PATH=C:\Program Files\Microsoft Platform SDK\Bin;C:\Program Files\Microsoft Platform SDK\Bin\WinNT;C:\Program Files\Microsoft Visual Studio\VC98\Bin;C:\Program Files\Microsoft Visual Studio\Common\MSDev98\Bin;C:\cygwin\bin;C:\cpanfly-5.16\var\megalib\bin;C:\Perl-5.16\site\bin;C:\Perl-5.16\bin;C:\cygwin\bin;C:\Program Files\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\instantclient_11_2;C:\cygwin\bin;C:\Program Files\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\mysql\bin Start 2014-07-15T06:43:17 ActivePerl-1600 CPAN-2.00 LIB=C:\PROGRA~1\MICROS~3\VC98\Lib\PSDK;C:\PROGRA~1\MICROS~2\Lib;C:\PROGRA~1\MICROS~3\VC98\Lib;C:\PROGRA~1\MICROS~3\VC98\MFC\Lib INCLUDE=C:\PROGRA~1\MICROS~2\Include;C:\PROGRA~1\MICROS~3\VC98\ATL\Include;C:\PROGRA~1\MICROS~3\VC98\Include;C:\PROGRA~1\MICROS~3\VC98\MFC\Include PATH=C:/CPANFL~1.16/var/libs/bin;C:\PROGRA~1\MICROS~2\Bin;C:\PROGRA~1\MICROS~2\Bin\WinNT;C:\PROGRA~1\MICROS~3\VC98\Bin;C:\PROGRA~1\MICROS~3\Common\MSDev98\Bin;C:\cygwin\bin;C:\CPANFL~1.16\var\megalib\bin;C:\Perl-5.16\site\bin;C:\Perl-5.16\bin;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\INSTAN~1;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\mysql\bin Reading 'C:\cpanfly-5.16\var\cpan\Metadata' Database was generated on Tue, 15 Jul 2014 08:41:02 GMT Running make for C/CJ/CJFIELDS/BioPerl-1.6.924.tar.gz Fetching with LWP: http://cpan.nas1.activestate.com/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.924.tar.gz Fetching with LWP: http://cpan.nas1.activestate.com/authors/id/C/CJ/CJFIELDS/CHECKSUMS Checksum for C:\cpanfly-5.16\var\cpan\sources\authors\id\C\CJ\CJFIELDS\BioPerl-1.6.924.tar.gz ok BioPerl-1.6.924 BioPerl-1.6.924/.travis.yml BioPerl-1.6.924/AUTHORS BioPerl-1.6.924/BioPerl.pm BioPerl-1.6.924/BUGS BioPerl-1.6.924/Build.PL BioPerl-1.6.924/Changes BioPerl-1.6.924/DEPENDENCIES BioPerl-1.6.924/DEPRECATED BioPerl-1.6.924/INSTALL BioPerl-1.6.924/INSTALL.SKIP BioPerl-1.6.924/INSTALL.WIN BioPerl-1.6.924/LICENSE BioPerl-1.6.924/MANIFEST BioPerl-1.6.924/META.json BioPerl-1.6.924/META.yml BioPerl-1.6.924/README BioPerl-1.6.924/README.md BioPerl-1.6.924/Bio BioPerl-1.6.924/Bio/AlignIO.pm BioPerl-1.6.924/Bio/AnalysisI.pm BioPerl-1.6.924/Bio/AnalysisParserI.pm BioPerl-1.6.924/Bio/AnalysisResultI.pm BioPerl-1.6.924/Bio/AnnotatableI.pm BioPerl-1.6.924/Bio/AnnotationCollectionI.pm BioPerl-1.6.924/Bio/AnnotationI.pm BioPerl-1.6.924/Bio/ClusterI.pm BioPerl-1.6.924/Bio/ClusterIO.pm BioPerl-1.6.924/Bio/DasI.pm BioPerl-1.6.924/Bio/DBLinkContainerI.pm BioPerl-1.6.924/Bio/DescribableI.pm BioPerl-1.6.924/Bio/FeatureHolderI.pm BioPerl-1.6.924/Bio/HandlerBaseI.pm BioPerl-1.6.924/Bio/IdCollectionI.pm BioPerl-1.6.924/Bio/IdentifiableI.pm BioPerl-1.6.924/Bio/LocatableSeq.pm BioPerl-1.6.924/Bio/LocationI.pm BioPerl-1.6.924/Bio/MapIO.pm BioPerl-1.6.924/Bio/NexmlIO.pm BioPerl-1.6.924/Bio/OntologyIO.pm BioPerl-1.6.924/Bio/ParameterBaseI.pm BioPerl-1.6.924/Bio/Perl.pm BioPerl-1.6.924/Bio/PhyloNetwork.pm BioPerl-1.6.924/Bio/PrimarySeq.pm BioPerl-1.6.924/Bio/PrimarySeqI.pm BioPerl-1.6.924/Bio/PullParserI.pm BioPerl-1.6.924/Bio/Range.pm BioPerl-1.6.924/Bio/RangeI.pm BioPerl-1.6.924/Bio/SearchDist.pm BioPerl-1.6.924/Bio/SearchIO.pm BioPerl-1.6.924/Bio/Seq.pm BioPerl-1.6.924/Bio/SeqAnalysisParserI.pm BioPerl-1.6.924/Bio/SeqFeatureI.pm BioPerl-1.6.924/Bio/SeqI.pm BioPerl-1.6.924/Bio/SeqIO.pm BioPerl-1.6.924/Bio/SeqUtils.pm BioPerl-1.6.924/Bio/SimpleAlign.pm BioPerl-1.6.924/Bio/SimpleAnalysisI.pm BioPerl-1.6.924/Bio/Species.pm BioPerl-1.6.924/Bio/Taxon.pm BioPerl-1.6.924/Bio/Taxonomy.pm BioPerl-1.6.924/Bio/TreeIO.pm BioPerl-1.6.924/Bio/UpdateableSeqI.pm BioPerl-1.6.924/Bio/WebAgent.pm BioPerl-1.6.924/Bio/Align BioPerl-1.6.924/Bio/Align/AlignI.pm BioPerl-1.6.924/Bio/Align/DNAStatistics.pm BioPerl-1.6.924/Bio/Align/Graphics.pm BioPerl-1.6.924/Bio/Align/PairwiseStatistics.pm BioPerl-1.6.924/Bio/Align/ProteinStatistics.pm BioPerl-1.6.924/Bio/Align/StatisticsI.pm BioPerl-1.6.924/Bio/Align/Utilities.pm BioPerl-1.6.924/Bio/AlignIO BioPerl-1.6.924/Bio/AlignIO/arp.pm BioPerl-1.6.924/Bio/AlignIO/bl2seq.pm BioPerl-1.6.924/Bio/AlignIO/clustalw.pm BioPerl-1.6.924/Bio/AlignIO/emboss.pm BioPerl-1.6.924/Bio/AlignIO/fasta.pm BioPerl-1.6.924/Bio/AlignIO/largemultifasta.pm BioPerl-1.6.924/Bio/AlignIO/maf.pm BioPerl-1.6.924/Bio/AlignIO/mase.pm BioPerl-1.6.924/Bio/AlignIO/mega.pm BioPerl-1.6.924/Bio/AlignIO/meme.pm BioPerl-1.6.924/Bio/AlignIO/metafasta.pm BioPerl-1.6.924/Bio/AlignIO/msf.pm BioPerl-1.6.924/Bio/AlignIO/nexml.pm BioPerl-1.6.924/Bio/AlignIO/nexus.pm BioPerl-1.6.924/Bio/AlignIO/pfam.pm BioPerl-1.6.924/Bio/AlignIO/phylip.pm BioPerl-1.6.924/Bio/AlignIO/po.pm BioPerl-1.6.924/Bio/AlignIO/proda.pm BioPerl-1.6.924/Bio/AlignIO/prodom.pm BioPerl-1.6.924/Bio/AlignIO/psi.pm BioPerl-1.6.924/Bio/AlignIO/selex.pm BioPerl-1.6.924/Bio/AlignIO/stockholm.pm BioPerl-1.6.924/Bio/AlignIO/xmfa.pm BioPerl-1.6.924/Bio/AlignIO/Handler BioPerl-1.6.924/Bio/AlignIO/Handler/GenericAlignHandler.pm BioPerl-1.6.924/Bio/Annotation BioPerl-1.6.924/Bio/Annotation/AnnotationFactory.pm BioPerl-1.6.924/Bio/Annotation/Collection.pm BioPerl-1.6.924/Bio/Annotation/Comment.pm BioPerl-1.6.924/Bio/Annotation/DBLink.pm BioPerl-1.6.924/Bio/Annotation/OntologyTerm.pm BioPerl-1.6.924/Bio/Annotation/Reference.pm BioPerl-1.6.924/Bio/Annotation/Relation.pm BioPerl-1.6.924/Bio/Annotation/SimpleValue.pm BioPerl-1.6.924/Bio/Annotation/StructuredValue.pm BioPerl-1.6.924/Bio/Annotation/TagTree.pm BioPerl-1.6.924/Bio/Annotation/Target.pm BioPerl-1.6.924/Bio/Annotation/Tree.pm BioPerl-1.6.924/Bio/Annotation/TypeManager.pm BioPerl-1.6.924/Bio/Assembly BioPerl-1.6.924/Bio/Assembly/Contig.pm BioPerl-1.6.924/Bio/Assembly/ContigAnalysis.pm BioPerl-1.6.924/Bio/Assembly/IO.pm BioPerl-1.6.924/Bio/Assembly/Scaffold.pm BioPerl-1.6.924/Bio/Assembly/ScaffoldI.pm BioPerl-1.6.924/Bio/Assembly/Singlet.pm BioPerl-1.6.924/Bio/Assembly/IO BioPerl-1.6.924/Bio/Assembly/IO/ace.pm BioPerl-1.6.924/Bio/Assembly/IO/bowtie.pm BioPerl-1.6.924/Bio/Assembly/IO/maq.pm BioPerl-1.6.924/Bio/Assembly/IO/phrap.pm BioPerl-1.6.924/Bio/Assembly/IO/sam.pm BioPerl-1.6.924/Bio/Assembly/IO/tigr.pm BioPerl-1.6.924/Bio/Assembly/Tools BioPerl-1.6.924/Bio/Assembly/Tools/ContigSpectrum.pm BioPerl-1.6.924/Bio/Cluster BioPerl-1.6.924/Bio/Cluster/ClusterFactory.pm BioPerl-1.6.924/Bio/Cluster/FamilyI.pm BioPerl-1.6.924/Bio/Cluster/SequenceFamily.pm BioPerl-1.6.924/Bio/Cluster/UniGene.pm BioPerl-1.6.924/Bio/Cluster/UniGeneI.pm BioPerl-1.6.924/Bio/ClusterIO BioPerl-1.6.924/Bio/ClusterIO/dbsnp.pm BioPerl-1.6.924/Bio/ClusterIO/unigene.pm BioPerl-1.6.924/Bio/CodonUsage BioPerl-1.6.924/Bio/CodonUsage/IO.pm BioPerl-1.6.924/Bio/CodonUsage/Table.pm BioPerl-1.6.924/Bio/Coordinate BioPerl-1.6.924/Bio/Coordinate/Chain.pm BioPerl-1.6.924/Bio/Coordinate/Collection.pm BioPerl-1.6.924/Bio/Coordinate/ExtrapolatingPair.pm BioPerl-1.6.924/Bio/Coordinate/GeneMapper.pm BioPerl-1.6.924/Bio/Coordinate/Graph.pm BioPerl-1.6.924/Bio/Coordinate/MapperI.pm BioPerl-1.6.924/Bio/Coordinate/Pair.pm BioPerl-1.6.924/Bio/Coordinate/Result.pm BioPerl-1.6.924/Bio/Coordinate/ResultI.pm BioPerl-1.6.924/Bio/Coordinate/Utils.pm BioPerl-1.6.924/Bio/Coordinate/Result BioPerl-1.6.924/Bio/Coordinate/Result/Gap.pm BioPerl-1.6.924/Bio/Coordinate/Result/Match.pm BioPerl-1.6.924/Bio/Das BioPerl-1.6.924/Bio/Das/FeatureTypeI.pm BioPerl-1.6.924/Bio/Das/SegmentI.pm BioPerl-1.6.924/Bio/DB BioPerl-1.6.924/Bio/DB/Ace.pm BioPerl-1.6.924/Bio/DB/BioFetch.pm BioPerl-1.6.924/Bio/DB/CUTG.pm BioPerl-1.6.924/Bio/DB/DBFetch.pm BioPerl-1.6.924/Bio/DB/EMBL.pm BioPerl-1.6.924/Bio/DB/EntrezGene.pm BioPerl-1.6.924/Bio/DB/Expression.pm BioPerl-1.6.924/Bio/DB/Failover.pm BioPerl-1.6.924/Bio/DB/Fasta.pm BioPerl-1.6.924/Bio/DB/FileCache.pm BioPerl-1.6.924/Bio/DB/Flat.pm BioPerl-1.6.924/Bio/DB/GenBank.pm BioPerl-1.6.924/Bio/DB/GenericWebAgent.pm BioPerl-1.6.924/Bio/DB/GenPept.pm BioPerl-1.6.924/Bio/DB/GFF.pm BioPerl-1.6.924/Bio/DB/HIV.pm BioPerl-1.6.924/Bio/DB/IndexedBase.pm BioPerl-1.6.924/Bio/DB/InMemoryCache.pm BioPerl-1.6.924/Bio/DB/LocationI.pm BioPerl-1.6.924/Bio/DB/MeSH.pm BioPerl-1.6.924/Bio/DB/NCBIHelper.pm BioPerl-1.6.924/Bio/DB/Qual.pm BioPerl-1.6.924/Bio/DB/QueryI.pm BioPerl-1.6.924/Bio/DB/RandomAccessI.pm BioPerl-1.6.924/Bio/DB/ReferenceI.pm BioPerl-1.6.924/Bio/DB/RefSeq.pm BioPerl-1.6.924/Bio/DB/Registry.pm BioPerl-1.6.924/Bio/DB/SeqFeature.pm BioPerl-1.6.924/Bio/DB/SeqHound.pm BioPerl-1.6.924/Bio/DB/SeqI.pm BioPerl-1.6.924/Bio/DB/SeqVersion.pm BioPerl-1.6.924/Bio/DB/SwissProt.pm BioPerl-1.6.924/Bio/DB/Taxonomy.pm BioPerl-1.6.924/Bio/DB/TFBS.pm BioPerl-1.6.924/Bio/DB/Universal.pm BioPerl-1.6.924/Bio/DB/UpdateableSeqI.pm BioPerl-1.6.924/Bio/DB/WebDBSeqI.pm BioPerl-1.6.924/Bio/DB/Expression BioPerl-1.6.924/Bio/DB/Expression/geo.pm BioPerl-1.6.924/Bio/DB/Flat BioPerl-1.6.924/Bio/DB/Flat/BDB.pm BioPerl-1.6.924/Bio/DB/Flat/BinarySearch.pm BioPerl-1.6.924/Bio/DB/Flat/BDB BioPerl-1.6.924/Bio/DB/Flat/BDB/embl.pm BioPerl-1.6.924/Bio/DB/Flat/BDB/fasta.pm BioPerl-1.6.924/Bio/DB/Flat/BDB/genbank.pm BioPerl-1.6.924/Bio/DB/Flat/BDB/swiss.pm BioPerl-1.6.924/Bio/DB/GFF BioPerl-1.6.924/Bio/DB/GFF/Aggregator.pm BioPerl-1.6.924/Bio/DB/GFF/Featname.pm BioPerl-1.6.924/Bio/DB/GFF/Feature.pm BioPerl-1.6.924/Bio/DB/GFF/Homol.pm BioPerl-1.6.924/Bio/DB/GFF/RelSegment.pm BioPerl-1.6.924/Bio/DB/GFF/Segment.pm BioPerl-1.6.924/Bio/DB/GFF/Typename.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor BioPerl-1.6.924/Bio/DB/GFF/Adaptor/ace.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/berkeleydb.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/biofetch.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/biofetch_oracle.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/memory.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/berkeleydb BioPerl-1.6.924/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/iterator.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/mysql.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/oracle.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/oracleace.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/pg.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/memory BioPerl-1.6.924/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm BioPerl-1.6.924/Bio/DB/GFF/Adaptor/memory/iterator.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator BioPerl-1.6.924/Bio/DB/GFF/Aggregator/alignment.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/clone.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/coding.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/gene.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/match.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/none.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/orf.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/processed_transcript.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/so_transcript.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/transcript.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_acembly.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_genscan.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_refgene.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_softberry.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm BioPerl-1.6.924/Bio/DB/GFF/Aggregator/ucsc_unigene.pm BioPerl-1.6.924/Bio/DB/GFF/Util BioPerl-1.6.924/Bio/DB/GFF/Util/Binning.pm BioPerl-1.6.924/Bio/DB/GFF/Util/Rearrange.pm BioPerl-1.6.924/Bio/DB/HIV BioPerl-1.6.924/Bio/DB/HIV/HIVAnnotProcessor.pm BioPerl-1.6.924/Bio/DB/HIV/HIVQueryHelper.pm BioPerl-1.6.924/Bio/DB/HIV/lanl-schema.xml BioPerl-1.6.924/Bio/DB/Query BioPerl-1.6.924/Bio/DB/Query/GenBank.pm BioPerl-1.6.924/Bio/DB/Query/HIVQuery.pm BioPerl-1.6.924/Bio/DB/Query/WebQuery.pm BioPerl-1.6.924/Bio/DB/SeqFeature BioPerl-1.6.924/Bio/DB/SeqFeature/NormalizedFeature.pm BioPerl-1.6.924/Bio/DB/SeqFeature/NormalizedFeatureI.pm BioPerl-1.6.924/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Segment.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store BioPerl-1.6.924/Bio/DB/SeqFeature/Store/bdb.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/berkeleydb.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/berkeleydb3.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/GFF2Loader.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/GFF3Loader.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/Loader.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/LoadHelper.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/memory.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/DBI BioPerl-1.6.924/Bio/DB/SeqFeature/Store/DBI/Iterator.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/DBI/mysql.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/DBI/Pg.pm BioPerl-1.6.924/Bio/DB/SeqFeature/Store/DBI/SQLite.pm BioPerl-1.6.924/Bio/DB/SeqVersion BioPerl-1.6.924/Bio/DB/SeqVersion/gi.pm BioPerl-1.6.924/Bio/DB/Taxonomy BioPerl-1.6.924/Bio/DB/Taxonomy/entrez.pm BioPerl-1.6.924/Bio/DB/Taxonomy/flatfile.pm BioPerl-1.6.924/Bio/DB/Taxonomy/greengenes.pm BioPerl-1.6.924/Bio/DB/Taxonomy/list.pm BioPerl-1.6.924/Bio/DB/Taxonomy/silva.pm BioPerl-1.6.924/Bio/DB/TFBS BioPerl-1.6.924/Bio/DB/TFBS/transfac_pro.pm BioPerl-1.6.924/Bio/Draw BioPerl-1.6.924/Bio/Draw/Pictogram.pm BioPerl-1.6.924/Bio/Event BioPerl-1.6.924/Bio/Event/EventGeneratorI.pm BioPerl-1.6.924/Bio/Event/EventHandlerI.pm BioPerl-1.6.924/Bio/Factory BioPerl-1.6.924/Bio/Factory/AnalysisI.pm BioPerl-1.6.924/Bio/Factory/ApplicationFactoryI.pm BioPerl-1.6.924/Bio/Factory/DriverFactory.pm BioPerl-1.6.924/Bio/Factory/FTLocationFactory.pm BioPerl-1.6.924/Bio/Factory/LocationFactoryI.pm BioPerl-1.6.924/Bio/Factory/MapFactoryI.pm BioPerl-1.6.924/Bio/Factory/ObjectBuilderI.pm BioPerl-1.6.924/Bio/Factory/ObjectFactory.pm BioPerl-1.6.924/Bio/Factory/ObjectFactoryI.pm BioPerl-1.6.924/Bio/Factory/SeqAnalysisParserFactory.pm BioPerl-1.6.924/Bio/Factory/SeqAnalysisParserFactoryI.pm BioPerl-1.6.924/Bio/Factory/SequenceFactoryI.pm BioPerl-1.6.924/Bio/Factory/SequenceProcessorI.pm BioPerl-1.6.924/Bio/Factory/SequenceStreamI.pm BioPerl-1.6.924/Bio/Factory/TreeFactoryI.pm BioPerl-1.6.924/Bio/Index BioPerl-1.6.924/Bio/Index/Abstract.pm BioPerl-1.6.924/Bio/Index/AbstractSeq.pm BioPerl-1.6.924/Bio/Index/Blast.pm BioPerl-1.6.924/Bio/Index/BlastTable.pm BioPerl-1.6.924/Bio/Index/EMBL.pm BioPerl-1.6.924/Bio/Index/Fasta.pm BioPerl-1.6.924/Bio/Index/Fastq.pm BioPerl-1.6.924/Bio/Index/GenBank.pm BioPerl-1.6.924/Bio/Index/Hmmer.pm BioPerl-1.6.924/Bio/Index/Qual.pm BioPerl-1.6.924/Bio/Index/Stockholm.pm BioPerl-1.6.924/Bio/Index/SwissPfam.pm BioPerl-1.6.924/Bio/Index/Swissprot.pm BioPerl-1.6.924/Bio/LiveSeq BioPerl-1.6.924/Bio/LiveSeq/AARange.pm BioPerl-1.6.924/Bio/LiveSeq/Chain.pm BioPerl-1.6.924/Bio/LiveSeq/ChainI.pm BioPerl-1.6.924/Bio/LiveSeq/DNA.pm BioPerl-1.6.924/Bio/LiveSeq/Exon.pm BioPerl-1.6.924/Bio/LiveSeq/Gene.pm BioPerl-1.6.924/Bio/LiveSeq/Intron.pm BioPerl-1.6.924/Bio/LiveSeq/Mutation.pm BioPerl-1.6.924/Bio/LiveSeq/Mutator.pm BioPerl-1.6.924/Bio/LiveSeq/Prim_Transcript.pm BioPerl-1.6.924/Bio/LiveSeq/Range.pm BioPerl-1.6.924/Bio/LiveSeq/Repeat_Region.pm BioPerl-1.6.924/Bio/LiveSeq/Repeat_Unit.pm BioPerl-1.6.924/Bio/LiveSeq/SeqI.pm BioPerl-1.6.924/Bio/LiveSeq/Transcript.pm BioPerl-1.6.924/Bio/LiveSeq/Translation.pm BioPerl-1.6.924/Bio/LiveSeq/IO BioPerl-1.6.924/Bio/LiveSeq/IO/BioPerl.pm BioPerl-1.6.924/Bio/LiveSeq/IO/Loader.pm BioPerl-1.6.924/Bio/LiveSeq/IO/README BioPerl-1.6.924/Bio/Location BioPerl-1.6.924/Bio/Location/Atomic.pm BioPerl-1.6.924/Bio/Location/AvWithinCoordPolicy.pm BioPerl-1.6.924/Bio/Location/CoordinatePolicyI.pm BioPerl-1.6.924/Bio/Location/Fuzzy.pm BioPerl-1.6.924/Bio/Location/FuzzyLocationI.pm BioPerl-1.6.924/Bio/Location/NarrowestCoordPolicy.pm BioPerl-1.6.924/Bio/Location/Simple.pm BioPerl-1.6.924/Bio/Location/Split.pm BioPerl-1.6.924/Bio/Location/SplitLocationI.pm BioPerl-1.6.924/Bio/Location/WidestCoordPolicy.pm BioPerl-1.6.924/Bio/Map BioPerl-1.6.924/Bio/Map/Clone.pm BioPerl-1.6.924/Bio/Map/Contig.pm BioPerl-1.6.924/Bio/Map/CytoMap.pm BioPerl-1.6.924/Bio/Map/CytoMarker.pm BioPerl-1.6.924/Bio/Map/CytoPosition.pm BioPerl-1.6.924/Bio/Map/EntityI.pm BioPerl-1.6.924/Bio/Map/FPCMarker.pm BioPerl-1.6.924/Bio/Map/Gene.pm BioPerl-1.6.924/Bio/Map/GeneMap.pm BioPerl-1.6.924/Bio/Map/GenePosition.pm BioPerl-1.6.924/Bio/Map/GeneRelative.pm BioPerl-1.6.924/Bio/Map/LinkageMap.pm BioPerl-1.6.924/Bio/Map/LinkagePosition.pm BioPerl-1.6.924/Bio/Map/MapI.pm BioPerl-1.6.924/Bio/Map/Mappable.pm BioPerl-1.6.924/Bio/Map/MappableI.pm BioPerl-1.6.924/Bio/Map/Marker.pm BioPerl-1.6.924/Bio/Map/MarkerI.pm BioPerl-1.6.924/Bio/Map/Microsatellite.pm BioPerl-1.6.924/Bio/Map/OrderedPosition.pm BioPerl-1.6.924/Bio/Map/OrderedPositionWithDistance.pm BioPerl-1.6.924/Bio/Map/Physical.pm BioPerl-1.6.924/Bio/Map/Position.pm BioPerl-1.6.924/Bio/Map/PositionHandler.pm BioPerl-1.6.924/Bio/Map/PositionHandlerI.pm BioPerl-1.6.924/Bio/Map/PositionI.pm BioPerl-1.6.924/Bio/Map/PositionWithSequence.pm BioPerl-1.6.924/Bio/Map/Prediction.pm BioPerl-1.6.924/Bio/Map/Relative.pm BioPerl-1.6.924/Bio/Map/RelativeI.pm BioPerl-1.6.924/Bio/Map/SimpleMap.pm BioPerl-1.6.924/Bio/Map/TranscriptionFactor.pm BioPerl-1.6.924/Bio/MapIO BioPerl-1.6.924/Bio/MapIO/fpc.pm BioPerl-1.6.924/Bio/MapIO/mapmaker.pm BioPerl-1.6.924/Bio/Matrix BioPerl-1.6.924/Bio/Matrix/Generic.pm BioPerl-1.6.924/Bio/Matrix/IO.pm BioPerl-1.6.924/Bio/Matrix/MatrixI.pm BioPerl-1.6.924/Bio/Matrix/Mlagan.pm BioPerl-1.6.924/Bio/Matrix/PhylipDist.pm BioPerl-1.6.924/Bio/Matrix/Scoring.pm BioPerl-1.6.924/Bio/Matrix/IO BioPerl-1.6.924/Bio/Matrix/IO/mlagan.pm BioPerl-1.6.924/Bio/Matrix/IO/phylip.pm BioPerl-1.6.924/Bio/Matrix/IO/scoring.pm BioPerl-1.6.924/Bio/Matrix/PSM BioPerl-1.6.924/Bio/Matrix/PSM/InstanceSite.pm BioPerl-1.6.924/Bio/Matrix/PSM/InstanceSiteI.pm BioPerl-1.6.924/Bio/Matrix/PSM/IO.pm BioPerl-1.6.924/Bio/Matrix/PSM/ProtMatrix.pm BioPerl-1.6.924/Bio/Matrix/PSM/ProtPsm.pm BioPerl-1.6.924/Bio/Matrix/PSM/Psm.pm BioPerl-1.6.924/Bio/Matrix/PSM/PsmHeader.pm BioPerl-1.6.924/Bio/Matrix/PSM/PsmHeaderI.pm BioPerl-1.6.924/Bio/Matrix/PSM/PsmI.pm BioPerl-1.6.924/Bio/Matrix/PSM/SiteMatrix.pm BioPerl-1.6.924/Bio/Matrix/PSM/SiteMatrixI.pm BioPerl-1.6.924/Bio/Matrix/PSM/IO BioPerl-1.6.924/Bio/Matrix/PSM/IO/mast.pm BioPerl-1.6.924/Bio/Matrix/PSM/IO/masta.pm BioPerl-1.6.924/Bio/Matrix/PSM/IO/meme.pm BioPerl-1.6.924/Bio/Matrix/PSM/IO/psiblast.pm BioPerl-1.6.924/Bio/Matrix/PSM/IO/transfac.pm BioPerl-1.6.924/Bio/MolEvol BioPerl-1.6.924/Bio/MolEvol/CodonModel.pm BioPerl-1.6.924/Bio/Nexml BioPerl-1.6.924/Bio/Nexml/Factory.pm BioPerl-1.6.924/Bio/Ontology BioPerl-1.6.924/Bio/Ontology/DocumentRegistry.pm BioPerl-1.6.924/Bio/Ontology/GOterm.pm BioPerl-1.6.924/Bio/Ontology/InterProTerm.pm BioPerl-1.6.924/Bio/Ontology/OBOEngine.pm BioPerl-1.6.924/Bio/Ontology/OBOterm.pm BioPerl-1.6.924/Bio/Ontology/Ontology.pm BioPerl-1.6.924/Bio/Ontology/OntologyEngineI.pm BioPerl-1.6.924/Bio/Ontology/OntologyI.pm BioPerl-1.6.924/Bio/Ontology/OntologyStore.pm BioPerl-1.6.924/Bio/Ontology/Path.pm BioPerl-1.6.924/Bio/Ontology/PathI.pm BioPerl-1.6.924/Bio/Ontology/Relationship.pm BioPerl-1.6.924/Bio/Ontology/RelationshipFactory.pm BioPerl-1.6.924/Bio/Ontology/RelationshipI.pm BioPerl-1.6.924/Bio/Ontology/RelationshipType.pm BioPerl-1.6.924/Bio/Ontology/SimpleOntologyEngine.pm BioPerl-1.6.924/Bio/Ontology/Term.pm BioPerl-1.6.924/Bio/Ontology/TermFactory.pm BioPerl-1.6.924/Bio/Ontology/TermI.pm BioPerl-1.6.924/Bio/Ontology/SimpleGOEngine BioPerl-1.6.924/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm BioPerl-1.6.924/Bio/OntologyIO BioPerl-1.6.924/Bio/OntologyIO/dagflat.pm BioPerl-1.6.924/Bio/OntologyIO/goflat.pm BioPerl-1.6.924/Bio/OntologyIO/InterProParser.pm BioPerl-1.6.924/Bio/OntologyIO/obo.pm BioPerl-1.6.924/Bio/OntologyIO/simplehierarchy.pm BioPerl-1.6.924/Bio/OntologyIO/soflat.pm BioPerl-1.6.924/Bio/OntologyIO/Handlers BioPerl-1.6.924/Bio/OntologyIO/Handlers/BaseSAXHandler.pm BioPerl-1.6.924/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm BioPerl-1.6.924/Bio/OntologyIO/Handlers/InterProHandler.pm BioPerl-1.6.924/Bio/Phenotype BioPerl-1.6.924/Bio/Phenotype/Correlate.pm BioPerl-1.6.924/Bio/Phenotype/Measure.pm BioPerl-1.6.924/Bio/Phenotype/Phenotype.pm BioPerl-1.6.924/Bio/Phenotype/PhenotypeI.pm BioPerl-1.6.924/Bio/Phenotype/MeSH BioPerl-1.6.924/Bio/Phenotype/MeSH/Term.pm BioPerl-1.6.924/Bio/Phenotype/MeSH/Twig.pm BioPerl-1.6.924/Bio/Phenotype/OMIM BioPerl-1.6.924/Bio/Phenotype/OMIM/MiniMIMentry.pm BioPerl-1.6.924/Bio/Phenotype/OMIM/OMIMentry.pm BioPerl-1.6.924/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm BioPerl-1.6.924/Bio/Phenotype/OMIM/OMIMparser.pm BioPerl-1.6.924/Bio/PhyloNetwork BioPerl-1.6.924/Bio/PhyloNetwork/Factory.pm BioPerl-1.6.924/Bio/PhyloNetwork/FactoryX.pm BioPerl-1.6.924/Bio/PhyloNetwork/GraphViz.pm BioPerl-1.6.924/Bio/PhyloNetwork/muVector.pm BioPerl-1.6.924/Bio/PhyloNetwork/RandomFactory.pm BioPerl-1.6.924/Bio/PhyloNetwork/TreeFactory.pm BioPerl-1.6.924/Bio/PhyloNetwork/TreeFactoryMulti.pm BioPerl-1.6.924/Bio/PhyloNetwork/TreeFactoryX.pm BioPerl-1.6.924/Bio/PopGen BioPerl-1.6.924/Bio/PopGen/Genotype.pm BioPerl-1.6.924/Bio/PopGen/GenotypeI.pm BioPerl-1.6.924/Bio/PopGen/HtSNP.pm BioPerl-1.6.924/Bio/PopGen/Individual.pm BioPerl-1.6.924/Bio/PopGen/IndividualI.pm BioPerl-1.6.924/Bio/PopGen/IO.pm BioPerl-1.6.924/Bio/PopGen/Marker.pm BioPerl-1.6.924/Bio/PopGen/MarkerI.pm BioPerl-1.6.924/Bio/PopGen/PopStats.pm BioPerl-1.6.924/Bio/PopGen/Population.pm BioPerl-1.6.924/Bio/PopGen/PopulationI.pm BioPerl-1.6.924/Bio/PopGen/Statistics.pm BioPerl-1.6.924/Bio/PopGen/TagHaplotype.pm BioPerl-1.6.924/Bio/PopGen/Utilities.pm BioPerl-1.6.924/Bio/PopGen/IO BioPerl-1.6.924/Bio/PopGen/IO/csv.pm BioPerl-1.6.924/Bio/PopGen/IO/hapmap.pm BioPerl-1.6.924/Bio/PopGen/IO/phase.pm BioPerl-1.6.924/Bio/PopGen/IO/prettybase.pm BioPerl-1.6.924/Bio/PopGen/Simulation BioPerl-1.6.924/Bio/PopGen/Simulation/Coalescent.pm BioPerl-1.6.924/Bio/PopGen/Simulation/GeneticDrift.pm BioPerl-1.6.924/Bio/Restriction BioPerl-1.6.924/Bio/Restriction/Analysis.pm BioPerl-1.6.924/Bio/Restriction/Enzyme.pm BioPerl-1.6.924/Bio/Restriction/EnzymeCollection.pm BioPerl-1.6.924/Bio/Restriction/EnzymeI.pm BioPerl-1.6.924/Bio/Restriction/IO.pm BioPerl-1.6.924/Bio/Restriction/Enzyme BioPerl-1.6.924/Bio/Restriction/Enzyme/MultiCut.pm BioPerl-1.6.924/Bio/Restriction/Enzyme/MultiSite.pm BioPerl-1.6.924/Bio/Restriction/IO BioPerl-1.6.924/Bio/Restriction/IO/bairoch.pm BioPerl-1.6.924/Bio/Restriction/IO/base.pm BioPerl-1.6.924/Bio/Restriction/IO/itype2.pm BioPerl-1.6.924/Bio/Restriction/IO/prototype.pm BioPerl-1.6.924/Bio/Restriction/IO/withrefm.pm BioPerl-1.6.924/Bio/Root BioPerl-1.6.924/Bio/Root/Build.pm BioPerl-1.6.924/Bio/Root/Exception.pm BioPerl-1.6.924/Bio/Root/HTTPget.pm BioPerl-1.6.924/Bio/Root/IO.pm BioPerl-1.6.924/Bio/Root/Root.pm BioPerl-1.6.924/Bio/Root/RootI.pm BioPerl-1.6.924/Bio/Root/Storable.pm BioPerl-1.6.924/Bio/Root/Test.pm BioPerl-1.6.924/Bio/Root/Utilities.pm BioPerl-1.6.924/Bio/Root/Version.pm BioPerl-1.6.924/Bio/Search BioPerl-1.6.924/Bio/Search/BlastStatistics.pm BioPerl-1.6.924/Bio/Search/BlastUtils.pm BioPerl-1.6.924/Bio/Search/DatabaseI.pm BioPerl-1.6.924/Bio/Search/GenericDatabase.pm BioPerl-1.6.924/Bio/Search/GenericStatistics.pm BioPerl-1.6.924/Bio/Search/Processor.pm BioPerl-1.6.924/Bio/Search/SearchUtils.pm BioPerl-1.6.924/Bio/Search/StatisticsI.pm BioPerl-1.6.924/Bio/Search/Hit BioPerl-1.6.924/Bio/Search/Hit/BlastHit.pm BioPerl-1.6.924/Bio/Search/Hit/BlastPullHit.pm BioPerl-1.6.924/Bio/Search/Hit/Fasta.pm BioPerl-1.6.924/Bio/Search/Hit/GenericHit.pm BioPerl-1.6.924/Bio/Search/Hit/HitFactory.pm BioPerl-1.6.924/Bio/Search/Hit/HitI.pm BioPerl-1.6.924/Bio/Search/Hit/hmmer3Hit.pm BioPerl-1.6.924/Bio/Search/Hit/HMMERHit.pm BioPerl-1.6.924/Bio/Search/Hit/HmmpfamHit.pm BioPerl-1.6.924/Bio/Search/Hit/ModelHit.pm BioPerl-1.6.924/Bio/Search/Hit/PsiBlastHit.pm BioPerl-1.6.924/Bio/Search/Hit/PullHitI.pm BioPerl-1.6.924/Bio/Search/HSP BioPerl-1.6.924/Bio/Search/HSP/BlastHSP.pm BioPerl-1.6.924/Bio/Search/HSP/BlastPullHSP.pm BioPerl-1.6.924/Bio/Search/HSP/FastaHSP.pm BioPerl-1.6.924/Bio/Search/HSP/GenericHSP.pm BioPerl-1.6.924/Bio/Search/HSP/HMMERHSP.pm BioPerl-1.6.924/Bio/Search/HSP/HmmpfamHSP.pm BioPerl-1.6.924/Bio/Search/HSP/HSPFactory.pm BioPerl-1.6.924/Bio/Search/HSP/HSPI.pm BioPerl-1.6.924/Bio/Search/HSP/ModelHSP.pm BioPerl-1.6.924/Bio/Search/HSP/PsiBlastHSP.pm BioPerl-1.6.924/Bio/Search/HSP/PSLHSP.pm BioPerl-1.6.924/Bio/Search/HSP/PullHSPI.pm BioPerl-1.6.924/Bio/Search/HSP/WABAHSP.pm BioPerl-1.6.924/Bio/Search/Iteration BioPerl-1.6.924/Bio/Search/Iteration/GenericIteration.pm BioPerl-1.6.924/Bio/Search/Iteration/IterationI.pm BioPerl-1.6.924/Bio/Search/Result BioPerl-1.6.924/Bio/Search/Result/BlastPullResult.pm BioPerl-1.6.924/Bio/Search/Result/BlastResult.pm BioPerl-1.6.924/Bio/Search/Result/CrossMatchResult.pm BioPerl-1.6.924/Bio/Search/Result/GenericResult.pm BioPerl-1.6.924/Bio/Search/Result/hmmer3Result.pm BioPerl-1.6.924/Bio/Search/Result/HMMERResult.pm BioPerl-1.6.924/Bio/Search/Result/HmmpfamResult.pm BioPerl-1.6.924/Bio/Search/Result/PullResultI.pm BioPerl-1.6.924/Bio/Search/Result/ResultFactory.pm BioPerl-1.6.924/Bio/Search/Result/ResultI.pm BioPerl-1.6.924/Bio/Search/Result/WABAResult.pm BioPerl-1.6.924/Bio/Search/Tiling BioPerl-1.6.924/Bio/Search/Tiling/MapTileUtils.pm BioPerl-1.6.924/Bio/Search/Tiling/MapTiling.pm BioPerl-1.6.924/Bio/Search/Tiling/TilingI.pm BioPerl-1.6.924/Bio/SearchIO BioPerl-1.6.924/Bio/SearchIO/axt.pm BioPerl-1.6.924/Bio/SearchIO/blast.pm BioPerl-1.6.924/Bio/SearchIO/blast_pull.pm BioPerl-1.6.924/Bio/SearchIO/blasttable.pm BioPerl-1.6.924/Bio/SearchIO/blastxml.pm BioPerl-1.6.924/Bio/SearchIO/cross_match.pm BioPerl-1.6.924/Bio/SearchIO/erpin.pm BioPerl-1.6.924/Bio/SearchIO/EventHandlerI.pm BioPerl-1.6.924/Bio/SearchIO/exonerate.pm BioPerl-1.6.924/Bio/SearchIO/fasta.pm BioPerl-1.6.924/Bio/SearchIO/FastHitEventBuilder.pm BioPerl-1.6.924/Bio/SearchIO/gmap_f9.pm BioPerl-1.6.924/Bio/SearchIO/hmmer.pm BioPerl-1.6.924/Bio/SearchIO/hmmer2.pm BioPerl-1.6.924/Bio/SearchIO/hmmer3.pm BioPerl-1.6.924/Bio/SearchIO/hmmer_pull.pm BioPerl-1.6.924/Bio/SearchIO/infernal.pm BioPerl-1.6.924/Bio/SearchIO/IteratedSearchResultEventBuilder.pm BioPerl-1.6.924/Bio/SearchIO/megablast.pm BioPerl-1.6.924/Bio/SearchIO/psl.pm BioPerl-1.6.924/Bio/SearchIO/rnamotif.pm BioPerl-1.6.924/Bio/SearchIO/SearchResultEventBuilder.pm BioPerl-1.6.924/Bio/SearchIO/SearchWriterI.pm BioPerl-1.6.924/Bio/SearchIO/sim4.pm BioPerl-1.6.924/Bio/SearchIO/waba.pm BioPerl-1.6.924/Bio/SearchIO/wise.pm BioPerl-1.6.924/Bio/SearchIO/Writer BioPerl-1.6.924/Bio/SearchIO/Writer/BSMLResultWriter.pm BioPerl-1.6.924/Bio/SearchIO/Writer/GbrowseGFF.pm BioPerl-1.6.924/Bio/SearchIO/Writer/HitTableWriter.pm BioPerl-1.6.924/Bio/SearchIO/Writer/HSPTableWriter.pm BioPerl-1.6.924/Bio/SearchIO/Writer/HTMLResultWriter.pm BioPerl-1.6.924/Bio/SearchIO/Writer/ResultTableWriter.pm BioPerl-1.6.924/Bio/SearchIO/Writer/TextResultWriter.pm BioPerl-1.6.924/Bio/SearchIO/XML BioPerl-1.6.924/Bio/SearchIO/XML/BlastHandler.pm BioPerl-1.6.924/Bio/SearchIO/XML/PsiBlastHandler.pm BioPerl-1.6.924/Bio/Seq BioPerl-1.6.924/Bio/Seq/BaseSeqProcessor.pm BioPerl-1.6.924/Bio/Seq/EncodedSeq.pm BioPerl-1.6.924/Bio/Seq/LargeLocatableSeq.pm BioPerl-1.6.924/Bio/Seq/LargePrimarySeq.pm BioPerl-1.6.924/Bio/Seq/LargeSeq.pm BioPerl-1.6.924/Bio/Seq/LargeSeqI.pm BioPerl-1.6.924/Bio/Seq/Meta.pm BioPerl-1.6.924/Bio/Seq/MetaI.pm BioPerl-1.6.924/Bio/Seq/PrimaryQual.pm BioPerl-1.6.924/Bio/Seq/PrimedSeq.pm BioPerl-1.6.924/Bio/Seq/QualI.pm BioPerl-1.6.924/Bio/Seq/Quality.pm BioPerl-1.6.924/Bio/Seq/RichSeq.pm BioPerl-1.6.924/Bio/Seq/RichSeqI.pm BioPerl-1.6.924/Bio/Seq/SeqBuilder.pm BioPerl-1.6.924/Bio/Seq/SeqFactory.pm BioPerl-1.6.924/Bio/Seq/SeqFastaSpeedFactory.pm BioPerl-1.6.924/Bio/Seq/SequenceTrace.pm BioPerl-1.6.924/Bio/Seq/SeqWithQuality.pm BioPerl-1.6.924/Bio/Seq/SimulatedRead.pm BioPerl-1.6.924/Bio/Seq/TraceI.pm BioPerl-1.6.924/Bio/Seq/Meta BioPerl-1.6.924/Bio/Seq/Meta/Array.pm BioPerl-1.6.924/Bio/SeqEvolution BioPerl-1.6.924/Bio/SeqEvolution/DNAPoint.pm BioPerl-1.6.924/Bio/SeqEvolution/EvolutionI.pm BioPerl-1.6.924/Bio/SeqEvolution/Factory.pm BioPerl-1.6.924/Bio/SeqFeature BioPerl-1.6.924/Bio/SeqFeature/Amplicon.pm BioPerl-1.6.924/Bio/SeqFeature/AnnotationAdaptor.pm BioPerl-1.6.924/Bio/SeqFeature/Collection.pm BioPerl-1.6.924/Bio/SeqFeature/CollectionI.pm BioPerl-1.6.924/Bio/SeqFeature/Computation.pm BioPerl-1.6.924/Bio/SeqFeature/FeaturePair.pm BioPerl-1.6.924/Bio/SeqFeature/Generic.pm BioPerl-1.6.924/Bio/SeqFeature/Lite.pm BioPerl-1.6.924/Bio/SeqFeature/PositionProxy.pm BioPerl-1.6.924/Bio/SeqFeature/Primer.pm BioPerl-1.6.924/Bio/SeqFeature/Similarity.pm BioPerl-1.6.924/Bio/SeqFeature/SimilarityPair.pm BioPerl-1.6.924/Bio/SeqFeature/SubSeq.pm BioPerl-1.6.924/Bio/SeqFeature/TypedSeqFeatureI.pm BioPerl-1.6.924/Bio/SeqFeature/Gene BioPerl-1.6.924/Bio/SeqFeature/Gene/Exon.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/ExonI.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/GeneStructure.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/GeneStructureI.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/Intron.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/NC_Feature.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/Poly_A_site.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/Promoter.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/Transcript.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/TranscriptI.pm BioPerl-1.6.924/Bio/SeqFeature/Gene/UTR.pm BioPerl-1.6.924/Bio/SeqFeature/SiRNA BioPerl-1.6.924/Bio/SeqFeature/SiRNA/Oligo.pm BioPerl-1.6.924/Bio/SeqFeature/SiRNA/Pair.pm BioPerl-1.6.924/Bio/SeqFeature/Tools BioPerl-1.6.924/Bio/SeqFeature/Tools/FeatureNamer.pm BioPerl-1.6.924/Bio/SeqFeature/Tools/IDHandler.pm BioPerl-1.6.924/Bio/SeqFeature/Tools/TypeMapper.pm BioPerl-1.6.924/Bio/SeqFeature/Tools/Unflattener.pm BioPerl-1.6.924/Bio/SeqIO BioPerl-1.6.924/Bio/SeqIO/abi.pm BioPerl-1.6.924/Bio/SeqIO/ace.pm BioPerl-1.6.924/Bio/SeqIO/agave.pm BioPerl-1.6.924/Bio/SeqIO/alf.pm BioPerl-1.6.924/Bio/SeqIO/asciitree.pm BioPerl-1.6.924/Bio/SeqIO/bsml.pm BioPerl-1.6.924/Bio/SeqIO/bsml_sax.pm BioPerl-1.6.924/Bio/SeqIO/chadoxml.pm BioPerl-1.6.924/Bio/SeqIO/chaos.pm BioPerl-1.6.924/Bio/SeqIO/chaosxml.pm BioPerl-1.6.924/Bio/SeqIO/ctf.pm BioPerl-1.6.924/Bio/SeqIO/embl.pm BioPerl-1.6.924/Bio/SeqIO/embldriver.pm BioPerl-1.6.924/Bio/SeqIO/entrezgene.pm BioPerl-1.6.924/Bio/SeqIO/excel.pm BioPerl-1.6.924/Bio/SeqIO/exp.pm BioPerl-1.6.924/Bio/SeqIO/fasta.pm BioPerl-1.6.924/Bio/SeqIO/fastq.pm BioPerl-1.6.924/Bio/SeqIO/flybase_chadoxml.pm BioPerl-1.6.924/Bio/SeqIO/FTHelper.pm BioPerl-1.6.924/Bio/SeqIO/game.pm BioPerl-1.6.924/Bio/SeqIO/gbdriver.pm BioPerl-1.6.924/Bio/SeqIO/gbxml.pm BioPerl-1.6.924/Bio/SeqIO/gcg.pm BioPerl-1.6.924/Bio/SeqIO/genbank.pm BioPerl-1.6.924/Bio/SeqIO/interpro.pm BioPerl-1.6.924/Bio/SeqIO/kegg.pm BioPerl-1.6.924/Bio/SeqIO/largefasta.pm BioPerl-1.6.924/Bio/SeqIO/lasergene.pm BioPerl-1.6.924/Bio/SeqIO/locuslink.pm BioPerl-1.6.924/Bio/SeqIO/mbsout.pm BioPerl-1.6.924/Bio/SeqIO/metafasta.pm BioPerl-1.6.924/Bio/SeqIO/msout.pm BioPerl-1.6.924/Bio/SeqIO/MultiFile.pm BioPerl-1.6.924/Bio/SeqIO/nexml.pm BioPerl-1.6.924/Bio/SeqIO/phd.pm BioPerl-1.6.924/Bio/SeqIO/pir.pm BioPerl-1.6.924/Bio/SeqIO/pln.pm BioPerl-1.6.924/Bio/SeqIO/qual.pm BioPerl-1.6.924/Bio/SeqIO/raw.pm BioPerl-1.6.924/Bio/SeqIO/scf.pm BioPerl-1.6.924/Bio/SeqIO/seqxml.pm BioPerl-1.6.924/Bio/SeqIO/strider.pm BioPerl-1.6.924/Bio/SeqIO/swiss.pm BioPerl-1.6.924/Bio/SeqIO/swissdriver.pm BioPerl-1.6.924/Bio/SeqIO/tab.pm BioPerl-1.6.924/Bio/SeqIO/table.pm BioPerl-1.6.924/Bio/SeqIO/tigr.pm BioPerl-1.6.924/Bio/SeqIO/tigrxml.pm BioPerl-1.6.924/Bio/SeqIO/tinyseq.pm BioPerl-1.6.924/Bio/SeqIO/ztr.pm BioPerl-1.6.924/Bio/SeqIO/game BioPerl-1.6.924/Bio/SeqIO/game/featHandler.pm BioPerl-1.6.924/Bio/SeqIO/game/gameHandler.pm BioPerl-1.6.924/Bio/SeqIO/game/gameSubs.pm BioPerl-1.6.924/Bio/SeqIO/game/gameWriter.pm BioPerl-1.6.924/Bio/SeqIO/game/seqHandler.pm BioPerl-1.6.924/Bio/SeqIO/Handler BioPerl-1.6.924/Bio/SeqIO/Handler/GenericRichSeqHandler.pm BioPerl-1.6.924/Bio/SeqIO/tinyseq BioPerl-1.6.924/Bio/SeqIO/tinyseq/tinyseqHandler.pm BioPerl-1.6.924/Bio/Structure BioPerl-1.6.924/Bio/Structure/Atom.pm BioPerl-1.6.924/Bio/Structure/Chain.pm BioPerl-1.6.924/Bio/Structure/Entry.pm BioPerl-1.6.924/Bio/Structure/IO.pm BioPerl-1.6.924/Bio/Structure/Model.pm BioPerl-1.6.924/Bio/Structure/Residue.pm BioPerl-1.6.924/Bio/Structure/StructureI.pm BioPerl-1.6.924/Bio/Structure/IO BioPerl-1.6.924/Bio/Structure/IO/pdb.pm BioPerl-1.6.924/Bio/Structure/SecStr BioPerl-1.6.924/Bio/Structure/SecStr/DSSP BioPerl-1.6.924/Bio/Structure/SecStr/DSSP/Res.pm BioPerl-1.6.924/Bio/Structure/SecStr/STRIDE BioPerl-1.6.924/Bio/Structure/SecStr/STRIDE/Res.pm BioPerl-1.6.924/Bio/Symbol BioPerl-1.6.924/Bio/Symbol/Alphabet.pm BioPerl-1.6.924/Bio/Symbol/AlphabetI.pm BioPerl-1.6.924/Bio/Symbol/DNAAlphabet.pm BioPerl-1.6.924/Bio/Symbol/ProteinAlphabet.pm BioPerl-1.6.924/Bio/Symbol/README.Symbol BioPerl-1.6.924/Bio/Symbol/Symbol.pm BioPerl-1.6.924/Bio/Symbol/SymbolI.pm BioPerl-1.6.924/Bio/Taxonomy BioPerl-1.6.924/Bio/Taxonomy/FactoryI.pm BioPerl-1.6.924/Bio/Taxonomy/Node.pm BioPerl-1.6.924/Bio/Taxonomy/Taxon.pm BioPerl-1.6.924/Bio/Taxonomy/Tree.pm BioPerl-1.6.924/Bio/Tools BioPerl-1.6.924/Bio/Tools/AlignFactory.pm BioPerl-1.6.924/Bio/Tools/AmpliconSearch.pm BioPerl-1.6.924/Bio/Tools/AnalysisResult.pm BioPerl-1.6.924/Bio/Tools/Blat.pm BioPerl-1.6.924/Bio/Tools/CodonTable.pm BioPerl-1.6.924/Bio/Tools/Coil.pm BioPerl-1.6.924/Bio/Tools/dpAlign.pm BioPerl-1.6.924/Bio/Tools/ECnumber.pm BioPerl-1.6.924/Bio/Tools/EPCR.pm BioPerl-1.6.924/Bio/Tools/Eponine.pm BioPerl-1.6.924/Bio/Tools/ERPIN.pm BioPerl-1.6.924/Bio/Tools/Est2Genome.pm BioPerl-1.6.924/Bio/Tools/ESTScan.pm BioPerl-1.6.924/Bio/Tools/Fgenesh.pm BioPerl-1.6.924/Bio/Tools/FootPrinter.pm BioPerl-1.6.924/Bio/Tools/Gel.pm BioPerl-1.6.924/Bio/Tools/Geneid.pm BioPerl-1.6.924/Bio/Tools/Genemark.pm BioPerl-1.6.924/Bio/Tools/Genewise.pm BioPerl-1.6.924/Bio/Tools/Genomewise.pm BioPerl-1.6.924/Bio/Tools/Genscan.pm BioPerl-1.6.924/Bio/Tools/GFF.pm BioPerl-1.6.924/Bio/Tools/Glimmer.pm BioPerl-1.6.924/Bio/Tools/Grail.pm BioPerl-1.6.924/Bio/Tools/GuessSeqFormat.pm BioPerl-1.6.924/Bio/Tools/Hmmpfam.pm BioPerl-1.6.924/Bio/Tools/Infernal.pm BioPerl-1.6.924/Bio/Tools/ipcress.pm BioPerl-1.6.924/Bio/Tools/isPcr.pm BioPerl-1.6.924/Bio/Tools/IUPAC.pm BioPerl-1.6.924/Bio/Tools/Lucy.pm BioPerl-1.6.924/Bio/Tools/Match.pm BioPerl-1.6.924/Bio/Tools/MZEF.pm BioPerl-1.6.924/Bio/Tools/OddCodes.pm BioPerl-1.6.924/Bio/Tools/pICalculator.pm BioPerl-1.6.924/Bio/Tools/Primer3.pm BioPerl-1.6.924/Bio/Tools/Prints.pm BioPerl-1.6.924/Bio/Tools/Profile.pm BioPerl-1.6.924/Bio/Tools/Promoterwise.pm BioPerl-1.6.924/Bio/Tools/PrositeScan.pm BioPerl-1.6.924/Bio/Tools/Protparam.pm BioPerl-1.6.924/Bio/Tools/Pseudowise.pm BioPerl-1.6.924/Bio/Tools/pSW.pm BioPerl-1.6.924/Bio/Tools/QRNA.pm BioPerl-1.6.924/Bio/Tools/RandomDistFunctions.pm BioPerl-1.6.924/Bio/Tools/RepeatMasker.pm BioPerl-1.6.924/Bio/Tools/RNAMotif.pm BioPerl-1.6.924/Bio/Tools/Seg.pm BioPerl-1.6.924/Bio/Tools/SeqPattern.pm BioPerl-1.6.924/Bio/Tools/SeqStats.pm BioPerl-1.6.924/Bio/Tools/SeqWords.pm BioPerl-1.6.924/Bio/Tools/Sigcleave.pm BioPerl-1.6.924/Bio/Tools/Signalp.pm BioPerl-1.6.924/Bio/Tools/SiRNA.pm BioPerl-1.6.924/Bio/Tools/TandemRepeatsFinder.pm BioPerl-1.6.924/Bio/Tools/TargetP.pm BioPerl-1.6.924/Bio/Tools/Tmhmm.pm BioPerl-1.6.924/Bio/Tools/tRNAscanSE.pm BioPerl-1.6.924/Bio/Tools/Alignment BioPerl-1.6.924/Bio/Tools/Alignment/Consed.pm BioPerl-1.6.924/Bio/Tools/Alignment/Trim.pm BioPerl-1.6.924/Bio/Tools/Analysis BioPerl-1.6.924/Bio/Tools/Analysis/SimpleAnalysisBase.pm BioPerl-1.6.924/Bio/Tools/Analysis/DNA BioPerl-1.6.924/Bio/Tools/Analysis/DNA/ESEfinder.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein BioPerl-1.6.924/Bio/Tools/Analysis/Protein/Domcut.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/ELM.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/GOR4.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/HNN.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/Mitoprot.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/NetPhos.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/Scansite.pm BioPerl-1.6.924/Bio/Tools/Analysis/Protein/Sopma.pm BioPerl-1.6.924/Bio/Tools/EMBOSS BioPerl-1.6.924/Bio/Tools/EMBOSS/Palindrome.pm BioPerl-1.6.924/Bio/Tools/HMMER BioPerl-1.6.924/Bio/Tools/HMMER/Domain.pm BioPerl-1.6.924/Bio/Tools/HMMER/Results.pm BioPerl-1.6.924/Bio/Tools/HMMER/Set.pm BioPerl-1.6.924/Bio/Tools/Phylo BioPerl-1.6.924/Bio/Tools/Phylo/Gerp.pm BioPerl-1.6.924/Bio/Tools/Phylo/Gumby.pm BioPerl-1.6.924/Bio/Tools/Phylo/Molphy.pm BioPerl-1.6.924/Bio/Tools/Phylo/PAML.pm BioPerl-1.6.924/Bio/Tools/Phylo/Molphy BioPerl-1.6.924/Bio/Tools/Phylo/Molphy/Result.pm BioPerl-1.6.924/Bio/Tools/Phylo/PAML BioPerl-1.6.924/Bio/Tools/Phylo/PAML/Codeml.pm BioPerl-1.6.924/Bio/Tools/Phylo/PAML/ModelResult.pm BioPerl-1.6.924/Bio/Tools/Phylo/PAML/Result.pm BioPerl-1.6.924/Bio/Tools/Phylo/Phylip BioPerl-1.6.924/Bio/Tools/Phylo/Phylip/ProtDist.pm BioPerl-1.6.924/Bio/Tools/Prediction BioPerl-1.6.924/Bio/Tools/Prediction/Exon.pm BioPerl-1.6.924/Bio/Tools/Prediction/Gene.pm BioPerl-1.6.924/Bio/Tools/Primer BioPerl-1.6.924/Bio/Tools/Primer/AssessorI.pm BioPerl-1.6.924/Bio/Tools/Primer/Feature.pm BioPerl-1.6.924/Bio/Tools/Primer/Pair.pm BioPerl-1.6.924/Bio/Tools/Primer/Assessor BioPerl-1.6.924/Bio/Tools/Primer/Assessor/Base.pm BioPerl-1.6.924/Bio/Tools/Run BioPerl-1.6.924/Bio/Tools/Run/GenericParameters.pm BioPerl-1.6.924/Bio/Tools/Run/hmmer3.pm BioPerl-1.6.924/Bio/Tools/Run/ParametersI.pm BioPerl-1.6.924/Bio/Tools/Run/README BioPerl-1.6.924/Bio/Tools/Run/RemoteBlast.pm BioPerl-1.6.924/Bio/Tools/Run/StandAloneBlast.pm BioPerl-1.6.924/Bio/Tools/Run/StandAloneNCBIBlast.pm BioPerl-1.6.924/Bio/Tools/Run/StandAloneWUBlast.pm BioPerl-1.6.924/Bio/Tools/Run/WrapperBase.pm BioPerl-1.6.924/Bio/Tools/Run/WrapperBase BioPerl-1.6.924/Bio/Tools/Run/WrapperBase/CommandExts.pm BioPerl-1.6.924/Bio/Tools/SeqPattern BioPerl-1.6.924/Bio/Tools/SeqPattern/Backtranslate.pm BioPerl-1.6.924/Bio/Tools/Signalp BioPerl-1.6.924/Bio/Tools/Signalp/ExtendedSignalp.pm BioPerl-1.6.924/Bio/Tools/Sim4 BioPerl-1.6.924/Bio/Tools/Sim4/Exon.pm BioPerl-1.6.924/Bio/Tools/Sim4/Results.pm BioPerl-1.6.924/Bio/Tools/SiRNA BioPerl-1.6.924/Bio/Tools/SiRNA/Ruleset BioPerl-1.6.924/Bio/Tools/SiRNA/Ruleset/saigo.pm BioPerl-1.6.924/Bio/Tools/SiRNA/Ruleset/tuschl.pm BioPerl-1.6.924/Bio/Tools/Spidey BioPerl-1.6.924/Bio/Tools/Spidey/Exon.pm BioPerl-1.6.924/Bio/Tools/Spidey/Results.pm BioPerl-1.6.924/Bio/Tree BioPerl-1.6.924/Bio/Tree/AlleleNode.pm BioPerl-1.6.924/Bio/Tree/AnnotatableNode.pm BioPerl-1.6.924/Bio/Tree/Compatible.pm BioPerl-1.6.924/Bio/Tree/DistanceFactory.pm BioPerl-1.6.924/Bio/Tree/Node.pm BioPerl-1.6.924/Bio/Tree/NodeI.pm BioPerl-1.6.924/Bio/Tree/NodeNHX.pm BioPerl-1.6.924/Bio/Tree/RandomFactory.pm BioPerl-1.6.924/Bio/Tree/Statistics.pm BioPerl-1.6.924/Bio/Tree/Tree.pm BioPerl-1.6.924/Bio/Tree/TreeFunctionsI.pm BioPerl-1.6.924/Bio/Tree/TreeI.pm BioPerl-1.6.924/Bio/Tree/Draw BioPerl-1.6.924/Bio/Tree/Draw/Cladogram.pm BioPerl-1.6.924/Bio/TreeIO BioPerl-1.6.924/Bio/TreeIO/cluster.pm BioPerl-1.6.924/Bio/TreeIO/lintree.pm BioPerl-1.6.924/Bio/TreeIO/newick.pm BioPerl-1.6.924/Bio/TreeIO/NewickParser.pm BioPerl-1.6.924/Bio/TreeIO/nexml.pm BioPerl-1.6.924/Bio/TreeIO/nexus.pm BioPerl-1.6.924/Bio/TreeIO/nhx.pm BioPerl-1.6.924/Bio/TreeIO/pag.pm BioPerl-1.6.924/Bio/TreeIO/phyloxml.pm BioPerl-1.6.924/Bio/TreeIO/svggraph.pm BioPerl-1.6.924/Bio/TreeIO/tabtree.pm BioPerl-1.6.924/Bio/TreeIO/TreeEventBuilder.pm BioPerl-1.6.924/Bio/Variation BioPerl-1.6.924/Bio/Variation/AAChange.pm BioPerl-1.6.924/Bio/Variation/AAReverseMutate.pm BioPerl-1.6.924/Bio/Variation/Allele.pm BioPerl-1.6.924/Bio/Variation/DNAMutation.pm BioPerl-1.6.924/Bio/Variation/IO.pm BioPerl-1.6.924/Bio/Variation/README BioPerl-1.6.924/Bio/Variation/RNAChange.pm BioPerl-1.6.924/Bio/Variation/SeqDiff.pm BioPerl-1.6.924/Bio/Variation/SNP.pm BioPerl-1.6.924/Bio/Variation/VariantI.pm BioPerl-1.6.924/Bio/Variation/IO BioPerl-1.6.924/Bio/Variation/IO/flat.pm BioPerl-1.6.924/Bio/Variation/IO/xml.pm BioPerl-1.6.924/doc BioPerl-1.6.924/doc/makedoc.PL BioPerl-1.6.924/doc/README BioPerl-1.6.924/doc/Deobfuscator BioPerl-1.6.924/doc/Deobfuscator/Build.PL BioPerl-1.6.924/doc/Deobfuscator/Changes BioPerl-1.6.924/doc/Deobfuscator/excluded_modules.txt BioPerl-1.6.924/doc/Deobfuscator/LICENSE BioPerl-1.6.924/doc/Deobfuscator/Makefile.PL BioPerl-1.6.924/doc/Deobfuscator/MANIFEST BioPerl-1.6.924/doc/Deobfuscator/META.yml BioPerl-1.6.924/doc/Deobfuscator/README BioPerl-1.6.924/doc/Deobfuscator/bin BioPerl-1.6.924/doc/Deobfuscator/bin/deob_index.pl BioPerl-1.6.924/doc/Deobfuscator/bin/run-deobfuscator-update.pl BioPerl-1.6.924/doc/Deobfuscator/cgi-bin BioPerl-1.6.924/doc/Deobfuscator/cgi-bin/deob_detail.cgi BioPerl-1.6.924/doc/Deobfuscator/cgi-bin/deob_flowchart.png BioPerl-1.6.924/doc/Deobfuscator/cgi-bin/deob_help.html BioPerl-1.6.924/doc/Deobfuscator/cgi-bin/deob_interface.cgi BioPerl-1.6.924/doc/Deobfuscator/lib BioPerl-1.6.924/doc/Deobfuscator/lib/Deobfuscator.pm BioPerl-1.6.924/doc/Deobfuscator/t BioPerl-1.6.924/doc/Deobfuscator/t/00.load.t BioPerl-1.6.924/doc/Deobfuscator/t/pod.t BioPerl-1.6.924/examples BioPerl-1.6.924/examples/bioperl.pl BioPerl-1.6.924/examples/generate_random_seq.pl BioPerl-1.6.924/examples/longorf.pl BioPerl-1.6.924/examples/make_primers.pl BioPerl-1.6.924/examples/rev_and_trans.pl BioPerl-1.6.924/examples/revcom_dir.pl BioPerl-1.6.924/examples/subsequence.cgi BioPerl-1.6.924/examples/align BioPerl-1.6.924/examples/align/align_on_codons.pl BioPerl-1.6.924/examples/align/aligntutorial.pl BioPerl-1.6.924/examples/align/clustalw.pl BioPerl-1.6.924/examples/align/FastAlign.pl BioPerl-1.6.924/examples/align/simplealign.pl BioPerl-1.6.924/examples/Bio-DB-GFF BioPerl-1.6.924/examples/Bio-DB-GFF/load_ucsc.pl BioPerl-1.6.924/examples/cluster BioPerl-1.6.924/examples/cluster/dbsnp.pl BioPerl-1.6.924/examples/contributed BioPerl-1.6.924/examples/contributed/nmrpdb_parse.pl BioPerl-1.6.924/examples/contributed/prosite2perl.pl BioPerl-1.6.924/examples/contributed/rebase2list.pl BioPerl-1.6.924/examples/db BioPerl-1.6.924/examples/db/dbfetch BioPerl-1.6.924/examples/db/est_tissue_query.pl BioPerl-1.6.924/examples/db/gb2features.pl BioPerl-1.6.924/examples/db/get_seqs.pl BioPerl-1.6.924/examples/db/getGenBank.pl BioPerl-1.6.924/examples/db/rfetch.pl BioPerl-1.6.924/examples/db/use_registry.pl BioPerl-1.6.924/examples/liveseq BioPerl-1.6.924/examples/liveseq/change_gene.pl BioPerl-1.6.924/examples/popgen BioPerl-1.6.924/examples/popgen/parse_calc_stats.pl BioPerl-1.6.924/examples/quality BioPerl-1.6.924/examples/quality/svgtrace.pl BioPerl-1.6.924/examples/root BioPerl-1.6.924/examples/root/exceptions1.pl BioPerl-1.6.924/examples/root/exceptions2.pl BioPerl-1.6.924/examples/root/exceptions3.pl BioPerl-1.6.924/examples/root/exceptions4.pl BioPerl-1.6.924/examples/root/README BioPerl-1.6.924/examples/root/lib BioPerl-1.6.924/examples/root/lib/TestInterface.pm BioPerl-1.6.924/examples/root/lib/TestObject.pm BioPerl-1.6.924/examples/searchio BioPerl-1.6.924/examples/searchio/blast_example.pl BioPerl-1.6.924/examples/searchio/custom_writer.pl BioPerl-1.6.924/examples/searchio/hitwriter.pl BioPerl-1.6.924/examples/searchio/hspwriter.pl BioPerl-1.6.924/examples/searchio/htmlwriter.pl BioPerl-1.6.924/examples/searchio/psiblast_features.pl BioPerl-1.6.924/examples/searchio/psiblast_iterations.pl BioPerl-1.6.924/examples/searchio/rawwriter.pl BioPerl-1.6.924/examples/searchio/resultwriter.pl BioPerl-1.6.924/examples/searchio/waba2gff.pl BioPerl-1.6.924/examples/searchio/waba2gff3.pl BioPerl-1.6.924/examples/sirna BioPerl-1.6.924/examples/sirna/rnai_finder.cgi BioPerl-1.6.924/examples/sirna/TAG BioPerl-1.6.924/examples/structure BioPerl-1.6.924/examples/structure/structure-io.pl BioPerl-1.6.924/examples/tk BioPerl-1.6.924/examples/tk/gsequence.pl BioPerl-1.6.924/examples/tk/hitdisplay.pl BioPerl-1.6.924/examples/tools BioPerl-1.6.924/examples/tools/extract_genes.pl BioPerl-1.6.924/examples/tools/gb_to_gff.pl BioPerl-1.6.924/examples/tools/gff2ps.pl BioPerl-1.6.924/examples/tools/parse_codeml.pl BioPerl-1.6.924/examples/tools/psw.pl BioPerl-1.6.924/examples/tools/reverse-translate.pl BioPerl-1.6.924/examples/tools/run_genscan.pl BioPerl-1.6.924/examples/tools/run_primer3.pl BioPerl-1.6.924/examples/tools/seq_pattern.pl BioPerl-1.6.924/examples/tools/standaloneblast.pl BioPerl-1.6.924/examples/tree BioPerl-1.6.924/examples/tree/paup2phylip.pl BioPerl-1.6.924/ide BioPerl-1.6.924/ide/bioperl.komodo BioPerl-1.6.924/ide/bioperl-mode BioPerl-1.6.924/ide/bioperl-mode/README BioPerl-1.6.924/ide/bioperl-mode/dist BioPerl-1.6.924/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar BioPerl-1.6.924/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5 BioPerl-1.6.924/ide/bioperl-mode/dist/bioperl-mode.tar BioPerl-1.6.924/ide/bioperl-mode/dist/bioperl-mode.tar.md5 BioPerl-1.6.924/ide/bioperl-mode/dist/Changes BioPerl-1.6.924/ide/bioperl-mode/dist/package-me BioPerl-1.6.924/ide/bioperl-mode/dist/SKIP BioPerl-1.6.924/ide/bioperl-mode/etc BioPerl-1.6.924/ide/bioperl-mode/etc/images BioPerl-1.6.924/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm BioPerl-1.6.924/ide/bioperl-mode/etc/images/bpmode-tool.xpm BioPerl-1.6.924/ide/bioperl-mode/site-lisp BioPerl-1.6.924/ide/bioperl-mode/site-lisp/bioperl-init.el BioPerl-1.6.924/ide/bioperl-mode/site-lisp/bioperl-mode.el BioPerl-1.6.924/ide/bioperl-mode/site-lisp/bioperl-skel.el BioPerl-1.6.924/ide/bioperl-mode/site-lisp/pod.el BioPerl-1.6.924/maintenance BioPerl-1.6.924/maintenance/authors.pl BioPerl-1.6.924/maintenance/check_NAME.pl BioPerl-1.6.924/maintenance/check_URLs.pl BioPerl-1.6.924/maintenance/cvs2cl_by_file.pl BioPerl-1.6.924/maintenance/dependencies.pl BioPerl-1.6.924/maintenance/deprecated.pl BioPerl-1.6.924/maintenance/find_mod_deps.pl BioPerl-1.6.924/maintenance/module_usage.pl BioPerl-1.6.924/maintenance/modules.pl BioPerl-1.6.924/maintenance/ncbi_blast_switches.pl BioPerl-1.6.924/maintenance/perltidy.conf BioPerl-1.6.924/maintenance/pod.pl BioPerl-1.6.924/maintenance/README BioPerl-1.6.924/maintenance/symlink_script.pl BioPerl-1.6.924/maintenance/version.pl BioPerl-1.6.924/maintenance/big_split BioPerl-1.6.924/maintenance/big_split/file_classification.csv BioPerl-1.6.924/maintenance/big_split/rbuels_notes.txt BioPerl-1.6.924/models BioPerl-1.6.924/models/biblio.dia BioPerl-1.6.924/models/bio_liveseq_variation.dia BioPerl-1.6.924/models/bio_map.dia BioPerl-1.6.924/models/bio_restriction.dia BioPerl-1.6.924/models/bioperl.dia BioPerl-1.6.924/models/coordinatemapper.dia BioPerl-1.6.924/models/map_proposal.txt BioPerl-1.6.924/models/maps_and_markers.dia BioPerl-1.6.924/models/popgen.dia BioPerl-1.6.924/models/population_proposal.txt BioPerl-1.6.924/models/README BioPerl-1.6.924/scripts BioPerl-1.6.924/scripts/README BioPerl-1.6.924/scripts/Bio-DB-GFF BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_bulk_load_gff.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_fast_load_gff.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_genbank2gff.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_genbank2gff3.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_generate_histogram.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_load_gff.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_meta_gff.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_process_gadfly.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_process_sgd.