PATH=C:\Program Files\Microsoft Platform SDK\Bin;C:\Program Files\Microsoft Platform SDK\Bin\WinNT;C:\Program Files\Microsoft Visual Studio\VC98\Bin;C:\Program Files\Microsoft Visual Studio\Common\MSDev98\Bin;C:\Perl-5.8\site\bin;C:\Perl-5.8\bin;C:\cygwin\bin;C:\Program Files\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\WINDOWS\system32\WindowsPowerShell\v1.0;C:\mysql\bin Start 2011-08-03T09:56:41 ActivePerl-825 CPAN-1.9402 LIB=C:\PROGRA~1\MICROS~3\VC98\Lib\PSDK;C:\PROGRA~1\MICROS~2\Lib;C:\PROGRA~1\MICROS~3\VC98\Lib;C:\PROGRA~1\MICROS~3\VC98\MFC\Lib INCLUDE=C:\PROGRA~1\MICROS~2\Include;C:\PROGRA~1\MICROS~3\VC98\ATL\Include;C:\PROGRA~1\MICROS~3\VC98\Include;C:\PROGRA~1\MICROS~3\VC98\MFC\Include PATH=C:/CPANFL~1.8/var/libs/bin;C:\PROGRA~1\MICROS~2\Bin;C:\PROGRA~1\MICROS~2\Bin\WinNT;C:\PROGRA~1\MICROS~3\VC98\Bin;C:\PROGRA~1\MICROS~3\Common\MSDev98\Bin;C:\Perl-5.8\site\bin;C:\Perl-5.8\bin;C:\cygwin\bin;C:\PROGRA~1\Perforce;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\WINDOWS\system32\WINDOW~2\v1.0;C:\mysql\bin Going to read 'C:\cpanfly-5.8\var\cpan\Metadata' Database was generated on Tue, 02 Aug 2011 18:27:22 GMT Running make for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz Checksum for C:\cpanfly-5.8\var\cpan\sources\authors\id\C\CJ\CJFIELDS\BioPerl-1.6.1.tar.gz ok Will not use Archive::Tar, need 1.00 BioPerl-1.6.1 BioPerl-1.6.1/AUTHORS BioPerl-1.6.1/BioPerl.pm BioPerl-1.6.1/BUGS BioPerl-1.6.1/Build.PL BioPerl-1.6.1/Changes BioPerl-1.6.1/DEPENDENCIES BioPerl-1.6.1/DEPRECATED BioPerl-1.6.1/INSTALL BioPerl-1.6.1/INSTALL.SKIP BioPerl-1.6.1/INSTALL.WIN BioPerl-1.6.1/LICENSE BioPerl-1.6.1/Makefile.PL BioPerl-1.6.1/MANIFEST BioPerl-1.6.1/MANIFEST.SKIP BioPerl-1.6.1/META.yml BioPerl-1.6.1/README BioPerl-1.6.1/Bio BioPerl-1.6.1/Bio/AlignIO.pm BioPerl-1.6.1/Bio/AnalysisI.pm BioPerl-1.6.1/Bio/AnalysisParserI.pm BioPerl-1.6.1/Bio/AnalysisResultI.pm BioPerl-1.6.1/Bio/AnnotatableI.pm BioPerl-1.6.1/Bio/AnnotationCollectionI.pm BioPerl-1.6.1/Bio/AnnotationI.pm BioPerl-1.6.1/Bio/Biblio.pm BioPerl-1.6.1/Bio/ClusterI.pm BioPerl-1.6.1/Bio/ClusterIO.pm BioPerl-1.6.1/Bio/DasI.pm BioPerl-1.6.1/Bio/DBLinkContainerI.pm BioPerl-1.6.1/Bio/DescribableI.pm BioPerl-1.6.1/Bio/FeatureHolderI.pm BioPerl-1.6.1/Bio/FeatureIO.pm BioPerl-1.6.1/Bio/HandlerBaseI.pm BioPerl-1.6.1/Bio/IdCollectionI.pm BioPerl-1.6.1/Bio/IdentifiableI.pm BioPerl-1.6.1/Bio/LocatableSeq.pm BioPerl-1.6.1/Bio/LocationI.pm BioPerl-1.6.1/Bio/MapIO.pm BioPerl-1.6.1/Bio/OntologyIO.pm BioPerl-1.6.1/Bio/ParameterBaseI.pm BioPerl-1.6.1/Bio/Perl.pm BioPerl-1.6.1/Bio/PhyloNetwork.pm BioPerl-1.6.1/Bio/PrimarySeq.pm BioPerl-1.6.1/Bio/PrimarySeqI.pm BioPerl-1.6.1/Bio/PullParserI.pm BioPerl-1.6.1/Bio/Range.pm BioPerl-1.6.1/Bio/RangeI.pm BioPerl-1.6.1/Bio/SearchDist.pm BioPerl-1.6.1/Bio/SearchIO.pm BioPerl-1.6.1/Bio/Seq.pm BioPerl-1.6.1/Bio/SeqAnalysisParserI.pm BioPerl-1.6.1/Bio/SeqFeatureI.pm BioPerl-1.6.1/Bio/SeqI.pm BioPerl-1.6.1/Bio/SeqIO.pm BioPerl-1.6.1/Bio/SeqUtils.pm BioPerl-1.6.1/Bio/SimpleAlign.pm BioPerl-1.6.1/Bio/SimpleAnalysisI.pm BioPerl-1.6.1/Bio/Species.pm BioPerl-1.6.1/Bio/Taxon.pm BioPerl-1.6.1/Bio/Taxonomy.pm BioPerl-1.6.1/Bio/TreeIO.pm BioPerl-1.6.1/Bio/UpdateableSeqI.pm BioPerl-1.6.1/Bio/WebAgent.pm BioPerl-1.6.1/Bio/Align BioPerl-1.6.1/Bio/Align/AlignI.pm BioPerl-1.6.1/Bio/Align/DNAStatistics.pm BioPerl-1.6.1/Bio/Align/PairwiseStatistics.pm BioPerl-1.6.1/Bio/Align/ProteinStatistics.pm BioPerl-1.6.1/Bio/Align/StatisticsI.pm BioPerl-1.6.1/Bio/Align/Utilities.pm BioPerl-1.6.1/Bio/AlignIO BioPerl-1.6.1/Bio/AlignIO/arp.pm BioPerl-1.6.1/Bio/AlignIO/bl2seq.pm BioPerl-1.6.1/Bio/AlignIO/clustalw.pm BioPerl-1.6.1/Bio/AlignIO/emboss.pm BioPerl-1.6.1/Bio/AlignIO/fasta.pm BioPerl-1.6.1/Bio/AlignIO/largemultifasta.pm BioPerl-1.6.1/Bio/AlignIO/maf.pm BioPerl-1.6.1/Bio/AlignIO/mase.pm BioPerl-1.6.1/Bio/AlignIO/mega.pm BioPerl-1.6.1/Bio/AlignIO/meme.pm BioPerl-1.6.1/Bio/AlignIO/metafasta.pm BioPerl-1.6.1/Bio/AlignIO/msf.pm BioPerl-1.6.1/Bio/AlignIO/nexus.pm BioPerl-1.6.1/Bio/AlignIO/pfam.pm BioPerl-1.6.1/Bio/AlignIO/phylip.pm BioPerl-1.6.1/Bio/AlignIO/po.pm BioPerl-1.6.1/Bio/AlignIO/proda.pm BioPerl-1.6.1/Bio/AlignIO/prodom.pm BioPerl-1.6.1/Bio/AlignIO/psi.pm BioPerl-1.6.1/Bio/AlignIO/selex.pm BioPerl-1.6.1/Bio/AlignIO/stockholm.pm BioPerl-1.6.1/Bio/AlignIO/xmfa.pm BioPerl-1.6.1/Bio/AlignIO/Handler BioPerl-1.6.1/Bio/AlignIO/Handler/GenericAlignHandler.pm BioPerl-1.6.1/Bio/Annotation BioPerl-1.6.1/Bio/Annotation/AnnotationFactory.pm BioPerl-1.6.1/Bio/Annotation/Collection.pm BioPerl-1.6.1/Bio/Annotation/Comment.pm BioPerl-1.6.1/Bio/Annotation/DBLink.pm BioPerl-1.6.1/Bio/Annotation/OntologyTerm.pm BioPerl-1.6.1/Bio/Annotation/Reference.pm BioPerl-1.6.1/Bio/Annotation/Relation.pm BioPerl-1.6.1/Bio/Annotation/SimpleValue.pm BioPerl-1.6.1/Bio/Annotation/StructuredValue.pm BioPerl-1.6.1/Bio/Annotation/TagTree.pm BioPerl-1.6.1/Bio/Annotation/Target.pm BioPerl-1.6.1/Bio/Annotation/Tree.pm BioPerl-1.6.1/Bio/Annotation/TypeManager.pm BioPerl-1.6.1/Bio/Assembly BioPerl-1.6.1/Bio/Assembly/Contig.pm BioPerl-1.6.1/Bio/Assembly/ContigAnalysis.pm BioPerl-1.6.1/Bio/Assembly/IO.pm BioPerl-1.6.1/Bio/Assembly/Scaffold.pm BioPerl-1.6.1/Bio/Assembly/ScaffoldI.pm BioPerl-1.6.1/Bio/Assembly/Singlet.pm BioPerl-1.6.1/Bio/Assembly/IO BioPerl-1.6.1/Bio/Assembly/IO/ace.pm BioPerl-1.6.1/Bio/Assembly/IO/phrap.pm BioPerl-1.6.1/Bio/Assembly/IO/tigr.pm BioPerl-1.6.1/Bio/Assembly/Tools BioPerl-1.6.1/Bio/Assembly/Tools/ContigSpectrum.pm BioPerl-1.6.1/Bio/Biblio BioPerl-1.6.1/Bio/Biblio/Article.pm BioPerl-1.6.1/Bio/Biblio/BiblioBase.pm BioPerl-1.6.1/Bio/Biblio/Book.pm BioPerl-1.6.1/Bio/Biblio/BookArticle.pm BioPerl-1.6.1/Bio/Biblio/IO.pm BioPerl-1.6.1/Bio/Biblio/Journal.pm BioPerl-1.6.1/Bio/Biblio/JournalArticle.pm BioPerl-1.6.1/Bio/Biblio/MedlineArticle.pm BioPerl-1.6.1/Bio/Biblio/MedlineBook.pm BioPerl-1.6.1/Bio/Biblio/MedlineBookArticle.pm BioPerl-1.6.1/Bio/Biblio/MedlineJournal.pm BioPerl-1.6.1/Bio/Biblio/MedlineJournalArticle.pm BioPerl-1.6.1/Bio/Biblio/Organisation.pm BioPerl-1.6.1/Bio/Biblio/Patent.pm BioPerl-1.6.1/Bio/Biblio/Person.pm BioPerl-1.6.1/Bio/Biblio/Proceeding.pm BioPerl-1.6.1/Bio/Biblio/Provider.pm BioPerl-1.6.1/Bio/Biblio/PubmedArticle.pm BioPerl-1.6.1/Bio/Biblio/PubmedBookArticle.pm BioPerl-1.6.1/Bio/Biblio/PubmedJournalArticle.pm BioPerl-1.6.1/Bio/Biblio/Ref.pm BioPerl-1.6.1/Bio/Biblio/Service.pm BioPerl-1.6.1/Bio/Biblio/TechReport.pm BioPerl-1.6.1/Bio/Biblio/Thesis.pm BioPerl-1.6.1/Bio/Biblio/WebResource.pm BioPerl-1.6.1/Bio/Biblio/IO BioPerl-1.6.1/Bio/Biblio/IO/medline2ref.pm BioPerl-1.6.1/Bio/Biblio/IO/medlinexml.pm BioPerl-1.6.1/Bio/Biblio/IO/pubmed2ref.pm BioPerl-1.6.1/Bio/Biblio/IO/pubmedxml.pm BioPerl-1.6.1/Bio/Cluster BioPerl-1.6.1/Bio/Cluster/ClusterFactory.pm BioPerl-1.6.1/Bio/Cluster/FamilyI.pm BioPerl-1.6.1/Bio/Cluster/SequenceFamily.pm BioPerl-1.6.1/Bio/Cluster/UniGene.pm BioPerl-1.6.1/Bio/Cluster/UniGeneI.pm BioPerl-1.6.1/Bio/ClusterIO BioPerl-1.6.1/Bio/ClusterIO/dbsnp.pm BioPerl-1.6.1/Bio/ClusterIO/unigene.pm BioPerl-1.6.1/Bio/CodonUsage BioPerl-1.6.1/Bio/CodonUsage/IO.pm BioPerl-1.6.1/Bio/CodonUsage/Table.pm BioPerl-1.6.1/Bio/Coordinate BioPerl-1.6.1/Bio/Coordinate/Chain.pm BioPerl-1.6.1/Bio/Coordinate/Collection.pm BioPerl-1.6.1/Bio/Coordinate/ExtrapolatingPair.pm BioPerl-1.6.1/Bio/Coordinate/GeneMapper.pm BioPerl-1.6.1/Bio/Coordinate/Graph.pm BioPerl-1.6.1/Bio/Coordinate/MapperI.pm BioPerl-1.6.1/Bio/Coordinate/Pair.pm BioPerl-1.6.1/Bio/Coordinate/Result.pm BioPerl-1.6.1/Bio/Coordinate/ResultI.pm BioPerl-1.6.1/Bio/Coordinate/Utils.pm BioPerl-1.6.1/Bio/Coordinate/Result BioPerl-1.6.1/Bio/Coordinate/Result/Gap.pm BioPerl-1.6.1/Bio/Coordinate/Result/Match.pm BioPerl-1.6.1/Bio/Das BioPerl-1.6.1/Bio/Das/FeatureTypeI.pm BioPerl-1.6.1/Bio/Das/SegmentI.pm BioPerl-1.6.1/Bio/DB BioPerl-1.6.1/Bio/DB/Ace.pm BioPerl-1.6.1/Bio/DB/BiblioI.pm BioPerl-1.6.1/Bio/DB/BioFetch.pm BioPerl-1.6.1/Bio/DB/CUTG.pm BioPerl-1.6.1/Bio/DB/DBFetch.pm BioPerl-1.6.1/Bio/DB/EMBL.pm BioPerl-1.6.1/Bio/DB/EntrezGene.pm BioPerl-1.6.1/Bio/DB/EUtilities.pm BioPerl-1.6.1/Bio/DB/Expression.pm BioPerl-1.6.1/Bio/DB/Failover.pm BioPerl-1.6.1/Bio/DB/Fasta.pm BioPerl-1.6.1/Bio/DB/FileCache.pm BioPerl-1.6.1/Bio/DB/Flat.pm BioPerl-1.6.1/Bio/DB/GenBank.pm BioPerl-1.6.1/Bio/DB/GenericWebAgent.pm BioPerl-1.6.1/Bio/DB/GenPept.pm BioPerl-1.6.1/Bio/DB/GFF.pm BioPerl-1.6.1/Bio/DB/HIV.pm BioPerl-1.6.1/Bio/DB/InMemoryCache.pm BioPerl-1.6.1/Bio/DB/LocationI.pm BioPerl-1.6.1/Bio/DB/MeSH.pm BioPerl-1.6.1/Bio/DB/NCBIHelper.pm BioPerl-1.6.1/Bio/DB/Qual.pm BioPerl-1.6.1/Bio/DB/QueryI.pm BioPerl-1.6.1/Bio/DB/RandomAccessI.pm BioPerl-1.6.1/Bio/DB/ReferenceI.pm BioPerl-1.6.1/Bio/DB/RefSeq.pm BioPerl-1.6.1/Bio/DB/Registry.pm BioPerl-1.6.1/Bio/DB/SeqFeature.pm BioPerl-1.6.1/Bio/DB/SeqHound.pm BioPerl-1.6.1/Bio/DB/SeqI.pm BioPerl-1.6.1/Bio/DB/SeqVersion.pm BioPerl-1.6.1/Bio/DB/SwissProt.pm BioPerl-1.6.1/Bio/DB/Taxonomy.pm BioPerl-1.6.1/Bio/DB/TFBS.pm BioPerl-1.6.1/Bio/DB/Universal.pm BioPerl-1.6.1/Bio/DB/UpdateableSeqI.pm BioPerl-1.6.1/Bio/DB/WebDBSeqI.pm BioPerl-1.6.1/Bio/DB/Biblio BioPerl-1.6.1/Bio/DB/Biblio/biofetch.pm BioPerl-1.6.1/Bio/DB/Biblio/eutils.pm BioPerl-1.6.1/Bio/DB/Biblio/soap.pm BioPerl-1.6.1/Bio/DB/Expression BioPerl-1.6.1/Bio/DB/Expression/geo.pm BioPerl-1.6.1/Bio/DB/Flat BioPerl-1.6.1/Bio/DB/Flat/BDB.pm BioPerl-1.6.1/Bio/DB/Flat/BinarySearch.pm BioPerl-1.6.1/Bio/DB/Flat/BDB BioPerl-1.6.1/Bio/DB/Flat/BDB/embl.pm BioPerl-1.6.1/Bio/DB/Flat/BDB/fasta.pm BioPerl-1.6.1/Bio/DB/Flat/BDB/genbank.pm BioPerl-1.6.1/Bio/DB/Flat/BDB/swiss.pm BioPerl-1.6.1/Bio/DB/GFF BioPerl-1.6.1/Bio/DB/GFF/Aggregator.pm BioPerl-1.6.1/Bio/DB/GFF/Featname.pm BioPerl-1.6.1/Bio/DB/GFF/Feature.pm BioPerl-1.6.1/Bio/DB/GFF/Homol.pm BioPerl-1.6.1/Bio/DB/GFF/RelSegment.pm BioPerl-1.6.1/Bio/DB/GFF/Segment.pm BioPerl-1.6.1/Bio/DB/GFF/Typename.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor BioPerl-1.6.1/Bio/DB/GFF/Adaptor/ace.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/berkeleydb.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/biofetch.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/biofetch_oracle.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/memory.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/berkeleydb BioPerl-1.6.1/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/iterator.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/mysql.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/oracle.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/oracleace.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/pg.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/memory BioPerl-1.6.1/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm BioPerl-1.6.1/Bio/DB/GFF/Adaptor/memory/iterator.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator BioPerl-1.6.1/Bio/DB/GFF/Aggregator/alignment.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/clone.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/coding.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/gene.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/match.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/none.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/orf.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/processed_transcript.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/so_transcript.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/transcript.