.
Subroutine add_hsp redefined at Bio/Search/Hit/GenericHit.pm line 204.
Subroutine hsp_factory redefined at Bio/Search/Hit/GenericHit.pm line 228.
Subroutine name redefined at Bio/Search/Hit/GenericHit.pm line 248.
Subroutine accession redefined at Bio/Search/Hit/GenericHit.pm line 268.
Subroutine description redefined at Bio/Search/Hit/GenericHit.pm line 288.
Subroutine length redefined at Bio/Search/Hit/GenericHit.pm line 308.
Subroutine algorithm redefined at Bio/Search/Hit/GenericHit.pm line 333.
Subroutine raw_score redefined at Bio/Search/Hit/GenericHit.pm line 355.
Subroutine score redefined at Bio/Search/Hit/GenericHit.pm line 385.
Subroutine significance redefined at Bio/Search/Hit/GenericHit.pm line 400.
Subroutine bits redefined at Bio/Search/Hit/GenericHit.pm line 430.
Subroutine next_hsp redefined at Bio/Search/Hit/GenericHit.pm line 458.
Subroutine hsps redefined at Bio/Search/Hit/GenericHit.pm line 494.
Subroutine num_hsps redefined at Bio/Search/Hit/GenericHit.pm line 517.
Subroutine rewind redefined at Bio/Search/Hit/GenericHit.pm line 538.
Subroutine ambiguous_aln redefined at Bio/Search/Hit/GenericHit.pm line 564.
Subroutine overlap redefined at Bio/Search/Hit/GenericHit.pm line 576.
Subroutine n redefined at Bio/Search/Hit/GenericHit.pm line 605.
Subroutine p redefined at Bio/Search/Hit/GenericHit.pm line 652.
Subroutine hsp redefined at Bio/Search/Hit/GenericHit.pm line 694.
Subroutine logical_length redefined at Bio/Search/Hit/GenericHit.pm line 740.
Subroutine length_aln redefined at Bio/Search/Hit/GenericHit.pm line 786.
Subroutine gaps redefined at Bio/Search/Hit/GenericHit.pm line 849.
Subroutine matches redefined at Bio/Search/Hit/GenericHit.pm line 887.
Subroutine start redefined at Bio/Search/Hit/GenericHit.pm line 948.
Subroutine end redefined at Bio/Search/Hit/GenericHit.pm line 1025.
Subroutine range redefined at Bio/Search/Hit/GenericHit.pm line 1093.
Subroutine frac_identical redefined at Bio/Search/Hit/GenericHit.pm line 1150.
Subroutine frac_conserved redefined at Bio/Search/Hit/GenericHit.pm line 1226.
Subroutine frac_aligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1274.
Subroutine frac_aligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1310.
Subroutine num_unaligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1364.
Subroutine num_unaligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1400.
Subroutine seq_inds redefined at Bio/Search/Hit/GenericHit.pm line 1442.
Subroutine strand redefined at Bio/Search/Hit/GenericHit.pm line 1473.
Subroutine frame redefined at Bio/Search/Hit/GenericHit.pm line 1535.
Subroutine rank redefined at Bio/Search/Hit/GenericHit.pm line 1574.
Subroutine locus redefined at Bio/Search/Hit/GenericHit.pm line 1590.
Subroutine each_accession_number redefined at Bio/Search/Hit/GenericHit.pm line 1618.
Subroutine tiled_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1666.
Subroutine query_length redefined at Bio/Search/Hit/GenericHit.pm line 1683.
Subroutine ncbi_gi redefined at Bio/Search/Hit/GenericHit.pm line 1701.
Subroutine sort_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1732.
Subroutine iteration redefined at Bio/Search/Hit/GenericHit.pm line 1772.
Subroutine found_again redefined at Bio/Search/Hit/GenericHit.pm line 1807.
Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1333.
Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1341.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 420.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 420.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 420.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 420.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 420.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 420.
t/SearchIO/blasttable.t ...................... 
1..165
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::Search::SearchUtils;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6 - hit1_bits
ok 7 - hit1_name
ok 8 - hsp1_bits
ok 9 - hsp1_gaps
ok 10 - hsp1_he
ok 11 - hsp1_hs
ok 12 - hsp1_hstr
ok 13 - hsp1_qe
ok 14 - hsp1_qs
ok 15 - hsp1_qstr
ok 16 - hsp2_bits
ok 17 - hsp2_gaps
ok 18 - hsp2_he
ok 19 - hsp2_hs
ok 20 - hsp2_hstr
ok 21 - hsp2_qe
ok 22 - hsp2_qs
ok 23 - hsp2_qstr
ok 24 - hsp3_bits
ok 25 - hsp3_gaps
ok 26 - hsp3_he
ok 27 - hsp3_hs
ok 28 - hsp3_hstr
ok 29 - hsp3_qe
ok 30 - hsp3_qs
ok 31 - hsp3_qstr
ok 32 - hsp4_bits
ok 33 - hsp4_gaps
ok 34 - hsp4_he
ok 35 - hsp4_hs
ok 36 - hsp4_hstr
ok 37 - hsp4_qe
ok 38 - hsp4_qs
ok 39 - hsp4_qstr
ok 40 - hsp5_bits
ok 41 - hsp5_gaps
ok 42 - hsp5_he
ok 43 - hsp5_hs
ok 44 - hsp5_hstr
ok 45 - hsp5_qe
ok 46 - hsp5_qs
ok 47 - hsp5_qstr
ok 48 - hsp6_bits
ok 49 - hsp6_gaps
ok 50 - hsp6_he
ok 51 - hsp6_hs
ok 52 - hsp6_hstr
ok 53 - hsp6_qe
ok 54 - hsp6_qs
ok 55 - hsp6_qstr
ok 56 - hsp7_bits
ok 57 - hsp7_gaps
ok 58 - hsp7_he
ok 59 - hsp7_hs
ok 60 - hsp7_hstr
ok 61 - hsp7_qe
ok 62 - hsp7_qs
ok 63 - hsp7_qstr
ok 64 - hsp8_bits
ok 65 - hsp8_gaps
ok 66 - hsp8_he
ok 67 - hsp8_hs
ok 68 - hsp8_hstr
ok 69 - hsp8_qe
ok 70 - hsp8_qs
ok 71 - hsp8_qstr
ok 72 - query_name
ok 73 - The object isa Bio::Search::Result::ResultI
ok 74
ok 75
ok 76 - hit1_bits
ok 77 - hit1_name
ok 78 - hsp1_bits
ok 79 - hsp1_gaps
ok 80 - hsp1_he
ok 81 - hsp1_hs
ok 82 - hsp1_hstr
ok 83 - hsp1_qe
ok 84 - hsp1_qs
ok 85 - hsp1_qstr
ok 86 - hsp2_bits
ok 87 - hsp2_gaps
ok 88 - hsp2_he
ok 89 - hsp2_hs
ok 90 - hsp2_hstr
ok 91 - hsp2_qe
ok 92 - hsp2_qs
ok 93 - hsp2_qstr
ok 94 - hsp3_bits
ok 95 - hsp3_gaps
ok 96 - hsp3_he
ok 97 - hsp3_hs
ok 98 - hsp3_hstr
ok 99 - hsp3_qe
ok 100 - hsp3_qs
ok 101 - hsp3_qstr
ok 102 - hsp4_bits
ok 103 - hsp4_gaps
ok 104 - hsp4_he
ok 105 - hsp4_hs
ok 106 - hsp4_hstr
ok 107 - hsp4_qe
ok 108 - hsp4_qs
ok 109 - hsp4_qstr
ok 110 - hsp5_bits
ok 111 - hsp5_gaps
ok 112 - hsp5_he
ok 113 - hsp5_hs
ok 114 - hsp5_hstr
ok 115 - hsp5_qe
ok 116 - hsp5_qs
ok 117 - hsp5_qstr
ok 118 - hsp6_bits
ok 119 - hsp6_gaps
ok 120 - hsp6_he
ok 121 - hsp6_hs
ok 122 - hsp6_hstr
ok 123 - hsp6_qe
ok 124 - hsp6_qs
ok 125 - hsp6_qstr
ok 126 - hsp7_bits
ok 127 - hsp7_gaps
ok 128 - hsp7_he
ok 129 - hsp7_hs
ok 130 - hsp7_hstr
ok 131 - hsp7_qe
ok 132 - hsp7_qs
ok 133 - hsp7_qstr
ok 134 - hsp8_bits
ok 135 - hsp8_gaps
ok 136 - hsp8_he
ok 137 - hsp8_hs
ok 138 - hsp8_hstr
ok 139 - hsp8_qe
ok 140 - hsp8_qs
ok 141 - hsp8_qstr
ok 142 - query_name
ok 143
ok 144
ok 145
ok 146
ok 147 - hit score
ok 148 - hit raw_score
ok 149 - The object isa Bio::SeqFeatureI
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158 - The object isa Bio::SeqFeatureI
ok 159
ok 160
ok 161
ok 162 - The object isa Bio::SeqFeatureI
ok 163
ok 164
ok 165
ok
Subroutine start_document redefined at Bio\SearchIO\XML\BlastHandler.pm line 186.
Subroutine end_document redefined at Bio\SearchIO\XML\BlastHandler.pm line 203.
Subroutine start_element redefined at Bio\SearchIO\XML\BlastHandler.pm line 223.
Subroutine end_element redefined at Bio\SearchIO\XML\BlastHandler.pm line 246.
Subroutine characters redefined at Bio\SearchIO\XML\BlastHandler.pm line 303.
Subroutine eventHandler redefined at Bio\SearchIO\XML\BlastHandler.pm line 309.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190.
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175, <GEN107> line 617.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264, <GEN107> line 617.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284, <GEN107> line 617.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311, <GEN107> line 617.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337, <GEN107> line 617.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357, <GEN107> line 617.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378, <GEN107> line 617.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399, <GEN107> line 617.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420, <GEN107> line 617.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442, <GEN107> line 617.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465, <GEN107> line 617.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487, <GEN107> line 617.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508, <GEN107> line 617.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523, <GEN107> line 617.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540, <GEN107> line 617.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555, <GEN107> line 617.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574, <GEN107> line 617.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599, <GEN107> line 617.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616, <GEN107> line 617.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629, <GEN107> line 617.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646, <GEN107> line 617.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663, <GEN107> line 617.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680, <GEN107> line 617.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700, <GEN107> line 617.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728, <GEN107> line 617.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747, <GEN107> line 617.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763, <GEN107> line 617.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777, <GEN107> line 617.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794, <GEN107> line 617.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815, <GEN107> line 617.
t/SearchIO/blastxml.t ........................ 
1..391
ok 1 - use Bio::SearchIO;
ok 2
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4 - database_name()
ok 5 - query_name()
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - database_name()
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60 - query name on HSP
ok 61 - query desc on HSP
ok 62 - hitname
ok 63 - hitdesc
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90 - The object isa Bio::Search::Hit::HitI
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168 - query name on HSP
ok 169 - query desc on HSP
ok 170 - hitname
ok 171 - hitdesc
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214 - query name on HSP
ok 215 - query desc on HSP
ok 216 - hitname
ok 217 - hitdesc
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok
Subroutine new redefined at Bio\Search\HSP\GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio\Search\HSP\GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio\Search\HSP\GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio\Search\HSP\GenericHSP.pm line 263.
Subroutine evalue redefined at Bio\Search\HSP\GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio\Search\HSP\GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 350.
Subroutine gaps redefined at Bio\Search\HSP\GenericHSP.pm line 383.
Subroutine query_string redefined at Bio\Search\HSP\GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio\Search\HSP\GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio\Search\HSP\GenericHSP.pm line 463.
Subroutine length redefined at Bio\Search\HSP\GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio\Search\HSP\GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio\Search\HSP\GenericHSP.pm line 538.
Subroutine frame redefined at Bio\Search\HSP\GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio\Search\HSP\GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio\Search\HSP\GenericHSP.pm line 703.
Subroutine rank redefined at Bio\Search\HSP\GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 873.
Subroutine query redefined at Bio\Search\HSP\GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio\Search\HSP\GenericHSP.pm line 905.
Subroutine hit redefined at Bio\Search\HSP\GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio\Search\HSP\GenericHSP.pm line 936.
Subroutine significance redefined at Bio\Search\HSP\GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio\Search\HSP\GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio\Search\HSP\GenericHSP.pm line 1176.
Subroutine n redefined at Bio\Search\HSP\GenericHSP.pm line 1197.
Subroutine range redefined at Bio\Search\HSP\GenericHSP.pm line 1210.
Subroutine links redefined at Bio\Search\HSP\GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio\Search\HSP\GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio\Search\HSP\GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio\Search\HSP\GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio\Search\HSP\GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio\Search\HSP\GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio\Search\HSP\GenericHSP.pm line 1690.
Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 127.
Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 204.
Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 228.
Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 248.
Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 268.
Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 288.
Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 308.
Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 333.
Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 355.
Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 385.
Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 400.
Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 430.
Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 458.
Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 494.
Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 517.
Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 538.
Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 564.
Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 576.
Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 605.
Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 652.
Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 694.
Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 740.
Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 786.
Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 849.
Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 887.
Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 948.
Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1025.
Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1093.
Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1150.
Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1226.
Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1274.
Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1310.
Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1364.
Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1400.
Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1442.
Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1473.
Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1535.
Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1574.
Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1590.
Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1618.
Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1666.
Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1683.
Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1701.
Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1732.
Subroutine iteration redefined at Bio\Search\Hit\GenericHit.pm line 1772.
Subroutine found_again redefined at Bio\Search\Hit\GenericHit.pm line 1807.
Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1333.
Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1341.
Subroutine new redefined at Bio\Search\Result\GenericResult.pm line 175.
Subroutine algorithm redefined at Bio\Search\Result\GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio\Search\Result\GenericResult.pm line 284.
Subroutine next_hit redefined at Bio\Search\Result\GenericResult.pm line 311.
Subroutine query_name redefined at Bio\Search\Result\GenericResult.pm line 337.
Subroutine query_accession redefined at Bio\Search\Result\GenericResult.pm line 357.
Subroutine query_gi redefined at Bio\Search\Result\GenericResult.pm line 378.
Subroutine query_length redefined at Bio\Search\Result\GenericResult.pm line 399.
Subroutine query_description redefined at Bio\Search\Result\GenericResult.pm line 420.
Subroutine database_name redefined at Bio\Search\Result\GenericResult.pm line 442.
Subroutine database_letters redefined at Bio\Search\Result\GenericResult.pm line 465.
Subroutine database_entries redefined at Bio\Search\Result\GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio\Search\Result\GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio\Search\Result\GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio\Search\Result\GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio\Search\Result\GenericResult.pm line 555.
Subroutine add_hit redefined at Bio\Search\Result\GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio\Search\Result\GenericResult.pm line 599.
Subroutine rewind redefined at Bio\Search\Result\GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio\Search\Result\GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio\Search\Result\GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio\Search\Result\GenericResult.pm line 663.
Subroutine num_hits redefined at Bio\Search\Result\GenericResult.pm line 680.
Subroutine hits redefined at Bio\Search\Result\GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio\Search\Result\GenericResult.pm line 728.
Subroutine program_reference redefined at Bio\Search\Result\GenericResult.pm line 747.
Subroutine rid redefined at Bio\Search\Result\GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio\Search\Result\GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio\Search\Result\GenericResult.pm line 794.
Subroutine to_string redefined at Bio\Search\Result\GenericResult.pm line 815.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 41.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 41.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 41.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 41.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 41.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 41.
t/SearchIO/cross_match.t ..................... 
1..15
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 28.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 28.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 28.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 28.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 28.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 28.
t/SearchIO/erpin.t ........................... 
1..91
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::Search::Result::ResultI
ok 3 - Result ERPIN
ok 4 - Result ERPIN reference
ok 5 - Result ERPIN version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_name
ok 16 - The object isa Bio::Search::Hit::HitI
ok 17 - Hit accession
ok 18 - Hit GI
ok 19 - Hit algorithm
ok 20 - Hit bits
ok 21 - Hit description
ok 22 - Hit length
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit overlap
ok 28 - Hit query_length
ok 29 - Hit rank
ok 30 - Hit raw_score
ok 31 - Hit score
ok 32
ok 33 - The object isa Bio::Search::HSP::HSPI
ok 34 - HSP algorithm
ok 35
ok 36 - The object isa Bio::SeqFeature::Similarity
ok 37 - The object isa Bio::SeqFeature::Similarity
ok 38 - HSP frame
ok 39 - HSP gaps
ok 40 - HSP hit isa Bio::SeqFeature::Similarity
ok 41 - HSP hit_string
ok 42 - HSP homology_string
ok 43 - HSP hsp_group
ok 44 - HSP hsp_length
ok 45 - HSP length
ok 46 - HSP links
ok 47 - HSP query isa Bio::SeqFeature::Similarity
ok 48 - HSP query_string
ok 49 - HSP range
ok 50 - HSP rank
ok 51
ok 52 - HSP expect
ok 53 - The object isa Bio::LocatableSeq
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58
ok 59
ok 60 - HSP strand
ok 61
ok 62
ok 63 - ERPIN get_aln warning
ok 64 - The object isa Bio::Search::HSP::HSPI
ok 65 - HSP algorithm
ok 66
ok 67 - The object isa Bio::SeqFeature::Similarity
ok 68 - The object isa Bio::SeqFeature::Similarity
ok 69 - HSP frame
ok 70 - HSP gaps
ok 71 - HSP hit isa Bio::SeqFeature::Similarity
ok 72 - HSP hit_string
ok 73 - HSP homology_string
ok 74 - HSP query_string
ok 75 - HSP hsp_group
ok 76 - HSP hsp_length
ok 77 - HSP length
ok 78 - HSP links
ok 79 - The object isa Bio::SeqFeature::Similarity
ok 80 - HSP range
ok 81 - HSP rank
ok 82
ok 83 - HSP end
ok 84 - HSP expect
ok 85 - The object isa Bio::LocatableSeq
ok 86 - HSP seq_str
ok 87 - HSP start
ok 88 - HSP custom_score
ok 89
ok 90
ok 91 - HSP strand
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 42.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 42.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 42.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 42.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 42.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 42.
t/SearchIO/exonerate.t ....................... 
1..51
ok 1 - use Bio::SearchIO;
ok 2
ok 3 # skip no query length available in default output
ok 4
ok 5 # skip no hit length available in default output
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 # skip no query length available in default output
ok 26
ok 27 # skip no hit length available in default output
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - query_name
ok 47
ok 48 - query_name
ok 49
ok 50 - query_name
ok 51
ok
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 2549.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 2549.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 2549.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 2549.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 2549.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 2549.
t/SearchIO/fasta.t ........................... 
1..299
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267 - TFASTXY
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286 - num_identical()
ok 287 - num_conserved()
ok 288 - bug 2937 and FASTA version 3.5
ok 289 - algorithm version
ok 290 - query name
ok 291 - query description
ok 292 - query length
ok 293 - algorithm
ok 294 - num_identical()
ok 295 - num_conserved()
ok 296 - hsp->strand(hit)
ok 297 - hsp->hit->strand
ok 298 - hsp->strand(query)
ok 299 - hsp->query->strand
ok
Subroutine new redefined at Bio\Search\HSP\GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio\Search\HSP\GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio\Search\HSP\GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio\Search\HSP\GenericHSP.pm line 263.
Subroutine evalue redefined at Bio\Search\HSP\GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio\Search\HSP\GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 350.
Subroutine gaps redefined at Bio\Search\HSP\GenericHSP.pm line 383.
Subroutine query_string redefined at Bio\Search\HSP\GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio\Search\HSP\GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio\Search\HSP\GenericHSP.pm line 463.
Subroutine length redefined at Bio\Search\HSP\GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio\Search\HSP\GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio\Search\HSP\GenericHSP.pm line 538.
Subroutine frame redefined at Bio\Search\HSP\GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio\Search\HSP\GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio\Search\HSP\GenericHSP.pm line 703.
Subroutine rank redefined at Bio\Search\HSP\GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 873.
Subroutine query redefined at Bio\Search\HSP\GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio\Search\HSP\GenericHSP.pm line 905.
Subroutine hit redefined at Bio\Search\HSP\GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio\Search\HSP\GenericHSP.pm line 936.
Subroutine significance redefined at Bio\Search\HSP\GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio\Search\HSP\GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio\Search\HSP\GenericHSP.pm line 1176.
Subroutine n redefined at Bio\Search\HSP\GenericHSP.pm line 1197.
Subroutine range redefined at Bio\Search\HSP\GenericHSP.pm line 1210.
Subroutine links redefined at Bio\Search\HSP\GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio\Search\HSP\GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio\Search\HSP\GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio\Search\HSP\GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio\Search\HSP\GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio\Search\HSP\GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio\Search\HSP\GenericHSP.pm line 1690.
Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 127.
Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 204.
Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 228.
Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 248.
Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 268.
Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 288.
Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 308.
Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 333.
Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 355.
Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 385.
Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 400.
Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 430.
Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 458.
Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 494.
Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 517.
Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 538.
Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 564.
Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 576.
Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 605.
Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 652.
Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 694.
Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 740.
Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 786.
Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 849.
Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 887.
Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 948.
Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1025.
Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1093.
Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1150.
Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1226.
Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1274.
Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1310.
Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1364.
Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1400.
Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1442.
Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1473.
Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1535.
Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1574.
Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1590.
Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1618.
Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1666.
Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1683.
Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1701.
Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1732.
Subroutine iteration redefined at Bio\Search\Hit\GenericHit.pm line 1772.
Subroutine found_again redefined at Bio\Search\Hit\GenericHit.pm line 1807.
Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1333.
Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1341.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 313.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 313.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 313.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 313.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 313.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 313.
t/SearchIO/gmap_f9.t ......................... 
1..54
ok 1 - use Bio::SearchIO;
ok 2 - Did we get a Result? isa Bio::Search::Result::GenericResult
ok 3 - Did we get the expected number of hits?
ok 4 - Did we get the expected algorithm?
ok 5 - Did we get the expected query_name?
ok 6 - Did we get a Hit? isa Bio::Search::Hit::GenericHit
ok 7 - The object isa Bio::Search::Hit::HitI
ok 8 - Check the name
ok 9 - Check the hit length
ok 10 - Check the number of hsps
ok 11 - Check the query length
ok 12 - The object isa Bio::Search::HSP::HSPI
ok 13 - Check the algorithm
ok 14 - Count gaps in the query
ok 15 - Count gaps in the hit
ok 16 - Length of the query
ok 17 - Length of the hit
ok 18 - Query sequence
ok 19 - Hit sequence
ok 20 - Check query start
ok 21 - Check query end
ok 22 - Check query end
ok 23 - Check the homology string
ok 24 - Check seq_inds
ok 25 - Check hit start
ok 26 - Check hit end
ok 27 - Check hit end
ok 28 - Did we get a Result? isa Bio::Search::Result::GenericResult
ok 29 - Did we get the expected number of hits?
ok 30 - Did we get the expected algorithm?
ok 31 - Did we get the expected query_name?
ok 32 - The object isa Bio::Search::Hit::HitI
ok 33 - Check the name
ok 34 - Check the hit length
ok 35 - Check the number of hsps
ok 36 - Check the query length
ok 37 - The object isa Bio::Search::HSP::HSPI
ok 38 - Check the algorithm
ok 39 - Count gaps in the query
ok 40 - Count gaps in the hit
ok 41 - Length of the query
ok 42 - Length of the hit
ok 43 - Query sequence
ok 44 - Hit sequence
ok 45 - Check query start
ok 46 - Check query end
ok 47 - Check query end
ok 48 - Check the homology string
ok 49 - Check seq_inds
ok 50 - Check hit start
ok 51 - Check hit end
ok 52 - Check hit end
ok 53 - Can we loop over multiple results properly (expecting 58)?
ok 54 - simple query_name now caught, bug 3021
ok
Subroutine new redefined at Bio/SearchIO/hmmer.pm line 90.
Subroutine _initialize redefined at Bio/SearchIO/hmmer.pm line 142.
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN2> line 41.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN2> line 41.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN2> line 41.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN2> line 41.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN2> line 41.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN2> line 41.
t/SearchIO/hmmer.t ........................... 