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/bp_process_wormbase.pl BioPerl-1.6.924/scripts/Bio-DB-GFF/README BioPerl-1.6.924/scripts/Bio-DB-SeqFeature-Store BioPerl-1.6.924/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl BioPerl-1.6.924/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl BioPerl-1.6.924/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl BioPerl-1.6.924/scripts/das BioPerl-1.6.924/scripts/das/bp_das_server.pl BioPerl-1.6.924/scripts/das/README BioPerl-1.6.924/scripts/das/TAG BioPerl-1.6.924/scripts/DB BioPerl-1.6.924/scripts/DB/bp_biofetch_genbank_proxy.pl BioPerl-1.6.924/scripts/DB/bp_bioflat_index.pl BioPerl-1.6.924/scripts/DB/bp_biogetseq.pl BioPerl-1.6.924/scripts/DB/bp_flanks.pl BioPerl-1.6.924/scripts/DB/TAG BioPerl-1.6.924/scripts/DB-HIV BioPerl-1.6.924/scripts/DB-HIV/bp_hivq.pl BioPerl-1.6.924/scripts/index BioPerl-1.6.924/scripts/index/bp_fetch.pl BioPerl-1.6.924/scripts/index/bp_index.pl BioPerl-1.6.924/scripts/index/bp_seqret.pl BioPerl-1.6.924/scripts/index/TAG BioPerl-1.6.924/scripts/popgen BioPerl-1.6.924/scripts/popgen/bp_composite_LD.pl BioPerl-1.6.924/scripts/popgen/bp_heterogeneity_test.pl BioPerl-1.6.924/scripts/searchio BioPerl-1.6.924/scripts/searchio/bp_fastam9_to_table.pl BioPerl-1.6.924/scripts/searchio/bp_filter_search.pl BioPerl-1.6.924/scripts/searchio/bp_hmmer_to_table.pl BioPerl-1.6.924/scripts/searchio/bp_parse_hmmsearch.pl BioPerl-1.6.924/scripts/searchio/bp_search2table.pl BioPerl-1.6.924/scripts/searchio/README BioPerl-1.6.924/scripts/searchio/TAG BioPerl-1.6.924/scripts/seq BioPerl-1.6.924/scripts/seq/bp_extract_feature_seq.pl BioPerl-1.6.924/scripts/seq/bp_make_mrna_protein.pl BioPerl-1.6.924/scripts/seq/bp_seqconvert.pl BioPerl-1.6.924/scripts/seq/bp_seqcut.pl BioPerl-1.6.924/scripts/seq/bp_seqpart.pl BioPerl-1.6.924/scripts/seq/bp_seqretsplit.pl BioPerl-1.6.924/scripts/seq/bp_split_seq.pl BioPerl-1.6.924/scripts/seq/bp_translate_seq.pl BioPerl-1.6.924/scripts/seq/bp_unflatten_seq.pl BioPerl-1.6.924/scripts/seq/TAG BioPerl-1.6.924/scripts/seqstats BioPerl-1.6.924/scripts/seqstats/bp_aacomp.pl BioPerl-1.6.924/scripts/seqstats/bp_chaos_plot.pl BioPerl-1.6.924/scripts/seqstats/bp_gccalc.pl BioPerl-1.6.924/scripts/seqstats/bp_oligo_count.pl BioPerl-1.6.924/scripts/seqstats/TAG BioPerl-1.6.924/scripts/taxa BioPerl-1.6.924/scripts/taxa/bp_classify_hits_kingdom.pl BioPerl-1.6.924/scripts/taxa/bp_local_taxonomydb_query.pl BioPerl-1.6.924/scripts/taxa/bp_query_entrez_taxa.pl BioPerl-1.6.924/scripts/taxa/bp_taxid4species.pl BioPerl-1.6.924/scripts/taxa/bp_taxonomy2tree.pl BioPerl-1.6.924/scripts/taxa/TAG BioPerl-1.6.924/scripts/tree BioPerl-1.6.924/scripts/tree/bp_blast2tree.pl BioPerl-1.6.924/scripts/tree/bp_nexus2nh.pl BioPerl-1.6.924/scripts/tree/bp_tree2pag.pl BioPerl-1.6.924/scripts/tree/TAG BioPerl-1.6.924/scripts/utilities BioPerl-1.6.924/scripts/utilities/bp_dbsplit.pl BioPerl-1.6.924/scripts/utilities/bp_download_query_genbank.pl BioPerl-1.6.924/scripts/utilities/bp_mask_by_search.pl BioPerl-1.6.924/scripts/utilities/bp_mrtrans.pl BioPerl-1.6.924/scripts/utilities/bp_mutate.pl BioPerl-1.6.924/scripts/utilities/bp_netinstall.pl BioPerl-1.6.924/scripts/utilities/bp_nrdb.pl BioPerl-1.6.924/scripts/utilities/bp_pairwise_kaks.pl BioPerl-1.6.924/scripts/utilities/bp_remote_blast.pl BioPerl-1.6.924/scripts/utilities/bp_revtrans-motif.pl BioPerl-1.6.924/scripts/utilities/bp_search2alnblocks.pl BioPerl-1.6.924/scripts/utilities/bp_search2BSML.pl BioPerl-1.6.924/scripts/utilities/bp_search2gff.pl BioPerl-1.6.924/scripts/utilities/bp_search2tribe.pl BioPerl-1.6.924/scripts/utilities/bp_seq_length.pl BioPerl-1.6.924/scripts/utilities/bp_sreformat.pl BioPerl-1.6.924/scripts/utilities/README BioPerl-1.6.924/scripts/utilities/TAG BioPerl-1.6.924/t BioPerl-1.6.924/t/Alphabet.t BioPerl-1.6.924/t/nexml.t BioPerl-1.6.924/t/Perl.t BioPerl-1.6.924/t/PodSyntax.t BioPerl-1.6.924/t/SearchDist.t BioPerl-1.6.924/t/SeqEvolution.t BioPerl-1.6.924/t/Species.t BioPerl-1.6.924/t/Symbol.t BioPerl-1.6.924/t/TaxonTree.t BioPerl-1.6.924/t/Align BioPerl-1.6.924/t/Align/AlignStats.t BioPerl-1.6.924/t/Align/AlignUtil.t BioPerl-1.6.924/t/Align/Graphics.t BioPerl-1.6.924/t/Align/SimpleAlign.t BioPerl-1.6.924/t/Align/TreeBuild.t BioPerl-1.6.924/t/Align/Utilities.t BioPerl-1.6.924/t/AlignIO BioPerl-1.6.924/t/AlignIO/AlignIO.t BioPerl-1.6.924/t/AlignIO/arp.t BioPerl-1.6.924/t/AlignIO/bl2seq.t BioPerl-1.6.924/t/AlignIO/clustalw.t BioPerl-1.6.924/t/AlignIO/emboss.t BioPerl-1.6.924/t/AlignIO/fasta.t BioPerl-1.6.924/t/AlignIO/largemultifasta.t BioPerl-1.6.924/t/AlignIO/maf.t BioPerl-1.6.924/t/AlignIO/mase.t BioPerl-1.6.924/t/AlignIO/mega.t BioPerl-1.6.924/t/AlignIO/meme.t BioPerl-1.6.924/t/AlignIO/metafasta.t BioPerl-1.6.924/t/AlignIO/msf.t BioPerl-1.6.924/t/AlignIO/nexml.t BioPerl-1.6.924/t/AlignIO/nexus.t BioPerl-1.6.924/t/AlignIO/pfam.t BioPerl-1.6.924/t/AlignIO/phylip.t BioPerl-1.6.924/t/AlignIO/po.t BioPerl-1.6.924/t/AlignIO/prodom.t BioPerl-1.6.924/t/AlignIO/psi.t BioPerl-1.6.924/t/AlignIO/selex.t BioPerl-1.6.924/t/AlignIO/stockholm.t BioPerl-1.6.924/t/AlignIO/xmfa.t BioPerl-1.6.924/t/Annotation BioPerl-1.6.924/t/Annotation/Annotation.t BioPerl-1.6.924/t/Annotation/AnnotationAdaptor.t BioPerl-1.6.924/t/Assembly BioPerl-1.6.924/t/Assembly/ContigSpectrum.t BioPerl-1.6.924/t/Assembly/core.t BioPerl-1.6.924/t/Assembly/IO BioPerl-1.6.924/t/Assembly/IO/bowtie.t BioPerl-1.6.924/t/Assembly/IO/sam.t BioPerl-1.6.924/t/Cluster BioPerl-1.6.924/t/Cluster/UniGene.t BioPerl-1.6.924/t/ClusterIO BioPerl-1.6.924/t/ClusterIO/ClusterIO.t BioPerl-1.6.924/t/ClusterIO/SequenceFamily.t BioPerl-1.6.924/t/ClusterIO/unigene.t BioPerl-1.6.924/t/Coordinate BioPerl-1.6.924/t/Coordinate/CoordinateBoundaryTest.t BioPerl-1.6.924/t/Coordinate/CoordinateGraph.t BioPerl-1.6.924/t/Coordinate/CoordinateMapper.t BioPerl-1.6.924/t/Coordinate/GeneCoordinateMapper.t BioPerl-1.6.924/t/data BioPerl-1.6.924/t/data/01_basic.xml BioPerl-1.6.924/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.924/t/data/02_dogfish_no_taxrefs.xml BioPerl-1.6.924/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.924/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.924/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.924/t/data/02_mackerel_no_taxrefs.xml BioPerl-1.6.924/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.924/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.924/t/data/03_bootstraps.xml BioPerl-1.6.924/t/data/03_bootstraps_in_tag.xml BioPerl-1.6.924/t/data/04_labeled_ancestors.xml BioPerl-1.6.924/t/data/05_ancestral_states.xml BioPerl-1.6.924/t/data/13-pilE-F.scf BioPerl-1.6.924/t/data/1A11.pdb BioPerl-1.6.924/t/data/1A3I.pdb BioPerl-1.6.924/t/data/1BPT.pdb BioPerl-1.6.924/t/data/1ZZ19XR301R-Alignment.tblastn BioPerl-1.6.924/t/data/2008.blasttable BioPerl-1.6.924/t/data/27-contig_Newbler.ace BioPerl-1.6.924/t/data/503384.MEGABLAST.0 BioPerl-1.6.924/t/data/503384.MEGABLAST.2 BioPerl-1.6.924/t/data/5X_1895.FASTXY BioPerl-1.6.924/t/data/8HVP.pdb BioPerl-1.6.924/t/data/a_thaliana.blastn BioPerl-1.6.924/t/data/AAC12660.fa BioPerl-1.6.924/t/data/aaml.mlc BioPerl-1.6.924/t/data/aaml_pairwise.mlc BioPerl-1.6.924/t/data/AB077698.gb BioPerl-1.6.924/t/data/acefile.ace.1 BioPerl-1.6.924/t/data/acefile.singlets BioPerl-1.6.924/t/data/adh.mb_tree.nexus BioPerl-1.6.924/t/data/AE003528_ecoli.bls BioPerl-1.6.924/t/data/AE003644_Adh-genomic.gb BioPerl-1.6.924/t/data/AF032047.gbk BioPerl-1.6.924/t/data/AF165282.gb BioPerl-1.6.924/t/data/AF305198.gb BioPerl-1.6.924/t/data/AHCYL1.kegg BioPerl-1.6.924/t/data/alleles.fas BioPerl-1.6.924/t/data/alnfile.fasta BioPerl-1.6.924/t/data/amino.fa BioPerl-1.6.924/t/data/amphora.newick BioPerl-1.6.924/t/data/AnnIX-v003.gbk BioPerl-1.6.924/t/data/ar.embl BioPerl-1.6.924/t/data/assembly_with_singlets.ace BioPerl-1.6.924/t/data/ATF14F8.gbk BioPerl-1.6.924/t/data/atp1.matrix BioPerl-1.6.924/t/data/ay007676.gb BioPerl-1.6.924/t/data/AY095303S1.gbk BioPerl-1.6.924/t/data/ay116458.gb BioPerl-1.6.924/t/data/ay149291.gb BioPerl-1.6.924/t/data/AY763288.gb BioPerl-1.6.924/t/data/BAB68554.gb BioPerl-1.6.924/t/data/badfasta.fa BioPerl-1.6.924/t/data/barns-combined.nex BioPerl-1.6.924/t/data/baseml.pairwise BioPerl-1.6.924/t/data/baseml.usertree BioPerl-1.6.924/t/data/basic-bush.nex BioPerl-1.6.924/t/data/basic-ladder.nex BioPerl-1.6.924/t/data/BC000007.gbk BioPerl-1.6.924/t/data/BEL16-LTR_AG.embl BioPerl-1.6.924/t/data/biofpc.cor BioPerl-1.6.924/t/data/biofpc.fpc BioPerl-1.6.924/t/data/biorecipe.nhx BioPerl-1.6.924/t/data/Bird_Ovomucoids.nex BioPerl-1.6.924/t/data/BK000016-tpa.gbk BioPerl-1.6.924/t/data/bl2seq+.blastn BioPerl-1.6.924/t/data/bl2seq.blastn BioPerl-1.6.924/t/data/bl2seq.blastn.rev BioPerl-1.6.924/t/data/bl2seq.blastx.out BioPerl-1.6.924/t/data/bl2seq.bug940.out BioPerl-1.6.924/t/data/bl2seq.out BioPerl-1.6.924/t/data/bl2seq.tblastn.out BioPerl-1.6.924/t/data/bl2seq.tblastx.out BioPerl-1.6.924/t/data/blast.report BioPerl-1.6.924/t/data/blast_no_hit_desc.txt BioPerl-1.6.924/t/data/blast_plus.blastp BioPerl-1.6.924/t/data/blastp2215.blast BioPerl-1.6.924/t/data/blat.psLayout3 BioPerl-1.6.924/t/data/BLOSUM50 BioPerl-1.6.924/t/data/blosum62.bla BioPerl-1.6.924/t/data/BN000066-tpa.embl BioPerl-1.6.924/t/data/bootstrap.tre BioPerl-1.6.924/t/data/BOSS_DROME.FASTP_v35_04 BioPerl-1.6.924/t/data/branchSite.mlc BioPerl-1.6.924/t/data/brassica_ATH.WUBLASTN BioPerl-1.6.924/t/data/bug1986.blast2 BioPerl-1.6.924/t/data/bug1986.blastp BioPerl-1.6.924/t/data/bug2120.phd BioPerl-1.6.924/t/data/bug2246.blast BioPerl-1.6.924/t/data/bug2391.megablast BioPerl-1.6.924/t/data/bug2399.tblastn BioPerl-1.6.924/t/data/bug2453.maf BioPerl-1.6.924/t/data/bug2473.fasta BioPerl-1.6.924/t/data/bug2862.pmr BioPerl-1.6.924/t/data/bug2869.tree BioPerl-1.6.924/t/data/bug2901.fa BioPerl-1.6.924/t/data/bug2937.fasta BioPerl-1.6.924/t/data/bug2942.blastx BioPerl-1.6.924/t/data/bug2982.embl BioPerl-1.6.924/t/data/bug2982.gb BioPerl-1.6.924/t/data/bug3021.gmap BioPerl-1.6.924/t/data/bug3086.embl BioPerl-1.6.924/t/data/bug3331.mlc BioPerl-1.6.924/t/data/c200-vs-yeast.BLASTN BioPerl-1.6.924/t/data/c200-vs-yeast.BLASTN.m8 BioPerl-1.6.924/t/data/calm.swiss BioPerl-1.6.924/t/data/catalase-webblast.BLASTP BioPerl-1.6.924/t/data/cds-266.fas BioPerl-1.6.924/t/data/cds_sample.embl BioPerl-1.6.924/t/data/CG11099.fasaln BioPerl-1.6.924/t/data/CG2865.fasaln BioPerl-1.6.924/t/data/chad100.scf BioPerl-1.6.924/t/data/char-interleave.nex BioPerl-1.6.924/t/data/char-matrix-spaces.nex BioPerl-1.6.924/t/data/characters+trees.nexml.xml BioPerl-1.6.924/t/data/characters.nexml.old.xml BioPerl-1.6.924/t/data/codeml.mlc BioPerl-1.6.924/t/data/codeml315.mlc BioPerl-1.6.924/t/data/codeml4.mlc BioPerl-1.6.924/t/data/codeml43.mlc BioPerl-1.6.924/t/data/codeml43_nssites.mlc BioPerl-1.6.924/t/data/codeml45.mlc BioPerl-1.6.924/t/data/codeml45b.mlc BioPerl-1.6.924/t/data/codeml_nan.mlc BioPerl-1.6.924/t/data/codeml_nssites.mlc BioPerl-1.6.924/t/data/compLD_missingtest.prettybase BioPerl-1.6.924/t/data/compLD_test.prettybase BioPerl-1.6.924/t/data/component.ontology.test BioPerl-1.6.924/t/data/component.ontology.test2 BioPerl-1.6.924/t/data/contig-by-hand.wublastp BioPerl-1.6.924/t/data/contigspectrumtest.tigr BioPerl-1.6.924/t/data/crab.dat.cn BioPerl-1.6.924/t/data/crab.nj BioPerl-1.6.924/t/data/crab.njb BioPerl-1.6.924/t/data/crypto.sim4-0 BioPerl-1.6.924/t/data/crypto.sim4-3 BioPerl-1.6.924/t/data/crypto.sim4-4 BioPerl-1.6.924/t/data/ctgdemo.fpc BioPerl-1.6.924/t/data/cys1_dicdi.water BioPerl-1.6.924/t/data/cysprot.fa BioPerl-1.6.924/t/data/cysprot.msf BioPerl-1.6.924/t/data/cysprot.needle BioPerl-1.6.924/t/data/cysprot.tblastn BioPerl-1.6.924/t/data/cysprot.water BioPerl-1.6.924/t/data/cysprot1.fa BioPerl-1.6.924/t/data/cysprot1.FASTA BioPerl-1.6.924/t/data/cysprot1a.fa BioPerl-1.6.924/t/data/cysprot1a.msf BioPerl-1.6.924/t/data/cysprot1b.fa BioPerl-1.6.924/t/data/cysprot1b.hmmsearch BioPerl-1.6.924/t/data/cysprot1b.msf BioPerl-1.6.924/t/data/cysprot1b.newick BioPerl-1.6.924/t/data/cysprot_vs_gadfly.FASTA BioPerl-1.6.924/t/data/D10483.gbk BioPerl-1.6.924/t/data/D12555.gbk BioPerl-1.6.924/t/data/dcr1_sp.WUBLASTP BioPerl-1.6.924/t/data/dmel_2Lchunk.gb BioPerl-1.6.924/t/data/dna1.fa BioPerl-1.6.924/t/data/dna2.fa BioPerl-1.6.924/t/data/dnaE-bsub-prot.fa BioPerl-1.6.924/t/data/dnaE-bsub.fa BioPerl-1.6.924/t/data/dnaEbsub_ecoli.wublastx BioPerl-1.6.924/t/data/dnaEbsub_ecoli.wutblastn BioPerl-1.6.924/t/data/dnaEbsub_ecoli.wutblastx BioPerl-1.6.924/t/data/DQ018368.gb BioPerl-1.6.924/t/data/dq519393.gb BioPerl-1.6.924/t/data/ECAPAH02.embl BioPerl-1.6.924/t/data/echofilter.wublastn BioPerl-1.6.924/t/data/ecoli-trna-qrna.out BioPerl-1.6.924/t/data/ecoli_domains.rps.xml BioPerl-1.6.924/t/data/ecoli_domains.rpsblast BioPerl-1.6.924/t/data/ecolitst.bls BioPerl-1.6.924/t/data/ecolitst.fa BioPerl-1.6.924/t/data/ecolitst.noseqs.wublastp BioPerl-1.6.924/t/data/ecolitst.wublastp BioPerl-1.6.924/t/data/EG352462.gbxml BioPerl-1.6.924/t/data/empty.bl2seq BioPerl-1.6.924/t/data/ENr111.mfa.example.elems BioPerl-1.6.924/t/data/entrezgene.dat BioPerl-1.6.924/t/data/entrezgene_bug3453.dat BioPerl-1.6.924/t/data/ex1.nucl.nhx BioPerl-1.6.924/t/data/example.hap BioPerl-1.6.924/t/data/example.phase BioPerl-1.6.924/t/data/example.vcf BioPerl-1.6.924/t/data/exonerate.output.dontwork BioPerl-1.6.924/t/data/exonerate.output.negativescore.works BioPerl-1.6.924/t/data/exonerate.output.works BioPerl-1.6.924/t/data/exonerate.whitespace_before_query.works BioPerl-1.6.924/t/data/expected.blast.out BioPerl-1.6.924/t/data/exsignalp.out BioPerl-1.6.924/t/data/factor7.embl BioPerl-1.6.924/t/data/Fang_2003.xml BioPerl-1.6.924/t/data/fgenesh.out BioPerl-1.6.924/t/data/footprinter.out BioPerl-1.6.924/t/data/forward_primer.fa BioPerl-1.6.924/t/data/forward_reverse_primers.fa BioPerl-1.6.924/t/data/frac_problems.blast BioPerl-1.6.924/t/data/frac_problems2.blast BioPerl-1.6.924/t/data/frac_problems3.blast BioPerl-1.6.924/t/data/geneid_1.0.out BioPerl-1.6.924/t/data/genemark-fragment.out BioPerl-1.6.924/t/data/genemark.out BioPerl-1.6.924/t/data/genewise.out BioPerl-1.6.924/t/data/genewise_output.paracel_btk BioPerl-1.6.924/t/data/genomewise.out BioPerl-1.6.924/t/data/genomic-seq.epcr BioPerl-1.6.924/t/data/genomic-seq.fasta BioPerl-1.6.924/t/data/genomic-seq.genscan BioPerl-1.6.924/t/data/genomic-seq.mzef BioPerl-1.6.924/t/data/Genscan.FastA BioPerl-1.6.924/t/data/gf-s71.needle BioPerl-1.6.924/t/data/Glimmer2.out BioPerl-1.6.924/t/data/glimmer3-fragment.detail BioPerl-1.6.924/t/data/glimmer3-fragment.predict BioPerl-1.6.924/t/data/Glimmer3.detail BioPerl-1.6.924/t/data/Glimmer3.predict BioPerl-1.6.924/t/data/GlimmerHMM.out BioPerl-1.6.924/t/data/GlimmerM.out BioPerl-1.6.924/t/data/gmap_f9-multiple_results.txt BioPerl-1.6.924/t/data/gmap_f9-reverse-strand.txt BioPerl-1.6.924/t/data/gmap_f9.txt BioPerl-1.6.924/t/data/GO.defs.test BioPerl-1.6.924/t/data/GO.defs.test2 BioPerl-1.6.924/t/data/headerless.psl BioPerl-1.6.924/t/data/hg16_chroms.gff BioPerl-1.6.924/t/data/hmmpfam.out BioPerl-1.6.924/t/data/hmmpfam_cs.out BioPerl-1.6.924/t/data/hmmpfam_fake.out BioPerl-1.6.924/t/data/hmmpfam_HSPdashline.txt BioPerl-1.6.924/t/data/hmmpfam_multiresult.out BioPerl-1.6.924/t/data/hmmscan.out BioPerl-1.6.924/t/data/hmmscan_multi_domain.out BioPerl-1.6.924/t/data/hmmscan_sec_struct.out BioPerl-1.6.924/t/data/hmmsearch.out BioPerl-1.6.924/t/data/hmmsearch3.out BioPerl-1.6.924/t/data/hmmsearch3_multi.out BioPerl-1.6.924/t/data/hs_est.est2genome BioPerl-1.6.924/t/data/hs_fugu.newick BioPerl-1.6.924/t/data/hs_owlmonkey.aln BioPerl-1.6.924/t/data/hs_owlmonkey.fas BioPerl-1.6.924/t/data/hs_owlmonkey.fasta BioPerl-1.6.924/t/data/hsinsulin.blastcl3.blastn BioPerl-1.6.924/t/data/HUMBETGLOA.fa BioPerl-1.6.924/t/data/HUMBETGLOA.FASTA BioPerl-1.6.924/t/data/HUMBETGLOA.gff BioPerl-1.6.924/t/data/HUMBETGLOA.grail BioPerl-1.6.924/t/data/HUMBETGLOA.grailexp BioPerl-1.6.924/t/data/HUMBETGLOA.mzef BioPerl-1.6.924/t/data/HUMBETGLOA.tblastx BioPerl-1.6.924/t/data/humor.maf BioPerl-1.6.924/t/data/humts1.pal BioPerl-1.6.924/t/data/hybrid2.gff3 BioPerl-1.6.924/t/data/in.fasta BioPerl-1.6.924/t/data/insulin.water BioPerl-1.6.924/t/data/interpro.xml BioPerl-1.6.924/t/data/interpro_ebi.xml BioPerl-1.6.924/t/data/interpro_relationship.xml BioPerl-1.6.924/t/data/interpro_sample.xml BioPerl-1.6.924/t/data/interpro_short.xml BioPerl-1.6.924/t/data/intrablock-comment.nex BioPerl-1.6.924/t/data/Kingdoms_DNA.nex BioPerl-1.6.924/t/data/L77119.hmmer BioPerl-1.6.924/t/data/little.largemultifasta BioPerl-1.6.924/t/data/LittleChrY.dbsnp.xml BioPerl-1.6.924/t/data/LOAD_Ccd1.dnd BioPerl-1.6.924/t/data/long-names.nex BioPerl-1.6.924/t/data/longnames.aln BioPerl-1.6.924/t/data/longnames.dnd BioPerl-1.6.924/t/data/lucy.info BioPerl-1.6.924/t/data/lucy.qual BioPerl-1.6.924/t/data/lucy.seq BioPerl-1.6.924/t/data/lucy.stderr BioPerl-1.6.924/t/data/lysozyme6.protml BioPerl-1.6.924/t/data/lysozyme6.simple.protml BioPerl-1.6.924/t/data/M0.mlc BioPerl-1.6.924/t/data/M12730.gb BioPerl-1.6.924/t/data/mapmaker.out BioPerl-1.6.924/t/data/mapmaker.txt BioPerl-1.6.924/t/data/mast.dat BioPerl-1.6.924/t/data/masta.dat BioPerl-1.6.924/t/data/match.output BioPerl-1.6.924/t/data/Mcjanrna_rdbII.gbk BioPerl-1.6.924/t/data/megablast_output.paracel_btk BioPerl-1.6.924/t/data/meme.dat BioPerl-1.6.924/t/data/mini-AE001405.gb BioPerl-1.6.924/t/data/mini-align.aln BioPerl-1.6.924/t/data/mixedmast.dat BioPerl-1.6.924/t/data/MmCT BioPerl-1.6.924/t/data/mpath.ontology.test BioPerl-1.6.924/t/data/MSGEFTUA.gb BioPerl-1.6.924/t/data/multi.blast.m8 BioPerl-1.6.924/t/data/multi.blast.m9 BioPerl-1.6.924/t/data/multi.phd BioPerl-1.6.924/t/data/multi_1.fa BioPerl-1.6.924/t/data/multi_2.fa BioPerl-1.6.924/t/data/multi_blast.bls BioPerl-1.6.924/t/data/multifa.seq BioPerl-1.6.924/t/data/multifa.seq.qual BioPerl-1.6.924/t/data/multiline-intrablock-comment.nex BioPerl-1.6.924/t/data/multiresult_blastn+.bls BioPerl-1.6.924/t/data/multiseq.bls BioPerl-1.6.924/t/data/multiseq_tags.phd BioPerl-1.6.924/t/data/mus.bls.xml BioPerl-1.6.924/t/data/mutations.dat BioPerl-1.6.924/t/data/mutations.old.dat BioPerl-1.6.924/t/data/mutations.old.xml BioPerl-1.6.924/t/data/mutations.xml BioPerl-1.6.924/t/data/myco_sites.gff BioPerl-1.6.924/t/data/NC_000007-ribosomal-slippage.gb BioPerl-1.6.924/t/data/NC_001284.gbk BioPerl-1.6.924/t/data/NC_002058_multDBLINK_bug3375.gb BioPerl-1.6.924/t/data/NC_006346.gb BioPerl-1.6.924/t/data/NC_006511-short.gbk BioPerl-1.6.924/t/data/NC_008536.gb BioPerl-1.6.924/t/data/nei_gojobori_test.aln BioPerl-1.6.924/t/data/neighbor.dist BioPerl-1.6.924/t/data/new_blastn.txt BioPerl-1.6.924/t/data/newblast.xml BioPerl-1.6.924/t/data/nhmmer-3.1.out BioPerl-1.6.924/t/data/nhx-bacteria.nhx BioPerl-1.6.924/t/data/NM_002254.gb BioPerl-1.6.924/t/data/no-genes.genscan BioPerl-1.6.924/t/data/no_cds_example.gb BioPerl-1.6.924/t/data/no_FH.embl BioPerl-1.6.924/t/data/no_hsps.blastp BioPerl-1.6.924/t/data/no_semicolon.newick BioPerl-1.6.924/t/data/noninterleaved.phy BioPerl-1.6.924/t/data/NT_021877.gbk BioPerl-1.6.924/t/data/nucmatrix.txt BioPerl-1.6.924/t/data/O_sat.wgs BioPerl-1.6.924/t/data/omim_genemap_test BioPerl-1.6.924/t/data/omim_genemap_test_nolinebreak BioPerl-1.6.924/t/data/omim_text_test BioPerl-1.6.924/t/data/P33897 BioPerl-1.6.924/t/data/P35527.gb BioPerl-1.6.924/t/data/P39765.gb BioPerl-1.6.924/t/data/PAM250 BioPerl-1.6.924/t/data/pep-266.aln BioPerl-1.6.924/t/data/pfam_tests.stk BioPerl-1.6.924/t/data/pfamOutput-bug3376.out BioPerl-1.6.924/t/data/phi.out BioPerl-1.6.924/t/data/phipsi.out BioPerl-1.6.924/t/data/phylipdist-36.out BioPerl-1.6.924/t/data/phylipdist.out BioPerl-1.6.924/t/data/phyloxml_examples.xml BioPerl-1.6.924/t/data/pictogram.fa BioPerl-1.6.924/t/data/plague_yeast.bls.xml BioPerl-1.6.924/t/data/polymorphism.dat BioPerl-1.6.924/t/data/polymorphism.old.xml BioPerl-1.6.924/t/data/polymorphism.xml BioPerl-1.6.924/t/data/popgen_saureus.dat BioPerl-1.6.924/t/data/popgen_saureus.multidat BioPerl-1.6.924/t/data/popstats.prettybase BioPerl-1.6.924/t/data/pre_rel9.swiss BioPerl-1.6.924/t/data/Primate_mtDNA.nex BioPerl-1.6.924/t/data/primedseq.fa BioPerl-1.6.924/t/data/primer3_infile.txt BioPerl-1.6.924/t/data/primer3_outfile.txt BioPerl-1.6.924/t/data/primer3_output.txt BioPerl-1.6.924/t/data/prints.out BioPerl-1.6.924/t/data/promoterwise.out BioPerl-1.6.924/t/data/protpars.phy BioPerl-1.6.924/t/data/protpars_longid.phy BioPerl-1.6.924/t/data/pseudowise.out BioPerl-1.6.924/t/data/psi_xml.dat BioPerl-1.6.924/t/data/psiblast.xml BioPerl-1.6.924/t/data/psiblastreport.out BioPerl-1.6.924/t/data/purine_v081.infernal BioPerl-1.6.924/t/data/puzzle.tre BioPerl-1.6.924/t/data/PX1CG.gb BioPerl-1.6.924/t/data/Q8GBD3.swiss BioPerl-1.6.924/t/data/qrna-relloc.out BioPerl-1.6.924/t/data/qualfile.qual BioPerl-1.6.924/t/data/quoted-strings1.nex BioPerl-1.6.924/t/data/quoted-strings2.nex BioPerl-1.6.924/t/data/Rab1.chaos-xml BioPerl-1.6.924/t/data/radical-whitespace.nex BioPerl-1.6.924/t/data/radical-whitespace_02.nex BioPerl-1.6.924/t/data/rebase.itype2 BioPerl-1.6.924/t/data/rebase.withrefm BioPerl-1.6.924/t/data/reference_ace.ace BioPerl-1.6.924/t/data/regulation_test.obo BioPerl-1.6.924/t/data/rel9.swiss BioPerl-1.6.924/t/data/repeatmasker.fa.out BioPerl-1.6.924/t/data/revcomp_mrna.gb BioPerl-1.6.924/t/data/rfam_tests.stk BioPerl-1.6.924/t/data/ribosome-slippage.gb BioPerl-1.6.924/t/data/roa1.dat BioPerl-1.6.924/t/data/roa1.gbxml BioPerl-1.6.924/t/data/roa1.genbank BioPerl-1.6.924/t/data/roa1.swiss BioPerl-1.6.924/t/data/roa1_v2.dat BioPerl-1.6.924/t/data/rpsblast.bls BioPerl-1.6.924/t/data/rpsblast_no_hits.bls BioPerl-1.6.924/t/data/sample_dataset.tigr BioPerl-1.6.924/t/data/sbay_c127.fas BioPerl-1.6.924/t/data/sbay_c545-yeast.BLASTZ.PSL BioPerl-1.6.924/t/data/seg.out BioPerl-1.6.924/t/data/semicolon.newick BioPerl-1.6.924/t/data/seqdatabase.ini BioPerl-1.6.924/t/data/seqfile.pir BioPerl-1.6.924/t/data/seqs.fas BioPerl-1.6.924/t/data/sequencefamily.dat BioPerl-1.6.924/t/data/seqxml.xml BioPerl-1.6.924/t/data/short.blx BioPerl-1.6.924/t/data/signalp.hmm.short BioPerl-1.6.924/t/data/signalp.hmm.summary BioPerl-1.6.924/t/data/signalp.negative.out BioPerl-1.6.924/t/data/signalp.nn.short BioPerl-1.6.924/t/data/signalp.nn.summary BioPerl-1.6.924/t/data/signalp.positive.out BioPerl-1.6.924/t/data/signalp.short BioPerl-1.6.924/t/data/signalp.summary BioPerl-1.6.924/t/data/sim4.for.for BioPerl-1.6.924/t/data/sim4.for.rev BioPerl-1.6.924/t/data/sim4.rev BioPerl-1.6.924/t/data/singleNSsite.mlc BioPerl-1.6.924/t/data/singlescore.gbk BioPerl-1.6.924/t/data/singlet_w_CT.ace BioPerl-1.6.924/t/data/so.obo BioPerl-1.6.924/t/data/sofa.ontology BioPerl-1.6.924/t/data/sp_subset.obo BioPerl-1.6.924/t/data/spaced_fasta.fa BioPerl-1.6.924/t/data/spaces.nex BioPerl-1.6.924/t/data/SPAN_Family4nl.nex BioPerl-1.6.924/t/data/SPAN_Family7n.nex BioPerl-1.6.924/t/data/SPAN_Family8a.nex BioPerl-1.6.924/t/data/sparsealn.needle BioPerl-1.6.924/t/data/spidey.noalignment BioPerl-1.6.924/t/data/spidey.test1 BioPerl-1.6.924/t/data/sprintf.rnamotif BioPerl-1.6.924/t/data/ssp160.embl.1 BioPerl-1.6.924/t/data/sv40_small.xml BioPerl-1.6.924/t/data/swiss.dat BioPerl-1.6.924/t/data/swisspfam.data BioPerl-1.6.924/t/data/SwissProt.dat BioPerl-1.6.924/t/data/T7.aln BioPerl-1.6.924/t/data/tab1part.mif BioPerl-1.6.924/t/data/tab2part.mif BioPerl-1.6.924/t/data/tab3part.mif BioPerl-1.6.924/t/data/tandem_repeats_finder.dat BioPerl-1.6.924/t/data/tandem_repeats_finder.noresults BioPerl-1.6.924/t/data/tandem_repeats_finder_no_desc.dat BioPerl-1.6.924/t/data/targetp.out BioPerl-1.6.924/t/data/tblastn.out BioPerl-1.6.924/t/data/test 2.txt BioPerl-1.6.924/t/data/test-3.0-1.meme BioPerl-1.6.924/t/data/test-3.0-2.meme BioPerl-1.6.924/t/data/test-4.9.meme BioPerl-1.6.924/t/data/test.abi BioPerl-1.6.924/t/data/test.ace BioPerl-1.6.924/t/data/test.bam BioPerl-1.6.924/t/data/test.bowtie BioPerl-1.6.924/t/data/test.cns.fastq BioPerl-1.6.924/t/data/test.ctf BioPerl-1.6.924/t/data/test.embl BioPerl-1.6.924/t/data/test.embl2sq BioPerl-1.6.924/t/data/test.exp BioPerl-1.6.924/t/data/test.fasta BioPerl-1.6.924/t/data/test.fastq BioPerl-1.6.924/t/data/test.game BioPerl-1.6.924/t/data/test.gcg BioPerl-1.6.924/t/data/test.gcgblast BioPerl-1.6.924/t/data/test.gcgfasta BioPerl-1.6.924/t/data/test.genbank BioPerl-1.6.924/t/data/test.genbank.noseq BioPerl-1.6.924/t/data/test.infernal BioPerl-1.6.924/t/data/test.interpro BioPerl-1.6.924/t/data/test.interpro-go.xml BioPerl-1.6.924/t/data/test.lasergene BioPerl-1.6.924/t/data/test.locuslink BioPerl-1.6.924/t/data/test.maq BioPerl-1.6.924/t/data/test.metafasta BioPerl-1.6.924/t/data/test.nh BioPerl-1.6.924/t/data/test.nhx BioPerl-1.6.924/t/data/test.phd BioPerl-1.6.924/t/data/test.pir BioPerl-1.6.924/t/data/test.pln BioPerl-1.6.924/t/data/test.raw BioPerl-1.6.924/t/data/test.ref.fas BioPerl-1.6.924/t/data/test.swiss BioPerl-1.6.924/t/data/test.tab BioPerl-1.6.924/t/data/test.tigrxml BioPerl-1.6.924/t/data/test.tseq BioPerl-1.6.924/t/data/test.tsv BioPerl-1.6.924/t/data/test.txt BioPerl-1.6.924/t/data/test.waba BioPerl-1.6.924/t/data/test.xls BioPerl-1.6.924/t/data/test.ztr BioPerl-1.6.924/t/data/test1.blasttab3 BioPerl-1.6.924/t/data/test1.wublastp BioPerl-1.6.924/t/data/test2.infernal BioPerl-1.6.924/t/data/test2.raw BioPerl-1.6.924/t/data/test_badlf.gcg BioPerl-1.6.924/t/data/test_clear_range.fastq BioPerl-1.6.924/t/data/test_data.axt BioPerl-1.6.924/t/data/test_singlets.cns.fastq BioPerl-1.6.924/t/data/test_singlets.maq BioPerl-1.6.924/t/data/testaln.arp BioPerl-1.6.924/t/data/testaln.clustalw BioPerl-1.6.924/t/data/testaln.fasta BioPerl-1.6.924/t/data/testaln.fastq BioPerl-1.6.924/t/data/testaln.list BioPerl-1.6.924/t/data/testaln.mase BioPerl-1.6.924/t/data/testaln.mega BioPerl-1.6.924/t/data/testaln.metafasta BioPerl-1.6.924/t/data/testaln.msf BioPerl-1.6.924/t/data/testaln.nexus BioPerl-1.6.924/t/data/testaln.pfam BioPerl-1.6.924/t/data/testaln.phylip BioPerl-1.6.924/t/data/testaln.po BioPerl-1.6.924/t/data/testaln.prodom BioPerl-1.6.924/t/data/testaln.psi BioPerl-1.6.924/t/data/testaln.selex BioPerl-1.6.924/t/data/testaln.stockholm BioPerl-1.6.924/t/data/testaln.xmfa BioPerl-1.6.924/t/data/testaln2.arp BioPerl-1.6.924/t/data/testaln2.fasta BioPerl-1.6.924/t/data/testdat.exonerate BioPerl-1.6.924/t/data/testdata.crossmatch BioPerl-1.6.924/t/data/testdbaccnums.out BioPerl-1.6.924/t/data/testfile.erpin BioPerl-1.6.924/t/data/testfuzzy.genbank BioPerl-1.6.924/t/data/tiny.stk BioPerl-1.6.924/t/data/tmhmm.out BioPerl-1.6.924/t/data/tmp.fst BioPerl-1.6.924/t/data/tol-2010-02-18.nhx BioPerl-1.6.924/t/data/traits.tab BioPerl-1.6.924/t/data/traittree.nexus BioPerl-1.6.924/t/data/transfac.dat BioPerl-1.6.924/t/data/tree_nonewline.nexus BioPerl-1.6.924/t/data/Treebase-chlamy-dna.nex BioPerl-1.6.924/t/data/trees.nexml.old.xml BioPerl-1.6.924/t/data/tricky.wublast BioPerl-1.6.924/t/data/trna.strict.rnamotif BioPerl-1.6.924/t/data/U58726.gb BioPerl-1.6.924/t/data/U71225.gb BioPerl-1.6.924/t/data/U71225.gb.mac BioPerl-1.6.924/t/data/U71225.gb.unix BioPerl-1.6.924/t/data/U71225.gb.win BioPerl-1.6.924/t/data/U83300.bsml BioPerl-1.6.924/t/data/UnaSmithHIV-both.nex BioPerl-1.6.924/t/data/unigene.data BioPerl-1.6.924/t/data/urease.tre.nexus BioPerl-1.6.924/t/data/version2.scf BioPerl-1.6.924/t/data/version3.scf BioPerl-1.6.924/t/data/wellcome_tol.nhx BioPerl-1.6.924/t/data/withrefm.906 BioPerl-1.6.924/t/data/worm_fam_2785.cdna BioPerl-1.6.924/t/data/X98338_Adh-mRNA.gb BioPerl-1.6.924/t/data/yeast.tRNAscanSE BioPerl-1.6.924/t/data/yn00.mlc BioPerl-1.6.924/t/data/yn00_45.mlc BioPerl-1.6.924/t/data/YP_007988852.gp BioPerl-1.6.924/t/data/ZABJ4EA7014.CH878695.1.blast.txt BioPerl-1.6.924/t/data/bad_dbfa BioPerl-1.6.924/t/data/bad_dbfa/bug3172.fa BioPerl-1.6.924/t/data/bad_dbfa/shotdb.fa BioPerl-1.6.924/t/data/biodbgff BioPerl-1.6.924/t/data/biodbgff/test.gff BioPerl-1.6.924/t/data/biodbgff/test.gff3 BioPerl-1.6.924/t/data/codeml_lysozyme BioPerl-1.6.924/t/data/codeml_lysozyme/2NG.dN BioPerl-1.6.924/t/data/codeml_lysozyme/2NG.dS BioPerl-1.6.924/t/data/codeml_lysozyme/2NG.tt BioPerl-1.6.924/t/data/codeml_lysozyme/4fold.nuc BioPerl-1.6.924/t/data/codeml_lysozyme/lnf BioPerl-1.6.924/t/data/codeml_lysozyme/lysozymeSmall.ctl BioPerl-1.6.924/t/data/codeml_lysozyme/lysozymeSmall.trees BioPerl-1.6.924/t/data/codeml_lysozyme/lysozymeSmall.txt BioPerl-1.6.924/t/data/codeml_lysozyme/mlc BioPerl-1.6.924/t/data/codeml_lysozyme/rst BioPerl-1.6.924/t/data/codeml_lysozyme/rst1 BioPerl-1.6.924/t/data/codeml_lysozyme/rub BioPerl-1.6.924/t/data/consed_project BioPerl-1.6.924/t/data/consed_project/edit_dir BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.contigs BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.log BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1 BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2 BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.log BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.problems BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.qual BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.fasta.screen.view BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.newtags BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.phrap.out BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project.screen.out BioPerl-1.6.924/t/data/consed_project/edit_dir/test_project_to_alu.cross BioPerl-1.6.924/t/data/consed_project/edit_dir/test_projectNewChromats.fof BioPerl-1.6.924/t/data/consed_project/phd_dir BioPerl-1.6.924/t/data/consed_project/phd_dir/ML4922R.phd.1 BioPerl-1.6.924/t/data/consed_project/phd_dir/ML4924F.phd.1 BioPerl-1.6.924/t/data/consed_project/phd_dir/ML4924R.phd.1 BioPerl-1.6.924/t/data/consed_project/phd_dir/ML4947F.phd.1 BioPerl-1.6.924/t/data/dbfa BioPerl-1.6.924/t/data/dbfa/1.fa BioPerl-1.6.924/t/data/dbfa/2.fa BioPerl-1.6.924/t/data/dbfa/3.fa BioPerl-1.6.924/t/data/dbfa/4.fa BioPerl-1.6.924/t/data/dbfa/5.fa BioPerl-1.6.924/t/data/dbfa/6.fa BioPerl-1.6.924/t/data/dbfa/7.fa BioPerl-1.6.924/t/data/dbfa/mixed_alphabet.fasta BioPerl-1.6.924/t/data/dbqual BioPerl-1.6.924/t/data/dbqual/1.qual BioPerl-1.6.924/t/data/dbqual/2.qual BioPerl-1.6.924/t/data/dbqual/3.qual BioPerl-1.6.924/t/data/fastq BioPerl-1.6.924/t/data/fastq/bug2335.fastq BioPerl-1.6.924/t/data/fastq/error_diff_ids.fastq BioPerl-1.6.924/t/data/fastq/error_double_qual.fastq BioPerl-1.6.924/t/data/fastq/error_double_seq.fastq BioPerl-1.6.924/t/data/fastq/error_long_qual.fastq BioPerl-1.6.924/t/data/fastq/error_no_qual.fastq BioPerl-1.6.924/t/data/fastq/error_qual_del.fastq BioPerl-1.6.924/t/data/fastq/error_qual_escape.fastq BioPerl-1.6.924/t/data/fastq/error_qual_null.fastq BioPerl-1.6.924/t/data/fastq/error_qual_space.fastq BioPerl-1.6.924/t/data/fastq/error_qual_tab.fastq BioPerl-1.6.924/t/data/fastq/error_qual_unit_sep.fastq BioPerl-1.6.924/t/data/fastq/error_qual_vtab.fastq BioPerl-1.6.924/t/data/fastq/error_short_qual.fastq BioPerl-1.6.924/t/data/fastq/error_spaces.fastq BioPerl-1.6.924/t/data/fastq/error_tabs.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_at_plus.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_at_qual.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_at_seq.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_in_plus.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_in_qual.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_in_seq.fastq BioPerl-1.6.924/t/data/fastq/error_trunc_in_title.fastq BioPerl-1.6.924/t/data/fastq/evil_wrapping.fastq BioPerl-1.6.924/t/data/fastq/example.fasta BioPerl-1.6.924/t/data/fastq/example.fastq BioPerl-1.6.924/t/data/fastq/example.qual BioPerl-1.6.924/t/data/fastq/illumina_faked.fastq BioPerl-1.6.924/t/data/fastq/sanger_93.fastq BioPerl-1.6.924/t/data/fastq/sanger_faked.fastq BioPerl-1.6.924/t/data/fastq/solexa_example.fastq BioPerl-1.6.924/t/data/fastq/solexa_faked.fastq BioPerl-1.6.924/t/data/fastq/test1_sanger.fastq BioPerl-1.6.924/t/data/fastq/test2_solexa.fastq BioPerl-1.6.924/t/data/fastq/test3_illumina.fastq BioPerl-1.6.924/t/data/fastq/tricky.fastq BioPerl-1.6.924/t/data/fastq/wrapping_issues.fastq BioPerl-1.6.924/t/data/fastq/zero_qual.fastq BioPerl-1.6.924/t/data/map_hem BioPerl-1.6.924/t/data/map_hem/HEM1-HEM12.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM12.fa.revcom BioPerl-1.6.924/t/data/map_hem/HEM1-HEM12.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1-HEM13.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM13.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1-HEM14.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM14.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1-HEM2.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM2.fa.revcom BioPerl-1.6.924/t/data/map_hem/HEM1-HEM2.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1-HEM3.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM3.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1-HEM4.fa BioPerl-1.6.924/t/data/map_hem/HEM1-HEM4.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM1.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM1.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM12-HEM13.fa BioPerl-1.6.924/t/data/map_hem/HEM12-HEM13.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM12-HEM14.fa BioPerl-1.6.924/t/data/map_hem/HEM12-HEM14.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM12-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM12-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM12.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM12.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM13-HEM14.fa BioPerl-1.6.924/t/data/map_hem/HEM13-HEM14.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM13-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM13-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM13.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM13.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM14-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM14-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM14.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM14.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM15.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM15.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM2-HEM12.fa BioPerl-1.6.924/t/data/map_hem/HEM2-HEM12.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM2-HEM13.fa BioPerl-1.6.924/t/data/map_hem/HEM2-HEM13.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM2-HEM14.fa BioPerl-1.6.924/t/data/map_hem/HEM2-HEM14.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM2-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM2-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM2-HEM3.fa BioPerl-1.6.924/t/data/map_hem/HEM2-HEM3.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM2-HEM4.fa BioPerl-1.6.924/t/data/map_hem/HEM2-HEM4.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM2.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM2.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM3-HEM12.fa BioPerl-1.6.924/t/data/map_hem/HEM3-HEM12.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM3-HEM13.fa BioPerl-1.6.924/t/data/map_hem/HEM3-HEM13.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM3-HEM14.fa BioPerl-1.6.924/t/data/map_hem/HEM3-HEM14.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM3-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM3-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM3-HEM4.fa BioPerl-1.6.924/t/data/map_hem/HEM3-HEM4.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM3.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM3.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/HEM4-HEM12.fa BioPerl-1.6.924/t/data/map_hem/HEM4-HEM12.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM4-HEM13.fa BioPerl-1.6.924/t/data/map_hem/HEM4-HEM13.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM4-HEM14.fa BioPerl-1.6.924/t/data/map_hem/HEM4-HEM14.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM4-HEM15.fa BioPerl-1.6.924/t/data/map_hem/HEM4-HEM15.meme.txt BioPerl-1.6.924/t/data/map_hem/HEM4.ups.fa_ BioPerl-1.6.924/t/data/map_hem/HEM4.ups.fa_.revcom BioPerl-1.6.924/t/data/map_hem/yeast.nc.1.freq BioPerl-1.6.924/t/data/mbsout BioPerl-1.6.924/t/data/mbsout/mbsout_infile1 BioPerl-1.6.924/t/data/mbsout/mbsout_infile2 BioPerl-1.6.924/t/data/mbsout/mbsout_infile3 BioPerl-1.6.924/t/data/msout BioPerl-1.6.924/t/data/msout/bad_msout_infile1 BioPerl-1.6.924/t/data/msout/bad_msout_infile2 BioPerl-1.6.924/t/data/msout/msout_infile1 BioPerl-1.6.924/t/data/msout/msout_infile2 BioPerl-1.6.924/t/data/msout/msout_infile3 BioPerl-1.6.924/t/data/msout/msout_infile4 BioPerl-1.6.924/t/data/nexml BioPerl-1.6.924/t/data/nexml/characters.nexml.8.xml BioPerl-1.6.924/t/data/nexml/characters.nexml.xml BioPerl-1.6.924/t/data/nexml/trees.nexml.8.xml BioPerl-1.6.924/t/data/nexml/trees.nexml.xml BioPerl-1.6.924/t/data/registry BioPerl-1.6.924/t/data/registry/bdb BioPerl-1.6.924/t/data/registry/bdb/seqdatabase.ini BioPerl-1.6.924/t/data/registry/flat BioPerl-1.6.924/t/data/registry/flat/seqdatabase.ini BioPerl-1.6.924/t/data/seqfeaturedb BioPerl-1.6.924/t/data/seqfeaturedb/test.gff3 BioPerl-1.6.924/t/data/taxdump BioPerl-1.6.924/t/data/taxdump/names.dmp BioPerl-1.6.924/t/data/taxdump/nodes.dmp BioPerl-1.6.924/t/data/taxonomy BioPerl-1.6.924/t/data/taxonomy/greengenes_taxonomy_16S_candiv_gg_2011_1.txt BioPerl-1.6.924/t/data/taxonomy/silva_SSURef_108_tax_silva_trunc.fasta BioPerl-1.6.924/t/data/transfac_pro BioPerl-1.6.924/t/data/transfac_pro/factor.dat BioPerl-1.6.924/t/data/transfac_pro/fragment.dat BioPerl-1.6.924/t/data/transfac_pro/gene.dat BioPerl-1.6.924/t/data/transfac_pro/matrix.dat BioPerl-1.6.924/t/data/transfac_pro/readme.txt BioPerl-1.6.924/t/data/transfac_pro/reference.dat BioPerl-1.6.924/t/data/transfac_pro/site.dat BioPerl-1.6.924/t/Draw BioPerl-1.6.924/t/Draw/Pictogram.t BioPerl-1.6.924/t/lib BioPerl-1.6.924/t/lib/Error.pm BioPerl-1.6.924/t/LiveSeq BioPerl-1.6.924/t/LiveSeq/Chain.t BioPerl-1.6.924/t/LiveSeq/LiveSeq.t BioPerl-1.6.924/t/LiveSeq/Mutation.t BioPerl-1.6.924/t/LiveSeq/Mutator.t BioPerl-1.6.924/t/LocalDB BioPerl-1.6.924/t/LocalDB/BioDBGFF.t BioPerl-1.6.924/t/LocalDB/Fasta.t BioPerl-1.6.924/t/LocalDB/Flat.t BioPerl-1.6.924/t/LocalDB/Qual.t BioPerl-1.6.924/t/LocalDB/Registry.t BioPerl-1.6.924/t/LocalDB/SeqFeature.t BioPerl-1.6.924/t/LocalDB/transfac_pro.t BioPerl-1.6.924/t/LocalDB/Index BioPerl-1.6.924/t/LocalDB/Index/Blast.t BioPerl-1.6.924/t/LocalDB/Index/BlastTable.t BioPerl-1.6.924/t/LocalDB/Index/Index.t BioPerl-1.6.924/t/LocalDB/Taxonomy BioPerl-1.6.924/t/LocalDB/Taxonomy/greengenes.t BioPerl-1.6.924/t/LocalDB/Taxonomy/silva.t BioPerl-1.6.924/t/Map BioPerl-1.6.924/t/Map/Cyto.t BioPerl-1.6.924/t/Map/Linkage.t BioPerl-1.6.924/t/Map/Map.t BioPerl-1.6.924/t/Map/MapIO.t BioPerl-1.6.924/t/Map/MicrosatelliteMarker.t BioPerl-1.6.924/t/Map/Physical.t BioPerl-1.6.924/t/Matrix BioPerl-1.6.924/t/Matrix/InstanceSite.t BioPerl-1.6.924/t/Matrix/Matrix.t BioPerl-1.6.924/t/Matrix/ProtMatrix.t BioPerl-1.6.924/t/Matrix/ProtPsm.t BioPerl-1.6.924/t/Matrix/SiteMatrix.t BioPerl-1.6.924/t/Matrix/IO BioPerl-1.6.924/t/Matrix/IO/masta.t BioPerl-1.6.924/t/Matrix/IO/psm.t BioPerl-1.6.924/t/Ontology BioPerl-1.6.924/t/Ontology/GOterm.t BioPerl-1.6.924/t/Ontology/GraphAdaptor.t BioPerl-1.6.924/t/Ontology/Ontology.t BioPerl-1.6.924/t/Ontology/OntologyEngine.t BioPerl-1.6.924/t/Ontology/OntologyStore.t BioPerl-1.6.924/t/Ontology/Relationship.t BioPerl-1.6.924/t/Ontology/RelationshipType.t BioPerl-1.6.924/t/Ontology/Term.t BioPerl-1.6.924/t/Ontology/IO BioPerl-1.6.924/t/Ontology/IO/go.t BioPerl-1.6.924/t/Ontology/IO/interpro.t BioPerl-1.6.924/t/Ontology/IO/obo.t BioPerl-1.6.924/t/Phenotype BioPerl-1.6.924/t/Phenotype/Correlate.t BioPerl-1.6.924/t/Phenotype/Measure.t BioPerl-1.6.924/t/Phenotype/MeSH.t BioPerl-1.6.924/t/Phenotype/MiniMIMentry.t BioPerl-1.6.924/t/Phenotype/OMIMentry.t BioPerl-1.6.924/t/Phenotype/OMIMentryAllelicVariant.t BioPerl-1.6.924/t/Phenotype/OMIMparser.t BioPerl-1.6.924/t/Phenotype/Phenotype.t BioPerl-1.6.924/t/PopGen BioPerl-1.6.924/t/PopGen/Coalescent.t BioPerl-1.6.924/t/PopGen/HtSNP.t BioPerl-1.6.924/t/PopGen/MK.t BioPerl-1.6.924/t/PopGen/PopGen.t BioPerl-1.6.924/t/PopGen/PopGenSims.t BioPerl-1.6.924/t/PopGen/TagHaplotype.t BioPerl-1.6.924/t/RemoteDB BioPerl-1.6.924/t/RemoteDB/BioFetch.t BioPerl-1.6.924/t/RemoteDB/CUTG.t BioPerl-1.6.924/t/RemoteDB/EMBL.t BioPerl-1.6.924/t/RemoteDB/EntrezGene.t BioPerl-1.6.924/t/RemoteDB/GenBank.t BioPerl-1.6.924/t/RemoteDB/GenPept.t BioPerl-1.6.924/t/RemoteDB/MeSH.t BioPerl-1.6.924/t/RemoteDB/RefSeq.t BioPerl-1.6.924/t/RemoteDB/SeqHound.t BioPerl-1.6.924/t/RemoteDB/SeqRead_fail.t BioPerl-1.6.924/t/RemoteDB/SeqVersion.t BioPerl-1.6.924/t/RemoteDB/SwissProt.t BioPerl-1.6.924/t/RemoteDB/Taxonomy.t BioPerl-1.6.924/t/RemoteDB/HIV BioPerl-1.6.924/t/RemoteDB/HIV/HIV.t BioPerl-1.6.924/t/RemoteDB/HIV/HIVAnnotProcessor.t BioPerl-1.6.924/t/RemoteDB/HIV/HIVQuery.t BioPerl-1.6.924/t/RemoteDB/HIV/HIVQueryHelper.t BioPerl-1.6.924/t/RemoteDB/Query BioPerl-1.6.924/t/RemoteDB/Query/GenBank.t BioPerl-1.6.924/t/Restriction BioPerl-1.6.924/t/Restriction/Analysis-refac.t BioPerl-1.6.924/t/Restriction/Analysis.t BioPerl-1.6.924/t/Restriction/Gel.t BioPerl-1.6.924/t/Restriction/IO.t BioPerl-1.6.924/t/Root BioPerl-1.6.924/t/Root/Exception.t BioPerl-1.6.924/t/Root/HTTPget.t BioPerl-1.6.924/t/Root/IO.t BioPerl-1.6.924/t/Root/RootI.t BioPerl-1.6.924/t/Root/Storable.t BioPerl-1.6.924/t/Root/Utilities.t BioPerl-1.6.924/t/SearchIO BioPerl-1.6.924/t/SearchIO/axt.t BioPerl-1.6.924/t/SearchIO/blast.t BioPerl-1.6.924/t/SearchIO/blast_pull.t BioPerl-1.6.924/t/SearchIO/blasttable.t BioPerl-1.6.924/t/SearchIO/blastxml.t BioPerl-1.6.924/t/SearchIO/CigarString.t BioPerl-1.6.924/t/SearchIO/cross_match.t BioPerl-1.6.924/t/SearchIO/erpin.t BioPerl-1.6.924/t/SearchIO/exonerate.t BioPerl-1.6.924/t/SearchIO/fasta.t BioPerl-1.6.924/t/SearchIO/gmap_f9.t BioPerl-1.6.924/t/SearchIO/hmmer.t BioPerl-1.6.924/t/SearchIO/hmmer_pull.t BioPerl-1.6.924/t/SearchIO/infernal.t BioPerl-1.6.924/t/SearchIO/megablast.t BioPerl-1.6.924/t/SearchIO/psl.t BioPerl-1.6.924/t/SearchIO/rnamotif.t BioPerl-1.6.924/t/SearchIO/SearchIO.t BioPerl-1.6.924/t/SearchIO/sim4.t BioPerl-1.6.924/t/SearchIO/SimilarityPair.t BioPerl-1.6.924/t/SearchIO/Tiling.t BioPerl-1.6.924/t/SearchIO/waba.t BioPerl-1.6.924/t/SearchIO/wise.t BioPerl-1.6.924/t/SearchIO/Writer BioPerl-1.6.924/t/SearchIO/Writer/GbrowseGFF.t BioPerl-1.6.924/t/SearchIO/Writer/HitTableWriter.t BioPerl-1.6.924/t/SearchIO/Writer/HSPTableWriter.t BioPerl-1.6.924/t/SearchIO/Writer/HTMLWriter.t BioPerl-1.6.924/t/SearchIO/Writer/TextWriter.t BioPerl-1.6.924/t/Seq BioPerl-1.6.924/t/Seq/DBLink.t BioPerl-1.6.924/t/Seq/EncodedSeq.t BioPerl-1.6.924/t/Seq/LargeLocatableSeq.t BioPerl-1.6.924/t/Seq/LargePSeq.t BioPerl-1.6.924/t/Seq/LocatableSeq.t BioPerl-1.6.924/t/Seq/MetaSeq.t BioPerl-1.6.924/t/Seq/PrimaryQual.t BioPerl-1.6.924/t/Seq/PrimarySeq.t BioPerl-1.6.924/t/Seq/PrimedSeq.t BioPerl-1.6.924/t/Seq/Quality.t BioPerl-1.6.924/t/Seq/Seq.t BioPerl-1.6.924/t/Seq/SimulatedRead.t BioPerl-1.6.924/t/Seq/WithQuality.t BioPerl-1.6.924/t/SeqFeature BioPerl-1.6.924/t/SeqFeature/Amplicon.t BioPerl-1.6.924/t/SeqFeature/Clone.t BioPerl-1.6.924/t/SeqFeature/Collection.t BioPerl-1.6.924/t/SeqFeature/Computation.t BioPerl-1.6.924/t/SeqFeature/FeaturePair.t BioPerl-1.6.924/t/SeqFeature/Gene.t BioPerl-1.6.924/t/SeqFeature/Generic.t BioPerl-1.6.924/t/SeqFeature/Location.t BioPerl-1.6.924/t/SeqFeature/LocationFactory.t BioPerl-1.6.924/t/SeqFeature/Primer.t BioPerl-1.6.924/t/SeqFeature/Range.t BioPerl-1.6.924/t/SeqFeature/RangeI.t BioPerl-1.6.924/t/SeqFeature/SeqAnalysisParser.t BioPerl-1.6.924/t/SeqFeature/SubSeq.t BioPerl-1.6.924/t/SeqFeature/Unflattener.t BioPerl-1.6.924/t/SeqIO BioPerl-1.6.924/t/SeqIO/abi.t BioPerl-1.6.924/t/SeqIO/ace.t BioPerl-1.6.924/t/SeqIO/agave.t BioPerl-1.6.924/t/SeqIO/alf.t BioPerl-1.6.924/t/SeqIO/asciitree.t BioPerl-1.6.924/t/SeqIO/bsml.t BioPerl-1.6.924/t/SeqIO/bsml_sax.t BioPerl-1.6.924/t/SeqIO/chadoxml.t BioPerl-1.6.924/t/SeqIO/chaos.t BioPerl-1.6.924/t/SeqIO/chaosxml.t BioPerl-1.6.924/t/SeqIO/ctf.t BioPerl-1.6.924/t/SeqIO/embl.t BioPerl-1.6.924/t/SeqIO/entrezgene.t BioPerl-1.6.924/t/SeqIO/excel.t BioPerl-1.6.924/t/SeqIO/exp.t BioPerl-1.6.924/t/SeqIO/fasta.t BioPerl-1.6.924/t/SeqIO/fastq.t BioPerl-1.6.924/t/SeqIO/flybase_chadoxml.t BioPerl-1.6.924/t/SeqIO/game.t BioPerl-1.6.924/t/SeqIO/gbxml.t BioPerl-1.6.924/t/SeqIO/gcg.t BioPerl-1.6.924/t/SeqIO/genbank.t BioPerl-1.6.924/t/SeqIO/Handler.t BioPerl-1.6.924/t/SeqIO/interpro.t BioPerl-1.6.924/t/SeqIO/kegg.t BioPerl-1.6.924/t/SeqIO/largefasta.t BioPerl-1.6.924/t/SeqIO/lasergene.t BioPerl-1.6.924/t/SeqIO/locuslink.t BioPerl-1.6.924/t/SeqIO/mbsout.t BioPerl-1.6.924/t/SeqIO/metafasta.t BioPerl-1.6.924/t/SeqIO/msout.t BioPerl-1.6.924/t/SeqIO/MultiFile.t BioPerl-1.6.924/t/SeqIO/Multiple_fasta.t BioPerl-1.6.924/t/SeqIO/nexml.t BioPerl-1.6.924/t/SeqIO/phd.t BioPerl-1.6.924/t/SeqIO/pir.t BioPerl-1.6.924/t/SeqIO/pln.t BioPerl-1.6.924/t/SeqIO/qual.t BioPerl-1.6.924/t/SeqIO/raw.t BioPerl-1.6.924/t/SeqIO/scf.t BioPerl-1.6.924/t/SeqIO/SeqBuilder.t BioPerl-1.6.924/t/SeqIO/SeqIO.t BioPerl-1.6.924/t/SeqIO/seqxml.t BioPerl-1.6.924/t/SeqIO/Splicedseq.t BioPerl-1.6.924/t/SeqIO/strider.t BioPerl-1.6.924/t/SeqIO/swiss.t BioPerl-1.6.924/t/SeqIO/tab.t BioPerl-1.6.924/t/SeqIO/table.t BioPerl-1.6.924/t/SeqIO/tigr.t BioPerl-1.6.924/t/SeqIO/tigrxml.t BioPerl-1.6.924/t/SeqIO/tinyseq.t BioPerl-1.6.924/t/SeqIO/ztr.t BioPerl-1.6.924/t/SeqTools BioPerl-1.6.924/t/SeqTools/Backtranslate.t BioPerl-1.6.924/t/SeqTools/CodonTable.t BioPerl-1.6.924/t/SeqTools/ECnumber.t BioPerl-1.6.924/t/SeqTools/GuessSeqFormat.t BioPerl-1.6.924/t/SeqTools/OddCodes.t BioPerl-1.6.924/t/SeqTools/SeqPattern.t BioPerl-1.6.924/t/SeqTools/SeqStats.t BioPerl-1.6.924/t/SeqTools/SeqUtils.t BioPerl-1.6.924/t/SeqTools/SeqWords.t BioPerl-1.6.924/t/Structure BioPerl-1.6.924/t/Structure/IO.t BioPerl-1.6.924/t/Structure/Structure.t BioPerl-1.6.924/t/Tools BioPerl-1.6.924/t/Tools/AmpliconSearch.t BioPerl-1.6.924/t/Tools/ePCR.t BioPerl-1.6.924/t/Tools/Est2Genome.t BioPerl-1.6.924/t/Tools/FootPrinter.t BioPerl-1.6.924/t/Tools/Geneid.t BioPerl-1.6.924/t/Tools/Genewise.t BioPerl-1.6.924/t/Tools/Genomewise.t BioPerl-1.6.924/t/Tools/Genpred.t BioPerl-1.6.924/t/Tools/GFF.t BioPerl-1.6.924/t/Tools/Hmmer.t BioPerl-1.6.924/t/Tools/IUPAC.t BioPerl-1.6.924/t/Tools/Lucy.t BioPerl-1.6.924/t/Tools/Match.t BioPerl-1.6.924/t/Tools/pICalculator.t BioPerl-1.6.924/t/Tools/Primer3.t BioPerl-1.6.924/t/Tools/Promoterwise.t BioPerl-1.6.924/t/Tools/Pseudowise.t BioPerl-1.6.924/t/Tools/QRNA.t BioPerl-1.6.924/t/Tools/RandDistFunctions.t BioPerl-1.6.924/t/Tools/RepeatMasker.t BioPerl-1.6.924/t/Tools/rnamotif.t BioPerl-1.6.924/t/Tools/Seg.t BioPerl-1.6.924/t/Tools/Sigcleave.t BioPerl-1.6.924/t/Tools/Signalp.t BioPerl-1.6.924/t/Tools/Sim4.t BioPerl-1.6.924/t/Tools/SiRNA.t BioPerl-1.6.924/t/Tools/TandemRepeatsFinder.t BioPerl-1.6.924/t/Tools/TargetP.t BioPerl-1.6.924/t/Tools/Tmhmm.t BioPerl-1.6.924/t/Tools/tRNAscanSE.t BioPerl-1.6.924/t/Tools/Alignment BioPerl-1.6.924/t/Tools/Alignment/Consed.t BioPerl-1.6.924/t/Tools/Analysis BioPerl-1.6.924/t/Tools/Analysis/DNA BioPerl-1.6.924/t/Tools/Analysis/DNA/ESEfinder.t BioPerl-1.6.924/t/Tools/Analysis/Protein BioPerl-1.6.924/t/Tools/Analysis/Protein/Domcut.t BioPerl-1.6.924/t/Tools/Analysis/Protein/ELM.t BioPerl-1.6.924/t/Tools/Analysis/Protein/GOR4.t BioPerl-1.6.924/t/Tools/Analysis/Protein/HNN.t BioPerl-1.6.924/t/Tools/Analysis/Protein/Mitoprot.t BioPerl-1.6.924/t/Tools/Analysis/Protein/NetPhos.t BioPerl-1.6.924/t/Tools/Analysis/Protein/Scansite.t BioPerl-1.6.924/t/Tools/Analysis/Protein/Sopma.t BioPerl-1.6.924/t/Tools/EMBOSS BioPerl-1.6.924/t/Tools/EMBOSS/Palindrome.t BioPerl-1.6.924/t/Tools/Phylo BioPerl-1.6.924/t/Tools/Phylo/Gerp.t BioPerl-1.6.924/t/Tools/Phylo/Molphy.t BioPerl-1.6.924/t/Tools/Phylo/PAML.t BioPerl-1.6.924/t/Tools/Phylo/Phylip BioPerl-1.6.924/t/Tools/Phylo/Phylip/ProtDist.t BioPerl-1.6.924/t/Tools/Run BioPerl-1.6.924/t/Tools/Run/Dummy.pm BioPerl-1.6.924/t/Tools/Run/RemoteBlast.t BioPerl-1.6.924/t/Tools/Run/RemoteBlast_rpsblast.t BioPerl-1.6.924/t/Tools/Run/StandAloneBlast.t BioPerl-1.6.924/t/Tools/Run/WBCommandExts.t BioPerl-1.6.924/t/Tools/Run/WrapperBase.t BioPerl-1.6.924/t/Tools/Run/Dummy BioPerl-1.6.924/t/Tools/Run/Dummy/Config.pm BioPerl-1.6.924/t/Tools/Signalp BioPerl-1.6.924/t/Tools/Signalp/ExtendedSignalp.t BioPerl-1.6.924/t/Tools/Spidey BioPerl-1.6.924/t/Tools/Spidey/Spidey.t BioPerl-1.6.924/t/Tree BioPerl-1.6.924/t/Tree/Compatible.t BioPerl-1.6.924/t/Tree/Node.t BioPerl-1.6.924/t/Tree/RandomTreeFactory.t BioPerl-1.6.924/t/Tree/Tree.t BioPerl-1.6.924/t/Tree/TreeIO.t BioPerl-1.6.924/t/Tree/TreeStatistics.t BioPerl-1.6.924/t/Tree/PhyloNetwork BioPerl-1.6.924/t/Tree/PhyloNetwork/Factory.t BioPerl-1.6.924/t/Tree/PhyloNetwork/GraphViz.t BioPerl-1.6.924/t/Tree/PhyloNetwork/MuVector.t BioPerl-1.6.924/t/Tree/PhyloNetwork/PhyloNetwork.t BioPerl-1.6.924/t/Tree/PhyloNetwork/RandomFactory.t BioPerl-1.6.924/t/Tree/PhyloNetwork/TreeFactory.t BioPerl-1.6.924/t/Tree/TreeIO BioPerl-1.6.924/t/Tree/TreeIO/lintree.t BioPerl-1.6.924/t/Tree/TreeIO/newick.t BioPerl-1.6.924/t/Tree/TreeIO/nexml.t BioPerl-1.6.924/t/Tree/TreeIO/nexus.t BioPerl-1.6.924/t/Tree/TreeIO/nhx.t BioPerl-1.6.924/t/Tree/TreeIO/phyloxml.t BioPerl-1.6.924/t/Tree/TreeIO/svggraph.t BioPerl-1.6.924/t/Tree/TreeIO/tabtree.t BioPerl-1.6.924/t/Variation BioPerl-1.6.924/t/Variation/AAChange.t BioPerl-1.6.924/t/Variation/AAReverseMutate.t BioPerl-1.6.924/t/Variation/Allele.t BioPerl-1.6.924/t/Variation/DNAMutation.t BioPerl-1.6.924/t/Variation/RNAChange.t BioPerl-1.6.924/t/Variation/SeqDiff.t BioPerl-1.6.924/t/Variation/SNP.t BioPerl-1.6.924/t/Variation/Variation_IO.t BioPerl-1.6.924/travis_scripts BioPerl-1.6.924/travis_scripts/dependency_installs CPAN.pm: Building C/CJ/CJFIELDS/BioPerl-1.6.924.tar.gz >>> C:\Perl-5.16\bin\perl.exe Build.PL could not find ParserDetails.ini in C:/cpanfly-5.16/var/megalib/XML/SAX Checking prerequisites... recommends: * Convert::Binary::C is not installed * DB_File is not installed * GraphViz is not installed Checking optional features... DB_File Tests.........disabled requires: ! DB_File is not installed EntrezGene............disabled requires: ! Bio::ASN1::EntrezGene is not installed ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions of the modules indicated above before proceeding with this installation Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts Do you want to run tests that require connection to servers across the internet (likely to cause some failures)? y/n [n] - will not run internet-requiring tests Created MYMETA.yml and MYMETA.json Creating new 'Build' script for 'BioPerl' version '1.006924' >>> C:\Perl-5.16\bin\perl.exe ./Build Building BioPerl CJFIELDS/BioPerl-1.6.924.tar.gz C:\Perl-5.16\bin\perl.exe ./Build -- OK Running Build test >>> C:\Perl-5.16\bin\perl.exe ./Build test verbose=1 t/Align/AlignStats.t ................... 1..45 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::AlignIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::Matrix::PhylipDist' isa 'Bio::Matrix::PhylipDist' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 43 ok 44 - Warn if seqs don't overlap ok 45 ok t/Align/AlignUtil.t .................... 1..47 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/Align/Graphics.t ..................... 1..41 ok 1 - use Bio::Align::Graphics; ok 2 - require Bio::Align::Graphics; ok 3 - Bio::Align::Graphics->can(...) ok 4 - input is defined ok 5 - AlignIO object is defined ok 6 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 7 - alignment is there and defined ok 8 - all starts are present ok 9 - all ends are present ok 10 - all colors are present ok 11 - first end is further than first start ok 12 - second end is further than second start ok 13 - third end is further than third start ok 14 - domain labels are present ok 15 - domain starts are present ok 16 - domain ends are present ok 17 - domain colors are present ok 18 - label - first end is further than first start ok 19 - label - second end is further than second start ok 20 - label - third end is further than third start ok 21 - first label start is within domain range ok 22 - second label start is within domain range ok 23 - third label start is within domain range ok 24 - first label end is within domain range ok 25 - second label end is within domain range ok 26 - third label end is within domain range ok 27 - individual labels work ok 28 - An object of class 'Bio::Align::Graphics' isa 'Bio::Align::Graphics' ok 29 - new object is defined ok 30 - pad_bottom is right ok 31 - default pad_top is right ok 32 - start point loaded ok 33 - end point loaded ok 34 - color of domain loaded ok 35 - domain labels loaded ok 36 - label starts loaded ok 37 - label ends loaded ok 38 - label colors loaded ok 39 - labels loaded ok 40 - output file is png ok 41 - wrapping length is not zero ok t/Align/SimpleAlign.t .................. 1..206 ok 1 - use Bio::SimpleAlign; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Location::Simple; ok 5 - use Bio::Location::Split; ok 6 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 7 - pfam input test ok 8 - match_line ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - num_sequences ok 11 - num_sequences ok 12 - select_noncont ok 13 - select_noncont ok 14 - num_sequences ok 15 - select_noncont ok 16 - select_noncont ok 17 - select_noncont_by_name ok 18 - select_noncont_by_name ok 19 - select_noncont_by_name ok 20 - select_noncont_by_name ok 21 - each_seq ok 22 - get_nse ok 23 - id ok 24 - num_gaps ok 25 - each_alphabetically ok 26 - column_from_residue_number ok 27 - display_name get/set ok 28 - display_name get ok 29 - consensus_string ok 30 - consensus_string ok 31 - consensus_string ok 32 ok 33 - each_seq_with_id ok 34 - is_flush ok 35 - id get/set ok 36 - length ok 37 - num_residues ok 38 - num_sequences ok 39 - overall_percentage_identity ok 40 - overall_percentage_identity (align) ok 41 - overall_percentage_identity (short) ok 42 - overall_percentage_identity (long) ok 43 - average_percentage_identity ok 44 ok 45 - set_displayname_count ok 46 ok 47 - set_displayname_flat ok 48 ok 49 - set_displayname_normal ok 50 ok 51 ok 52 - uppercase, map_chars ok 53 - match_line ok 54 - remove_seqs ok 55 - remove_seqs ok 56 - add_seq ok 57 - add_seq ok 58 - get_seq_by_pos ok 59 - get_seq_by_pos ok 60 ok 61 ok 62 ok 63 - purge ok 64 - purge ok 65 - IO::String consensus_iupac ok 66 - IO::String write_aln normal ok 67 - IO::String write_aln slice ok 68 - IO::String write_aln slice ok 69 - IO::String write_aln slice ok 70 - IO::String write_aln slice ok 71 - IO::String write_aln slice ok 72 ok 73 - remove_columns by position ok 74 - remove_columns by position (wrong order) ok 75 - cigar_line ok 76 - cigar_line ok 77 - cigar_line ok 78 - cigar_line ok 79 - sort_alphabetically - before ok 80 ok 81 - sort_alphabetically - after ok 82 - remove_gaps ok 83 - remove_gaps all_gaps_only ok 84 - set_new_reference ok 85 - set_new_reference ok 86 - uniq_seq ok 87 - bug 2099 ok 88 - bug 2099 ok 89 - bug 2793 ok 90 - bug 2793 ok 91 - bug 2793 ok 92 - bug 2793 ok 93 - Bad sequence, bad! ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 95 - added 3 seqs ok 96 - first 2 features added ok 97 - 3rd feature added ok 98 ok 99 - slice 1 len ok 100 - correct masked seq ok 101 - correct masked seq ok 102 - correct masked seq ok 103 ok 104 - slice 2 len ok 105 - correct masked seq ok 106 - correct masked seq ok 107 - correct masked seq ok 108 ok 109 - slice 3 len ok 110 - correct masked seq ok 111 - correct masked seq ok 112 - correct masked seq ok 113 ok 114 - slice 4 len ok 115 - correct masked seq ok 116 - correct masked seq ok 117 - correct masked seq ok 118 - initial display id ok ok 119 - safe display id ok ok 120 - restored display id ok ok 121 - sort by list ok ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 - BIC:GGATCCATT[C/C]CTACT ok 129 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT ok 130 - BIC:G[G/C]ATCCATT[C/G]CTACT ok 131 - BIC:GGATCCATT[C/G]CTACT ok 132 - BIC:GGATCCATT[C/G]CTAC[T/A] ok 133 - BIC:GGATCCATT[C/G]CTA[C/G][T/A] ok 134 - BIC:GGATCCATT[C/G]CTACT ok 135 - BIC:GGATCCATT{C.C}CTACT ok 136 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT ok 137 - BIC:G{G.C}ATCCATT{C.G}CTACT ok 138 - BIC:GGATCCATT{C.G}CTACT ok 139 - BIC:GGATCCATT{C.G}CTAC{T.A} ok 140 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A} ok 141 - BIC:GGATCCATT{C.G}CTACT ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 200 - consensus string looks ok ok 201 - conservation length ok 202 - conservation scores ok 203 - looks like correct unmasked alignment (from clustalw) ok 204 - looks like correct masked alignment (from clustalw) ok 205 ok 206 - align after looks ok ok t/Align/TreeBuild.t .................... 1..13 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::Align::Utilities; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Tree::DistanceFactory; ok 6 - use Bio::TreeIO; ok 7 - 'SimpleAlign object parsed out' isa 'Bio::SimpleAlign' ok 8 - 'Protein distance matrix retrieved' isa 'Bio::Matrix::MatrixI' ok 9 - 'Tree object gotten back' isa 'Bio::Tree::TreeI' ok 10 - NJ calculated Branch length ok 11 - NJ calculated Branch length ok 12 - Make sure two nodes are sister ok 13 - 10 replicates formulated ok t/Align/Utilities.t .................... 1..13 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::SimpleAlign; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::AlignIO; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/AlignIO/AlignIO.t .................... 1..29 ok 1 - use Bio::AlignIO; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 3 - input filehandle method test : metafasta ok 4 - input filehandle method test : po ok 5 - input filehandle method test : nexus ok 6 - input filehandle method test : prodom ok 7 - input filehandle method test : fasta ok 8 - input filehandle method test : arp ok 9 - input filehandle method test : xmfa ok 10 - input filehandle method test : mase ok 11 - input filehandle method test : psi ok 12 - input filehandle method test : clustalw ok 13 - input filehandle method test : phylip ok 14 - input filehandle method test : pfam ok 15 - input filehandle method test : selex ok 16 - input filehandle method test : stockholm ok 17 - input filehandle method test : msf ok 18 - filehandle output test : metafasta ok 19 - filehandle output test : po ok 20 - filehandle output test : nexus ok 21 - filehandle output test : fasta ok 22 - filehandle output test : xmfa ok 23 - filehandle output test : psi ok 24 - filehandle output test : clustalw ok 25 - filehandle output test : phylip ok 26 - filehandle output test : pfam ok 27 - filehandle output test : selex ok 28 - filehandle output test : stockholm ok 29 - filehandle output test : msf ok t/AlignIO/arp.t ........................ 