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_acembly.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_genscan.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_refgene.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_softberry.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm BioPerl-1.6.1/Bio/DB/GFF/Aggregator/ucsc_unigene.pm BioPerl-1.6.1/Bio/DB/GFF/Util BioPerl-1.6.1/Bio/DB/GFF/Util/Binning.pm BioPerl-1.6.1/Bio/DB/GFF/Util/Rearrange.pm BioPerl-1.6.1/Bio/DB/HIV BioPerl-1.6.1/Bio/DB/HIV/HIVAnnotProcessor.pm BioPerl-1.6.1/Bio/DB/HIV/HIVQueryHelper.pm BioPerl-1.6.1/Bio/DB/HIV/lanl-schema.xml BioPerl-1.6.1/Bio/DB/Query BioPerl-1.6.1/Bio/DB/Query/GenBank.pm BioPerl-1.6.1/Bio/DB/Query/HIVQuery.pm BioPerl-1.6.1/Bio/DB/Query/WebQuery.pm BioPerl-1.6.1/Bio/DB/SeqFeature BioPerl-1.6.1/Bio/DB/SeqFeature/NormalizedFeature.pm BioPerl-1.6.1/Bio/DB/SeqFeature/NormalizedFeatureI.pm BioPerl-1.6.1/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Segment.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store BioPerl-1.6.1/Bio/DB/SeqFeature/Store/bdb.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/berkeleydb.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/berkeleydb3.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/GFF2Loader.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/GFF3Loader.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/Loader.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/LoadHelper.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/memory.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/DBI BioPerl-1.6.1/Bio/DB/SeqFeature/Store/DBI/Iterator.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/DBI/mysql.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/DBI/Pg.pm BioPerl-1.6.1/Bio/DB/SeqFeature/Store/DBI/SQLite.pm BioPerl-1.6.1/Bio/DB/SeqVersion BioPerl-1.6.1/Bio/DB/SeqVersion/gi.pm BioPerl-1.6.1/Bio/DB/Taxonomy BioPerl-1.6.1/Bio/DB/Taxonomy/entrez.pm BioPerl-1.6.1/Bio/DB/Taxonomy/flatfile.pm BioPerl-1.6.1/Bio/DB/Taxonomy/list.pm BioPerl-1.6.1/Bio/DB/TFBS BioPerl-1.6.1/Bio/DB/TFBS/transfac_pro.pm BioPerl-1.6.1/Bio/Event BioPerl-1.6.1/Bio/Event/EventGeneratorI.pm BioPerl-1.6.1/Bio/Event/EventHandlerI.pm BioPerl-1.6.1/Bio/Expression BioPerl-1.6.1/Bio/Expression/Contact.pm BioPerl-1.6.1/Bio/Expression/DataSet.pm BioPerl-1.6.1/Bio/Expression/FeatureGroup.pm BioPerl-1.6.1/Bio/Expression/FeatureI.pm BioPerl-1.6.1/Bio/Expression/Platform.pm BioPerl-1.6.1/Bio/Expression/ProbeI.pm BioPerl-1.6.1/Bio/Expression/Sample.pm BioPerl-1.6.1/Bio/Expression/FeatureGroup BioPerl-1.6.1/Bio/Expression/FeatureGroup/FeatureGroupMas50.pm BioPerl-1.6.1/Bio/Expression/FeatureSet BioPerl-1.6.1/Bio/Expression/FeatureSet/FeatureSetMas50.pm BioPerl-1.6.1/Bio/Factory BioPerl-1.6.1/Bio/Factory/AnalysisI.pm BioPerl-1.6.1/Bio/Factory/ApplicationFactoryI.pm BioPerl-1.6.1/Bio/Factory/DriverFactory.pm BioPerl-1.6.1/Bio/Factory/FTLocationFactory.pm BioPerl-1.6.1/Bio/Factory/LocationFactoryI.pm BioPerl-1.6.1/Bio/Factory/MapFactoryI.pm BioPerl-1.6.1/Bio/Factory/ObjectBuilderI.pm BioPerl-1.6.1/Bio/Factory/ObjectFactory.pm BioPerl-1.6.1/Bio/Factory/ObjectFactoryI.pm BioPerl-1.6.1/Bio/Factory/SeqAnalysisParserFactory.pm BioPerl-1.6.1/Bio/Factory/SeqAnalysisParserFactoryI.pm BioPerl-1.6.1/Bio/Factory/SequenceFactoryI.pm BioPerl-1.6.1/Bio/Factory/SequenceProcessorI.pm BioPerl-1.6.1/Bio/Factory/SequenceStreamI.pm BioPerl-1.6.1/Bio/Factory/TreeFactoryI.pm BioPerl-1.6.1/Bio/FeatureIO BioPerl-1.6.1/Bio/FeatureIO/bed.pm BioPerl-1.6.1/Bio/FeatureIO/gff.pm BioPerl-1.6.1/Bio/FeatureIO/gtf.pm BioPerl-1.6.1/Bio/FeatureIO/interpro.pm BioPerl-1.6.1/Bio/FeatureIO/ptt.pm BioPerl-1.6.1/Bio/FeatureIO/vecscreen_simple.pm BioPerl-1.6.1/Bio/Index BioPerl-1.6.1/Bio/Index/Abstract.pm BioPerl-1.6.1/Bio/Index/AbstractSeq.pm BioPerl-1.6.1/Bio/Index/Blast.pm BioPerl-1.6.1/Bio/Index/BlastTable.pm BioPerl-1.6.1/Bio/Index/EMBL.pm BioPerl-1.6.1/Bio/Index/Fasta.pm BioPerl-1.6.1/Bio/Index/Fastq.pm BioPerl-1.6.1/Bio/Index/GenBank.pm BioPerl-1.6.1/Bio/Index/Hmmer.pm BioPerl-1.6.1/Bio/Index/Qual.pm BioPerl-1.6.1/Bio/Index/Stockholm.pm BioPerl-1.6.1/Bio/Index/SwissPfam.pm BioPerl-1.6.1/Bio/Index/Swissprot.pm BioPerl-1.6.1/Bio/LiveSeq BioPerl-1.6.1/Bio/LiveSeq/AARange.pm BioPerl-1.6.1/Bio/LiveSeq/Chain.pm BioPerl-1.6.1/Bio/LiveSeq/ChainI.pm BioPerl-1.6.1/Bio/LiveSeq/DNA.pm BioPerl-1.6.1/Bio/LiveSeq/Exon.pm BioPerl-1.6.1/Bio/LiveSeq/Gene.pm BioPerl-1.6.1/Bio/LiveSeq/Intron.pm BioPerl-1.6.1/Bio/LiveSeq/Mutation.pm BioPerl-1.6.1/Bio/LiveSeq/Mutator.pm BioPerl-1.6.1/Bio/LiveSeq/Prim_Transcript.pm BioPerl-1.6.1/Bio/LiveSeq/Range.pm BioPerl-1.6.1/Bio/LiveSeq/Repeat_Region.pm BioPerl-1.6.1/Bio/LiveSeq/Repeat_Unit.pm BioPerl-1.6.1/Bio/LiveSeq/SeqI.pm BioPerl-1.6.1/Bio/LiveSeq/Transcript.pm BioPerl-1.6.1/Bio/LiveSeq/Translation.pm BioPerl-1.6.1/Bio/LiveSeq/IO BioPerl-1.6.1/Bio/LiveSeq/IO/BioPerl.pm BioPerl-1.6.1/Bio/LiveSeq/IO/Loader.pm BioPerl-1.6.1/Bio/LiveSeq/IO/README BioPerl-1.6.1/Bio/Location BioPerl-1.6.1/Bio/Location/Atomic.pm BioPerl-1.6.1/Bio/Location/AvWithinCoordPolicy.pm BioPerl-1.6.1/Bio/Location/CoordinatePolicyI.pm BioPerl-1.6.1/Bio/Location/Fuzzy.pm BioPerl-1.6.1/Bio/Location/FuzzyLocationI.pm BioPerl-1.6.1/Bio/Location/NarrowestCoordPolicy.pm BioPerl-1.6.1/Bio/Location/Simple.pm BioPerl-1.6.1/Bio/Location/Split.pm BioPerl-1.6.1/Bio/Location/SplitLocationI.pm BioPerl-1.6.1/Bio/Location/WidestCoordPolicy.pm BioPerl-1.6.1/Bio/Map BioPerl-1.6.1/Bio/Map/Clone.pm BioPerl-1.6.1/Bio/Map/Contig.pm BioPerl-1.6.1/Bio/Map/CytoMap.pm BioPerl-1.6.1/Bio/Map/CytoMarker.pm BioPerl-1.6.1/Bio/Map/CytoPosition.pm BioPerl-1.6.1/Bio/Map/EntityI.pm BioPerl-1.6.1/Bio/Map/FPCMarker.pm BioPerl-1.6.1/Bio/Map/Gene.pm BioPerl-1.6.1/Bio/Map/GeneMap.pm BioPerl-1.6.1/Bio/Map/GenePosition.pm BioPerl-1.6.1/Bio/Map/GeneRelative.pm BioPerl-1.6.1/Bio/Map/LinkageMap.pm BioPerl-1.6.1/Bio/Map/LinkagePosition.pm BioPerl-1.6.1/Bio/Map/MapI.pm BioPerl-1.6.1/Bio/Map/Mappable.pm BioPerl-1.6.1/Bio/Map/MappableI.pm BioPerl-1.6.1/Bio/Map/Marker.pm BioPerl-1.6.1/Bio/Map/MarkerI.pm BioPerl-1.6.1/Bio/Map/Microsatellite.pm BioPerl-1.6.1/Bio/Map/OrderedPosition.pm BioPerl-1.6.1/Bio/Map/OrderedPositionWithDistance.pm BioPerl-1.6.1/Bio/Map/Physical.pm BioPerl-1.6.1/Bio/Map/Position.pm BioPerl-1.6.1/Bio/Map/PositionHandler.pm BioPerl-1.6.1/Bio/Map/PositionHandlerI.pm BioPerl-1.6.1/Bio/Map/PositionI.pm BioPerl-1.6.1/Bio/Map/PositionWithSequence.pm BioPerl-1.6.1/Bio/Map/Prediction.pm BioPerl-1.6.1/Bio/Map/Relative.pm BioPerl-1.6.1/Bio/Map/RelativeI.pm BioPerl-1.6.1/Bio/Map/SimpleMap.pm BioPerl-1.6.1/Bio/Map/TranscriptionFactor.pm BioPerl-1.6.1/Bio/MapIO BioPerl-1.6.1/Bio/MapIO/fpc.pm BioPerl-1.6.1/Bio/MapIO/mapmaker.pm BioPerl-1.6.1/Bio/Matrix BioPerl-1.6.1/Bio/Matrix/Generic.pm BioPerl-1.6.1/Bio/Matrix/IO.pm BioPerl-1.6.1/Bio/Matrix/MatrixI.pm BioPerl-1.6.1/Bio/Matrix/Mlagan.pm BioPerl-1.6.1/Bio/Matrix/PhylipDist.pm BioPerl-1.6.1/Bio/Matrix/Scoring.pm BioPerl-1.6.1/Bio/Matrix/IO BioPerl-1.6.1/Bio/Matrix/IO/mlagan.pm BioPerl-1.6.1/Bio/Matrix/IO/phylip.pm BioPerl-1.6.1/Bio/Matrix/IO/scoring.pm BioPerl-1.6.1/Bio/Matrix/PSM BioPerl-1.6.1/Bio/Matrix/PSM/InstanceSite.pm BioPerl-1.6.1/Bio/Matrix/PSM/InstanceSiteI.pm BioPerl-1.6.1/Bio/Matrix/PSM/IO.pm BioPerl-1.6.1/Bio/Matrix/PSM/ProtMatrix.pm BioPerl-1.6.1/Bio/Matrix/PSM/ProtPsm.pm BioPerl-1.6.1/Bio/Matrix/PSM/Psm.pm BioPerl-1.6.1/Bio/Matrix/PSM/PsmHeader.pm BioPerl-1.6.1/Bio/Matrix/PSM/PsmHeaderI.pm BioPerl-1.6.1/Bio/Matrix/PSM/PsmI.pm BioPerl-1.6.1/Bio/Matrix/PSM/SiteMatrix.pm BioPerl-1.6.1/Bio/Matrix/PSM/SiteMatrixI.pm BioPerl-1.6.1/Bio/Matrix/PSM/IO BioPerl-1.6.1/Bio/Matrix/PSM/IO/mast.pm BioPerl-1.6.1/Bio/Matrix/PSM/IO/masta.pm BioPerl-1.6.1/Bio/Matrix/PSM/IO/meme.pm BioPerl-1.6.1/Bio/Matrix/PSM/IO/psiblast.pm BioPerl-1.6.1/Bio/Matrix/PSM/IO/transfac.pm BioPerl-1.6.1/Bio/MolEvol BioPerl-1.6.1/Bio/MolEvol/CodonModel.pm BioPerl-1.6.1/Bio/Ontology BioPerl-1.6.1/Bio/Ontology/DocumentRegistry.pm BioPerl-1.6.1/Bio/Ontology/GOterm.pm BioPerl-1.6.1/Bio/Ontology/InterProTerm.pm BioPerl-1.6.1/Bio/Ontology/OBOEngine.pm BioPerl-1.6.1/Bio/Ontology/OBOterm.pm BioPerl-1.6.1/Bio/Ontology/Ontology.pm BioPerl-1.6.1/Bio/Ontology/OntologyEngineI.pm BioPerl-1.6.1/Bio/Ontology/OntologyI.pm BioPerl-1.6.1/Bio/Ontology/OntologyStore.pm BioPerl-1.6.1/Bio/Ontology/Path.pm BioPerl-1.6.1/Bio/Ontology/PathI.pm BioPerl-1.6.1/Bio/Ontology/Relationship.pm BioPerl-1.6.1/Bio/Ontology/RelationshipFactory.pm BioPerl-1.6.1/Bio/Ontology/RelationshipI.pm BioPerl-1.6.1/Bio/Ontology/RelationshipType.pm BioPerl-1.6.1/Bio/Ontology/SimpleOntologyEngine.pm BioPerl-1.6.1/Bio/Ontology/Term.pm BioPerl-1.6.1/Bio/Ontology/TermFactory.pm BioPerl-1.6.1/Bio/Ontology/TermI.pm BioPerl-1.6.1/Bio/Ontology/SimpleGOEngine BioPerl-1.6.1/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm BioPerl-1.6.1/Bio/Ontology/SimpleGOEngine/GraphAdaptor02.pm BioPerl-1.6.1/Bio/OntologyIO BioPerl-1.6.1/Bio/OntologyIO/dagflat.pm BioPerl-1.6.1/Bio/OntologyIO/goflat.pm BioPerl-1.6.1/Bio/OntologyIO/InterProParser.pm BioPerl-1.6.1/Bio/OntologyIO/obo.pm BioPerl-1.6.1/Bio/OntologyIO/simplehierarchy.pm BioPerl-1.6.1/Bio/OntologyIO/soflat.pm BioPerl-1.6.1/Bio/OntologyIO/Handlers BioPerl-1.6.1/Bio/OntologyIO/Handlers/BaseSAXHandler.pm BioPerl-1.6.1/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm BioPerl-1.6.1/Bio/OntologyIO/Handlers/InterProHandler.pm BioPerl-1.6.1/Bio/Phenotype BioPerl-1.6.1/Bio/Phenotype/Correlate.pm BioPerl-1.6.1/Bio/Phenotype/Measure.pm BioPerl-1.6.1/Bio/Phenotype/Phenotype.pm BioPerl-1.6.1/Bio/Phenotype/PhenotypeI.pm BioPerl-1.6.1/Bio/Phenotype/MeSH BioPerl-1.6.1/Bio/Phenotype/MeSH/Term.pm BioPerl-1.6.1/Bio/Phenotype/MeSH/Twig.pm BioPerl-1.6.1/Bio/Phenotype/OMIM BioPerl-1.6.1/Bio/Phenotype/OMIM/MiniMIMentry.pm BioPerl-1.6.1/Bio/Phenotype/OMIM/OMIMentry.pm BioPerl-1.6.1/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm BioPerl-1.6.1/Bio/Phenotype/OMIM/OMIMparser.pm BioPerl-1.6.1/Bio/PhyloNetwork BioPerl-1.6.1/Bio/PhyloNetwork/Factory.pm BioPerl-1.6.1/Bio/PhyloNetwork/FactoryX.pm BioPerl-1.6.1/Bio/PhyloNetwork/GraphViz.pm BioPerl-1.6.1/Bio/PhyloNetwork/muVector.pm BioPerl-1.6.1/Bio/PhyloNetwork/RandomFactory.pm BioPerl-1.6.1/Bio/PhyloNetwork/TreeFactory.pm BioPerl-1.6.1/Bio/PhyloNetwork/TreeFactoryMulti.pm BioPerl-1.6.1/Bio/PhyloNetwork/TreeFactoryX.pm BioPerl-1.6.1/Bio/PopGen BioPerl-1.6.1/Bio/PopGen/Genotype.pm BioPerl-1.6.1/Bio/PopGen/GenotypeI.pm BioPerl-1.6.1/Bio/PopGen/HtSNP.pm BioPerl-1.6.1/Bio/PopGen/Individual.pm BioPerl-1.6.1/Bio/PopGen/IndividualI.pm BioPerl-1.6.1/Bio/PopGen/IO.pm BioPerl-1.6.1/Bio/PopGen/Marker.pm BioPerl-1.6.1/Bio/PopGen/MarkerI.pm BioPerl-1.6.1/Bio/PopGen/PopStats.pm BioPerl-1.6.1/Bio/PopGen/Population.pm BioPerl-1.6.1/Bio/PopGen/PopulationI.pm BioPerl-1.6.1/Bio/PopGen/Statistics.pm BioPerl-1.6.1/Bio/PopGen/TagHaplotype.pm BioPerl-1.6.1/Bio/PopGen/Utilities.pm BioPerl-1.6.1/Bio/PopGen/IO BioPerl-1.6.1/Bio/PopGen/IO/csv.pm BioPerl-1.6.1/Bio/PopGen/IO/hapmap.pm BioPerl-1.6.1/Bio/PopGen/IO/phase.pm BioPerl-1.6.1/Bio/PopGen/IO/prettybase.pm BioPerl-1.6.1/Bio/PopGen/Simulation BioPerl-1.6.1/Bio/PopGen/Simulation/Coalescent.pm BioPerl-1.6.1/Bio/PopGen/Simulation/GeneticDrift.pm BioPerl-1.6.1/Bio/Restriction BioPerl-1.6.1/Bio/Restriction/Analysis.pm BioPerl-1.6.1/Bio/Restriction/Enzyme.pm BioPerl-1.6.1/Bio/Restriction/EnzymeCollection.pm BioPerl-1.6.1/Bio/Restriction/EnzymeI.pm