1..295
ok 1 - use Bio::SearchIO;
ok 2 - Check for the correct result reference type
ok 3 - Check algorithm
ok 4 - Check algorithm version
ok 5 - Check hmm_name
ok 6 - Check sequence_file
ok 7 - Check query_name
ok 8 - Check query_description
ok 9 - Check num_hits
ok 10 - Check hit name
ok 11 - Check hit raw_score
ok 12 - Check hit significance
ok 13 - Check for the correct hit reference type
ok 14 - Check num_hsps
ok 15 - Check for hit hmmfrom value
ok 16 - Check for hit hmm to value
ok 17 - Check for query alifrom value
ok 18 - Check for query ali to value
ok 19 - Check for hsp score
ok 20 - Check for hsp c-Evalue
ok 21 - Check for query string
ok 22 - Check for number of gaps in query
ok 23 - Check for hit string
ok 24 - Check for homology string
ok 25 - Check if homology string and hit string have an equal lenght
ok 26 - Check if query string and homology string have an equal lenght
ok 27 - Check for hit hmmfrom value
ok 28 - Check for hit hmm to value
ok 29 - Check for query alifrom value
ok 30 - Check for query ali to value
ok 31 - Check for hsp score
ok 32 - Check for hsp c-Evalue
ok 33 - Check for query string
ok 34 - Check for number of gaps in query
ok 35 - Check for hit string
ok 36 - Check for homology string
ok 37 - Check if homology string and hit string have an equal lenght
ok 38 - Check if query string and homology string have an equal lenght
ok 39 - Check for the correct result reference type
ok 40 - Check algorithm
ok 41 - Check algorithm version
ok 42 - Check hmm_name
ok 43 - Check sequence_file
ok 44 - Check database_name
ok 45 - Check query_name
ok 46 - Check query_description
ok 47 - Check num_hits
ok 48 - Check hit name
ok 49 - Check for hit description
ok 50 - Check hit significance
ok 51 - Check hit raw_score
ok 52 - Check for hsp score
ok 53 - Check for hsp c-Evalue
ok 54 - Check for query alifrom value
ok 55 - Check for query ali to value
ok 56 - Check for hit hmmfrom value
ok 57 - Check for hit hmm to value
ok 58 - Check for query seq_id
ok 59 - Check for hit seq_id
ok 60 - Check for the correct result reference type
ok 61 - Check algorithm
ok 62 - Check algorithm version
ok 63 - Check hmm_name
ok 64 - Check sequence_file
ok 65 - Check query_name
ok 66 - Check query_description
ok 67 - Check num_hits
ok 68 - Check hit name
ok 69 - Check for hit description
ok 70 - Check hit significance
ok 71 - Check hit raw_score
ok 72 - Check for hsp score
ok 73 - Check for hsp evalue
ok 74 - Check for query alifrom value
ok 75 - Check for query ali to value
ok 76 - Check for hit hmmfrom value
ok 77 - Check for hit hmm to value
ok 78 - Check for query seq_id
ok 79 - Check for hit seq_id
ok 80 - Check for hiy string
ok 81 - Check for query string
ok 82 - Check for homology string
ok 83 - Check for nomatch indices in query
ok 84 - Check for nomatch indices in hit
ok 85 - Check for gap indices in query
ok 86 - Check for gap indices in hit
ok 87 - Check for the correct result reference type
ok 88 - Check algorithm
ok 89 - Check algorithm version
ok 90 - Check hmm_name
ok 91 - Check database_name
ok 92 - Check sequence_file
ok 93 - Check query_name
ok 94 - Check query_accession
ok 95 - Check query_description
ok 96 - Check num_hits
ok 97 - Check hit name
ok 98 - Check for hit description
ok 99 - Check hit significance
ok 100 - Check hit raw_score
ok 101 - Check for hsp score
ok 102 - Check for hsp evalue
ok 103 - Check for query alifrom value
ok 104 - Check for query ali to value
ok 105 - Check for hit hmmfrom value
ok 106 - Check for hit hmm to value
ok 107 - Check for query seq_id
ok 108 - Check for hit seq_id
ok 109 - Check for hiy string
ok 110 - Check for homology string
ok 111 - Check for query string
ok 112 - Check hit name
ok 113 - Check for hit description
ok 114 - Check hit significance
ok 115 - Check hit raw_score
ok 116 - Check for hsp seq_str
ok 117 - Check for the correct result reference type
ok 118 - Check algorithm
ok 119 - Check algorithm version
ok 120 - Check hmm_name
ok 121 - Check sequence_file
ok 122 - Check query_name
ok 123 - Check query_length
ok 124 - Check query_description
ok 125 - Check num_hits
ok 126 - Check for the correct hit reference type
ok 127 - Check hit name
ok 128 - Check for hit description
ok 129 - Check hit raw_score
ok 130 - Check hit significance
ok 131 - Check num_hsps
ok 132 - Check for correct hsp reference type
ok 133 - Check for hit hmmfrom value
ok 134 - Check for hit hmm to value
ok 135 - Check for query alifrom value
ok 136 - Check for query ali to value
ok 137 - Check for hsp score
ok 138 - Check for hsp c-Evalue
ok 139 - Check for query string
ok 140 - Check for hit string
ok 141 - Check for homology string
ok 142 - Check for the correct result reference type
ok 143 - Check algorithm
ok 144 - Check algorithm version
ok 145 - Check hmm_name
ok 146 - Check sequence_file
ok 147 - Check query_name
ok 148 - Check query_length
ok 149 - Check query_description
ok 150 - Check num_hits
ok 151 - Check for the correct result reference type
ok 152 - Check algorithm
ok 153 - Check algorithm version
ok 154 - Check hmm_name
ok 155 - Check sequence_file
ok 156 - Check query_name
ok 157 - Check query_length
ok 158 - Check query_description
ok 159 - Check num_hits
ok 160 - Check for the correct hit reference type
ok 161 - Check hit name
ok 162 - Check for hit description
ok 163 - Check hit raw_score
ok 164 - Check hit significance
ok 165 - Check num_hsps
ok 166 - Check for correct hsp reference type
ok 167 - Check for hit envfrom value
ok 168 - Check for hit env to value
ok 169 - Check for query hmmfrom value
ok 170 - Check for query hmm to value
ok 171 - Check for hsp score
ok 172 - Check for hsp c-Evalue
ok 173 - Check for correct hsp reference type
ok 174 - Check for hit envfrom value
ok 175 - Check for hit env to value
ok 176 - Check for query hmmfrom value
ok 177 - Check for query hmm to value
ok 178 - Check for hsp score
ok 179 - Check for hsp c-Evalue
ok 180 - Check for correct hsp reference type
ok 181 - Check for hit envfrom value
ok 182 - Check for hit env to value
ok 183 - Check for query hmmfrom value
ok 184 - Check for query hmm to value
ok 185 - Check for hsp score
ok 186 - Check for hsp c-Evalue
ok 187 - Check for correct hsp reference type
ok 188 - Check for hit envfrom value
ok 189 - Check for hit env to value
ok 190 - Check for query hmmfrom value
ok 191 - Check for query hmm to value
ok 192 - Check for hsp score
ok 193 - Check for hsp c-Evalue
ok 194 - Check for correct hsp reference type
ok 195 - Check for hit envfrom value
ok 196 - Check for hit env to value
ok 197 - Check for query hmmfrom value
ok 198 - Check for query hmm to value
ok 199 - Check for hsp score
ok 200 - Check for hsp c-Evalue
ok 201 - Check for correct hsp reference type
ok 202 - Check for hit envfrom value
ok 203 - Check for hit env to value
ok 204 - Check for query hmmfrom value
ok 205 - Check for query hmm to value
ok 206 - Check for hsp score
ok 207 - Check for hsp c-Evalue
ok 208 - Check for the correct hit reference type
ok 209 - Check hit name
ok 210 - Check for hit description
ok 211 - Check hit raw_score
ok 212 - Check hit significance
ok 213 - Check num_hsps
ok 214 - Check for correct hsp reference type
ok 215 - Check for hit envfrom value
ok 216 - Check for hit env to value
ok 217 - Check for query hmmfrom value
ok 218 - Check for query hmm to value
ok 219 - Check for hsp score
ok 220 - Check for hsp c-Evalue
ok 221 - Check for correct hsp reference type
ok 222 - Check for hit envfrom value
ok 223 - Check for hit env to value
ok 224 - Check for query hmmfrom value
ok 225 - Check for query hmm to value
ok 226 - Check for hsp score
ok 227 - Check for hsp c-Evalue
ok 228 - Check for correct hsp reference type
ok 229 - Check for hit envfrom value
ok 230 - Check for hit env to value
ok 231 - Check for query hmmfrom value
ok 232 - Check for query hmm to value
ok 233 - Check for hsp score
ok 234 - Check for hsp c-Evalue
ok 235 - Check for the correct result reference type
ok 236 - Check algorithm
ok 237 - Check algorithm version
ok 238 - Check hmm_name
ok 239 - Check sequence_file
ok 240 - Check query_name
ok 241 - Check query_length
ok 242 - Check query_description
ok 243 - Check num_hits
ok 244 - Check for the correct hit reference type
ok 245 - Check hit name
ok 246 - Check for hit description
ok 247 - Check hit raw_score
ok 248 - Check hit significance
ok 249 - Check num_hsps
ok 250 - Check for correct hsp reference type
ok 251 - Check hit sequence
ok 252 - Check query sequence
ok 253 - Check for correct hsp reference type
ok 254 - Check hit sequence
ok 255 - Check query sequence
ok 256 - Check for the correct hit reference type
ok 257 - Check hit name
ok 258 - Check for hit description
ok 259 - Check hit raw_score
ok 260 - Check hit significance
ok 261 - Check num_hsps
ok 262 - Check for correct hsp reference type
ok 263 - Check hit sequence
ok 264 - Check query sequence
ok 265 - Check for correct hsp reference type
ok 266 - Check hit sequence
ok 267 - Check query sequence
ok 268 - Check for the correct hit reference type
ok 269 - Check hit name
ok 270 - Check for hit description
ok 271 - Check hit raw_score
ok 272 - Check hit significance
ok 273 - Check num_hsps
ok 274 - Check for correct hsp reference type
ok 275 - Check hit sequence
ok 276 - Check query sequence
ok 277 - Check for correct hsp reference type
ok 278 - Check hit sequence
ok 279 - Check query sequence
ok 280 - Check if loading hmmpfam output via the hmm2 parser directly works
ok 281 - Check for the correct result reference type
ok 282 - Check if loading hmmsearch2 output via the hmm2 parser directly works
ok 283 - Check for the correct result reference type
ok 284 - Check if loading hmmscan output via the hmm3 parser directly works
ok 285 - Check for the correct result reference type
ok 286 - Check if loading hmmsearch3 output via the hmm3 parser directly works
ok 287 - Check for the correct result reference type
ok 288 - Check if selecting the correct hmmpfam parser using -version works
ok 289 - Check for the correct result reference type
ok 290 - Check if selecting the correct hmmsearch2 parser using -version works
ok 291 - Check for the correct result reference type
ok 292 - Check if selecting the correct hmmscan parser using -version works
ok 293 - Check for the correct result reference type
ok 294 - Check if selecting the correct hmmsearch3 parser using -version works
ok 295 - Check for the correct result reference type
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 14.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 14.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 14.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 14.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 14.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 14.
t/SearchIO/hmmer_pull.t ...................... 
1..290
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 80.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 80.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 80.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 80.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 80.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 80.
t/SearchIO/infernal.t ........................ 
1..412
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::Search::Result::ResultI
ok 3 - Result
ok 4 - Result reference
ok 5 - Result version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_length
ok 16 - Result query_name
ok 17 - The object isa Bio::Search::Hit::HitI
ok 18 - Hit GI
ok 19 - Hit accession
ok 20 - Hit algorithm
ok 21 - Hit bits
ok 22 - Hit description
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit length_aln() not implemented
ok 28 - Hit num_unaligned_hit() not implemented
ok 29 - Hit num_unaligned_query() not implemented
ok 30 - Hit num_unaligned_sbjct() not implemented
ok 31 - Hit start not implemented
ok 32 - Hit end not implemented
ok 33 - Hit strand not implemented
ok 34 - Hit logical_length not implemented
ok 35 - Hit frac_aligned_hit not implemented
ok 36 - Hit frac_aligned_query not implemented
ok 37 - Hit frac_conserved not implemented
ok 38 - Hit frac_identical not implemented
ok 39 - Hit matches not implemented
ok 40 - Hit gaps not implemented
ok 41 - Hit frame not implemented
ok 42 - Hit range not implemented
ok 43 - Hit seq_inds not implemented
ok 44 - Hit length
ok 45 - Hit overlap
ok 46 - Hit query_length
ok 47 - Hit rank
ok 48 - Hit raw_score
ok 49 - Hit score
ok 50 - Hit p
ok 51
ok 52 - The object isa Bio::Search::HSP::HSPI
ok 53 - HSP algorithm
ok 54
ok 55 - The object isa Bio::SeqFeature::Similarity
ok 56 - The object isa Bio::SeqFeature::Similarity
ok 57
ok 58
ok 59 - HSP frame
ok 60 - HSP gaps
ok 61 - Hit length
ok 62 - The object isa Bio::Align::AlignI
ok 63 - HSP hit isa Bio::SeqFeature::Similarity
ok 64 - HSP hit_string
ok 65 - HSP homology_string
ok 66 - HSP hsp_group
ok 67 - HSP hsp_length
ok 68 - HSP length
ok 69 - HSP links
ok 70 - HSP n
ok 71 - HSP pvalue
ok 72 - HSP query isa Bio::SeqFeature::Similarity
ok 73 - HSP query_string
ok 74 - HSP range
ok 75 - HSP rank
ok 76
ok 77 - HSP end
ok 78 - HSP expect
ok 79 - HSP seq_inds not implemented
ok 80 - HSP matches not implemented
ok 81 - HSP frac_conserved not implemented
ok 82 - HSP frac_identical not implemented
ok 83 - HSP num_conserved not implemented
ok 84 - HSP num_identical not implemented
ok 85 - HSP percent_identity not implemented
ok 86 - HSP cigar_string not implemented
ok 87 - HSP cigar_string not implemented
ok 88 - The object isa Bio::LocatableSeq
ok 89 - HSP seq_str
ok 90 - HSP start
ok 91 - HSP custom_score
ok 92 - HSP meta
ok 93 - HSP strand
ok 94 - The object isa Bio::Search::HSP::HSPI
ok 95 - HSP algorithm
ok 96
ok 97 - The object isa Bio::SeqFeature::Similarity
ok 98 - The object isa Bio::SeqFeature::Similarity
ok 99 - HSP frame
ok 100 - HSP gaps
ok 101 - The object isa Bio::Align::AlignI
ok 102 - HSP hit isa Bio::SeqFeature::Similarity
ok 103 - HSP hit_string
ok 104 - HSP homology_string
ok 105 - HSP hsp_group
ok 106 - HSP hsp_length
ok 107 - HSP length
ok 108 - HSP links
ok 109 - HSP n
ok 110 - HSP pvalue
ok 111 - HSP query isa Bio::SeqFeature::Similarity