1..48 ok 1 - use Bio::AlignIO::arp; ok 2 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 - ARP get_nse() ok 5 ok 6 - ARP num_sequences() ok 7 - ARP id() ok 8 - ARP description() ok 9 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 10 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 - ARP get_nse() ok 18 - ARP num_sequences() ok 19 - ARP id() ok 20 - ARP description() ok 21 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 22 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 23 ok 24 ok 25 ok 26 ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - ARP get_nse() ok 29 - ARP num_sequences() ok 30 - ARP id() ok 31 - ARP description() ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 33 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 34 ok 35 ok 36 ok 37 ok 38 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 39 - ARP get_nse() ok 40 - ARP num_sequences() ok 41 - ARP id() ok 42 - ARP description() ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 44 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 45 ok 46 ok 47 ok 48 ok t/AlignIO/bl2seq.t ..................... 1..7 ok 1 - use Bio::AlignIO::bl2seq; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - BLAST bl2seq format test ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok t/AlignIO/clustalw.t ................... 1..6 ok 1 - use Bio::AlignIO::clustalw; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - clustalw consensus_string test ok 4 - clustalw output test ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - clustalw input test ok t/AlignIO/emboss.t ..................... 1..37 ok 1 - use Bio::AlignIO::emboss; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 19 ok 20 ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 33 ok 34 ok 35 ok 36 ok 37 ok t/AlignIO/fasta.t ...................... 1..10 ok 1 - use Bio::AlignIO::fasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for end ok 7 - fasta input test for description ok 8 - fasta output test ok 9 - filehandle input test ok 10 - filehandle output test ok t/AlignIO/largemultifasta.t ............ 1..7 ok 1 - use Bio::AlignIO::largemultifasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for description ok 7 - fasta output test ok t/AlignIO/maf.t ........................ 1..11 ok 1 - use Bio::AlignIO::maf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - maf input test ok 4 ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - maf input test ok 7 ok 8 - maf input test ok 9 ok 10 - maf input test ok 11 ok t/AlignIO/mase.t ....................... 1..3 ok 1 - use Bio::AlignIO::mase; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - mase input test ok t/AlignIO/mega.t ....................... 1..6 ok 1 - use Bio::AlignIO::mega; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 - mega output test ok t/AlignIO/meme.t ....................... 1..20 ok 1 - use Bio::AlignIO::meme; ok 2 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 ok 18 ok 19 ok 20 ok t/AlignIO/metafasta.t .................. 1..4 ok 1 - use Bio::AlignIO::metafasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - consensus_string on metafasta ok 4 - symbol_chars() using metafasta ok t/AlignIO/msf.t ........................ 1..4 ok 1 - use Bio::AlignIO::msf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - msf input test ok 4 - msf output test ok # WARNING: NeXML parsing for NeXML v0.9 is currently very experimental support t/AlignIO/nexml.t ...................... 1..125 ok 1 - use Bio::AlignIO::nexml; ok 2 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 3 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 4 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 5 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 6 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 7 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 8 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 9 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 10 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 11 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 12 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 13 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 14 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 15 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 16 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 17 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 18 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 19 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 20 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 21 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 22 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 23 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 24 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 25 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 26 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 27 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 28 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 29 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 30 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 31 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 32 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 33 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 34 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 35 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 36 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 37 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 38 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 39 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 40 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 41 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 42 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 43 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 44 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 45 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 46 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 47 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 48 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 49 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 50 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 51 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 52 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 53 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 54 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 55 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 56 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 57 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 58 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 59 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 60 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 61 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 62 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 63 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 64 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 65 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 66 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 67 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 68 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 69 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 70 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 71 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 72 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 73 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 74 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 75 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 76 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 77 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 78 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 79 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 80 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 81 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 82 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 83 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 84 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 85 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 86 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 87 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 88 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 89 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 90 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 91 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 92 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 93 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 94 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 95 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 96 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 97 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 98 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 99 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 100 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 101 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 102 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 103 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 104 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 105 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 106 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 107 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 108 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 109 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 110 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 111 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 112 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 113 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 114 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 115 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 116 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 117 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 118 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 119 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 120 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 121 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 122 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 123 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 124 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 125 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok t/AlignIO/nexus.t ...................... 1..43 ok 1 - use Bio::AlignIO::nexus; ok 2 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - nexus output test ok 6 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 11 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 12 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 15 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 16 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 20 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 23 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 24 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 25 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 26 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 33 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 34 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 35 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 36 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 40 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 41 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 42 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 43 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok t/AlignIO/pfam.t ....................... 1..5 ok 1 - use Bio::AlignIO::pfam; ok 2 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - pfam output test ok t/AlignIO/phylip.t ..................... 1..17 ok 1 - use Bio::AlignIO::phylip; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 - phylip output test ok 12 ok 13 ok 14 not ok 15 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 81. # got: undef # expected: '0' not ok 16 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 82. # got: '50' # expected: '47' ok 17 - newline between header and sequences is parsed correctly ok t/AlignIO/po.t ......................... 1..11 ok 1 - use Bio::AlignIO::po; ok 2 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 6 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 7 - po output test ok 8 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok t/AlignIO/prodom.t ..................... 1..3 ok 1 - use Bio::AlignIO::prodom; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - prodom input test ok t/AlignIO/psi.t ........................ 1..5 ok 1 - use Bio::AlignIO::psi; ok 2 - An object of class 'Bio::AlignIO::psi' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok t/AlignIO/selex.t ...................... 1..4 ok 1 - use Bio::AlignIO::selex; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - selex format test ok 4 - selex output test ok t/AlignIO/stockholm.t .................. 1..87 ok 1 - use Bio::AlignIO::stockholm; ok 2 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 10 - Stockholm annotation ok 11 - Stockholm annotation ok 12 - stockholm output test ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 - 'Stockholm annotation' isa 'Bio::Annotation::Reference' ok 21 - Stockholm annotation ok 22 - Stockholm annotation ok 23 - Stockholm annotation ok 24 - Stockholm annotation ok 25 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 26 - Rfam meta data ok 27 - Rfam meta data ok 28 ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 36 - Rfam meta data ok 37 - Rfam meta data ok 38 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO' ok 39 ok 40 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 41 ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 46 - Pfam annotation ok 47 ok 48 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 49 ok 50 ok 51 ok 52 ok 53 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 60 - Pfam aln meta data ok 61 - Pfam aln meta data ok 62 - Pfam aln meta data ok 63 - Pfam aln meta data ok 64 - Pfam aln meta data ok 65 - Pfam aln meta data ok 66 - Pfam seq meta data ok 67 - Pfam seq meta data ok 68 - Pfam seq meta data ok 69 - Pfam seq meta data ok 70 ok 71 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI' ok 72 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta' ok 73 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 74 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::DBLink' ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok t/AlignIO/xmfa.t ....................... 1..30 ok 1 - use Bio::AlignIO::xmfa; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - xmfa input test ok 4 - xmfa input test for start ok 5 - xmfa input test for end ok 6 - xmfa strand test ok 7 - xmfa input test for id ok 8 - xmfa input test for id ok 9 - xmfa input test ok 10 - xmfa input test for start ok 11 - xmfa input test for end ok 12 - xmfa strand test ok 13 - xmfa input test for id ok 14 - xmfa input test for id ok 15 - xmfa input test ok 16 - xmfa input test for start ok 17 - xmfa input test for end ok 18 - xmfa strand test ok 19 - xmfa input test for id ok 20 - xmfa input test for id ok 21 - xmfa alignment score ok 22 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 23 - xmfa input test ok 24 - xmfa strand ok 25 - xmfa input test for description ok 26 - xmfa input test for id ok 27 - xmfa input test for end ok 28 - xmfa input test for end ok 29 - xmfa alignment score ok 30 - xmfa output test ok t/Alphabet.t ........................... 1..100 ok 1 - use Bio::Symbol::Alphabet; ok 2 - use Bio::Symbol::Symbol; ok 3 - use Bio::Symbol::DNAAlphabet; ok 4 - use Bio::Symbol::ProteinAlphabet; ok 5 - An object of class 'Bio::Symbol::Alphabet' isa 'Bio::Symbol::Alphabet' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Symbol::DNAAlphabet' isa 'Bio::Symbol::AlphabetI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - An object of class 'Bio::Symbol::ProteinAlphabet' isa 'Bio::Symbol::AlphabetI' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok t/Annotation/Annotation.t .............. 1..152 ok 1 - use Bio::Annotation::Collection; ok 2 - use Bio::Annotation::DBLink; ok 3 - use Bio::Annotation::Comment; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Target; ok 7 - use Bio::Annotation::AnnotationFactory; ok 8 - use Bio::Annotation::StructuredValue; ok 9 - use Bio::Annotation::TagTree; ok 10 - use Bio::Annotation::Tree; ok 11 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::AnnotationI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::AnnotationI' ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 23 ok 24 ok 25 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 26 ok 27 - An object of class 'Bio::Annotation::Reference' isa 'Bio::AnnotationI' ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::AnnotationI' ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 66 ok 67 ok 68 ok 69 ok 70 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::Annotation::StructuredValue' ok 71 ok 72 ok 73 ok 74 ok 75 - use Bio::Annotation::OntologyTerm; ok 76 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::Term' ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 83 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 84 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 85 # skip The optional module Bio::SeqFeature::Annotated (or dependencies thereof) was not installed ok 86 - An object of class 'Bio::Annotation::AnnotationFactory' isa 'Bio::Factory::ObjectFactoryI' ok 87 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 88 ok 89 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Annotation::OntologyTerm' ok 90 - Bio::Annotation::Comment ok 91 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 92 ok 93 - Bio::Annotation::Comment ok 94 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 95 - Bio::Annotation::Comment ok 96 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 97 ok 98 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::Target' ok 99 ok 100 ok 101 - An object of class 'Bio::Annotation::Tree' isa 'Bio::AnnotationI' ok 102 - tree_id() ok 103 - tagname() ok 104 ok 105 - add tree to AlignI ok 106 - get seq from node id ok 107 ok 108 - An object of class 'Bio::Annotation::Tree' isa 'Bio::Annotation::Tree' ok 109 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 110 - default itext ok 111 - roundtrip ok 112 - itext ok 113 - spxr ok 114 - indent ok 115 - xml ok 116 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 117 ok 118 - child changes ok 119 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 120 ok 121 - child changes ok 122 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 123 ok 124 - child changes ok 125 - child changes in parent node ok 126 - no tags ok 127 - before Stag node ok 128 - after Stag node ok 129 - both stag nodes ok 130 - different instances ok 131 - before TagTree ok 132 - after TagTree ok 133 - both stag nodes ok 134 - different instances ok 135 - before TagTree ok 136 - after TagTree ok 137 - stag nodes ok 138 - same instance ok 139 - before TagTree ok 140 - after TagTree ok 141 - stag nodes ok 142 - different instance ok 143 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 144 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 145 - child changes ok 146 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 147 - child changes ok 148 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 149 - child changes ok 150 ok 151 ok 152 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::Annotation::TagTree' ok t/Annotation/AnnotationAdaptor.t ....... 1..23 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::AnnotationAdaptor; ok 3 - use Bio::Annotation::DBLink; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Assembly/ContigSpectrum.t ............ skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/IO/bowtie.t ................. skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/IO/sam.t .................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/Assembly/core.t ...................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/Cluster/UniGene.t .................... 1..2 ok 1 - use Bio::Cluster::UniGene; ok 2 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::AnnotatableI' ok t/ClusterIO/ClusterIO.t ................ 1..12 ok 1 - use Bio::ClusterIO; ok 2 - use Bio::Cluster::ClusterFactory; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok 12 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok t/ClusterIO/SequenceFamily.t ........... 1..17 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Cluster::SequenceFamily; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/ClusterIO/unigene.t .................. 1..73 ok 1 - use Bio::ClusterIO; ok 2 - new Bio::ClusterIO object defined ok 3 ok 4 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok 5 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::ClusterI' ok 6 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::IdentifiableI' ok 7 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::DescribableI' ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 49 ok 50 ok 51 - annotation object defined ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 67 ok 68 - next cluster ok 69 ok 70 ok 71 ok 72 ok 73 ok t/Coordinate/CoordinateBoundaryTest.t .. 1..174 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 ok 4 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 5 ok 6 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 7 ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 9 ok 10 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 11 ok 12 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 33 ok 34 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 35 ok 36 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 51 ok 52 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 53 ok 54 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 69 ok 70 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 71 ok 72 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 89 ok 90 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 91 ok 92 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 109 ok 110 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 111 ok 112 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 113 ok 114 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 115 ok 116 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 133 ok 134 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 143 ok 144 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 153 ok 154 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 165 ok 166 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok t/Coordinate/CoordinateGraph.t ......... 1..7 ok 1 - use Bio::Coordinate::Graph; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok t/Coordinate/CoordinateMapper.t ........ 1..175 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::Result::Match; ok 4 - use Bio::Coordinate::Result::Gap; ok 5 - use Bio::Coordinate::Chain; ok 6 - use Bio::Coordinate::Collection; ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 15 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Location::SplitLocationI' ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::LocationI' ok 20 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match' ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::Coordinate::Result::Gap' ok 38 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::LocationI' ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match' ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Match: |314696| Test: 314696| ok 139 ok 140 ok 141 ok 142 - Match: |341| Test: 341| ok 143 ok 144 ok 145 ok 146 - Match: |315843| Test: 315843| ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - Match: |627011| Test: 627011| ok 153 ok 154 ok 155 ok 156 - Match: |chr1| Test: chr1| ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok t/Coordinate/GeneCoordinateMapper.t .... 1..116 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::ExtrapolatingPair; ok 4 - use Bio::Coordinate::GeneMapper; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple' ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple' ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/Draw/Pictogram.t ..................... 1..6 ok 1 - use Bio::Draw::Pictogram; ok 2 - use Bio::SeqIO; ok 3 - use Bio::Matrix::PSM::IO; ok 4 - An object of class 'Bio::Draw::Pictogram' isa 'Bio::Draw::Pictogram' ok 5 ok 6 ok t/LiveSeq/Chain.t ...................... 1..45 ok 1 - use Bio::LiveSeq::Chain; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok t/LiveSeq/LiveSeq.t .................... 1..48 ok 1 - use Bio::LiveSeq::IO::BioPerl; ok 2 ok 3 ok 4 - Bio::LiveSeq::Gene ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok t/LiveSeq/Mutation.t ................... 1..19 ok 1 - use Bio::LiveSeq::Mutation; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/LiveSeq/Mutator.t .................... 1..24 ok 1 - use Bio::LiveSeq::Mutator; ok 2 - use Bio::LiveSeq::IO::BioPerl; ok 3 - use Bio::Variation::IO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok You are loading a Bio::DB::GFF database with GFF3 formatted data. While this will likely work fine, the Bio::DB::GFF schema does not always faithfully capture the complexity represented in GFF3 files. Unless you have a specific reason for using Bio::DB::GFF, we suggest that you use a Bio::DB::SeqFeature::Store database and its corresponding loader, bp_seqfeature_load.pl. t/LocalDB/BioDBGFF.t ................... 1..275 ok 1 - use Bio::DB::GFF; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 # skip fetch_feature_by_gid() not implemented by this adaptor ok 102 # skip fetch_feature_by_gid() not implemented by this adaptor ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 # skip delete_groups() not implemented by this adaptor ok 133 # skip delete_groups() not implemented by this adaptor ok 134 # skip Not compatible with your Operating System ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 # skip fetch_feature_by_gid() not implemented by this adaptor ok 239 # skip fetch_feature_by_gid() not implemented by this adaptor ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 # skip preferred groups are not supported by gff3 ok 247 # skip preferred groups are not supported by gff3 ok 248 # skip preferred groups are not supported by gff3 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 # skip delete_groups() not implemented by this adaptor ok 270 # skip delete_groups() not implemented by this adaptor ok 271 # skip Not compatible with your Operating System ok 272 ok 273 ok 274 ok 275 ok t/LocalDB/Fasta.t ...................... 1..107 ok 1 - Index a directory ok 2 ok 3 - An object of class 'Bio::DB::Fasta' isa 'Bio::DB::Fasta' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 29 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - bug 3126 ok 38 ok 39 ok 40 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 41 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 46 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 47 ok 48 ok 49 - use Class::Unload; ok 50 - Re-open an existing index ok 51 ok 52 - Tied hash access ok 53 ok 54 ok 55 ok 56 ok 57 - Writing with SeqIO ok 58 ok 59 ok 60 - Index a single file ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 - Make single ID ok 89 ok 90 ok 91 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 92 - Make multiple IDs, bug \#3389 ok 93 ok 94 ok 95 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 96 - Index a set of files ok 97 ok 98 ok 99 ok 100 ok 101 - threw Regexp ((?^:FASTA header doesn't match)) ok 102 - threw Regexp ((?^:Blank lines can only precede header lines)) ok 103 ok 104 - length is correct in sequences past spaces ok 105 ok 106 - subseq is correct ok 107 - subseq is correct ok t/LocalDB/Flat.t ....................... skipped: The optional module DB_File (or dependencies thereof) was not installed t/LocalDB/Index/Blast.t ................ 1..26 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::Blast; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/LocalDB/Index/BlastTable.t ........... 1..27 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::BlastTable; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/LocalDB/Index/Index.t ................ skipped: The optional module DB_File (or dependencies thereof) was not installed t/LocalDB/Qual.t ....................... 1..56 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 - An object of class 'Bio::DB::Qual' isa 'Bio::DB::Qual' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 23 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 38 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 43 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 49 ok 50 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 51 ok 52 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 53 ok 54 ok 55 ok 56 ok t/LocalDB/Registry.t ................... 1..14 ok 1 - use Bio::DB::Registry; ok 2 - use Bio::DB::Flat; ok 3 ok 4 # skip The optional module DB_File (or dependencies thereof) was not installed ok 5 # skip The optional module DB_File (or dependencies thereof) was not installed ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok t/LocalDB/SeqFeature.t ................. skipped: The optional module DB_File (or dependencies thereof) was not installed t/LocalDB/Taxonomy/greengenes.t ........ 1..38 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::greengenes' ok 5 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/LocalDB/Taxonomy/silva.t ............. 1..42 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::silva' ok 5 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok t/LocalDB/transfac_pro.t ............... skipped: The optional module DB_File (or dependencies thereof) was not installed t/Map/Cyto.t ........................... 1..110 ok 1 - use Bio::Map::CytoMap; ok 2 - use Bio::Map::CytoPosition; ok 3 - use Bio::Map::CytoMarker; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Map::CytoPosition' isa 'Bio::Map::CytoPosition' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Range' isa 'Bio::Range' ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok t/Map/Linkage.t ........................ 1..18 ok 1 - use Bio::Map::LinkagePosition; ok 2 - use Bio::Map::Microsatellite; ok 3 - use Bio::Map::LinkageMap; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/Map/Map.t ............................ 1..267 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Marker; ok 3 - use Bio::Map::Position; ok 4 - use Bio::Map::Relative; ok 5 - use Bio::Map::Mappable; ok 6 ok 7 ok 8 ok 9 ok 10 - Length is 0 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 - use Bio::Map::Gene; ok 152 - use Bio::Map::GeneMap; ok 153 - use Bio::Map::TranscriptionFactor; ok 154 - use Bio::Map::GeneRelative; ok 155 - use Bio::Map::GenePosition; ok 156 - use Bio::Map::Prediction; ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok t/Map/MapIO.t .......................... 1..51 ok 1 - use Bio::MapIO; ok 2 ok 3 - An object of class 'Bio::Map::SimpleMap' isa 'Bio::Map::MapI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Map/MicrosatelliteMarker.t ........... 1..8 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Position; ok 3 - use Bio::Map::Microsatellite; ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Map/Physical.t ....................... 1..40 ok 1 - use Bio::Map::Physical; ok 2 - use Bio::MapIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - code holds and returns a string, definition requires a boolean ok 13 - code holds and returns a string, definition requires a boolean ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok t/Matrix/IO/masta.t .................... 1..16 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/Matrix/IO/psm.t ...................... 1..63 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Matrix/InstanceSite.t ................ 1..6 ok 1 - use Bio::Matrix::PSM::InstanceSite; ok 2 ok 3 ok 4 ok 5 ok 6 ok t/Matrix/Matrix.t ...................... 1..77 ok 1 - use Bio::Matrix::Generic; ok 2 - use Bio::Matrix::IO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok t/Matrix/ProtMatrix.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::ProtMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Matrix/ProtPsm.t ..................... 1..14 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 # skip TODO: Module incomplete ok 6 # skip TODO: Module incomplete ok 7 # skip TODO: Module incomplete ok 8 # skip TODO: Module incomplete ok 9 # skip TODO: Module incomplete ok 10 # skip TODO: Module incomplete ok 11 # skip TODO: Module incomplete ok 12 # skip TODO: Module incomplete ok 13 # skip TODO: Module incomplete ok 14 # skip TODO: Module incomplete ok t/Matrix/SiteMatrix.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::SiteMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Ontology/GOterm.t .................... 1..62 ok 1 - use Bio::Ontology::GOterm; ok 2 - use Bio::Ontology::Ontology; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok t/Ontology/GraphAdaptor.t .............. 1..28 ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Ontology/IO/go.t ..................... 1..102 ok 1 - use Bio::OntologyIO; ok 2 ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::OntologyI' ok 4 ok 5 - An object of class 'Bio::Ontology::OBOEngine' isa 'Bio::Ontology::OntologyEngineI' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/Ontology/IO/interpro.t ............... 1..69 ok 1 - use Bio::OntologyIO; ok 2 - An object of class 'Bio::OntologyIO::InterProParser' isa 'Bio::OntologyIO::InterProParser' ok 3 ok 4 - get_dbxrefs on leaf terms is non-empty ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty ok 11 - get_members on leaf terms is non-empty ok 12 - class_list on leaf terms is non-empty ok 13 - get_examples on leaf terms is non-empty ok 14 - get_external_documents on leaf terms is non-empty ok 15 - get_references on leaf terms is non-empty ok 16 - protein_count on leaf terms is non-empty ok 17 - to_string looks reasonable ok 18 - There are 8 root InterPro terms ok 19 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 20 - term Integrins alpha chain in ontology InterPro ok 21 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 22 - term post-translational modification in ontology InterPro ok 23 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 24 - term Repeat in ontology InterPro ok 25 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 26 - term Binding Site in ontology InterPro ok 27 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 28 - term Cdc20/Fizzy in ontology InterPro ok 29 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 30 - term Conserved Site in ontology InterPro ok 31 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 32 - term Region in ontology InterPro ok 33 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 34 - term Kringle in ontology InterPro ok 35 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 36 - term Helix-turn-helix, AraC type in ontology InterPro ok 37 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 38 - term Active Site in ontology InterPro ok 39 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 40 - term Active Site in ontology InterPro ok 41 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 42 - term Binding Site in ontology InterPro ok 43 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 44 - term Conserved Site in ontology InterPro ok 45 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 46 - term Domain in ontology InterPro ok 47 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 48 - term Family in ontology InterPro ok 49 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 50 - term Region in ontology InterPro ok 51 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 52 - term Repeat in ontology InterPro ok 53 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 54 - term post-translational modification in ontology InterPro ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Integrins alpha chain term has one parent ok 62 - Integrins alpha chain term has one ancestor ok 63 - Cdc20/Fizzy term has one parent ok 64 - Cdc20/Fizzy term has one ancestor ok 65 - Kringle term has one parent ok 66 - Kringle term has one ancestor ok 67 - Helix-turn-helix, AraC type term has one parent ok 68 - Helix-turn-helix, AraC type term has one ancestor ok 69 - secondary accession map has 2 keys ok t/Ontology/IO/obo.t .................... 1..92 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 47 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 48 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 49 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 50 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 51 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 52 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 53 - Gene ontology ok 54 - biological process ok 55 - molecular function ok 56 - Got root ok 57 - Got root ok 58 - Got regulates # from gene_ontology ok 59 - Got # positively regulates from gene_ontology ok 60 - Got # regulates from biological_process ok 61 - Got # positively regulates from biological_process ok 62 - Got predicates for gene_ontology ok 63 - Got predicates for biological_process ok 64 - Got regulates predicate ok 65 - Got positively regulates predicate ok 66 - Got relationships for biological_process ok 67 - Got relationships for molecular_function ok 68 - Got is a relationship from # molecular_function ok 69 - 'Got term object' isa 'Bio::Ontology::Term' ok 70 - Got term id ok 71 - Got term name ok 72 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 73 - Got regulated term1 id ok 74 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 75 - Got back the child ok 76 - 'Got term object' isa 'Bio::Ontology::Term' ok 77 - Got term id ok 78 - Got term name ok 79 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 80 - Got regulated term1 id ok 81 - Got identical regulation ok 82 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 83 - Got back the child ok 84 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok t/Ontology/Ontology.t .................. 1..55 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - Interpro XML file interpro.xml can be parsed ok 54 - Interpro XML file interpro_sample.xml can be parsed ok 55 - Interpro XML file interpro_relationship.xml can be parsed ok t/Ontology/OntologyEngine.t ............ 1..31 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::Relationship; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - use Bio::Ontology::SimpleOntologyEngine; ok 5 - use Bio::Ontology::Ontology; ok 6 - An object of class 'Bio::Ontology::SimpleOntologyEngine' isa 'Bio::Ontology::OntologyEngineI' ok 7 ok 8 - adding a relationship with an undef object term fails ok 9 - adding a relationship with an undef object term fails ok 10 - adding a relationship with an undef subject term fails ok 11 - adding a relationship with an undef subject term fails ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/Ontology/OntologyStore.t ............. skipped: Network tests have not been requested t/Ontology/Relationship.t .............. 1..12 ok 1 - use Bio::Ontology::Relationship; ok 2 - use Bio::Ontology::GOterm; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 5 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 6 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 7 - An object of class 'Bio::Ontology::Relationship' isa 'Bio::Ontology::Relationship' ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Ontology/RelationshipType.t .......... 1..23 ok 1 - use Bio::Ontology::RelationshipType; ok 2 - use Bio::Ontology::Ontology; ok 3 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Ontology/Term.t ...................... 1..54 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::TermFactory; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 45 ok 46 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::TermI' ok 47 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Ontology::TermI' ok 51 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::AnnotationI' ok 52 ok 53 ok 54 ok t/Perl.t ............................... 1..31 ok 1 - use Bio::Perl; ok 2 ok 3 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 4 ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI' ok 6 ok 7 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 8 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 9 ok 10 ok 11 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 12 ok 13 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 14 ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 16 ok 17 ok 18 ok 19 ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok t/Phenotype/Correlate.t ................ 1..17 ok 1 - use Bio::Phenotype::Correlate; ok 2 - use Bio::Species; ok 3 - An object of class 'Bio::Phenotype::Correlate' isa 'Bio::Phenotype::Correlate' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/Phenotype/MeSH.t ..................... 1..24 ok 1 - use Bio::Phenotype::MeSH::Term; ok 2 - use Bio::Phenotype::MeSH::Twig; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Phenotype/Measure.t .................. 1..21 ok 1 - use Bio::Phenotype::Measure; ok 2 - An object of class 'Bio::Phenotype::Measure' isa 'Bio::Phenotype::Measure' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Phenotype/MiniMIMentry.t ............. 1..15 ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 2 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/Phenotype/OMIMentry.t ................ 1..153 ok 1 - use Bio::Phenotype::OMIM::OMIMentry; ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 3 - use Bio::Species; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Map::CytoPosition; ok 6 - use Bio::Phenotype::Correlate; ok 7 - use Bio::Phenotype::Measure; ok 8 - use Bio::Annotation::DBLink; ok 9 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - operator overloading in AnnotationI is deprecated ok 80 - operator overloading in AnnotationI is deprecated ok 81 ok 82 ok 83 - operator overloading in AnnotationI is deprecated ok 84 - operator overloading in AnnotationI is deprecated ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - operator overloading in AnnotationI is deprecated ok 137 - operator overloading in AnnotationI is deprecated ok 138 ok 139 ok 140 - operator overloading in AnnotationI is deprecated ok 141 - operator overloading in AnnotationI is deprecated ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok t/Phenotype/OMIMentryAllelicVariant.t .. 1..27 ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant; ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' isa 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Phenotype/OMIMparser.t ............... 1..175 ok 1 - use Bio::Phenotype::OMIM::OMIMparser; ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMparser' isa 'Bio::Phenotype::OMIM::OMIMparser' ok 3 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - missing linebreak caught ok t/Phenotype/Phenotype.t ................ 1..116 ok 1 - use Bio::Phenotype::Phenotype; ok 2 - use Bio::Species; ok 3 - use Bio::Annotation::Reference; ok 4 - use Bio::Map::CytoPosition; ok 5 - use Bio::Phenotype::Correlate; ok 6 - use Bio::Phenotype::Measure; ok 7 - use Bio::Annotation::DBLink; ok 8 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::PhenotypeI' ok 9 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::Phenotype' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - operator overloading in AnnotationI is deprecated ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 - operator overloading in AnnotationI is deprecated ok 47 - operator overloading in AnnotationI is deprecated ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - operator overloading in AnnotationI is deprecated ok 100 - operator overloading in AnnotationI is deprecated ok 101 ok 102 ok 103 - operator overloading in AnnotationI is deprecated ok 104 - operator overloading in AnnotationI is deprecated ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/PodSyntax.t .......................... 1..953 ok 1 - POD test for Bio/AlignIO.pm ok 2 - POD test for Bio/AnalysisI.pm ok 3 - POD test for Bio/AnalysisParserI.pm ok 4 - POD test for Bio/AnalysisResultI.pm ok 5 - POD test for Bio/AnnotatableI.pm ok 6 - POD test for Bio/AnnotationCollectionI.pm ok 7 - POD test for Bio/AnnotationI.pm ok 8 - POD test for Bio/ClusterI.pm ok 9 - POD test for Bio/ClusterIO.pm ok 10 - POD test for Bio/DasI.pm ok 11 - POD test for Bio/DBLinkContainerI.pm ok 12 - POD test for Bio/DescribableI.pm ok 13 - POD test for Bio/FeatureHolderI.pm ok 14 - POD test for Bio/HandlerBaseI.pm ok 15 - POD test for Bio/IdCollectionI.pm ok 16 - POD test for Bio/IdentifiableI.pm ok 17 - POD test for Bio/LocatableSeq.pm ok 18 - POD test for Bio/LocationI.pm ok 19 - POD test for Bio/MapIO.pm ok 20 - POD test for Bio/NexmlIO.pm ok 21 - POD test for Bio/OntologyIO.pm ok 22 - POD test for Bio/ParameterBaseI.pm ok 23 - POD test for Bio/Perl.pm ok 24 - POD test for Bio/PhyloNetwork.pm ok 25 - POD test for Bio/PrimarySeq.pm ok 26 - POD test for Bio/PrimarySeqI.pm ok 27 - POD test for Bio/PullParserI.pm ok 28 - POD test for Bio/Range.pm ok 29 - POD test for Bio/RangeI.pm ok 30 - POD test for Bio/SearchDist.pm ok 31 - POD test for Bio/SearchIO.pm ok 32 - POD test for Bio/Seq.pm ok 33 - POD test for Bio/SeqAnalysisParserI.pm ok 34 - POD test for Bio/SeqFeatureI.pm ok 35 - POD test for Bio/SeqI.pm ok 36 - POD test for Bio/SeqIO.pm ok 37 - POD test for Bio/SeqUtils.pm ok 38 - POD test for Bio/SimpleAlign.pm ok 39 - POD test for Bio/SimpleAnalysisI.pm ok 40 - POD test for Bio/Species.pm ok 41 - POD test for Bio/Taxon.pm ok 42 - POD test for Bio/Taxonomy.pm ok 43 - POD test for Bio/TreeIO.pm ok 44 - POD test for Bio/UpdateableSeqI.pm ok 45 - POD test for Bio/WebAgent.pm ok 46 - POD test for Bio/Align/AlignI.pm ok 47 - POD test for Bio/Align/DNAStatistics.pm ok 48 - POD test for Bio/Align/Graphics.pm ok 49 - POD test for Bio/Align/PairwiseStatistics.pm ok 50 - POD test for Bio/Align/ProteinStatistics.pm ok 51 - POD test for Bio/Align/StatisticsI.pm ok 52 - POD test for Bio/Align/Utilities.pm ok 53 - POD test for Bio/AlignIO/arp.pm ok 54 - POD test for Bio/AlignIO/bl2seq.pm ok 55 - POD test for Bio/AlignIO/clustalw.pm ok 56 - POD test for Bio/AlignIO/emboss.pm ok 57 - POD test for Bio/AlignIO/fasta.pm ok 58 - POD test for Bio/AlignIO/largemultifasta.pm ok 59 - POD test for Bio/AlignIO/maf.pm ok 60 - POD test for Bio/AlignIO/mase.pm ok 61 - POD test for Bio/AlignIO/mega.pm ok 62 - POD test for Bio/AlignIO/meme.pm ok 63 - POD test for Bio/AlignIO/metafasta.pm ok 64 - POD test for Bio/AlignIO/msf.pm ok 65 - POD test for Bio/AlignIO/nexml.pm ok 66 - POD test for Bio/AlignIO/nexus.pm ok 67 - POD test for Bio/AlignIO/pfam.pm ok 68 - POD test for Bio/AlignIO/phylip.pm ok 69 - POD test for Bio/AlignIO/po.pm ok 70 - POD test for Bio/AlignIO/proda.pm ok 71 - POD test for Bio/AlignIO/prodom.pm ok 72 - POD test for Bio/AlignIO/psi.pm ok 73 - POD test for Bio/AlignIO/selex.pm ok 74 - POD test for Bio/AlignIO/stockholm.pm ok 75 - POD test for Bio/AlignIO/xmfa.pm ok 76 - POD test for Bio/AlignIO/Handler/GenericAlignHandler.pm ok 77 - POD test for Bio/Annotation/AnnotationFactory.pm ok 78 - POD test for Bio/Annotation/Collection.pm ok 79 - POD test for Bio/Annotation/Comment.pm ok 80 - POD test for Bio/Annotation/DBLink.pm ok 81 - POD test for Bio/Annotation/OntologyTerm.pm ok 82 - POD test for Bio/Annotation/Reference.pm ok 83 - POD test for Bio/Annotation/Relation.pm ok 84 - POD test for Bio/Annotation/SimpleValue.pm ok 85 - POD test for Bio/Annotation/StructuredValue.pm ok 86 - POD test for Bio/Annotation/TagTree.pm ok 87 - POD test for Bio/Annotation/Target.pm ok 88 - POD test for Bio/Annotation/Tree.pm ok 89 - POD test for Bio/Annotation/TypeManager.pm ok 90 - POD test for Bio/Assembly/Contig.pm ok 91 - POD test for Bio/Assembly/ContigAnalysis.pm ok 92 - POD test for Bio/Assembly/IO.pm ok 93 - POD test for Bio/Assembly/Scaffold.pm ok 94 - POD test for Bio/Assembly/ScaffoldI.pm ok 95 - POD test for Bio/Assembly/Singlet.pm ok 96 - POD test for Bio/Assembly/IO/ace.pm ok 97 - POD test for Bio/Assembly/IO/bowtie.pm ok 98 - POD test for Bio/Assembly/IO/maq.pm ok 99 - POD test for Bio/Assembly/IO/phrap.pm ok 100 - POD test for Bio/Assembly/IO/sam.pm ok 101 - POD test for Bio/Assembly/IO/tigr.pm ok 102 - POD test for Bio/Assembly/Tools/ContigSpectrum.pm ok 103 - POD test for Bio/Cluster/ClusterFactory.pm ok 104 - POD test for Bio/Cluster/FamilyI.pm ok 105 - POD test for Bio/Cluster/SequenceFamily.pm ok 106 - POD test for Bio/Cluster/UniGene.pm ok 107 - POD test for Bio/Cluster/UniGeneI.pm ok 108 - POD test for Bio/ClusterIO/dbsnp.pm ok 109 - POD test for Bio/ClusterIO/unigene.pm ok 110 - POD test for Bio/CodonUsage/IO.pm ok 111 - POD test for Bio/CodonUsage/Table.pm ok 112 - POD test for Bio/Coordinate/Chain.pm ok 113 - POD test for Bio/Coordinate/Collection.pm ok 114 - POD test for Bio/Coordinate/ExtrapolatingPair.pm ok 115 - POD test for Bio/Coordinate/GeneMapper.pm ok 116 - POD test for Bio/Coordinate/Graph.pm ok 117 - POD test for Bio/Coordinate/MapperI.pm ok 118 - POD test for Bio/Coordinate/Pair.pm ok 119 - POD test for Bio/Coordinate/Result.pm ok 120 - POD test for Bio/Coordinate/ResultI.pm ok 121 - POD test for Bio/Coordinate/Utils.pm ok 122 - POD test for Bio/Coordinate/Result/Gap.pm ok 123 - POD test for Bio/Coordinate/Result/Match.pm ok 124 - POD test for Bio/Das/FeatureTypeI.pm ok 125 - POD test for Bio/Das/SegmentI.pm ok 126 - POD test for Bio/DB/Ace.pm ok 127 - POD test for Bio/DB/BioFetch.pm ok 128 - POD test for Bio/DB/CUTG.pm ok 129 - POD test for Bio/DB/DBFetch.pm ok 130 - POD test for Bio/DB/EMBL.pm ok 131 - POD test for Bio/DB/EntrezGene.pm ok 132 - POD test for Bio/DB/Expression.pm ok 133 - POD test for Bio/DB/Failover.pm ok 134 - POD test for Bio/DB/Fasta.pm ok 135 - POD test for Bio/DB/FileCache.pm ok 136 - POD test for Bio/DB/Flat.pm ok 137 - POD test for Bio/DB/GenBank.pm ok 138 - POD test for Bio/DB/GenericWebAgent.pm ok 139 - POD test for Bio/DB/GenPept.pm ok 140 - POD test for Bio/DB/GFF.pm ok 141 - POD test for Bio/DB/HIV.pm ok 142 - POD test for Bio/DB/IndexedBase.pm ok 143 - POD test for Bio/DB/InMemoryCache.pm ok 144 - POD test for Bio/DB/LocationI.pm ok 145 - POD test for Bio/DB/MeSH.pm ok 146 - POD test for Bio/DB/NCBIHelper.pm ok 147 - POD test for Bio/DB/Qual.pm ok 148 - POD test for Bio/DB/QueryI.pm ok 149 - POD test for Bio/DB/RandomAccessI.pm ok 150 - POD test for Bio/DB/ReferenceI.pm ok 151 - POD test for Bio/DB/RefSeq.pm ok 152 - POD test for Bio/DB/Registry.pm ok 153 - POD test for Bio/DB/SeqFeature.pm ok 154 - POD test for Bio/DB/SeqHound.pm ok 155 - POD test for Bio/DB/SeqI.pm ok 156 - POD test for Bio/DB/SeqVersion.pm ok 157 - POD test for Bio/DB/SwissProt.pm ok 158 - POD test for Bio/DB/Taxonomy.pm ok 159 - POD test for Bio/DB/TFBS.pm ok 160 - POD test for Bio/DB/Universal.pm ok 161 - POD test for Bio/DB/UpdateableSeqI.pm ok 162 - POD test for Bio/DB/WebDBSeqI.pm ok 163 - POD test for Bio/DB/Expression/geo.pm ok 164 - POD test for Bio/DB/Flat/BDB.pm ok 165 - POD test for Bio/DB/Flat/BinarySearch.pm ok 166 - POD test for Bio/DB/Flat/BDB/embl.pm ok 167 - POD test for Bio/DB/Flat/BDB/fasta.pm ok 168 - POD test for Bio/DB/Flat/BDB/genbank.pm ok 169 - POD test for Bio/DB/Flat/BDB/swiss.pm ok 170 - POD test for Bio/DB/GFF/Aggregator.pm ok 171 - POD test for Bio/DB/GFF/Featname.pm ok 172 - POD test for Bio/DB/GFF/Feature.pm ok 173 - POD test for Bio/DB/GFF/Homol.pm ok 174 - POD test for Bio/DB/GFF/RelSegment.pm ok 175 - POD test for Bio/DB/GFF/Segment.pm ok 176 - POD test for Bio/DB/GFF/Typename.pm ok 177 - POD test for Bio/DB/GFF/Adaptor/ace.pm ok 178 - POD test for Bio/DB/GFF/Adaptor/berkeleydb.pm ok 179 - POD test for Bio/DB/GFF/Adaptor/biofetch.pm ok 180 - POD test for Bio/DB/GFF/Adaptor/biofetch_oracle.pm ok 181 - POD test for Bio/DB/GFF/Adaptor/dbi.pm ok 182 - POD test for Bio/DB/GFF/Adaptor/memory.pm ok 183 - POD test for Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm ok 184 - POD test for Bio/DB/GFF/Adaptor/dbi/caching_handle.pm ok 185 - POD test for Bio/DB/GFF/Adaptor/dbi/iterator.pm ok 186 - POD