BioPerl-1.6.1/Bio/Restriction/IO.pm BioPerl-1.6.1/Bio/Restriction/Enzyme BioPerl-1.6.1/Bio/Restriction/Enzyme/MultiCut.pm BioPerl-1.6.1/Bio/Restriction/Enzyme/MultiSite.pm BioPerl-1.6.1/Bio/Restriction/IO BioPerl-1.6.1/Bio/Restriction/IO/bairoch.pm BioPerl-1.6.1/Bio/Restriction/IO/base.pm BioPerl-1.6.1/Bio/Restriction/IO/itype2.pm BioPerl-1.6.1/Bio/Restriction/IO/prototype.pm BioPerl-1.6.1/Bio/Restriction/IO/withrefm.pm BioPerl-1.6.1/Bio/Root BioPerl-1.6.1/Bio/Root/Build.pm BioPerl-1.6.1/Bio/Root/Exception.pm BioPerl-1.6.1/Bio/Root/HTTPget.pm BioPerl-1.6.1/Bio/Root/IO.pm BioPerl-1.6.1/Bio/Root/Root.pm BioPerl-1.6.1/Bio/Root/RootI.pm BioPerl-1.6.1/Bio/Root/Storable.pm BioPerl-1.6.1/Bio/Root/Test.pm BioPerl-1.6.1/Bio/Root/Utilities.pm BioPerl-1.6.1/Bio/Root/Version.pm BioPerl-1.6.1/Bio/Root/Test BioPerl-1.6.1/Bio/Root/Test/Warn.pm BioPerl-1.6.1/Bio/Search BioPerl-1.6.1/Bio/Search/BlastStatistics.pm BioPerl-1.6.1/Bio/Search/BlastUtils.pm BioPerl-1.6.1/Bio/Search/DatabaseI.pm BioPerl-1.6.1/Bio/Search/GenericDatabase.pm BioPerl-1.6.1/Bio/Search/GenericStatistics.pm BioPerl-1.6.1/Bio/Search/Processor.pm BioPerl-1.6.1/Bio/Search/SearchUtils.pm BioPerl-1.6.1/Bio/Search/StatisticsI.pm BioPerl-1.6.1/Bio/Search/Hit BioPerl-1.6.1/Bio/Search/Hit/BlastHit.pm BioPerl-1.6.1/Bio/Search/Hit/BlastPullHit.pm BioPerl-1.6.1/Bio/Search/Hit/Fasta.pm BioPerl-1.6.1/Bio/Search/Hit/GenericHit.pm BioPerl-1.6.1/Bio/Search/Hit/HitFactory.pm BioPerl-1.6.1/Bio/Search/Hit/HitI.pm BioPerl-1.6.1/Bio/Search/Hit/HMMERHit.pm BioPerl-1.6.1/Bio/Search/Hit/HmmpfamHit.pm BioPerl-1.6.1/Bio/Search/Hit/ModelHit.pm BioPerl-1.6.1/Bio/Search/Hit/PsiBlastHit.pm BioPerl-1.6.1/Bio/Search/Hit/PullHitI.pm BioPerl-1.6.1/Bio/Search/HSP BioPerl-1.6.1/Bio/Search/HSP/BlastHSP.pm BioPerl-1.6.1/Bio/Search/HSP/BlastPullHSP.pm BioPerl-1.6.1/Bio/Search/HSP/FastaHSP.pm BioPerl-1.6.1/Bio/Search/HSP/GenericHSP.pm BioPerl-1.6.1/Bio/Search/HSP/HMMERHSP.pm BioPerl-1.6.1/Bio/Search/HSP/HmmpfamHSP.pm BioPerl-1.6.1/Bio/Search/HSP/HSPFactory.pm BioPerl-1.6.1/Bio/Search/HSP/HSPI.pm BioPerl-1.6.1/Bio/Search/HSP/ModelHSP.pm BioPerl-1.6.1/Bio/Search/HSP/PsiBlastHSP.pm BioPerl-1.6.1/Bio/Search/HSP/PSLHSP.pm BioPerl-1.6.1/Bio/Search/HSP/PullHSPI.pm BioPerl-1.6.1/Bio/Search/HSP/WABAHSP.pm BioPerl-1.6.1/Bio/Search/Iteration BioPerl-1.6.1/Bio/Search/Iteration/GenericIteration.pm BioPerl-1.6.1/Bio/Search/Iteration/IterationI.pm BioPerl-1.6.1/Bio/Search/Result BioPerl-1.6.1/Bio/Search/Result/BlastPullResult.pm BioPerl-1.6.1/Bio/Search/Result/BlastResult.pm BioPerl-1.6.1/Bio/Search/Result/CrossMatchResult.pm BioPerl-1.6.1/Bio/Search/Result/GenericResult.pm BioPerl-1.6.1/Bio/Search/Result/HMMERResult.pm BioPerl-1.6.1/Bio/Search/Result/HmmpfamResult.pm BioPerl-1.6.1/Bio/Search/Result/PullResultI.pm BioPerl-1.6.1/Bio/Search/Result/ResultFactory.pm BioPerl-1.6.1/Bio/Search/Result/ResultI.pm BioPerl-1.6.1/Bio/Search/Result/WABAResult.pm BioPerl-1.6.1/Bio/Search/Tiling BioPerl-1.6.1/Bio/Search/Tiling/MapTileUtils.pm BioPerl-1.6.1/Bio/Search/Tiling/MapTiling.pm BioPerl-1.6.1/Bio/Search/Tiling/TilingI.pm BioPerl-1.6.1/Bio/SearchIO BioPerl-1.6.1/Bio/SearchIO/axt.pm BioPerl-1.6.1/Bio/SearchIO/blast.pm BioPerl-1.6.1/Bio/SearchIO/blast_pull.pm BioPerl-1.6.1/Bio/SearchIO/blasttable.pm BioPerl-1.6.1/Bio/SearchIO/blastxml.pm BioPerl-1.6.1/Bio/SearchIO/cross_match.pm BioPerl-1.6.1/Bio/SearchIO/erpin.pm BioPerl-1.6.1/Bio/SearchIO/EventHandlerI.pm BioPerl-1.6.1/Bio/SearchIO/exonerate.pm BioPerl-1.6.1/Bio/SearchIO/fasta.pm BioPerl-1.6.1/Bio/SearchIO/FastHitEventBuilder.pm BioPerl-1.6.1/Bio/SearchIO/gmap_f9.pm BioPerl-1.6.1/Bio/SearchIO/hmmer.pm BioPerl-1.6.1/Bio/SearchIO/hmmer_pull.pm BioPerl-1.6.1/Bio/SearchIO/infernal.pm BioPerl-1.6.1/Bio/SearchIO/IteratedSearchResultEventBuilder.pm BioPerl-1.6.1/Bio/SearchIO/megablast.pm BioPerl-1.6.1/Bio/SearchIO/psl.pm BioPerl-1.6.1/Bio/SearchIO/rnamotif.pm BioPerl-1.6.1/Bio/SearchIO/SearchResultEventBuilder.pm BioPerl-1.6.1/Bio/SearchIO/SearchWriterI.pm BioPerl-1.6.1/Bio/SearchIO/sim4.pm BioPerl-1.6.1/Bio/SearchIO/waba.pm BioPerl-1.6.1/Bio/SearchIO/wise.pm BioPerl-1.6.1/Bio/SearchIO/Writer BioPerl-1.6.1/Bio/SearchIO/Writer/BSMLResultWriter.pm BioPerl-1.6.1/Bio/SearchIO/Writer/GbrowseGFF.pm BioPerl-1.6.1/Bio/SearchIO/Writer/HitTableWriter.pm BioPerl-1.6.1/Bio/SearchIO/Writer/HSPTableWriter.pm BioPerl-1.6.1/Bio/SearchIO/Writer/HTMLResultWriter.pm BioPerl-1.6.1/Bio/SearchIO/Writer/ResultTableWriter.pm BioPerl-1.6.1/Bio/SearchIO/Writer/TextResultWriter.pm BioPerl-1.6.1/Bio/SearchIO/XML BioPerl-1.6.1/Bio/SearchIO/XML/BlastHandler.pm BioPerl-1.6.1/Bio/SearchIO/XML/PsiBlastHandler.pm BioPerl-1.6.1/Bio/Seq BioPerl-1.6.1/Bio/Seq/BaseSeqProcessor.pm BioPerl-1.6.1/Bio/Seq/EncodedSeq.pm BioPerl-1.6.1/Bio/Seq/LargeLocatableSeq.pm BioPerl-1.6.1/Bio/Seq/LargePrimarySeq.pm BioPerl-1.6.1/Bio/Seq/LargeSeq.pm BioPerl-1.6.1/Bio/Seq/LargeSeqI.pm BioPerl-1.6.1/Bio/Seq/Meta.pm BioPerl-1.6.1/Bio/Seq/MetaI.pm BioPerl-1.6.1/Bio/Seq/PrimaryQual.pm BioPerl-1.6.1/Bio/Seq/PrimedSeq.pm BioPerl-1.6.1/Bio/Seq/QualI.pm BioPerl-1.6.1/Bio/Seq/Quality.pm BioPerl-1.6.1/Bio/Seq/RichSeq.pm BioPerl-1.6.1/Bio/Seq/RichSeqI.pm BioPerl-1.6.1/Bio/Seq/SeqBuilder.pm BioPerl-1.6.1/Bio/Seq/SeqFactory.pm BioPerl-1.6.1/Bio/Seq/SeqFastaSpeedFactory.pm BioPerl-1.6.1/Bio/Seq/SequenceTrace.pm BioPerl-1.6.1/Bio/Seq/SeqWithQuality.pm BioPerl-1.6.1/Bio/Seq/TraceI.pm BioPerl-1.6.1/Bio/Seq/Meta BioPerl-1.6.1/Bio/Seq/Meta/Array.pm BioPerl-1.6.1/Bio/SeqEvolution BioPerl-1.6.1/Bio/SeqEvolution/DNAPoint.pm BioPerl-1.6.1/Bio/SeqEvolution/EvolutionI.pm BioPerl-1.6.1/Bio/SeqEvolution/Factory.pm BioPerl-1.6.1/Bio/SeqFeature BioPerl-1.6.1/Bio/SeqFeature/Annotated.pm BioPerl-1.6.1/Bio/SeqFeature/AnnotationAdaptor.pm BioPerl-1.6.1/Bio/SeqFeature/Collection.pm BioPerl-1.6.1/Bio/SeqFeature/CollectionI.pm BioPerl-1.6.1/Bio/SeqFeature/Computation.pm BioPerl-1.6.1/Bio/SeqFeature/FeaturePair.pm BioPerl-1.6.1/Bio/SeqFeature/Generic.pm BioPerl-1.6.1/Bio/SeqFeature/Lite.pm BioPerl-1.6.1/Bio/SeqFeature/PositionProxy.pm BioPerl-1.6.1/Bio/SeqFeature/Primer.pm BioPerl-1.6.1/Bio/SeqFeature/Similarity.pm BioPerl-1.6.1/Bio/SeqFeature/SimilarityPair.pm BioPerl-1.6.1/Bio/SeqFeature/TypedSeqFeatureI.pm BioPerl-1.6.1/Bio/SeqFeature/Gene BioPerl-1.6.1/Bio/SeqFeature/Gene/Exon.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/ExonI.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/GeneStructure.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/GeneStructureI.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/Intron.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/NC_Feature.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/Poly_A_site.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/Promoter.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/Transcript.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/TranscriptI.pm BioPerl-1.6.1/Bio/SeqFeature/Gene/UTR.pm BioPerl-1.6.1/Bio/SeqFeature/SiRNA BioPerl-1.6.1/Bio/SeqFeature/SiRNA/Oligo.pm BioPerl-1.6.1/Bio/SeqFeature/SiRNA/Pair.pm BioPerl-1.6.1/Bio/SeqFeature/Tools BioPerl-1.6.1/Bio/SeqFeature/Tools/FeatureNamer.pm BioPerl-1.6.1/Bio/SeqFeature/Tools/IDHandler.pm BioPerl-1.6.1/Bio/SeqFeature/Tools/TypeMapper.pm BioPerl-1.6.1/Bio/SeqFeature/Tools/Unflattener.pm BioPerl-1.6.1/Bio/SeqIO BioPerl-1.6.1/Bio/SeqIO/abi.pm BioPerl-1.6.1/Bio/SeqIO/ace.pm BioPerl-1.6.1/Bio/SeqIO/agave.pm BioPerl-1.6.1/Bio/SeqIO/alf.pm BioPerl-1.6.1/Bio/SeqIO/asciitree.pm BioPerl-1.6.1/Bio/SeqIO/bsml.pm BioPerl-1.6.1/Bio/SeqIO/bsml_sax.pm BioPerl-1.6.1/Bio/SeqIO/chadoxml.pm BioPerl-1.6.1/Bio/SeqIO/chaos.pm BioPerl-1.6.1/Bio/SeqIO/chaosxml.pm BioPerl-1.6.1/Bio/SeqIO/ctf.pm BioPerl-1.6.1/Bio/SeqIO/embl.pm BioPerl-1.6.1/Bio/SeqIO/embldriver.pm BioPerl-1.6.1/Bio/SeqIO/entrezgene.pm BioPerl-1.6.1/Bio/SeqIO/excel.pm BioPerl-1.6.1/Bio/SeqIO/exp.pm BioPerl-1.6.1/Bio/SeqIO/fasta.pm BioPerl-1.6.1/Bio/SeqIO/fastq.pm BioPerl-1.6.1/Bio/SeqIO/flybase_chadoxml.pm BioPerl-1.6.1/Bio/SeqIO/FTHelper.pm BioPerl-1.6.1/Bio/SeqIO/game.pm BioPerl-1.6.1/Bio/SeqIO/gbdriver.pm BioPerl-1.6.1/Bio/SeqIO/gcg.pm BioPerl-1.6.1/Bio/SeqIO/genbank.pm BioPerl-1.6.1/Bio/SeqIO/interpro.pm BioPerl-1.6.1/Bio/SeqIO/kegg.pm BioPerl-1.6.1/Bio/SeqIO/largefasta.pm BioPerl-1.6.1/Bio/SeqIO/lasergene.pm BioPerl-1.6.1/Bio/SeqIO/locuslink.pm BioPerl-1.6.1/Bio/SeqIO/metafasta.pm BioPerl-1.6.1/Bio/SeqIO/MultiFile.pm BioPerl-1.6.1/Bio/SeqIO/phd.pm BioPerl-1.6.1/Bio/SeqIO/pir.pm BioPerl-1.6.1/Bio/SeqIO/pln.pm BioPerl-1.6.1/Bio/SeqIO/qual.pm BioPerl-1.6.1/Bio/SeqIO/raw.pm BioPerl-1.6.1/Bio/SeqIO/scf.pm BioPerl-1.6.1/Bio/SeqIO/strider.pm BioPerl-1.6.1/Bio/SeqIO/swiss.pm BioPerl-1.6.1/Bio/SeqIO/swissdriver.pm BioPerl-1.6.1/Bio/SeqIO/tab.pm BioPerl-1.6.1/Bio/SeqIO/table.pm BioPerl-1.6.1/Bio/SeqIO/tigr.pm BioPerl-1.6.1/Bio/SeqIO/tigrxml.pm BioPerl-1.6.1/Bio/SeqIO/tinyseq.pm BioPerl-1.6.1/Bio/SeqIO/ztr.pm BioPerl-1.6.1/Bio/SeqIO/game BioPerl-1.6.1/Bio/SeqIO/game/featHandler.pm BioPerl-1.6.1/Bio/SeqIO/game/gameHandler.pm BioPerl-1.6.1/Bio/SeqIO/game/gameSubs.pm BioPerl-1.6.1/Bio/SeqIO/game/gameWriter.pm BioPerl-1.6.1/Bio/SeqIO/game/seqHandler.pm BioPerl-1.6.1/Bio/SeqIO/Handler BioPerl-1.6.1/Bio/SeqIO/Handler/GenericRichSeqHandler.pm BioPerl-1.6.1/Bio/SeqIO/tinyseq BioPerl-1.6.1/Bio/SeqIO/tinyseq/tinyseqHandler.pm BioPerl-1.6.1/Bio/Structure BioPerl-1.6.1/Bio/Structure/Atom.pm BioPerl-1.6.1/Bio/Structure/Chain.pm BioPerl-1.6.1/Bio/Structure/Entry.pm BioPerl-1.6.1/Bio/Structure/IO.pm BioPerl-1.6.1/Bio/Structure/Model.pm BioPerl-1.6.1/Bio/Structure/Residue.pm BioPerl-1.6.1/Bio/Structure/StructureI.pm BioPerl-1.6.1/Bio/Structure/IO BioPerl-1.6.1/Bio/Structure/IO/pdb.pm BioPerl-1.6.1/Bio/Structure/SecStr BioPerl-1.6.1/Bio/Structure/SecStr/DSSP BioPerl-1.6.1/Bio/Structure/SecStr/DSSP/Res.pm BioPerl-1.6.1/Bio/Structure/SecStr/STRIDE BioPerl-1.6.1/Bio/Structure/SecStr/STRIDE/Res.pm BioPerl-1.6.1/Bio/Symbol BioPerl-1.6.1/Bio/Symbol/Alphabet.pm BioPerl-1.6.1/Bio/Symbol/AlphabetI.pm BioPerl-1.6.1/Bio/Symbol/DNAAlphabet.pm BioPerl-1.6.1/Bio/Symbol/ProteinAlphabet.pm BioPerl-1.6.1/Bio/Symbol/README.Symbol BioPerl-1.6.1/Bio/Symbol/Symbol.pm BioPerl-1.6.1/Bio/Symbol/SymbolI.pm BioPerl-1.6.1/Bio/Taxonomy BioPerl-1.6.1/Bio/Taxonomy/FactoryI.pm BioPerl-1.6.1/Bio/Taxonomy/Node.pm BioPerl-1.6.1/Bio/Taxonomy/Taxon.pm BioPerl-1.6.1/Bio/Taxonomy/Tree.pm BioPerl-1.6.1/Bio/Tools BioPerl-1.6.1/Bio/Tools/AlignFactory.pm BioPerl-1.6.1/Bio/Tools/AnalysisResult.pm BioPerl-1.6.1/Bio/Tools/Blat.pm BioPerl-1.6.1/Bio/Tools/CodonTable.pm BioPerl-1.6.1/Bio/Tools/Coil.pm BioPerl-1.6.1/Bio/Tools/dpAlign.pm BioPerl-1.6.1/Bio/Tools/ECnumber.pm BioPerl-1.6.1/Bio/Tools/EPCR.pm BioPerl-1.6.1/Bio/Tools/Eponine.pm BioPerl-1.6.1/Bio/Tools/ERPIN.pm BioPerl-1.6.1/Bio/Tools/Est2Genome.pm BioPerl-1.6.1/Bio/Tools/ESTScan.pm BioPerl-1.6.1/Bio/Tools/EUtilities.pm BioPerl-1.6.1/Bio/Tools/Fgenesh.pm BioPerl-1.6.1/Bio/Tools/FootPrinter.pm BioPerl-1.6.1/Bio/Tools/Gel.pm BioPerl-1.6.1/Bio/Tools/Geneid.pm BioPerl-1.6.1/Bio/Tools/Genemark.pm BioPerl-1.6.1/Bio/Tools/Genewise.pm BioPerl-1.6.1/Bio/Tools/Genomewise.pm BioPerl-1.6.1/Bio/Tools/Genscan.pm BioPerl-1.6.1/Bio/Tools/GFF.pm BioPerl-1.6.1/Bio/Tools/Glimmer.pm BioPerl-1.6.1/Bio/Tools/Grail.pm BioPerl-1.6.1/Bio/Tools/GuessSeqFormat.pm BioPerl-1.6.1/Bio/Tools/Hmmpfam.pm BioPerl-1.6.1/Bio/Tools/Infernal.pm BioPerl-1.6.1/Bio/Tools/ipcress.pm BioPerl-1.6.1/Bio/Tools/isPcr.pm BioPerl-1.6.1/Bio/Tools/IUPAC.pm BioPerl-1.6.1/Bio/Tools/Lucy.pm BioPerl-1.6.1/Bio/Tools/Match.pm BioPerl-1.6.1/Bio/Tools/MZEF.pm BioPerl-1.6.1/Bio/Tools/OddCodes.pm BioPerl-1.6.1/Bio/Tools/pICalculator.pm BioPerl-1.6.1/Bio/Tools/Primer3.pm BioPerl-1.6.1/Bio/Tools/Prints.pm BioPerl-1.6.1/Bio/Tools/Profile.pm BioPerl-1.6.1/Bio/Tools/Promoterwise.pm BioPerl-1.6.1/Bio/Tools/PrositeScan.pm BioPerl-1.6.1/Bio/Tools/Protparam.pm BioPerl-1.6.1/Bio/Tools/Pseudowise.pm BioPerl-1.6.1/Bio/Tools/pSW.pm BioPerl-1.6.1/Bio/Tools/QRNA.pm BioPerl-1.6.1/Bio/Tools/RandomDistFunctions.pm BioPerl-1.6.1/Bio/Tools/RepeatMasker.pm BioPerl-1.6.1/Bio/Tools/RNAMotif.pm BioPerl-1.6.1/Bio/Tools/Seg.pm BioPerl-1.6.1/Bio/Tools/SeqPattern.pm BioPerl-1.6.1/Bio/Tools/SeqStats.pm BioPerl-1.6.1/Bio/Tools/SeqWords.pm BioPerl-1.6.1/Bio/Tools/Sigcleave.pm BioPerl-1.6.1/Bio/Tools/Signalp.pm BioPerl-1.6.1/Bio/Tools/SiRNA.pm BioPerl-1.6.1/Bio/Tools/TandemRepeatsFinder.pm BioPerl-1.6.1/Bio/Tools/TargetP.pm BioPerl-1.6.1/Bio/Tools/Tmhmm.pm BioPerl-1.6.1/Bio/Tools/tRNAscanSE.pm BioPerl-1.6.1/Bio/Tools/Alignment BioPerl-1.6.1/Bio/Tools/Alignment/Consed.pm BioPerl-1.6.1/Bio/Tools/Alignment/Trim.pm BioPerl-1.6.1/Bio/Tools/Analysis BioPerl-1.6.1/Bio/Tools/Analysis/SimpleAnalysisBase.pm BioPerl-1.6.1/Bio/Tools/Analysis/DNA BioPerl-1.6.1/Bio/Tools/Analysis/DNA/ESEfinder.