ok 112 - HSP query_string
ok 113 - HSP range
ok 114 - HSP rank
ok 115
ok 116 - HSP end
ok 117 - HSP expect
ok 118 - The object isa Bio::LocatableSeq
ok 119 - HSP seq_str
ok 120 - HSP start
ok 121 - HSP custom_score
ok 122 - HSP meta
ok 123 - HSP strand
ok 124 - The object isa Bio::Search::Result::ResultI
ok 125 - Result CMSEARCH
ok 126 - Result CMSEARCH reference
ok 127 - Result CMSEARCH version
ok 128 - Result parameters
ok 129 - Result statistics
ok 130 - Result entries
ok 131 - Result letters
ok 132 - Result database_name
ok 133 - Result num_hits
ok 134 - Result program_reference
ok 135 - Result query_accession
ok 136 - Result query_description
ok 137 - Result query_length
ok 138 - Result query_name
ok 139 - The object isa Bio::Search::Hit::HitI
ok 140 - Hit GI
ok 141 - Hit accession
ok 142 - Hit algorithm
ok 143 - Hit bits
ok 144 - Hit description
ok 145 - Hit locus
ok 146 - Hit n
ok 147 - Hit name
ok 148 - Hit num_hsps
ok 149 - No p values
ok 150 - Hit length
ok 151 - Hit overlap
ok 152 - Hit query_length
ok 153 - Hit rank
ok 154 - Hit raw_score
ok 155 - Hit score
ok 156
ok 157 - The object isa Bio::Search::HSP::HSPI
ok 158 - HSP algorithm
ok 159
ok 160 - The object isa Bio::SeqFeature::Similarity
ok 161 - The object isa Bio::SeqFeature::Similarity
ok 162
ok 163
ok 164 - HSP frame
ok 165 - HSP gaps
ok 166 - Hit length
ok 167 - The object isa Bio::Align::AlignI
ok 168 - HSP hit isa Bio::SeqFeature::Similarity
ok 169 - HSP hit_string
ok 170 - HSP homology_string
ok 171 - HSP hsp_group
ok 172 - HSP hsp_length
ok 173 - HSP length
ok 174 - HSP links
ok 175 - HSP n
ok 176 - HSP pvalue
ok 177 - HSP query isa Bio::SeqFeature::Similarity
ok 178 - HSP query_string
ok 179 - HSP range
ok 180 - HSP rank
ok 181
ok 182 - HSP end
ok 183 - HSP expect
ok 184 - The object isa Bio::LocatableSeq
ok 185 - HSP seq_str
ok 186 - HSP start
ok 187 - HSP custom_score
ok 188 - HSP meta
ok 189 - HSP strand
ok 190 - The object isa Bio::Search::HSP::HSPI
ok 191 - HSP algorithm
ok 192
ok 193 - The object isa Bio::SeqFeature::Similarity
ok 194 - The object isa Bio::SeqFeature::Similarity
ok 195 - HSP frame
ok 196 - HSP gaps
ok 197 - The object isa Bio::Align::AlignI
ok 198 - HSP hit isa Bio::SeqFeature::Similarity
ok 199 - HSP hit_string
ok 200 - HSP homology_string
ok 201 - HSP hsp_group
ok 202 - HSP hsp_length
ok 203 - HSP length
ok 204 - HSP links
ok 205 - HSP n
ok 206 - HSP pvalue
ok 207 - HSP query isa Bio::SeqFeature::Similarity
ok 208 - HSP query_string
ok 209 - HSP range
ok 210 - HSP rank
ok 211
ok 212 - HSP end
ok 213 - HSP expect
ok 214 - The object isa Bio::LocatableSeq
ok 215 - HSP seq_str
ok 216 - HSP start
ok 217 - HSP custom_score
ok 218 - HSP meta
ok 219 - HSP strand
ok 220 - The object isa Bio::Search::Hit::HitI
ok 221 - Hit accession
ok 222 - Hit GI
ok 223 - Hit algorithm
ok 224 - Hit bits
ok 225 - Hit description
ok 226 - Hit length
ok 227 - Hit locus
ok 228 - Hit n
ok 229 - Hit name
ok 230 - Hit num_hsps
ok 231 - Hit overlap
ok 232 - Hit query_length
ok 233 - Hit rank
ok 234 - Hit raw_score
ok 235 - Hit score
ok 236
ok 237 - The object isa Bio::Search::HSP::HSPI
ok 238 - HSP algorithm
ok 239
ok 240 - The object isa Bio::SeqFeature::Similarity
ok 241 - The object isa Bio::SeqFeature::Similarity
ok 242 - HSP frame
ok 243 - HSP gaps
ok 244 - The object isa Bio::Align::AlignI
ok 245 - HSP hit isa Bio::SeqFeature::Similarity
ok 246 - HSP hit_string
ok 247 - HSP homology_string
ok 248 - HSP hsp_group
ok 249 - HSP hsp_length
ok 250 - HSP length
ok 251 - HSP links
ok 252 - HSP n
ok 253 - HSP query isa Bio::SeqFeature::Similarity
ok 254 - HSP query_string
ok 255 - HSP range
ok 256 - HSP rank
ok 257
ok 258 - HSP end
ok 259 - HSP expect
ok 260 - The object isa Bio::LocatableSeq
ok 261 - HSP seq_str
ok 262 - HSP start
ok 263 - HSP custom_score
ok 264 - HSP meta
ok 265 - HSP strand
ok 266 - HSP meta gap bug
ok 267 - HSP meta
ok 268 - HSP meta
ok 269
ok 270
ok 271 - The object isa Bio::Search::Result::ResultI
ok 272 - Result CMSEARCH
ok 273 - Result CMSEARCH reference
ok 274 - Result CMSEARCH version
ok 275 - Result parameters
ok 276 - Result statistics
ok 277 - Result entries
ok 278 - Result letters
ok 279 - Result database_name
ok 280 - Result num_hits
ok 281 - Result program_reference
ok 282 - Result query_accession
ok 283 - Result query_description
ok 284 - Result query_length
ok 285 - Result query_name
ok 286 - The object isa Bio::Search::Hit::HitI
ok 287 - Hit GI
ok 288 - Hit accession
ok 289 - Hit algorithm
ok 290 - Hit bits
ok 291 - Hit description
ok 292 - Hit locus
ok 293 - Hit n
ok 294 - Hit name
ok 295 - Hit num_hsps
ok 296 - No p values
ok 297 - Hit length
ok 298 - Hit overlap
ok 299 - Hit query_length
ok 300 - Hit rank
ok 301 - Hit raw_score
ok 302 - Hit score
ok 303
ok 304 - The object isa Bio::Search::HSP::HSPI
ok 305 - HSP algorithm
ok 306
ok 307 - The object isa Bio::SeqFeature::Similarity
ok 308 - The object isa Bio::SeqFeature::Similarity
ok 309
ok 310
ok 311 - HSP frame
ok 312 - HSP gaps
ok 313 - Hit length
ok 314 - The object isa Bio::Align::AlignI
ok 315 - HSP hit isa Bio::SeqFeature::Similarity
ok 316 - HSP hit_string
ok 317 - HSP homology_string
ok 318 - HSP hsp_group
ok 319 - HSP hsp_length
ok 320 - HSP length
ok 321 - HSP links
ok 322 - HSP n
ok 323 - HSP pvalue
ok 324 - HSP query isa Bio::SeqFeature::Similarity
ok 325 - HSP query_string
ok 326 - HSP range
ok 327 - HSP rank
ok 328
ok 329 - HSP end
ok 330 - HSP expect
ok 331 - The object isa Bio::LocatableSeq
ok 332 - HSP seq_str
ok 333 - HSP start
ok 334 - HSP custom_score
ok 335 - HSP meta
ok 336 - HSP strand
ok 337 - The object isa Bio::Search::HSP::HSPI
ok 338 - HSP algorithm
ok 339
ok 340 - The object isa Bio::SeqFeature::Similarity
ok 341 - The object isa Bio::SeqFeature::Similarity
ok 342 - HSP frame
ok 343 - HSP gaps
ok 344 - The object isa Bio::Align::AlignI
ok 345 - HSP hit isa Bio::SeqFeature::Similarity
ok 346 - HSP hit_string
ok 347 - HSP homology_string
ok 348 - HSP hsp_group
ok 349 - HSP hsp_length
ok 350 - HSP length
ok 351 - HSP links
ok 352 - HSP n
ok 353 - HSP pvalue
ok 354 - HSP query isa Bio::SeqFeature::Similarity
ok 355 - HSP query_string
ok 356 - HSP range
ok 357 - HSP rank
ok 358
ok 359 - HSP end
ok 360 - HSP expect
ok 361 - The object isa Bio::LocatableSeq
ok 362 - HSP seq_str
ok 363 - HSP start
ok 364 - HSP custom_score
ok 365 - HSP meta
ok 366 - HSP strand
ok 367 - The object isa Bio::Search::Hit::HitI
ok 368 - Hit accession
ok 369 - Hit GI
ok 370 - Hit algorithm
ok 371 - Hit bits
ok 372 - Hit description
ok 373 - Hit length
ok 374 - Hit locus
ok 375 - Hit n
ok 376 - Hit name
ok 377 - Hit num_hsps
ok 378 - Hit overlap
ok 379 - Hit query_length
ok 380 - Hit rank
ok 381 - Hit raw_score
ok 382 - Hit score
ok 383
ok 384 - The object isa Bio::Search::HSP::HSPI
ok 385 - HSP algorithm
ok 386
ok 387 - The object isa Bio::SeqFeature::Similarity
ok 388 - The object isa Bio::SeqFeature::Similarity
ok 389 - HSP frame
ok 390 - HSP gaps
ok 391 - The object isa Bio::Align::AlignI
ok 392 - HSP hit isa Bio::SeqFeature::Similarity
ok 393 - HSP hit_string
ok 394 - HSP homology_string
ok 395 - HSP hsp_group
ok 396 - HSP hsp_length
ok 397 - HSP length
ok 398 - HSP links
ok 399 - HSP n
ok 400 - HSP query isa Bio::SeqFeature::Similarity
ok 401 - HSP query_string
ok 402 - HSP range
ok 403 - HSP rank
ok 404
ok 405 - HSP end
ok 406 - HSP expect
ok 407 - The object isa Bio::LocatableSeq
ok 408 - HSP seq_str
ok 409 - HSP start
ok 410 - HSP custom_score
ok 411 - HSP meta
ok 412 - HSP strand
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 21.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 21.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 21.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 21.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 21.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 21.
t/SearchIO/megablast.t ....................... 
1..31
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 4.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 4.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 4.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 4.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 4.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 4.
t/SearchIO/psl.t ............................. 
1..53
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - next_hsp should be undef
ok 51 - next_hit should be undef
not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string

#   Failed (TODO) test 'next_result should be undef'
#   at t/SearchIO/psl.t line 97.
#          got: ''
#     expected: undef
ok 53
ok
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 199.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 199.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 199.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 199.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 199.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 199.
t/SearchIO/rnamotif.t ........................ 
1..60
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::Search::Result::ResultI
ok 3 - Result RNAMOTIF
ok 4 - Result RNAMOTIF reference
ok 5 - Result RNAMOTIF version
ok 6 - Result entries
ok 7 - Result letters
ok 8 - Result database_name
ok 9 - Result num_hits
ok 10 - Result program_reference
ok 11 - Result query_accession
ok 12 - Result query_description
ok 13 - Result query_length
ok 14 - Result query_name
ok 15 - The object isa Bio::Search::Hit::HitI
ok 16 - Hit accession
ok 17 - Hit GI
ok 18 - Hit algorithm
ok 19 - Hit description
ok 20 - Hit length
ok 21 - Hit locus
ok 22 - Hit n
ok 23 - Hit name
ok 24 - Hit num_hsps
ok 25 - Hit overlap
ok 26 - Hit rank
ok 27 - Hit raw_score
ok 28 - Hit score
ok 29
ok 30 - The object isa Bio::Search::HSP::HSPI
ok 31 - HSP algorithm
ok 32
ok 33 - The object isa Bio::SeqFeature::Similarity
ok 34 - The object isa Bio::SeqFeature::Similarity
ok 35 - HSP frame
ok 36 - HSP gaps
ok 37 - RNAMotif get_aln warning
ok 38 - HSP hit isa Bio::SeqFeature::Similarity
ok 39 - HSP hit_string
ok 40 - HSP homology_string
ok 41 - HSP hsp_group
ok 42 - HSP hsp_length
ok 43 - HSP length
ok 44 - HSP links
ok 45 - HSP n
ok 46 - HSP query isa Bio::SeqFeature::Similarity
ok 47 - HSP query_string
ok 48 - HSP range
ok 49 - HSP rank
ok 50
ok 51 - HSP end
ok 52 - HSP expect
ok 53 - The object isa Bio::LocatableSeq
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58 - HSP strand
ok 59
ok 60
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 6.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 6.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 6.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 6.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 6.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 6.
t/SearchIO/sim4.t ............................ 
1..102
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175.
Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 264.
Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 284.
Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 311.
Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 337.
Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 357.
Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 378.
Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 399.
Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 420.
Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 442.
Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 465.
Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 487.
Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 508.
Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 523.
Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 540.
Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 555.
Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 574.
Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 599.
Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 616.
Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 629.
Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 646.
Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 663.
Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 680.
Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 700.
Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 728.
Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 747.
Subroutine rid redefined at Bio/Search/Result/GenericResult.pm line 763.
Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 777.
Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 794.
Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 815.
Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 175.
Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 216.
Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 241.
Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 263.
Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 282.
Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 308.
Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 350.
Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 383.
Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 413.
Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 437.
Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 463.
Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 493.
Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 525.
Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 538.
Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 578.
Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 622.
Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 679.
Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 703.
Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 726.
Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 778.
Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 873.
Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 897.
Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 905.
Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 928.
Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 936.
Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 962.
Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1020.