test for Bio/DB/GFF/Adaptor/dbi/mysql.pm ok 187 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlace.pm ok 188 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm ok 189 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm ok 190 - POD test for Bio/DB/GFF/Adaptor/dbi/oracle.pm ok 191 - POD test for Bio/DB/GFF/Adaptor/dbi/oracleace.pm ok 192 - POD test for Bio/DB/GFF/Adaptor/dbi/pg.pm ok 193 - POD test for Bio/DB/GFF/Adaptor/dbi/pg_fts.pm ok 194 - POD test for Bio/DB/GFF/Adaptor/memory/feature_serializer.pm ok 195 - POD test for Bio/DB/GFF/Adaptor/memory/iterator.pm ok 196 - POD test for Bio/DB/GFF/Aggregator/alignment.pm ok 197 - POD test for Bio/DB/GFF/Aggregator/clone.pm ok 198 - POD test for Bio/DB/GFF/Aggregator/coding.pm ok 199 - POD test for Bio/DB/GFF/Aggregator/gene.pm ok 200 - POD test for Bio/DB/GFF/Aggregator/match.pm ok 201 - POD test for Bio/DB/GFF/Aggregator/none.pm ok 202 - POD test for Bio/DB/GFF/Aggregator/orf.pm ok 203 - POD test for Bio/DB/GFF/Aggregator/processed_transcript.pm ok 204 - POD test for Bio/DB/GFF/Aggregator/so_transcript.pm ok 205 - POD test for Bio/DB/GFF/Aggregator/transcript.pm ok 206 - POD test for Bio/DB/GFF/Aggregator/ucsc_acembly.pm ok 207 - POD test for Bio/DB/GFF/Aggregator/ucsc_ensgene.pm ok 208 - POD test for Bio/DB/GFF/Aggregator/ucsc_genscan.pm ok 209 - POD test for Bio/DB/GFF/Aggregator/ucsc_refgene.pm ok 210 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22.pm ok 211 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm ok 212 - POD test for Bio/DB/GFF/Aggregator/ucsc_softberry.pm ok 213 - POD test for Bio/DB/GFF/Aggregator/ucsc_twinscan.pm ok 214 - POD test for Bio/DB/GFF/Aggregator/ucsc_unigene.pm ok 215 - POD test for Bio/DB/GFF/Util/Binning.pm ok 216 - POD test for Bio/DB/GFF/Util/Rearrange.pm ok 217 - POD test for Bio/DB/HIV/HIVAnnotProcessor.pm ok 218 - POD test for Bio/DB/HIV/HIVQueryHelper.pm ok 219 - POD test for Bio/DB/Query/GenBank.pm ok 220 - POD test for Bio/DB/Query/HIVQuery.pm ok 221 - POD test for Bio/DB/Query/WebQuery.pm ok 222 - POD test for Bio/DB/SeqFeature/NormalizedFeature.pm ok 223 - POD test for Bio/DB/SeqFeature/NormalizedFeatureI.pm ok 224 - POD test for Bio/DB/SeqFeature/NormalizedTableFeatureI.pm ok 225 - POD test for Bio/DB/SeqFeature/Segment.pm ok 226 - POD test for Bio/DB/SeqFeature/Store.pm ok 227 - POD test for Bio/DB/SeqFeature/Store/bdb.pm ok 228 - POD test for Bio/DB/SeqFeature/Store/berkeleydb.pm ok 229 - POD test for Bio/DB/SeqFeature/Store/berkeleydb3.pm ok 230 - POD test for Bio/DB/SeqFeature/Store/FeatureFileLoader.pm ok 231 - POD test for Bio/DB/SeqFeature/Store/GFF2Loader.pm ok 232 - POD test for Bio/DB/SeqFeature/Store/GFF3Loader.pm ok 233 - POD test for Bio/DB/SeqFeature/Store/Loader.pm ok 234 - POD test for Bio/DB/SeqFeature/Store/LoadHelper.pm ok 235 - POD test for Bio/DB/SeqFeature/Store/memory.pm ok 236 - POD test for Bio/DB/SeqFeature/Store/DBI/Iterator.pm ok 237 - POD test for Bio/DB/SeqFeature/Store/DBI/mysql.pm ok 238 - POD test for Bio/DB/SeqFeature/Store/DBI/Pg.pm ok 239 - POD test for Bio/DB/SeqFeature/Store/DBI/SQLite.pm ok 240 - POD test for Bio/DB/SeqVersion/gi.pm ok 241 - POD test for Bio/DB/Taxonomy/entrez.pm ok 242 - POD test for Bio/DB/Taxonomy/flatfile.pm ok 243 - POD test for Bio/DB/Taxonomy/greengenes.pm ok 244 - POD test for Bio/DB/Taxonomy/list.pm ok 245 - POD test for Bio/DB/Taxonomy/silva.pm ok 246 - POD test for Bio/DB/TFBS/transfac_pro.pm ok 247 - POD test for Bio/Draw/Pictogram.pm ok 248 - POD test for Bio/Event/EventGeneratorI.pm ok 249 - POD test for Bio/Event/EventHandlerI.pm ok 250 - POD test for Bio/Factory/AnalysisI.pm ok 251 - POD test for Bio/Factory/ApplicationFactoryI.pm ok 252 - POD test for Bio/Factory/DriverFactory.pm ok 253 - POD test for Bio/Factory/FTLocationFactory.pm ok 254 - POD test for Bio/Factory/LocationFactoryI.pm ok 255 - POD test for Bio/Factory/MapFactoryI.pm ok 256 - POD test for Bio/Factory/ObjectBuilderI.pm ok 257 - POD test for Bio/Factory/ObjectFactory.pm ok 258 - POD test for Bio/Factory/ObjectFactoryI.pm ok 259 - POD test for Bio/Factory/SeqAnalysisParserFactory.pm ok 260 - POD test for Bio/Factory/SeqAnalysisParserFactoryI.pm ok 261 - POD test for Bio/Factory/SequenceFactoryI.pm ok 262 - POD test for Bio/Factory/SequenceProcessorI.pm ok 263 - POD test for Bio/Factory/SequenceStreamI.pm ok 264 - POD test for Bio/Factory/TreeFactoryI.pm ok 265 - POD test for Bio/Index/Abstract.pm ok 266 - POD test for Bio/Index/AbstractSeq.pm ok 267 - POD test for Bio/Index/Blast.pm ok 268 - POD test for Bio/Index/BlastTable.pm ok 269 - POD test for Bio/Index/EMBL.pm ok 270 - POD test for Bio/Index/Fasta.pm ok 271 - POD test for Bio/Index/Fastq.pm ok 272 - POD test for Bio/Index/GenBank.pm ok 273 - POD test for Bio/Index/Hmmer.pm ok 274 - POD test for Bio/Index/Qual.pm ok 275 - POD test for Bio/Index/Stockholm.pm ok 276 - POD test for Bio/Index/SwissPfam.pm ok 277 - POD test for Bio/Index/Swissprot.pm ok 278 - POD test for Bio/LiveSeq/AARange.pm ok 279 - POD test for Bio/LiveSeq/Chain.pm ok 280 - POD test for Bio/LiveSeq/ChainI.pm ok 281 - POD test for Bio/LiveSeq/DNA.pm ok 282 - POD test for Bio/LiveSeq/Exon.pm ok 283 - POD test for Bio/LiveSeq/Gene.pm ok 284 - POD test for Bio/LiveSeq/Intron.pm ok 285 - POD test for Bio/LiveSeq/Mutation.pm ok 286 - POD test for Bio/LiveSeq/Mutator.pm ok 287 - POD test for Bio/LiveSeq/Prim_Transcript.pm ok 288 - POD test for Bio/LiveSeq/Range.pm ok 289 - POD test for Bio/LiveSeq/Repeat_Region.pm ok 290 - POD test for Bio/LiveSeq/Repeat_Unit.pm ok 291 - POD test for Bio/LiveSeq/SeqI.pm ok 292 - POD test for Bio/LiveSeq/Transcript.pm ok 293 - POD test for Bio/LiveSeq/Translation.pm ok 294 - POD test for Bio/LiveSeq/IO/BioPerl.pm ok 295 - POD test for Bio/LiveSeq/IO/Loader.pm ok 296 - POD test for Bio/Location/Atomic.pm ok 297 - POD test for Bio/Location/AvWithinCoordPolicy.pm ok 298 - POD test for Bio/Location/CoordinatePolicyI.pm ok 299 - POD test for Bio/Location/Fuzzy.pm ok 300 - POD test for Bio/Location/FuzzyLocationI.pm ok 301 - POD test for Bio/Location/NarrowestCoordPolicy.pm ok 302 - POD test for Bio/Location/Simple.pm ok 303 - POD test for Bio/Location/Split.pm ok 304 - POD test for Bio/Location/SplitLocationI.pm ok 305 - POD test for Bio/Location/WidestCoordPolicy.pm ok 306 - POD test for Bio/Map/Clone.pm ok 307 - POD test for Bio/Map/Contig.pm ok 308 - POD test for Bio/Map/CytoMap.pm ok 309 - POD test for Bio/Map/CytoMarker.pm ok 310 - POD test for Bio/Map/CytoPosition.pm ok 311 - POD test for Bio/Map/EntityI.pm ok 312 - POD test for Bio/Map/FPCMarker.pm ok 313 - POD test for Bio/Map/Gene.pm ok 314 - POD test for Bio/Map/GeneMap.pm ok 315 - POD test for Bio/Map/GenePosition.pm ok 316 - POD test for Bio/Map/GeneRelative.pm ok 317 - POD test for Bio/Map/LinkageMap.pm ok 318 - POD test for Bio/Map/LinkagePosition.pm ok 319 - POD test for Bio/Map/MapI.pm ok 320 - POD test for Bio/Map/Mappable.pm ok 321 - POD test for Bio/Map/MappableI.pm ok 322 - POD test for Bio/Map/Marker.pm ok 323 - POD test for Bio/Map/MarkerI.pm ok 324 - POD test for Bio/Map/Microsatellite.pm ok 325 - POD test for Bio/Map/OrderedPosition.pm ok 326 - POD test for Bio/Map/OrderedPositionWithDistance.pm ok 327 - POD test for Bio/Map/Physical.pm ok 328 - POD test for Bio/Map/Position.pm ok 329 - POD test for Bio/Map/PositionHandler.pm ok 330 - POD test for Bio/Map/PositionHandlerI.pm ok 331 - POD test for Bio/Map/PositionI.pm ok 332 - POD test for Bio/Map/PositionWithSequence.pm ok 333 - POD test for Bio/Map/Prediction.pm ok 334 - POD test for Bio/Map/Relative.pm ok 335 - POD test for Bio/Map/RelativeI.pm ok 336 - POD test for Bio/Map/SimpleMap.pm ok 337 - POD test for Bio/Map/TranscriptionFactor.pm ok 338 - POD test for Bio/MapIO/fpc.pm ok 339 - POD test for Bio/MapIO/mapmaker.pm ok 340 - POD test for Bio/Matrix/Generic.pm ok 341 - POD test for Bio/Matrix/IO.pm ok 342 - POD test for Bio/Matrix/MatrixI.pm ok 343 - POD test for Bio/Matrix/Mlagan.pm ok 344 - POD test for Bio/Matrix/PhylipDist.pm ok 345 - POD test for Bio/Matrix/Scoring.pm ok 346 - POD test for Bio/Matrix/IO/mlagan.pm ok 347 - POD test for Bio/Matrix/IO/phylip.pm ok 348 - POD test for Bio/Matrix/IO/scoring.pm ok 349 - POD test for Bio/Matrix/PSM/InstanceSite.pm ok 350 - POD test for Bio/Matrix/PSM/InstanceSiteI.pm ok 351 - POD test for Bio/Matrix/PSM/IO.pm ok 352 - POD test for Bio/Matrix/PSM/ProtMatrix.pm ok 353 - POD test for Bio/Matrix/PSM/ProtPsm.pm ok 354 - POD test for Bio/Matrix/PSM/Psm.pm ok 355 - POD test for Bio/Matrix/PSM/PsmHeader.pm ok 356 - POD test for Bio/Matrix/PSM/PsmHeaderI.pm ok 357 - POD test for Bio/Matrix/PSM/PsmI.pm ok 358 - POD test for Bio/Matrix/PSM/SiteMatrix.pm ok 359 - POD test for Bio/Matrix/PSM/SiteMatrixI.pm ok 360 - POD test for Bio/Matrix/PSM/IO/mast.pm ok 361 - POD test for Bio/Matrix/PSM/IO/masta.pm ok 362 - POD test for Bio/Matrix/PSM/IO/meme.pm ok 363 - POD test for Bio/Matrix/PSM/IO/psiblast.pm ok 364 - POD test for Bio/Matrix/PSM/IO/transfac.pm ok 365 - POD test for Bio/MolEvol/CodonModel.pm ok 366 - POD test for Bio/Nexml/Factory.pm ok 367 - POD test for Bio/Ontology/DocumentRegistry.pm ok 368 - POD test for Bio/Ontology/GOterm.pm ok 369 - POD test for Bio/Ontology/InterProTerm.pm ok 370 - POD test for Bio/Ontology/OBOEngine.pm ok 371 - POD test for Bio/Ontology/OBOterm.pm ok 372 - POD test for Bio/Ontology/Ontology.pm ok 373 - POD test for Bio/Ontology/OntologyEngineI.pm ok 374 - POD test for Bio/Ontology/OntologyI.pm ok 375 - POD test for Bio/Ontology/OntologyStore.pm ok 376 - POD test for Bio/Ontology/Path.pm ok 377 - POD test for Bio/Ontology/PathI.pm ok 378 - POD test for Bio/Ontology/Relationship.pm ok 379 - POD test for Bio/Ontology/RelationshipFactory.pm ok 380 - POD test for Bio/Ontology/RelationshipI.pm ok 381 - POD test for Bio/Ontology/RelationshipType.pm ok 382 - POD test for Bio/Ontology/SimpleOntologyEngine.pm ok 383 - POD test for Bio/Ontology/Term.pm ok 384 - POD test for Bio/Ontology/TermFactory.pm ok 385 - POD test for Bio/Ontology/TermI.pm ok 386 - POD test for Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm ok 387 - POD test for Bio/OntologyIO/dagflat.pm ok 388 - POD test for Bio/OntologyIO/goflat.pm ok 389 - POD test for Bio/OntologyIO/InterProParser.pm ok 390 - POD test for Bio/OntologyIO/obo.pm ok 391 - POD test for Bio/OntologyIO/simplehierarchy.pm ok 392 - POD test for Bio/OntologyIO/soflat.pm ok 393 - POD test for Bio/OntologyIO/Handlers/BaseSAXHandler.pm ok 394 - POD test for Bio/OntologyIO/Handlers/InterProHandler.pm ok 395 - POD test for Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm ok 396 - POD test for Bio/Phenotype/Correlate.pm ok 397 - POD test for Bio/Phenotype/Measure.pm ok 398 - POD test for Bio/Phenotype/Phenotype.pm ok 399 - POD test for Bio/Phenotype/PhenotypeI.pm ok 400 - POD test for Bio/Phenotype/MeSH/Term.pm ok 401 - POD test for Bio/Phenotype/MeSH/Twig.pm ok 402 - POD test for Bio/Phenotype/OMIM/MiniMIMentry.pm ok 403 - POD test for Bio/Phenotype/OMIM/OMIMentry.pm ok 404 - POD test for Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm ok 405 - POD test for Bio/Phenotype/OMIM/OMIMparser.pm ok 406 - POD test for Bio/PhyloNetwork/Factory.pm ok 407 - POD test for Bio/PhyloNetwork/FactoryX.pm ok 408 - POD test for Bio/PhyloNetwork/GraphViz.pm ok 409 - POD test for Bio/PhyloNetwork/muVector.pm ok 410 - POD test for Bio/PhyloNetwork/RandomFactory.pm ok 411 - POD test for Bio/PhyloNetwork/TreeFactory.pm ok 412 - POD test for Bio/PhyloNetwork/TreeFactoryMulti.pm ok 413 - POD test for Bio/PhyloNetwork/TreeFactoryX.pm ok 414 - POD test for Bio/PopGen/Genotype.pm ok 415 - POD test for Bio/PopGen/GenotypeI.pm ok 416 - POD test for Bio/PopGen/HtSNP.pm ok 417 - POD test for Bio/PopGen/Individual.pm ok 418 - POD test for Bio/PopGen/IndividualI.pm ok 419 - POD test for Bio/PopGen/IO.pm ok 420 - POD test for Bio/PopGen/Marker.pm ok 421 - POD test for Bio/PopGen/MarkerI.pm ok 422 - POD test for Bio/PopGen/PopStats.pm ok 423 - POD test for Bio/PopGen/Population.pm ok 424 - POD test for Bio/PopGen/PopulationI.pm ok 425 - POD test for Bio/PopGen/Statistics.pm ok 426 - POD test for Bio/PopGen/TagHaplotype.pm ok 427 - POD test for Bio/PopGen/Utilities.pm ok 428 - POD test for Bio/PopGen/IO/csv.pm ok 429 - POD test for Bio/PopGen/IO/hapmap.pm ok 430 - POD test for Bio/PopGen/IO/phase.pm ok 431 - POD test for Bio/PopGen/IO/prettybase.pm ok 432 - POD test for Bio/PopGen/Simulation/Coalescent.pm ok 433 - POD test for Bio/PopGen/Simulation/GeneticDrift.pm ok 434 - POD test for Bio/Restriction/Analysis.pm ok 435 - POD test for Bio/Restriction/Enzyme.pm ok 436 - POD test for Bio/Restriction/EnzymeCollection.pm ok 437 - POD test for Bio/Restriction/EnzymeI.pm ok 438 - POD test for Bio/Restriction/IO.pm ok 439 - POD test for Bio/Restriction/Enzyme/MultiCut.pm ok 440 - POD test for Bio/Restriction/Enzyme/MultiSite.pm ok 441 - POD test for Bio/Restriction/IO/bairoch.pm ok 442 - POD test for Bio/Restriction/IO/base.pm ok 443 - POD test for Bio/Restriction/IO/itype2.pm ok 444 - POD test for Bio/Restriction/IO/prototype.pm ok 445 - POD test for Bio/Restriction/IO/withrefm.pm ok 446 - POD test for Bio/Root/Build.pm ok 447 - POD test for Bio/Root/Exception.pm ok 448 - POD test for Bio/Root/HTTPget.pm ok 449 - POD test for Bio/Root/IO.pm ok 450 - POD test for Bio/Root/Root.pm ok 451 - POD test for Bio/Root/RootI.pm ok 452 - POD test for Bio/Root/Storable.pm ok 453 - POD test for Bio/Root/Test.pm ok 454 - POD test for Bio/Root/Utilities.pm ok 455 - POD test for Bio/Root/Version.pm ok 456 - POD test for Bio/Search/BlastStatistics.pm ok 457 - POD test for Bio/Search/BlastUtils.pm ok 458 - POD test for Bio/Search/DatabaseI.pm ok 459 - POD test for Bio/Search/GenericDatabase.pm ok 460 - POD test for Bio/Search/GenericStatistics.pm ok 461 - POD test for Bio/Search/Processor.pm ok 462 - POD test for Bio/Search/SearchUtils.pm ok 463 - POD test for Bio/Search/StatisticsI.pm ok 464 - POD test for Bio/Search/Hit/BlastHit.pm ok 465 - POD test for Bio/Search/Hit/BlastPullHit.pm ok 466 - POD test for Bio/Search/Hit/Fasta.pm ok 467 - POD test for Bio/Search/Hit/GenericHit.pm ok 468 - POD test for Bio/Search/Hit/HitFactory.pm ok 469 - POD test for Bio/Search/Hit/HitI.pm ok 470 - POD test for Bio/Search/Hit/hmmer3Hit.pm ok 471 - POD test for Bio/Search/Hit/HMMERHit.pm ok 472 - POD test for Bio/Search/Hit/HmmpfamHit.pm ok 473 - POD test for Bio/Search/Hit/ModelHit.pm ok 474 - POD test for Bio/Search/Hit/PsiBlastHit.pm ok 475 - POD test for Bio/Search/Hit/PullHitI.pm ok 476 - POD test for Bio/Search/HSP/BlastHSP.pm ok 477 - POD test for Bio/Search/HSP/BlastPullHSP.pm ok 478 - POD test for Bio/Search/HSP/FastaHSP.pm ok 479 - POD test for Bio/Search/HSP/GenericHSP.pm ok 480 - POD test for Bio/Search/HSP/HMMERHSP.pm ok 481 - POD test for Bio/Search/HSP/HmmpfamHSP.pm ok 482 - POD test for Bio/Search/HSP/HSPFactory.pm ok 483 - POD test for Bio/Search/HSP/HSPI.pm ok 484 - POD test for Bio/Search/HSP/ModelHSP.pm ok 485 - POD test for Bio/Search/HSP/PsiBlastHSP.pm ok 486 - POD test for Bio/Search/HSP/PSLHSP.pm ok 487 - POD test for Bio/Search/HSP/PullHSPI.pm ok 488 - POD test for Bio/Search/HSP/WABAHSP.pm ok 489 - POD test for Bio/Search/Iteration/GenericIteration.pm ok 490 - POD test for Bio/Search/Iteration/IterationI.pm ok 491 - POD test for Bio/Search/Result/BlastPullResult.pm ok 492 - POD test for Bio/Search/Result/BlastResult.pm ok 493 - POD test for Bio/Search/Result/CrossMatchResult.pm ok 494 - POD test for Bio/Search/Result/GenericResult.pm ok 495 - POD test for Bio/Search/Result/hmmer3Result.pm ok 496 - POD test for Bio/Search/Result/HMMERResult.pm ok 497 - POD test for Bio/Search/Result/HmmpfamResult.pm ok 498 - POD test for Bio/Search/Result/PullResultI.pm ok 499 - POD test for Bio/Search/Result/ResultFactory.pm ok 500 - POD test for Bio/Search/Result/ResultI.pm ok 501 - POD test for Bio/Search/Result/WABAResult.pm ok 502 - POD test for Bio/Search/Tiling/MapTileUtils.pm ok 503 - POD test for Bio/Search/Tiling/MapTiling.pm ok 504 - POD test for Bio/Search/Tiling/TilingI.pm ok 505 - POD test for Bio/SearchIO/axt.pm ok 506 - POD test for Bio/SearchIO/blast.pm ok 507 - POD test for Bio/SearchIO/blasttable.pm ok 508 - POD test for Bio/SearchIO/blastxml.pm ok 509 - POD test for Bio/SearchIO/blast_pull.pm ok 510 - POD test for Bio/SearchIO/cross_match.pm ok 511 - POD test for Bio/SearchIO/erpin.pm ok 512 - POD test for Bio/SearchIO/EventHandlerI.pm ok 513 - POD test for Bio/SearchIO/exonerate.pm ok 514 - POD test for Bio/SearchIO/fasta.pm ok 515 - POD test for Bio/SearchIO/FastHitEventBuilder.pm ok 516 - POD test for Bio/SearchIO/gmap_f9.pm ok 517 - POD test for Bio/SearchIO/hmmer.pm ok 518 - POD test for Bio/SearchIO/hmmer2.pm ok 519 - POD test for Bio/SearchIO/hmmer3.pm ok 520 - POD test for Bio/SearchIO/hmmer_pull.pm ok 521 - POD test for Bio/SearchIO/infernal.pm ok 522 - POD test for Bio/SearchIO/IteratedSearchResultEventBuilder.pm ok 523 - POD test for Bio/SearchIO/megablast.pm ok 524 - POD test for Bio/SearchIO/psl.pm ok 525 - POD test for Bio/SearchIO/rnamotif.pm ok 526 - POD test for Bio/SearchIO/SearchResultEventBuilder.pm ok 527 - POD test for Bio/SearchIO/SearchWriterI.pm ok 528 - POD test for Bio/SearchIO/sim4.pm ok 529 - POD test for Bio/SearchIO/waba.pm ok 530 - POD test for Bio/SearchIO/wise.pm ok 531 - POD test for Bio/SearchIO/Writer/BSMLResultWriter.pm ok 532 - POD test for Bio/SearchIO/Writer/GbrowseGFF.pm ok 533 - POD test for Bio/SearchIO/Writer/HitTableWriter.pm ok 534 - POD test for Bio/SearchIO/Writer/HSPTableWriter.pm ok 535 - POD test for Bio/SearchIO/Writer/HTMLResultWriter.pm ok 536 - POD test for Bio/SearchIO/Writer/ResultTableWriter.pm ok 537 - POD test for Bio/SearchIO/Writer/TextResultWriter.pm ok 538 - POD test for Bio/SearchIO/XML/BlastHandler.pm ok 539 - POD test for Bio/SearchIO/XML/PsiBlastHandler.pm ok 540 - POD test for Bio/Seq/BaseSeqProcessor.pm ok 541 - POD test for Bio/Seq/EncodedSeq.pm ok 542 - POD test for Bio/Seq/LargeLocatableSeq.pm ok 543 - POD test for Bio/Seq/LargePrimarySeq.pm ok 544 - POD test for Bio/Seq/LargeSeq.pm ok 545 - POD test for Bio/Seq/LargeSeqI.pm ok 546 - POD test for Bio/Seq/Meta.pm ok 547 - POD test for Bio/Seq/MetaI.pm ok 548 - POD test for Bio/Seq/PrimaryQual.pm ok 549 - POD test for Bio/Seq/PrimedSeq.pm ok 550 - POD test for Bio/Seq/QualI.pm ok 551 - POD test for Bio/Seq/Quality.pm ok 552 - POD test for Bio/Seq/RichSeq.pm ok 553 - POD test for Bio/Seq/RichSeqI.pm ok 554 - POD test for Bio/Seq/SeqBuilder.pm ok 555 - POD test for Bio/Seq/SeqFactory.pm ok 556 - POD test for Bio/Seq/SeqFastaSpeedFactory.pm ok 557 - POD test for Bio/Seq/SequenceTrace.pm ok 558 - POD test for Bio/Seq/SeqWithQuality.pm ok 559 - POD test for Bio/Seq/SimulatedRead.pm ok 560 - POD test for Bio/Seq/TraceI.pm ok 561 - POD test for Bio/Seq/Meta/Array.pm ok 562 - POD test for Bio/SeqEvolution/DNAPoint.pm ok 563 - POD test for Bio/SeqEvolution/EvolutionI.pm ok 564 - POD test for Bio/SeqEvolution/Factory.pm ok 565 - POD test for Bio/SeqFeature/Amplicon.pm ok 566 - POD test for Bio/SeqFeature/AnnotationAdaptor.pm ok 567 - POD test for Bio/SeqFeature/Collection.pm ok 568 - POD test for Bio/SeqFeature/CollectionI.pm ok 569 - POD test for Bio/SeqFeature/Computation.pm ok 570 - POD test for Bio/SeqFeature/FeaturePair.pm ok 571 - POD test for Bio/SeqFeature/Generic.pm ok 572 - POD test for Bio/SeqFeature/Lite.pm ok 573 - POD test for Bio/SeqFeature/PositionProxy.pm ok 574 - POD test for Bio/SeqFeature/Primer.pm ok 575 - POD test for Bio/SeqFeature/Similarity.pm ok 576 - POD test for Bio/SeqFeature/SimilarityPair.pm ok 577 - POD test for Bio/SeqFeature/SubSeq.pm ok 578 - POD test for Bio/SeqFeature/TypedSeqFeatureI.pm ok 579 - POD test for Bio/SeqFeature/Gene/Exon.pm ok 580 - POD test for Bio/SeqFeature/Gene/ExonI.pm ok 581 - POD test for Bio/SeqFeature/Gene/GeneStructure.pm ok 582 - POD test for Bio/SeqFeature/Gene/GeneStructureI.pm ok 583 - POD test for Bio/SeqFeature/Gene/Intron.pm ok 584 - POD test for Bio/SeqFeature/Gene/NC_Feature.pm ok 585 - POD test for Bio/SeqFeature/Gene/Poly_A_site.pm ok 586 - POD test for Bio/SeqFeature/Gene/Promoter.pm ok 587 - POD test for Bio/SeqFeature/Gene/Transcript.pm ok 588 - POD test for Bio/SeqFeature/Gene/TranscriptI.pm ok 589 - POD test for Bio/SeqFeature/Gene/UTR.pm ok 590 - POD test for Bio/SeqFeature/SiRNA/Oligo.pm ok 591 - POD test for Bio/SeqFeature/SiRNA/Pair.pm ok 592 - POD test for Bio/SeqFeature/Tools/FeatureNamer.pm ok 593 - POD test for Bio/SeqFeature/Tools/IDHandler.pm ok 594 - POD test for Bio/SeqFeature/Tools/TypeMapper.pm ok 595 - POD test for Bio/SeqFeature/Tools/Unflattener.pm ok 596 - POD test for Bio/SeqIO/abi.pm ok 597 - POD test for Bio/SeqIO/ace.pm ok 598 - POD test for Bio/SeqIO/agave.pm ok 599 - POD test for Bio/SeqIO/alf.pm ok 600 - POD test for Bio/SeqIO/asciitree.pm ok 601 - POD test for Bio/SeqIO/bsml.pm ok 602 - POD test for Bio/SeqIO/bsml_sax.pm ok 603 - POD test for Bio/SeqIO/chadoxml.pm ok 604 - POD test for Bio/SeqIO/chaos.pm ok 605 - POD test for Bio/SeqIO/chaosxml.pm ok 606 - POD test for Bio/SeqIO/ctf.pm ok 607 - POD test for Bio/SeqIO/embl.pm ok 608 - POD test for Bio/SeqIO/embldriver.pm ok 609 - POD test for Bio/SeqIO/entrezgene.pm ok 610 - POD test for Bio/SeqIO/excel.pm ok 611 - POD test for Bio/SeqIO/exp.pm ok 612 - POD test for Bio/SeqIO/fasta.pm ok 613 - POD test for Bio/SeqIO/fastq.pm ok 614 - POD test for Bio/SeqIO/flybase_chadoxml.pm ok 615 - POD test for Bio/SeqIO/FTHelper.pm ok 616 - POD test for Bio/SeqIO/game.pm ok 617 - POD test for Bio/SeqIO/gbdriver.pm ok 618 - POD test for Bio/SeqIO/gbxml.pm ok 619 - POD test for Bio/SeqIO/gcg.pm ok 620 - POD test for Bio/SeqIO/genbank.pm ok 621 - POD test for Bio/SeqIO/interpro.pm ok 622 - POD test for Bio/SeqIO/kegg.pm ok 623 - POD test for Bio/SeqIO/largefasta.pm ok 624 - POD test for Bio/SeqIO/lasergene.pm ok 625 - POD test for Bio/SeqIO/locuslink.pm ok 626 - POD test for Bio/SeqIO/mbsout.pm ok 627 - POD test for Bio/SeqIO/metafasta.pm ok 628 - POD test for Bio/SeqIO/msout.pm ok 629 - POD test for Bio/SeqIO/MultiFile.pm ok 630 - POD test for Bio/SeqIO/nexml.pm ok 631 - POD test for Bio/SeqIO/phd.pm ok 632 - POD test for Bio/SeqIO/pir.pm ok 633 - POD test for Bio/SeqIO/pln.pm ok 634 - POD test for Bio/SeqIO/qual.pm ok 635 - POD test for Bio/SeqIO/raw.pm ok 636 - POD test for Bio/SeqIO/scf.pm ok 637 - POD test for Bio/SeqIO/seqxml.pm ok 638 - POD test for Bio/SeqIO/strider.pm ok 639 - POD test for Bio/SeqIO/swiss.pm ok 640 - POD test for Bio/SeqIO/swissdriver.pm ok 641 - POD test for Bio/SeqIO/tab.pm ok 642 - POD test for Bio/SeqIO/table.pm ok 643 - POD test for Bio/SeqIO/tigr.pm ok 644 - POD test for Bio/SeqIO/tigrxml.pm ok 645 - POD test for Bio/SeqIO/tinyseq.pm ok 646 - POD test for Bio/SeqIO/ztr.pm ok 647 - POD test for Bio/SeqIO/game/featHandler.pm ok 648 - POD test for Bio/SeqIO/game/gameHandler.pm ok 649 - POD test for Bio/SeqIO/game/gameSubs.pm ok 650 - POD test for Bio/SeqIO/game/gameWriter.pm ok 651 - POD test for Bio/SeqIO/game/seqHandler.pm ok 652 - POD test for Bio/SeqIO/Handler/GenericRichSeqHandler.pm ok 653 - POD test for Bio/SeqIO/tinyseq/tinyseqHandler.pm ok 654 - POD test for Bio/Structure/Atom.pm ok 655 - POD test for Bio/Structure/Chain.pm ok 656 - POD test for Bio/Structure/Entry.pm ok 657 - POD test for Bio/Structure/IO.pm ok 658 - POD test for Bio/Structure/Model.pm ok 659 - POD test for Bio/Structure/Residue.pm ok 660 - POD test for Bio/Structure/StructureI.pm ok 661 - POD test for Bio/Structure/IO/pdb.pm ok 662 - POD test for Bio/Structure/SecStr/DSSP/Res.pm ok 663 - POD test for Bio/Structure/SecStr/STRIDE/Res.pm ok 664 - POD test for Bio/Symbol/Alphabet.pm ok 665 - POD test for Bio/Symbol/AlphabetI.pm ok 666 - POD test for Bio/Symbol/DNAAlphabet.pm ok 667 - POD test for Bio/Symbol/ProteinAlphabet.pm ok 668 - POD test for Bio/Symbol/Symbol.pm ok 669 - POD test for Bio/Symbol/SymbolI.pm ok 670 - POD test for Bio/Taxonomy/FactoryI.pm ok 671 - POD test for Bio/Taxonomy/Node.pm ok 672 - POD test for Bio/Taxonomy/Taxon.pm ok 673 - POD test for Bio/Taxonomy/Tree.pm ok 674 - POD test for Bio/Tools/AlignFactory.pm ok 675 - POD test for Bio/Tools/AmpliconSearch.pm ok 676 - POD test for Bio/Tools/AnalysisResult.pm ok 677 - POD test for Bio/Tools/Blat.pm ok 678 - POD test for Bio/Tools/CodonTable.pm ok 679 - POD test for Bio/Tools/Coil.pm ok 680 - POD test for Bio/Tools/dpAlign.pm ok 681 - POD test for Bio/Tools/ECnumber.pm ok 682 - POD test for Bio/Tools/EPCR.pm ok 683 - POD test for Bio/Tools/Eponine.pm ok 684 - POD test for Bio/Tools/ERPIN.pm ok 685 - POD test for Bio/Tools/Est2Genome.pm ok 686 - POD test for Bio/Tools/ESTScan.pm ok 687 - POD test for Bio/Tools/Fgenesh.pm ok 688 - POD test for Bio/Tools/FootPrinter.pm ok 689 - POD test for Bio/Tools/Gel.pm ok 690 - POD test for Bio/Tools/Geneid.pm ok 691 - POD test for Bio/Tools/Genemark.pm ok 692 - POD test for Bio/Tools/Genewise.pm ok 693 - POD test for Bio/Tools/Genomewise.pm ok 694 - POD test for Bio/Tools/Genscan.pm ok 695 - POD test for Bio/Tools/GFF.pm ok 696 - POD test for Bio/Tools/Glimmer.pm ok 697 - POD test for Bio/Tools/Grail.pm ok 698 - POD test for Bio/Tools/GuessSeqFormat.pm ok 699 - POD test for Bio/Tools/Hmmpfam.pm ok 700 - POD test for Bio/Tools/Infernal.pm ok 701 - POD test for Bio/Tools/ipcress.pm ok 702 - POD test for Bio/Tools/isPcr.pm ok 703 - POD test for Bio/Tools/IUPAC.pm ok 704 - POD test for Bio/Tools/Lucy.pm ok 705 - POD test for Bio/Tools/Match.pm ok 706 - POD test for Bio/Tools/MZEF.pm ok 707 - POD test for Bio/Tools/OddCodes.pm ok 708 - POD test for Bio/Tools/pICalculator.pm ok 709 - POD test for Bio/Tools/Primer3.pm ok 710 - POD test for Bio/Tools/Prints.pm ok 711 - POD test for Bio/Tools/Profile.pm ok 712 - POD test for Bio/Tools/Promoterwise.pm ok 713 - POD test for Bio/Tools/PrositeScan.pm ok 714 - POD test for Bio/Tools/Protparam.pm ok 715 - POD test for Bio/Tools/Pseudowise.pm ok 716 - POD test for Bio/Tools/pSW.pm ok 717 - POD test for Bio/Tools/QRNA.pm ok 718 - POD test for Bio/Tools/RandomDistFunctions.pm ok 719 - POD test for Bio/Tools/RepeatMasker.pm ok 720 - POD test for Bio/Tools/RNAMotif.pm ok 721 - POD test for Bio/Tools/Seg.pm ok 722 - POD test for Bio/Tools/SeqPattern.pm ok 723 - POD test for Bio/Tools/SeqStats.pm ok 724 - POD test for Bio/Tools/SeqWords.pm ok 725 - POD test for Bio/Tools/Sigcleave.pm ok 726 - POD test for Bio/Tools/Signalp.pm ok 727 - POD test for Bio/Tools/SiRNA.pm ok 728 - POD test for Bio/Tools/TandemRepeatsFinder.pm ok 729 - POD test for Bio/Tools/TargetP.pm ok 730 - POD test for Bio/Tools/Tmhmm.pm ok 731 - POD test for Bio/Tools/tRNAscanSE.pm ok 732 - POD test for Bio/Tools/Alignment/Consed.pm ok 733 - POD test for Bio/Tools/Alignment/Trim.pm ok 734 - POD test for Bio/Tools/Analysis/SimpleAnalysisBase.pm ok 735 - POD test for Bio/Tools/Analysis/DNA/ESEfinder.pm ok 736 - POD test for Bio/Tools/Analysis/Protein/Domcut.pm ok 737 - POD test for Bio/Tools/Analysis/Protein/ELM.pm ok 738 - POD test for Bio/Tools/Analysis/Protein/GOR4.pm ok 739 - POD test for Bio/Tools/Analysis/Protein/HNN.pm ok 740 - POD test for Bio/Tools/Analysis/Protein/Mitoprot.pm ok 741 - POD test for Bio/Tools/Analysis/Protein/NetPhos.pm ok 742 - POD test for Bio/Tools/Analysis/Protein/Scansite.pm ok 743 - POD test for Bio/Tools/Analysis/Protein/Sopma.pm ok 744 - POD test for Bio/Tools/EMBOSS/Palindrome.pm ok 745 - POD test for Bio/Tools/HMMER/Domain.pm ok 746 - POD test for Bio/Tools/HMMER/Results.pm ok 747 - POD test for Bio/Tools/HMMER/Set.pm ok 748 - POD test for Bio/Tools/Phylo/Gerp.pm ok 749 - POD test for Bio/Tools/Phylo/Gumby.pm ok 750 - POD test for Bio/Tools/Phylo/Molphy.pm ok 751 - POD test for Bio/Tools/Phylo/PAML.pm ok 752 - POD test for Bio/Tools/Phylo/Molphy/Result.pm ok 753 - POD test for Bio/Tools/Phylo/PAML/Codeml.pm ok 754 - POD test for Bio/Tools/Phylo/PAML/ModelResult.pm ok 755 - POD test for Bio/Tools/Phylo/PAML/Result.pm ok 756 - POD test for Bio/Tools/Phylo/Phylip/ProtDist.pm ok 757 - POD test for Bio/Tools/Prediction/Exon.pm ok 758 - POD test for Bio/Tools/Prediction/Gene.pm ok 759 - POD test for Bio/Tools/Primer/AssessorI.pm ok 760 - POD test for Bio/Tools/Primer/Feature.pm ok 761 - POD test for Bio/Tools/Primer/Pair.pm ok 762 - POD test for Bio/Tools/Primer/Assessor/Base.pm ok 763 - POD test for Bio/Tools/Run/GenericParameters.pm ok 764 - POD test for Bio/Tools/Run/hmmer3.pm (no pod) ok 765 - POD test for Bio/Tools/Run/ParametersI.pm ok 766 - POD test for Bio/Tools/Run/RemoteBlast.pm ok 767 - POD test for Bio/Tools/Run/StandAloneBlast.pm ok 768 - POD test for Bio/Tools/Run/StandAloneNCBIBlast.pm ok 769 - POD test for Bio/Tools/Run/StandAloneWUBlast.pm ok 770 - POD test for Bio/Tools/Run/WrapperBase.pm ok 771 - POD test for Bio/Tools/Run/WrapperBase/CommandExts.pm ok 772 - POD test for Bio/Tools/SeqPattern/Backtranslate.pm ok 773 - POD test for Bio/Tools/Signalp/ExtendedSignalp.pm ok 774 - POD test for Bio/Tools/Sim4/Exon.pm ok 775 - POD test for Bio/Tools/Sim4/Results.pm ok 776 - POD test for Bio/Tools/SiRNA/Ruleset/saigo.pm ok 777 - POD test for Bio/Tools/SiRNA/Ruleset/tuschl.pm ok 778 - POD test for Bio/Tools/Spidey/Exon.pm ok 779 - POD test for Bio/Tools/Spidey/Results.pm ok 780 - POD test for Bio/Tree/AlleleNode.pm ok 781 - POD test for Bio/Tree/AnnotatableNode.pm ok 782 - POD test for Bio/Tree/Compatible.pm ok 783 - POD test for Bio/Tree/DistanceFactory.pm ok 784 - POD test for Bio/Tree/Node.pm ok 785 - POD test for Bio/Tree/NodeI.pm ok 786 - POD test for Bio/Tree/NodeNHX.pm ok 787 - POD test for Bio/Tree/RandomFactory.pm ok 788 - POD test for Bio/Tree/Statistics.pm ok 789 - POD test for Bio/Tree/Tree.pm ok 790 - POD test for Bio/Tree/TreeFunctionsI.pm ok 791 - POD test for Bio/Tree/TreeI.pm ok 792 - POD test for Bio/Tree/Draw/Cladogram.pm ok 793 - POD test for Bio/TreeIO/cluster.pm ok 794 - POD test for Bio/TreeIO/lintree.pm ok 795 - POD test for Bio/TreeIO/newick.pm ok 796 - POD test for Bio/TreeIO/NewickParser.pm ok 797 - POD test for Bio/TreeIO/nexml.pm ok 798 - POD test for Bio/TreeIO/nexus.pm ok 799 - POD test for Bio/TreeIO/nhx.pm ok 800 - POD test for Bio/TreeIO/pag.pm ok 801 - POD test for Bio/TreeIO/phyloxml.pm ok 802 - POD test for Bio/TreeIO/svggraph.pm ok 803 - POD test for Bio/TreeIO/tabtree.pm ok 804 - POD test for Bio/TreeIO/TreeEventBuilder.pm ok 805 - POD test for Bio/Variation/AAChange.pm ok 806 - POD test for Bio/Variation/AAReverseMutate.pm ok 807 - POD test for Bio/Variation/Allele.pm ok 808 - POD test for Bio/Variation/DNAMutation.pm ok 809 - POD test for Bio/Variation/IO.pm ok 810 - POD test for Bio/Variation/RNAChange.pm ok 811 - POD test for Bio/Variation/SeqDiff.pm ok 812 - POD test for Bio/Variation/SNP.pm ok 813 - POD test for Bio/Variation/VariantI.pm ok 814 - POD test for Bio/Variation/IO/flat.pm ok 815 - POD test for Bio/Variation/IO/xml.pm ok 816 - POD test for scripts/Bio-DB-GFF/bp_bulk_load_gff.pl ok 817 - POD test for scripts/Bio-DB-GFF/bp_fast_load_gff.pl ok 818 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff.pl ok 819 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff3.pl ok 820 - POD test for scripts/Bio-DB-GFF/bp_generate_histogram.pl ok 821 - POD test for scripts/Bio-DB-GFF/bp_load_gff.pl ok 822 - POD test for scripts/Bio-DB-GFF/bp_meta_gff.pl ok 823 - POD test for scripts/Bio-DB-GFF/bp_process_gadfly.pl ok 824 - POD test for scripts/Bio-DB-GFF/bp_process_sgd.pl ok 825 - POD test for scripts/Bio-DB-GFF/bp_process_wormbase.pl ok 826 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl (no pod) ok 827 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl (no pod) ok 828 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl ok 829 - POD test for scripts/das/bp_das_server.pl (no pod) ok 830 - POD test for scripts/DB/bp_biofetch_genbank_proxy.pl ok 831 - POD test for scripts/DB/bp_bioflat_index.pl ok 832 - POD test for scripts/DB/bp_biogetseq.pl ok 833 - POD test for scripts/DB/bp_flanks.pl ok 834 - POD test for scripts/DB-HIV/bp_hivq.pl ok 835 - POD test for scripts/index/bp_fetch.pl ok 836 - POD test for scripts/index/bp_index.pl ok 837 - POD test for scripts/index/bp_seqret.pl ok 838 - POD test for scripts/popgen/bp_composite_LD.pl ok 839 - POD test for scripts/popgen/bp_heterogeneity_test.pl ok 840 - POD test for scripts/searchio/bp_fastam9_to_table.pl ok 841 - POD test for scripts/searchio/bp_filter_search.pl ok 842 - POD test for scripts/searchio/bp_hmmer_to_table.pl ok 843 - POD test for scripts/searchio/bp_parse_hmmsearch.pl ok 844 - POD test for scripts/searchio/bp_search2table.pl ok 845 - POD test for scripts/seq/bp_extract_feature_seq.pl ok 846 - POD test for scripts/seq/bp_make_mrna_protein.pl ok 847 - POD test for scripts/seq/bp_seqconvert.pl ok 848 - POD test for scripts/seq/bp_seqcut.pl ok 849 - POD test for scripts/seq/bp_seqpart.pl ok 850 - POD test for scripts/seq/bp_seqretsplit.pl ok 851 - POD test for scripts/seq/bp_split_seq.pl ok 852 - POD test for scripts/seq/bp_translate_seq.pl ok 853 - POD test for scripts/seq/bp_unflatten_seq.pl ok 854 - POD test for scripts/seqstats/bp_aacomp.pl ok 855 - POD test for scripts/seqstats/bp_chaos_plot.pl ok 856 - POD test for scripts/seqstats/bp_gccalc.pl ok 857 - POD test for scripts/seqstats/bp_oligo_count.pl ok 858 - POD test for scripts/taxa/bp_classify_hits_kingdom.pl ok 859 - POD test for scripts/taxa/bp_local_taxonomydb_query.pl ok 860 - POD test for scripts/taxa/bp_query_entrez_taxa.pl ok 861 - POD test for scripts/taxa/bp_taxid4species.pl ok 862 - POD test for scripts/taxa/bp_taxonomy2tree.pl ok 863 - POD test for scripts/tree/bp_blast2tree.pl ok 864 - POD test for scripts/tree/bp_nexus2nh.pl ok 865 - POD test for scripts/tree/bp_tree2pag.pl ok 866 - POD test for scripts/utilities/bp_dbsplit.pl ok 867 - POD test for scripts/utilities/bp_download_query_genbank.pl ok 868 - POD test for scripts/utilities/bp_mask_by_search.pl ok 869 - POD test for scripts/utilities/bp_mrtrans.pl ok 870 - POD test for scripts/utilities/bp_mutate.pl ok 871 - POD test for scripts/utilities/bp_netinstall.pl ok 872 - POD test for scripts/utilities/bp_nrdb.pl ok 873 - POD test for scripts/utilities/bp_pairwise_kaks.pl ok 874 - POD test for scripts/utilities/bp_remote_blast.pl ok 875 - POD test for scripts/utilities/bp_revtrans-motif.pl ok 876 - POD test for scripts/utilities/bp_search2alnblocks.pl ok 877 - POD test for scripts/utilities/bp_search2BSML.pl ok 878 - POD test for scripts/utilities/bp_search2gff.pl ok 879 - POD test for scripts/utilities/bp_search2tribe.pl ok 880 - POD test for scripts/utilities/bp_seq_length.pl ok 881 - POD test for scripts/utilities/bp_sreformat.pl ok 882 - POD test for examples/bioperl.pl (no pod) ok 883 - POD test for examples/generate_random_seq.pl (no pod) ok 884 - POD test for examples/longorf.pl ok 885 - POD test for examples/make_primers.pl (no pod) ok 886 - POD test for examples/revcom_dir.pl (no pod) ok 887 - POD test for examples/rev_and_trans.pl (no pod) ok 888 - POD test for examples/subsequence.cgi (no pod) ok 889 - POD test for examples/align/aligntutorial.pl (no pod) ok 890 - POD test for examples/align/align_on_codons.pl (no pod) ok 891 - POD test for examples/align/clustalw.pl (no pod) ok 892 - POD test for examples/align/FastAlign.pl ok 893 - POD test for examples/align/simplealign.pl (no pod) ok 894 - POD test for examples/Bio-DB-GFF/load_ucsc.pl (no pod) ok 895 - POD test for examples/cluster/dbsnp.pl (no pod) ok 896 - POD test for examples/contributed/nmrpdb_parse.pl (no pod) ok 897 - POD test for examples/contributed/prosite2perl.pl (no pod) ok 898 - POD test for examples/contributed/rebase2list.pl (no pod) ok 899 - POD test for examples/db/dbfetch ok 900 - POD test for examples/db/est_tissue_query.pl (no pod) ok 901 - POD test for examples/db/gb2features.pl (no pod) ok 902 - POD test for examples/db/getGenBank.pl (no pod) ok 903 - POD test for examples/db/get_seqs.pl (no pod) ok 904 - POD test for examples/db/rfetch.pl (no pod) ok 905 - POD test for examples/db/use_registry.pl (no pod) ok 906 - POD test for examples/liveseq/change_gene.pl (no pod) ok 907 - POD test for examples/popgen/parse_calc_stats.pl (no pod) ok 908 - POD test for examples/quality/svgtrace.pl (no pod) ok 909 - POD test for examples/root/exceptions1.pl (no pod) ok 910 - POD test for examples/root/exceptions2.pl (no pod) ok 911 - POD test for examples/root/exceptions3.pl (no pod) ok 912 - POD test for examples/root/exceptions4.pl (no pod) ok 913 - POD test for examples/root/lib/TestInterface.pm ok 914 - POD test for examples/root/lib/TestObject.pm ok 915 - POD test for examples/searchio/blast_example.pl (no pod) ok 916 - POD test for examples/searchio/custom_writer.pl (no pod) ok 917 - POD test for examples/searchio/hitwriter.pl (no pod) ok 918 - POD test for examples/searchio/hspwriter.pl (no pod) ok 919 - POD test for examples/searchio/htmlwriter.pl (no pod) ok 920 - POD test for examples/searchio/psiblast_features.pl (no pod) ok 921 - POD test for examples/searchio/psiblast_iterations.pl (no pod) ok 922 - POD test for examples/searchio/rawwriter.pl (no pod) ok 923 - POD test for examples/searchio/resultwriter.pl (no pod) ok 924 - POD test for examples/searchio/waba2gff.pl (no pod) ok 925 - POD test for examples/searchio/waba2gff3.pl ok 926 - POD test for examples/sirna/rnai_finder.cgi ok 927 - POD test for examples/structure/structure-io.pl (no pod) ok 928 - POD test for examples/tk/gsequence.pl (no pod) ok 929 - POD test for examples/tk/hitdisplay.pl (no pod) ok 930 - POD test for examples/tools/extract_genes.pl ok 931 - POD test for examples/tools/gb_to_gff.pl (no pod) ok 932 - POD test for examples/tools/gff2ps.pl ok 933 - POD test for examples/tools/parse_codeml.pl (no pod) ok 934 - POD test for examples/tools/psw.pl (no pod) ok 935 - POD test for examples/tools/reverse-translate.pl ok 936 - POD test for examples/tools/run_genscan.pl (no pod) ok 937 - POD test for examples/tools/run_primer3.pl ok 938 - POD test for examples/tools/seq_pattern.pl (no pod) ok 939 - POD test for examples/tools/standaloneblast.pl (no pod) ok 940 - POD test for examples/tree/paup2phylip.pl (no pod) ok 941 - POD test for maintenance/authors.pl ok 942 - POD test for maintenance/check_NAME.pl ok 943 - POD test for maintenance/check_URLs.pl ok 944 - POD test for maintenance/cvs2cl_by_file.pl ok 945 - POD test for maintenance/dependencies.pl ok 946 - POD test for maintenance/deprecated.pl ok 947 - POD test for maintenance/find_mod_deps.pl ok 948 - POD test for maintenance/modules.pl ok 949 - POD test for maintenance/module_usage.pl (no pod) ok 950 - POD test for maintenance/ncbi_blast_switches.pl (no pod) ok 951 - POD test for maintenance/pod.pl ok 952 - POD test for maintenance/symlink_script.pl ok 953 - POD test for maintenance/version.pl ok t/PopGen/Coalescent.t .................. 1..13 ok 1 - use Bio::PopGen::Simulation::Coalescent; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 - pi ok 7 - theta ok 8 - tajimaD ok 9 - all the mutations should be polymorphic (by definition) ok 10 - fu and li D ok 11 - fu and li D* ok 12 - fu and li F ok 13 - fu and li F ok t/PopGen/HtSNP.t ....................... 1..8 ok 1 - use Bio::PopGen::HtSNP; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/PopGen/MK.t .......................... 1..46 ok 1 - use Bio::AlignIO; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::PopGen::Utilities; ok 4 - An object of class 'Bio::PopGen::Statistics' isa 'Bio::PopGen::Statistics' ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 6 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population' ok 7 - Marker Names ok 8 - Number of Inds ok 9 - number of ingroup sequences ok 10 - number of outgroup1 sequences ok 11 - number of outgroup2 sequences ok 12 - NSpoly ok 13 - NSfixed ok 14 - Spoly ok 15 - Sfixed ok 16 - McDonald Kreitman ok 17 - NSpoly ok 18 - NSfixed ok 19 - Spoly ok 20 - Sfixed ok 21 - McDonald Kreitman ok 22 - NSpoly ok 23 - NSfixed ok 24 - Spoly ok 25 - Sfixed ok 26 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 27 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population' ok 28 - Marker Names ok 29 - Number of Inds ok 30 - number of ingroup sequences ok 31 - number of outgroup1 sequences ok 32 - number of outgroup2 sequences ok 33 - NSpoly ok 34 - NSfixed ok 35 - Spoly ok 36 - Sfixed ok 37 - McDonald Kreitman ok 38 - NSpoly ok 39 - NSfixed ok 40 - Spoly ok 41 - Sfixed ok 42 - McDonald Kreitman ok 43 - NSpoly ok 44 - NSfixed ok 45 - Spoly ok 46 - Sfixed ok t/PopGen/PopGen.t ...................... 1..105 ok 1 - use IO::String; ok 2 - use Bio::PopGen::Individual; ok 3 - use Bio::PopGen::Genotype; ok 4 - use Bio::PopGen::Population; ok 5 - use Bio::PopGen::IO; ok 6 - use Bio::PopGen::PopStats; ok 7 - use Bio::AlignIO; ok 8 - use Bio::PopGen::Statistics; ok 9 - use Bio::PopGen::Utilities; ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 - mrsa,mssa aflp1 ok 41 - all pops, aflp1 ok 42 - mrsa,envpop aflp1,aflp2 ok 43 ok 44 ok 45 ok 46 - mssa,mrsa all_bands ok 47 - env,mssa mkr1 ok 48 - env,mssa,mrsa all bands ok 49 - env,mssa,mrsa mkr2 ok 50 - mrsa,nc all_bands ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 - Pi on 3-allele data ok 105 - Theta on 3-allele data ok t/PopGen/PopGenSims.t .................. 1..23 ok 1 - use Bio::PopGen::Simulation::GeneticDrift; ok 2 - Allele freqs should sum to 1 ok 3 - Allele freqs should sum to 1 ok 4 - Allele freqs should sum to 1 ok 5 - Allele freqs should sum to 1 ok 6 - Allele freqs should sum to 1 ok 7 - Allele freqs should sum to 1 ok 8 - Allele freqs should sum to 1 ok 9 - Allele freqs should sum to 1 ok 10 - Allele freqs should sum to 1 ok 11 - Allele freqs should sum to 1 ok 12 ok 13 - All frequencies should be <= 1 ok 14 - Allele freqs should sum to 1 ok 15 - Allele freqs should sum to 1 ok 16 - Allele freqs should sum to 1 ok 17 - Allele freqs should sum to 1 ok 18 - Allele freqs should sum to 1 ok 19 - Allele freqs should sum to 1 ok 20 - Allele freqs should sum to 1 ok 21 - Allele freqs should sum to 1 ok 22 - Allele freqs should sum to 1 ok 23 - Allele freqs should sum to 1 ok t/PopGen/TagHaplotype.t ................ 1..3 ok 1 - use Bio::PopGen::TagHaplotype; ok 2 ok 3 ok t/RemoteDB/BioFetch.t .................. skipped: Network tests have not been requested t/RemoteDB/CUTG.t ...................... 1..37 ok 1 - use Bio::DB::CUTG; ok 2 - use Bio::CodonUsage::Table; ok 3 - use Bio::CodonUsage::IO; ok 4 - use Bio::SeqIO; ok 5 - use Bio::Tools::SeqStats; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok t/RemoteDB/EMBL.t ...................... skipped: Network tests have not been requested t/RemoteDB/EntrezGene.t ................ skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/RemoteDB/GenBank.t ................... skipped: Network tests have not been requested t/RemoteDB/GenPept.t ................... skipped: Network tests have not been requested t/RemoteDB/HIV/HIV.t ................... 1..30 ok 1 - use Bio::DB::HIV; ok 2 - use Bio::DB::WebDBSeqI; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - An object of class 'Bio::DB::HIV' isa 'Bio::DB::HIV' ok 5 - An object of class 'Bio::DB::HIV' isa 'Bio::Root::Root' ok 6 - Bio::DB::HIV->can(...) ok 7 - Bio::DB::HIV->can(...) ok 8 - Bio::DB::HIV->can(...) ok 9 - lanl_base set in default object ok 10 - map_db set in default object ok 11 - make_search_if set in default object ok 12 - search_ set in default object ok 13 - url_base_address set in default object ok 14 - default sequence request format (fasta) ok 15 - sorry till implemented ok 16 - sorry till implemented ok 17 - HIVQuery type exception check ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVAnnotProcessor.t ..... 1..11 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::DB::HIV::HIVAnnotProcessor' ok 5 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::Root::Root' ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...) ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query') ok 8 - bad type set exception ok 9 - attach stream ok 10 - write exception ok 11 - access stream ok t/RemoteDB/HIV/HIVQuery.t .............. 1..41 ok 1 - use Bio::DB::Query::HIVQuery; ok 2 - use Bio::DB::HIV; ok 3 - use Bio::Annotation::Collection; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::Reference; ok 6 - use Bio::DB::HIV::HIVQueryHelper; ok 7 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::DB::Query::HIVQuery' ok 8 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::Root::Root' ok 9 - Bio::DB::Query::HIVQuery->can(...) ok 10 - Bio::DB::Query::HIVQuery->can(...) ok 11 - Bio::DB::Query::HIVQuery->can(...) ok 12 - _map_db_uri set in default object ok 13 - _make_search_if_uri set in default object ok 14 - _search_uri set in default object ok 15 - _schema_file set in default object ok 16 - _run_option set in default object ok 17 - annotations container available ok 18 - query syntax check 1 ok 19 - query syntax check 2 ok 20 - query syntax check 3 ok 21 - query parser check ok 22 - multiquery parse check ok 23 # skip The optional module HTML::Parser generated the following error: # HTML::Parser object version 3.69 does not match bootstrap parameter 3.71 at C:\cpanfly-5.16\var\megalib/XSLoader.pm line 92. # Compilation failed in require at (eval 108) line 1. # ok 24 # skip The optional module HTML::Parser generated the following error: # HTML::Parser object version 3.69 does not match bootstrap parameter 3.71 at C:\cpanfly-5.16\var\megalib/XSLoader.pm line 92. # Compilation failed in require at (eval 108) line 1. # ok 25 # skip The optional module HTML::Parser generated the following error: # HTML::Parser object version 3.69 does not match bootstrap parameter 3.71 at C:\cpanfly-5.16\var\megalib/XSLoader.pm line 92. # Compilation failed in require at (eval 108) line 1. # ok 26 - bad field exception check ok 27 - bad match data exception check ok 28 - empty field not ok exception check ok 29 - uninitialized schema exception check ok 30 - query not run (level 1) warning check ok 31 - query not run (level 2) warning check ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVQueryHelper.t ........ 1..40 ok 1 - use Bio::DB::HIV::HIVQueryHelper; ok 2 - An object of class 'HIVSchema' isa 'HIVSchema' ok 3 - An object of class 'QRY' isa 'QRY' ok 4 - An object of class 'R' isa 'R' ok 5 - An object of class 'Q' isa 'Q' ok 6 - schema load ok 7 - HIVSchema->can(...) ok 8 - fields complete ok 9 - tables complete ok 10 - aliases complete ok 11 ok 12 - test field syntax ok ok 13 - test field syntax ok ok 14 - test alias by field name ok 15 - correct primary key for SequenceEntry ok 16 - correct number of foreign keys for AUthor ok 17 - correct foreign table for au_pub_id ok 18 - correct annotation key hash ok 19 - QRY->can(...) ok 20 - R->can(...) ok 21 - Q->can(...) ok 22 - null QRY ok 23 - null R (request object) ok 24 - null Q (atomic query object) ok 25 - R obj create and init (1) ok 26 - R obj create and init (2) ok 27 - R::In ok 28 - !R::In ok 29 - R::Eq ok 30 - QRY obj create and init (1) ok 31 - QRY obj create and init (2) ok 32 - QRY obj create and init (3) ok 33 - QRY overload | ok 34 - QRY overload & ok 35 - QRY nontrivial & ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]} ok 37 - make: 2 queries returned ok 38 - {annotation fields} parsed correctly ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]} ok 40 - above query is null ok t/RemoteDB/MeSH.t ...................... skipped: Network tests have not been requested t/RemoteDB/Query/GenBank.t ............. skipped: Network tests have not been requested t/RemoteDB/RefSeq.t .................... 1..16 ok 1 - use Bio::DB::RefSeq; ok 2 - use Bio::DB::GenBank; ok 3 - use Bio::DB::EMBL; ok 4 ok 5 ok 6 ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok t/RemoteDB/SeqHound.t .................. skipped: Network tests have not been requested t/RemoteDB/SeqRead_fail.t .............. skipped: Network tests have not been requested t/RemoteDB/SeqVersion.t ................ skipped: The optional module HTML::TableExtract generated the following error: t/RemoteDB/SwissProt.t ................. skipped: Network tests have not been requested t/RemoteDB/Taxonomy.t .................. skipped: The optional module DB_File (or dependencies thereof) was not installed t/Restriction/Analysis-refac.t ......... 1..91 ok 1 - use Bio::Restriction::IO; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Restriction::EnzymeCollection; ok 4 - use Bio::Restriction::Enzyme; ok 5 - read withrefm file ok 6 - parse withrefm file ok 7 - HindIII: nonambiguous intrasite cutter ok 8 - AarI: nonambiguous extrasite cutter ok 9 - AasI: ambiguous intrasite cutter ok 10 - BceSI: ambiguous extrasite cutter ok 11 - AjuI: cutter with central recog site ok 12 - TaqII: multi-extrasite cutter ok 13 ok 14 - HindIII plus ok 15 - HindIII minus ok 16 - AasI plus ok 17 - AasI minus ok 18 - AarI plus ok 19 - AarI minus ok 20 - BceSI plus ok 21 - BceSI minus ok 22 - AjuI plus ok 23 - AjuI minus ok 24 - TaqII plus ok 25 - TaqII minus ok 26 - build real B:R::Analysis object ok 27 - 13 fragments ok 28 - circularize ok 29 - recut ok 30 - circ: AasI # site at origin ok 31 - circ: still 13 fragments (cut site at origin) ok 32 - use Bio::Restriction::IO; ok 33 - use Bio::Restriction::Analysis; ok 34 - read withrefm file ok 35 - parse withrefm file ok 36 - Collection initiated ok 37 - AbeI: found ok into collection ok 38 - AccBSI: found ok into collection ok 39 - AciI: found ok into collection ok 40 - Asp26HI: found ok into collection ok 41 - BmgBI: found ok into collection ok 42 - AbeI plus ok 43 - AbeI minus ok 44 - AbeI fragment ok 45 - AbeI positions ok 46 - AbeI Overhang ok 47 - AbeI name ok 48 - AbeI site ok 49 - AbeI revcom_site ok 50 - AbeI cut ok 51 - AbeI complementary_cut ok 52 - AccBSI plus ok 53 - AccBSI minus ok 54 - AccBSI fragment ok 55 - AccBSI positions ok 56 - AccBSI Overhang ok 57 - AccBSI name ok 58 - AccBSI site ok 59 - AccBSI revcom_site ok 60 - AccBSI cut ok 61 - AccBSI complementary_cut ok 62 - AciI plus ok 63 - AciI minus ok 64 - AciI fragment ok 65 - AciI positions ok 66 - AciI Overhang ok 67 - AciI name ok 68 - AciI site ok 69 - AciI revcom_site ok 70 - AciI cut ok 71 - AciI complementary_cut ok 72 - Asp26HI plus ok 73 - Asp26HI minus ok 74 - Asp26HI fragment ok 75 - Asp26HI positions ok 76 - Asp26HI Overhang ok 77 - Asp26HI name ok 78 - Asp26HI site ok 79 - Asp26HI revcom_site ok 80 - Asp26HI cut ok 81 - Asp26HI complementary_cut ok 82 - BmgBI plus ok 83 - BmgBI minus ok 84 - BmgBI fragment ok 85 - BmgBI positions ok 86 - BmgBI Overhang ok 87 - BmgBI name ok 88 - BmgBI site ok 89 - BmgBI revcom_site ok 90 - BmgBI cut ok 91 - BmgBI complementary_cut ok t/Restriction/Analysis.t ............... 1..182 ok 1 - use Bio::Restriction::Enzyme; ok 2 - use Bio::Restriction::Enzyme::MultiCut; ok 3 - use Bio::Restriction::Enzyme::MultiSite; ok 4 - use Bio::Restriction::EnzymeCollection; ok 5 - use Bio::Restriction::Analysis; ok 6 - use Bio::SeqIO; ok 7 ok 8 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::EnzymeI' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - bug 2179 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI' ok 77 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI' ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI' ok 88 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI' ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme' ok 100 ok 101 ok 102 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme' ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 - number of unique cutters ok 119 - number of RsaI fragments ok 120 - number of maximum cutters ok 121 - number of zero cutters ok 122 - number of cutters ok 123 - number of 3x cutters ok 124 - 4 MseI fragments ok 125 - 3 MseI cut sites ok 126 - expected 2 PspEI fragments ok 127 ok 128 ok 129 - expected 2 sizes for PspEI ok 130 ok 131 - expected 2 sizes for PspEI ok 132 ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut ok 134 ok 135 ok 136 - number of RsaI fragments ok 137 - 3 circular MseI fragments ok 138 - 3 circular MseI cut sites ok 139 - number for AciI a non-palindromic enzyme ok 140 - 1 fragment for MwoI as it cuts across the circ point ok 141 ok 142 ok 143 ok 144 ok 145 - 7 fragments in the multiple digest ok 146 - 7 positions in the multiple digest ok 147 - 7 sizes in the multiple digest ok 148 ok 149 - expected 9 cuts for HindI ok 150 - expect 9 fragment maps for HindI ok 151 - sequence for GT ok 152 - start at 40 ok 153 - end at 41 ok 154 - sequence for GGATTAAAAAAAGAGT ok 155 - start at 42 ok 156 - end at 57 ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT ok 158 - start at 58 ok 159 - end at 92 ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA ok 161 - start at 93 ok 162 - end at 123 ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA ok 164 - start at 124 ok 165 - end at 155 ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA ok 167 - start at 156 ok 168 - end at 181 ok 169 - sequence for CAACATCCATGAAACGCATTAGCA ok 170 - start at 182 ok 171 - end at 205 ok 172 - sequence for CCA ok 173 - start at 206 ok 174 - end at 208 ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT ok 176 - start at 209 ok 177 - end at 39 ok 178 ok 179 - bug 2139 ok 180 - number of HindIII fragments ok 181 - number of EcoRI fragments ok 182 - number of RsaI fragments ok t/Restriction/Gel.t .................... 