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein BioPerl-1.6.1/Bio/Tools/Analysis/Protein/Domcut.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/ELM.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/GOR4.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/HNN.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/Mitoprot.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/NetPhos.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/Scansite.pm BioPerl-1.6.1/Bio/Tools/Analysis/Protein/Sopma.pm BioPerl-1.6.1/Bio/Tools/EMBOSS BioPerl-1.6.1/Bio/Tools/EMBOSS/Palindrome.pm BioPerl-1.6.1/Bio/Tools/EUtilities BioPerl-1.6.1/Bio/Tools/EUtilities/Cookie.pm BioPerl-1.6.1/Bio/Tools/EUtilities/EUtilDataI.pm BioPerl-1.6.1/Bio/Tools/EUtilities/EUtilParameters.pm BioPerl-1.6.1/Bio/Tools/EUtilities/History.pm BioPerl-1.6.1/Bio/Tools/EUtilities/HistoryI.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Info.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Link.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Query.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Summary.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Info BioPerl-1.6.1/Bio/Tools/EUtilities/Info/FieldInfo.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Info/LinkInfo.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Link BioPerl-1.6.1/Bio/Tools/EUtilities/Link/LinkSet.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Link/UrlLink.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Query BioPerl-1.6.1/Bio/Tools/EUtilities/Query/GlobalQuery.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Summary BioPerl-1.6.1/Bio/Tools/EUtilities/Summary/DocSum.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Summary/Item.pm BioPerl-1.6.1/Bio/Tools/EUtilities/Summary/ItemContainerI.pm BioPerl-1.6.1/Bio/Tools/HMMER BioPerl-1.6.1/Bio/Tools/HMMER/Domain.pm BioPerl-1.6.1/Bio/Tools/HMMER/Results.pm BioPerl-1.6.1/Bio/Tools/HMMER/Set.pm BioPerl-1.6.1/Bio/Tools/Phylo BioPerl-1.6.1/Bio/Tools/Phylo/Gerp.pm BioPerl-1.6.1/Bio/Tools/Phylo/Gumby.pm BioPerl-1.6.1/Bio/Tools/Phylo/Molphy.pm BioPerl-1.6.1/Bio/Tools/Phylo/PAML.pm BioPerl-1.6.1/Bio/Tools/Phylo/Molphy BioPerl-1.6.1/Bio/Tools/Phylo/Molphy/Result.pm BioPerl-1.6.1/Bio/Tools/Phylo/PAML BioPerl-1.6.1/Bio/Tools/Phylo/PAML/ModelResult.pm BioPerl-1.6.1/Bio/Tools/Phylo/PAML/Result.pm BioPerl-1.6.1/Bio/Tools/Phylo/Phylip BioPerl-1.6.1/Bio/Tools/Phylo/Phylip/ProtDist.pm BioPerl-1.6.1/Bio/Tools/Prediction BioPerl-1.6.1/Bio/Tools/Prediction/Exon.pm BioPerl-1.6.1/Bio/Tools/Prediction/Gene.pm BioPerl-1.6.1/Bio/Tools/Primer BioPerl-1.6.1/Bio/Tools/Primer/AssessorI.pm BioPerl-1.6.1/Bio/Tools/Primer/Feature.pm BioPerl-1.6.1/Bio/Tools/Primer/Pair.pm BioPerl-1.6.1/Bio/Tools/Primer/Assessor BioPerl-1.6.1/Bio/Tools/Primer/Assessor/Base.pm BioPerl-1.6.1/Bio/Tools/Run BioPerl-1.6.1/Bio/Tools/Run/GenericParameters.pm BioPerl-1.6.1/Bio/Tools/Run/ParametersI.pm BioPerl-1.6.1/Bio/Tools/Run/README BioPerl-1.6.1/Bio/Tools/Run/RemoteBlast.pm BioPerl-1.6.1/Bio/Tools/Run/StandAloneBlast.pm BioPerl-1.6.1/Bio/Tools/Run/StandAloneNCBIBlast.pm BioPerl-1.6.1/Bio/Tools/Run/StandAloneWUBlast.pm BioPerl-1.6.1/Bio/Tools/Run/WrapperBase.pm BioPerl-1.6.1/Bio/Tools/SeqPattern BioPerl-1.6.1/Bio/Tools/SeqPattern/Backtranslate.pm BioPerl-1.6.1/Bio/Tools/Signalp BioPerl-1.6.1/Bio/Tools/Signalp/ExtendedSignalp.pm BioPerl-1.6.1/Bio/Tools/Sim4 BioPerl-1.6.1/Bio/Tools/Sim4/Exon.pm BioPerl-1.6.1/Bio/Tools/Sim4/Results.pm BioPerl-1.6.1/Bio/Tools/SiRNA BioPerl-1.6.1/Bio/Tools/SiRNA/Ruleset BioPerl-1.6.1/Bio/Tools/SiRNA/Ruleset/saigo.pm BioPerl-1.6.1/Bio/Tools/SiRNA/Ruleset/tuschl.pm BioPerl-1.6.1/Bio/Tools/Spidey BioPerl-1.6.1/Bio/Tools/Spidey/Exon.pm BioPerl-1.6.1/Bio/Tools/Spidey/Results.pm BioPerl-1.6.1/Bio/Tree BioPerl-1.6.1/Bio/Tree/AlleleNode.pm BioPerl-1.6.1/Bio/Tree/AnnotatableNode.pm BioPerl-1.6.1/Bio/Tree/Compatible.pm BioPerl-1.6.1/Bio/Tree/DistanceFactory.pm BioPerl-1.6.1/Bio/Tree/Node.pm BioPerl-1.6.1/Bio/Tree/NodeI.pm BioPerl-1.6.1/Bio/Tree/NodeNHX.pm BioPerl-1.6.1/Bio/Tree/RandomFactory.pm BioPerl-1.6.1/Bio/Tree/Statistics.pm BioPerl-1.6.1/Bio/Tree/Tree.pm BioPerl-1.6.1/Bio/Tree/TreeFunctionsI.pm BioPerl-1.6.1/Bio/Tree/TreeI.pm BioPerl-1.6.1/Bio/Tree/Draw BioPerl-1.6.1/Bio/Tree/Draw/Cladogram.pm BioPerl-1.6.1/Bio/TreeIO BioPerl-1.6.1/Bio/TreeIO/cluster.pm BioPerl-1.6.1/Bio/TreeIO/lintree.pm BioPerl-1.6.1/Bio/TreeIO/newick.pm BioPerl-1.6.1/Bio/TreeIO/nexus.pm BioPerl-1.6.1/Bio/TreeIO/nhx.pm BioPerl-1.6.1/Bio/TreeIO/pag.pm BioPerl-1.6.1/Bio/TreeIO/phyloxml.pm BioPerl-1.6.1/Bio/TreeIO/svggraph.pm BioPerl-1.6.1/Bio/TreeIO/tabtree.pm BioPerl-1.6.1/Bio/TreeIO/TreeEventBuilder.pm BioPerl-1.6.1/Bio/Variation BioPerl-1.6.1/Bio/Variation/AAChange.pm BioPerl-1.6.1/Bio/Variation/AAReverseMutate.pm BioPerl-1.6.1/Bio/Variation/Allele.pm BioPerl-1.6.1/Bio/Variation/DNAMutation.pm BioPerl-1.6.1/Bio/Variation/IO.pm BioPerl-1.6.1/Bio/Variation/README BioPerl-1.6.1/Bio/Variation/RNAChange.pm BioPerl-1.6.1/Bio/Variation/SeqDiff.pm BioPerl-1.6.1/Bio/Variation/SNP.pm BioPerl-1.6.1/Bio/Variation/VariantI.pm BioPerl-1.6.1/Bio/Variation/IO BioPerl-1.6.1/Bio/Variation/IO/flat.pm BioPerl-1.6.1/Bio/Variation/IO/xml.pm BioPerl-1.6.1/doc BioPerl-1.6.1/doc/makedoc.PL BioPerl-1.6.1/doc/README BioPerl-1.6.1/doc/Deobfuscator BioPerl-1.6.1/doc/Deobfuscator/Build.PL BioPerl-1.6.1/doc/Deobfuscator/Changes BioPerl-1.6.1/doc/Deobfuscator/excluded_modules.txt BioPerl-1.6.1/doc/Deobfuscator/LICENSE BioPerl-1.6.1/doc/Deobfuscator/Makefile.PL BioPerl-1.6.1/doc/Deobfuscator/MANIFEST BioPerl-1.6.1/doc/Deobfuscator/META.yml BioPerl-1.6.1/doc/Deobfuscator/README BioPerl-1.6.1/doc/Deobfuscator/bin BioPerl-1.6.1/doc/Deobfuscator/bin/deob_index.pl BioPerl-1.6.1/doc/Deobfuscator/cgi-bin BioPerl-1.6.1/doc/Deobfuscator/cgi-bin/deob_detail.cgi BioPerl-1.6.1/doc/Deobfuscator/cgi-bin/deob_flowchart.png BioPerl-1.6.1/doc/Deobfuscator/cgi-bin/deob_help.html BioPerl-1.6.1/doc/Deobfuscator/cgi-bin/deob_interface.cgi BioPerl-1.6.1/doc/Deobfuscator/lib BioPerl-1.6.1/doc/Deobfuscator/lib/Deobfuscator.pm BioPerl-1.6.1/doc/Deobfuscator/t BioPerl-1.6.1/doc/Deobfuscator/t/00.load.t BioPerl-1.6.1/doc/Deobfuscator/t/pod.t BioPerl-1.6.1/examples BioPerl-1.6.1/examples/bioperl.pl BioPerl-1.6.1/examples/generate_random_seq.pl BioPerl-1.6.1/examples/longorf.pl BioPerl-1.6.1/examples/make_primers.pl BioPerl-1.6.1/examples/rev_and_trans.pl BioPerl-1.6.1/examples/revcom_dir.pl BioPerl-1.6.1/examples/subsequence.cgi BioPerl-1.6.1/examples/align BioPerl-1.6.1/examples/align/align_on_codons.pl BioPerl-1.6.1/examples/align/aligntutorial.pl BioPerl-1.6.1/examples/align/clustalw.pl BioPerl-1.6.1/examples/align/simplealign.pl BioPerl-1.6.1/examples/biblio BioPerl-1.6.1/examples/biblio/biblio-eutils-example.pl BioPerl-1.6.1/examples/biblio/biblio-soap-example.pl BioPerl-1.6.1/examples/biblio/biblio_soap.pl BioPerl-1.6.1/examples/Bio-DB-GFF BioPerl-1.6.1/examples/Bio-DB-GFF/load_ucsc.pl BioPerl-1.6.1/examples/cluster BioPerl-1.6.1/examples/cluster/dbsnp.pl BioPerl-1.6.1/examples/contributed BioPerl-1.6.1/examples/contributed/nmrpdb_parse.pl BioPerl-1.6.1/examples/contributed/prosite2perl.pl BioPerl-1.6.1/examples/contributed/rebase2list.pl BioPerl-1.6.1/examples/db BioPerl-1.6.1/examples/db/dbfetch BioPerl-1.6.1/examples/db/est_tissue_query.pl BioPerl-1.6.1/examples/db/gb2features.pl BioPerl-1.6.1/examples/db/get_seqs.pl BioPerl-1.6.1/examples/db/getGenBank.pl BioPerl-1.6.1/examples/db/rfetch.pl BioPerl-1.6.1/examples/db/use_registry.pl BioPerl-1.6.1/examples/liveseq BioPerl-1.6.1/examples/liveseq/change_gene.pl BioPerl-1.6.1/examples/popgen BioPerl-1.6.1/examples/popgen/parse_calc_stats.pl BioPerl-1.6.1/examples/quality BioPerl-1.6.1/examples/quality/svgtrace.pl BioPerl-1.6.1/examples/root BioPerl-1.6.1/examples/root/exceptions1.pl BioPerl-1.6.1/examples/root/exceptions2.pl BioPerl-1.6.1/examples/root/exceptions3.pl BioPerl-1.6.1/examples/root/exceptions4.pl BioPerl-1.6.1/examples/root/README BioPerl-1.6.1/examples/root/lib BioPerl-1.6.1/examples/root/lib/TestInterface.pm BioPerl-1.6.1/examples/root/lib/TestObject.pm BioPerl-1.6.1/examples/root/lib/Bio BioPerl-1.6.1/examples/root/lib/Bio/PrimarySeq.pm BioPerl-1.6.1/examples/root/lib/Bio/PrimarySeqI.pm BioPerl-1.6.1/examples/root/lib/Bio/Seq.pm BioPerl-1.6.1/examples/root/lib/Bio/SeqI.pm BioPerl-1.6.1/examples/searchio BioPerl-1.6.1/examples/searchio/blast_example.pl BioPerl-1.6.1/examples/searchio/custom_writer.pl BioPerl-1.6.1/examples/searchio/hitwriter.pl BioPerl-1.6.1/examples/searchio/hspwriter.pl BioPerl-1.6.1/examples/searchio/htmlwriter.pl BioPerl-1.6.1/examples/searchio/psiblast_features.pl BioPerl-1.6.1/examples/searchio/psiblast_iterations.pl BioPerl-1.6.1/examples/searchio/rawwriter.pl BioPerl-1.6.1/examples/searchio/resultwriter.pl BioPerl-1.6.1/examples/searchio/waba2gff.pl BioPerl-1.6.1/examples/searchio/waba2gff3.pl BioPerl-1.6.1/examples/sirna BioPerl-1.6.1/examples/sirna/rnai_finder.cgi BioPerl-1.6.1/examples/sirna/TAG BioPerl-1.6.1/examples/structure BioPerl-1.6.1/examples/structure/structure-io.pl BioPerl-1.6.1/examples/tk BioPerl-1.6.1/examples/tk/gsequence.pl BioPerl-1.6.1/examples/tk/hitdisplay.pl BioPerl-1.6.1/examples/tools BioPerl-1.6.1/examples/tools/extract_genes.pl BioPerl-1.6.1/examples/tools/gb_to_gff.pl BioPerl-1.6.1/examples/tools/gff2ps.pl BioPerl-1.6.1/examples/tools/parse_codeml.pl BioPerl-1.6.1/examples/tools/psw.pl BioPerl-1.6.1/examples/tools/reverse-translate.pl BioPerl-1.6.1/examples/tools/run_genscan.pl BioPerl-1.6.1/examples/tools/run_primer3.pl BioPerl-1.6.1/examples/tools/seq_pattern.pl BioPerl-1.6.1/examples/tools/standaloneblast.pl BioPerl-1.6.1/examples/tree BioPerl-1.6.1/examples/tree/paup2phylip.pl BioPerl-1.6.1/ide BioPerl-1.6.1/ide/bioperl.komodo BioPerl-1.6.1/ide/bioperl-mode BioPerl-1.6.1/ide/bioperl-mode/README BioPerl-1.6.1/ide/bioperl-mode/dist BioPerl-1.6.1/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar BioPerl-1.6.1/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5 BioPerl-1.6.1/ide/bioperl-mode/dist/bioperl-mode.tar BioPerl-1.6.1/ide/bioperl-mode/dist/bioperl-mode.tar.md5 