Subroutine _calculate_seq_offsets redefined at Bio/Search/HSP/GenericHSP.pm line 1176.
Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1197.
Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1210.
Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1241.
Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1260.
Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1280.
Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1337.
Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1359.
Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1391.
Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1408.
Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1448.
Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1526.
Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1597.
Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1625.
Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1660.
Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1690.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 13.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 13.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 13.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 13.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 13.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 13.
t/SearchIO/waba.t ............................ 
1..64
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::SearchIO
ok 3 - query_name
ok 4 - query database
ok 5 - database name
ok 6 - name
ok 7 - hsps
ok 8 - total length
ok 9 - start
ok 10 - end
ok 11 - strand
ok 12 - start
ok 13 - end
ok 14 - strand
ok 15 - query string
ok 16 - hit_string
ok 17 - hmmstate string
ok 18
ok 19
ok 20
ok 21 - total length
ok 22 - start
ok 23 - end
ok 24 - strand
ok 25 - start
ok 26 - end
ok 27 - strand
ok 28 - query string
ok 29 - hit_string
ok 30 - hmmstate string
ok 31
ok 32
ok 33
ok 34 - total length
ok 35 - start
ok 36 - end
ok 37 - strand
ok 38 - start
ok 39 - end
ok 40 - strand
ok 41 - query string
ok 42 - hit_string
ok 43 - hmmstate string
ok 44
ok 45
ok 46
ok 47 - query_name
ok 48 - query database
ok 49 - database name
ok 50 - name
ok 51 - hsps
ok 52 - total length
ok 53 - start
ok 54 - end
ok 55 - strand
ok 56 - start
ok 57 - end
ok 58 - strand
ok 59 - query string
ok 60 - hit_string
ok 61 - hmmstate string
ok 62
ok 63
ok 64
ok
Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153, <GEN1> chunk 2.
Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, <GEN1> chunk 2.
Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265, <GEN1> chunk 2.
Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286, <GEN1> chunk 2.
Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316, <GEN1> chunk 2.
Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333, <GEN1> chunk 2.
Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350, <GEN1> chunk 2.
Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367, <GEN1> chunk 2.
Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384, <GEN1> chunk 2.
Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418, <GEN1> chunk 2.
Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446, <GEN1> chunk 2.
Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465, <GEN1> chunk 2.
Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483, <GEN1> chunk 2.
Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498, <GEN1> chunk 2.
Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518, <GEN1> chunk 2.
Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544, <GEN1> chunk 2.
Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560, <GEN1> chunk 2.
Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585, <GEN1> chunk 2.
Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614, <GEN1> chunk 2.
Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656, <GEN1> chunk 2.
Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679, <GEN1> chunk 2.
Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696, <GEN1> chunk 2.
Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720, <GEN1> chunk 2.
Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751, <GEN1> chunk 2.
Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775, <GEN1> chunk 2.
Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814, <GEN1> chunk 2.
Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846, <GEN1> chunk 2.
Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876, <GEN1> chunk 2.
Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899, <GEN1> chunk 2.
Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936, <GEN1> chunk 2.
Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958, <GEN1> chunk 2.
Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989, <GEN1> chunk 2.
Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006, <GEN1> chunk 2.
Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022, <GEN1> chunk 2.
Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028, <GEN1> chunk 2.
Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035, <GEN1> chunk 2.
Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036, <GEN1> chunk 2.
Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047, <GEN1> chunk 2.
Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040, <GEN1> chunk 2.
Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041, <GEN1> chunk 2.
Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042, <GEN1> chunk 2.
Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044, <GEN1> chunk 2.
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85, <GEN1> line 3.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122, <GEN1> line 3.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138, <GEN1> line 3.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154, <GEN1> line 3.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170, <GEN1> line 3.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190, <GEN1> line 3.
t/SearchIO/wise.t ............................ 
1..20
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok
t/Seq/DBLink.t ............................... 
1..131
ok 1 - use Bio::SeqIO;
ok 2 - "swissprot:K1C9_HUMAN"
ok 3 - no double colon
ok 4 - no trailing colon
ok 5 - no double space
ok 6 - dblink value is splittable
ok 7 - "GenBank:Z29074.1"
ok 8 - no double colon
ok 9 - no trailing colon
ok 10 - no double space
ok 11 - dblink value is splittable
ok 12 - "GenPept:CAA82315.1"
ok 13 - no double colon
ok 14 - no trailing colon
ok 15 - no double space
ok 16 - dblink value is splittable
ok 17 - "GenBank:S69510.1"
ok 18 - no double colon
ok 19 - no trailing colon
ok 20 - no double space
ok 21 - dblink value is splittable
ok 22 - "GenPept:AAC60619.1"
ok 23 - no double colon
ok 24 - no trailing colon
ok 25 - no double space
ok 26 - dblink value is splittable
ok 27 - "GenBank:X75015.1"
ok 28 - no double colon
ok 29 - no trailing colon
ok 30 - no double space
ok 31 - dblink value is splittable
ok 32 - "GenPept:CAA52924.1"
ok 33 - no double colon
ok 34 - no trailing colon
ok 35 - no double space
ok 36 - dblink value is splittable
ok 37 - "GenBank:AB001594.1"
ok 38 - no double colon
ok 39 - no trailing colon
ok 40 - no double space
ok 41 - dblink value is splittable
ok 42 - "GenPept:BAA19418.1"
ok 43 - no double colon
ok 44 - no trailing colon
ok 45 - no double space
ok 46 - dblink value is splittable
ok 47 - "GenBank:I37984"
ok 48 - no double colon
ok 49 - no trailing colon
ok 50 - no double space
ok 51 - dblink value is splittable
ok 52 - "HSSP:P08670"
ok 53 - no double colon
ok 54 - no trailing colon
ok 55 - no double space
ok 56 - dblink value is splittable
ok 57 - "IntAct:P35527"
ok 58 - no double colon
ok 59 - no trailing colon
ok 60 - no double space
ok 61 - dblink value is splittable
ok 62 - "Ensembl:ENSG00000171403"
ok 63 - no double colon
ok 64 - no trailing colon
ok 65 - no double space
ok 66 - dblink value is splittable
ok 67 - "KEGG:hsa:3857"
ok 68 - no double colon
ok 69 - no trailing colon
ok 70 - no double space
ok 71 - dblink value is splittable
ok 72 - "HGNC:6447"
ok 73 - no double colon
ok 74 - no trailing colon
ok 75 - no double space
ok 76 - dblink value is splittable
ok 77 - "MIM:144200"
ok 78 - no double colon
ok 79 - no trailing colon
ok 80 - no double space
ok 81 - dblink value is splittable
ok 82 - "MIM:607606"
ok 83 - no double colon
ok 84 - no trailing colon
ok 85 - no double space
ok 86 - dblink value is splittable
ok 87 - "ArrayExpress:P35527"
ok 88 - no double colon
ok 89 - no trailing colon
ok 90 - no double space
ok 91 - dblink value is splittable
ok 92 - "GO:0005200"
ok 93 - no double colon
ok 94 - no trailing colon
ok 95 - no double space
ok 96 - dblink value is splittable
ok 97 - "GO:0008544"
ok 98 - no double colon
ok 99 - no trailing colon
ok 100 - no double space
ok 101 - dblink value is splittable
ok 102 - "InterPro:IPR011000"
ok 103 - no double colon
ok 104 - no trailing colon
ok 105 - no double space
ok 106 - dblink value is splittable
ok 107 - "InterPro:IPR001664"
ok 108 - no double colon
ok 109 - no trailing colon
ok 110 - no double space
ok 111 - dblink value is splittable
ok 112 - "InterPro:IPR002957"
ok 113 - no double colon
ok 114 - no trailing colon
ok 115 - no double space
ok 116 - dblink value is splittable
ok 117 - "Pfam:PF00038"
ok 118 - no double colon
ok 119 - no trailing colon
ok 120 - no double space
ok 121 - dblink value is splittable
ok 122 - "PRINTS:PR01248"
ok 123 - no double colon
ok 124 - no trailing colon
ok 125 - no double space
ok 126 - dblink value is splittable
ok 127 - "PROSITE:PS00226"
ok 128 - no double colon
ok 129 - no trailing colon
ok 130 - no double space
ok 131 - dblink value is splittable
ok
t/Seq/EncodedSeq.t ........................... 
1..37
ok 1 - use Bio::Seq::EncodedSeq;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - The object isa Bio::Location::Simple
ok 12
ok 13
ok 14 - The object isa Bio::Location::Simple
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/Seq/LargeLocatableSeq.t .................... 
1..8
ok 1 - use Bio::Seq::LargeLocatableSeq;
ok 2
ok 3 - The object isa Bio::Seq::LargeSeqI
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Seq/LargePSeq.t ............................ 
1..30
ok 1 - use Bio::Seq::LargePrimarySeq;
ok 2 - use Bio::Seq::LargeSeq;
ok 3 - use Bio::Location::Simple;
ok 4 - use Bio::Location::Fuzzy;
ok 5 - use Bio::Location::Split;
ok 6 - use Bio::SeqIO;
ok 7
ok 8
ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 10 - Subseq is GGGGT
ok 11
ok 12
ok 13
ok 14 - trunc seq was GGGGTGAA
ok 15
ok 16
ok 17
ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 19
ok 20 - output via Bio::SeqIO::fasta
ok 21 - Subseq is GGGGT
ok 22 - trunc seq was GGGGTGAA
ok 23
ok 24
ok 25
ok 26 - Sequence is ATGGGGTGGGGT
ok 27 - Subseq is GGGGT
ok 28 - trunc seq was GGGGT
ok 29
ok 30
ok
t/Seq/LocatableSeq.t ......................... 
1..118
ok 1 - use Bio::LocatableSeq;
ok 2 - use Bio::AlignIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - The object isa Bio::Location::Simple
ok 13
ok 14
ok 15 - The object isa Bio::Location::Simple
ok 16
ok 17
ok 18
ok 19
not ok 20 # TODO Need to fix columns before start of seq w/ start > 1

#   Failed (TODO) test at t/Seq/LocatableSeq.t line 45.
#          got: 'Bio::Location::Simple=HASH(0x334d81c)'
#     expected: undef
ok 21
ok 22 - The object isa Bio::AlignIO
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49 - The object isa Bio::Location::Simple
ok 50
ok 51
ok 52 - The object isa Bio::Location::Simple
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105 - * is counted in length
ok 106 - * is counted in length, but end is wrong
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
not ok 117 # TODO Bio::LocatableSeq global variables have scoping issues

#   Failed (TODO) test at t/Seq/LocatableSeq.t line 301.
#          got: '\-\.=~'
#     expected: '-\?'
not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues

#   Failed (TODO) test at t/Seq/LocatableSeq.t line 303.
#          got: '19'
#     expected: anything else
ok
t/Seq/MetaSeq.t .............................. 
1..128
ok 1 - use Bio::Seq::Meta;
ok 2 - use Bio::Seq::Meta::Array;
ok 3 - use Bio::SeqIO;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Seq::Quality;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - aa-bb  bb 
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok
t/Seq/PrimaryQual.t .......................... 
1..35
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::Quality;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok
t/Seq/PrimarySeq.t ........................... 
1..87
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::Location::Split;
ok 5
ok 6 - The object isa Bio::PrimarySeqI
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::IdentifiableI
ok 15 - The object isa Bio::DescribableI
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - The object isa Bio::PrimarySeqI
ok 30
ok 31 - The object isa Bio::PrimarySeqI
ok 32
ok 33 - The object isa Bio::PrimarySeqI
ok 34
ok 35 - The object isa Bio::PrimarySeqI
ok 36
ok 37
ok 38 - alphabet copied through revcom
not ok 39 - namespace copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms

#   Failed (TODO) test 'namespace copied through revcom'
#   at t/Seq/PrimarySeq.t line 110.
#          got: ''
#     expected: 't'
not ok 40 - namespace_string copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms

#   Failed (TODO) test 'namespace_string copied through revcom'
#   at t/Seq/PrimarySeq.t line 111.
#          got: ':X677667'
#     expected: 't:X677667.47'
not ok 41 - is_circular copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms

#   Failed (TODO) test 'is_circular copied through revcom'
#   at t/Seq/PrimarySeq.t line 113.
#          got: undef
#     expected: '0'
ok 42 - Translation: LVAST
ok 43 - Translation: MVAST
ok 44 - Translation: MVAST
ok 45 - Translation: MVAST*
ok 46 - Translation: M*
ok 47 - Translation: M
ok 48
ok 49 - Translation: MWP
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60 - Alphabet
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77 - Bug 2438
ok 78
ok 79 - Bug \#2864
ok 80 - Terminator + inside sequence
ok 81
ok 82 - _find_orfs 1
ok 83 - orfs are sorted by descending length
ok 84 - got correct -orf => "longest" seq
ok 85 - _find_orfs 1
ok 86 - orfs are sorted by descending length
ok 87 - got correct -orf => "longest" seq
ok
t/Seq/PrimedSeq.t ............................ 
1..10
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::PrimedSeq;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok
t/Seq/Quality.t .............................. 
1..85
ok 1 - use Bio::Seq::Quality;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bug 2845
ok 73
ok 74 - Bug 2845
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok
t/Seq/Seq.t .................................. 