1..9 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Tools::Gel; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/Restriction/IO.t ..................... 1..18 ok 1 - use Bio::Restriction::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT! # Failed (TODO) test at t/Restriction/IO.t line 31. ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok t/Root/Exception.t ..................... 1..8 ok 1 - use TestObject; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Root/HTTPget.t ....................... skipped: Network tests have not been requested t/Root/IO.t ............................ 1..154 ok 1 - use Bio::Root::IO; ok 2 ok 3 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 4 - Throw ok 5 - threw Regexp ((?^:Testing throw)) ok 6 - Warn ok 7 - threw Regexp ((?^:Testing throw)) ok 8 - Stack trace ok 9 ok 10 - Verbosity ok 11 ok 12 ok 13 ok 14 - executable file ok 15 - non-executable file ok 16 - executable dir ok 17 ok 18 ok 19 ok 20 - Read from file ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - Write to file ok 31 ok 32 ok 33 ok 34 ok 35 - Read+write to file ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - Read from File::Temp handle ok 47 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 48 - is a write handle ok 49 - no warnings in ->close() ok 50 ok 51 - Exclusive arguments ok 52 - threw Regexp ((?^:Input file given twice)) ok 53 - threw Regexp ((?^:File or filehandle provided with -string)) ok 54 - threw Regexp ((?^:Providing both a file and a filehandle for reading)) ok 55 - threw Regexp ((?^:File or filehandle provided with -string)) ok 56 - threw Regexp ((?^:File or filehandle provided with -string)) ok 57 - Same file ok 58 - Pushback ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 - _print ok 72 ok 73 - _insert at middle of file ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - _insert in empty file ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 - Bio::Root::IO->new can handle a Path::Class object ok 123 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 124 - Read string ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 137 - A reference of type 'GLOB' isa 'GLOB' ok 138 ok 139 ok 140 - auto UNLINK => 1 ok 141 ok 142 ok 143 - tempfile deleted ok 144 - A reference of type 'GLOB' isa 'GLOB' ok 145 ok 146 - UNLINK => 0 ok 147 ok 148 ok 149 - A reference of type 'GLOB' isa 'GLOB' ok 150 - tempfile suffix ok 151 ok 152 - A reference of type 'GLOB' isa 'GLOB' ok 153 - tempfile() in scalar context ok 154 ok t/Root/RootI.t ......................... 1..62 ok 1 - use Bio::Root::Root; ok 2 ok 3 - An object of class 'Bio::Root::Root' isa 'Bio::Root::RootI' ok 4 - threw Regexp ((?^:Testing throw)) ok 5 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented)) ok 6 - threw Regexp ((?^:EXCEPTION )) ok 7 - threw Regexp ((?^:Testing throw)) ok 8 ok 9 - threw Regexp ((?^:Testing throw)) ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - simple ok 16 ok 17 - warns for versions below current version ok 18 - warns for versions below current version ok 19 - throws for versions above current version ok 20 - throws for versions above current version ok 21 - throws for versions equal to current version ok 22 - simple ok 23 - simple ok 24 - warns for versions below current version ok 25 - warns for versions below current version ok 26 - throws for versions above current version ok 27 - throws for versions above current version ok 28 - arg callable since method was created ok 29 - mal-formed arg callable since method was created with good name ok 30 - Bio::Foo2->can('t3') ok 31 - Methods don't pollute original Bio::Root::Root namespace ok 32 - Bio::Foo2->can('test_4') ok 33 - Methods don't pollute original Bio::Root::Root namespace ok 34 - Bio::Foo3->can('t5') ok 35 - arg not in method list not created ok 36 - Bio::Foo3->can('t5') ok 37 - Methods don't pollute original Bio::Root::Root namespace ok 38 - verbose was set correctly ok 39 - synonym was set correctly ok 40 - real method of synonym was set correctly ok 41 - mal-formed arg correctly resolved to created method ok 42 - synonym of set method was set correctly ok 43 - Bio::Foo4->can('t7') ok 44 - Methods don't pollute original Bio::Root::Root namespace ok 45 - Bio::Foo4->can('test7') ok 46 - Methods don't pollute original Bio::Root::Root namespace ok 47 - Bio::Foo4->can('test_8') ok 48 - Methods don't pollute original Bio::Root::Root namespace ok 49 - Bio::Foo4->can('t8') ok 50 - Methods don't pollute original Bio::Root::Root namespace ok 51 - clone ok 52 - clone ok 53 - clone ok 54 - clone changed, original didn't ok 55 - parameters passed to clone() modify object ok 56 - original is not modified ok 57 - must use proper versioning scheme ok 58 - warns for versions >= current version ok 59 - warns for versions >= current version ok 60 - throws for versions >= current version ok 61 - throws for versions >= current version ok 62 - No warnings/exceptions below current version ok t/Root/Storable.t ...................... 1..35 ok 1 - use Bio::Root::Storable; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip.exe' found. Using C:\cygwin\bin/gzip.exe. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip.exe' found. Using C:\cygwin\bin/gzip.exe. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip.exe' found. Using C:\cygwin\bin/gzip.exe. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip.exe' found. Using C:\cygwin\bin/gzip.exe. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip.exe' found. Using C:\cygwin\bin/gzip.exe. --------------------------------------------------- t/Root/Utilities.t ..................... 1..56 ok 1 - use Bio::Root::Utilities; ok 2 - An object of class 'Bio::Root::Utilities' isa 'Bio::Root::Utilities' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - file_date() ok 38 - unix (\n or 012 or ^J) ok 39 - date format ok 40 - date format ok 41 - date format ok 42 - date format ok 43 - date format ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok t/SearchDist.t ......................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed t/SearchIO/CigarString.t ............... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/SearchIO.t .................. 1..19 ok 1 - use Bio::SearchIO; ok 2 - blastxml for f.blastxml ok 3 - fasta for f.fy ok 4 - exonerate for f.exonerate ok 5 - blast for f.tblx ok 6 - fasta for f.fx ok 7 - fasta for f.osearch ok 8 - blast for filename.bls ok 9 - exonerate for f.exon ok 10 - fasta for f.SSEARCH.m9 ok 11 - blast for filename.blast ok 12 - fasta for f.m9 ok 13 - blast for f.blx ok 14 - blastxml for f.xml ok 15 - fasta for f.fasta ok 16 - fasta for f.fa ok 17 - blast for fast.bls ok 18 - fasta for f.ssearch ok 19 - fasta for f.psearch ok t/SearchIO/SimilarityPair.t ............ 1..12 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SeqIO; ok 3 ok 4 - An object of class 'Bio::Seq' isa 'Bio::SeqI' Dubious, test returned 5 (wstat 1280, 0x500) Failed 8/12 subtests t/SearchIO/Tiling.t .................... 1..1141 ok 1 - use Bio::Search::Tiling::MapTiling; ok 2 - use Bio::Search::Tiling::MapTileUtils; ok 3 - use Bio::SearchIO; ok 4 - use Bio::Search::Hit::BlastHit; ok 5 - use File::Spec; ok 6 - parse data file ok 7 - got test hit ok 8 - create tiling ok 9 - An object of class 'Bio::Search::Tiling::MapTiling' isa 'Bio::Search::Tiling::TilingI' ok 10 - implements 'next_tiling' ok 11 - implements 'rewind_tilings' ok 12 - implements 'identities' ok 13 - implements 'conserved' ok 14 - implements 'length' ok 15 - identities regression test ok 16 - conserved regression test ok 17 - tiling iterator regression test(1) ok 18 - tiling iterator regression test(2) ok 19 - tiling iterator regression test(3, rewind) ok 20 - ecolitst.wublastp ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - dnaEbsub_ecoli.wublastx ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - tricky.wublast ok 37 - tricky.wublast(1) ok 38 - tricky.wublast(2) ok 39 - tricky.wublast(3) ok 40 - tricky.wublast(4) ok 41 - ecolitst.bls ok 42 - tile ecolitst.bls hit 1 \#hsps 1 ok 43 - q id: est (0.98293) = fast (0.98293) ok 44 - q cn: est (0.98293) = fast (0.98293) ok 45 - h id: est (0.98293) = fast (0.98293) ok 46 - h cn: est (0.98293) = fast (0.98293) ok 47 - tile ecolitst.bls hit 2 \#hsps 1 ok 48 - q id: est (0.30074) = fast (0.30074) ok 49 - q cn: est (0.49876) = fast (0.49876) ok 50 - h id: est (0.30759) = fast (0.30759) ok 51 - h cn: est (0.51013) = fast (0.51013) ok 52 - tile ecolitst.bls hit 3 \#hsps 1 ok 53 - q id: est (0.31004) = fast (0.31004) ok 54 - q cn: est (0.49782) = fast (0.49782) ok 55 - h id: est (0.32054) = fast (0.32054) ok 56 - h cn: est (0.51467) = fast (0.51467) ok 57 - tile ecolitst.bls hit 4 \#hsps 1 ok 58 - q id: est (0.30435) = fast (0.30435) ok 59 - q cn: est (0.47826) = fast (0.47826) ok 60 - h id: est (0.29787) = fast (0.29787) ok 61 - h cn: est (0.46809) = fast (0.46809) ok 62 - tricky.wublast ok 63 - tile tricky.wublast hit 1 \#hsps 7 ok 64 - q id: exact (0.22153) ~ est (0.22153) ok 65 - q id: exact (0.22153) <= max (0.22153) ok 66 - q cn: exact (0.42760) ~ est (0.42760) ok 67 - q cn: exact (0.42760) <= max (0.42760) ok 68 - h id: exact (0.22704) ~ est (0.22704) ok 69 - h id: exact (0.22704) <= max (0.22704) ok 70 - h cn: exact (0.43335) ~ est (0.43335) ok 71 - h cn: exact (0.43335) <= max (0.43335) ok 72 - a_thaliana.blastn ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1 ok 74 - q id: est (0.96667) = fast (0.96667) ok 75 - q cn: est (0.96667) = fast (0.96667) ok 76 - h id: est (0.98305) = fast (0.98305) ok 77 - h cn: est (0.98305) = fast (0.98305) ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1 ok 79 - q id: est (0.96667) = fast (0.96667) ok 80 - q cn: est (0.96667) = fast (0.96667) ok 81 - h id: est (0.98305) = fast (0.98305) ok 82 - h cn: est (0.98305) = fast (0.98305) ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1 ok 84 - q id: est (1.00000) = fast (1.00000) ok 85 - q cn: est (1.00000) = fast (1.00000) ok 86 - h id: est (1.00000) = fast (1.00000) ok 87 - h cn: est (1.00000) = fast (1.00000) ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1 ok 89 - q id: est (1.00000) = fast (1.00000) ok 90 - q cn: est (1.00000) = fast (1.00000) ok 91 - h id: est (1.00000) = fast (1.00000) ok 92 - h cn: est (1.00000) = fast (1.00000) ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1 ok 94 - q id: est (0.92308) = fast (0.92308) ok 95 - q cn: est (0.92308) = fast (0.92308) ok 96 - h id: est (0.92308) = fast (0.92308) ok 97 - h cn: est (0.92308) = fast (0.92308) ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1 ok 99 - q id: est (1.00000) = fast (1.00000) ok 100 - q cn: est (1.00000) = fast (1.00000) ok 101 - h id: est (1.00000) = fast (1.00000) ok 102 - h cn: est (1.00000) = fast (1.00000) ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1 ok 104 - q id: est (1.00000) = fast (1.00000) ok 105 - q cn: est (1.00000) = fast (1.00000) ok 106 - h id: est (1.00000) = fast (1.00000) ok 107 - h cn: est (1.00000) = fast (1.00000) ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1 ok 109 - q id: est (1.00000) = fast (1.00000) ok 110 - q cn: est (1.00000) = fast (1.00000) ok 111 - h id: est (1.00000) = fast (1.00000) ok 112 - h cn: est (1.00000) = fast (1.00000) ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1 ok 114 - q id: est (1.00000) = fast (1.00000) ok 115 - q cn: est (1.00000) = fast (1.00000) ok 116 - h id: est (1.00000) = fast (1.00000) ok 117 - h cn: est (1.00000) = fast (1.00000) ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1 ok 119 - q id: est (1.00000) = fast (1.00000) ok 120 - q cn: est (1.00000) = fast (1.00000) ok 121 - h id: est (1.00000) = fast (1.00000) ok 122 - h cn: est (1.00000) = fast (1.00000) ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1 ok 124 - q id: est (1.00000) = fast (1.00000) ok 125 - q cn: est (1.00000) = fast (1.00000) ok 126 - h id: est (1.00000) = fast (1.00000) ok 127 - h cn: est (1.00000) = fast (1.00000) ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1 ok 129 - q id: est (1.00000) = fast (1.00000) ok 130 - q cn: est (1.00000) = fast (1.00000) ok 131 - h id: est (1.00000) = fast (1.00000) ok 132 - h cn: est (1.00000) = fast (1.00000) ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1 ok 134 - q id: est (1.00000) = fast (1.00000) ok 135 - q cn: est (1.00000) = fast (1.00000) ok 136 - h id: est (1.00000) = fast (1.00000) ok 137 - h cn: est (1.00000) = fast (1.00000) ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1 ok 139 - q id: est (1.00000) = fast (1.00000) ok 140 - q cn: est (1.00000) = fast (1.00000) ok 141 - h id: est (1.00000) = fast (1.00000) ok 142 - h cn: est (1.00000) = fast (1.00000) ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1 ok 144 - q id: est (1.00000) = fast (1.00000) ok 145 - q cn: est (1.00000) = fast (1.00000) ok 146 - h id: est (1.00000) = fast (1.00000) ok 147 - h cn: est (1.00000) = fast (1.00000) ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1 ok 149 - q id: est (1.00000) = fast (1.00000) ok 150 - q cn: est (1.00000) = fast (1.00000) ok 151 - h id: est (1.00000) = fast (1.00000) ok 152 - h cn: est (1.00000) = fast (1.00000) ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1 ok 154 - q id: est (1.00000) = fast (1.00000) ok 155 - q cn: est (1.00000) = fast (1.00000) ok 156 - h id: est (1.00000) = fast (1.00000) ok 157 - h cn: est (1.00000) = fast (1.00000) ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1 ok 159 - q id: est (1.00000) = fast (1.00000) ok 160 - q cn: est (1.00000) = fast (1.00000) ok 161 - h id: est (1.00000) = fast (1.00000) ok 162 - h cn: est (1.00000) = fast (1.00000) ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1 ok 164 - q id: est (1.00000) = fast (1.00000) ok 165 - q cn: est (1.00000) = fast (1.00000) ok 166 - h id: est (1.00000) = fast (1.00000) ok 167 - h cn: est (1.00000) = fast (1.00000) ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1 ok 169 - q id: est (0.95238) = fast (0.95238) ok 170 - q cn: est (0.95238) = fast (0.95238) ok 171 - h id: est (0.95238) = fast (0.95238) ok 172 - h cn: est (0.95238) = fast (0.95238) ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1 ok 174 - q id: est (1.00000) = fast (1.00000) ok 175 - q cn: est (1.00000) = fast (1.00000) ok 176 - h id: est (1.00000) = fast (1.00000) ok 177 - h cn: est (1.00000) = fast (1.00000) ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1 ok 179 - q id: est (0.95238) = fast (0.95238) ok 180 - q cn: est (0.95238) = fast (0.95238) ok 181 - h id: est (0.95238) = fast (0.95238) ok 182 - h cn: est (0.95238) = fast (0.95238) ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1 ok 184 - q id: est (1.00000) = fast (1.00000) ok 185 - q cn: est (1.00000) = fast (1.00000) ok 186 - h id: est (1.00000) = fast (1.00000) ok 187 - h cn: est (1.00000) = fast (1.00000) ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1 ok 189 - q id: est (0.95238) = fast (0.95238) ok 190 - q cn: est (0.95238) = fast (0.95238) ok 191 - h id: est (0.95238) = fast (0.95238) ok 192 - h cn: est (0.95238) = fast (0.95238) ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1 ok 194 - q id: est (1.00000) = fast (1.00000) ok 195 - q cn: est (1.00000) = fast (1.00000) ok 196 - h id: est (1.00000) = fast (1.00000) ok 197 - h cn: est (1.00000) = fast (1.00000) ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1 ok 199 - q id: est (1.00000) = fast (1.00000) ok 200 - q cn: est (1.00000) = fast (1.00000) ok 201 - h id: est (1.00000) = fast (1.00000) ok 202 - h cn: est (1.00000) = fast (1.00000) ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1 ok 204 - q id: est (1.00000) = fast (1.00000) ok 205 - q cn: est (1.00000) = fast (1.00000) ok 206 - h id: est (1.00000) = fast (1.00000) ok 207 - h cn: est (1.00000) = fast (1.00000) ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1 ok 209 - q id: est (1.00000) = fast (1.00000) ok 210 - q cn: est (1.00000) = fast (1.00000) ok 211 - h id: est (1.00000) = fast (1.00000) ok 212 - h cn: est (1.00000) = fast (1.00000) ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1 ok 214 - q id: est (1.00000) = fast (1.00000) ok 215 - q cn: est (1.00000) = fast (1.00000) ok 216 - h id: est (1.00000) = fast (1.00000) ok 217 - h cn: est (1.00000) = fast (1.00000) ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1 ok 219 - q id: est (1.00000) = fast (1.00000) ok 220 - q cn: est (1.00000) = fast (1.00000) ok 221 - h id: est (1.00000) = fast (1.00000) ok 222 - h cn: est (1.00000) = fast (1.00000) ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1 ok 224 - q id: est (1.00000) = fast (1.00000) ok 225 - q cn: est (1.00000) = fast (1.00000) ok 226 - h id: est (1.00000) = fast (1.00000) ok 227 - h cn: est (1.00000) = fast (1.00000) ok 228 - brassica_ATH.WUBLASTN ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3 ok 230 - q id: exact (0.82465) ~ est (0.82343) ok 231 - q id: exact (0.82465) <= max (0.83333) ok 232 - q cn: exact (0.85590) ~ est (0.85312) ok 233 - q cn: exact (0.85590) <= max (0.86458) ok 234 - h id: exact (0.83920) ~ est (0.83920) ok 235 - h id: exact (0.83920) <= max (0.83920) ok 236 - h cn: exact (0.86935) ~ est (0.86935) ok 237 - h cn: exact (0.86935) <= max (0.86935) ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2 ok 239 - q id: exact (0.82486) ~ est (0.82486) ok 240 - q id: exact (0.82486) <= max (0.82486) ok 241 - q cn: exact (0.85122) ~ est (0.85122) ok 242 - q cn: exact (0.85122) <= max (0.85122) ok 243 - h id: exact (0.82955) ~ est (0.82955) ok 244 - h id: exact (0.82955) <= max (0.82955) ok 245 - h cn: exact (0.85606) ~ est (0.85606) ok 246 - h cn: exact (0.85606) <= max (0.85606) ok 247 - no_hsps.blastp ok 248 - tile no_hsps.blastp hit 1 \#hsps 0 ok 249 - tile no_hsps.blastp hit 2 \#hsps 0 ok 250 - tile no_hsps.blastp hit 3 \#hsps 0 ok 251 - tile no_hsps.blastp hit 4 \#hsps 0 ok 252 - tile no_hsps.blastp hit 5 \#hsps 0 ok 253 - tile no_hsps.blastp hit 6 \#hsps 0 ok 254 - tile no_hsps.blastp hit 7 \#hsps 0 ok 255 - tile no_hsps.blastp hit 8 \#hsps 0 ok 256 - tile no_hsps.blastp hit 9 \#hsps 0 ok 257 - tile no_hsps.blastp hit 10 \#hsps 0 ok 258 - tile no_hsps.blastp hit 11 \#hsps 0 ok 259 - tile no_hsps.blastp hit 12 \#hsps 0 ok 260 - tile no_hsps.blastp hit 13 \#hsps 0 ok 261 - tile no_hsps.blastp hit 14 \#hsps 0 ok 262 - tile no_hsps.blastp hit 15 \#hsps 0 ok 263 - tile no_hsps.blastp hit 16 \#hsps 0 ok 264 - tile no_hsps.blastp hit 17 \#hsps 0 ok 265 - tile no_hsps.blastp hit 18 \#hsps 0 ok 266 - tile no_hsps.blastp hit 19 \#hsps 0 ok 267 - tile no_hsps.blastp hit 20 \#hsps 0 ok 268 - tile no_hsps.blastp hit 21 \#hsps 0 ok 269 - tile no_hsps.blastp hit 22 \#hsps 0 ok 270 - tile no_hsps.blastp hit 23 \#hsps 0 ok 271 - tile no_hsps.blastp hit 24 \#hsps 0 ok 272 - tile no_hsps.blastp hit 25 \#hsps 0 ok 273 - tile no_hsps.blastp hit 26 \#hsps 0 ok 274 - tile no_hsps.blastp hit 27 \#hsps 0 ok 275 - tile no_hsps.blastp hit 28 \#hsps 0 ok 276 - tile no_hsps.blastp hit 29 \#hsps 0 ok 277 - tile no_hsps.blastp hit 30 \#hsps 0 ok 278 - tile no_hsps.blastp hit 31 \#hsps 0 ok 279 - tile no_hsps.blastp hit 32 \#hsps 0 ok 280 - tile no_hsps.blastp hit 33 \#hsps 0 ok 281 - tile no_hsps.blastp hit 34 \#hsps 0 ok 282 - tile no_hsps.blastp hit 35 \#hsps 0 ok 283 - tile no_hsps.blastp hit 36 \#hsps 0 ok 284 - tile no_hsps.blastp hit 37 \#hsps 0 ok 285 - tile no_hsps.blastp hit 38 \#hsps 0 ok 286 - tile no_hsps.blastp hit 39 \#hsps 0 ok 287 - tile no_hsps.blastp hit 40 \#hsps 0 ok 288 - tile no_hsps.blastp hit 41 \#hsps 0 ok 289 - tile no_hsps.blastp hit 42 \#hsps 0 ok 290 - tile no_hsps.blastp hit 43 \#hsps 0 ok 291 - tile no_hsps.blastp hit 44 \#hsps 0 ok 292 - tile no_hsps.blastp hit 45 \#hsps 0 ok 293 - tile no_hsps.blastp hit 46 \#hsps 0 ok 294 - tile no_hsps.blastp hit 47 \#hsps 0 ok 295 - tile no_hsps.blastp hit 48 \#hsps 0 ok 296 - tile no_hsps.blastp hit 49 \#hsps 0 ok 297 - tile no_hsps.blastp hit 50 \#hsps 0 ok 298 - tile no_hsps.blastp hit 51 \#hsps 0 ok 299 - tile no_hsps.blastp hit 52 \#hsps 0 ok 300 - tile no_hsps.blastp hit 53 \#hsps 0 ok 301 - tile no_hsps.blastp hit 54 \#hsps 0 ok 302 - tile no_hsps.blastp hit 55 \#hsps 0 ok 303 - tile no_hsps.blastp hit 56 \#hsps 0 ok 304 - tile no_hsps.blastp hit 57 \#hsps 0 ok 305 - tile no_hsps.blastp hit 58 \#hsps 0 ok 306 - tile no_hsps.blastp hit 59 \#hsps 0 ok 307 - tile no_hsps.blastp hit 60 \#hsps 0 ok 308 - tile no_hsps.blastp hit 61 \#hsps 0 ok 309 - tile no_hsps.blastp hit 62 \#hsps 0 ok 310 - tile no_hsps.blastp hit 63 \#hsps 0 ok 311 - tile no_hsps.blastp hit 64 \#hsps 0 ok 312 - tile no_hsps.blastp hit 65 \#hsps 0 ok 313 - tile no_hsps.blastp hit 66 \#hsps 0 ok 314 - tile no_hsps.blastp hit 67 \#hsps 0 ok 315 - tile no_hsps.blastp hit 68 \#hsps 0 ok 316 - tile no_hsps.blastp hit 69 \#hsps 0 ok 317 - tile no_hsps.blastp hit 70 \#hsps 0 ok 318 - tile no_hsps.blastp hit 71 \#hsps 0 ok 319 - tile no_hsps.blastp hit 72 \#hsps 0 ok 320 - tile no_hsps.blastp hit 73 \#hsps 0 ok 321 - tile no_hsps.blastp hit 74 \#hsps 0 ok 322 - tile no_hsps.blastp hit 75 \#hsps 0 ok 323 - tile no_hsps.blastp hit 76 \#hsps 0 ok 324 - tile no_hsps.blastp hit 77 \#hsps 0 ok 325 - tile no_hsps.blastp hit 78 \#hsps 0 ok 326 - tile no_hsps.blastp hit 79 \#hsps 0 ok 327 - tile no_hsps.blastp hit 80 \#hsps 0 ok 328 - tile no_hsps.blastp hit 81 \#hsps 0 ok 329 - tile no_hsps.blastp hit 82 \#hsps 0 ok 330 - tile no_hsps.blastp hit 83 \#hsps 0 ok 331 - tile no_hsps.blastp hit 84 \#hsps 0 ok 332 - tile no_hsps.blastp hit 85 \#hsps 0 ok 333 - tile no_hsps.blastp hit 86 \#hsps 0 ok 334 - tile no_hsps.blastp hit 87 \#hsps 0 ok 335 - tile no_hsps.blastp hit 88 \#hsps 0 ok 336 - tile no_hsps.blastp hit 89 \#hsps 0 ok 337 - tile no_hsps.blastp hit 90 \#hsps 0 ok 338 - tile no_hsps.blastp hit 91 \#hsps 0 ok 339 - tile no_hsps.blastp hit 92 \#hsps 0 ok 340 - tile no_hsps.blastp hit 93 \#hsps 0 ok 341 - tile no_hsps.blastp hit 94 \#hsps 0 ok 342 - tile no_hsps.blastp hit 95 \#hsps 0 ok 343 - tile no_hsps.blastp hit 96 \#hsps 0 ok 344 - tile no_hsps.blastp hit 97 \#hsps 0 ok 345 - tile no_hsps.blastp hit 98 \#hsps 0 ok 346 - tile no_hsps.blastp hit 99 \#hsps 0 ok 347 - tile no_hsps.blastp hit 100 \#hsps 0 ok 348 - tile no_hsps.blastp hit 101 \#hsps 0 ok 349 - tile no_hsps.blastp hit 102 \#hsps 0 ok 350 - tile no_hsps.blastp hit 103 \#hsps 0 ok 351 - tile no_hsps.blastp hit 104 \#hsps 0 ok 352 - tile no_hsps.blastp hit 105 \#hsps 0 ok 353 - tile no_hsps.blastp hit 106 \#hsps 0 ok 354 - tile no_hsps.blastp hit 107 \#hsps 0 ok 355 - tile no_hsps.blastp hit 108 \#hsps 0 ok 356 - tile no_hsps.blastp hit 109 \#hsps 0 ok 357 - tile no_hsps.blastp hit 110 \#hsps 0 ok 358 - tile no_hsps.blastp hit 111 \#hsps 0 ok 359 - tile no_hsps.blastp hit 112 \#hsps 0 ok 360 - tile no_hsps.blastp hit 113 \#hsps 0 ok 361 - tile no_hsps.blastp hit 114 \#hsps 0 ok 362 - tile no_hsps.blastp hit 115 \#hsps 0 ok 363 - tile no_hsps.blastp hit 116 \#hsps 0 ok 364 - tile no_hsps.blastp hit 117 \#hsps 0 ok 365 - tile no_hsps.blastp hit 118 \#hsps 0 ok 366 - tile no_hsps.blastp hit 119 \#hsps 0 ok 367 - tile no_hsps.blastp hit 120 \#hsps 0 ok 368 - tile no_hsps.blastp hit 121 \#hsps 0 ok 369 - tile no_hsps.blastp hit 122 \#hsps 0 ok 370 - tile no_hsps.blastp hit 123 \#hsps 0 ok 371 - tile no_hsps.blastp hit 124 \#hsps 0 ok 372 - tile no_hsps.blastp hit 125 \#hsps 0 ok 373 - tile no_hsps.blastp hit 126 \#hsps 0 ok 374 - tile no_hsps.blastp hit 127 \#hsps 0 ok 375 - tile no_hsps.blastp hit 128 \#hsps 0 ok 376 - tile no_hsps.blastp hit 129 \#hsps 0 ok 377 - tile no_hsps.blastp hit 130 \#hsps 0 ok 378 - tile no_hsps.blastp hit 131 \#hsps 0 ok 379 - tile no_hsps.blastp hit 132 \#hsps 0 ok 380 - tile no_hsps.blastp hit 133 \#hsps 0 ok 381 - tile no_hsps.blastp hit 134 \#hsps 0 ok 382 - tile no_hsps.blastp hit 135 \#hsps 0 ok 383 - tile no_hsps.blastp hit 136 \#hsps 0 ok 384 - tile no_hsps.blastp hit 137 \#hsps 0 ok 385 - tile no_hsps.blastp hit 138 \#hsps 0 ok 386 - tile no_hsps.blastp hit 139 \#hsps 0 ok 387 - tile no_hsps.blastp hit 140 \#hsps 0 ok 388 - tile no_hsps.blastp hit 141 \#hsps 0 ok 389 - tile no_hsps.blastp hit 142 \#hsps 0 ok 390 - tile no_hsps.blastp hit 143 \#hsps 0 ok 391 - tile no_hsps.blastp hit 144 \#hsps 0 ok 392 - tile no_hsps.blastp hit 145 \#hsps 0 ok 393 - tile no_hsps.blastp hit 146 \#hsps 0 ok 394 - tile no_hsps.blastp hit 147 \#hsps 0 ok 395 - tile no_hsps.blastp hit 148 \#hsps 0 ok 396 - tile no_hsps.blastp hit 149 \#hsps 0 ok 397 - tile no_hsps.blastp hit 150 \#hsps 0 ok 398 - tile no_hsps.blastp hit 151 \#hsps 0 ok 399 - tile no_hsps.blastp hit 152 \#hsps 0 ok 400 - tile no_hsps.blastp hit 153 \#hsps 0 ok 401 - tile no_hsps.blastp hit 154 \#hsps 0 ok 402 - tile no_hsps.blastp hit 155 \#hsps 0 ok 403 - tile no_hsps.blastp hit 156 \#hsps 0 ok 404 - tile no_hsps.blastp hit 157 \#hsps 0 ok 405 - tile no_hsps.blastp hit 158 \#hsps 0 ok 406 - tile no_hsps.blastp hit 159 \#hsps 0 ok 407 - tile no_hsps.blastp hit 160 \#hsps 0 ok 408 - tile no_hsps.blastp hit 161 \#hsps 0 ok 409 - tile no_hsps.blastp hit 162 \#hsps 0 ok 410 - tile no_hsps.blastp hit 163 \#hsps 0 ok 411 - tile no_hsps.blastp hit 164 \#hsps 0 ok 412 - tile no_hsps.blastp hit 165 \#hsps 0 ok 413 - tile no_hsps.blastp hit 166 \#hsps 0 ok 414 - tile no_hsps.blastp hit 167 \#hsps 0 ok 415 - tile no_hsps.blastp hit 168 \#hsps 0 ok 416 - tile no_hsps.blastp hit 169 \#hsps 0 ok 417 - tile no_hsps.blastp hit 170 \#hsps 0 ok 418 - tile no_hsps.blastp hit 171 \#hsps 0 ok 419 - tile no_hsps.blastp hit 172 \#hsps 0 ok 420 - tile no_hsps.blastp hit 173 \#hsps 0 ok 421 - tile no_hsps.blastp hit 174 \#hsps 0 ok 422 - tile no_hsps.blastp hit 175 \#hsps 0 ok 423 - tile no_hsps.blastp hit 176 \#hsps 0 ok 424 - tile no_hsps.blastp hit 177 \#hsps 0 ok 425 - tile no_hsps.blastp hit 178 \#hsps 0 ok 426 - tile no_hsps.blastp hit 179 \#hsps 0 ok 427 - tile no_hsps.blastp hit 180 \#hsps 0 ok 428 - tile no_hsps.blastp hit 181 \#hsps 0 ok 429 - tile no_hsps.blastp hit 182 \#hsps 0 ok 430 - tile no_hsps.blastp hit 183 \#hsps 0 ok 431 - tile no_hsps.blastp hit 184 \#hsps 0 ok 432 - tile no_hsps.blastp hit 185 \#hsps 0 ok 433 - tile no_hsps.blastp hit 186 \#hsps 0 ok 434 - tile no_hsps.blastp hit 187 \#hsps 0 ok 435 - tile no_hsps.blastp hit 188 \#hsps 0 ok 436 - tile no_hsps.blastp hit 189 \#hsps 0 ok 437 - tile no_hsps.blastp hit 190 \#hsps 0 ok 438 - tile no_hsps.blastp hit 191 \#hsps 0 ok 439 - tile no_hsps.blastp hit 192 \#hsps 0 ok 440 - tile no_hsps.blastp hit 193 \#hsps 0 ok 441 - tile no_hsps.blastp hit 194 \#hsps 0 ok 442 - tile no_hsps.blastp hit 195 \#hsps 0 ok 443 - tile no_hsps.blastp hit 196 \#hsps 0 ok 444 - tile no_hsps.blastp hit 197 \#hsps 0 ok 445 - tile no_hsps.blastp hit 198 \#hsps 0 ok 446 - tile no_hsps.blastp hit 199 \#hsps 0 ok 447 - tile no_hsps.blastp hit 200 \#hsps 0 ok 448 - tile no_hsps.blastp hit 201 \#hsps 0 ok 449 - tile no_hsps.blastp hit 202 \#hsps 0 ok 450 - tile no_hsps.blastp hit 203 \#hsps 0 ok 451 - tile no_hsps.blastp hit 204 \#hsps 0 ok 452 - tile no_hsps.blastp hit 205 \#hsps 0 ok 453 - tile no_hsps.blastp hit 206 \#hsps 0 ok 454 - tile no_hsps.blastp hit 207 \#hsps 0 ok 455 - tile no_hsps.blastp hit 208 \#hsps 0 ok 456 - tile no_hsps.blastp hit 209 \#hsps 0 ok 457 - tile no_hsps.blastp hit 210 \#hsps 0 ok 458 - tile no_hsps.blastp hit 211 \#hsps 0 ok 459 - tile no_hsps.blastp hit 212 \#hsps 0 ok 460 - tile no_hsps.blastp hit 213 \#hsps 0 ok 461 - tile no_hsps.blastp hit 214 \#hsps 0 ok 462 - tile no_hsps.blastp hit 215 \#hsps 0 ok 463 - tile no_hsps.blastp hit 216 \#hsps 0 ok 464 - tile no_hsps.blastp hit 217 \#hsps 0 ok 465 - tile no_hsps.blastp hit 218 \#hsps 0 ok 466 - tile no_hsps.blastp hit 219 \#hsps 0 ok 467 - tile no_hsps.blastp hit 220 \#hsps 0 ok 468 - tile no_hsps.blastp hit 221 \#hsps 0 ok 469 - tile no_hsps.blastp hit 222 \#hsps 0 ok 470 - tile no_hsps.blastp hit 223 \#hsps 0 ok 471 - tile no_hsps.blastp hit 224 \#hsps 0 ok 472 - tile no_hsps.blastp hit 225 \#hsps 0 ok 473 - tile no_hsps.blastp hit 226 \#hsps 0 ok 474 - tile no_hsps.blastp hit 227 \#hsps 0 ok 475 - tile no_hsps.blastp hit 228 \#hsps 0 ok 476 - tile no_hsps.blastp hit 229 \#hsps 0 ok 477 - tile no_hsps.blastp hit 230 \#hsps 0 ok 478 - tile no_hsps.blastp hit 231 \#hsps 0 ok 479 - tile no_hsps.blastp hit 232 \#hsps 0 ok 480 - tile no_hsps.blastp hit 233 \#hsps 0 ok 481 - tile no_hsps.blastp hit 234 \#hsps 0 ok 482 - tile no_hsps.blastp hit 235 \#hsps 0 ok 483 - tile no_hsps.blastp hit 236 \#hsps 0 ok 484 - tile no_hsps.blastp hit 237 \#hsps 0 ok 485 - tile no_hsps.blastp hit 238 \#hsps 0 ok 486 - tile no_hsps.blastp hit 239 \#hsps 0 ok 487 - tile no_hsps.blastp hit 240 \#hsps 0 ok 488 - tile no_hsps.blastp hit 241 \#hsps 0 ok 489 - tile no_hsps.blastp hit 242 \#hsps 0 ok 490 - tile no_hsps.blastp hit 243 \#hsps 0 ok 491 - tile no_hsps.blastp hit 244 \#hsps 0 ok 492 - tile no_hsps.blastp hit 245 \#hsps 0 ok 493 - tile no_hsps.blastp hit 246 \#hsps 0 ok 494 - tile no_hsps.blastp hit 247 \#hsps 0 ok 495 - tile no_hsps.blastp hit 248 \#hsps 0 ok 496 - tile no_hsps.blastp hit 249 \#hsps 0 ok 497 - tile no_hsps.blastp hit 250 \#hsps 0 ok 498 - tile no_hsps.blastp hit 251 \#hsps 0 ok 499 - tile no_hsps.blastp hit 252 \#hsps 0 ok 500 - tile no_hsps.blastp hit 253 \#hsps 0 ok 501 - tile no_hsps.blastp hit 254 \#hsps 0 ok 502 - tile no_hsps.blastp hit 255 \#hsps 0 ok 503 - tile no_hsps.blastp hit 256 \#hsps 0 ok 504 - tile no_hsps.blastp hit 257 \#hsps 0 ok 505 - tile no_hsps.blastp hit 258 \#hsps 0 ok 506 - tile no_hsps.blastp hit 259 \#hsps 0 ok 507 - tile no_hsps.blastp hit 260 \#hsps 0 ok 508 - tile no_hsps.blastp hit 261 \#hsps 0 ok 509 - tile no_hsps.blastp hit 262 \#hsps 0 ok 510 - tile no_hsps.blastp hit 263 \#hsps 0 ok 511 - tile no_hsps.blastp hit 264 \#hsps 0 ok 512 - tile no_hsps.blastp hit 265 \#hsps 0 ok 513 - tile no_hsps.blastp hit 266 \#hsps 0 ok 514 - tile no_hsps.blastp hit 267 \#hsps 0 ok 515 - tile no_hsps.blastp hit 268 \#hsps 0 ok 516 - tile no_hsps.blastp hit 269 \#hsps 0 ok 517 - tile no_hsps.blastp hit 270 \#hsps 0 ok 518 - tile no_hsps.blastp hit 271 \#hsps 0 ok 519 - tile no_hsps.blastp hit 272 \#hsps 0 ok 520 - tile no_hsps.blastp hit 273 \#hsps 0 ok 521 - tile no_hsps.blastp hit 274 \#hsps 0 ok 522 - tile no_hsps.blastp hit 275 \#hsps 0 ok 523 - tile no_hsps.blastp hit 276 \#hsps 0 ok 524 - tile no_hsps.blastp hit 277 \#hsps 0 ok 525 - tile no_hsps.blastp hit 278 \#hsps 0 ok 526 - tile no_hsps.blastp hit 279 \#hsps 0 ok 527 - tile no_hsps.blastp hit 280 \#hsps 0 ok 528 - tile no_hsps.blastp hit 281 \#hsps 0 ok 529 - tile no_hsps.blastp hit 282 \#hsps 0 ok 530 - tile no_hsps.blastp hit 283 \#hsps 0 ok 531 - tile no_hsps.blastp hit 284 \#hsps 0 ok 532 - tile no_hsps.blastp hit 285 \#hsps 0 ok 533 - tile no_hsps.blastp hit 286 \#hsps 0 ok 534 - tile no_hsps.blastp hit 287 \#hsps 0 ok 535 - tile no_hsps.blastp hit 288 \#hsps 0 ok 536 - tile no_hsps.blastp hit 289 \#hsps 0 ok 537 - tile no_hsps.blastp hit 290 \#hsps 0 ok 538 - tile no_hsps.blastp hit 291 \#hsps 0 ok 539 - tile no_hsps.blastp hit 292 \#hsps 0 ok 540 - tile no_hsps.blastp hit 293 \#hsps 0 ok 541 - tile no_hsps.blastp hit 294 \#hsps 0 ok 542 - tile no_hsps.blastp hit 295 \#hsps 0 ok 543 - tile no_hsps.blastp hit 296 \#hsps 0 ok 544 - tile no_hsps.blastp hit 297 \#hsps 0 ok 545 - tile no_hsps.blastp hit 298 \#hsps 0 ok 546 - tile no_hsps.blastp hit 299 \#hsps 0 ok 547 - tile no_hsps.blastp hit 300 \#hsps 0 ok 548 - tile no_hsps.blastp hit 301 \#hsps 0 ok 549 - tile no_hsps.blastp hit 302 \#hsps 0 ok 550 - tile no_hsps.blastp hit 303 \#hsps 0 ok 551 - tile no_hsps.blastp hit 304 \#hsps 0 ok 552 - tile no_hsps.blastp hit 305 \#hsps 0 ok 553 - tile no_hsps.blastp hit 306 \#hsps 0 ok 554 - tile no_hsps.blastp hit 307 \#hsps 0 ok 555 - tile no_hsps.blastp hit 308 \#hsps 0 ok 556 - tile no_hsps.blastp hit 309 \#hsps 0 ok 557 - tile no_hsps.blastp hit 310 \#hsps 0 ok 558 - tile no_hsps.blastp hit 311 \#hsps 0 ok 559 - tile no_hsps.blastp hit 312 \#hsps 0 ok 560 - tile no_hsps.blastp hit 313 \#hsps 0 ok 561 - tile no_hsps.blastp hit 314 \#hsps 0 ok 562 - tile no_hsps.blastp hit 315 \#hsps 0 ok 563 - tile no_hsps.blastp hit 316 \#hsps 0 ok 564 - tile no_hsps.blastp hit 317 \#hsps 0 ok 565 - tile no_hsps.blastp hit 318 \#hsps 0 ok 566 - tile no_hsps.blastp hit 319 \#hsps 0 ok 567 - tile no_hsps.blastp hit 320 \#hsps 0 ok 568 - tile no_hsps.blastp hit 321 \#hsps 0 ok 569 - tile no_hsps.blastp hit 322 \#hsps 0 ok 570 - tile no_hsps.blastp hit 323 \#hsps 0 ok 571 - tile no_hsps.blastp hit 324 \#hsps 0 ok 572 - tile no_hsps.blastp hit 325 \#hsps 0 ok 573 - tile no_hsps.blastp hit 326 \#hsps 0 ok 574 - tile no_hsps.blastp hit 327 \#hsps 0 ok 575 - tile no_hsps.blastp hit 328 \#hsps 0 ok 576 - tile no_hsps.blastp hit 329 \#hsps 0 ok 577 - tile no_hsps.blastp hit 330 \#hsps 0 ok 578 - tile no_hsps.blastp hit 331 \#hsps 0 ok 579 - tile no_hsps.blastp hit 332 \#hsps 0 ok 580 - tile no_hsps.blastp hit 333 \#hsps 0 ok 581 - tile no_hsps.blastp hit 334 \#hsps 0 ok 582 - tile no_hsps.blastp hit 335 \#hsps 0 ok 583 - tile no_hsps.blastp hit 336 \#hsps 0 ok 584 - tile no_hsps.blastp hit 337 \#hsps 0 ok 585 - tile no_hsps.blastp hit 338 \#hsps 0 ok 586 - tile no_hsps.blastp hit 339 \#hsps 0 ok 587 - tile no_hsps.blastp hit 340 \#hsps 0 ok 588 - tile no_hsps.blastp hit 341 \#hsps 0 ok 589 - tile no_hsps.blastp hit 342 \#hsps 0 ok 590 - tile no_hsps.blastp hit 343 \#hsps 0 ok 591 - tile no_hsps.blastp hit 344 \#hsps 0 ok 592 - tile no_hsps.blastp hit 345 \#hsps 0 ok 593 - tile no_hsps.blastp hit 346 \#hsps 0 ok 594 - tile no_hsps.blastp hit 347 \#hsps 0 ok 595 - tile no_hsps.blastp hit 348 \#hsps 0 ok 596 - tile no_hsps.blastp hit 349 \#hsps 0 ok 597 - tile no_hsps.blastp hit 350 \#hsps 0 ok 598 - tile no_hsps.blastp hit 351 \#hsps 0 ok 599 - tile no_hsps.blastp hit 352 \#hsps 0 ok 600 - tile no_hsps.blastp hit 353 \#hsps 0 ok 601 - tile no_hsps.blastp hit 354 \#hsps 0 ok 602 - tile no_hsps.blastp hit 355 \#hsps 0 ok 603 - tile no_hsps.blastp hit 356 \#hsps 0 ok 604 - tile no_hsps.blastp hit 357 \#hsps 0 ok 605 - tile no_hsps.blastp hit 358 \#hsps 0 ok 606 - tile no_hsps.blastp hit 359 \#hsps 0 ok 607 - tile no_hsps.blastp hit 360 \#hsps 0 ok 608 - tile no_hsps.blastp hit 361 \#hsps 0 ok 609 - tile no_hsps.blastp hit 362 \#hsps 0 ok 610 - tile no_hsps.blastp hit 363 \#hsps 0 ok 611 - tile no_hsps.blastp hit 364 \#hsps 0 ok 612 - tile no_hsps.blastp hit 365 \#hsps 0 ok 613 - tile no_hsps.blastp hit 366 \#hsps 0 ok 614 - tile no_hsps.blastp hit 367 \#hsps 0 ok 615 - tile no_hsps.blastp hit 368 \#hsps 0 ok 616 - tile no_hsps.blastp hit 369 \#hsps 0 ok 617 - tile no_hsps.blastp hit 370 \#hsps 0 ok 618 - tile no_hsps.blastp hit 371 \#hsps 0 ok 619 - tile no_hsps.blastp hit 372 \#hsps 0 ok 620 - tile no_hsps.blastp hit 373 \#hsps 0 ok 621 - tile no_hsps.blastp hit 374 \#hsps 0 ok 622 - tile no_hsps.blastp hit 375 \#hsps 0 ok 623 - tile no_hsps.blastp hit 376 \#hsps 0 ok 624 - tile no_hsps.blastp hit 377 \#hsps 0 ok 625 - tile no_hsps.blastp hit 378 \#hsps 0 ok 626 - tile no_hsps.blastp hit 379 \#hsps 0 ok 627 - tile no_hsps.blastp hit 380 \#hsps 0 ok 628 - tile no_hsps.blastp hit 381 \#hsps 0 ok 629 - tile no_hsps.blastp hit 382 \#hsps 0 ok 630 - tile no_hsps.blastp hit 383 \#hsps 0 ok 631 - tile no_hsps.blastp hit 384 \#hsps 0 ok 632 - tile no_hsps.blastp hit 385 \#hsps 0 ok 633 - tile no_hsps.blastp hit 386 \#hsps 0 ok 634 - tile no_hsps.blastp hit 387 \#hsps 0 ok 635 - tile no_hsps.blastp hit 388 \#hsps 0 ok 636 - tile no_hsps.blastp hit 389 \#hsps 0 ok 637 - tile no_hsps.blastp hit 390 \#hsps 0 ok 638 - tile no_hsps.blastp hit 391 \#hsps 0 ok 639 - tile no_hsps.blastp hit 392 \#hsps 0 ok 640 - tile no_hsps.blastp hit 393 \#hsps 0 ok 641 - tile no_hsps.blastp hit 394 \#hsps 0 ok 642 - tile no_hsps.blastp hit 395 \#hsps 0 ok 643 - tile no_hsps.blastp hit 396 \#hsps 0 ok 644 - tile no_hsps.blastp hit 397 \#hsps 0 ok 645 - tile no_hsps.blastp hit 398 \#hsps 0 ok 646 - tile no_hsps.blastp hit 399 \#hsps 0 ok 647 - tile no_hsps.blastp hit 400 \#hsps 0 ok 648 - tile no_hsps.blastp hit 401 \#hsps 0 ok 649 - tile no_hsps.blastp hit 402 \#hsps 0 ok 650 - tile no_hsps.blastp hit 403 \#hsps 0 ok 651 - tile no_hsps.blastp hit 404 \#hsps 0 ok 652 - tile no_hsps.blastp hit 405 \#hsps 0 ok 653 - tile no_hsps.blastp hit 406 \#hsps 0 ok 654 - tile no_hsps.blastp hit 407 \#hsps 0 ok 655 - tile no_hsps.blastp hit 408 \#hsps 0 ok 656 - tile no_hsps.blastp hit 409 \#hsps 0 ok 657 - tile no_hsps.blastp hit 410 \#hsps 0 ok 658 - tile no_hsps.blastp hit 411 \#hsps 0 ok 659 - tile no_hsps.blastp hit 412 \#hsps 0 ok 660 - tile no_hsps.blastp hit 413 \#hsps 0 ok 661 - tile no_hsps.blastp hit 414 \#hsps 0 ok 662 - tile no_hsps.blastp hit 415 \#hsps 0 ok 663 - catalase-webblast.BLASTP ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1 ok 665 - q id: est (1.00000) = fast (1.00000) ok 666 - q cn: est (1.00000) = fast (1.00000) ok 667 - h id: est (1.00000) = fast (1.00000) ok 668 - h cn: est (1.00000) = fast (1.00000) ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1 ok 670 - q id: est (0.80973) = fast (0.80973) ok 671 - q cn: est (0.89006) = fast (0.89006) ok 672 - h id: est (0.82543) = fast (0.82543) ok 673 - h cn: est (0.90733) = fast (0.90733) ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1 ok 675 - q id: est (0.71670) = fast (0.71670) ok 676 - q cn: est (0.84144) = fast (0.84144) ok 677 - h id: est (0.72747) = fast (0.72747) ok 678 - h cn: est (0.85408) = fast (0.85408) ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1 ok 680 - q id: est (0.58910) = fast (0.58910) ok 681 - q cn: est (0.70860) = fast (0.70860) ok 682 - h id: est (0.65654) = fast (0.65654) ok 683 - h cn: est (0.78972) = fast (0.78972) ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1 ok 685 - q id: est (0.49245) = fast (0.49245) ok 686 - q cn: est (0.65257) = fast (0.65257) ok 687 - h id: est (0.49544) = fast (0.49544) ok 688 - h cn: est (0.65653) = fast (0.65653) ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1 ok 690 - q id: est (0.44366) = fast (0.44366) ok 691 - q cn: est (0.58920) = fast (0.58920) ok 692 - h id: est (0.44787) = fast (0.44787) ok 693 - h cn: est (0.59479) = fast (0.59479) ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1 ok 695 - q id: est (0.42564) = fast (0.42564) ok 696 - q cn: est (0.61282) = fast (0.61282) ok 697 - h id: est (0.43229) = fast (0.43229) ok 698 - h cn: est (0.62240) = fast (0.62240) ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1 ok 700 - q id: est (0.48358) = fast (0.48358) ok 701 - q cn: est (0.63881) = fast (0.63881) ok 702 - h id: est (0.48943) = fast (0.48943) ok 703 - h cn: est (0.64653) = fast (0.64653) ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1 ok 705 - q id: est (0.42308) = fast (0.42308) ok 706 - q cn: est (0.61282) = fast (0.61282) ok 707 - h id: est (0.42969) = fast (0.42969) ok 708 - h cn: est (0.62240) = fast (0.62240) ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1 ok 710 - q id: est (0.39675) = fast (0.39675) ok 711 - q cn: est (0.58933) = fast (0.58933) ok 712 - h id: est (0.39767) = fast (0.39767) ok 713 - h cn: est (0.59070) = fast (0.59070) ok 714 - dcr1_sp.WUBLASTP ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1 ok 716 - q id: est (1.00000) = fast (1.00000) ok 717 - q cn: est (1.00000) = fast (1.00000) ok 718 - h id: est (1.00000) = fast (1.00000) ok 719 - h cn: est (1.00000) = fast (1.00000) ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4 ok 721 - q id: exact (0.36876) ~ est (0.36973) ok 722 - q id: exact (0.36876) <= max (0.37070) ok 723 - q cn: exact (0.55022) ~ est (0.55041) ok 724 - q cn: exact (0.55022) <= max (0.55105) ok 725 - h id: exact (0.35111) ~ est (0.35111) ok 726 - h id: exact (0.35111) <= max (0.35111) ok 727 - h cn: exact (0.52305) ~ est (0.52305) ok 728 - h cn: exact (0.52305) <= max (0.52305) ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1 ok 730 - q id: est (0.38685) = fast (0.38685) ok 731 - q cn: est (0.55397) = fast (0.55397) ok 732 - h id: est (0.37613) = fast (0.37613) ok 733 - h cn: est (0.53863) = fast (0.53863) ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1 ok 735 - q id: est (0.38247) = fast (0.38247) ok 736 - q cn: est (0.55068) = fast (0.55068) ok 737 - h id: est (0.37306) = fast (0.37306) ok 738 - h cn: est (0.53715) = fast (0.53715) ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5 ok 740 - q id: exact (0.35010) ~ est (0.35010) ok 741 - q id: exact (0.35010) <= max (0.35010) ok 742 - q cn: exact (0.53183) ~ est (0.53183) ok 743 - q cn: exact (0.53183) <= max (0.53183) ok 744 - h id: exact (0.35082) ~ est (0.35082) ok 745 - h id: exact (0.35082) <= max (0.35082) ok 746 - h cn: exact (0.53292) ~ est (0.53292) ok 747 - h cn: exact (0.53292) <= max (0.53292) ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8 ok 749 - q id: exact (0.30547) ~ est (0.30659) ok 750 - q id: exact (0.30547) <= max (0.30623) ok 751 - q cn: exact (0.50076) ~ est (0.50205) ok 752 - q cn: exact (0.50076) <= max (0.50076) ok 753 - h id: exact (0.31390) ~ est (0.31179) ok 754 - h id: exact (0.31390) <= max (0.31795) ok 755 - h cn: exact (0.50531) ~ est (0.50557) ok 756 - h cn: exact (0.50531) <= max (0.51091) ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7 ok 758 - q id: exact (0.30136) ~ est (0.30184) ok 759 - q id: exact (0.30136) <= max (0.30498) ok 760 - q cn: exact (0.48688) ~ est (0.48742) ok 761 - q cn: exact (0.48688) <= max (0.49140) ok 762 - h id: exact (0.30944) ~ est (0.31034) ok 763 - h id: exact (0.30944) <= max (0.30988) ok 764 - h cn: exact (0.50178) ~ est (0.50277) ok 765 - h cn: exact (0.50178) <= max (0.50223) ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10 ok 767 - q id: exact (0.28918) ~ est (0.28961) ok 768 - q id: exact (0.28918) <= max (0.28955) ok 769 - q cn: exact (0.46418) ~ est (0.46247) ok 770 - q cn: exact (0.46418) <= max (0.46866) ok 771 - h id: exact (0.30166) ~ est (0.30299) ok 772 - h id: exact (0.30166) <= max (0.30800) ok 773 - h cn: exact (0.48179) ~ est (0.48439) ok 774 - h cn: exact (0.48179) <= max (0.48535) ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8 ok 776 - q id: exact (0.30289) ~ est (0.30238) ok 777 - q id: exact (0.30289) <= max (0.30651) ok 778 - q cn: exact (0.49955) ~ est (0.49787) ok 779 - q cn: exact (0.49955) <= max (0.50362) ok 780 - h id: exact (0.31395) ~ est (0.31347) ok 781 - h id: exact (0.31395) <= max (0.31721) ok 782 - h cn: exact (0.51535) ~ est (0.51578) ok 783 - h cn: exact (0.51535) <= max (0.51814) ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5 ok 785 - q id: exact (0.29334) ~ est (0.29534) ok 786 - q id: exact (0.29334) <= max (0.29810) ok 787 - q cn: exact (0.46617) ~ est (0.46719) ok 788 - q cn: exact (0.46617) <= max (0.47040) ok 789 - h id: exact (0.31176) ~ est (0.31176) ok 790 - h id: exact (0.31176) <= max (0.31176) ok 791 - h cn: exact (0.49299) ~ est (0.49299) ok 792 - h cn: exact (0.49299) <= max (0.49299) ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7 ok 794 - q id: exact (0.30456) ~ est (0.30514) ok 795 - q id: exact (0.30456) <= max (0.30650) ok 796 - q cn: exact (0.48739) ~ est (0.48879) ok 797 - q cn: exact (0.48739) <= max (0.49370) ok 798 - h id: exact (0.32062) ~ est (0.31987) ok 799 - h id: exact (0.32062) <= max (0.32932) ok 800 - h cn: exact (0.51071) ~ est (0.51306) ok 801 - h cn: exact (0.51071) <= max (0.52410) ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8 ok 803 - q id: exact (0.29615) ~ est (0.29879) ok 804 - q id: exact (0.29615) <= max (0.30009) ok 805 - q cn: exact (0.47419) ~ est (0.47394) ok 806 - q cn: exact (0.47419) <= max (0.48119) ok 807 - h id: exact (0.31611) ~ est (0.31482) ok 808 - h id: exact (0.31611) <= max (0.32227) ok 809 - h cn: exact (0.49779) ~ est (0.49788) ok 810 - h cn: exact (0.49779) <= max (0.50616) ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8 ok 812 - q id: exact (0.30390) ~ est (0.30440) ok 813 - q id: exact (0.30390) <= max (0.30701) ok 814 - q cn: exact (0.45874) ~ est (0.45993) ok 815 - q cn: exact (0.45874) <= max (0.45963) ok 816 - h id: exact (0.32282) ~ est (0.32324) ok 817 - h id: exact (0.32282) <= max (0.32560) ok 818 - h cn: exact (0.48052) ~ est (0.48136) ok 819 - h cn: exact (0.48052) <= max (0.48330) ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6 ok 821 - q id: exact (0.29769) ~ est (0.29851) ok 822 - q id: exact (0.29769) <= max (0.29769) ok 823 - q cn: exact (0.48480) ~ est (0.48628) ok 824 - q cn: exact (0.48480) <= max (0.48637) ok 825 - h id: exact (0.30704) ~ est (0.30810) ok 826 - h id: exact (0.30704) <= max (0.30917) ok 827 - h cn: exact (0.50107) ~ est (0.50292) ok 828 - h cn: exact (0.50107) <= max (0.50320) ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6 ok 830 - q id: exact (0.27854) ~ est (0.27854) ok 831 - q id: exact (0.27854) <= max (0.27854) ok 832 - q cn: exact (0.48174) ~ est (0.48174) ok 833 - q cn: exact (0.48174) <= max (0.48174) ok 834 - h id: exact (0.28514) ~ est (0.28623) ok 835 - h id: exact (0.28514) <= max (0.28594) ok 836 - h cn: exact (0.49197) ~ est (0.49154) ok 837 - h cn: exact (0.49197) <= max (0.49237) ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8 ok 839 - q id: exact (0.30362) ~ est (0.30824) ok 840 - q id: exact (0.30362) <= max (0.30852) ok 841 - q cn: exact (0.47111) ~ est (0.47587) ok 842 - q cn: exact (0.47111) <= max (0.47405) ok 843 - h id: exact (0.32347) ~ est (0.32392) ok 844 - h id: exact (0.32347) <= max (0.32643) ok 845 - h cn: exact (0.49310) ~ est (0.49360) ok 846 - h cn: exact (0.49310) <= max (0.49606) ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4 ok 848 - q id: exact (0.29174) ~ est (0.29174) ok 849 - q id: exact (0.29174) <= max (0.29174) ok 850 - q cn: exact (0.46230) ~ est (0.46230) ok 851 - q cn: exact (0.46230) <= max (0.46230) ok 852 - h id: exact (0.30204) ~ est (0.30204) ok 853 - h id: exact (0.30204) <= max (0.30204) ok 854 - h cn: exact (0.47862) ~ est (0.47862) ok 855 - h cn: exact (0.47862) <= max (0.47862) ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6 ok 857 - q id: exact (0.29064) ~ est (0.29089) ok 858 - q id: exact (0.29064) <= max (0.29115) ok 859 - q cn: exact (0.48765) ~ est (0.48670) ok 860 - q cn: exact (0.48765) <= max (0.48868) ok 861 - h id: exact (0.29848) ~ est (0.29887) ok 862 - h id: exact (0.29848) <= max (0.29902) ok 863 - h cn: exact (0.50108) ~ est (0.50116) ok 864 - h cn: exact (0.50108) <= max (0.50163) ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5 ok 866 - q id: exact (0.29510) ~ est (0.29505) ok 867 - q id: exact (0.29510) <= max (0.29510) ok 868 - q cn: exact (0.48982) ~ est (0.49039) ok 869 - q cn: exact (0.48982) <= max (0.49029) ok 870 - h id: exact (0.30019) ~ est (0.30019) ok 871 - h id: exact (0.30019) <= max (0.30019) ok 872 - h cn: exact (0.49906) ~ est (0.49906) ok 873 - h cn: exact (0.49906) <= max (0.49906) ok 874 - 503384.MEGABLAST.2 ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5 ok 876 - q id: exact (0.91435) ~ est (0.91435) ok 877 - q id: exact (0.91435) <= max (0.91435) ok 878 - q cn: exact (0.91435) ~ est (0.91435) ok 879 - q cn: exact (0.91435) <= max (0.91435) ok 880 - h id: exact (0.91157) ~ est (0.91157) ok 881 - h id: exact (0.91157) <= max (0.91157) ok 882 - h cn: exact (0.91157) ~ est (0.91157) ok 883 - h cn: exact (0.91157) <= max (0.91157) ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9 ok 885 - q id: exact (0.92895) ~ est (0.92895) ok 886 - q id: exact (0.92895) <= max (0.92895) ok 887 - q cn: exact (0.92895) ~ est (0.92895) ok 888 - q cn: exact (0.92895) <= max (0.92895) ok 889 - h id: exact (0.92854) ~ est (0.92854) ok 890 - h id: exact (0.92854) <= max (0.92854) ok 891 - h cn: exact (0.92854) ~ est (0.92854) ok 892 - h cn: exact (0.92854) <= max (0.92854) ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3 ok 894 - q id: exact (0.93516) ~ est (0.93516) ok 895 - q id: exact (0.93516) <= max (0.93516) ok 896 - q cn: exact (0.93516) ~ est (0.93516) ok 897 - q cn: exact (0.93516) <= max (0.93516) ok 898 - h id: exact (0.93651) ~ est (0.93651) ok 899 - h id: exact (0.93651) <= max (0.93651) ok 900 - h cn: exact (0.93651) ~ est (0.93651) ok 901 - h cn: exact (0.93651) <= max (0.93651) ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3 ok 903 - q id: exact (0.93064) ~ est (0.93064) ok 904 - q id: exact (0.93064) <= max (0.93064) ok 905 - q cn: exact (0.93064) ~ est (0.93064) ok 906 - q cn: exact (0.93064) <= max (0.93064) ok 907 - h id: exact (0.92885) ~ est (0.92885) ok 908 - h id: exact (0.92885) <= max (0.92885) ok 909 - h cn: exact (0.92885) ~ est (0.92885) ok 910 - h cn: exact (0.92885) <= max (0.92885) ok 911 - bl2seq.blastx.out ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6 ok 913 - q id: est (0.71429) = fast (0.71429) ok 914 - q cn: est (1.00000) = fast (1.00000) ok 915 - q id: exact (0.70536) ~ est (0.70495) ok 916 - q id: exact (0.70536) <= max (0.94286) ok 917 - q cn: exact (0.78810) ~ est (0.78803) ok 918 - q cn: exact (0.78810) <= max (0.96429) ok 919 - q id: est (0.35714) = fast (0.35714) ok 920 - q cn: est (0.57143) = fast (0.57143) ok 921 - h id: exact (0.61923) ~ est (0.61955) ok 922 - h id: exact (0.61923) <= max (0.64231) ok 923 - h cn: exact (0.73077) ~ est (0.73077) ok 924 - h cn: exact (0.73077) <= max (0.75000) ok 925 - dnaEbsub_ecoli.wublastx ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1 ok 927 - q id: est (0.36386) = fast (0.36386) ok 928 - q cn: est (0.53735) = fast (0.53735) ok 929 - h id: est (0.36562) = fast (0.36562) ok 930 - h cn: est (0.53995) = fast (0.53995) ok 931 - tblastn.out ok 932 - tile tblastn.out hit 1 \#hsps 2 ok 933 - q id: exact (0.31250) ~ est (0.33325) ok 934 - q id: exact (0.31250) <= max (0.33333) ok 935 - q cn: exact (0.44792) ~ est (0.47055) ok 936 - q cn: exact (0.44792) <= max (0.45833) ok 937 - h id: exact (0.33333) ~ est (0.33333) ok 938 - h id: exact (0.33333) <= max (0.33333) ok 939 - h cn: exact (0.47059) ~ est (0.47059) ok 940 - h cn: exact (0.47059) <= max (0.47059) ok 941 - tile tblastn.out hit 2 \#hsps 2 ok 942 - q id: exact (0.68750) ~ est (0.68750) ok 943 - q id: exact (0.68750) <= max (0.68750) ok 944 - q cn: exact (0.81250) ~ est (0.81250) ok 945 - q cn: exact (0.81250) <= max (0.81250) ok 946 - h id: est (0.66667) = fast (0.66667) ok 947 - h cn: est (0.77778) = fast (0.77778) ok 948 - h id: est (0.71429) = fast (0.71429) ok 949 - h cn: est (0.85714) = fast (0.85714) ok 950 - dnaEbsub_ecoli.wutblastn ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1 ok 952 - q id: est (0.36386) = fast (0.36386) ok 953 - q cn: est (0.53735) = fast (0.53735) ok 954 - h id: est (0.36562) = fast (0.36562) ok 955 - h cn: est (0.53995) = fast (0.53995) ok 956 - HUMBETGLOA.tblastx ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1 ok 958 - q id: est (0.42308) = fast (0.42308) ok 959 - q cn: est (0.61538) = fast (0.61538) ok 960 - h id: est (0.42308) = fast (0.42308) ok 961 - h cn: est (0.61538) = fast (0.61538) ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1 ok 963 - q id: est (0.47059) = fast (0.47059) ok 964 - q cn: est (0.76471) = fast (0.76471) ok 965 - h id: est (0.47059) = fast (0.47059) ok 966 - h cn: est (0.76471) = fast (0.76471) ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1 ok 968 - q id: est (0.36000) = fast (0.36000) ok 969 - q cn: est (0.56000) = fast (0.56000) ok 970 - h id: est (0.36000) = fast (0.36000) ok 971 - h cn: est (0.56000) = fast (0.56000) ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1 ok 973 - q id: est (0.29268) = fast (0.29268) ok 974 - q cn: est (0.58537) = fast (0.58537) ok 975 - h id: est (0.29268) = fast (0.29268) ok 976 - h cn: est (0.58537) = fast (0.58537) ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1 ok 978 - q id: est (0.38889) = fast (0.38889) ok 979 - q cn: est (0.55556) = fast (0.55556) ok 980 - h id: est (0.38889) = fast (0.38889) ok 981 - h cn: est (0.55556) = fast (0.55556) ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1 ok 983 - q id: est (0.43590) = fast (0.43590) ok 984 - q cn: est (0.51282) = fast (0.51282) ok 985 - h id: est (0.43590) = fast (0.43590) ok 986 - h cn: est (0.51282) = fast (0.51282) ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1 ok 988 - q id: est (0.35714) = fast (0.35714) ok 989 - q cn: est (0.42857) = fast (0.42857) ok 990 - h id: est (0.35714) = fast (0.35714) ok 991 - h cn: est (0.42857) = fast (0.42857) ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1 ok 993 - q id: est (0.33333) = fast (0.33333) ok 994 - q cn: est (0.66667) = fast (0.66667) ok 995 - h id: est (0.33333) = fast (0.33333) ok 996 - h cn: est (0.66667) = fast (0.66667) ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2 ok 998 - q id: exact (0.40541) ~ est (0.40541) ok 999 - q id: exact (0.40541) <= max (0.40541) ok 1000 - q cn: exact (0.56757) ~ est (0.56757) ok 1001 - q cn: exact (0.56757) <= max (0.56757) ok 1002 - h id: est (0.36364) = fast (0.36364) ok 1003 - h cn: est (0.63636) = fast (0.63636) ok 1004 - h id: est (0.42308) = fast (0.42308) ok 1005 - h cn: est (0.53846) = fast (0.53846) ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1 ok 1007 - q id: est (0.29167) = fast (0.29167) ok 1008 - q cn: est (0.39583) = fast (0.39583) ok 1009 - h id: est (0.29167) = fast (0.29167) ok 1010 - h cn: est (0.39583) = fast (0.39583) ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1 ok 1012 - q id: est (0.60000) = fast (0.60000) ok 1013 - q cn: est (0.65000) = fast (0.65000) ok 1014 - h id: est (0.60000) = fast (0.60000) ok 1015 - h cn: est (0.65000) = fast (0.65000) ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1 ok 1017 - q id: est (0.50000) = fast (0.50000) ok 1018 - q cn: est (0.68182) = fast (0.68182) ok 1019 - h id: est (0.50000) = fast (0.50000) ok 1020 - h cn: est (0.68182) = fast (0.68182) ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1 ok 1022 - q id: est (0.29630) = fast (0.29630) ok 1023 - q cn: est (0.48148) = fast (0.48148) ok 1024 - h id: est (0.29630) = fast (0.29630) ok 1025 - h cn: est (0.48148) = fast (0.48148) ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1 ok 1027 - q id: est (0.47826) = fast (0.47826) ok 1028 - q cn: est (0.52174) = fast (0.52174) ok 1029 - h id: est (0.47826) = fast (0.47826) ok 1030 - h cn: est (0.52174) = fast (0.52174) ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1 ok 1032 - q id: est (0.47368) = fast (0.47368) ok 1033 - q cn: est (0.63158) = fast (0.63158) ok 1034 - h id: est (0.47368) = fast (0.47368) ok 1035 - h cn: est (0.63158) = fast (0.63158) ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1 ok 1037 - q id: est (0.44444) = fast (0.44444) ok 1038 - q cn: est (0.55556) = fast (0.55556) ok 1039 - h id: est (0.44444) = fast (0.44444) ok 1040 - h cn: est (0.55556) = fast (0.55556) ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1 ok 1042 - q id: est (0.47059) = fast (0.47059) ok 1043 - q cn: est (0.70588) = fast (0.70588) ok 1044 - h id: est (0.47059) = fast (0.47059) ok 1045 - h cn: est (0.70588) = fast (0.70588) ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1 ok 1047 - q id: est (0.38889) = fast (0.38889) ok 1048 - q cn: est (0.66667) = fast (0.66667) ok 1049 - h id: est (0.38889) = fast (0.38889) ok 1050 - h cn: est (0.66667) = fast (0.66667) ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1 ok 1052 - q id: est (0.27660) = fast (0.27660) ok 1053 - q cn: est (0.48936) = fast (0.48936) ok 1054 - h id: est (0.27660) = fast (0.27660) ok 1055 - h cn: est (0.48936) = fast (0.48936) ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1 ok 1057 - q id: est (0.40000) = fast (0.40000) ok 1058 - q cn: est (0.60000) = fast (0.60000) ok 1059 - h id: est (0.40000) = fast (0.40000) ok 1060 - h cn: est (0.60000) = fast (0.60000) ok 1061 - dnaEbsub_ecoli.wutblastx ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12 ok 1063 - q id: exact (0.40224) ~ est (0.40912) ok 1064 - q id: exact (0.40224) <= max (0.42628) ok 1065 - q cn: exact (0.58494) ~ est (0.58968) ok 1066 - q cn: exact (0.58494) <= max (0.62179) ok 1067 - q id: est (0.25352) = fast (0.25352) ok 1068 - q cn: est (0.47887) = fast (0.47887) ok 1069 - q id: est (0.37500) = fast (0.37500) ok 1070 - q cn: est (0.62500) = fast (0.62500) ok 1071 - q id: exact (0.44118) ~ est (0.44118) ok 1072 - q id: exact (0.44118) <= max (0.44118) ok 1073 - q cn: exact (0.54412) ~ est (0.54412) ok 1074 - q cn: exact (0.54412) <= max (0.54412) ok 1075 - h id: est (0.25352) = fast (0.25352) ok 1076 - h cn: est (0.47887) = fast (0.47887) ok 1077 - h id: exact (0.39848) ~ est (0.40304) ok 1078 - h id: exact (0.39848) <= max (0.40355) ok 1079 - h cn: exact (0.58376) ~ est (0.58889) ok 1080 - h cn: exact (0.58376) <= max (0.58883) ok 1081 - h id: exact (0.44118) ~ est (0.44118) ok 1082 - h id: exact (0.44118) <= max (0.44118) ok 1083 - h cn: exact (0.54412) ~ est (0.54412) ok 1084 - h cn: exact (0.54412) <= max (0.54412) ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2 ok 1086 - q id: exact (0.41818) ~ est (0.41818) ok 1087 - q id: exact (0.41818) <= max (0.41818) ok 1088 - q cn: exact (0.52727) ~ est (0.52727) ok 1089 - q cn: exact (0.52727) <= max (0.52727) ok 1090 - h id: est (0.53333) = fast (0.53333) ok 1091 - h cn: est (0.66667) = fast (0.66667) ok 1092 - h id: est (0.37500) = fast (0.37500) ok 1093 - h cn: est (0.47500) = fast (0.47500) ok 1094 - bug2942: query m0: range correct ok 1095 - bug2942: query m1: range correct ok 1096 - bug2942: query m2: range correct ok 1097 - bug2942: subject all : range correct ok 1098 - get_tiled_alns ok 1099 - got all alns ok 1100 ok 1101 - aln and qfeat lengths correspond ok 1102 - q length correct ok 1103 ok 1104 - features on q and s correspond ok 1105 - aln and hfeat lengths correspond ok 1106 - s length correct ok 1107 ok 1108 - aln and qfeat lengths correspond ok 1109 - q length correct ok 1110 ok 1111 - features on q and s correspond ok 1112 - aln and hfeat lengths correspond ok 1113 - s length correct ok 1114 ok 1115 - aln and qfeat lengths correspond ok 1116 - q length correct ok 1117 ok 1118 - features on q and s correspond ok 1119 - aln and hfeat lengths correspond ok 1120 - s length correct ok 1121 ok 1122 - aln and qfeat lengths correspond ok 1123 - q length correct ok 1124 ok 1125 - features on q and s correspond ok 1126 - aln and hfeat lengths correspond ok 1127 - s length correct ok 1128 ok 1129 - aln and qfeat lengths correspond ok 1130 - q length correct ok 1131 ok 1132 - features on q and s correspond ok 1133 - aln and hfeat lengths correspond ok 1134 - s length correct ok 1135 ok 1136 - aln and qfeat lengths correspond ok 1137 - q length correct ok 1138 ok 1139 - features on q and s correspond ok 1140 - aln and hfeat lengths correspond ok 1141 - s length correct ok t/SearchIO/Writer/GbrowseGFF.t ......... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/Writer/HSPTableWriter.t ..... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HSPTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/HTMLWriter.t ......... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/HitTableWriter.t ..... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HitTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/TextWriter.t ......... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::TextResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/axt.t ....................... 1..19 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/SearchIO/blast.t ..................... 1..1389 ok 1 - use Bio::SearchIO; ok 2 - Bio::SearchIO->new can handle a Path::Class object ok 3 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 4 - Bio::SearchIO->new can handle a Path::Class object ok 5 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 6 ok 7 - database_name() ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 not ok 415 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 668. # '0.852' # > # '0.9' not ok 416 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 669. # '1.599' # <= # '1' ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 - Multiblast query test ok 598 ok 599 - Multiblast query test ok 600 ok 601 - Multiblast query test ok 602 ok 603 - Multiblast query test ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 ok 979 ok 980 ok 981 ok 982 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 ok 1007 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 ok 1055 ok 1056 ok 1057 ok 1058 ok 1059 ok 1060 ok 1061 ok 1062 ok 1063 ok 1064 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1065 ok 1066 ok 1067 ok 1068 ok 1069 ok 1070 ok 1071 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 - blastxml for f.blastxml ok 1084 - fasta for f.fy ok 1085 - exonerate for f.exonerate ok 1086 - blast for f.tblx ok 1087 - fasta for f.fx ok 1088 - fasta for f.osearch ok 1089 - blast for filename.bls ok 1090 - exonerate for f.exon ok 1091 - fasta for f.SSEARCH.m9 ok 1092 - blast for filename.blast ok 1093 - fasta for f.m9 ok 1094 - blast for f.blx ok 1095 - blastxml for f.xml ok 1096 - fasta for f.fasta ok 1097 - fasta for f.fa ok 1098 - blast for fast.bls ok 1099 - fasta for f.ssearch ok 1100 - fasta for f.psearch ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 - full hit name ok 1117 - hit accession ok 1118 ok 1119 ok 1120 - query start ok 1121 - query start ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok 1146 ok 1147 ok 1148 ok 1149 ok 1150 ok 1151 ok 1152 ok 1153 ok 1154 ok 1155 ok 1156 ok 1157 ok 1158 ok 1159 ok 1160 ok 1161 ok 1162 ok 1163 ok 1164 ok 1165 ok 1166 ok 1167 ok 1168 ok 1169 ok 1170 ok 1171 ok 1172 ok 1173 ok 1174 ok 1175 ok 1176 ok 1177 ok 1178 ok 1179 ok 1180 ok 1181 ok 1182 ok 1183 ok 1184 ok 1185 ok 1186 ok 1187 ok 1188 ok 1189 ok 1190 ok 1191 ok 1192 ok 1193 ok 1194 ok 1195 ok 1196 ok 1197 ok 1198 ok 1199 ok 1200 ok 1201 ok 1202 ok 1203 ok 1204 ok 1205 ok 1206 ok 1207 ok 1208 ok 1209 ok 1210 ok 1211 ok 1212 ok 1213 ok 1214 ok 1215 ok 1216 ok 1217 ok 1218 ok 1219 ok 1220 ok 1221 ok 1222 ok 1223 ok 1224 ok 1225 ok 1226 ok 1227 ok 1228 ok 1229 ok 1230 ok 1231 ok 1232 ok 1233 ok 1234 ok 1235 ok 1236 ok 1237 ok 1238 ok 1239 ok 1240 ok 1241 ok 1242 ok 1243 ok 1244 ok 1245 ok 1246 ok 1247 ok 1248 ok 1249 ok 1250 ok 1251 ok 1252 ok 1253 ok 1254 ok 1255 ok 1256 ok 1257 ok 1258 ok 1259 ok 1260 ok 1261 ok 1262 ok 1263 ok 1264 ok 1265 ok 1266 ok 1267 ok 1268 ok 1269 ok 1270 ok 1271 ok 1272 ok 1273 ok 1274 ok 1275 ok 1276 ok 1277 ok 1278 ok 1279 ok 1280 ok 1281 ok 1282 ok 1283 ok 1284 ok 1285 ok 1286 ok 1287 ok 1288 ok 1289 ok 1290 ok 1291 ok 1292 ok 1293 ok 1294 ok 1295 ok 1296 ok 1297 ok 1298 ok 1299 ok 1300 ok 1301 ok 1302 ok 1303 ok 1304 ok 1305 ok 1306 ok 1307 ok 1308 ok 1309 ok 1310 ok 1311 ok 1312 ok 1313 ok 1314 ok 1315 ok 1316 ok 1317 ok 1318 ok 1319 ok 1320 ok 1321 ok 1322 ok 1323 ok 1324 ok 1325 ok 1326 ok 1327 ok 1328 ok 1329 ok 1330 ok 1331 ok 1332 ok 1333 ok 1334 ok 1335 ok 1336 ok 1337 ok 1338 ok 1339 ok 1340 ok 1341 ok 1342 ok 1343 ok 1344 ok 1345 ok 1346 ok 1347 ok 1348 ok 1349 ok 1350 ok 1351 ok 1352 ok 1353 ok 1354 ok 1355 ok 1356 ok 1357 ok 1358 ok 1359 ok 1360 ok 1361 ok 1362 ok 1363 ok 1364 ok 1365 ok 1366 ok 1367 ok 1368 ok 1369 ok 1370 ok 1371 ok 1372 ok 1373 ok 1374 ok 1375 ok 1376 ok 1377 ok 1378 ok 1379 ok 1380 ok 1381 ok 1382 ok 1383 ok 1384 - testing Bug 3298 ok 1385 - testing Bug 3298 ok 1386 - testing Bug 3298 ok 1387 - testing Bug 3251 ok 1388 - testing Bug 3251 ok 1389 - testing Bug 3251 ok t/SearchIO/blast_pull.t ................ 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - database_name() ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 not ok 191 # TODO frac_identical failing! # Failed (TODO) test at t/SearchIO/blast_pull.t line 260. # got: '0.946' # expected: '0.943' ok 192 ok 193 ok 194 ok 195 ok 196 - Multiblast query test ok 197 - Multiblast query test ok 198 - Multiblast query test ok 199 - Multiblast query test ok 200 ok 201 ok 202 ok 203 - full hit name ok 204 - hit accession ok 205 ok 206 - query start ok 207 - query start ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok t/SearchIO/blasttable.t ................ 1..166 ok 1 - use Bio::SearchIO; ok 2 - use Bio::Search::SearchUtils; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 - hit1_bits ok 7 - hit1_name ok 8 - hsp1_bits ok 9 - hsp1_gaps ok 10 - hsp1_he ok 11 - hsp1_hs ok 12 - hsp1_hstr ok 13 - hsp1_qe ok 14 - hsp1_qs ok 15 - hsp1_qstr ok 16 - hsp2_bits ok 17 - hsp2_gaps ok 18 - hsp2_he ok 19 - hsp2_hs ok 20 - hsp2_hstr ok 21 - hsp2_qe ok 22 - hsp2_qs ok 23 - hsp2_qstr ok 24 - hsp3_bits ok 25 - hsp3_gaps ok 26 - hsp3_he ok 27 - hsp3_hs ok 28 - hsp3_hstr ok 29 - hsp3_qe ok 30 - hsp3_qs ok 31 - hsp3_qstr ok 32 - hsp4_bits ok 33 - hsp4_gaps ok 34 - hsp4_he ok 35 - hsp4_hs ok 36 - hsp4_hstr ok 37 - hsp4_qe ok 38 - hsp4_qs ok 39 - hsp4_qstr ok 40 - hsp5_bits ok 41 - hsp5_gaps ok 42 - hsp5_he ok 43 - hsp5_hs ok 44 - hsp5_hstr ok 45 - hsp5_qe ok 46 - hsp5_qs ok 47 - hsp5_qstr ok 48 - hsp6_bits ok 49 - hsp6_gaps ok 50 - hsp6_he ok 51 - hsp6_hs ok 52 - hsp6_hstr ok 53 - hsp6_qe ok 54 - hsp6_qs ok 55 - hsp6_qstr ok 56 - hsp7_bits ok 57 - hsp7_gaps ok 58 - hsp7_he ok 59 - hsp7_hs ok 60 - hsp7_hstr ok 61 - hsp7_qe ok 62 - hsp7_qs ok 63 - hsp7_qstr ok 64 - hsp8_bits ok 65 - hsp8_gaps ok 66 - hsp8_he ok 67 - hsp8_hs ok 68 - hsp8_hstr ok 69 - hsp8_qe ok 70 - hsp8_qs ok 71 - hsp8_qstr ok 72 - query_name ok 73 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 74 ok 75 ok 76 - hit1_bits ok 77 - hit1_name ok 78 - hsp1_bits ok 79 - hsp1_gaps ok 80 - hsp1_he ok 81 - hsp1_hs ok 82 - hsp1_hstr ok 83 - hsp1_qe ok 84 - hsp1_qs ok 85 - hsp1_qstr ok 86 - hsp2_bits ok 87 - hsp2_gaps ok 88 - hsp2_he ok 89 - hsp2_hs ok 90 - hsp2_hstr ok 91 - hsp2_qe ok 92 - hsp2_qs ok 93 - hsp2_qstr ok 94 - hsp3_bits ok 95 - hsp3_gaps ok 96 - hsp3_he ok 97 - hsp3_hs ok 98 - hsp3_hstr ok 99 - hsp3_qe ok 100 - hsp3_qs ok 101 - hsp3_qstr ok 102 - hsp4_bits ok 103 - hsp4_gaps ok 104 - hsp4_he ok 105 - hsp4_hs ok 106 - hsp4_hstr ok 107 - hsp4_qe ok 108 - hsp4_qs ok 109 - hsp4_qstr ok 110 - hsp5_bits ok 111 - hsp5_gaps ok 112 - hsp5_he ok 113 - hsp5_hs ok 114 - hsp5_hstr ok 115 - hsp5_qe ok 116 - hsp5_qs ok 117 - hsp5_qstr ok 118 - hsp6_bits ok 119 - hsp6_gaps ok 120 - hsp6_he ok 121 - hsp6_hs ok 122 - hsp6_hstr ok 123 - hsp6_qe ok 124 - hsp6_qs ok 125 - hsp6_qstr ok 126 - hsp7_bits ok 127 - hsp7_gaps ok 128 - hsp7_he ok 129 - hsp7_hs ok 130 - hsp7_hstr ok 131 - hsp7_qe ok 132 - hsp7_qs ok 133 - hsp7_qstr ok 134 - hsp8_bits ok 135 - hsp8_gaps ok 136 - hsp8_he ok 137 - hsp8_hs ok 138 - hsp8_hstr ok 139 - hsp8_qe ok 140 - hsp8_qs ok 141 - hsp8_qstr ok 142 - query_name ok 143 ok 144 ok 145 ok 146 ok 147 - hit score ok 148 - hit raw_score ok 149 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 - fixed bug 3343 (percent identity) ok 158 - side effect of fixing bug 3343 (number of gaps) ok 159 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 160 ok 161 ok 162 ok 163 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 164 ok 165 ok 166 ok t/SearchIO/blastxml.t .................. 1..391 ok 1 - use Bio::SearchIO; ok 2 ok 3 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 4 - database_name() ok 5 - query_name() ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - database_name() ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 - query name on HSP ok 61 - query desc on HSP ok 62 - hitname ok 63 - hitdesc ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 - query name on HSP ok 169 - query desc on HSP ok 170 - hitname ok 171 - hitdesc ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 - query name on HSP ok 215 - query desc on HSP ok 216 - hitname ok 217 - hitdesc ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok t/SearchIO/cross_match.t ............... 1..15 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SearchIO/erpin.t ..................... 1..91 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result ERPIN ok 4 - Result ERPIN reference ok 5 - Result ERPIN version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_name ok 16 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 17 - Hit accession ok 18 - Hit GI ok 19 - Hit algorithm ok 20 - Hit bits ok 21 - Hit description ok 22 - Hit length ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit overlap ok 28 - Hit query_length ok 29 - Hit rank ok 30 - Hit raw_score ok 31 - Hit score ok 32 ok 33 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 34 - HSP algorithm ok 35 ok 36 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 37 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 38 - HSP frame ok 39 - HSP gaps ok 40 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 41 - HSP hit_string ok 42 - HSP homology_string ok 43 - HSP hsp_group ok 44 - HSP hsp_length ok 45 - HSP length ok 46 - HSP links ok 47 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 48 - HSP query_string ok 49 - HSP range ok 50 - HSP rank ok 51 ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 ok 59 ok 60 - HSP strand ok 61 ok 62 ok 63 - ERPIN get_aln warning ok 64 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 65 - HSP algorithm ok 66 ok 67 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 68 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 69 - HSP frame ok 70 - HSP gaps ok 71 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 72 - HSP hit_string ok 73 - HSP homology_string ok 74 - HSP query_string ok 75 - HSP hsp_group ok 76 - HSP hsp_length ok 77 - HSP length ok 78 - HSP links ok 79 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 80 - HSP range ok 81 - HSP rank ok 82 ok 83 - HSP end ok 84 - HSP expect ok 85 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 86 - HSP seq_str ok 87 - HSP start ok 88 - HSP custom_score ok 89 ok 90 ok 91 - HSP strand ok t/SearchIO/exonerate.t ................. 1..52 ok 1 - use Bio::SearchIO; ok 2 ok 3 # skip no query length available in default output ok 4 ok 5 # skip no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # skip no query length available in default output ok 26 ok 27 # skip no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - query_name ok 47 ok 48 - query_name ok 49 ok 50 - query_name ok 51 ok 52 ok t/SearchIO/fasta.t ..................... 1..299 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 - TFASTXY ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 - num_identical() ok 287 - num_conserved() ok 288 - bug 2937 and FASTA version 3.5 ok 289 - algorithm version ok 290 - query name ok 291 - query description ok 292 - query length ok 293 - algorithm ok 294 - num_identical() ok 295 - num_conserved() ok 296 - hsp->strand(hit) ok 297 - hsp->hit->strand ok 298 - hsp->strand(query) ok 299 - hsp->query->strand ok t/SearchIO/gmap_f9.t ................... 1..54 ok 1 - use Bio::SearchIO; ok 2 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 3 - Did we get the expected number of hits? ok 4 - Did we get the expected algorithm? ok 5 - Did we get the expected query_name? ok 6 - 'Did we get a Hit?' isa 'Bio::Search::Hit::GenericHit' ok 7 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 8 - Check the name ok 9 - Check the hit length ok 10 - Check the number of hsps ok 11 - Check the query length ok 12 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 13 - Check the algorithm ok 14 - Count gaps in the query ok 15 - Count gaps in the hit ok 16 - Length of the query ok 17 - Length of the hit ok 18 - Query sequence ok 19 - Hit sequence ok 20 - Check query start ok 21 - Check query end ok 22 - Check query end ok 23 - Check the homology string ok 24 - Check seq_inds ok 25 - Check hit start ok 26 - Check hit end ok 27 - Check hit end ok 28 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 29 - Did we get the expected number of hits? ok 30 - Did we get the expected algorithm? ok 31 - Did we get the expected query_name? ok 32 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 33 - Check the name ok 34 - Check the hit length ok 35 - Check the number of hsps ok 36 - Check the query length ok 37 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 38 - Check the algorithm ok 39 - Count gaps in the query ok 40 - Count gaps in the hit ok 41 - Length of the query ok 42 - Length of the hit ok 43 - Query sequence ok 44 - Hit sequence ok 45 - Check query start ok 46 - Check query end ok 47 - Check query end ok 48 - Check the homology string ok 49 - Check seq_inds ok 50 - Check hit start ok 51 - Check hit end ok 52 - Check hit end ok 53 - Can we loop over multiple results properly (expecting 58)? ok 54 - simple query_name now caught, bug 3021 ok t/SearchIO/hmmer.t ..................... 1..773 ok 1 - use Bio::SearchIO; ok 2 - Check for the correct result reference type ok 3 - Check algorithm ok 4 - Check algorithm version ok 5 - Check hmm_name ok 6 - Check sequence_file ok 7 - Check query_name ok 8 - Check query_length absence ok 9 - Check query_description ok 10 - Check num_hits ok 11 - Check for the correct hit reference type ok 12 - Check hit name ok 13 - Check for hit description ok 14 - Check hit raw_score ok 15 - Check hit significance ok 16 - Check num_hsps ok 17 - Check hit length ok 18 ok 19 ok 20 - Check hit total conserved residues ok 21 - Check hit total identical residues ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - Check for correct hsp reference type ok 29 - Check for query seq_id ok 30 - Check for hit seq_id ok 31 - Check for hit hmmfrom value ok 32 - Check for hit hmm to value ok 33 - Check for query alifrom value ok 34 - Check for query ali to value ok 35 - Check for hsp score ok 36 - Check for hsp c-Evalue ok 37 - Check for hsp query length ok 38 - Check for hsp hit length ok 39 - Check for hsp total length ok 40 - Check for hsp query gaps ok 41 - Check for hsp hit gaps ok 42 - Check for hsp total gaps ok 43 - Check hit length consistency ok 44 - Check query length consistency ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - Check for query string ok 55 - Check for hit string ok 56 - Check for homology string ok 57 - Check if homology string and hit string have an equal length ok 58 - Check if query string and homology string have an equal length ok 59 ok 60 ok 61 - Check for the correct hit reference type ok 62 - Check hit name ok 63 - Check for hit description ok 64 - Check hit raw_score ok 65 - Check hit significance ok 66 - Check num_hsps ok 67 - Check hit length ok 68 ok 69 ok 70 - Check hit total conserved residues ok 71 - Check hit total identical residues ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Check for correct hsp reference type ok 79 - Check for query seq_id ok 80 - Check for hit seq_id ok 81 - Check for hit hmmfrom value ok 82 - Check for hit hmm to value ok 83 - Check for query alifrom value ok 84 - Check for query ali to value ok 85 - Check for hsp score ok 86 - Check for hsp c-Evalue ok 87 - Check for hsp query length ok 88 - Check for hsp hit length ok 89 - Check for hsp total length ok 90 - Check for hsp query gaps ok 91 - Check for hsp hit gaps ok 92 - Check for hsp total gaps ok 93 - Check hit length consistency ok 94 - Check query length consistency ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 - Check for query string ok 105 - Check for hit string ok 106 - Check for homology string ok 107 - Check if homology string and hit string have an equal length ok 108 - Check if query string and homology string have an equal length ok 109 - Check for the correct result reference type ok 110 - Check algorithm ok 111 - Check algorithm version ok 112 - Check hmm_name ok 113 - Check sequence_file ok 114 - Check database_name ok 115 - Check query_name ok 116 - Check query_length ok 117 - Check query_description ok 118 - Check num_hits ok 119 - Check for the correct hit reference type ok 120 - Check hit name ok 121 - Check for hit description ok 122 - Check hit raw_score ok 123 - Check hit significance ok 124 - Check num_hsps ok 125 - Check hit length ok 126 - Check for correct hsp reference type ok 127 - Check for query seq_id ok 128 - Check for hit seq_id ok 129 - Check for hit hmmfrom value ok 130 - Check for hit hmm to value ok 131 - Check for query alifrom value ok 132 - Check for query ali to value ok 133 - Check for hsp score ok 134 - Check for hsp c-Evalue ok 135 - Check for hsp query length ok 136 - Check for hsp hit length ok 137 - Check for hsp total length ok 138 - Check for hsp query gaps ok 139 - Check for hsp hit gaps ok 140 - Check for hsp total gaps ok 141 - Check hit length ok 142 ok 143 ok 144 - Check for query seq_id ok 145 - Check for hit seq_id ok 146 - Check for hit hmmfrom value ok 147 - Check for hit hmm to value ok 148 - Check for query alifrom value ok 149 - Check for query ali to value ok 150 - Check for hsp score ok 151 - Check for hsp c-Evalue ok 152 - Check for hsp query length ok 153 - Check for hsp hit length ok 154 - Check for hsp total length ok 155 - Check for hsp query gaps ok 156 - Check for hsp hit gaps ok 157 - Check for hsp total gaps ok 158 - Check hit length ok 159 ok 160 ok 161 - Check for query seq_id ok 162 - Check for hit seq_id ok 163 - Check for hit hmmfrom value ok 164 - Check for hit hmm to value ok 165 - Check for query alifrom value ok 166 - Check for query ali to value ok 167 - Check for hsp score ok 168 - Check for hsp c-Evalue ok 169 - Check for hsp query length ok 170 - Check for hsp hit length ok 171 - Check for hsp total length ok 172 - Check for hsp query gaps ok 173 - Check for hsp hit gaps ok 174 - Check for hsp total gaps ok 175 - Check for the correct result reference type ok 176 - Check algorithm ok 177 - Check algorithm version ok 178 - Check hmm_name ok 179 - Check sequence_file ok 180 - Check query_name ok 181 - Check query_length absence ok 182 - Check query_description ok 183 - Check num_hits ok 184 - Check for the correct hit reference type ok 185 - Check hit name ok 186 - Check for hit description ok 187 - Check hit raw_score ok 188 - Check hit significance ok 189 - Check num_hsps ok 190 - Check hit length ok 191 ok 192 ok 193 - Check hit total conserved residues ok 194 - Check hit total identical residues ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 - Check for correct hsp reference type ok 202 - Check for query seq_id ok 203 - Check for hit seq_id ok 204 - Check for hit hmmfrom value ok 205 - Check for hit hmm to value ok 206 - Check for query alifrom value ok 207 - Check for query ali to value ok 208 - Check for hsp score ok 209 - Check for hsp evalue ok 210 - Check for hsp query length ok 211 - Check for hsp hit length ok 212 - Check for hsp total length ok 213 - Check for hsp query gaps ok 214 - Check for hsp hit gaps ok 215 - Check for hsp total gaps ok 216 - Check hit length consistency ok 217 - Check query length consistency ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 - Check for hiy string ok 229 - Check for query string ok 230 - Check for homology string ok 231 - Check for nomatch indices in query ok 232 - Check for nomatch indices in hit ok 233 - Check for gap indices in query ok 234 - Check for gap indices in hit ok 235 - Check for the correct result reference type ok 236 - Check algorithm ok 237 - Check algorithm version ok 238 - Check hmm_name ok 239 - Check database_name ok 240 - Check sequence_file ok 241 - Check query_name ok 242 - Check query_length ok 243 - Check query_accession ok 244 - Check query_description ok 245 - Check num_hits ok 246 - Check for the correct hit reference type ok 247 - Check hit name ok 248 - Check for hit description ok 249 - Check hit raw_score ok 250 - Check hit significance ok 251 - Check num_hsps ok 252 - Check hit length absence ok 253 ok 254 ok 255 - Check hit total conserved residues ok 256 - Check hit total identical residues ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 - Check for correct hsp reference type ok 264 - Check for query seq_id ok 265 - Check for hit seq_id ok 266 - Check for hit hmmfrom value ok 267 - Check for hit hmm to value ok 268 - Check for query alifrom value ok 269 - Check for query ali to value ok 270 - Check for hsp score ok 271 - Check for hsp evalue ok 272 - Check for hsp query length ok 273 - Check for hsp hit length ok 274 - Check for hsp total length ok 275 - Check for hsp query gaps ok 276 - Check for hsp hit gaps ok 277 - Check for hsp total gaps ok 278 - Check hit length consistency ok 279 - Check query length consistency ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 - Check for hiy string ok 291 - Check for homology string ok 292 - Check for query string ok 293 ok 294 ok 295 - Check hit name ok 296 - Check for hit description ok 297 - Check hit raw_score ok 298 - Check hit significance ok 299 ok 300 ok 301 ok 302 ok 303 - Check for consensus structure string ok 304 - Check for hsp seq_str ok 305 - Check for query string ok 306 - Check for hit string ok 307 - Check for homology string ok 308 - Check if correct searchio object is returned ok 309 - Check for the correct result reference type ok 310 - Check algorithm ok 311 - Check algorithm version ok 312 - Check hmm_name ok 313 - Check sequence_file ok 314 - Check query_name ok 315 - Check query_length ok 316 - Check query_accession ok 317 - Check query_description ok 318 - Check num_hits ok 319 - Check for the correct hit reference type ok 320 - Check hit name ok 321 - Check for hit description ok 322 - Check hit raw_score ok 323 - Check hit significance ok 324 - Check num_hsps ok 325 - Check hit length absence ok 326 ok 327 ok 328 - Check for correct hsp reference type ok 329 - Check for hit seq_id ok 330 - Check for query seq_id ok 331 - Check for hit hmmfrom value ok 332 - Check for hit hmm to value ok 333 - Check for query alifrom value ok 334 - Check for query ali to value ok 335 - Check for hsp score ok 336 - Check for hsp c-Evalue ok 337 - Check for hsp query length ok 338 - Check for hsp hit length ok 339 - Check for hsp total length ok 340 - Check for hsp query gaps ok 341 - Check for hsp hit gaps ok 342 - Check for hsp total gaps ok 343 - Check hit length consistency ok 344 - Check query length consistency ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 - Check for query string ok 356 - Check for hit string ok 357 - Check for homology string ok 358 - Check for posterior probability string ok 359 - Check algorithm ok 360 - Check algorithm version ok 361 - Check hmm_name ok 362 - Check sequence_file ok 363 - Check query_name ok 364 - Check query_length ok 365 - Check query_description ok 366 - Check num_hits ok 367 - Check for the correct hit reference type ok 368 - Check hit name ok 369 - Check for hit description ok 370 - Check num_hsps ok 371 - Check for correct hsp reference type ok 372 - Check for hit seq_id ok 373 - Check for query seq_id ok 374 - Check for hit hmmfrom value ok 375 - Check for hit hmm to value ok 376 - Check for query alifrom value ok 377 - Check for query ali to value ok 378 - Check for hsp score ok 379 - Check for hsp c-Evalue ok 380 - Check for the correct hit reference type ok 381 - Check hit name ok 382 - Check for hit description ok 383 - Check num_hsps ok 384 - Check for correct hsp reference type ok 385 - Check for hit seq_id ok 386 - Check for query seq_id ok 387 - Check for hit hmmfrom value ok 388 - Check for hit hmm to value ok 389 - Check for query alifrom value ok 390 - Check for query ali to value ok 391 - Check for hsp score ok 392 - Check for hsp c-Evalue ok 393 - Check for the correct result reference type ok 394 - Check algorithm ok 395 - Check algorithm version ok 396 - Check hmm_name ok 397 - Check sequence_file ok 398 - Check query_name ok 399 - Check query_length ok 400 - Check query_description ok 401 - Check num_hits ok 402 - Check if correct searchio object is returned ok 403 - Check for the correct result reference type ok 404 - Check algorithm ok 405 - Check algorithm version ok 406 - Check hmm_name ok 407 - Check sequence_file ok 408 - Check query_name ok 409 - Check query_length ok 410 - Check query_accession ok 411 - Check query_description ok 412 - Check num_hits ok 413 - Check for the correct result reference type ok 414 - Check algorithm ok 415 - Check algorithm version ok 416 - Check hmm_name ok 417 - Check sequence_file ok 418 - Check query_name ok 419 - Check query_length ok 420 - Check query_accession ok 421 - Check query_description ok 422 - Check num_hits ok 423 - Check for the correct hit reference type ok 424 - Check hit name ok 425 - Check for hit description ok 426 - Check hit raw_score ok 427 - Check hit significance ok 428 - Check num_hsps ok 429 - Check for correct hsp reference type ok 430 - Check for hit seq_id ok 431 - Check for query seq_id ok 432 - Check for hit alifrom value ok 433 - Check for hit ali to value ok 434 - Check for query hmmfrom value ok 435 - Check for query hmm to value ok 436 - Check for hsp score ok 437 - Check for hsp c-Evalue ok 438 - Check for hsp query length ok 439 - Check for hsp hit length ok 440 - Check for hsp total length ok 441 - Check for hsp query gaps ok 442 - Check for hsp hit gaps ok 443 - Check for hsp total gaps ok 444 - Check hit length consistency ok 445 - Check query length consistency ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 - Check for consensus structure string ok 457 - Check for query string ok 458 - Check for hit string ok 459 - Check for homology string ok 460 - Check for posterior probability string ok 461 - Check for the correct result reference type ok 462 - Check algorithm ok 463 - Check algorithm version ok 464 - Check hmm_name ok 465 - Check sequence_file ok 466 - Check query_name ok 467 - Check query_length ok 468 - Check query_accession ok 469 - Check query_description ok 470 - Check num_hits ok 471 - Check for the correct hit reference type ok 472 - Check hit name ok 473 - Check for hit description ok 474 - Check hit raw_score ok 475 - Check hit significance ok 476 - Check num_hsps ok 477 - Check hit length absence ok 478 ok 479 ok 480 - Check for correct hsp reference type ok 481 - Check for hit seq_id ok 482 - Check for query seq_id ok 483 - Check for hit alifrom value ok 484 - Check for hit ali to value ok 485 - Check for query hmmfrom value ok 486 - Check for query hmm to value ok 487 - Check for hsp score ok 488 - Check for hsp c-Evalue ok 489 - Check for hsp query length ok 490 - Check for hsp hit length ok 491 - Check for hsp total length ok 492 - Check for hsp query gaps ok 493 - Check for hsp hit gaps ok 494 - Check for hsp total gaps ok 495 - Check hit length consistency ok 496 - Check query length consistency ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 - Check for consensus structure string ok 508 - Check for query string ok 509 - Check for hit string ok 510 - Check for homology string ok 511 - Check for posterior probability string ok 512 - Check for the correct result reference type ok 513 - Check algorithm ok 514 - Check algorithm version ok 515 - Check hmm_name ok 516 - Check sequence_file ok 517 - Check query_name ok 518 - Check query_length ok 519 - Check query_description ok 520 - Check num_hits ok 521 - Check for the correct hit reference type ok 522 - Check hit name ok 523 - Check for hit description ok 524 - Check hit raw_score ok 525 - Check hit significance ok 526 - Check num_hsps ok 527 - Check for correct hsp reference type ok 528 - Check for hit envfrom value ok 529 - Check for hit env to value ok 530 - Check for query hmmfrom value ok 531 - Check for query hmm to value ok 532 - Check for hsp score ok 533 - Check for hsp c-Evalue ok 534 - Check for correct hsp reference type ok 535 - Check for hit envfrom value ok 536 - Check for hit env to value ok 537 - Check for query hmmfrom value ok 538 - Check for query hmm to value ok 539 - Check for hsp score ok 540 - Check for hsp c-Evalue ok 541 - Check for correct hsp reference type ok 542 - Check for hit envfrom value ok 543 - Check for hit env to value ok 544 - Check for query hmmfrom value ok 545 - Check for query hmm to value ok 546 - Check for hsp score ok 547 - Check for hsp c-Evalue ok 548 - Check for correct hsp reference type ok 549 - Check for hit envfrom value ok 550 - Check for hit env to value ok 551 - Check for query hmmfrom value ok 552 - Check for query hmm to value ok 553 - Check for hsp score ok 554 - Check for hsp c-Evalue ok 555 - Check for correct hsp reference type ok 556 - Check for hit envfrom value ok 557 - Check for hit env to value ok 558 - Check for query hmmfrom value ok 559 - Check for query hmm to value ok 560 - Check for hsp score ok 561 - Check for hsp c-Evalue ok 562 - Check for correct hsp reference type ok 563 - Check for hit envfrom value ok 564 - Check for hit env to value ok 565 - Check for query hmmfrom value ok 566 - Check for query hmm to value ok 567 - Check for hsp score ok 568 - Check for hsp c-Evalue ok 569 - Check hit length ok 570 ok 571 ok 572 - Check for the correct hit reference type ok 573 - Check hit name ok 574 - Check for hit description ok 575 - Check hit raw_score ok 576 - Check hit significance ok 577 - Check num_hsps ok 578 - Check for correct hsp reference type ok 579 - Check for hit envfrom value ok 580 - Check for hit env to value ok 581 - Check for query hmmfrom value ok 582 - Check for query hmm to value ok 583 - Check for hsp score ok 584 - Check for hsp c-Evalue ok 585 - Check for correct hsp reference type ok 586 - Check for hit envfrom value ok 587 - Check for hit env to value ok 588 - Check for query hmmfrom value ok 589 - Check for query hmm to value ok 590 - Check for hsp score ok 591 - Check for hsp c-Evalue ok 592 - Check for correct hsp reference type ok 593 - Check for hit envfrom value ok 594 - Check for hit env to value ok 595 - Check for query hmmfrom value ok 596 - Check for query hmm to value ok 597 - Check for hsp score ok 598 - Check for hsp c-Evalue ok 599 - Check for the correct result reference type ok 600 - Check algorithm ok 601 - Check algorithm version ok 602 - Check hmm_name ok 603 - Check sequence_file ok 604 - Check query_name ok 605 - Check query_length ok 606 - Check query_description ok 607 - Check num_hits ok 608 - Check for the correct hit reference type ok 609 - Check hit name ok 610 - Check for hit description ok 611 - Check hit raw_score ok 612 - Check hit significance ok 613 - Check num_hsps ok 614 - Check for correct hsp reference type ok 615 - Check hit sequence ok 616 - Check query sequence ok 617 - Check for correct hsp reference type ok 618 - Check hit sequence ok 619 - Check query sequence ok 620 - Check hit length ok 621 ok 622 ok 623 - Check for the correct hit reference type ok 624 - Check hit name ok 625 - Check for hit description ok 626 - Check hit raw_score ok 627 - Check hit significance ok 628 - Check num_hsps ok 629 - Check for correct hsp reference type ok 630 - Check hit sequence ok 631 - Check query sequence ok 632 - Check for correct hsp reference type ok 633 - Check hit sequence ok 634 - Check query sequence ok 635 - Check for the correct hit reference type ok 636 - Check hit name ok 637 - Check for hit description ok 638 - Check hit raw_score ok 639 - Check hit significance ok 640 - Check num_hsps ok 641 - Check for correct hsp reference type ok 642 - Check hit sequence ok 643 - Check query sequence ok 644 - Check for correct hsp reference type ok 645 - Check hit sequence ok 646 - Check query sequence ok 647 - Check if loading hmmpfam output via the hmm2 parser directly works ok 648 - Check for the correct result reference type ok 649 - Check if loading hmmsearch2 output via the hmm2 parser directly works ok 650 - Check for the correct result reference type ok 651 - Check if loading hmmscan output via the hmm3 parser directly works ok 652 - Check for the correct result reference type ok 653 - Check if loading hmmsearch3 output via the hmm3 parser directly works ok 654 - Check for the correct result reference type ok 655 - Check if selecting the correct hmmpfam parser using -version works ok 656 - Check for the correct result reference type ok 657 - Check if selecting the correct hmmsearch2 parser using -version works ok 658 - Check for the correct result reference type ok 659 - Check if selecting the correct hmmscan parser using -version works ok 660 - Check for the correct result reference type ok 661 - Check if selecting the correct hmmsearch3 parser using -version works ok 662 - Check for the correct result reference type ok 663 - Check if reading from a pipe works ok 664 - Check for the correct result reference type ok 665 - Check num_hits ok 666 - Check query_length ok 667 - Check nhmmer hit length ok 668 - bug3376 ok 669 - bug3421 - Check if can correctly parse an HSP with line full of dashes ok 670 - bug3302 - Check if can parse multiresult hmmer ok 671 - Check algorithm ok 672 - Check nhmmer algorithm version ok 673 - Check hmm_name ok 674 - Check sequence_file ok 675 - Check query_name ok 676 - Check query_length ok 677 - Check query_accession ok 678 - Check query_description ok 679 - Check num_hits ok 680 - Check for the correct hit reference type ok 681 - Check nhmmer hit name ok 682 - Check nhmmer hit description ok 683 - Check nhmmer hit score ok 684 - Check nhmmer hit significance ok 685 - Check num_hsps ok 686 - Check nhmmer hit length ok 687 ok 688 ok 689 - Check for correct hsp reference type ok 690 - Check for nhmmer hit seq_id ok 691 - Check for nhmmer query seq_id ok 692 - Check nhmmer hsp hit start ok 693 - Check nhmmer hsp hit end ok 694 - Check nhmmer hsp query start ok 695 - Check nhmmer hsp query end ok 696 - Check nhmmer hsp hit strand ok 697 - Check nhmmer hsp query strand ok 698 - Check nhmmer hsp score ok 699 - Check nhmmer hsp evalue ok 700 - Check for hsp query length ok 701 - Check for hsp hit length ok 702 - Check for hsp total length ok 703 - Check for hsp query gaps ok 704 - Check for hsp hit gaps ok 705 - Check for hsp total gaps ok 706 - Check hit length consistency ok 707 - Check query length consistency ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 - Check for consensus structure string ok 718 - Check for nhmmer query string ok 719 - Check for nhmmer homology string ok 720 - Check for nhmmer hit string ok 721 - Check for nhmmer posterior probability string ok 722 - Check if nhmmer homology string and hit string have an equal length ok 723 - Check if nhmmer query string and homology string have an equal length ok 724 - Check nhmmer hit name ok 725 - Check nhmmer hit description ok 726 - Check nhmmer hit score ok 727 - Check nhmmer hit significance ok 728 - Check nhmmer hit length ok 729 - Check for nhmmer hit seq_id ok 730 - Check for nhmmer query seq_id ok 731 - Check nhmmer hsp query start ok 732 - Check nhmmer hsp query end ok 733 - Check nhmmer hsp hit start ok 734 - Check nhmmer hsp hit end ok 735 - Check nhmmer hsp hit strand ok 736 - Check nhmmer hsp query strand ok 737 - Check nhmmer hsp score ok 738 - Check nhmmer hsp evalue ok 739 - Check for hsp query length ok 740 - Check for hsp hit length ok 741 - Check for hsp total length ok 742 - Check for hsp query gaps ok 743 - Check for hsp hit gaps ok 744 - Check for hsp total gaps ok 745 - Check hit length consistency ok 746 - Check query length consistency ok 747 ok 748 - Check for consensus structure string ok 749 - Check for nhmmer query string ok 750 - Check for nhmmer homology string ok 751 - Check for nhmmer hit string ok 752 - Check for nhmmer posterior probability string ok 753 - Check if nhmmer homology string and hit string have an equal length ok 754 - Check if nhmmer query string and homology string have an equal length ok 755 - Check Significance filtered num_hits ok 756 - Check Significance filtered hit ID ok 757 - Check Significance filtered hit ID ok 758 - Check Significance filtered hit ID ok 759 - Check Significance filtered hit ID ok 760 - Check Significance filtered hit ID ok 761 ok 762 - Check Score filtered num_hits ok 763 - Check Score filtered hit ID ok 764 - Check Score filtered hit ID ok 765 - Check Score filtered hit ID ok 766 - Check Score filtered hit ID ok 767 ok 768 - Check Bits filtered num_hits ok 769 - Check Bits filtered num_hits ok 770 - Check Bits filtered num_hits ok 771 - Check Hit_filter filtered num_hits ok 772 - Check Hit_filter filtered hits ID ok 773 ok t/SearchIO/hmmer_pull.t ................ 1..290 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok t/SearchIO/infernal.t .................. 1..412 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result ok 4 - Result reference ok 5 - Result version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_length ok 16 - Result query_name ok 17 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 18 - Hit GI ok 19 - Hit accession ok 20 - Hit algorithm ok 21 - Hit bits ok 22 - Hit description ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit length_aln() not implemented ok 28 - Hit num_unaligned_hit() not implemented ok 29 - Hit num_unaligned_query() not implemented ok 30 - Hit num_unaligned_sbjct() not implemented ok 31 - Hit start not implemented ok 32 - Hit end not implemented ok 33 - Hit strand not implemented ok 34 - Hit logical_length not implemented ok 35 - Hit frac_aligned_hit not implemented ok 36 - Hit frac_aligned_query not implemented ok 37 - Hit frac_conserved not implemented ok 38 - Hit frac_identical not implemented ok 39 - Hit matches not implemented ok 40 - Hit gaps not implemented ok 41 - Hit frame not implemented ok 42 - Hit range not implemented ok 43 - Hit seq_inds not implemented ok 44 - Hit length ok 45 - Hit overlap ok 46 - Hit query_length ok 47 - Hit rank ok 48 - Hit raw_score ok 49 - Hit score ok 50 - Hit p ok 51 ok 52 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 53 - HSP algorithm ok 54 ok 55 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 56 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 57 ok 58 ok 59 - HSP frame ok 60 - HSP gaps ok 61 - Hit length ok 62 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 63 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 64 - HSP hit_string ok 65 - HSP homology_string ok 66 - HSP hsp_group ok 67 - HSP hsp_length ok 68 - HSP length ok 69 - HSP links ok 70 - HSP n ok 71 - HSP pvalue ok 72 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 73 - HSP query_string ok 74 - HSP range ok 75 - HSP rank ok 76 ok 77 - HSP end ok 78 - HSP expect ok 79 - HSP seq_inds not implemented ok 80 - HSP matches not implemented ok 81 - HSP frac_conserved not implemented ok 82 - HSP frac_identical not implemented ok 83 - HSP num_conserved not implemented ok 84 - HSP num_identical not implemented ok 85 - HSP percent_identity not implemented ok 86 - HSP cigar_string not implemented ok 87 - HSP cigar_string not implemented ok 88 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 89 - HSP seq_str ok 90 - HSP start ok 91 - HSP custom_score ok 92 - HSP meta ok 93 - HSP strand ok 94 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 95 - HSP algorithm ok 96 ok 97 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 98 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 99 - HSP frame ok 100 - HSP gaps ok 101 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 102 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 103 - HSP hit_string ok 104 - HSP homology_string ok 105 - HSP hsp_group ok 106 - HSP hsp_length ok 107 - HSP length ok 108 - HSP links ok 109 - HSP n ok 110 - HSP pvalue ok 111 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 112 - HSP query_string ok 113 - HSP range ok 114 - HSP rank ok 115 ok 116 - HSP end ok 117 - HSP expect ok 118 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 119 - HSP seq_str ok 120 - HSP start ok 121 - HSP custom_score ok 122 - HSP meta ok 123 - HSP strand ok 124 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 125 - Result CMSEARCH ok 126 - Result CMSEARCH reference ok 127 - Result CMSEARCH version ok 128 - Result parameters ok 129 - Result statistics ok 130 - Result entries ok 131 - Result letters ok 132 - Result database_name ok 133 - Result num_hits ok 134 - Result program_reference ok 135 - Result query_accession ok 136 - Result query_description ok 137 - Result query_length ok 138 - Result query_name ok 139 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 140 - Hit GI ok 141 - Hit accession ok 142 - Hit algorithm ok 143 - Hit bits ok 144 - Hit description ok 145 - Hit locus ok 146 - Hit n ok 147 - Hit name ok 148 - Hit num_hsps ok 149 - No p values ok 150 - Hit length ok 151 - Hit overlap ok 152 - Hit query_length ok 153 - Hit rank ok 154 - Hit raw_score ok 155 - Hit score ok 156 ok 157 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 158 - HSP algorithm ok 159 ok 160 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 161 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 162 ok 163 ok 164 - HSP frame ok 165 - HSP gaps ok 166 - Hit length ok 167 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 168 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 169 - HSP hit_string ok 170 - HSP homology_string ok 171 - HSP hsp_group ok 172 - HSP hsp_length ok 173 - HSP length ok 174 - HSP links ok 175 - HSP n ok 176 - HSP pvalue ok 177 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 178 - HSP query_string ok 179 - HSP range ok 180 - HSP rank ok 181 ok 182 - HSP end ok 183 - HSP expect ok 184 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 185 - HSP seq_str ok 186 - HSP start ok 187 - HSP custom_score ok 188 - HSP meta ok 189 - HSP strand ok 190 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 191 - HSP algorithm ok 192 ok 193 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 194 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 195 - HSP frame ok 196 - HSP gaps ok 197 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 198 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 199 - HSP hit_string ok 200 - HSP homology_string ok 201 - HSP hsp_group ok 202 - HSP hsp_length ok 203 - HSP length ok 204 - HSP links ok 205 - HSP n ok 206 - HSP pvalue ok 207 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 208 - HSP query_string ok 209 - HSP range ok 210 - HSP rank ok 211 ok 212 - HSP end ok 213 - HSP expect ok 214 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 215 - HSP seq_str ok 216 - HSP start ok 217 - HSP custom_score ok 218 - HSP meta ok 219 - HSP strand ok 220 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 221 - Hit accession ok 222 - Hit GI ok 223 - Hit algorithm ok 224 - Hit bits ok 225 - Hit description ok 226 - Hit length ok 227 - Hit locus ok 228 - Hit n ok 229 - Hit name ok 230 - Hit num_hsps ok 231 - Hit overlap ok 232 - Hit query_length ok 233 - Hit rank ok 234 - Hit raw_score ok 235 - Hit score ok 236 ok 237 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 238 - HSP algorithm ok 239 ok 240 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 241 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 242 - HSP frame ok 243 - HSP gaps ok 244 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 245 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 246 - HSP hit_string ok 247 - HSP homology_string ok 248 - HSP hsp_group ok 249 - HSP hsp_length ok 250 - HSP length ok 251 - HSP links ok 252 - HSP n ok 253 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 254 - HSP query_string ok 255 - HSP range ok 256 - HSP rank ok 257 ok 258 - HSP end ok 259 - HSP expect ok 260 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 261 - HSP seq_str ok 262 - HSP start ok 263 - HSP custom_score ok 264 - HSP meta ok 265 - HSP strand ok 266 - HSP meta gap bug ok 267 - HSP meta ok 268 - HSP meta ok 269 ok 270 ok 271 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 272 - Result CMSEARCH ok 273 - Result CMSEARCH reference ok 274 - Result CMSEARCH version ok 275 - Result parameters ok 276 - Result statistics ok 277 - Result entries ok 278 - Result letters ok 279 - Result database_name ok 280 - Result num_hits ok 281 - Result program_reference ok 282 - Result query_accession ok 283 - Result query_description ok 284 - Result query_length ok 285 - Result query_name ok 286 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 287 - Hit GI ok 288 - Hit accession ok 289 - Hit algorithm ok 290 - Hit bits ok 291 - Hit description ok 292 - Hit locus ok 293 - Hit n ok 294 - Hit name ok 295 - Hit num_hsps ok 296 - No p values ok 297 - Hit length ok 298 - Hit overlap ok 299 - Hit query_length ok 300 - Hit rank ok 301 - Hit raw_score ok 302 - Hit score ok 303 ok 304 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 305 - HSP algorithm ok 306 ok 307 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 308 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 309 ok 310 ok 311 - HSP frame ok 312 - HSP gaps ok 313 - Hit length ok 314 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 315 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 316 - HSP hit_string ok 317 - HSP homology_string ok 318 - HSP hsp_group ok 319 - HSP hsp_length ok 320 - HSP length ok 321 - HSP links ok 322 - HSP n ok 323 - HSP pvalue ok 324 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 325 - HSP query_string ok 326 - HSP range ok 327 - HSP rank ok 328 ok 329 - HSP end ok 330 - HSP expect ok 331 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 332 - HSP seq_str ok 333 - HSP start ok 334 - HSP custom_score ok 335 - HSP meta ok 336 - HSP strand ok 337 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 338 - HSP algorithm ok 339 ok 340 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 341 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 342 - HSP frame ok 343 - HSP gaps ok 344 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 345 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 346 - HSP hit_string ok 347 - HSP homology_string ok 348 - HSP hsp_group ok 349 - HSP hsp_length ok 350 - HSP length ok 351 - HSP links ok 352 - HSP n ok 353 - HSP pvalue ok 354 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 355 - HSP query_string ok 356 - HSP range ok 357 - HSP rank ok 358 ok 359 - HSP end ok 360 - HSP expect ok 361 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 362 - HSP seq_str ok 363 - HSP start ok 364 - HSP custom_score ok 365 - HSP meta ok 366 - HSP strand ok 367 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 368 - Hit accession ok 369 - Hit GI ok 370 - Hit algorithm ok 371 - Hit bits ok 372 - Hit description ok 373 - Hit length ok 374 - Hit locus ok 375 - Hit n ok 376 - Hit name ok 377 - Hit num_hsps ok 378 - Hit overlap ok 379 - Hit query_length ok 380 - Hit rank ok 381 - Hit raw_score ok 382 - Hit score ok 383 ok 384 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 385 - HSP algorithm ok 386 ok 387 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 388 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 389 - HSP frame ok 390 - HSP gaps ok 391 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 392 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 393 - HSP hit_string ok 394 - HSP homology_string ok 395 - HSP hsp_group ok 396 - HSP hsp_length ok 397 - HSP length ok 398 - HSP links ok 399 - HSP n ok 400 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 401 - HSP query_string ok 402 - HSP range ok 403 - HSP rank ok 404 ok 405 - HSP end ok 406 - HSP expect ok 407 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 408 - HSP seq_str ok 409 - HSP start ok 410 - HSP custom_score ok 411 - HSP meta ok 412 - HSP strand ok t/SearchIO/megablast.t ................. 