BioPerl-1.6.1/ide/bioperl-mode/dist/package-me BioPerl-1.6.1/ide/bioperl-mode/dist/SKIP BioPerl-1.6.1/ide/bioperl-mode/etc BioPerl-1.6.1/ide/bioperl-mode/etc/images BioPerl-1.6.1/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm BioPerl-1.6.1/ide/bioperl-mode/etc/images/bpmode-tool.xpm BioPerl-1.6.1/ide/bioperl-mode/site-lisp BioPerl-1.6.1/ide/bioperl-mode/site-lisp/bioperl-init.el BioPerl-1.6.1/ide/bioperl-mode/site-lisp/bioperl-mode.el BioPerl-1.6.1/ide/bioperl-mode/site-lisp/bioperl-skel.el BioPerl-1.6.1/ide/bioperl-mode/site-lisp/pod.el BioPerl-1.6.1/maintenance BioPerl-1.6.1/maintenance/authors.pl BioPerl-1.6.1/maintenance/check_NAME.pl BioPerl-1.6.1/maintenance/check_URLs.pl BioPerl-1.6.1/maintenance/cvs2cl_by_file.pl BioPerl-1.6.1/maintenance/dependencies.pl BioPerl-1.6.1/maintenance/deprecated.pl BioPerl-1.6.1/maintenance/module_usage.pl BioPerl-1.6.1/maintenance/modules.pl BioPerl-1.6.1/maintenance/ncbi_blast_switches.pl BioPerl-1.6.1/maintenance/perltidy.conf BioPerl-1.6.1/maintenance/pod.pl BioPerl-1.6.1/maintenance/README BioPerl-1.6.1/maintenance/symlink_script.pl BioPerl-1.6.1/maintenance/version.pl BioPerl-1.6.1/models BioPerl-1.6.1/models/biblio.dia BioPerl-1.6.1/models/bio_liveseq_variation.dia BioPerl-1.6.1/models/bio_map.dia BioPerl-1.6.1/models/bio_restriction.dia BioPerl-1.6.1/models/bioperl.dia BioPerl-1.6.1/models/coordinatemapper.dia BioPerl-1.6.1/models/map_proposal.txt BioPerl-1.6.1/models/maps_and_markers.dia BioPerl-1.6.1/models/popgen.dia BioPerl-1.6.1/models/population_proposal.txt BioPerl-1.6.1/models/README BioPerl-1.6.1/scripts BioPerl-1.6.1/scripts/README BioPerl-1.6.1/scripts/biblio BioPerl-1.6.1/scripts/biblio/biblio.PLS BioPerl-1.6.1/scripts/biblio/TAG BioPerl-1.6.1/scripts/Bio-DB-EUtilities BioPerl-1.6.1/scripts/Bio-DB-EUtilities/einfo.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF BioPerl-1.6.1/scripts/Bio-DB-GFF/bulk_load_gff.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/fast_load_gff.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/genbank2gff.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/genbank2gff3.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/generate_histogram.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/load_gff.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/meta_gff.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/process_gadfly.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/process_sgd.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/process_wormbase.PLS BioPerl-1.6.1/scripts/Bio-DB-GFF/README BioPerl-1.6.1/scripts/Bio-SeqFeature-Store BioPerl-1.6.1/scripts/Bio-SeqFeature-Store/bp_seqfeature_delete.PLS BioPerl-1.6.1/scripts/Bio-SeqFeature-Store/bp_seqfeature_gff3.PLS BioPerl-1.6.1/scripts/Bio-SeqFeature-Store/bp_seqfeature_load.PLS BioPerl-1.6.1/scripts/das BioPerl-1.6.1/scripts/das/README BioPerl-1.6.1/scripts/das/TAG BioPerl-1.6.1/scripts/DB BioPerl-1.6.1/scripts/DB/biofetch_genbank_proxy.PLS BioPerl-1.6.1/scripts/DB/bioflat_index.PLS BioPerl-1.6.1/scripts/DB/biogetseq.PLS BioPerl-1.6.1/scripts/DB/flanks.PLS BioPerl-1.6.1/scripts/DB/TAG BioPerl-1.6.1/scripts/DB-HIV BioPerl-1.6.1/scripts/DB-HIV/hivq.PLS BioPerl-1.6.1/scripts/index BioPerl-1.6.1/scripts/index/bp_fetch.PLS BioPerl-1.6.1/scripts/index/bp_index.PLS BioPerl-1.6.1/scripts/index/bp_seqret.PLS BioPerl-1.6.1/scripts/index/TAG BioPerl-1.6.1/scripts/popgen BioPerl-1.6.1/scripts/popgen/composite_LD.PLS BioPerl-1.6.1/scripts/popgen/heterogeneity_test.PLS BioPerl-1.6.1/scripts/searchio BioPerl-1.6.1/scripts/searchio/fastam9_to_table.PLS BioPerl-1.6.1/scripts/searchio/filter_search.PLS BioPerl-1.6.1/scripts/searchio/hmmer_to_table.PLS BioPerl-1.6.1/scripts/searchio/parse_hmmsearch.PLS BioPerl-1.6.1/scripts/searchio/README BioPerl-1.6.1/scripts/searchio/search2table.PLS BioPerl-1.6.1/scripts/searchio/TAG BioPerl-1.6.1/scripts/seq BioPerl-1.6.1/scripts/seq/extract_feature_seq.PLS BioPerl-1.6.1/scripts/seq/make_mrna_protein.PLS BioPerl-1.6.1/scripts/seq/seqconvert.PLS BioPerl-1.6.1/scripts/seq/seqretsplit.PLS BioPerl-1.6.1/scripts/seq/split_seq.PLS BioPerl-1.6.1/scripts/seq/TAG BioPerl-1.6.1/scripts/seq/translate_seq.PLS BioPerl-1.6.1/scripts/seq/unflatten_seq.PLS BioPerl-1.6.1/scripts/seqstats BioPerl-1.6.1/scripts/seqstats/aacomp.PLS BioPerl-1.6.1/scripts/seqstats/chaos_plot.PLS BioPerl-1.6.1/scripts/seqstats/gccalc.PLS BioPerl-1.6.1/scripts/seqstats/oligo_count.PLS BioPerl-1.6.1/scripts/seqstats/TAG BioPerl-1.6.1/scripts/taxa BioPerl-1.6.1/scripts/taxa/classify_hits_kingdom.PLS BioPerl-1.6.1/scripts/taxa/local_taxonomydb_query.PLS BioPerl-1.6.1/scripts/taxa/query_entrez_taxa.PLS BioPerl-1.6.1/scripts/taxa/TAG BioPerl-1.6.1/scripts/taxa/taxid4species.PLS BioPerl-1.6.1/scripts/taxa/taxonomy2tree.PLS BioPerl-1.6.1/scripts/tree BioPerl-1.6.1/scripts/tree/blast2tree.PLS BioPerl-1.6.1/scripts/tree/nexus2nh.PLS BioPerl-1.6.1/scripts/tree/TAG BioPerl-1.6.1/scripts/tree/tree2pag.PLS BioPerl-1.6.1/scripts/utilities BioPerl-1.6.1/scripts/utilities/bp_mrtrans.PLS BioPerl-1.6.1/scripts/utilities/bp_nrdb.PLS BioPerl-1.6.1/scripts/utilities/bp_sreformat.PLS BioPerl-1.6.1/scripts/utilities/dbsplit.PLS BioPerl-1.6.1/scripts/utilities/download_query_genbank.PLS BioPerl-1.6.1/scripts/utilities/mask_by_search.PLS BioPerl-1.6.1/scripts/utilities/mutate.PLS BioPerl-1.6.1/scripts/utilities/pairwise_kaks.PLS BioPerl-1.6.1/scripts/utilities/README BioPerl-1.6.1/scripts/utilities/remote_blast.PLS BioPerl-1.6.1/scripts/utilities/revtrans-motif.PLS BioPerl-1.6.1/scripts/utilities/search2alnblocks.PLS BioPerl-1.6.1/scripts/utilities/search2BSML.PLS BioPerl-1.6.1/scripts/utilities/search2gff.PLS BioPerl-1.6.1/scripts/utilities/search2tribe.PLS BioPerl-1.6.1/scripts/utilities/seq_length.PLS BioPerl-1.6.1/scripts/utilities/TAG BioPerl-1.6.1/t BioPerl-1.6.1/t/Alphabet.t BioPerl-1.6.1/t/Perl.t BioPerl-1.6.1/t/PodSyntax.t BioPerl-1.6.1/t/SearchDist.t BioPerl-1.6.1/t/SeqEvolution.t BioPerl-1.6.1/t/SeqIO.t BioPerl-1.6.1/t/Species.t BioPerl-1.6.1/t/Symbol.t BioPerl-1.6.1/t/TaxonTree.t BioPerl-1.6.1/t/Align BioPerl-1.6.1/t/Align/AlignStats.t BioPerl-1.6.1/t/Align/AlignUtil.t BioPerl-1.6.1/t/Align/SimpleAlign.t BioPerl-1.6.1/t/Align/TreeBuild.t BioPerl-1.6.1/t/Align/Utilities.t BioPerl-1.6.1/t/AlignIO BioPerl-1.6.1/t/AlignIO/AlignIO.t BioPerl-1.6.1/t/AlignIO/arp.t BioPerl-1.6.1/t/AlignIO/bl2seq.t BioPerl-1.6.1/t/AlignIO/clustalw.t BioPerl-1.6.1/t/AlignIO/emboss.t BioPerl-1.6.1/t/AlignIO/fasta.t BioPerl-1.6.1/t/AlignIO/largemultifasta.t BioPerl-1.6.1/t/AlignIO/maf.t BioPerl-1.6.1/t/AlignIO/mase.t BioPerl-1.6.1/t/AlignIO/mega.t BioPerl-1.6.1/t/AlignIO/meme.t BioPerl-1.6.1/t/AlignIO/metafasta.t BioPerl-1.6.1/t/AlignIO/msf.t BioPerl-1.6.1/t/AlignIO/nexus.t BioPerl-1.6.1/t/AlignIO/pfam.t BioPerl-1.6.1/t/AlignIO/phylip.t BioPerl-1.6.1/t/AlignIO/po.t BioPerl-1.6.1/t/AlignIO/prodom.t BioPerl-1.6.1/t/AlignIO/psi.t BioPerl-1.6.1/t/AlignIO/selex.t BioPerl-1.6.1/t/AlignIO/stockholm.t BioPerl-1.6.1/t/AlignIO/xmfa.t BioPerl-1.6.1/t/Annotation BioPerl-1.6.1/t/Annotation/Annotation.t BioPerl-1.6.1/t/Annotation/AnnotationAdaptor.t BioPerl-1.6.1/t/Assembly BioPerl-1.6.1/t/Assembly/Assembly.t BioPerl-1.6.1/t/Assembly/ContigSpectrum.t BioPerl-1.6.1/t/Biblio BioPerl-1.6.1/t/Biblio/Biblio.t BioPerl-1.6.1/t/Biblio/biofetch.t BioPerl-1.6.1/t/Biblio/eutils.t BioPerl-1.6.1/t/Biblio/References.t BioPerl-1.6.1/t/ClusterIO BioPerl-1.6.1/t/ClusterIO/ClusterIO.t BioPerl-1.6.1/t/ClusterIO/SequenceFamily.t BioPerl-1.6.1/t/ClusterIO/unigene.t BioPerl-1.6.1/t/Coordinate BioPerl-1.6.1/t/Coordinate/CoordinateGraph.t BioPerl-1.6.1/t/Coordinate/CoordinateMapper.t BioPerl-1.6.1/t/Coordinate/GeneCoordinateMapper.t BioPerl-1.6.1/t/data BioPerl-1.6.1/t/data/13-pilE-F.scf BioPerl-1.6.1/t/data/1A11.pdb BioPerl-1.6.1/t/data/1A3I.pdb BioPerl-1.6.1/t/data/1BPT.pdb BioPerl-1.6.1/t/data/1ZZ19XR301R-Alignment.tblastn BioPerl-1.6.1/t/data/2008.blasttable BioPerl-1.6.1/t/data/503384.MEGABLAST.0 BioPerl-1.6.1/t/data/503384.MEGABLAST.2 BioPerl-1.6.1/t/data/5X_1895.FASTXY BioPerl-1.6.1/t/data/8HVP.pdb BioPerl-1.6.1/t/data/a_thaliana.blastn BioPerl-1.6.1/t/data/AAC12660.fa BioPerl-1.6.1/t/data/aaml.mlc BioPerl-1.6.1/t/data/aaml_pairwise.mlc BioPerl-1.6.1/t/data/AB077698.gb BioPerl-1.6.1/t/data/acefile.ace.1 BioPerl-1.6.1/t/data/acefile.singlets BioPerl-1.6.1/t/data/adh.mb_tree.nexus BioPerl-1.6.1/t/data/AE003528_ecoli.bls BioPerl-1.6.1/t/data/AE003644_Adh-genomic.gb BioPerl-1.6.1/t/data/AF032047.gbk BioPerl-1.6.1/t/data/AF165282.gb BioPerl-1.6.1/t/data/AF305198.gb BioPerl-1.6.1/t/data/AHCYL1.kegg BioPerl-1.6.1/t/data/alleles.fas BioPerl-1.6.1/t/data/alnfile.fasta BioPerl-1.6.1/t/data/amino.fa BioPerl-1.6.1/t/data/AnnIX-v003.gbk BioPerl-1.6.1/t/data/ar.embl BioPerl-1.6.1/t/data/assembly_with_singlets.ace BioPerl-1.6.1/t/data/ATF14F8.gbk BioPerl-1.6.1/t/data/atp1.matrix BioPerl-1.6.1/t/data/ay007676.gb BioPerl-1.6.1/t/data/AY095303S1.gbk BioPerl-1.6.1/t/data/ay116458.gb BioPerl-1.6.1/t/data/ay149291.gb BioPerl-1.6.1/t/data/AY763288.gb BioPerl-1.6.1/t/data/BAB68554.gb BioPerl-1.6.1/t/data/barns-combined.nex BioPerl-1.6.1/t/data/baseml.pairwise BioPerl-1.6.1/t/data/baseml.usertree BioPerl-1.6.1/t/data/basic-bush.nex BioPerl-1.6.1/t/data/basic-ladder.nex BioPerl-1.6.1/t/data/BC000007.gbk BioPerl-1.6.1/t/data/BEL16-LTR_AG.embl BioPerl-1.6.1/t/data/biofpc.cor BioPerl-1.6.1/t/data/biofpc.fpc BioPerl-1.6.1/t/data/Bird_Ovomucoids.nex BioPerl-1.6.1/t/data/BK000016-tpa.gbk BioPerl-1.6.1/t/data/bl2seq.blastn BioPerl-1.6.1/t/data/bl2seq.blastn.rev BioPerl-1.6.1/t/data/bl2seq.blastx.out BioPerl-1.6.1/t/data/bl2seq.bug940.out BioPerl-1.6.1/t/data/bl2seq.out BioPerl-1.6.1/t/data/bl2seq.tblastx.out BioPerl-1.6.1/t/data/blast.report BioPerl-1.6.1/t/data/blast_no_hit_desc.txt BioPerl-1.6.1/t/data/blastp2215.blast BioPerl-1.6.1/t/data/blat.psLayout3 BioPerl-1.6.1/t/data/BLOSUM50 BioPerl-1.6.1/t/data/blosum62.bla BioPerl-1.6.1/t/data/BN000066-tpa.embl BioPerl-1.6.1/t/data/bootstrap.tre BioPerl-1.6.1/t/data/BOSS_DROME.FASTP_v35_04 BioPerl-1.6.1/t/data/branchSite.mlc BioPerl-1.6.1/t/data/brassica_ATH.WUBLASTN BioPerl-1.6.1/t/data/bug1986.blast2 BioPerl-1.6.1/t/data/bug1986.blastp BioPerl-1.6.1/t/data/bug2120.phd BioPerl-1.6.1/t/data/bug2246.blast BioPerl-1.6.1/t/data/bug2391.megablast BioPerl-1.6.1/t/data/bug2399.tblastn BioPerl-1.6.1/t/data/bug2453.maf BioPerl-1.6.1/t/data/bug2473.fasta BioPerl-1.6.1/t/data/bug2862.pmr BioPerl-1.6.1/t/data/c200-vs-yeast.BLASTN BioPerl-1.6.1/t/data/c200-vs-yeast.BLASTN.m8 BioPerl-1.6.1/t/data/calm.swiss BioPerl-1.6.1/t/data/catalase-webblast.BLASTP BioPerl-1.6.1/t/data/cds-266.fas BioPerl-1.6.1/t/data/cds_sample.embl BioPerl-1.6.1/t/data/CG11099.fasaln BioPerl-1.6.1/t/data/CG2865.fasaln BioPerl-1.6.1/t/data/chad100.scf BioPerl-1.6.1/t/data/char-interleave.nex BioPerl-1.6.1/t/data/char-matrix-spaces.nex BioPerl-1.6.1/t/data/codeml.mlc BioPerl-1.6.1/t/data/codeml315.mlc BioPerl-1.6.1/t/data/codeml4.mlc BioPerl-1.6.1/t/data/codeml_nssites.mlc BioPerl-1.6.1/t/data/compLD_missingtest.prettybase BioPerl-1.6.1/t/data/compLD_test.prettybase BioPerl-1.6.1/t/data/component.ontology.test BioPerl-1.6.1/t/data/component.ontology.test2 BioPerl-1.6.1/t/data/contig-by-hand.wublastp BioPerl-1.6.1/t/data/contigspectrumtest.asm BioPerl-1.6.1/t/data/crab.dat.cn BioPerl-1.6.1/t/data/crab.nj BioPerl-1.6.1/t/data/crab.njb BioPerl-1.6.1/t/data/crypto.sim4-0 BioPerl-1.6.1/t/data/crypto.sim4-3 BioPerl-1.6.1/t/data/crypto.sim4-4 