1..72
ok 1 - use Bio::Seq;
ok 2 - use Bio::Seq::RichSeq;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Species;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7
ok 8
ok 9
ok 10 - truncated sequence length
ok 11 - truncated sequence string
ok 12
ok 13
ok 14 - alphabet
ok 15 - id
ok 16 - accession number
ok 17 - subseq
ok 18 - The object isa Bio::IdentifiableI
ok 19 - The object isa Bio::DescribableI
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33 - translated sequence
ok 34 - translated sequence with explicit unambiguous codons
ok 35 - translated sequence with unknown unambiguous codons
ok 36 - translated sequence with unknown unambiguous codons, completed
ok 37 - translated sequence with unambiguous codons
ok 38 - translated sequence with unambiguous codons
ok 39 - translated sequence with unknown unambiguous codons, completed
ok 40 - translated sequence with unambiguous codons
ok 41 - translated sequence with unknown unambiguous codons, completed
ok 42 - translated sequence with stop
ok 43 - translated sequence
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64 - Bug \#2864
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok
t/Seq/WithQuality.t .......................... 
1..22
ok 1 - use Bio::Seq::SeqWithQuality;
ok 2 - use Bio::PrimarySeq;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - The object isa Bio::Seq::PrimaryQual
ok 20 - The object isa Bio::PrimarySeq
ok 21
ok 22
ok
Subroutine new redefined at Bio\Seq.pm line 482.
Subroutine seq redefined at Bio\Seq.pm line 568.
Subroutine validate_seq redefined at Bio\Seq.pm line 595.
Subroutine length redefined at Bio\Seq.pm line 610.
Subroutine subseq redefined at Bio\Seq.pm line 634.
Subroutine display_id redefined at Bio\Seq.pm line 664.
Subroutine accession_number redefined at Bio\Seq.pm line 692.
Subroutine desc redefined at Bio\Seq.pm line 708.
Subroutine primary_id redefined at Bio\Seq.pm line 735.
Subroutine can_call_new redefined at Bio\Seq.pm line 775.
Subroutine alphabet redefined at Bio\Seq.pm line 797.
Subroutine is_circular redefined at Bio\Seq.pm line 813.
Subroutine object_id redefined at Bio\Seq.pm line 836.
Subroutine version redefined at Bio\Seq.pm line 853.
Subroutine authority redefined at Bio\Seq.pm line 870.
Subroutine namespace redefined at Bio\Seq.pm line 887.
Subroutine display_name redefined at Bio\Seq.pm line 910.
Subroutine description redefined at Bio\Seq.pm line 930.
Subroutine annotation redefined at Bio\Seq.pm line 952.
Subroutine get_Annotations redefined at Bio\Seq.pm line 977.
Subroutine add_Annotation redefined at Bio\Seq.pm line 1002.
Subroutine remove_Annotations redefined at Bio\Seq.pm line 1017.
Subroutine get_num_of_annotations redefined at Bio\Seq.pm line 1030.
Subroutine num_Annotations redefined at Bio\Seq.pm line 1031.
Subroutine get_SeqFeatures redefined at Bio\Seq.pm line 1064.
Subroutine feature_count redefined at Bio\Seq.pm line 1111.
Subroutine add_SeqFeature redefined at Bio\Seq.pm line 1136.
Subroutine remove_SeqFeatures redefined at Bio\Seq.pm line 1170.
Subroutine id redefined at Bio\Seq.pm line 1243.
Subroutine primary_seq redefined at Bio\Seq.pm line 1266.
Subroutine species redefined at Bio\Seq.pm line 1299.
Subroutine DESTROY redefined at Bio\Seq.pm line 1313.
Subroutine all_SeqFeatures redefined at Bio\Seq.pm line 1328.
Subroutine accession redefined at Bio\Seq.pm line 1332.
Subroutine Bio::Seq::flush_SeqFeature redefined at Bio\Seq.pm line 1321.
Subroutine Bio::Seq::flush_SeqFeatures redefined at Bio\Seq.pm line 1322.
Subroutine Bio::Seq::top_SeqFeatures redefined at Bio\Seq.pm line 1325.
t/SeqEvolution.t ............................. 
1..39
ok 1 - use Bio::SeqEvolution::Factory;
ok 2 - use Bio::PrimarySeq;
ok 3
ok 4 - The object isa Bio::SeqEvolution::DNAPoint
ok 5
ok 6 - The object isa Bio::SeqEvolution::DNAPoint
ok 7
ok 8 - The object isa Bio::SeqEvolution::DNAPoint
ok 9
ok 10
ok 11 - get rate()
ok 12 - get and set rate()
ok 13 - identity()
ok 14 - identity()
ok 15 - pam()
ok 16 - pam()
ok 17 - mutation_count()
ok 18 - mutation_count()
ok 19 - seq_type()
ok 20 - seq_type()
ok 21 - next_seq()
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - each_mutation()
ok 28
ok 29
ok 30 - get_alignment_identity()
ok 31
ok 32
ok 33 - get_mutation_counter()
ok 34 - get_sequence_counter()
ok 35 - reset_sequence_counter()
ok 36 - get_sequence_counter() == 0
ok 37
ok 38
ok 39 - The object isa Bio::SimpleAlign
ok
t/SeqFeature/Clone.t ......................... 
1..17
ok 1 - clone()
ok 2 - start() clone set
ok 3 - start() clone get
ok 4 - start() original unchanged
ok 5 - clone() with arguments
ok 6 - start() orig get
ok 7 - end() orig get
ok 8 - start() clone get
ok 9 - end() clone get
ok 10 - start() clone set
ok 11 - start() clone get
ok 12 - start() original unchanged
ok 13 - location() Bio::Location::Split
ok 14 - clone()
ok 15 - start() clone set
ok 16 - start() clone get
ok 17 - start() original unchanged
ok
t/SeqFeature/FeatureIO.t ..................... 
1..47
ok 1 - use Bio::FeatureIO;
ok 2
ok 3
not ok 4 # TODO How did this ever work?!?

#   Failed (TODO) test at t/SeqFeature/FeatureIO.t line 43.
#          got: 'TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC'
#     expected: 'Test1'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
not ok 13 # TODO How did this ever work?!?

#   Failed (TODO) test at t/SeqFeature/FeatureIO.t line 103.
#          got: 'GATTACAGATTACA'
#     expected: 'Test1'
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
not ok 24 # TODO How did this ever work?!?

#   Failed (TODO) test at t/SeqFeature/FeatureIO.t line 173.
#          got: 'GATTACAGATTACA'
#     expected: 'Test1'
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - vecscreen_simple gets the correct features
ok 46
ok 47
ok
Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 85.
Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 122.
Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 138.
Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 154.
Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 170.
Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 190.
Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153.
Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195.
Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265.
Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286.
Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316.
Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333.
Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350.
Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367.
Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384.
Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418.
Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446.
Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465.
Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483.
Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498.
Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518.
Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544.
Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560.
Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585.
Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614.
Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656.
Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679.
Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696.
Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720.
Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751.
Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775.
Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814.
Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846.
Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876.
Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899.
Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936.
Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958.
Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989.
Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006.
Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022.
Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028.
Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035.
Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036.
Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047.
Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040.
Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041.
Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042.
Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044.
t/SeqFeature/Location.t ...................... 
1..103
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Location::Split;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::SeqFeature::Generic;
ok 5 - use Bio::SeqFeature::SimilarityPair;
ok 6 - use Bio::SeqFeature::FeaturePair;
ok 7 - The object isa Bio::LocationI
ok 8 - The object isa Bio::RangeI
ok 9 - Bio::Location::Simple tests
ok 10
ok 11
ok 12
ok 13
ok 14 - Bio::SeqFeature::Generic isa Bio::SeqFeatureI
ok 15 - The object isa Bio::RangeI
ok 16
ok 17
ok 18 - Bio::SeqFeature::FeaturePair tests
ok 19
ok 20
ok 21
ok 22 - Bio::SeqFeature::Generic tests
ok 23
ok 24 - Bio::Location::Fuzzy tests
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38 - Bio::Location::Split tests
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55 - Bugfix 1074
ok 56
ok 57
ok 58
ok 59 - Positive length
ok 60
ok 61 - seq_id() on Bio::Location::Split
ok 62
ok 63
ok 64 - The object isa Bio::LocationI
ok 65 - The object isa Bio::RangeI
ok 66 - Bio::Location::Simple EXACT
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bio::Location::Simple IN-BETWEEN
ok 73
ok 74
ok 75
ok 76
ok 77 - Testing error handling
ok 78
ok 79
ok 80
ok 81 - use Bio::Location::WidestCoordPolicy;
ok 82 - use Bio::Location::NarrowestCoordPolicy;
ok 83 - use Bio::Location::AvWithinCoordPolicy;
ok 84 - Default coodinate policy
ok 85
ok 86
ok 87
ok 88 - The object isa Bio::Location::WidestCoordPolicy
ok 89 - Narrowest coodinate policy
ok 90
ok 91
ok 92
ok 93 - The object isa Bio::Location::NarrowestCoordPolicy
ok 94 - Average coodinate policy
ok 95
ok 96
ok 97
ok 98 - The object isa Bio::Location::AvWithinCoordPolicy
ok 99 - Widest coodinate policy
ok 100
ok 101
ok 102
ok 103 - The object isa Bio::Location::WidestCoordPolicy
ok
t/SeqFeature/LocationFactory.t ............... 
1..272
ok 1 - use Bio::Factory::FTLocationFactory;
ok 2 - The object isa Bio::Factory::LocationFactoryI
ok 3 - Bio::Location::Simple
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - Location String: J00194:100..202
ok 13
ok 14 - Bio::Location::Fuzzy
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23 - Location String: 1..?
ok 24
ok 25 - Bio::Location::Fuzzy
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - Location String: (122.133)..(204.221)
ok 35
ok 36 - Bio::Location::Fuzzy
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - Location String: (102.110)
ok 46
ok 47 - Bio::Location::Simple
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - Location String: 340..565
ok 57
ok 58 - Bio::Location::Split
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - Location String: join(12..78,134..202)
ok 68
ok 69 - Bio::Location::Fuzzy
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78 - Location String: ?..?
ok 79
ok 80 - Bio::Location::Fuzzy
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - Location String: <345..500
ok 90
ok 91 - Bio::Location::Fuzzy
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100 - Location String: ?22..?64
ok 101
ok 102 - Bio::Location::Simple
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111 - Location String: J00194:100..202
ok 112
ok 113 - Bio::Location::Simple
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122 - Location String: 467
ok 123
ok 124 - Bio::Location::Fuzzy
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133 - Location String: (23.45)..600
ok 134
ok 135 - Bio::Location::Simple
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144 - Location String: 123^124
ok 145
ok 146 - Bio::Location::Fuzzy
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155 - Location String: <1..?
ok 156
ok 157 - Bio::Location::Fuzzy
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166 - Location String: 145^177
ok 167
ok 168 - Bio::Location::Fuzzy
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177 - Location String: 22..?64
ok 178
ok 179 - Bio::Location::Fuzzy
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188 - Location String: complement(34..(122.126))
ok 189
ok 190 - Bio::Location::Split
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199 - Location String: complement(join(4918..5163,2691..4571))
ok 200
ok 201 - Bio::Location::Split
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599)
ok 211
ok 212 - Bio::Location::Fuzzy
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221 - Location String: ?..>393
ok 222
ok 223 - Bio::Location::Fuzzy
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232 - Location String: ?2465..2774
ok 233
ok 234 - Bio::Location::Fuzzy
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243 - Location String: (122.133)..(204.221)
ok 244
ok 245 - Bio::Location::Fuzzy
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254 - Location String: ?..536
ok 255
ok 256 - Bio::Location::Fuzzy
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265 - Location String: <1..888
ok 266
ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294)))
ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081)))
ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669)))
ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672)))
ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000)
ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19))
ok
t/SeqFeature/Primer.t ........................ 
1..18
ok 1 - use Bio::SeqFeature::Primer;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/SeqFeature/Range.t ......................... 
1..49
ok 1 - use Bio::Range;
ok 2 - BioRange object isa Bio::Range
ok 3
ok 4 - BioRange object isa Bio::Range
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - BioRange object isa Bio::Range
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - BioRange object isa Bio::Range
ok 26 - BioRange object isa Bio::Range
ok 27 - BioRange object isa Bio::Range
ok 28 -  1 & -1
ok 29 -  1 & 1 true
ok 30 -  1 & 0 true
ok 31 -  1 & -1 false
ok 32 -  1 & 1 true
ok 33 -  1 & 0 false
ok 34 -  1 & -1 false
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - Bio::Range object isa Bio::Range
ok 46
ok 47
ok 48
ok 49
ok
t/SeqFeature/RangeI.t ........................ 
1..45
ok 1 - use Bio::SeqFeature::Generic;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39 - subtract() of split features
ok 40 -    0 start
ok 41 -    0 end
ok 42 -    1 start
ok 43 -    1 end
ok 44 -    2 start
ok 45 -    2 end
ok
t/SeqFeature/SeqAnalysisParser.t ............. 
1..14
ok 1 - use Bio::Factory::SeqAnalysisParserFactory;
ok 2 - use Bio::SeqIO;
ok 3 - The object isa Bio::SeqIO
ok 4 - The object isa Bio::PrimarySeqI
ok 5 - The object isa Bio::SeqAnalysisParserI
ok 6
ok 7
ok 8
ok 9 - The object isa Bio::PrimarySeqI
ok 10 - The object isa Bio::SeqAnalysisParserI
ok 11
ok 12
ok 13 - The object isa Bio::SeqAnalysisParserI
ok 14
ok
t/SeqFeature/SeqFeatAnnotated.t .............. skipped: Network tests have not been requested
t/SeqFeature/SeqFeatCollection.t ............. skipped: The optional module DB_File (or dependencies thereof) was not installed
Subroutine new redefined at Bio\SeqFeature\Generic.pm line 153.
Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195.
Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 265.
Subroutine location redefined at Bio\SeqFeature\Generic.pm line 286.
Subroutine start redefined at Bio\SeqFeature\Generic.pm line 316.
Subroutine end redefined at Bio\SeqFeature\Generic.pm line 333.
Subroutine length redefined at Bio\SeqFeature\Generic.pm line 350.
Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 367.
Subroutine score redefined at Bio\SeqFeature\Generic.pm line 384.
Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 418.
Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 446.
Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 465.
Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 483.
Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 498.
Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 518.
Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 544.
Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 560.
Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 585.
Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 614.
Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 656.
Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 679.
Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 696.
Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 720.
Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 751.
Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 775.
Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 814.
Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 846.
Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 876.
Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 899.
Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 936.
Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 958.
Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 989.
Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1006.
Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1022.
Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1028.
Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1035.
Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1036.
Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1047.
Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1040.
Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1041.
Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1042.
Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1044.
t/SeqFeature/SeqFeature.t .................... 
1..249
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::SeqFeature::FeaturePair;
ok 5 - use Bio::SeqFeature::Computation;
ok 6 - use Bio::SeqFeature::Gene::Transcript;
ok 7 - use Bio::SeqFeature::Gene::UTR;
ok 8 - use Bio::SeqFeature::Gene::Exon;
ok 9 - use Bio::SeqFeature::Gene::Poly_A_site;
ok 10 - use Bio::SeqFeature::Gene::GeneStructure;
ok 11 - use Bio::Location::Fuzzy;
ok 12 - start of feature location
ok 13 - end of feature location
ok 14 - primary tag
ok 15 - source tag
ok 16 - undef phase by default
ok 17 - phase accessor returns
ok 18 - phase is persistent
ok 19
ok 20 - set phase from constructor
ok 21
ok 22 - feature1 of pair stored
ok 23 - feature2 of pair stored
ok 24 - feature start
ok 25 - feature end
ok 26 - primary tag
ok 27 - source tag
ok 28 - hstart
ok 29 - hend
ok 30 - hprimary tag
ok 31 - hsource tag
ok 32 - inverted end
ok 33
ok 34 - seq string
ok 35 - sf1 end
ok 36 - sf1 start
ok 37
ok 38 - sf2
ok 39
ok 40 - computation id
ok 41 - score value
ok 42
ok 43
ok 44 - sft[0] is exon
ok 45
ok 46 - computation id
ok 47
ok 48 - score value
ok 49 - sfeat start for EXPAND-ED feature (bug \#947)
ok 50 - sfeat end for EXPAND-ED feature (bug \#947)
ok 51
ok 52 - can create feature starting and ending at 0
ok 53
ok 54 - can create feature starting and ending at 0
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74 - mRNA spliced length
ok 75 - has 2 UTRs
ok 76
ok 77
ok 78
ok 79
ok 80 - The object isa Bio::SeqIO
ok 81 - The object isa Bio::Seq
ok 82 # skip Network tests have not been requested
ok 83 # skip Network tests have not been requested
ok 84 # skip Network tests have not been requested
ok 85 # skip Network tests have not been requested
ok 86 # skip Network tests have not been requested
ok 87 - The object isa Bio::SeqIO
ok 88 - The object isa Bio::Seq
ok 89 # skip Network tests have not been requested
ok 90 # skip Network tests have not been requested
ok 91 - The object isa Bio::SeqIO
ok 92 - spliced seq translation matches expected
ok 93 - spliced seq translation matches expected
ok 94 - spliced seq translation matches expected
ok 95 - spliced seq translation matches expected
ok 96 - spliced seq translation matches expected
ok 97 - spliced seq translation matches expected
ok 98 - spliced seq translation matches expected
ok 99 - spliced seq translation matches expected
ok 100 - spliced seq translation matches expected
ok 101 - spliced seq translation matches expected
ok 102 - spliced seq translation matches expected
ok 103 - spliced seq translation matches expected
ok 104 - spliced seq translation matches expected
ok 105 - spliced seq translation matches expected
ok 106 - spliced seq translation matches expected
ok 107 - spliced seq translation matches expected
ok 108 - spliced seq translation matches expected
ok 109 - spliced seq translation matches expected
ok 110 - spliced seq translation matches expected
ok 111 - spliced seq translation matches expected
ok 112 - spliced seq translation matches expected
ok 113 - spliced seq translation matches expected
ok 114 - spliced seq translation matches expected
ok 115 - spliced seq translation matches expected
ok 116 - spliced seq translation matches expected
ok 117 - spliced seq translation matches expected
ok 118 - spliced seq translation matches expected
ok 119 - spliced seq translation matches expected
ok 120 - spliced seq translation matches expected
ok 121 - spliced seq translation matches expected
ok 122 - spliced seq translation matches expected
ok 123 - spliced seq translation matches expected
ok 124 - spliced seq translation matches expected
ok 125 - spliced seq translation matches expected
ok 126 - spliced seq translation matches expected
ok 127 - spliced seq translation matches expected
ok 128 - spliced seq translation matches expected
ok 129 - spliced seq translation matches expected
ok 130 - spliced seq translation matches expected
ok 131 - spliced seq translation matches expected
ok 132 - spliced seq translation matches expected
ok 133 - spliced seq translation matches expected
ok 134 - spliced seq translation matches expected
ok 135 - spliced seq translation matches expected
ok 136 - spliced seq translation matches expected
ok 137 - spliced seq translation matches expected
ok 138 - spliced seq translation matches expected
ok 139 - spliced seq translation matches expected
ok 140 - spliced seq translation matches expected
ok 141 - spliced seq translation matches expected
ok 142 - spliced seq translation matches expected
ok 143 - spliced seq translation matches expected
ok 144 - spliced seq translation matches expected
ok 145 - spliced seq translation matches expected
ok 146 - spliced seq translation matches expected
ok 147 - spliced seq translation matches expected
ok 148 - spliced seq translation matches expected
ok 149 - spliced seq translation matches expected
ok 150 - spliced seq translation matches expected
ok 151 - spliced seq translation matches expected
ok 152 - spliced seq translation matches expected
ok 153 - spliced seq translation matches expected
ok 154 - spliced seq translation matches expected
ok 155 - spliced seq translation matches expected
ok 156 - spliced seq translation matches expected
ok 157 - spliced seq translation matches expected
ok 158 - spliced seq translation matches expected
ok 159 - spliced seq translation matches expected
ok 160 - spliced seq translation matches expected
ok 161 - spliced seq translation matches expected
ok 162 - spliced seq translation matches expected
ok 163 - spliced seq translation matches expected
ok 164 - spliced seq translation matches expected
ok 165 - spliced seq translation matches expected
ok 166 - spliced seq translation matches expected
ok 167 - spliced seq translation matches expected
ok 168 - spliced seq translation matches expected
ok 169 - spliced seq translation matches expected
ok 170 - spliced seq translation matches expected
ok 171 - spliced seq translation matches expected
ok 172 - spliced seq translation matches expected
ok 173 - spliced seq translation matches expected
ok 174 - spliced seq translation matches expected
ok 175 - spliced seq translation matches expected
ok 176 - spliced seq translation matches expected
ok 177 - spliced seq translation matches expected
ok 178 - spliced seq translation matches expected
ok 179 - spliced seq translation matches expected
ok 180 - spliced seq translation matches expected
ok 181 - spliced seq translation matches expected
ok 182 - spliced seq translation matches expected
ok 183 - spliced seq translation matches expected
ok 184 - spliced seq translation matches expected
ok 185 - spliced seq translation matches expected
ok 186 - spliced seq translation matches expected
ok 187 - spliced seq translation matches expected
ok 188 - spliced seq translation matches expected
ok 189 - spliced seq translation matches expected
ok 190 - spliced seq translation matches expected
ok 191 - spliced seq translation matches expected
ok 192 - spliced seq translation matches expected
ok 193 - spliced seq translation matches expected
ok 194 - spliced seq translation matches expected
ok 195 - spliced seq translation matches expected
ok 196 - spliced seq translation matches expected
ok 197 - spliced seq translation matches expected
ok 198 - spliced seq translation matches expected
ok 199 - spliced seq translation matches expected
ok 200 - spliced seq translation matches expected
ok 201 - spliced seq translation matches expected
ok 202 - spliced seq translation matches expected
ok 203 - spliced seq translation matches expected
ok 204 - spliced seq translation matches expected
ok 205 - spliced seq translation matches expected
ok 206 - spliced seq translation matches expected
ok 207 - spliced seq translation matches expected
ok 208 - spliced seq translation matches expected
ok 209
ok 210 - phase check
ok 211
ok 212 - phase check
ok 213
ok 214 - phase check
ok 215
ok 216 - phase check
ok 217
ok 218 - phase check
ok 219 - tags found
ok 220 - get_tagset_values tag values found
ok 221 - get_tagset_values tag values for multiple tags found
ok 222 - get_tag_values tag values found
ok 223 - get_tag_values lives with tag
ok 224 - get_tagset_values no tag values found
ok 225 - get_tagset_values lives with no tag
ok 226 - get_tag_values throws with no tag
ok 227 - Phi-X174 genome is circular
ok 228 - only 3 split locations
ok 229 - The object isa Bio::Location::SplitLocationI
ok 230 - feature string
ok 231 - first ten nucleotides
ok 232 - strand
not ok 233 - start # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'start'
#   at t/SeqFeature/SeqFeature.t line 421.
#          got: '1'
#     expected: '3981'
not ok 234 - end # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'end'
#   at t/SeqFeature/SeqFeature.t line 422.
#          got: '5386'
#     expected: '136'
not ok 235 - expected length # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'expected length'
#   at t/SeqFeature/SeqFeature.t line 423.
#          got: '5386'
#     expected: '1542'
ok 236 - The object isa Bio::Location::SplitLocationI
ok 237 - feature string
ok 238 - first ten nucleotides
ok 239 - strand
not ok 240 - start # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'start'
#   at t/SeqFeature/SeqFeature.t line 421.
#          got: '1'
#     expected: '4497'
not ok 241 - end # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'end'
#   at t/SeqFeature/SeqFeature.t line 422.
#          got: '5386'
#     expected: '136'
not ok 242 - expected length # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'expected length'
#   at t/SeqFeature/SeqFeature.t line 423.
#          got: '5386'
#     expected: '1026'
ok 243 - The object isa Bio::Location::SplitLocationI
ok 244 - feature string
ok 245 - first ten nucleotides
ok 246 - strand
not ok 247 - start # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'start'
#   at t/SeqFeature/SeqFeature.t line 421.
#          got: '1'
#     expected: '5075'
not ok 248 - end # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'end'
#   at t/SeqFeature/SeqFeature.t line 422.
#          got: '5386'
#     expected: '136'
not ok 249 - expected length # TODO Need to define how to deal with start, end length for circular sequences

#   Failed (TODO) test 'expected length'
#   at t/SeqFeature/SeqFeature.t line 423.
#          got: '5386'
#     expected: '363'
ok
t/SeqFeature/SeqFeaturePrimer.t .............. 
1..8
ok 1 - use Bio::SeqFeature::Primer;
ok 2 - The object isa Bio::SeqFeature::Primer
ok 3 - The object isa Bio::SeqFeature::Primer
ok 4 - The object isa Bio::Seq
ok 5
ok 6
ok 7
ok 8
ok
t/SeqFeature/Unflattener.t ................... 
1..10
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Tools::Unflattener;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok
t/SeqFeature/Unflattener2.t .................. 
1..12
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Tools::Unflattener;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/SeqIO/Handler.t ............................ 