1..31 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/SearchIO/psl.t ....................... 1..53 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - next_hsp should be undef ok 51 - next_hit should be undef not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string # Failed (TODO) test 'next_result should be undef' # at t/SearchIO/psl.t line 97. # got: '' # expected: undef ok 53 ok t/SearchIO/rnamotif.t .................. 1..60 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result RNAMOTIF ok 4 - Result RNAMOTIF reference ok 5 - Result RNAMOTIF version ok 6 - Result entries ok 7 - Result letters ok 8 - Result database_name ok 9 - Result num_hits ok 10 - Result program_reference ok 11 - Result query_accession ok 12 - Result query_description ok 13 - Result query_length ok 14 - Result query_name ok 15 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 16 - Hit accession ok 17 - Hit GI ok 18 - Hit algorithm ok 19 - Hit description ok 20 - Hit length ok 21 - Hit locus ok 22 - Hit n ok 23 - Hit name ok 24 - Hit num_hsps ok 25 - Hit overlap ok 26 - Hit rank ok 27 - Hit raw_score ok 28 - Hit score ok 29 ok 30 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 31 - HSP algorithm ok 32 ok 33 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 34 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 35 - HSP frame ok 36 - HSP gaps ok 37 - RNAMotif get_aln warning ok 38 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 39 - HSP hit_string ok 40 - HSP homology_string ok 41 - HSP hsp_group ok 42 - HSP hsp_length ok 43 - HSP length ok 44 - HSP links ok 45 - HSP n ok 46 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 47 - HSP query_string ok 48 - HSP range ok 49 - HSP rank ok 50 ok 51 - HSP end ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 - HSP strand ok 59 ok 60 ok t/SearchIO/sim4.t ...................... 1..102 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/SearchIO/waba.t ...................... 1..64 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::SearchIO::waba' isa 'Bio::SearchIO' ok 3 - query_name ok 4 - query database ok 5 - database name ok 6 - name ok 7 - hsps ok 8 - total length ok 9 - start ok 10 - end ok 11 - strand ok 12 - start ok 13 - end ok 14 - strand ok 15 - query string ok 16 - hit_string ok 17 - hmmstate string ok 18 ok 19 ok 20 ok 21 - total length ok 22 - start ok 23 - end ok 24 - strand ok 25 - start ok 26 - end ok 27 - strand ok 28 - query string ok 29 - hit_string ok 30 - hmmstate string ok 31 ok 32 ok 33 ok 34 - total length ok 35 - start ok 36 - end ok 37 - strand ok 38 - start ok 39 - end ok 40 - strand ok 41 - query string ok 42 - hit_string ok 43 - hmmstate string ok 44 ok 45 ok 46 ok 47 - query_name ok 48 - query database ok 49 - database name ok 50 - name ok 51 - hsps ok 52 - total length ok 53 - start ok 54 - end ok 55 - strand ok 56 - start ok 57 - end ok 58 - strand ok 59 - query string ok 60 - hit_string ok 61 - hmmstate string ok 62 ok 63 ok 64 ok t/SearchIO/wise.t ...................... 1..20 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok t/Seq/DBLink.t ......................... 1..131 ok 1 - use Bio::SeqIO; ok 2 - "swissprot:K1C9_HUMAN" ok 3 - no double colon ok 4 - no trailing colon ok 5 - no double space ok 6 - dblink value is splittable ok 7 - "GenBank:Z29074.1" ok 8 - no double colon ok 9 - no trailing colon ok 10 - no double space ok 11 - dblink value is splittable ok 12 - "GenPept:CAA82315.1" ok 13 - no double colon ok 14 - no trailing colon ok 15 - no double space ok 16 - dblink value is splittable ok 17 - "GenBank:S69510.1" ok 18 - no double colon ok 19 - no trailing colon ok 20 - no double space ok 21 - dblink value is splittable ok 22 - "GenPept:AAC60619.1" ok 23 - no double colon ok 24 - no trailing colon ok 25 - no double space ok 26 - dblink value is splittable ok 27 - "GenBank:X75015.1" ok 28 - no double colon ok 29 - no trailing colon ok 30 - no double space ok 31 - dblink value is splittable ok 32 - "GenPept:CAA52924.1" ok 33 - no double colon ok 34 - no trailing colon ok 35 - no double space ok 36 - dblink value is splittable ok 37 - "GenBank:AB001594.1" ok 38 - no double colon ok 39 - no trailing colon ok 40 - no double space ok 41 - dblink value is splittable ok 42 - "GenPept:BAA19418.1" ok 43 - no double colon ok 44 - no trailing colon ok 45 - no double space ok 46 - dblink value is splittable ok 47 - "GenBank:I37984" ok 48 - no double colon ok 49 - no trailing colon ok 50 - no double space ok 51 - dblink value is splittable ok 52 - "HSSP:P08670" ok 53 - no double colon ok 54 - no trailing colon ok 55 - no double space ok 56 - dblink value is splittable ok 57 - "IntAct:P35527" ok 58 - no double colon ok 59 - no trailing colon ok 60 - no double space ok 61 - dblink value is splittable ok 62 - "Ensembl:ENSG00000171403" ok 63 - no double colon ok 64 - no trailing colon ok 65 - no double space ok 66 - dblink value is splittable ok 67 - "KEGG:hsa:3857" ok 68 - no double colon ok 69 - no trailing colon ok 70 - no double space ok 71 - dblink value is splittable ok 72 - "HGNC:6447" ok 73 - no double colon ok 74 - no trailing colon ok 75 - no double space ok 76 - dblink value is splittable ok 77 - "MIM:144200" ok 78 - no double colon ok 79 - no trailing colon ok 80 - no double space ok 81 - dblink value is splittable ok 82 - "MIM:607606" ok 83 - no double colon ok 84 - no trailing colon ok 85 - no double space ok 86 - dblink value is splittable ok 87 - "ArrayExpress:P35527" ok 88 - no double colon ok 89 - no trailing colon ok 90 - no double space ok 91 - dblink value is splittable ok 92 - "GO:0005200" ok 93 - no double colon ok 94 - no trailing colon ok 95 - no double space ok 96 - dblink value is splittable ok 97 - "GO:0008544" ok 98 - no double colon ok 99 - no trailing colon ok 100 - no double space ok 101 - dblink value is splittable ok 102 - "InterPro:IPR011000" ok 103 - no double colon ok 104 - no trailing colon ok 105 - no double space ok 106 - dblink value is splittable ok 107 - "InterPro:IPR001664" ok 108 - no double colon ok 109 - no trailing colon ok 110 - no double space ok 111 - dblink value is splittable ok 112 - "InterPro:IPR002957" ok 113 - no double colon ok 114 - no trailing colon ok 115 - no double space ok 116 - dblink value is splittable ok 117 - "Pfam:PF00038" ok 118 - no double colon ok 119 - no trailing colon ok 120 - no double space ok 121 - dblink value is splittable ok 122 - "PRINTS:PR01248" ok 123 - no double colon ok 124 - no trailing colon ok 125 - no double space ok 126 - dblink value is splittable ok 127 - "PROSITE:PS00226" ok 128 - no double colon ok 129 - no trailing colon ok 130 - no double space ok 131 - dblink value is splittable ok t/Seq/EncodedSeq.t ..................... 1..37 ok 1 - use Bio::Seq::EncodedSeq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 12 ok 13 ok 14 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok t/Seq/LargeLocatableSeq.t .............. 1..8 ok 1 - use Bio::Seq::LargeLocatableSeq; ok 2 ok 3 - An object of class 'Bio::Seq::LargeLocatableSeq' isa 'Bio::Seq::LargeSeqI' ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Seq/LargePSeq.t ...................... 1..30 ok 1 - use Bio::Seq::LargePrimarySeq; ok 2 - use Bio::Seq::LargeSeq; ok 3 - use Bio::Location::Simple; ok 4 - use Bio::Location::Fuzzy; ok 5 - use Bio::Location::Split; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 10 - Subseq is GGGGT ok 11 ok 12 ok 13 ok 14 - trunc seq was GGGGTGAA ok 15 ok 16 ok 17 ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 19 ok 20 - output via Bio::SeqIO::fasta ok 21 - Subseq is GGGGT ok 22 - trunc seq was GGGGTGAA ok 23 ok 24 ok 25 ok 26 - Sequence is ATGGGGTGGGGT ok 27 - Subseq is GGGGT ok 28 - trunc seq was GGGGT ok 29 ok 30 ok t/Seq/LocatableSeq.t ................... 1..119 ok 1 - use Bio::LocatableSeq; ok 2 - use Bio::AlignIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 13 ok 14 ok 15 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 16 ok 17 ok 18 ok 19 not ok 20 # TODO Need to fix columns before start of seq w/ start > 1 # Failed (TODO) test at t/Seq/LocatableSeq.t line 47. # got: 'Bio::Location::Simple=HASH(0x95941c)' # expected: undef ok 21 ok 22 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 23 ok 24 ok 25 ok 26 ok 27 - threw Regexp ((?^:.+)) ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 51 ok 52 ok 53 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - * is counted in length ok 107 - * is counted in length, but end is wrong ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 307. # got: '\-\.=~' # expected: '-\?' not ok 119 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 309. # got: '19' # expected: anything else ok t/Seq/MetaSeq.t ........................ 1..132 ok 1 - use Bio::Seq::Meta; ok 2 - use Bio::Seq::Meta::Array; ok 3 - use Bio::SeqIO; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Seq::Quality; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - aa-bb bb ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok t/Seq/PrimaryQual.t .................... 1..70 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 - A reference of type 'ARRAY' isa 'ARRAY' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - threw Regexp ((?^:.+)) ok 27 - threw Regexp ((?^:.+)) ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 - threw Regexp ((?^:EX)) ok 34 ok 35 ok 36 - threw Regexp ((?^:EX)) ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok t/Seq/PrimarySeq.t ..................... 1..310 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::Location::Split; ok 5 - Bare object ok 6 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::IdentifiableI' ok 26 - An object of class 'Bio::PrimarySeq' isa 'Bio::DescribableI' ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 - threw Regexp ((?^:.+)) ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 59 ok 60 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 61 ok 62 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 63 ok 64 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - Translation: LVAST ok 77 - Translation: MVAST ok 78 - Translation: MVAST ok 79 - Translation: MVAST* ok 80 - Translation: M* ok 81 - Translation: M ok 82 ok 83 - Translation: MWP ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 - Alphabet ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 - Bug 2438 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Bug \#2864 ok 139 - Terminator + inside sequence ok 140 ok 141 - Length method ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 - threw Regexp ((?^:.+)) ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 - threw Regexp ((?^:.+)) ok 174 - Validation ok 175 ok 176 ok 177 - threw Regexp ((?^:.+)) ok 178 ok 179 ok 180 - _find_orfs 1 ok 181 - orfs are sorted by descending length ok 182 - got correct -orf => "longest" seq ok 183 - _find_orfs 1 ok 184 - orfs are sorted by descending length ok 185 - got correct -orf => "longest" seq ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok t/Seq/PrimedSeq.t ...................... 1..65 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimedSeq; ok 3 - Priming the target with sequence objects ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 13 ok 14 ok 15 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - Priming the target with primer objects ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - Priming the target with located primer objects ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok t/Seq/Quality.t ........................ 1..85 ok 1 - use Bio::Seq::Quality; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bug 2845 ok 73 ok 74 - Bug 2845 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok t/Seq/Seq.t ............................ 1..73 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::RichSeq; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Species; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 - An object of class 'Bio::Seq' isa 'Bio::AnnotatableI' ok 8 ok 9 ok 10 ok 11 - truncated sequence length ok 12 - truncated sequence string ok 13 ok 14 ok 15 - alphabet ok 16 - id ok 17 - accession number ok 18 - subseq ok 19 - An object of class 'Bio::Seq' isa 'Bio::IdentifiableI' ok 20 - An object of class 'Bio::Seq' isa 'Bio::DescribableI' ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - translated sequence ok 35 - translated sequence with explicit unambiguous codons ok 36 - translated sequence with unknown unambiguous codons ok 37 - translated sequence with unknown unambiguous codons, completed ok 38 - translated sequence with unambiguous codons ok 39 - translated sequence with unambiguous codons ok 40 - translated sequence with unknown unambiguous codons, completed ok 41 - translated sequence with unambiguous codons ok 42 - translated sequence with unknown unambiguous codons, completed ok 43 - translated sequence with stop ok 44 - translated sequence ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - Bug \#2864 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok t/Seq/SimulatedRead.t .................. 1..194 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::Seq::SimulatedRead; ok 6 ok 7 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::SimulatedRead' ok 8 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::LocatableSeq' ok 9 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::Quality' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 - redundant errors ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 - errors() ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 - track() ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 - qual_levels() ok 138 ok 139 - reference() ok 140 ok 141 - mid() ok 142 ok 143 ok 144 ok 145 - ACGT ok 146 ok 147 ok 148 ok 149 ok 150 - TTTAAA ok 151 ok 152 ok 153 ok 154 ok 155 - Bio::Seq::Quality ok 156 - Bio::Seq ok 157 - Bio::PrimarySeq ok 158 - Bio::LocatableSeq ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok t/Seq/WithQuality.t .................... 1..22 ok 1 - use Bio::Seq::SeqWithQuality; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 21 ok 22 ok t/SeqEvolution.t ....................... 1..39 ok 1 - use Bio::SeqEvolution::Factory; ok 2 - use Bio::PrimarySeq; ok 3 ok 4 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint' ok 5 ok 6 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint' ok 7 ok 8 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint' ok 9 ok 10 ok 11 - get rate() ok 12 - get and set rate() ok 13 - identity() ok 14 - identity() ok 15 - pam() ok 16 - pam() ok 17 - mutation_count() ok 18 - mutation_count() ok 19 - seq_type() ok 20 - seq_type() ok 21 - next_seq() ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - each_mutation() ok 28 ok 29 ok 30 - get_alignment_identity() ok 31 ok 32 ok 33 - get_mutation_counter() ok 34 - get_sequence_counter() ok 35 - reset_sequence_counter() ok 36 - get_sequence_counter() == 0 ok 37 ok 38 ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok t/SeqFeature/Amplicon.t ................ 1..21 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::Primer; ok 3 - use Bio::SeqFeature::Amplicon; ok 4 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 5 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::SubSeq' ok 6 ok 7 ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 16 ok 17 ok 18 ok 19 ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 21 ok t/SeqFeature/Clone.t ................... 1..17 ok 1 - clone() ok 2 - start() clone set ok 3 - start() clone get ok 4 - start() original unchanged ok 5 - clone() with arguments ok 6 - start() orig get ok 7 - end() orig get ok 8 - start() clone get ok 9 - end() clone get ok 10 - start() clone set ok 11 - start() clone get ok 12 - start() original unchanged ok 13 - location() Bio::Location::Split ok 14 - clone() ok 15 - start() clone set ok 16 - start() clone get ok 17 - start() original unchanged ok t/SeqFeature/Collection.t .............. skipped: The optional module DB_File (or dependencies thereof) was not installed t/SeqFeature/Computation.t ............. 1..12 ok 1 - use Bio::SeqFeature::Computation; ok 2 ok 3 - computation id ok 4 - score value ok 5 ok 6 ok 7 ok 8 - sft[0] is exon ok 9 ok 10 - computation id ok 11 ok 12 - score value ok t/SeqFeature/FeaturePair.t ............. 1..19 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::FeaturePair; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - feature1 of pair stored ok 9 - feature2 of pair stored ok 10 - feature start ok 11 - feature end ok 12 - primary tag ok 13 - source tag ok 14 - hstart ok 15 - hend ok 16 - hprimary tag ok 17 - hsource tag ok 18 ok 19 - inverted end ok t/SeqFeature/Gene.t .................... 1..28 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Gene::Transcript; ok 3 - use Bio::SeqFeature::Gene::UTR; ok 4 - use Bio::SeqFeature::Gene::Exon; ok 5 - use Bio::SeqFeature::Gene::Poly_A_site; ok 6 - use Bio::SeqFeature::Gene::GeneStructure; ok 7 - use Bio::Location::Fuzzy; ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - mRNA spliced length ok 28 - has 2 UTRs ok t/SeqFeature/Generic.t ................. 1..362 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - Start of feature location ok 10 - End of feature location ok 11 - Primary tag ok 12 - Source tag ok 13 - Display name ok 14 - Undef phase by default ok 15 - Phase accessor returns ok 16 - Phase is persistent ok 17 ok 18 ok 19 - Set phase from constructor ok 20 ok 21 ok 22 - Start of first seqfeature ok 23 - End of first seqfeature ok 24 - Strand of first seqfeature ok 25 ok 26 - Sequence of first seqfeature ok 27 ok 28 ok 29 ok 30 - Start of second seqfeature ok 31 - End of second seqfeature ok 32 - Strand of second seqfeature ok 33 ok 34 - Sequence of second seqfeature ok 35 ok 36 ok 37 ok 38 - sfeat start for EXPAND-ED feature (bug \#947) ok 39 - sfeat end for EXPAND-ED feature (bug \#947) ok 40 ok 41 ok 42 - Can create feature starting and ending at 0 ok 43 ok 44 - Can create feature starting and ending at 0 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 55 ok 56 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 57 ok 58 # skip Network tests have not been requested ok 59 # skip Network tests have not been requested ok 60 # skip Network tests have not been requested ok 61 # skip Network tests have not been requested ok 62 # skip Network tests have not been requested ok 63 ok 64 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 65 ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 67 ok 68 # skip Network tests have not been requested ok 69 # skip Network tests have not been requested ok 70 ok 71 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 72 ok 73 ok 74 - spliced_seq translation matches expected ok 75 ok 76 - spliced_seq translation matches expected ok 77 ok 78 - spliced_seq translation matches expected ok 79 ok 80 - spliced_seq translation matches expected ok 81 ok 82 - spliced_seq translation matches expected ok 83 ok 84 - spliced_seq translation matches expected ok 85 ok 86 - spliced_seq translation matches expected ok 87 ok 88 - spliced_seq translation matches expected ok 89 ok 90 - spliced_seq translation matches expected ok 91 ok 92 - spliced_seq translation matches expected ok 93 ok 94 - spliced_seq translation matches expected ok 95 ok 96 - spliced_seq translation matches expected ok 97 ok 98 - spliced_seq translation matches expected ok 99 ok 100 - spliced_seq translation matches expected ok 101 ok 102 - spliced_seq translation matches expected ok 103 ok 104 - spliced_seq translation matches expected ok 105 ok 106 - spliced_seq translation matches expected ok 107 ok 108 - spliced_seq translation matches expected ok 109 ok 110 - spliced_seq translation matches expected ok 111 ok 112 - spliced_seq translation matches expected ok 113 ok 114 - spliced_seq translation matches expected ok 115 ok 116 - spliced_seq translation matches expected ok 117 ok 118 - spliced_seq translation matches expected ok 119 ok 120 - spliced_seq translation matches expected ok 121 ok 122 - spliced_seq translation matches expected ok 123 ok 124 - spliced_seq translation matches expected ok 125 ok 126 - spliced_seq translation matches expected ok 127 ok 128 - spliced_seq translation matches expected ok 129 ok 130 - spliced_seq translation matches expected ok 131 ok 132 - spliced_seq translation matches expected ok 133 ok 134 - spliced_seq translation matches expected ok 135 ok 136 - spliced_seq translation matches expected ok 137 ok 138 - spliced_seq translation matches expected ok 139 ok 140 - spliced_seq translation matches expected ok 141 ok 142 - spliced_seq translation matches expected ok 143 ok 144 - spliced_seq translation matches expected ok 145 ok 146 - spliced_seq translation matches expected ok 147 ok 148 - spliced_seq translation matches expected ok 149 ok 150 - spliced_seq translation matches expected ok 151 ok 152 - spliced_seq translation matches expected ok 153 ok 154 - spliced_seq translation matches expected ok 155 ok 156 - spliced_seq translation matches expected ok 157 ok 158 - spliced_seq translation matches expected ok 159 ok 160 - spliced_seq translation matches expected ok 161 ok 162 - spliced_seq translation matches expected ok 163 ok 164 - spliced_seq translation matches expected ok 165 ok 166 - spliced_seq translation matches expected ok 167 ok 168 - spliced_seq translation matches expected ok 169 ok 170 - spliced_seq translation matches expected ok 171 ok 172 - spliced_seq translation matches expected ok 173 ok 174 - spliced_seq translation matches expected ok 175 ok 176 - spliced_seq translation matches expected ok 177 ok 178 - spliced_seq translation matches expected ok 179 ok 180 - spliced_seq translation matches expected ok 181 ok 182 - spliced_seq translation matches expected ok 183 ok 184 - spliced_seq translation matches expected ok 185 ok 186 - spliced_seq translation matches expected ok 187 ok 188 - spliced_seq translation matches expected ok 189 ok 190 - spliced_seq translation matches expected ok 191 ok 192 - spliced_seq translation matches expected ok 193 ok 194 - spliced_seq translation matches expected ok 195 ok 196 - spliced_seq translation matches expected ok 197 ok 198 - spliced_seq translation matches expected ok 199 ok 200 - spliced_seq translation matches expected ok 201 ok 202 - spliced_seq translation matches expected ok 203 ok 204 - spliced_seq translation matches expected ok 205 ok 206 - spliced_seq translation matches expected ok 207 ok 208 - spliced_seq translation matches expected ok 209 ok 210 - spliced_seq translation matches expected ok 211 ok 212 - spliced_seq translation matches expected ok 213 ok 214 - spliced_seq translation matches expected ok 215 ok 216 - spliced_seq translation matches expected ok 217 ok 218 - spliced_seq translation matches expected ok 219 ok 220 - spliced_seq translation matches expected ok 221 ok 222 - spliced_seq translation matches expected ok 223 ok 224 - spliced_seq translation matches expected ok 225 ok 226 - spliced_seq translation matches expected ok 227 ok 228 - spliced_seq translation matches expected ok 229 ok 230 - spliced_seq translation matches expected ok 231 ok 232 - spliced_seq translation matches expected ok 233 ok 234 - spliced_seq translation matches expected ok 235 ok 236 - spliced_seq translation matches expected ok 237 ok 238 - spliced_seq translation matches expected ok 239 ok 240 - spliced_seq translation matches expected ok 241 ok 242 - spliced_seq translation matches expected ok 243 ok 244 - spliced_seq translation matches expected ok 245 ok 246 - spliced_seq translation matches expected ok 247 ok 248 - spliced_seq translation matches expected ok 249 ok 250 - spliced_seq translation matches expected ok 251 ok 252 - spliced_seq translation matches expected ok 253 ok 254 - spliced_seq translation matches expected ok 255 ok 256 - spliced_seq translation matches expected ok 257 ok 258 - spliced_seq translation matches expected ok 259 ok 260 - spliced_seq translation matches expected ok 261 ok 262 - spliced_seq translation matches expected ok 263 ok 264 - spliced_seq translation matches expected ok 265 ok 266 - spliced_seq translation matches expected ok 267 ok 268 - spliced_seq translation matches expected ok 269 ok 270 - spliced_seq translation matches expected ok 271 ok 272 - spliced_seq translation matches expected ok 273 ok 274 - spliced_seq translation matches expected ok 275 ok 276 - spliced_seq translation matches expected ok 277 ok 278 - spliced_seq translation matches expected ok 279 ok 280 - spliced_seq translation matches expected ok 281 ok 282 - spliced_seq translation matches expected ok 283 ok 284 - spliced_seq translation matches expected ok 285 ok 286 - spliced_seq translation matches expected ok 287 ok 288 - spliced_seq translation matches expected ok 289 ok 290 - spliced_seq translation matches expected ok 291 ok 292 - spliced_seq translation matches expected ok 293 ok 294 - spliced_seq translation matches expected ok 295 ok 296 - spliced_seq translation matches expected ok 297 ok 298 - spliced_seq translation matches expected ok 299 ok 300 - spliced_seq translation matches expected ok 301 ok 302 - spliced_seq translation matches expected ok 303 ok 304 - spliced_seq translation matches expected ok 305 ok 306 - spliced_seq translation matches expected ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 - phase check ok 313 ok 314 ok 315 - phase check ok 316 ok 317 ok 318 - phase check ok 319 ok 320 ok 321 - phase check ok 322 ok 323 ok 324 - phase check ok 325 ok 326 ok 327 ok 328 - Tags found ok 329 - get_tagset_values tag values found ok 330 - get_tagset_values tag values for multiple tags found ok 331 - get_tag_values tag values found ok 332 - get_tag_values lives with tag ok 333 - get_tagset_values no tag values found ok 334 - get_tagset_values lives with no tag ok 335 - get_tag_values throws with no tag ok 336 - Phi-X174 genome is circular ok 337 ok 338 - Only 3 split locations ok 339 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 340 ok 341 - Feature string ok 342 - First ten nucleotides ok 343 - Strand ok 344 - Start ok 345 - End ok 346 - Expected length ok 347 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 348 ok 349 - Feature string ok 350 - First ten nucleotides ok 351 - Strand ok 352 - Start ok 353 - End ok 354 - Expected length ok 355 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 356 ok 357 - Feature string ok 358 - First ten nucleotides ok 359 - Strand ok 360 - Start ok 361 - End ok 362 - Expected length ok t/SeqFeature/Location.t ................ 1..109 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Location::Split; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::SeqFeature::SimilarityPair; ok 6 - use Bio::SeqFeature::FeaturePair; ok 7 - use Bio::SeqFeature::Lite; ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 9 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI' ok 10 - Bio::Location::Simple tests ok 11 ok 12 ok 13 ok 14 ok 15 - 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI' ok 16 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::RangeI' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - Bio::SeqFeature::FeaturePair tests ok 25 ok 26 ok 27 ok 28 - Bio::SeqFeature::Generic tests ok 29 ok 30 - Bio::Location::Fuzzy tests ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - Bio::Location::Split tests ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Bugfix 1074 ok 62 ok 63 ok 64 ok 65 - Positive length ok 66 ok 67 - seq_id() on Bio::Location::Split ok 68 ok 69 ok 70 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 71 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI' ok 72 - Bio::Location::Simple EXACT ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Bio::Location::Simple IN-BETWEEN ok 79 ok 80 ok 81 ok 82 ok 83 - Testing error handling ok 84 ok 85 ok 86 ok 87 - use Bio::Location::WidestCoordPolicy; ok 88 - use Bio::Location::NarrowestCoordPolicy; ok 89 - use Bio::Location::AvWithinCoordPolicy; ok 90 - Default coodinate policy ok 91 ok 92 ok 93 ok 94 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy' ok 95 - Narrowest coodinate policy ok 96 ok 97 ok 98 ok 99 - An object of class 'Bio::Location::NarrowestCoordPolicy' isa 'Bio::Location::NarrowestCoordPolicy' ok 100 - Average coodinate policy ok 101 ok 102 ok 103 ok 104 - An object of class 'Bio::Location::AvWithinCoordPolicy' isa 'Bio::Location::AvWithinCoordPolicy' ok 105 - Widest coodinate policy ok 106 ok 107 ok 108 ok 109 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy' ok t/SeqFeature/LocationFactory.t ......... 1..272 ok 1 - use Bio::Factory::FTLocationFactory; ok 2 - An object of class 'Bio::Factory::FTLocationFactory' isa 'Bio::Factory::LocationFactoryI' ok 3 - Bio::Location::Simple ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - Location String: J00194:100..202 ok 13 ok 14 - Bio::Location::Fuzzy ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - Location String: 1..? ok 24 ok 25 - Bio::Location::Fuzzy ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - Location String: (122.133)..(204.221) ok 35 ok 36 - Bio::Location::Fuzzy ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Location String: (102.110) ok 46 ok 47 - Bio::Location::Simple ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - Location String: 340..565 ok 57 ok 58 - Bio::Location::Split ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - Location String: join(12..78,134..202) ok 68 ok 69 - Bio::Location::Fuzzy ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Location String: ?..? ok 79 ok 80 - Bio::Location::Fuzzy ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - Location String: <345..500 ok 90 ok 91 - Bio::Location::Fuzzy ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 - Location String: ?22..?64 ok 101 ok 102 - Bio::Location::Simple ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 - Location String: J00194:100..202 ok 112 ok 113 - Bio::Location::Simple ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 - Location String: 467 ok 123 ok 124 - Bio::Location::Fuzzy ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 - Location String: (23.45)..600 ok 134 ok 135 - Bio::Location::Simple ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 - Location String: 123^124 ok 145 ok 146 - Bio::Location::Fuzzy ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - Location String: <1..? ok 156 ok 157 - Bio::Location::Fuzzy ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 - Location String: 145^177 ok 167 ok 168 - Bio::Location::Fuzzy ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 - Location String: 22..?64 ok 178 ok 179 - Bio::Location::Fuzzy ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 - Location String: complement(34..(122.126)) ok 189 ok 190 - Bio::Location::Split ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - Location String: complement(join(4918..5163,2691..4571)) ok 200 ok 201 - Bio::Location::Split ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599) ok 211 ok 212 - Bio::Location::Fuzzy ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 - Location String: ?..>393 ok 222 ok 223 - Bio::Location::Fuzzy ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 - Location String: ?2465..2774 ok 233 ok 234 - Bio::Location::Fuzzy ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 - Location String: (122.133)..(204.221) ok 244 ok 245 - Bio::Location::Fuzzy ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 - Location String: ?..536 ok 255 ok 256 - Bio::Location::Fuzzy ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 - Location String: <1..888 ok 266 ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294))) ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081))) ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669))) ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672))) ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000) ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19)) ok t/SeqFeature/Primer.t .................. 1..47 ok 1 - use Bio::SeqFeature::Primer; ok 2 - use Bio::PrimarySeq; ok 3 - Implied primer sequence ok 4 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 5 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::SubSeq' ok 6 ok 7 ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 9 ok 10 - PrimarySeq primer ok 11 ok 12 ok 13 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 42 ok 43 ok 44 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 45 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 46 ok 47 ok t/SeqFeature/Range.t ................... 1..49 ok 1 - use Bio::Range; ok 2 - 'BioRange object' isa 'Bio::Range' ok 3 ok 4 - 'BioRange object' isa 'Bio::Range' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - 'BioRange object' isa 'Bio::Range' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - 'BioRange object' isa 'Bio::Range' ok 26 - 'BioRange object' isa 'Bio::Range' ok 27 - 'BioRange object' isa 'Bio::Range' ok 28 - 1 & -1 ok 29 - 1 & 1 true ok 30 - 1 & 0 true ok 31 - 1 & -1 false ok 32 - 1 & 1 true ok 33 - 1 & 0 false ok 34 - 1 & -1 false ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - 'Bio::Range object' isa 'Bio::Range' ok 46 ok 47 ok 48 ok 49 ok t/SeqFeature/RangeI.t .................. 1..45 ok 1 - use Bio::SeqFeature::Generic; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 - subtract() of split features ok 40 - 0 start ok 41 - 0 end ok 42 - 1 start ok 43 - 1 end ok 44 - 2 start ok 45 - 2 end ok t/SeqFeature/SeqAnalysisParser.t ....... 1..14 ok 1 - use Bio::Factory::SeqAnalysisParserFactory; ok 2 - use Bio::SeqIO; ok 3 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO' ok 4 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 5 - An object of class 'Bio::Tools::Genscan' isa 'Bio::SeqAnalysisParserI' ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 10 - An object of class 'Bio::Tools::MZEF' isa 'Bio::SeqAnalysisParserI' ok 11 ok 12 ok 13 - An object of class 'Bio::Tools::EPCR' isa 'Bio::SeqAnalysisParserI' ok 14 ok t/SeqFeature/SubSeq.t .................. 1..37 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::SubSeq; ok 3 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::SubSeq' ok 4 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::Generic' ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 31 ok 32 ok 33 ok 34 ok 35 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 36 ok 37 ok t/SeqFeature/Unflattener.t ............. 1..21 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Tools::Unflattener; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/SeqIO/Handler.t ...................... 1..561 ok 1 - use Bio::SeqIO; ok 2 - AI129902 ok 3 ok 4 ok 5 ok 6 - NT_021877 ok 7 ok 8 ok 9 ok 10 ok 11 - BAB68554 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - operator overloading in AnnotationI is deprecated ok 22 - NC_006346 ok 23 ok 24 ok 25 - U71225 ok 26 ok 27 - AB077698 ok 28 ok 29 - DQ018368 ok 30 - D10483 ok 31 ok 32 ok 33 ok 34 - bug 1487 ok 35 ok 36 - bug 1647 ok 37 ok 38 ok 39 - bug 1673 ok 40 ok 41 ok 42 ok 43 - AF165282 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - species parsing incorrect for genbank ok 53 - genus duplicated in genbank parsing ok 54 ok 55 ok 56 - species parsing incorrect for genbank ok 57 - genus duplicated in genbank parsing ok 58 ok 59 ok 60 - species parsing incorrect for genbank ok 61 - genus duplicated in genbank parsing ok 62 ok 63 - streaming ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 - Total number of sequences in test file ok 70 ok 71 - Fuzzy in ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 - Fuzzy out ok 84 - BK000016 ok 85 ok 86 - BK000016 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 - BK000016 ok 102 - roundtrip ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 - revcomp split location ok 121 - Bug 1925 ok 122 ok 123 ok 124 - wgs ok 125 ok 126 - wgs_scafld ok 127 ok 128 - wgs_scafld ok 129 ok 130 ok 131 - BC000007 ok 132 - BK000016-tpa.gbk ok 133 - ay116458.gb ok 134 - ay149291.gb ok 135 - NC_006346.gb ok 136 - ay007676.gb ok 137 - dq519393.gb ok 138 ok 139 - swissprot:K1C9_HUMAN ok 140 ok 141 - swissprot ok 142 ok 143 - GenBank:Z29074.1 ok 144 ok 145 - GenBank ok 146 ok 147 - GenPept:CAA82315.1 ok 148 ok 149 - GenPept ok 150 ok 151 - GenBank:S69510.1 ok 152 ok 153 - GenBank ok 154 ok 155 - GenPept:AAC60619.1 ok 156 ok 157 - GenPept ok 158 ok 159 - GenBank:X75015.1 ok 160 ok 161 - GenBank ok 162 ok 163 - GenPept:CAA52924.1 ok 164 ok 165 - GenPept ok 166 ok 167 - GenBank:AB001594.1 ok 168 ok 169 - GenBank ok 170 ok 171 - GenPept:BAA19418.1 ok 172 ok 173 - GenPept ok 174 ok 175 - GenBank:I37984 ok 176 ok 177 - GenBank ok 178 ok 179 - HSSP:P08670 ok 180 ok 181 - HSSP ok 182 ok 183 - IntAct:P35527 ok 184 ok 185 - IntAct ok 186 ok 187 - Ensembl:ENSG00000171403 ok 188 ok 189 - Ensembl ok 190 ok 191 - KEGG:hsa:3857 ok 192 ok 193 - KEGG ok 194 ok 195 - HGNC:6447 ok 196 ok 197 - HGNC ok 198 ok 199 - MIM:144200 ok 200 ok 201 - MIM ok 202 ok 203 - MIM:607606 ok 204 ok 205 - MIM ok 206 ok 207 - ArrayExpress:P35527 ok 208 ok 209 - ArrayExpress ok 210 ok 211 - GO:0005200 ok 212 ok 213 - GO ok 214 ok 215 - GO:0008544 ok 216 ok 217 - GO ok 218 ok 219 - InterPro:IPR011000 ok 220 ok 221 - InterPro ok 222 ok 223 - InterPro:IPR001664 ok 224 ok 225 - InterPro ok 226 ok 227 - InterPro:IPR002957 ok 228 ok 229 - InterPro ok 230 ok 231 - Pfam:PF00038 ok 232 ok 233 - Pfam ok 234 ok 235 - PRINTS:PR01248 ok 236 ok 237 - PRINTS ok 238 ok 239 - PROSITE:PS00226 ok 240 ok 241 - PROSITE ok 242 ok 243 - Bug 2195 ok 244 - Bug 2195 ok 245 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 246 ok 247 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 - success reading Embl with ^ location and badly split double quotes ok 274 ok 275 ok 276 - success writing Embl format with ^ < and > locations ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 - genus duplication test ok 310 ok 311 ok 312 - An object of class 'Bio::SeqIO::swissdriver' isa 'Bio::SeqIO' ok 313 - An object of class 'Bio::Species' isa 'Bio::Species' ok 314 ok 315 ok 316 - operator overloading in AnnotationI is deprecated ok 317 ok 318 - dates ok 319 - dates ok 320 - dates ok 321 ok 322 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 323 ok 324 ok 325 ok 326 - operator overloading in AnnotationI is deprecated ok 327 ok 328 ok 329 ok 330 ok 331 - id is ROA1_HUMAN ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 - operator overloading in AnnotationI is deprecated ok 340 ok 341 ok 342 ok 343 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 - operator overloading in AnnotationI is deprecated ok 354 ok 355 ok 356 ok 357 - GC1QBP ok 358 - HABP1 ok 359 - SF2P32 ok 360 - C1QBP ok 361 ok 362 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 - F54H12.1 ok 370 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 383 ok 384 ok 385 ok 386 ok 387 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 - An object of class 'Bio::Species' isa 'Bio::Species' ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 - An object of class 'Bio::Species' isa 'Bio::Species' ok 518 ok 519 ok 520 - operator overloading in AnnotationI is deprecated ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 - P39765 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 - operator overloading in AnnotationI is deprecated ok t/SeqIO/MultiFile.t .................... 1..5 ok 1 - use Bio::SeqIO::MultiFile; ok 2 ok 3 ok 4 ok 5 ok t/SeqIO/Multiple_fasta.t ............... 1..9 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - all sequences in the file ok t/SeqIO/SeqBuilder.t ................... 1..137 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::Seq::SeqBuilder' isa 'Bio::Factory::ObjectBuilderI' ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok t/SeqIO/SeqIO.t ........................ 1..58 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 - ID for format gcg ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - ID for format fasta ok 11 ok 12 ok 13 ok 14 - accession.version ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - ID for format pir ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - ID for format tab ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - ID for format ace ok 38 ok 39 ok 40 ok 41 ok 42 - use Algorithm::Diff; ok 43 - use IO::ScalarArray; ok 44 - use IO::String; ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 not ok 55 - Must pass a file or file handle # TODO file/fh-based tests should be in Bio::Root::IO, see issue #3204 # Failed (TODO) test 'Must pass a file or file handle' # at t/SeqIO/SeqIO.t line 159. # expecting: Regexp ((?^:No file, fh, or string argument provided)) # found: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: Could not guess format from file, filehandle or string # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:449 # STACK: Bio::SeqIO::new Bio/SeqIO.pm:411 # STACK: Test::Exception::throws_ok t/SeqIO/SeqIO.t:158 # STACK: t/SeqIO/SeqIO.t:159 # ----------------------------------------------------------- # ) ok 56 - Must pass a file or file handle ok 57 - Must pass a file or file handle ok 58 - Must pass a real file ok t/SeqIO/Splicedseq.t ................... 1..19 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - get_SeqFeatures() ok 12 - protein sequence ok 13 - nucleotide sequence - correct CDS range ok 14 - nucleotide length ok 15 - appropriate warning if db not provided for remote sequence ok 16 - correct number of Ns added if remote sequence not provided ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok t/SeqIO/abi.t .......................... skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/ace.t .......................... 1..7 ok 1 - use Bio::SeqIO; ok 2 - number of sequence objects ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters ok 4 - alphabets detected ok 5 - alphabets detected ok 6 - writing sequence ok 7 - test output ok t/SeqIO/agave.t ........................ 1..8 ok 1 - use Bio::SeqIO::agave; not ok 2 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 3 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 4 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 5 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 6 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 7 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 8 # TODO & SKIP No tests for agave format -- no sample file to test against ok t/SeqIO/alf.t .......................... skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/asciitree.t .................... 1..2 ok 1 - use Bio::SeqIO; not ok 2 # TODO Output doesn't exists on MSWin32 # Failed (TODO) test at t/SeqIO/asciitree.t line 39. ok t/SeqIO/bsml.t ......................... 1..16 ok 1 - use XML::DOM; ok 2 - use Bio::SeqIO::bsml; ok 3 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 4 - got correct number of refs ok 5 - display_id ok 6 - molecule ok 7 - is_circular ok 8 - dates ok 9 - accession_number ok 10 - seq_version ok 11 - got correct number of SeqFeatures ok 12 - feature start ok 13 - feature end ok 14 - get_tag_values db_xref ok 15 - get_Annotations reference ok 16 - get_Annotations dblink ok t/SeqIO/bsml_sax.t ..................... 1..15 ok 1 - use Bio::SeqIO; ok 2 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SeqIO/chadoxml.t ..................... 1..8 ok 1 - use Bio::SeqIO::chadoxml; not ok 2 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 3 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 4 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 5 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 6 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 7 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 8 # TODO & SKIP No tests for chadoxml format -- no sample file to test against ok t/SeqIO/chaos.t ........................ 1..8 ok 1 - use Bio::SeqIO::chaos; not ok 2 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 3 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 4 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 5 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 6 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 7 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 8 # TODO & SKIP No tests for chaos format -- no sample file to test against ok t/SeqIO/chaosxml.t ..................... 1..2 ok 1 - use Bio::SeqIO; ok 2 ok t/SeqIO/ctf.t .......................... skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/embl.t ......................... 1..96 ok 1 - use Bio::SeqIO::embl; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - success reading Embl with ^ location and badly split double quotes ok 25 ok 26 - success writing Embl format with ^ < and > locations ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - genus duplication test ok 55 ok 56 ok 57 ok 58 ok 59 - CDS - accession on PA line ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - CDS - OX tagname ok 68 - CDS - OX database ok 69 - CDS - OX primary_id ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 - Check if product was parsed correctly ok 86 - Parse long qualifier ok 87 ok 88 - TaxID set correctly ok 89 - The read sequence has a species object ok 90 - NCBI TaxID has roundtripped ok 91 - Name has roundtripped ok 92 - TaxID set correctly ok 93 - The read sequence has a species object ok 94 - The taxid of the source feature overrides that of the OX line ok 95 - Name has roundtripped ok 96 - The ID field was written correctly ok t/SeqIO/entrezgene.t ................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/SeqIO/excel.t ........................ 1..4 ok 1 - use Bio::SeqIO::excel; ok 2 - An object of class 'Bio::SeqIO::excel' isa 'Bio::SeqIO' ok 3 - Bio::SeqIO::excel->can('next_seq') ok 4 - Bio::SeqIO::excel->can('write_seq') ok t/SeqIO/exp.t .......................... skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\fasta.pm line 85. Subroutine next_seq redefined at Bio\SeqIO\fasta.pm line 119. Subroutine write_seq redefined at Bio\SeqIO\fasta.pm line 199. Subroutine width redefined at Bio\SeqIO\fasta.pm line 289. Subroutine block redefined at Bio\SeqIO\fasta.pm line 310. Subroutine preferred_id_type redefined at Bio\SeqIO\fasta.pm line 335. t/SeqIO/fasta.t ........................ 1..22 ok 1 - use Bio::SeqIO::fasta; ok 2 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO' ok 3 - Bio::SeqIO::fasta->can('next_seq') ok 4 - Bio::SeqIO::fasta->can('write_seq') ok 5 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 6 - sequence ok 7 - length ok 8 - primary_id ok 9 - description ok 10 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 11 - sequence ok 12 - length ok 13 - primary_id ok 14 - description ok 15 - use Algorithm::Diff; ok 16 - use IO::ScalarArray; ok 17 - use IO::String; ok 18 - fasta format can round-trip ok 19 - dies with roa1.genbank ok 20 - dies with test.gcg ok 21 - dies with test.ace ok 22 - dies with test.raw ok t/SeqIO/fastq.t ........................ 1..140 ok 1 - use Bio::SeqIO::fastq; ok 2 - use Bio::Seq::Quality; ok 3 - bug2335 parses ok 4 - correct num. seqs in bug2335 ok 5 - sample sequence obtained ok 6 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 7 - seq() matches bug2335 ok 8 - desc() matches bug2335 ok 9 - display_id() matches bug2335 ok 10 - qual() matches bug2335 ok 11 ok 12 - evil_wrapping parses ok 13 - correct num. seqs in evil_wrapping ok 14 - sample sequence obtained ok 15 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 16 - seq() matches evil_wrapping ok 17 - desc() matches evil_wrapping ok 18 - display_id() matches evil_wrapping ok 19 - qual() matches evil_wrapping ok 20 ok 21 - example parses ok 22 - correct num. seqs in example ok 23 - sample sequence obtained ok 24 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 25 - seq() matches example ok 26 - desc() matches example ok 27 - display_id() matches example ok 28 - qual() matches example ok 29 ok 30 - illumina_faked parses ok 31 - correct num. seqs in illumina_faked ok 32 - sample sequence obtained ok 33 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 34 - seq() matches illumina_faked ok 35 - desc() matches illumina_faked ok 36 - display_id() matches illumina_faked ok 37 - qual() matches illumina_faked ok 38 ok 39 - sanger_93 parses ok 40 - correct num. seqs in sanger_93 ok 41 - sample sequence obtained ok 42 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 43 - seq() matches sanger_93 ok 44 - desc() matches sanger_93 ok 45 - display_id() matches sanger_93 ok 46 - qual() matches sanger_93 ok 47 ok 48 - sanger_faked parses ok 49 - correct num. seqs in sanger_faked ok 50 - sample sequence obtained ok 51 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 52 - seq() matches sanger_faked ok 53 - desc() matches sanger_faked ok 54 - display_id() matches sanger_faked ok 55 - qual() matches sanger_faked ok 56 ok 57 - solexa_example parses ok 58 - correct num. seqs in solexa_example ok 59 - sample sequence obtained ok 60 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 61 - seq() matches solexa_example ok 62 - desc() matches solexa_example ok 63 - display_id() matches solexa_example ok 64 - qual() matches solexa_example ok 65 ok 66 - solexa_faked parses ok 67 - correct num. seqs in solexa_faked ok 68 - sample sequence obtained ok 69 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 70 - seq() matches solexa_faked ok 71 - desc() matches solexa_faked ok 72 - display_id() matches solexa_faked ok 73 - qual() matches solexa_faked ok 74 ok 75 - test1_sanger parses ok 76 - correct num. seqs in test1_sanger ok 77 - sample sequence obtained ok 78 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 79 - seq() matches test1_sanger ok 80 - desc() matches test1_sanger ok 81 - display_id() matches test1_sanger ok 82 - qual() matches test1_sanger ok 83 ok 84 - test2_solexa parses ok 85 - correct num. seqs in test2_solexa ok 86 - sample sequence obtained ok 87 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 88 - seq() matches test2_solexa ok 89 - desc() matches test2_solexa ok 90 - display_id() matches test2_solexa ok 91 - qual() matches test2_solexa ok 92 ok 93 - test3_illumina parses ok 94 - correct num. seqs in test3_illumina ok 95 - sample sequence obtained ok 96 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 97 - seq() matches test3_illumina ok 98 - desc() matches test3_illumina ok 99 - display_id() matches test3_illumina ok 100 - qual() matches test3_illumina ok 101 ok 102 - tricky parses ok 103 - correct num. seqs in tricky ok 104 - sample sequence obtained ok 105 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 106 - seq() matches tricky ok 107 - desc() matches tricky ok 108 - display_id() matches tricky ok 109 - qual() matches tricky ok 110 ok 111 - Conversion from illumina to sanger ok 112 - Conversion from illumina to illumina ok 113 - Conversion from illumina to solexa ok 114 - Conversion from sanger to sanger ok 115 - Conversion from sanger to illumina ok 116 - Conversion from sanger to solexa ok 117 - Conversion from solexa to sanger ok 118 - Conversion from solexa to illumina ok 119 - Conversion from solexa to solexa ok 120 - Exception caught for error_diff_ids ok 121 - Exception caught for error_long_qual ok 122 - Exception caught for error_no_qual ok 123 - Exception caught for error_qual_del ok 124 - Exception caught for error_qual_escape ok 125 - Exception caught for error_qual_null ok 126 - Exception caught for error_qual_space ok 127 - Exception caught for error_qual_tab ok 128 - Exception caught for error_qual_unit_sep ok 129 - Exception caught for error_qual_vtab ok 130 - Exception caught for error_short_qual ok 131 - Exception caught for error_spaces ok 132 - Exception caught for error_tabs ok 133 - Exception caught for error_trunc_at_plus ok 134 - Exception caught for error_trunc_at_qual ok 135 - Exception caught for error_trunc_at_seq ok 136 - Exception caught for error_trunc_in_plus ok 137 - Exception caught for error_trunc_in_qual ok 138 - Exception caught for error_trunc_in_seq ok 139 - Exception caught for error_trunc_in_title ok 140 - edge case; single 0 in quality fails ok t/SeqIO/flybase_chadoxml.t ............. 