BioPerl-1.6.1/t/data/ctgdemo.fpc BioPerl-1.6.1/t/data/cys1_dicdi.water BioPerl-1.6.1/t/data/cysprot.fa BioPerl-1.6.1/t/data/cysprot.msf BioPerl-1.6.1/t/data/cysprot.needle BioPerl-1.6.1/t/data/cysprot.tblastn BioPerl-1.6.1/t/data/cysprot.water BioPerl-1.6.1/t/data/cysprot1.fa BioPerl-1.6.1/t/data/cysprot1.FASTA BioPerl-1.6.1/t/data/cysprot1a.fa BioPerl-1.6.1/t/data/cysprot1a.msf BioPerl-1.6.1/t/data/cysprot1b.fa BioPerl-1.6.1/t/data/cysprot1b.hmmsearch BioPerl-1.6.1/t/data/cysprot1b.msf BioPerl-1.6.1/t/data/cysprot1b.newick BioPerl-1.6.1/t/data/cysprot_vs_gadfly.FASTA BioPerl-1.6.1/t/data/D10483.gbk BioPerl-1.6.1/t/data/D12555.gbk BioPerl-1.6.1/t/data/dcr1_sp.WUBLASTP BioPerl-1.6.1/t/data/directives.gff3 BioPerl-1.6.1/t/data/dmel_2Lchunk.gb BioPerl-1.6.1/t/data/dna1.fa BioPerl-1.6.1/t/data/dna2.fa BioPerl-1.6.1/t/data/dnaE-bsub-prot.fa BioPerl-1.6.1/t/data/dnaE-bsub.fa BioPerl-1.6.1/t/data/dnaEbsub_ecoli.wublastx BioPerl-1.6.1/t/data/dnaEbsub_ecoli.wutblastn BioPerl-1.6.1/t/data/dnaEbsub_ecoli.wutblastx BioPerl-1.6.1/t/data/DQ018368.gb BioPerl-1.6.1/t/data/dq519393.gb BioPerl-1.6.1/t/data/ECAPAH02.embl BioPerl-1.6.1/t/data/echofilter.wublastn BioPerl-1.6.1/t/data/ecoli-trna-qrna.out BioPerl-1.6.1/t/data/ecoli_domains.rps.xml BioPerl-1.6.1/t/data/ecoli_domains.rpsblast BioPerl-1.6.1/t/data/ecolitst.bls BioPerl-1.6.1/t/data/ecolitst.fa BioPerl-1.6.1/t/data/ecolitst.noseqs.wublastp BioPerl-1.6.1/t/data/ecolitst.wublastp BioPerl-1.6.1/t/data/empty.bl2seq BioPerl-1.6.1/t/data/ENr111.mfa.example.elems BioPerl-1.6.1/t/data/entrezgene.dat BioPerl-1.6.1/t/data/example.hap BioPerl-1.6.1/t/data/example.phase BioPerl-1.6.1/t/data/exonerate.output.dontwork BioPerl-1.6.1/t/data/exonerate.output.works BioPerl-1.6.1/t/data/expected.blast.out BioPerl-1.6.1/t/data/exsignalp.out BioPerl-1.6.1/t/data/factor7.embl BioPerl-1.6.1/t/data/fgenesh.out BioPerl-1.6.1/t/data/footprinter.out BioPerl-1.6.1/t/data/frac_problems.blast BioPerl-1.6.1/t/data/frac_problems2.blast BioPerl-1.6.1/t/data/frac_problems3.blast BioPerl-1.6.1/t/data/geneid_1.0.out BioPerl-1.6.1/t/data/genemark-fragment.out BioPerl-1.6.1/t/data/genemark.out BioPerl-1.6.1/t/data/genewise.out BioPerl-1.6.1/t/data/genewise_output.paracel_btk BioPerl-1.6.1/t/data/genomewise.out BioPerl-1.6.1/t/data/genomic-seq.epcr BioPerl-1.6.1/t/data/genomic-seq.fasta BioPerl-1.6.1/t/data/genomic-seq.genscan BioPerl-1.6.1/t/data/genomic-seq.mzef BioPerl-1.6.1/t/data/Genscan.FastA BioPerl-1.6.1/t/data/gf-s71.needle BioPerl-1.6.1/t/data/Glimmer2.out BioPerl-1.6.1/t/data/glimmer3-fragment.detail BioPerl-1.6.1/t/data/glimmer3-fragment.predict BioPerl-1.6.1/t/data/Glimmer3.detail BioPerl-1.6.1/t/data/Glimmer3.predict BioPerl-1.6.1/t/data/GlimmerHMM.out BioPerl-1.6.1/t/data/GlimmerM.out BioPerl-1.6.1/t/data/gmap_f9-multiple_results.txt BioPerl-1.6.1/t/data/gmap_f9-reverse-strand.txt BioPerl-1.6.1/t/data/gmap_f9.txt BioPerl-1.6.1/t/data/GO.defs.test BioPerl-1.6.1/t/data/GO.defs.test2 BioPerl-1.6.1/t/data/headerless.psl BioPerl-1.6.1/t/data/hemoglobinA.meg BioPerl-1.6.1/t/data/hg16_chroms.gff BioPerl-1.6.1/t/data/hmmpfam.out BioPerl-1.6.1/t/data/hmmpfam_cs.out BioPerl-1.6.1/t/data/hmmpfam_fake.out BioPerl-1.6.1/t/data/hmmsearch.out BioPerl-1.6.1/t/data/hs_est.est2genome BioPerl-1.6.1/t/data/hs_fugu.newick BioPerl-1.6.1/t/data/hs_owlmonkey.aln BioPerl-1.6.1/t/data/hs_owlmonkey.fas BioPerl-1.6.1/t/data/hs_owlmonkey.fasta BioPerl-1.6.1/t/data/hsinsulin.blastcl3.blastn BioPerl-1.6.1/t/data/HUMBETGLOA.fa BioPerl-1.6.1/t/data/HUMBETGLOA.FASTA BioPerl-1.6.1/t/data/HUMBETGLOA.gff BioPerl-1.6.1/t/data/HUMBETGLOA.grail BioPerl-1.6.1/t/data/HUMBETGLOA.grailexp BioPerl-1.6.1/t/data/HUMBETGLOA.mzef BioPerl-1.6.1/t/data/HUMBETGLOA.tblastx BioPerl-1.6.1/t/data/humor.maf BioPerl-1.6.1/t/data/humts1.pal BioPerl-1.6.1/t/data/hybrid1.gff3 BioPerl-1.6.1/t/data/hybrid2.gff3 BioPerl-1.6.1/t/data/in.fasta BioPerl-1.6.1/t/data/insulin.water BioPerl-1.6.1/t/data/interpro_ebi.xml BioPerl-1.6.1/t/data/interpro_short.xml BioPerl-1.6.1/t/data/intrablock-comment.nex BioPerl-1.6.1/t/data/Kingdoms_DNA.nex BioPerl-1.6.1/t/data/knownGene.gff3 BioPerl-1.6.1/t/data/L77119.hmmer BioPerl-1.6.1/t/data/little.largemultifasta BioPerl-1.6.1/t/data/LittleChrY.dbsnp.xml BioPerl-1.6.1/t/data/LOAD_Ccd1.dnd BioPerl-1.6.1/t/data/long-names.nex BioPerl-1.6.1/t/data/longnames.aln BioPerl-1.6.1/t/data/longnames.dnd BioPerl-1.6.1/t/data/lucy.info BioPerl-1.6.1/t/data/lucy.qual BioPerl-1.6.1/t/data/lucy.seq BioPerl-1.6.1/t/data/lucy.stderr BioPerl-1.6.1/t/data/lysozyme6.protml BioPerl-1.6.1/t/data/lysozyme6.simple.protml BioPerl-1.6.1/t/data/M0.mlc BioPerl-1.6.1/t/data/M12730.gb BioPerl-1.6.1/t/data/mapmaker.out BioPerl-1.6.1/t/data/mapmaker.txt BioPerl-1.6.1/t/data/mast.dat BioPerl-1.6.1/t/data/masta.dat BioPerl-1.6.1/t/data/match.output BioPerl-1.6.1/t/data/Mcjanrna_rdbII.gbk BioPerl-1.6.1/t/data/megablast_output.paracel_btk BioPerl-1.6.1/t/data/meme.dat BioPerl-1.6.1/t/data/mini-AE001405.gb BioPerl-1.6.1/t/data/mini-align.aln BioPerl-1.6.1/t/data/mixedmast.dat BioPerl-1.6.1/t/data/MmCT BioPerl-1.6.1/t/data/mpath.ontology.test BioPerl-1.6.1/t/data/MSGEFTUA.gb BioPerl-1.6.1/t/data/multi.phd BioPerl-1.6.1/t/data/multi_1.fa BioPerl-1.6.1/t/data/multi_2.fa BioPerl-1.6.1/t/data/multi_blast.bls BioPerl-1.6.1/t/data/multifa.seq BioPerl-1.6.1/t/data/multifa.seq.qual BioPerl-1.6.1/t/data/multiline-intrablock-comment.nex BioPerl-1.6.1/t/data/multiseq.bls BioPerl-1.6.1/t/data/mus.bls.xml BioPerl-1.6.1/t/data/mutations.dat BioPerl-1.6.1/t/data/mutations.old.dat BioPerl-1.6.1/t/data/mutations.old.xml BioPerl-1.6.1/t/data/mutations.xml BioPerl-1.6.1/t/data/myco_sites.gff BioPerl-1.6.1/t/data/NC_001284.gbk BioPerl-1.6.1/t/data/NC_006346.gb BioPerl-1.6.1/t/data/NC_006511-short.gbk BioPerl-1.6.1/t/data/NC_008536.gb BioPerl-1.6.1/t/data/nei_gojobori_test.aln BioPerl-1.6.1/t/data/neighbor.dist BioPerl-1.6.1/t/data/new_blastn.txt BioPerl-1.6.1/t/data/newblast.xml BioPerl-1.6.1/t/data/NM_002254.gb BioPerl-1.6.1/t/data/no-genes.genscan BioPerl-1.6.1/t/data/no_cds_example.gb BioPerl-1.6.1/t/data/no_FH.embl BioPerl-1.6.1/t/data/no_hsps.blastp BioPerl-1.6.1/t/data/no_semicolon.newick BioPerl-1.6.1/t/data/noninterleaved.phy BioPerl-1.6.1/t/data/NT_021877.gbk BioPerl-1.6.1/t/data/nucmatrix.txt BioPerl-1.6.1/t/data/O_sat.wgs BioPerl-1.6.1/t/data/omim_genemap_test BioPerl-1.6.1/t/data/omim_genemap_test_nolinebreak BioPerl-1.6.1/t/data/omim_text_test BioPerl-1.6.1/t/data/P33897 BioPerl-1.6.1/t/data/P35527.gb BioPerl-1.6.1/t/data/P39765.gb BioPerl-1.6.1/t/data/PAM250 BioPerl-1.6.1/t/data/pep-266.aln BioPerl-1.6.1/t/data/pfam_tests.stk BioPerl-1.6.1/t/data/phi.out BioPerl-1.6.1/t/data/phipsi.out BioPerl-1.6.1/t/data/phylipdist-36.out BioPerl-1.6.1/t/data/phylipdist.out BioPerl-1.6.1/t/data/phyloxml_examples.xml BioPerl-1.6.1/t/data/pictogram.fa BioPerl-1.6.1/t/data/plague_yeast.bls.xml BioPerl-1.6.1/t/data/polymorphism.dat BioPerl-1.6.1/t/data/polymorphism.old.xml BioPerl-1.6.1/t/data/polymorphism.xml BioPerl-1.6.1/t/data/popgen_saureus.dat BioPerl-1.6.1/t/data/popgen_saureus.multidat BioPerl-1.6.1/t/data/popstats.prettybase BioPerl-1.6.1/t/data/pre_rel9.swiss BioPerl-1.6.1/t/data/Primate_mtDNA.nex BioPerl-1.6.1/t/data/primedseq.fa BioPerl-1.6.1/t/data/primer3_infile.txt BioPerl-1.6.1/t/data/primer3_outfile.txt BioPerl-1.6.1/t/data/primer3_output.txt BioPerl-1.6.1/t/data/prints.out BioPerl-1.6.1/t/data/promoterwise.out BioPerl-1.6.1/t/data/protpars.phy BioPerl-1.6.1/t/data/protpars_longid.phy BioPerl-1.6.1/t/data/pseudowise.out BioPerl-1.6.1/t/data/psi_xml.dat BioPerl-1.6.1/t/data/psiblast.xml BioPerl-1.6.1/t/data/psiblastreport.out BioPerl-1.6.1/t/data/purine_v081.infernal BioPerl-1.6.1/t/data/puzzle.tre BioPerl-1.6.1/t/data/Q8GBD3.swiss BioPerl-1.6.1/t/data/qrna-relloc.out BioPerl-1.6.1/t/data/qualfile.qual BioPerl-1.6.1/t/data/quoted-strings1.nex BioPerl-1.6.1/t/data/quoted-strings2.nex BioPerl-1.6.1/t/data/Rab1.chaos-xml BioPerl-1.6.1/t/data/radical-whitespace.nex BioPerl-1.6.1/t/data/radical-whitespace_02.nex BioPerl-1.6.1/t/data/rebase.itype2 BioPerl-1.6.1/t/data/rebase.withrefm BioPerl-1.6.1/t/data/regulation_test.obo BioPerl-1.6.1/t/data/rel9.swiss BioPerl-1.6.1/t/data/repeatmasker.fa.out BioPerl-1.6.1/t/data/revcomp_mrna.gb BioPerl-1.6.1/t/data/rfam_tests.stk BioPerl-1.6.1/t/data/roa1.dat BioPerl-1.6.1/t/data/roa1.genbank BioPerl-1.6.1/t/data/roa1.swiss BioPerl-1.6.1/t/data/roa1_v2.dat BioPerl-1.6.1/t/data/rpsblast.bls BioPerl-1.6.1/t/data/sample_dataset.tasm BioPerl-1.6.1/t/data/sbay_c127.fas BioPerl-1.6.1/t/data/sbay_c545-yeast.BLASTZ.PSL BioPerl-1.6.1/t/data/seg.out BioPerl-1.6.1/t/data/semicolon.newick BioPerl-1.6.1/t/data/seqdatabase.ini BioPerl-1.6.1/t/data/seqfile.pir BioPerl-1.6.1/t/data/seqs.fas BioPerl-1.6.1/t/data/sequencefamily.dat BioPerl-1.6.1/t/data/short.blx BioPerl-1.6.1/t/data/signalp.hmm.short BioPerl-1.6.1/t/data/signalp.hmm.summary BioPerl-1.6.1/t/data/signalp.negative.out BioPerl-1.6.1/t/data/signalp.nn.short BioPerl-1.6.1/t/data/signalp.nn.summary BioPerl-1.6.1/t/data/signalp.positive.out BioPerl-1.6.1/t/data/signalp.short BioPerl-1.6.1/t/data/signalp.summary BioPerl-1.6.1/t/data/sim4.for.for BioPerl-1.6.1/t/data/sim4.for.rev BioPerl-1.6.1/t/data/sim4.rev BioPerl-1.6.1/t/data/singleNSsite.mlc BioPerl-1.6.1/t/data/so.obo BioPerl-1.6.1/t/data/sofa.ontology BioPerl-1.6.1/t/data/spaces.nex BioPerl-1.6.1/t/data/SPAN_Family4nl.nex BioPerl-1.6.1/t/data/SPAN_Family7n.nex BioPerl-1.6.1/t/data/SPAN_Family8a.nex BioPerl-1.6.1/t/data/sparsealn.needle BioPerl-1.6.1/t/data/spidey.noalignment BioPerl-1.6.1/t/data/spidey.test1 BioPerl-1.6.1/t/data/sprintf.rnamotif BioPerl-1.6.1/t/data/ssp160.embl.1 BioPerl-1.6.1/t/data/stress_test_medline.xml BioPerl-1.6.1/t/data/stress_test_pubmed.xml BioPerl-1.6.1/t/data/sv40_small.xml BioPerl-1.6.1/t/data/swiss.dat BioPerl-1.6.1/t/data/swisspfam.data BioPerl-1.6.1/t/data/SwissProt.dat BioPerl-1.6.1/t/data/T7.aln BioPerl-1.6.1/t/data/tab1part.mif BioPerl-1.6.1/t/data/tab2part.mif BioPerl-1.6.1/t/data/tab3part.mif BioPerl-1.6.1/t/data/tandem_repeats_finder.dat BioPerl-1.6.1/t/data/tandem_repeats_finder.noresults BioPerl-1.6.1/t/data/targetp.out BioPerl-1.6.1/t/data/tblastn.out BioPerl-1.6.1/t/data/test 2.txt BioPerl-1.6.1/t/data/test.abi BioPerl-1.6.1/t/data/test.ace BioPerl-1.6.1/t/data/test.ctf BioPerl-1.6.1/t/data/test.embl BioPerl-1.6.1/t/data/test.embl2sq BioPerl-1.6.1/t/data/test.exp BioPerl-1.6.1/t/data/test.fasta BioPerl-1.6.1/t/data/test.game BioPerl-1.6.1/t/data/test.gcg BioPerl-1.6.1/t/data/test.gcgblast BioPerl-1.6.1/t/data/test.gcgfasta BioPerl-1.6.1/t/data/test.genbank BioPerl-1.6.1/t/data/test.genbank.noseq BioPerl-1.6.1/t/data/test.infernal BioPerl-1.6.1/t/data/test.interpro BioPerl-1.6.1/t/data/test.interpro-go.xml BioPerl-1.6.1/t/data/test.lasergene BioPerl-1.6.1/t/data/test.locuslink BioPerl-1.6.1/t/data/test.mase BioPerl-1.6.1/t/data/test.meme BioPerl-1.6.1/t/data/test.meme2 BioPerl-1.6.1/t/data/test.metafasta BioPerl-1.6.1/t/data/test.nh BioPerl-1.6.1/t/data/test.nhx BioPerl-1.6.1/t/data/test.pfam BioPerl-1.6.1/t/data/test.phd BioPerl-1.6.1/t/data/test.pir BioPerl-1.6.1/t/data/test.pln BioPerl-1.6.1/t/data/test.ptt BioPerl-1.6.1/t/data/test.raw BioPerl-1.6.1/t/data/test.swiss BioPerl-1.6.1/t/data/test.tab BioPerl-1.6.1/t/data/test.tigrxml BioPerl-1.6.1/t/data/test.tseq BioPerl-1.6.1/t/data/test.tsv BioPerl-1.6.1/t/data/test.txt BioPerl-1.6.1/t/data/test.waba