1..561
ok 1 - use Bio::SeqIO;
ok 2 - AI129902
ok 3
ok 4
ok 5
ok 6 - NT_021877
ok 7
ok 8
ok 9
ok 10
ok 11 - BAB68554
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21 - operator overloading in AnnotationI is deprecated
ok 22 - NC_006346
ok 23
ok 24
ok 25 - U71225
ok 26
ok 27 - AB077698
ok 28
ok 29 - DQ018368
ok 30 - D10483
ok 31
ok 32
ok 33
ok 34 - bug 1487
ok 35
ok 36 - bug 1647
ok 37
ok 38
ok 39 - bug 1673
ok 40
ok 41
ok 42
ok 43 - AF165282
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52 - species parsing incorrect for genbank
ok 53 - genus duplicated in genbank parsing
ok 54
ok 55
ok 56 - species parsing incorrect for genbank
ok 57 - genus duplicated in genbank parsing
ok 58
ok 59
ok 60 - species parsing incorrect for genbank
ok 61 - genus duplicated in genbank parsing
ok 62
ok 63 - streaming
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69 - Total number of sequences in test file
ok 70
ok 71 - Fuzzy in
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83 - Fuzzy out
ok 84 - BK000016
ok 85
ok 86 - BK000016
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101 - BK000016
ok 102 - roundtrip
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120 - revcomp split location
ok 121 - Bug 1925
ok 122
ok 123
ok 124 - wgs
ok 125
ok 126 - wgs_scafld
ok 127
ok 128 - wgs_scafld
ok 129
ok 130
ok 131 - BC000007
ok 132 - BK000016-tpa.gbk
ok 133 - ay116458.gb
ok 134 - ay149291.gb
ok 135 - NC_006346.gb
ok 136 - ay007676.gb
ok 137 - dq519393.gb
ok 138
ok 139 - swissprot:K1C9_HUMAN
ok 140
ok 141 - swissprot
ok 142
ok 143 - GenBank:Z29074.1
ok 144
ok 145 - GenBank
ok 146
ok 147 - GenPept:CAA82315.1
ok 148
ok 149 - GenPept
ok 150
ok 151 - GenBank:S69510.1
ok 152
ok 153 - GenBank
ok 154
ok 155 - GenPept:AAC60619.1
ok 156
ok 157 - GenPept
ok 158
ok 159 - GenBank:X75015.1
ok 160
ok 161 - GenBank
ok 162
ok 163 - GenPept:CAA52924.1
ok 164
ok 165 - GenPept
ok 166
ok 167 - GenBank:AB001594.1
ok 168
ok 169 - GenBank
ok 170
ok 171 - GenPept:BAA19418.1
ok 172
ok 173 - GenPept
ok 174
ok 175 - GenBank:I37984
ok 176
ok 177 - GenBank
ok 178
ok 179 - HSSP:P08670
ok 180
ok 181 - HSSP
ok 182
ok 183 - IntAct:P35527
ok 184
ok 185 - IntAct
ok 186
ok 187 - Ensembl:ENSG00000171403
ok 188
ok 189 - Ensembl
ok 190
ok 191 - KEGG:hsa:3857
ok 192
ok 193 - KEGG
ok 194
ok 195 - HGNC:6447
ok 196
ok 197 - HGNC
ok 198
ok 199 - MIM:144200
ok 200
ok 201 - MIM
ok 202
ok 203 - MIM:607606
ok 204
ok 205 - MIM
ok 206
ok 207 - ArrayExpress:P35527
ok 208
ok 209 - ArrayExpress
ok 210
ok 211 - GO:0005200
ok 212
ok 213 - GO
ok 214
ok 215 - GO:0008544
ok 216
ok 217 - GO
ok 218
ok 219 - InterPro:IPR011000
ok 220
ok 221 - InterPro
ok 222
ok 223 - InterPro:IPR001664
ok 224
ok 225 - InterPro
ok 226
ok 227 - InterPro:IPR002957
ok 228
ok 229 - InterPro
ok 230
ok 231 - Pfam:PF00038
ok 232
ok 233 - Pfam
ok 234
ok 235 - PRINTS:PR01248
ok 236
ok 237 - PRINTS
ok 238
ok 239 - PROSITE:PS00226
ok 240
ok 241 - PROSITE
ok 242
ok 243 - Bug 2195
ok 244 - Bug 2195
ok 245 - The object isa Bio::Annotation::SimpleValue
ok 246
ok 247 - The object isa Bio::Annotation::SimpleValue
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273 - success reading Embl with ^ location and badly split double quotes
ok 274
ok 275
ok 276 - success writing Embl format with ^ < and > locations
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309 - genus duplication test
ok 310
ok 311
ok 312 - The object isa Bio::SeqIO
ok 313 - The object isa Bio::Species
ok 314
ok 315
ok 316 - operator overloading in AnnotationI is deprecated
ok 317
ok 318 - dates
ok 319 - dates
ok 320 - dates
ok 321
ok 322 - The object isa Bio::Seq::RichSeqI
ok 323
ok 324
ok 325
ok 326 - operator overloading in AnnotationI is deprecated
ok 327
ok 328
ok 329
ok 330
ok 331 - id is ROA1_HUMAN
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339 - operator overloading in AnnotationI is deprecated
ok 340
ok 341
ok 342
ok 343 - The object isa Bio::Seq::RichSeqI
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353 - operator overloading in AnnotationI is deprecated
ok 354
ok 355
ok 356
ok 357 - GC1QBP
ok 358 - HABP1
ok 359 - SF2P32
ok 360 - C1QBP
ok 361
ok 362 - The object isa Bio::Seq::RichSeqI
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369 - F54H12.1
ok 370 - The object isa Bio::Seq::RichSeqI
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382 - The object isa Bio::Seq::RichSeqI
ok 383
ok 384
ok 385
ok 386
ok 387 - The object isa Bio::Seq::RichSeqI
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401 - The object isa Bio::Seq::RichSeqI
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485 - The object isa Bio::Species
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517 - The object isa Bio::Species
ok 518
ok 519
ok 520 - operator overloading in AnnotationI is deprecated
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551 - P39765
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561 - operator overloading in AnnotationI is deprecated
ok
t/SeqIO/MultiFile.t .......................... 
1..3
ok 1 - use Bio::SeqIO::MultiFile;
ok 2
ok 3
ok
t/SeqIO/Multiple_fasta.t ..................... 
1..9
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - all sequences in the file
ok
t/SeqIO/SeqBuilder.t ......................... 
1..101
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - The object isa Bio::Factory::ObjectBuilderI
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok
t/SeqIO/SeqIO.t .............................. 
1..45
ok 1 - use Bio::SeqIO;
ok 2
ok 3 - ID for format gcg
ok 4
ok 5
ok 6
ok 7
ok 8 - ID for format fasta
ok 9
ok 10
ok 11
ok 12 - accession.version
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - ID for format pir
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - ID for format tab
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - ID for format ace
ok 32
ok 33
ok 34
ok 35
ok 36 - use Algorithm::Diff;
ok 37 - use IO::ScalarArray;
ok 38 - use IO::String;
ok 39
ok 40
ok 41
not ok 42 - Must pass a file or file handle # TODO file/fh-based tests should be in Bio::Root::IO, see issue #3204

#   Failed (TODO) test 'Must pass a file or file handle'
#   at t/SeqIO/SeqIO.t line 120.
# expecting: Regexp ((?-xism:No file, fh, or string argument provided))
# found: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: Could not guess format from file/fh
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::SeqIO::new Bio/SeqIO.pm:389
# STACK: Test::Exception::throws_ok t/SeqIO/SeqIO.t:119
# STACK: t/SeqIO/SeqIO.t:120
# -----------------------------------------------------------
# )
ok 43 - Must pass a file or file handle
ok 44 - Must pass a file or file handle
ok 45 - Must pass a real file
ok
t/SeqIO/Splicedseq.t ......................... 
1..14
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - get_SeqFeatures()
ok 12 - protein sequence
ok 13 - nucleotide sequence - correct CDS range
ok 14 - nucleotide length
ok
t/SeqIO/abi.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
t/SeqIO/ace.t ................................ 
1..7
ok 1 - use Bio::SeqIO;
ok 2 - number of sequence objects
ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters
ok 4 - alphabets detected
ok 5 - alphabets detected
ok 6 - writing sequence
ok 7 - test output
ok
t/SeqIO/agave.t .............................. 
1..8
ok 1 - use Bio::SeqIO::agave;
not ok 2 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for agave format -- no sample file to test against
ok
t/SeqIO/alf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
t/SeqIO/asciitree.t .......................... 
1..2
ok 1 - use Bio::SeqIO;
ok 2 - File exists, has contents on MSWin32
ok
Subroutine next_seq redefined at Bio\SeqIO\bsml.pm line 187.
Subroutine GETFLOPPIES redefined at Bio\SeqIO\bsml.pm line 428.
Subroutine FLOPPYVALS redefined at Bio\SeqIO\bsml.pm line 444.
Subroutine FIRSTDATA redefined at Bio\SeqIO\bsml.pm line 464.
Subroutine STRIP redefined at Bio\SeqIO\bsml.pm line 481.
Subroutine to_bsml redefined at Bio\SeqIO\bsml.pm line 547.
Subroutine write_seq redefined at Bio\SeqIO\bsml.pm line 846.
Subroutine _parse_location redefined at Bio\SeqIO\bsml.pm line 894.
Subroutine _parse_bsml_feature redefined at Bio\SeqIO\bsml.pm line 947.
Subroutine _parse_bsml_location redefined at Bio\SeqIO\bsml.pm line 1026.
Subroutine _parse_reference redefined at Bio\SeqIO\bsml.pm line 1083.
Subroutine _parse_annotation redefined at Bio\SeqIO\bsml.pm line 1149.
Subroutine _parse_annotation_old redefined at Bio\SeqIO\bsml.pm line 1221.
Subroutine _add_page redefined at Bio\SeqIO\bsml.pm line 1266.
Subroutine _addel redefined at Bio\SeqIO\bsml.pm line 1305.
Subroutine _show_dna redefined at Bio\SeqIO\bsml.pm line 1329.
Subroutine _initialize redefined at Bio\SeqIO\bsml.pm line 1349.
Subroutine _parseparams redefined at Bio\SeqIO\bsml.pm line 1388.
Subroutine _parse_xml redefined at Bio\SeqIO\bsml.pm line 1415.
Subroutine DESTROY redefined at Bio\SeqIO\bsml.pm line 1428.
t/SeqIO/bsml.t ............................... 
1..16
ok 1 - use XML::DOM;
ok 2 - use Bio::SeqIO::bsml;
ok 3 - The object isa Bio::Seq::RichSeqI
ok 4 - got correct number of refs
ok 5 - display_id
ok 6 - molecule
ok 7 - is_circular
ok 8 - dates
ok 9 - accession_number
ok 10 - seq_version
ok 11 - got correct number of SeqFeatures
ok 12 - feature start
ok 13 - feature end
ok 14 - get_tag_values db_xref
ok 15 - get_Annotations reference
ok 16 - get_Annotations dblink
ok
t/SeqIO/bsml_sax.t ........................... 
1..15
ok 1 - use Bio::SeqIO;
ok 2 - The object isa Bio::Seq::RichSeqI
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/SeqIO/chadoxml.t ........................... 
1..8
ok 1 - use Bio::SeqIO::chadoxml;
not ok 2 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
ok
t/SeqIO/chaos.t .............................. 
1..8
ok 1 - use Bio::SeqIO::chaos;
not ok 2 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for chaos format -- no sample file to test against
ok
t/SeqIO/chaosxml.t ........................... 
1..2
ok 1 - use Bio::SeqIO;
ok 2
ok
t/SeqIO/ctf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
Subroutine _initialize redefined at Bio\SeqIO\embl.pm line 154.
Subroutine next_seq redefined at Bio\SeqIO\embl.pm line 179.
Subroutine _write_ID_line redefined at Bio\SeqIO\embl.pm line 494.
Subroutine _is_valid_division redefined at Bio\SeqIO\embl.pm line 571.
Subroutine _is_valid_molecule_type redefined at Bio\SeqIO\embl.pm line 604.
Subroutine write_seq redefined at Bio\SeqIO\embl.pm line 637.
Subroutine _print_EMBL_FTHelper redefined at Bio\SeqIO\embl.pm line 935.
Subroutine _read_EMBL_Contig redefined at Bio\SeqIO\embl.pm line 999.
Subroutine _read_EMBL_References redefined at Bio\SeqIO\embl.pm line 1030.
Subroutine _read_EMBL_Species redefined at Bio\SeqIO\embl.pm line 1098.
Subroutine _read_EMBL_DBLink redefined at Bio\SeqIO\embl.pm line 1205.
Subroutine _read_EMBL_TaxID_DBLink redefined at Bio\SeqIO\embl.pm line 1239.
Subroutine _filehandle redefined at Bio\SeqIO\embl.pm line 1272.
Subroutine _read_FTHelper_EMBL redefined at Bio\SeqIO\embl.pm line 1293.
Subroutine _write_line_EMBL redefined at Bio\SeqIO\embl.pm line 1418.
Subroutine _write_line_EMBL_regex redefined at Bio\SeqIO\embl.pm line 1454.
Subroutine _post_sort redefined at Bio\SeqIO\embl.pm line 1506.
Subroutine _show_dna redefined at Bio\SeqIO\embl.pm line 1527.
Subroutine _id_generation_func redefined at Bio\SeqIO\embl.pm line 1548.
Subroutine _ac_generation_func redefined at Bio\SeqIO\embl.pm line 1569.
Subroutine _sv_generation_func redefined at Bio\SeqIO\embl.pm line 1590.
Subroutine _kw_generation_func redefined at Bio\SeqIO\embl.pm line 1611.
t/SeqIO/embl.t ............................... 
1..95
ok 1 - use Bio::SeqIO::embl;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 - success reading Embl with ^ location and badly split double quotes
ok 25
ok 26 - success writing Embl format with ^ < and > locations
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - genus duplication test
ok 55
ok 56
ok 57
ok 58
ok 59 - CDS - accession on PA line
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - CDS - OX tagname
ok 68 - CDS - OX database
ok 69 - CDS - OX primary_id
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85 - Check if product was parsed correctly
ok 86 - Parse long qualifier
ok 87
ok 88 - TaxID set correctly
ok 89 - The read sequence has a species object
ok 90 - NCBI TaxID has roundtripped
ok 91 - Name has roundtripped
ok 92 - TaxID set correctly
ok 93 - The read sequence has a species object
ok 94 - The taxid of the source feature overrides that of the OX line
ok 95 - Name has roundtripped
ok

Timeout (max run time is 420s)
C:\Perl-5.12\bin\perl.exe exits with 37