1..8 ok 1 - use Bio::SeqIO::flybase_chadoxml; not ok 2 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 3 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 4 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 5 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 6 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 7 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 8 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against ok t/SeqIO/game.t ......................... 1..24 ok 1 - use Bio::SeqIO::game; ok 2 - An object of class 'Bio::SeqIO::game' isa 'Bio::SeqIO' ok 3 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/SeqIO/gbxml.t ........................ 1..14 ok 1 - use Bio::SeqIO::gbxml; ok 2 - An object of class 'Bio::SeqIO::gbxml' isa 'Bio::SeqIO' ok 3 - molecule ok 4 - alphabet ok 5 - primary_id ok 6 - display_id ok 7 - version ok 8 - is_circular ok 9 - description ok 10 - sequence ok 11 - classification ok 12 - feat - clone_lib ok 13 - feat - db_xref ok 14 - feat - lab_host ok t/SeqIO/gcg.t .......................... 1..17 ok 1 - use Bio::SeqIO::gcg; ok 2 - An object of class 'Bio::SeqIO::gcg' isa 'Bio::SeqIO' ok 3 - Bio::SeqIO::gcg->can('next_seq') ok 4 - Bio::SeqIO::gcg->can('write_seq') ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 6 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 7 - sequence ok 8 - length not ok 9 - primary_id # TODO possible bug: RichSeq not setting primary_id? # Failed (TODO) test 'primary_id' # at t/SeqIO/gcg.t line 54. # got: 'Bio::PrimarySeq=HASH(0x137b464)' # expected: 'roa1_drome' ok 10 - description ok 11 ok 12 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI' ok 13 ok 14 - use Algorithm::Diff; ok 15 - use IO::ScalarArray; ok 16 - use IO::String; ok 17 - gcg format can round-trip ok t/SeqIO/genbank.t ...................... 1..287 ok 1 - use Bio::SeqIO::genbank; ok 2 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 3 - AI129902 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - NT_021877 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - BAB68554 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 - NC_006346 ok 30 ok 31 ok 32 - U71225 ok 33 ok 34 - AB077698 ok 35 ok 36 - DQ018368 ok 37 - D10483 ok 38 ok 39 ok 40 ok 41 - bug 1487 ok 42 ok 43 - bug 1647 ok 44 ok 45 ok 46 - bug 1673 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - AF165282 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - species parsing incorrect for genbank ok 62 - genus duplicated in genbank parsing ok 63 ok 64 ok 65 - species parsing incorrect for genbank ok 66 - genus duplicated in genbank parsing ok 67 ok 68 ok 69 - species parsing incorrect for genbank ok 70 - genus duplicated in genbank parsing ok 71 ok 72 - streaming ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Total number of sequences in test file ok 79 ok 80 - Fuzzy in ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 - Fuzzy out ok 93 - BK000016 ok 94 ok 95 - BK000016 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 - BK000016 ok 111 - roundtrip ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 - revcomp split location ok 130 - Bug 1925 ok 131 ok 132 ok 133 - wgs ok 134 ok 135 - wgs_scafld ok 136 ok 137 - wgs_scafld ok 138 ok 139 ok 140 - BC000007 ok 141 - BK000016-tpa.gbk ok 142 - ay116458.gb ok 143 - ay149291.gb ok 144 - NC_006346.gb ok 145 - ay007676.gb ok 146 - dq519393.gb ok 147 ok 148 - swissprot:K1C9_HUMAN ok 149 ok 150 - swissprot ok 151 ok 152 - GenBank:Z29074.1 ok 153 ok 154 - GenBank ok 155 ok 156 - GenPept:CAA82315.1 ok 157 ok 158 - GenPept ok 159 ok 160 - GenBank:S69510.1 ok 161 ok 162 - GenBank ok 163 ok 164 - GenPept:AAC60619.1 ok 165 ok 166 - GenPept ok 167 ok 168 - GenBank:X75015.1 ok 169 ok 170 - GenBank ok 171 ok 172 - GenPept:CAA52924.1 ok 173 ok 174 - GenPept ok 175 ok 176 - GenBank:AB001594.1 ok 177 ok 178 - GenBank ok 179 ok 180 - GenPept:BAA19418.1 ok 181 ok 182 - GenPept ok 183 ok 184 - GenBank:I37984 ok 185 ok 186 - GenBank ok 187 ok 188 - HSSP:P08670 ok 189 ok 190 - HSSP ok 191 ok 192 - IntAct:P35527 ok 193 ok 194 - IntAct ok 195 ok 196 - Ensembl:ENSG00000171403 ok 197 ok 198 - Ensembl ok 199 ok 200 - KEGG:hsa:3857 ok 201 ok 202 - KEGG ok 203 ok 204 - HGNC:6447 ok 205 ok 206 - HGNC ok 207 ok 208 - MIM:144200 ok 209 ok 210 - MIM ok 211 ok 212 - MIM:607606 ok 213 ok 214 - MIM ok 215 ok 216 - ArrayExpress:P35527 ok 217 ok 218 - ArrayExpress ok 219 ok 220 - GO:0005200 ok 221 ok 222 - GO ok 223 ok 224 - GO:0008544 ok 225 ok 226 - GO ok 227 ok 228 - InterPro:IPR011000 ok 229 ok 230 - InterPro ok 231 ok 232 - InterPro:IPR001664 ok 233 ok 234 - InterPro ok 235 ok 236 - InterPro:IPR002957 ok 237 ok 238 - InterPro ok 239 ok 240 - Pfam:PF00038 ok 241 ok 242 - Pfam ok 243 ok 244 - PRINTS:PR01248 ok 245 ok 246 - PRINTS ok 247 ok 248 - PROSITE:PS00226 ok 249 ok 250 - PROSITE ok 251 ok 252 - Bug 2195 ok 253 - Bug 2195 ok 254 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 255 ok 256 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 257 ok 258 - P39765 ok 259 - P39765 ok 260 - P39765 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 - operator overloading in AnnotationI is deprecated ok 271 ok 272 ok 273 ok 274 ok 275 - bug3375 database is BioProject ok 276 - bug3375 primary_id is PRJNA15288 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 - Label is the same ok 283 ok 284 ok 285 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 286 ok 287 ok t/SeqIO/interpro.t ..................... 1..20 ok 1 - use Bio::SeqIO::interpro; ok 2 - An object of class 'Bio::SeqIO::interpro' isa 'Bio::SeqIO' ok 3 - seq obj is defined ok 4 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 5 - right number of SeqFeatures ok 6 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 7 - display_name() ok 8 - seq object is defined ok 9 - right number of SeqFeatures ok 10 - there is no next_seq (correctly) ok 11 - bug 1908 ok 12 - right number of SeqFeatures ok 13 - primary_tag() ok 14 - display_name() ok 15 - location->end() ok 16 - right number of dblinks ok 17 - first primary_id ok 18 - second primary_id ok 19 - right number of dblinks ok 20 - primary_id via dblinks ok t/SeqIO/kegg.t ......................... 1..16 ok 1 - use Bio::SeqIO::kegg; ok 2 - An object of class 'Bio::SeqIO::kegg' isa 'Bio::SeqIO' ok 3 ok 4 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeq' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/largefasta.t ................... 1..16 ok 1 - use Bio::SeqIO::largefasta; ok 2 - An object of class 'Bio::SeqIO::largefasta' isa 'Bio::SeqIO' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/lasergene.t .................... 1..13 ok 1 - use Bio::SeqIO::lasergene; ok 2 ok 3 - An object of class 'Bio::SeqIO::lasergene' isa 'Bio::SeqIO' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/SeqIO/locuslink.t .................... 1..26 ok 1 - use Bio::SeqIO::locuslink; ok 2 - use Bio::SeqFeature::Generic; ok 3 - use Bio::SeqFeature::AnnotationAdaptor; ok 4 ok 5 - An object of class 'Bio::SeqIO::locuslink' isa 'Bio::SeqIO' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/SeqIO/mbsout.t ....................... 1..74 ok 1 - use Bio::SeqIO::mbsout; ok 2 - Bio::SeqIO::mbsout is at least api version 1.1.3 ok 3 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 4 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 5 - Get NSITES ok 6 - Get TRAJ_FILENAME ok 7 - Get SELPOS ok 8 - Get TOT_RUN_HAPS ok 9 - Get MBS_INFO_LINE ok 10 - Get NFILES ok 11 - Get POP_MUT_PARAM_PER_SITE ok 12 - Get POP_RECOMB_PARAM_PER_SITE ok 13 - Get NEXT_RUN_NUM ok 14 - Get CURRENT_RUN_SEGSITES ok 15 - Get RUNS ok 16 - Get LAST_READ_HAP_NUM ok 17 - Get NREPS ok 18 - Get POSITIONS ok 19 - Get SEGSITES ok 20 - Get next_hap at beginning of run ok 21 - Get next_hap after beginning of run ok 22 - Get next_pop after beginning of pop ok 23 - Get next_hap ok 24 - Get next_hap ok 25 - Get next_run after beginning of run ok 26 - Get next_run at beginning of run ok 27 - Get next_run at beginning of run ok 28 - have all lines been read? ok 29 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 30 - Get NSITES ok 31 - Get TRAJ_FILENAME ok 32 - Get SELPOS ok 33 - Get TOT_RUN_HAPS ok 34 - Get MBS_INFO_LINE ok 35 - Get NFILES ok 36 - Get POP_MUT_PARAM_PER_SITE ok 37 - Get POP_RECOMB_PARAM_PER_SITE ok 38 - Get NEXT_RUN_NUM ok 39 - Get CURRENT_RUN_SEGSITES ok 40 - Get RUNS ok 41 - Get LAST_READ_HAP_NUM ok 42 - Get NREPS ok 43 - Get POSITIONS ok 44 - Get SEGSITES ok 45 - Get next_hap at beginning of run ok 46 - Get next_hap after beginning of run ok 47 - Testing mbsout::outgroup ok 48 - Get next_run after beginning of run ok 49 - Get next_run after beginning of run ok 50 - Get next_run at beginning of run ok 51 - Get next_hap at beginning of run 2 ok 52 - Get next_run after hap ok 53 - next run should be 5. ok 54 - An object of class 'Bio::SeqIO::mbsout' isa 'Bio::SeqIO::mbsout' ok 55 - Get NSITES ok 56 - Get TRAJ_FILENAME ok 57 - Get SELPOS ok 58 - Get TOT_RUN_HAPS ok 59 - Get MBS_INFO_LINE ok 60 - Get NFILES ok 61 - Get POP_MUT_PARAM_PER_SITE ok 62 - Get POP_RECOMB_PARAM_PER_SITE ok 63 - Get NEXT_RUN_NUM ok 64 - Get CURRENT_RUN_SEGSITES ok 65 - Get RUNS ok 66 - Get LAST_READ_HAP_NUM ok 67 - Get NREPS ok 68 - Get POSITIONS ok 69 - Get SEGSITES ok 70 - Get next_run at end/beginning of run ok 71 - have all lines been read? ok 72 - Get next_run at eof ok 73 - Get next_hap at eof ok 74 - Get next_seq at eof ok t/SeqIO/metafasta.t .................... 1..6 ok 1 - use Bio::SeqIO::metafasta; ok 2 - An object of class 'Bio::SeqIO::metafasta' isa 'Bio::SeqIO' ok 3 ok 4 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta' ok 5 ok 6 ok t/SeqIO/msout.t ........................ 1..165 ok 1 - use Bio::SeqIO::msout; ok 2 - Bio::SeqIO::msout is at least api version 1.1.5 ok 3 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 4 - Get N_SITES ok 5 - Get TOT_RUN_HAPS ok 6 - Get POPS ok 7 - Get CURRENT_RUN_SEGSITES ok 8 - Get NEXT_RUN_NUM ok 9 - Get RUNS ok 10 - Get MS_INFO_LINE ok 11 - Get LAST_READ_HAP_NUM ok 12 - Get POSITIONS ok 13 - Get SEGSITES ok 14 - Get SEEDS ok 15 - Get next_hap at beginning of run ok 16 - Get next_hap after beginning of run ok 17 - Testing msout::outgroup ok 18 - Get next_pop after beginning of pop ok 19 - Get next_pop at beginning of pop ok 20 - Get next_run after beginning of run ok 21 - Get next_pop at beginning of run ok 22 - Get next_hap after pop ok 23 - Get next_run after pop and hap ok 24 - Get next_run at beginning of run ok 25 - have all lines been read? ok 26 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 27 - Get N_SITES ok 28 - Get TOT_RUN_HAPS ok 29 - Get POPS ok 30 - Get CURRENT_RUN_SEGSITES ok 31 - Get NEXT_RUN_NUM ok 32 - Get RUNS ok 33 - Get MS_INFO_LINE ok 34 - Get LAST_READ_HAP_NUM ok 35 - Get POSITIONS ok 36 - Get SEGSITES ok 37 - Get SEEDS ok 38 - Get next_hap at beginning of run ok 39 - Get next_hap after beginning of run ok 40 - Testing msout::outgroup ok 41 - Get next_pop after beginning of pop ok 42 - Get next_pop at beginning of pop/run ok 43 - Get next_run at beginning of run ok 44 - Get next_hap at beginning of run 2 ok 45 - Get next_run after hap ok 46 - next run should be 5. ok 47 - Get last hap through next_hap ok 48 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 49 - Get TOT_RUN_HAPS ok 50 - Get POPS ok 51 - Get CURRENT_RUN_SEGSITES ok 52 - Get NEXT_RUN_NUM ok 53 - Get RUNS ok 54 - Get MS_INFO_LINE ok 55 - Get LAST_READ_HAP_NUM ok 56 - Get POSITIONS ok 57 - Get SEGSITES ok 58 - Get SEEDS ok 59 - Get next_pop at end of run ok 60 - have all lines been read? ok 61 - Get next_pop at eof ok 62 - Get next_run at eof ok 63 - Get next_hap at eof ok 64 - Get next_seq at eof ok 65 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 66 - Get N_SITES ok 67 - Get TOT_RUN_HAPS ok 68 - Get POPS ok 69 - Get CURRENT_RUN_SEGSITES ok 70 - Get NEXT_RUN_NUM ok 71 - Get LAST_READ_HAP_NUM ok 72 - Get MS_INFO_LINE ok 73 - Get RUNS ok 74 - Get POSITIONS ok 75 - Get SEGSITES ok 76 - Get SEEDS ok 77 - Get next_hap at beginning of run ok 78 - Get next_hap after beginning of run ok 79 - Testing msout::outgroup ok 80 - Get next_pop after beginning of pop ok 81 - Get next_pop at beginning of pop ok 82 - Get next_run after beginning of run ok 83 - Get next_pop at beginning of run ok 84 - Get next_hap after pop ok 85 - Get next_run after pop and hap ok 86 - Get next_run at beginning of run ok 87 - have all lines been read? ok 88 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 89 - Caught error in bad msout file 1 ok 90 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 91 - Caught error in bad msout file 2 ok 92 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 93 - Get N_SITES ok 94 - Get TOT_RUN_HAPS ok 95 - Get POPS ok 96 - Get CURRENT_RUN_SEGSITES ok 97 - Get NEXT_RUN_NUM ok 98 - Get LAST_READ_HAP_NUM ok 99 - Get MS_INFO_LINE ok 100 - Get RUNS ok 101 - Get POSITIONS ok 102 - Get SEGSITES ok 103 - Get SEEDS ok 104 - Get next_hap at beginning of run ok 105 - Get next_hap after beginning of run ok 106 - Testing msout::outgroup ok 107 - Get next_pop after beginning of pop ok 108 - Get next_pop at beginning of pop ok 109 - Get next_run after beginning of run ok 110 - Get next_pop at beginning of run ok 111 - Get next_hap after pop ok 112 - Get next_run after pop and hap ok 113 - Get next_run at beginning of run ok 114 - have all lines been read? ok 115 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 116 - Get N_SITES ok 117 - Get TOT_RUN_HAPS ok 118 - Get POPS ok 119 - Get CURRENT_RUN_SEGSITES ok 120 - Get NEXT_RUN_NUM ok 121 - Get LAST_READ_HAP_NUM ok 122 - Get MS_INFO_LINE ok 123 - Get RUNS ok 124 - Get POSITIONS ok 125 - Get SEGSITES ok 126 - Get SEEDS ok 127 - Get next_hap at beginning of run ok 128 - Get next_hap after beginning of run ok 129 - Testing msout::outgroup ok 130 - Get next_pop after beginning of pop ok 131 - Get next_pop at beginning of pop/run ok 132 - Get next_run at beginning of run ok 133 - Get next_hap at beginning of run 2 ok 134 - Get next_run after hap ok 135 - next run should be 5. ok 136 - Get last hap through next_hap ok 137 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 138 - Get N_SITES ok 139 - Get TOT_RUN_HAPS ok 140 - Get POPS ok 141 - Get CURRENT_RUN_SEGSITES ok 142 - Get NEXT_RUN_NUM ok 143 - Get LAST_READ_HAP_NUM ok 144 - Get MS_INFO_LINE ok 145 - Get RUNS ok 146 - Get POSITIONS ok 147 - Get SEGSITES ok 148 - Get SEEDS ok 149 - Get next_hap at beginning of run ok 150 - Get next_hap after beginning of run ok 151 - Testing msout::outgroup ok 152 - Get next_pop after beginning of pop ok 153 - Get next_pop at beginning of pop ok 154 - Get next_run after beginning of run ok 155 - Get next_pop at beginning of run ok 156 - Get next_hap after pop ok 157 - Get next_run after pop and hap ok 158 - Get next_run at beginning of run ok 159 - have all lines been read? ok 160 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 161 - Caught error in bad msout file 1 ok 162 - An object of class 'Bio::SeqIO::msout' isa 'Bio::SeqIO::msout' ok 163 - Caught error in bad msout file 2 ok 164 - threw Regexp ((?^:first argument needs to be a positive integer. argument supplied: -1)) ok 165 - too few n_sites failed OK ok # WARNING: NeXML parsing for NeXML v0.9 is currently very experimental support t/SeqIO/nexml.t ........................ 1..126 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqIO::nexml; ok 3 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 4 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 5 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 6 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 7 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 8 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 9 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 10 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 11 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 12 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 13 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 14 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 15 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 16 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 17 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 18 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 19 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 20 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 21 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 22 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 23 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 24 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 25 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 26 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 27 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 28 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 29 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 30 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 31 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 32 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 33 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 34 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 35 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 36 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 37 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 38 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 39 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 40 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 41 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 42 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 43 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 44 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 45 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 46 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 47 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 48 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 49 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 50 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 51 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 52 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 53 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 54 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 55 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 56 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 57 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 58 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 59 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 60 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 61 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 62 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 63 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 64 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 65 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 66 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 67 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 68 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 69 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 70 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 71 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 72 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 73 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 74 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 75 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 76 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 77 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 78 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 79 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 80 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 81 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 82 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 83 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 84 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 85 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 86 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 87 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 88 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 89 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 90 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 91 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 92 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 93 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 94 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 95 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 96 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 97 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 98 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 99 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 100 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 101 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 102 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 103 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 104 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 105 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 106 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 107 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 108 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 109 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 110 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 111 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 112 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 113 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 114 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 115 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 116 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 117 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 118 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 119 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 120 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 121 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 122 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 123 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 124 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 125 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 126 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok t/SeqIO/phd.t .......................... 1..21 ok 1 - use Bio::SeqIO::phd; ok 2 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd' ok 3 - Did you get the 'QUALITY_LEVELS' comment? ok 4 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 5 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd' ok 6 ok 7 - $seq->subseq() ok 8 - $seq->subqual_tex() ok 9 - $seq->subqual_tex() ok 10 - $phd->chromat_file() ok 11 - $phd->chromat_file() ok 12 ok 13 - $seq->subseq() ok 14 - $seq->subqual_tex() ok 15 - $seq->subqual_tex() ok 16 ok 17 - $seq->subseq() ok 18 - $seq->subqual_tex() ok 19 - $seq->subqual_tex() ok 20 - An object of class 'Bio::SeqIO::phd' isa 'Bio::SeqIO::phd' ok 21 ok t/SeqIO/pir.t .......................... 1..9 ok 1 - use Bio::SeqIO::pir; ok 2 - new instance is defined ok 3 - An object of class 'Bio::SeqIO::pir' isa 'Bio::SeqIO' ok 4 - checked length ok 5 - checked length ok 6 - checked length ok 7 - checked length ok 8 - checked length ok 9 - checked length ok t/SeqIO/pln.t .......................... skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/qual.t ......................... 1..18 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimaryQual; ok 3 ok 4 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 5 ok 6 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 7 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 8 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 9 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 10 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 11 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 12 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/SeqIO/raw.t .......................... 1..25 ok 1 - use Bio::SeqIO::raw; ok 2 - An object of class 'Bio::SeqIO::raw' isa 'Bio::SeqIO' ok 3 ok 4 - Bio::SeqIO::raw->can('next_seq') ok 5 - Bio::SeqIO::raw->can('write_seq') ok 6 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 7 - sequence ok 8 - length ok 9 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 10 - sequence ok 11 - length ok 12 - use Algorithm::Diff; ok 13 - raw format can round-trip ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok t/SeqIO/scf.t .......................... 1..80 ok 1 - use Bio::SeqIO::scf; ok 2 - use Bio::Seq::SequenceTrace; ok 3 ok 4 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 14 - An object of class 'Bio::Seq::Quality' isa 'Bio::Seq::Quality' ok 15 - alphabet ok 16 - display_id ok 17 - primary_id is the stringified memory position ok 18 - set primary_id ok 19 - accession_number ok 20 - desc ok 21 - desc ok 22 - id ok 23 - id ok 24 - seq ok 25 - subseq ok 26 - baseat ok 27 - qualat ok 28 - trace_value_at not ok 29 - accuracies # TODO documentation and code for accuracies() do not match # Failed (TODO) test 'accuracies' # at t/SeqIO/scf.t line 78. # got: 'ARRAY(0x13bc1c4)' # expected: '482' ok 30 ok 31 - sub_peak_index ok 32 - peak_index_at ok 33 ok 34 ok 35 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 36 - accuracy_at ok 37 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 42 ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 44 ok 45 ok 46 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 55 - An object of class 'Bio::Annotation::Collection' isa 'Bio::Annotation::Collection' ok 56 ok 57 ok 58 ok 59 ok 60 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 61 ok 62 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 63 - qual scores match ok 64 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 65 ok 66 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' not ok 67 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'ML4942R' # expected: undef ok 68 - qual scores match ok 69 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 70 ok 71 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' not ok 72 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'IIABP1D4373' # expected: undef ok 73 - qual scores match ok 74 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' ok 75 ok 76 - An object of class 'Bio::Seq::SequenceTrace' isa 'Bio::Seq::SequenceTrace' not ok 77 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'IIABP1D4373' # expected: undef ok 78 - qual scores match ok 79 - Bio::Sequence::Quality matches ok 80 - Bio::Sequence::Quality matches ok t/SeqIO/seqxml.t ....................... 1..61 ok 1 - use Bio::SeqIO; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::SeqIO::seqxml; ok 4 - stream ok ok 5 - seqXML version ok 6 - source ok 7 - source version ok 8 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 9 - display id ok 10 - primary id ok 11 - description ok 12 - sequence ok 13 - length ok 14 - entry source ok 15 - 'species' isa 'Bio::Species' ok 16 - species name ok 17 - NCBI tax id ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::Annotation::DBLink' ok 19 - dblink source ok 20 - dblink ID ok 21 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 22 - boolean property ok 23 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 24 - property with value ok 25 - writer ok ok 26 - outfile is created ok 27 - seqXML version ok 28 - source ok 29 - source version ok 30 - schemaLocation ok 31 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 32 - display id ok 33 - primary id ok 34 - description ok 35 - sequence ok 36 - length ok 37 - entry source ok 38 - 'species' isa 'Bio::Species' ok 39 - species name ok 40 - NCBI tax id ok 41 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::Annotation::DBLink' ok 42 - dblink source ok 43 - dblink ID ok 44 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 45 - property with value ok 46 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 47 - boolean property ok 48 - outfile is created ok 49 - seqXML version ok 50 - source ok 51 - source version ok 52 - display id ok 53 - primary id ok 54 - description ok 55 - sequence ok 56 - length ok 57 - display id ok 58 - primary id ok 59 - description ok 60 - sequence ok 61 - length ok t/SeqIO/strider.t ...................... skipped: The optional module Convert::Binary::C (or dependencies thereof) was not installed t/SeqIO/swiss.t ........................ 1..247 ok 1 - use Bio::SeqIO::swiss; ok 2 - An object of class 'Bio::SeqIO::swiss' isa 'Bio::SeqIO' ok 3 - An object of class 'Bio::Species' isa 'Bio::Species' ok 4 ok 5 ok 6 - operator overloading in AnnotationI is deprecated ok 7 - dates ok 8 - dates ok 9 - dates ok 10 ok 11 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 12 ok 13 ok 14 ok 15 - operator overloading in AnnotationI is deprecated ok 16 ok 17 ok 18 ok 19 ok 20 - id is ROA1_HUMAN ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 ok 30 ok 31 ok 32 ok 33 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 ok 47 - GC1QBP ok 48 - HABP1 ok 49 - SF2P32 ok 50 - C1QBP ok 51 ok 52 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - F54H12.1 ok 60 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 73 ok 74 ok 75 ok 76 ok 77 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq::RichSeqI' ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - An object of class 'Bio::Species' isa 'Bio::Species' ok 176 ok 177 ok 178 - operator overloading in AnnotationI is deprecated ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 - An object of class 'Bio::Species' isa 'Bio::Species' ok 208 ok 209 ok 210 - operator overloading in AnnotationI is deprecated ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 - Converting to fasta seqids match ok 242 - Converting to fasta sequences match ok 243 - Can parse generated swiss ok 244 - Roundtrip, seqids match ok 245 - Roundtrip, sequences match ok 246 ok 247 ok t/SeqIO/tab.t .......................... 1..8 ok 1 - use Bio::SeqIO::tab; ok 2 - An object of class 'Bio::SeqIO::tab' isa 'Bio::SeqIO' ok 3 - seq is defined ok 4 - check seq length ok 5 - check matching ok 6 - seq is defined ok 7 - check seq length ok 8 - check matching ok t/SeqIO/table.t ........................ 1..450 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::SeqIO::table; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok t/SeqIO/tigr.t ......................... 1..8 ok 1 - use Bio::SeqIO::tigr; not ok 2 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 3 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 4 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 5 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 6 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 7 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 8 # TODO & SKIP No tests for tigr format -- no sample file to test against ok t/SeqIO/tigrxml.t ...................... 1..49 ok 1 - use Bio::SeqIO::tigrxml; ok 2 - An object of class 'Bio::SeqIO::tigrxml' isa 'Bio::SeqIO' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok t/SeqIO/tinyseq.t ...................... 1..16 ok 1 - use Bio::SeqIO::tinyseq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/ztr.t .......................... skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqTools/Backtranslate.t ............. 1..8 ok 1 - use Bio::Tools::SeqPattern::Backtranslate; ok 2 - Bio::Tools::SeqPattern::Backtranslate->can('_reverse_translate_motif') ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - threw Regexp ((?^:syntax token)) ok t/SeqTools/CodonTable.t ................ 1..71 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::CodonUsage::IO; ok 3 ok 4 - An object of class 'Bio::Tools::CodonTable' isa 'Bio::Tools::CodonTable' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok t/SeqTools/ECnumber.t .................. 1..27 ok 1 - use Bio::Tools::ECnumber; ok 2 - An object of class 'Bio::Tools::ECnumber' isa 'Bio::Tools::ECnumber' ok 3 - An object of class 'Bio::Tools::ECnumber' isa 'Bio::Tools::ECnumber' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/SeqTools/GuessSeqFormat.t ............ 1..105 ok 1 - use Bio::Tools::GuessSeqFormat; ok 2 - use Bio::SeqIO; ok 3 - use Bio::AlignIO; ok 4 ok 5 - An object of class 'Bio::Tools::GuessSeqFormat' isa 'Bio::Tools::GuessSeqFormat' ok 6 - File input ok 7 ok 8 - String input ok 9 ok 10 - Filehandle input ok 11 ok 12 - Unknown file format ok 13 - threw Regexp ((?^:Could not guess format)) ok 14 - ace format ok 15 ok 16 ok 17 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 18 - embl format ok 19 ok 20 ok 21 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 22 - fasta format ok 23 ok 24 ok 25 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 26 - fastq format ok 27 ok 28 ok 29 - An object of class 'Bio::Seq::Quality' isa 'Bio::PrimarySeqI' ok 30 - game format ok 31 ok 32 ok 33 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 34 - gcg format ok 35 ok 36 ok 37 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 38 - genbank format ok 39 ok 40 ok 41 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 42 - pir format ok 43 ok 44 ok 45 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 46 - raw format ok 47 ok 48 ok 49 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 50 - swiss format ok 51 ok 52 ok 53 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 54 - tab format ok 55 ok 56 ok 57 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 58 - clustalw format ok 59 ok 60 ok 61 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 62 - fasta format ok 63 ok 64 ok 65 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 66 - fastq format ok 67 - mase format ok 68 ok 69 ok 70 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 71 - mega format ok 72 ok 73 ok 74 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 75 - msf format ok 76 ok 77 ok 78 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 79 - nexus format ok 80 ok 81 ok 82 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 83 - pfam format ok 84 ok 85 ok 86 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 87 - phylip format ok 88 ok 89 ok 90 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 91 - prodom format ok 92 ok 93 ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 95 - selex format ok 96 ok 97 ok 98 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 99 - stockholm format ok 100 ok 101 ok 102 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 103 - gcgblast format ok 104 - vcf format ok 105 - blast format ok t/SeqTools/OddCodes.t .................. 1..11 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::OddCodes; ok 3 - An object of class 'Bio::Tools::OddCodes' isa 'Bio::Tools::OddCodes' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/SeqTools/SeqPattern.t ................ 1..28 ok 1 - use Bio::Tools::SeqPattern; ok 2 ok 3 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 8 ok 9 ok 10 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 11 ok 12 - threw Regexp ((?^:revcom for .+ sequence types)) ok 13 - threw Regexp ((?^:backtranslate for .+ sequence types)) ok 14 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 15 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 16 ok 17 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 18 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 19 ok 20 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 21 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 22 ok 23 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 24 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 25 ok 26 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 27 - An object of class 'Bio::Tools::SeqPattern' isa 'Bio::Tools::SeqPattern' ok 28 ok t/SeqTools/SeqStats.t .................. 1..47 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqStats; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools:SeqStats object ok 5 - count_monomers() ok 6 - count_codons() ok 7 - get_mol_wt() ok 8 ok 9 - An object of class 'Bio::Tools::SeqStats' isa 'Bio::Tools::SeqStats' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/SeqTools/SeqUtils.t .................. 1..133 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqUtils; ok 3 - use Bio::LiveSeq::Mutation; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Collection; ok 7 - use Bio::Annotation::Comment; ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - cat - has expected tags ok 37 - cat - has expected tag values ok 38 - cat - note tag transfered (no throw) ok 39 - cat - note tag values transfered (correct count) ok 40 - get correct start of feature before 'cat' ok 41 - get correct start of feature after 'cat' ok 42 - different alphabets ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - trunc_with_features - has expected tags ok 49 - trunc_with_features - has expected tag values ok 50 ok 51 - primary_tag matches original feature... ok 52 - but tagged sf is now revcom ok 53 - primary_tag matches original feature... ok 54 - but tagged sf is now revcom ok 55 - primary_tag matches original feature... ok 56 - but tagged sf is now revcom ok 57 - revcom_with_features - has expected tags ok 58 - revcom_with_features - has expected tag values ok 59 - still not circular ok 60 - still circular ok 61 - No error thrown when deleting a segment of the sequence ok 62 - annotation of whole sequence has been moved to new molecule ok 63 - the product has an additional 'misc_feature' and the note specifies the lengths of the deletion' ok 64 - The composite feature is still present ok 65 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 66 - 'a composite feature that spanned the deletion site has been split up, Location' isa 'Bio::Location::Split' ok 67 - one of the sub-eatures of the composite feature has been deleted completely ok 68 - sub-feature 1 of the composite feature is still present ok 69 - the original end of sf1 is 12 ok 70 - after deletion, the end of sf1 is 1nt before the deletion site ok 71 - the original end location of sf1 EXACT ok 72 - annotation of subeature 1 has been moved to new molecule ok 73 - feature1 is till present ok 74 - 'feature1 location has now been split by the deletion and location object' isa 'Bio::Location::Split' ok 75 - feature1 has two locations after the deletion ok 76 - feature1 start is unaffected by the deletion ok 77 - feature1 end of first split is 1nt before deletion site ok 78 - feature1 start of second split is 1nt after deletion site ok 79 - feature1 end of second split has been adjusted correctly ok 80 - split feature now has a note ok 81 - got the expected note about length and position of deletion ok 82 - feature3 is till present ok 83 - a feature downstream of the deletion site is shifted entirely by 10nt to the left ok 84 - feature4 is till present ok 85 - a feature upstream of the deletion site is not repositioned by the deletion ok 86 - feature2 is till present ok 87 - start pos of a feature that started in the deletion site has been altered accordingly ok 88 - feature 2 now has a note ok 89 - note added to feature2 about deletion at 3' end ok 90 - a feature that was completely positioned inside the deletion site is not present on the new molecule ok 91 - feature6 is till present ok 92 - start pos of a feature that started in the deletion site has been altered accordingly ok 93 - end pos of a feature that started in the deletion site has been altered accordingly ok 94 - No error thrown when inserting a fragment into recipient sequence ok 95 - annotation of whole sequence has been moved to new molecule ok 96 - The composite feature is still present ok 97 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 98 - 'a composite feature that spanned the insertion site has been split up, Location' isa 'Bio::Location::Split' ok 99 - all of the parts of the composite feature are still present ok 100 - sub-feature 1 of the composite feature is still present ok 101 - the original end of sf1 is 12 ok 102 - after insertion, the end of sf1 has been shifted by the length of the insertion ok 103 - 'sub-feature 1 (spans insertion site) is now split up and' isa 'Bio::Location::Split' ok 104 - the start and end position types of sub-feature1 have not changed ok 105 - annotation of subeature 1 has been moved to new molecule ok 106 - split feature now has a note ok 107 - got the expected note about length and position of insertion ok 108 - feature3 is till present ok 109 - a feature downstream of the insertion site is shifted entirely to the left by the length of the insertion ok 110 - feature4 is till present ok 111 - a feature upstream of the insertion site is not repositioned ok 112 - a feature on the inserted fragment is present on the product molecule ok 113 - position of the feature on the insert has been adjusted to product coordinates ok 114 - strand of the feature on insert has not changed ok 115 - desctription of the product contains description of the fragment ok 116 - desctription of the product contains description of the recipient ok 117 - the product has an additional 'misc_feature' with note='inserted fragment' ok 118 - No error thrown using 'ligate' of fragment into recipient ok 119 - product has the expected length ok 120 - the sequence of the fragment is inserted into the product ok 121 - we have a feature annotating the ligated fragment ok 122 - coordinates of the feature annotating the ligated feature are correct ok 123 - the fragment feature1 is now a feature of the product ok 124 - start and end of a feature on the fragment are correct after insertion with "flip" option ok 125 - Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error ok 126 - Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new' ok 127 - An object of class 'Bio::Seq::Foo' isa 'Bio::Seq::Foo' ok 128 - the product has an additional 'misc_feature' and the note specifies the lengths of the deletion' ok 129 - The composite feature is still present ok 130 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 131 - 'a composite feature that spanned the deletion site has been split up, Location' isa 'Bio::Location::Split' ok 132 - 'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new ok 133 - 'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new ok t/SeqTools/SeqWords.t .................. 1..22 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqWords; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools::SeqWords object ok 5 - count_words ok 6 ok 7 - An object of class 'Bio::Tools::SeqWords' isa 'Bio::Tools::SeqWords' ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - An object of class 'Bio::Tools::SeqWords' isa 'Bio::Tools::SeqWords' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Species.t ............................ 1..23 ok 1 - use Bio::Species; ok 2 - use Bio::DB::Taxonomy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 ok 23 ok t/Structure/IO.t ....................... 1..14 ok 1 - use Bio::Structure::IO; ok 2 ok 3 ok 4 - An object of class 'Bio::Structure::Entry' isa 'Bio::Structure::Entry' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Structure/Structure.t ................ 1..51 ok 1 - use Bio::Structure::Entry; ok 2 - use Bio::Structure::Model; ok 3 - use Bio::Structure::Chain; ok 4 - use Bio::Structure::Residue; ok 5 - use Bio::Structure::Atom; ok 6 ok 7 - An object of class 'Bio::Structure::Entry' isa 'Bio::Structure::Entry' ok 8 ok 9 - An object of class 'Bio::Structure::Model' isa 'Bio::Structure::Model' ok 10 ok 11 - An object of class 'Bio::Structure::Chain' isa 'Bio::Structure::Chain' ok 12 ok 13 - An object of class 'Bio::Structure::Residue' isa 'Bio::Structure::Residue' ok 14 ok 15 - An object of class 'Bio::Structure::Atom' isa 'Bio::Structure::Atom' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - An object of class 'Bio::Structure::Model' isa 'Bio::Structure::Model' ok 24 ok 25 ok 26 ok 27 - An object of class 'Bio::Structure::Chain' isa 'Bio::Structure::Chain' ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::Structure::Residue' isa 'Bio::Structure::Residue' ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Symbol.t ............................. 1..9 ok 1 - use Bio::Symbol::Symbol; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/TaxonTree.t .......................... skipped: These modules are now probably deprecated t/Tools/Alignment/Consed.t ............. 1..15 ok 1 - use Bio::Tools::Alignment::Consed; ok 2 - new CSM::Consed object was created ok 3 - An object of class 'Bio::Tools::Alignment::Consed' isa 'Bio::Tools::Alignment::Consed' ok 4 - singlets can be successfully set ok 5 - singlets can be retrieved ok 6 - doublets can be set ok 7 - doublets can be retreived ok 8 - doublets can be retrieved ok 9 - pairs can be retrieved ok 10 - multiplets can be retrieved ok 11 - singletons can be retrieved ok 12 - how many sequences there are in the acefile _and_ in the singlets file ok 13 - statistics from the Bio::Tools::Alignment::Consed object to compare the total number of sequences accounted for there to the number of sequences found via grep ok 14 ok 15 ok t/Tools/AmpliconSearch.t ............... 1..185 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::Primer; ok 3 - use Bio::Tools::AmpliconSearch; ok 4 - Basic ok 5 - An object of class 'Bio::Tools::AmpliconSearch' isa 'Bio::Tools::AmpliconSearch' ok 6 - Forward primer only ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 11 ok 12 ok 13 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - Reverse primer only ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 - Two primers, no match ok 39 ok 40 ok 41 ok 42 ok 43 - Two degenerate primers from a file ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - RNA template ok 55 ok 56 ok 57 ok 58 ok 59 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - Forward primer from file ok 66 ok 67 ok 68 ok 69 ok 70 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 71 ok 72 ok 73 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - Multiple amplicons ok 80 ok 81 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 - Amplicon on reverse strand ok 94 ok 95 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 - Overlapping amplicons (1) ok 108 ok 109 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 - Overlapping amplicons (2) ok 116 ok 117 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 - Overlapping amplicons (3) ok 124 ok 125 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 - Amplicons on both strands ok 132 ok 133 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 - Overlapping amplicons on both strands ok 146 ok 147 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 - Annotated template ok 154 ok 155 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 156 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 157 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 158 ok 159 ok 160 - Update primers ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - Update template ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok t/Tools/Analysis/DNA/ESEfinder.t ....... skipped: The optional module HTML::HeadParser generated the following error: t/Tools/Analysis/Protein/Domcut.t ...... skipped: Network tests have not been requested t/Tools/Analysis/Protein/ELM.t ......... skipped: The optional module HTML::HeadParser generated the following error: t/Tools/Analysis/Protein/GOR4.t ........ skipped: Network tests have not been requested t/Tools/Analysis/Protein/HNN.t ......... skipped: Network tests have not been requested t/Tools/Analysis/Protein/Mitoprot.t .... skipped: Network tests have not been requested t/Tools/Analysis/Protein/NetPhos.t ..... skipped: Network tests have not been requested t/Tools/Analysis/Protein/Scansite.t .... 1..14 ok 1 - use Bio::Tools::Analysis::Protein::Scansite; ok 2 - use Bio::SeqIO; ok 3 - use Bio::WebAgent; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok t/Tools/Analysis/Protein/Sopma.t ....... 1..16 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::Analysis::Protein::Sopma; ok 3 ok 4 ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok t/Tools/EMBOSS/Palindrome.t ............ 1..13 ok 1 - use Bio::Tools::EMBOSS::Palindrome; ok 2 - use Bio::Tools::GFF; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/Tools/Est2Genome.t ................... 1..61 ok 1 - use Bio::Tools::Est2Genome; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok t/Tools/FootPrinter.t .................. 1..27 ok 1 - use Bio::Tools::FootPrinter; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Tools/GFF.t .......................... 1..34 ok 1 - use Bio::Tools::GFF; ok 2 - use Bio::SeqFeature::Generic; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok t/Tools/Geneid.t ....................... 1..26 ok 1 - use Bio::Tools::Geneid; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/Tools/Genewise.t ..................... 1..33 ok 1 - use Bio::Tools::Genewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok t/Tools/Genomewise.t ................... 1..21 ok 1 - use Bio::Tools::Genomewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Tools/Genpred.t ...................... 1..185 ok 1 - use Bio::Tools::Fgenesh; ok 2 - use Bio::Tools::Genscan; ok 3 - use Bio::Tools::Genemark; ok 4 - use Bio::Tools::Glimmer; ok 5 - use Bio::Tools::MZEF; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 ok 10 - strand match (-1 and -1) ok 11 - score match (1.05 and 1.05) ok 12 ok 13 - predicted and extracted protein seqs match ok 14 - strand match (1 and 1) ok 15 - score match (4.46 and 4.46) ok 16 ok 17 - predicted and extracted protein seqs match ok 18 - initial exons 0 ok 19 - score match 1.74 ok 20 ok 21 - predicted and extracted protein seqs match ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - Genemark tests ok 43 ok 44 ok 45 ok 46 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 - An object of class 'Bio::Location::Fuzzy' isa 'Bio::Location::Fuzzy' ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok t/Tools/Hmmer.t ........................ 1..29 ok 1 - use Bio::Tools::HMMER::Domain; ok 2 - use Bio::Tools::HMMER::Set; ok 3 - use Bio::Tools::HMMER::Results; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok t/Tools/IUPAC.t ........................ 1..46 ok 1 - use Bio::Tools::IUPAC; ok 2 - use Bio::Seq; ok 3 - use Bio::PrimarySeq; ok 4 ok 5 ok 6 - Regexp ok 7 ok 8 - Regexp ok 9 - Count ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - Regexp matches ambiguous sequences ok 28 ok 29 - Nucleic IUPAC ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - Proteic IUPAC ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok t/Tools/Lucy.t ......................... 1..22 ok 1 - use Bio::Tools::Lucy; ok 2 - An object of class 'Bio::Tools::Lucy' isa 'Bio::Tools::Lucy' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Tools/Match.t ........................ 1..38 ok 1 - use Bio::Tools::Match; ok 2 ok 3 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature core score correct ok 8 - feature matrix score correct ok 9 - feature matrix id correct ok 10 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 11 - correct source ok 12 - feature start correct ok 13 - feature end correct ok 14 - feature core score correct ok 15 - feature matrix score correct ok 16 - feature matrix id correct ok 17 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 18 - correct source ok 19 - feature start correct ok 20 - feature end correct ok 21 - feature core score correct ok 22 - feature matrix score correct ok 23 - feature matrix id correct ok 24 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 25 - correct source ok 26 - feature start correct ok 27 - feature end correct ok 28 - feature core score correct ok 29 - feature matrix score correct ok 30 - feature matrix id correct ok 31 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeature::Generic' ok 32 - correct source ok 33 - feature start correct ok 34 - feature end correct ok 35 - feature core score correct ok 36 - feature matrix score correct ok 37 - feature matrix id correct ok 38 - correct number of results managed to get tested ok Timeout (max run time is 420s) C:\Perl-5.16\bin\perl.exe exits with 37.