BioPerl-1.6.1/t/data/test.xls BioPerl-1.6.1/t/data/test.ztr BioPerl-1.6.1/t/data/test1.blasttab3 BioPerl-1.6.1/t/data/test1.wublastp BioPerl-1.6.1/t/data/test2.infernal BioPerl-1.6.1/t/data/test2.raw BioPerl-1.6.1/t/data/test_badlf.gcg BioPerl-1.6.1/t/data/test_clear_range.fastq BioPerl-1.6.1/t/data/testaln.aln BioPerl-1.6.1/t/data/testaln.arp BioPerl-1.6.1/t/data/testaln.fasta BioPerl-1.6.1/t/data/testaln.list BioPerl-1.6.1/t/data/testaln.mase BioPerl-1.6.1/t/data/testaln.metafasta BioPerl-1.6.1/t/data/testaln.msf BioPerl-1.6.1/t/data/testaln.nexus BioPerl-1.6.1/t/data/testaln.pfam BioPerl-1.6.1/t/data/testaln.phylip BioPerl-1.6.1/t/data/testaln.po BioPerl-1.6.1/t/data/testaln.prodom BioPerl-1.6.1/t/data/testaln.psi BioPerl-1.6.1/t/data/testaln.selex BioPerl-1.6.1/t/data/testaln.stockholm BioPerl-1.6.1/t/data/testaln.xmfa BioPerl-1.6.1/t/data/testaln2.arp BioPerl-1.6.1/t/data/testaln2.fasta BioPerl-1.6.1/t/data/testdat.exonerate BioPerl-1.6.1/t/data/testdata.crossmatch BioPerl-1.6.1/t/data/testdbaccnums.out BioPerl-1.6.1/t/data/testfile.erpin BioPerl-1.6.1/t/data/testfuzzy.genbank BioPerl-1.6.1/t/data/tmhmm.out BioPerl-1.6.1/t/data/tmp.fst BioPerl-1.6.1/t/data/traits.tab BioPerl-1.6.1/t/data/traittree.nexus BioPerl-1.6.1/t/data/transfac.dat BioPerl-1.6.1/t/data/tree_nonewline.nexus BioPerl-1.6.1/t/data/Treebase-chlamy-dna.nex BioPerl-1.6.1/t/data/tricky.wublast BioPerl-1.6.1/t/data/trna.strict.rnamotif BioPerl-1.6.1/t/data/U58726.gb BioPerl-1.6.1/t/data/U71225.gb BioPerl-1.6.1/t/data/U83300.bsml BioPerl-1.6.1/t/data/UnaSmithHIV-both.nex BioPerl-1.6.1/t/data/unigene.data BioPerl-1.6.1/t/data/urease.tre.nexus BioPerl-1.6.1/t/data/vecscreen_simple.test_output BioPerl-1.6.1/t/data/version2.scf BioPerl-1.6.1/t/data/version3.scf BioPerl-1.6.1/t/data/withrefm.906 BioPerl-1.6.1/t/data/worm_fam_2785.cdna BioPerl-1.6.1/t/data/X98338_Adh-mRNA.gb BioPerl-1.6.1/t/data/yeast.tRNAscanSE BioPerl-1.6.1/t/data/yn00.mlc BioPerl-1.6.1/t/data/biodbgff BioPerl-1.6.1/t/data/biodbgff/test.gff BioPerl-1.6.1/t/data/biodbgff/test.gff3 BioPerl-1.6.1/t/data/codeml_lysozyme BioPerl-1.6.1/t/data/codeml_lysozyme/2NG.dN BioPerl-1.6.1/t/data/codeml_lysozyme/2NG.dS BioPerl-1.6.1/t/data/codeml_lysozyme/2NG.tt BioPerl-1.6.1/t/data/codeml_lysozyme/4fold.nuc BioPerl-1.6.1/t/data/codeml_lysozyme/lnf BioPerl-1.6.1/t/data/codeml_lysozyme/lysozymeSmall.ctl BioPerl-1.6.1/t/data/codeml_lysozyme/lysozymeSmall.trees BioPerl-1.6.1/t/data/codeml_lysozyme/lysozymeSmall.txt BioPerl-1.6.1/t/data/codeml_lysozyme/mlc BioPerl-1.6.1/t/data/codeml_lysozyme/rst BioPerl-1.6.1/t/data/codeml_lysozyme/rst1 BioPerl-1.6.1/t/data/codeml_lysozyme/rub BioPerl-1.6.1/t/data/consed_project BioPerl-1.6.1/t/data/consed_project/edit_dir BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.contigs BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.log BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1 BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2 BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.log BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.problems BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.qual BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.fasta.screen.view BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.newtags BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.phrap.out BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project.screen.out BioPerl-1.6.1/t/data/consed_project/edit_dir/test_project_to_alu.cross BioPerl-1.6.1/t/data/consed_project/edit_dir/test_projectNewChromats.fof BioPerl-1.6.1/t/data/consed_project/phd_dir BioPerl-1.6.1/t/data/consed_project/phd_dir/ML4922R.phd.1 BioPerl-1.6.1/t/data/consed_project/phd_dir/ML4924F.phd.1 BioPerl-1.6.1/t/data/consed_project/phd_dir/ML4924R.phd.1 BioPerl-1.6.1/t/data/consed_project/phd_dir/ML4947F.phd.1 BioPerl-1.6.1/t/data/dbfa BioPerl-1.6.1/t/data/dbfa/1.fa BioPerl-1.6.1/t/data/dbfa/2.fa BioPerl-1.6.1/t/data/dbfa/3.fa BioPerl-1.6.1/t/data/dbfa/4.fa BioPerl-1.6.1/t/data/dbfa/5.fa BioPerl-1.6.1/t/data/dbfa/6.fa BioPerl-1.6.1/t/data/dbfa/7.fa BioPerl-1.6.1/t/data/dbqual BioPerl-1.6.1/t/data/dbqual/1.qual BioPerl-1.6.1/t/data/dbqual/2.qual BioPerl-1.6.1/t/data/dbqual/3.qual BioPerl-1.6.1/t/data/eutils BioPerl-1.6.1/t/data/eutils/egquery.xml BioPerl-1.6.1/t/data/eutils/einfo.xml BioPerl-1.6.1/t/data/eutils/einfo_dbs.xml BioPerl-1.6.1/t/data/eutils/elink_acheck.xml BioPerl-1.6.1/t/data/eutils/elink_acheck_corr.xml BioPerl-1.6.1/t/data/eutils/elink_dball.xml BioPerl-1.6.1/t/data/eutils/elink_lcheck.xml BioPerl-1.6.1/t/data/eutils/elink_lcheck_corr.xml BioPerl-1.6.1/t/data/eutils/elink_llinks.xml BioPerl-1.6.1/t/data/eutils/elink_llinks_corr.xml BioPerl-1.6.1/t/data/eutils/elink_multidb.xml BioPerl-1.6.1/t/data/eutils/elink_multidb_corr.xml BioPerl-1.6.1/t/data/eutils/elink_ncheck.xml BioPerl-1.6.1/t/data/eutils/elink_ncheck_corr.xml BioPerl-1.6.1/t/data/eutils/elink_neighbor.xml BioPerl-1.6.1/t/data/eutils/elink_neighbor_corr.xml BioPerl-1.6.1/t/data/eutils/elink_nhist.xml BioPerl-1.6.1/t/data/eutils/elink_nhist_corr.xml BioPerl-1.6.1/t/data/eutils/elink_scores.xml BioPerl-1.6.1/t/data/eutils/epost.xml BioPerl-1.6.1/t/data/eutils/esearch1.xml BioPerl-1.6.1/t/data/eutils/esearch2.xml BioPerl-1.6.1/t/data/eutils/espell.xml BioPerl-1.6.1/t/data/eutils/esummary1.xml BioPerl-1.6.1/t/data/eutils/esummary2.xml BioPerl-1.6.1/t/data/fastq BioPerl-1.6.1/t/data/fastq/bug2335.fastq BioPerl-1.6.1/t/data/fastq/error_diff_ids.fastq BioPerl-1.6.1/t/data/fastq/error_double_qual.fastq BioPerl-1.6.1/t/data/fastq/error_double_seq.fastq BioPerl-1.6.1/t/data/fastq/error_long_qual.fastq BioPerl-1.6.1/t/data/fastq/error_no_qual.fastq BioPerl-1.6.1/t/data/fastq/error_qual_del.fastq BioPerl-1.6.1/t/data/fastq/error_qual_escape.fastq BioPerl-1.6.1/t/data/fastq/error_qual_null.fastq BioPerl-1.6.1/t/data/fastq/error_qual_space.fastq BioPerl-1.6.1/t/data/fastq/error_qual_tab.fastq BioPerl-1.6.1/t/data/fastq/error_qual_unit_sep.fastq BioPerl-1.6.1/t/data/fastq/error_qual_vtab.fastq BioPerl-1.6.1/t/data/fastq/error_short_qual.fastq BioPerl-1.6.1/t/data/fastq/error_spaces.fastq BioPerl-1.6.1/t/data/fastq/error_tabs.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_at_plus.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_at_qual.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_at_seq.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_in_plus.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_in_qual.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_in_seq.fastq BioPerl-1.6.1/t/data/fastq/error_trunc_in_title.fastq BioPerl-1.6.1/t/data/fastq/evil_wrapping.fastq BioPerl-1.6.1/t/data/fastq/example.fasta BioPerl-1.6.1/t/data/fastq/example.fastq BioPerl-1.6.1/t/data/fastq/example.qual BioPerl-1.6.1/t/data/fastq/illumina_faked.fastq BioPerl-1.6.1/t/data/fastq/sanger_93.fastq BioPerl-1.6.1/t/data/fastq/sanger_faked.fastq BioPerl-1.6.1/t/data/fastq/solexa_example.fastq BioPerl-1.6.1/t/data/fastq/solexa_faked.fastq BioPerl-1.6.1/t/data/fastq/test1_sanger.fastq BioPerl-1.6.1/t/data/fastq/test2_solexa.fastq BioPerl-1.6.1/t/data/fastq/test3_illumina.fastq BioPerl-1.6.1/t/data/fastq/tricky.fastq BioPerl-1.6.1/t/data/fastq/wrapping_issues.fastq BioPerl-1.6.1/t/data/map_hem BioPerl-1.6.1/t/data/map_hem/HEM1-HEM12.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM12.fa.revcom BioPerl-1.6.1/t/data/map_hem/HEM1-HEM12.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1-HEM13.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM13.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1-HEM14.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM14.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1-HEM2.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM2.fa.revcom BioPerl-1.6.1/t/data/map_hem/HEM1-HEM2.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1-HEM3.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM3.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1-HEM4.fa BioPerl-1.6.1/t/data/map_hem/HEM1-HEM4.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM1.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM1.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM12-HEM13.fa BioPerl-1.6.1/t/data/map_hem/HEM12-HEM13.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM12-HEM14.fa BioPerl-1.6.1/t/data/map_hem/HEM12-HEM14.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM12-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM12-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM12.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM12.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM13-HEM14.fa BioPerl-1.6.1/t/data/map_hem/HEM13-HEM14.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM13-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM13-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM13.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM13.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM14-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM14-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM14.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM14.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM15.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM15.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM2-HEM12.fa BioPerl-1.6.1/t/data/map_hem/HEM2-HEM12.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM2-HEM13.fa BioPerl-1.6.1/t/data/map_hem/HEM2-HEM13.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM2-HEM14.fa BioPerl-1.6.1/t/data/map_hem/HEM2-HEM14.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM2-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM2-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM2-HEM3.fa BioPerl-1.6.1/t/data/map_hem/HEM2-HEM3.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM2-HEM4.fa BioPerl-1.6.1/t/data/map_hem/HEM2-HEM4.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM2.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM2.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM3-HEM12.fa BioPerl-1.6.1/t/data/map_hem/HEM3-HEM12.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM3-HEM13.fa BioPerl-1.6.1/t/data/map_hem/HEM3-HEM13.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM3-HEM14.fa BioPerl-1.6.1/t/data/map_hem/HEM3-HEM14.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM3-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM3-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM3-HEM4.fa BioPerl-1.6.1/t/data/map_hem/HEM3-HEM4.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM3.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM3.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/HEM4-HEM12.fa BioPerl-1.6.1/t/data/map_hem/HEM4-HEM12.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM4-HEM13.fa BioPerl-1.6.1/t/data/map_hem/HEM4-HEM13.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM4-HEM14.fa BioPerl-1.6.1/t/data/map_hem/HEM4-HEM14.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM4-HEM15.fa BioPerl-1.6.1/t/data/map_hem/HEM4-HEM15.meme.txt BioPerl-1.6.1/t/data/map_hem/HEM4.ups.fa_ BioPerl-1.6.1/t/data/map_hem/HEM4.ups.fa_.revcom BioPerl-1.6.1/t/data/map_hem/yeast.nc.1.freq BioPerl-1.6.1/t/data/registry BioPerl-1.6.1/t/data/registry/bdb BioPerl-1.6.1/t/data/registry/bdb/seqdatabase.ini BioPerl-1.6.1/t/data/registry/flat BioPerl-1.6.1/t/data/registry/flat/seqdatabase.ini BioPerl-1.6.1/t/data/seqfeaturedb BioPerl-1.6.1/t/data/seqfeaturedb/test.gff3 BioPerl-1.6.1/t/data/taxdump BioPerl-1.6.1/t/data/taxdump/names.dmp BioPerl-1.6.1/t/data/taxdump/nodes.dmp BioPerl-1.6.1/t/data/transfac_pro BioPerl-1.6.1/t/data/transfac_pro/factor.dat BioPerl-1.6.1/t/data/transfac_pro/fragment.dat BioPerl-1.6.1/t/data/transfac_pro/gene.dat BioPerl-1.6.1/t/data/transfac_pro/matrix.dat BioPerl-1.6.1/t/data/transfac_pro/readme.txt BioPerl-1.6.1/t/data/transfac_pro/reference.dat BioPerl-1.6.1/t/data/transfac_pro/site.dat BioPerl-1.6.1/t/lib BioPerl-1.6.1/t/lib/Error.pm BioPerl-1.6.1/t/lib/Array BioPerl-1.6.1/t/lib/Array/Compare.pm BioPerl-1.6.1/t/lib/Sub BioPerl-1.6.1/t/lib/Sub/Uplevel.pm BioPerl-1.6.1/t/lib/Test BioPerl-1.6.1/t/lib/Test/Builder.pm BioPerl-1.6.1/t/lib/Test/Exception.pm BioPerl-1.6.1/t/lib/Test/Harness.pm BioPerl-1.6.1/t/lib/Test/More.pm BioPerl-1.6.1/t/lib/Test/Simple.pm BioPerl-1.6.1/t/lib/Test/Tutorial.pod BioPerl-1.6.1/t/lib/Test/Warn.pm BioPerl-1.6.1/t/lib/Test/Builder BioPerl-1.6.1/t/lib/Test/Builder/Module.pm BioPerl-1.6.1/t/lib/Test/Builder/Tester.pm BioPerl-1.6.1/t/lib/Test/Builder/Tester BioPerl-1.6.1/t/lib/Test/Builder/Tester/Color.pm BioPerl-1.6.1/t/lib/Test/Harness BioPerl-1.6.1/t/lib/Test/Harness/Assert.pm BioPerl-1.6.1/t/lib/Test/Harness/Iterator.pm BioPerl-1.6.1/t/lib/Test/Harness/Point.pm BioPerl-1.6.1/t/lib/Test/Harness/Results.pm BioPerl-1.6.1/t/lib/Test/Harness/Straps.pm BioPerl-1.6.1/t/lib/Test/Harness/TAP.pod BioPerl-1.6.1/t/lib/Test/Harness/Util.pm BioPerl-1.6.1/t/lib/Tree BioPerl-1.6.1/t/lib/Tree/DAG_Node.pm BioPerl-1.6.1/t/LiveSeq BioPerl-1.6.1/t/LiveSeq/Chain.t BioPerl-1.6.1/t/LiveSeq/LiveSeq.t BioPerl-1.6.1/t/LiveSeq/Mutation.t BioPerl-1.6.1/t/LiveSeq/Mutator.t BioPerl-1.6.1/t/LocalDB BioPerl-1.6.1/t/LocalDB/BioDBGFF.t BioPerl-1.6.1/t/LocalDB/BlastIndex.t BioPerl-1.6.1/t/LocalDB/DBFasta.t BioPerl-1.6.1/t/LocalDB/DBQual.t BioPerl-1.6.1/t/LocalDB/Flat.t BioPerl-1.6.1/t/LocalDB/Index.t BioPerl-1.6.1/t/LocalDB/Registry.t BioPerl-1.6.1/t/LocalDB/SeqFeature.t BioPerl-1.6.1/t/LocalDB/transfac_pro.t BioPerl-1.6.1/t/Map BioPerl-1.6.1/t/Map/Cyto.t BioPerl-1.6.1/t/Map/Linkage.t BioPerl-1.6.1/t/Map/Map.t BioPerl-1.6.1/t/Map/MapIO.t BioPerl-1.6.1/t/Map/MicrosatelliteMarker.t BioPerl-1.6.1/t/Map/Physical.t BioPerl-1.6.1/t/Matrix BioPerl-1.6.1/t/Matrix/InstanceSite.t BioPerl-1.6.1/t/Matrix/Matrix.t BioPerl-1.6.1/t/Matrix/ProtMatrix.t BioPerl-1.6.1/t/Matrix/ProtPsm.t BioPerl-1.6.1/t/Matrix/SiteMatrix.t BioPerl-1.6.1/t/Matrix/IO BioPerl-1.6.1/t/Matrix/IO/masta.t BioPerl-1.6.1/t/Matrix/IO/psm.t BioPerl-1.6.1/t/Ontology BioPerl-1.6.1/t/Ontology/GOterm.t BioPerl-1.6.1/t/Ontology/GraphAdaptor.t BioPerl-1.6.1/t/Ontology/Ontology.t BioPerl-1.6.1/t/Ontology/OntologyEngine.t BioPerl-1.6.1/t/Ontology/OntologyStore.t BioPerl-1.6.1/t/Ontology/Relationship.t BioPerl-1.6.1/t/Ontology/RelationshipType.t BioPerl-1.6.1/t/Ontology/Term.t BioPerl-1.6.1/t/Ontology/IO BioPerl-1.6.1/t/Ontology/IO/go.t BioPerl-1.6.1/t/Ontology/IO/interpro.t BioPerl-1.6.1/t/Ontology/IO/obo.t BioPerl-1.6.1/t/Phenotype BioPerl-1.6.1/t/Phenotype/Correlate.t BioPerl-1.6.1/t/Phenotype/Measure.t BioPerl-1.6.1/t/Phenotype/MeSH.t BioPerl-1.6.1/t/Phenotype/MiniMIMentry.t BioPerl-1.6.1/t/Phenotype/OMIMentry.t BioPerl-1.6.1/t/Phenotype/OMIMentryAllelicVariant.t BioPerl-1.6.1/t/Phenotype/OMIMparser.t BioPerl-1.6.1/t/Phenotype/Phenotype.t BioPerl-1.6.1/t/PopGen BioPerl-1.6.1/t/PopGen/Coalescent.t BioPerl-1.6.1/t/PopGen/HtSNP.t BioPerl-1.6.1/t/PopGen/MK.t BioPerl-1.6.1/t/PopGen/PopGen.t BioPerl-1.6.1/t/PopGen/PopGenSims.t BioPerl-1.6.1/t/PopGen/TagHaplotype.t BioPerl-1.6.1/t/RemoteDB BioPerl-1.6.1/t/RemoteDB/BioFetch.t BioPerl-1.6.1/t/RemoteDB/CUTG.t BioPerl-1.6.1/t/RemoteDB/EMBL.t BioPerl-1.6.1/t/RemoteDB/EntrezGene.t BioPerl-1.6.1/t/RemoteDB/EUtilities.t BioPerl-1.6.1/t/RemoteDB/GenBank.t BioPerl-1.6.1/t/RemoteDB/GenPept.t BioPerl-1.6.1/t/RemoteDB/MeSH.t BioPerl-1.6.1/t/RemoteDB/RefSeq.t BioPerl-1.6.1/t/RemoteDB/SeqHound.t BioPerl-1.6.1/t/RemoteDB/SeqRead_fail.t BioPerl-1.6.1/t/RemoteDB/SeqVersion.t BioPerl-1.6.1/t/RemoteDB/SwissProt.t BioPerl-1.6.1/t/RemoteDB/Taxonomy.t BioPerl-1.6.1/t/RemoteDB/HIV BioPerl-1.6.1/t/RemoteDB/HIV/HIV.t BioPerl-1.6.1/t/RemoteDB/HIV/HIVAnnotProcessor.t BioPerl-1.6.1/t/RemoteDB/HIV/HIVQuery.t BioPerl-1.6.1/t/RemoteDB/HIV/HIVQueryHelper.t BioPerl-1.6.1/t/RemoteDB/Query BioPerl-1.6.1/t/RemoteDB/Query/GenBank.t BioPerl-1.6.1/t/Restriction BioPerl-1.6.1/t/Restriction/Analysis-refac.t BioPerl-1.6.1/t/Restriction/Analysis.t BioPerl-1.6.1/t/Restriction/Gel.t BioPerl-1.6.1/t/Restriction/IO.t BioPerl-1.6.1/t/Root BioPerl-1.6.1/t/Root/Exception.t BioPerl-1.6.1/t/Root/RootI.t BioPerl-1.6.1/t/Root/RootIO.t BioPerl-1.6.1/t/Root/Storable.t BioPerl-1.6.1/t/Root/Tempfile.t BioPerl-1.6.1/t/Root/Utilities.t BioPerl-1.6.1/t/SearchIO BioPerl-1.6.1/t/SearchIO/blast.t BioPerl-1.6.1/t/SearchIO/blast_pull.t BioPerl-1.6.1/t/SearchIO/blasttable.t BioPerl-1.6.1/t/SearchIO/blastxml.t BioPerl-1.6.1/t/SearchIO/CigarString.t BioPerl-1.6.1/t/SearchIO/cross_match.t BioPerl-1.6.1/t/SearchIO/erpin.t BioPerl-1.6.1/t/SearchIO/exonerate.t BioPerl-1.6.1/t/SearchIO/fasta.t BioPerl-1.6.1/t/SearchIO/gmap_f9.t BioPerl-1.6.1/t/SearchIO/hmmer.t BioPerl-1.6.1/t/SearchIO/hmmer_pull.t BioPerl-1.6.1/t/SearchIO/infernal.t BioPerl-1.6.1/t/SearchIO/megablast.t BioPerl-1.6.1/t/SearchIO/psl.t BioPerl-1.6.1/t/SearchIO/rnamotif.t BioPerl-1.6.1/t/SearchIO/SearchIO.t BioPerl-1.6.1/t/SearchIO/sim4.t BioPerl-1.6.1/t/SearchIO/SimilarityPair.t BioPerl-1.6.1/t/SearchIO/Tiling.t BioPerl-1.6.1/t/SearchIO/waba.t BioPerl-1.6.1/t/SearchIO/wise.t BioPerl-1.6.1/t/SearchIO/Writer BioPerl-1.6.1/t/SearchIO/Writer/GbrowseGFF.t BioPerl-1.6.1/t/SearchIO/Writer/HitTableWriter.t BioPerl-1.6.1/t/SearchIO/Writer/HSPTableWriter.t BioPerl-1.6.1/t/SearchIO/Writer/HTMLWriter.t BioPerl-1.6.1/t/Seq BioPerl-1.6.1/t/Seq/DBLink.t BioPerl-1.6.1/t/Seq/EncodedSeq.t BioPerl-1.6.1/t/Seq/LargeLocatableSeq.t BioPerl-1.6.1/t/Seq/LargePSeq.t BioPerl-1.6.1/t/Seq/LocatableSeq.t BioPerl-1.6.1/t/Seq/MetaSeq.t BioPerl-1.6.1/t/Seq/PrimaryQual.t BioPerl-1.6.1/t/Seq/PrimarySeq.t BioPerl-1.6.1/t/Seq/PrimedSeq.t BioPerl-1.6.1/t/Seq/Quality.t BioPerl-1.6.1/t/Seq/Seq.t BioPerl-1.6.1/t/Seq/WithQuality.t BioPerl-1.6.1/t/SeqFeature BioPerl-1.6.1/t/SeqFeature/FeatureIO.t BioPerl-1.6.1/t/SeqFeature/Location.t BioPerl-1.6.1/t/SeqFeature/LocationFactory.t BioPerl-1.6.1/t/SeqFeature/Primer.t BioPerl-1.6.1/t/SeqFeature/Range.t BioPerl-1.6.1/t/SeqFeature/RangeI.t BioPerl-1.6.1/t/SeqFeature/SeqAnalysisParser.t BioPerl-1.6.1/t/SeqFeature/SeqFeatAnnotated.t BioPerl-1.6.1/t/SeqFeature/SeqFeatCollection.t BioPerl-1.6.1/t/SeqFeature/SeqFeature.t BioPerl-1.6.1/t/SeqFeature/SeqFeaturePrimer.t BioPerl-1.6.1/t/SeqFeature/Unflattener.t BioPerl-1.6.1/t/SeqFeature/Unflattener2.t BioPerl-1.6.1/t/SeqIO BioPerl-1.6.1/t/SeqIO/abi.t BioPerl-1.6.1/t/SeqIO/ace.t BioPerl-1.6.1/t/SeqIO/agave.t BioPerl-1.6.1/t/SeqIO/alf.t BioPerl-1.6.1/t/SeqIO/asciitree.t BioPerl-1.6.1/t/SeqIO/bsml.t BioPerl-1.6.1/t/SeqIO/bsml_sax.t BioPerl-1.6.1/t/SeqIO/chadoxml.t BioPerl-1.6.1/t/SeqIO/chaos.t BioPerl-1.6.1/t/SeqIO/chaosxml.t BioPerl-1.6.1/t/SeqIO/ctf.t BioPerl-1.6.1/t/SeqIO/embl.t BioPerl-1.6.1/t/SeqIO/entrezgene.t BioPerl-1.6.1/t/SeqIO/excel.t BioPerl-1.6.1/t/SeqIO/exp.t BioPerl-1.6.1/t/SeqIO/fasta.t BioPerl-1.6.1/t/SeqIO/fastq.t BioPerl-1.6.1/t/SeqIO/flybase_chadoxml.t BioPerl-1.6.1/t/SeqIO/game.t BioPerl-1.6.1/t/SeqIO/gcg.t BioPerl-1.6.1/t/SeqIO/genbank.t BioPerl-1.6.1/t/SeqIO/Handler.t BioPerl-1.6.1/t/SeqIO/interpro.t BioPerl-1.6.1/t/SeqIO/kegg.t BioPerl-1.6.1/t/SeqIO/largefasta.t BioPerl-1.6.1/t/SeqIO/lasergene.t BioPerl-1.6.1/t/SeqIO/locuslink.t BioPerl-1.6.1/t/SeqIO/metafasta.t BioPerl-1.6.1/t/SeqIO/MultiFile.t BioPerl-1.6.1/t/SeqIO/Multiple_fasta.t BioPerl-1.6.1/t/SeqIO/phd.t BioPerl-1.6.1/t/SeqIO/pir.t BioPerl-1.6.1/t/SeqIO/pln.t BioPerl-1.6.1/t/SeqIO/qual.t BioPerl-1.6.1/t/SeqIO/raw.t BioPerl-1.6.1/t/SeqIO/scf.t BioPerl-1.6.1/t/SeqIO/SeqBuilder.t BioPerl-1.6.1/t/SeqIO/Splicedseq.t BioPerl-1.6.1/t/SeqIO/strider.t BioPerl-1.6.1/t/SeqIO/swiss.t BioPerl-1.6.1/t/SeqIO/tab.t BioPerl-1.6.1/t/SeqIO/table.t BioPerl-1.6.1/t/SeqIO/tigr.t BioPerl-1.6.1/t/SeqIO/tigrxml.t BioPerl-1.6.1/t/SeqIO/tinyseq.t BioPerl-1.6.1/t/SeqIO/ztr.t BioPerl-1.6.1/t/SeqTools BioPerl-1.6.1/t/SeqTools/Backtranslate.t BioPerl-1.6.1/t/SeqTools/CodonTable.t BioPerl-1.6.1/t/SeqTools/ECnumber.t BioPerl-1.6.1/t/SeqTools/GuessSeqFormat.t BioPerl-1.6.1/t/SeqTools/OddCodes.t BioPerl-1.6.1/t/SeqTools/SeqPattern.t BioPerl-1.6.1/t/SeqTools/SeqStats.t BioPerl-1.6.1/t/SeqTools/SeqUtils.t BioPerl-1.6.1/t/SeqTools/SeqWords.t BioPerl-1.6.1/t/Structure BioPerl-1.6.1/t/Structure/IO.t BioPerl-1.6.1/t/Structure/Structure.t BioPerl-1.6.1/t/Tools BioPerl-1.6.1/t/Tools/ePCR.t BioPerl-1.6.1/t/Tools/Est2Genome.t BioPerl-1.6.1/t/Tools/FootPrinter.t BioPerl-1.6.1/t/Tools/Geneid.t BioPerl-1.6.1/t/Tools/Genewise.t BioPerl-1.6.1/t/Tools/Genomewise.t BioPerl-1.6.1/t/Tools/Genpred.t BioPerl-1.6.1/t/Tools/GFF.t BioPerl-1.6.1/t/Tools/Hmmer.t BioPerl-1.6.1/t/Tools/IUPAC.t BioPerl-1.6.1/t/Tools/Lucy.t BioPerl-1.6.1/t/Tools/Match.t BioPerl-1.6.1/t/Tools/pICalculator.t BioPerl-1.6.1/t/Tools/Primer3.t BioPerl-1.6.1/t/Tools/Promoterwise.t BioPerl-1.6.1/t/Tools/Pseudowise.t BioPerl-1.6.1/t/Tools/QRNA.t BioPerl-1.6.1/t/Tools/RandDistFunctions.t BioPerl-1.6.1/t/Tools/RepeatMasker.t BioPerl-1.6.1/t/Tools/rnamotif.t BioPerl-1.6.1/t/Tools/Seg.t BioPerl-1.6.1/t/Tools/Sigcleave.t BioPerl-1.6.1/t/Tools/Signalp.t BioPerl-1.6.1/t/Tools/Sim4.t BioPerl-1.6.1/t/Tools/SiRNA.t BioPerl-1.6.1/t/Tools/TandemRepeatsFinder.t BioPerl-1.6.1/t/Tools/TargetP.t BioPerl-1.6.1/t/Tools/Tmhmm.t BioPerl-1.6.1/t/Tools/tRNAscanSE.t BioPerl-1.6.1/t/Tools/Alignment BioPerl-1.6.1/t/Tools/Alignment/Consed.t BioPerl-1.6.1/t/Tools/Analysis BioPerl-1.6.1/t/Tools/Analysis/DNA BioPerl-1.6.1/t/Tools/Analysis/DNA/ESEfinder.t BioPerl-1.6.1/t/Tools/Analysis/Protein BioPerl-1.6.1/t/Tools/Analysis/Protein/Domcut.t BioPerl-1.6.1/t/Tools/Analysis/Protein/ELM.t BioPerl-1.6.1/t/Tools/Analysis/Protein/GOR4.t BioPerl-1.6.1/t/Tools/Analysis/Protein/HNN.t BioPerl-1.6.1/t/Tools/Analysis/Protein/Mitoprot.t BioPerl-1.6.1/t/Tools/Analysis/Protein/NetPhos.t BioPerl-1.6.1/t/Tools/Analysis/Protein/Scansite.t BioPerl-1.6.1/t/Tools/Analysis/Protein/Sopma.t BioPerl-1.6.1/t/Tools/EMBOSS BioPerl-1.6.1/t/Tools/EMBOSS/Palindrome.t BioPerl-1.6.1/t/Tools/EUtilities BioPerl-1.6.1/t/Tools/EUtilities/egquery.t BioPerl-1.6.1/t/Tools/EUtilities/einfo.t BioPerl-1.6.1/t/Tools/EUtilities/elink_acheck.t BioPerl-1.6.1/t/Tools/EUtilities/elink_lcheck.t BioPerl-1.6.1/t/Tools/EUtilities/elink_llinks.t BioPerl-1.6.1/t/Tools/EUtilities/elink_ncheck.t BioPerl-1.6.1/t/Tools/EUtilities/elink_neighbor.t BioPerl-1.6.1/t/Tools/EUtilities/elink_neighbor_history.t BioPerl-1.6.1/t/Tools/EUtilities/elink_scores.t BioPerl-1.6.1/t/Tools/EUtilities/epost.t BioPerl-1.6.1/t/Tools/EUtilities/esearch.t BioPerl-1.6.1/t/Tools/EUtilities/espell.t BioPerl-1.6.1/t/Tools/EUtilities/esummary.t BioPerl-1.6.1/t/Tools/EUtilities/EUtilParameters.t BioPerl-1.6.1/t/Tools/Phylo BioPerl-1.6.1/t/Tools/Phylo/Gerp.t BioPerl-1.6.1/t/Tools/Phylo/Molphy.t BioPerl-1.6.1/t/Tools/Phylo/PAML.t BioPerl-1.6.1/t/Tools/Phylo/Phylip BioPerl-1.6.1/t/Tools/Phylo/Phylip/ProtDist.t BioPerl-1.6.1/t/Tools/Run BioPerl-1.6.1/t/Tools/Run/RemoteBlast.t BioPerl-1.6.1/t/Tools/Run/RemoteBlast_rpsblast.t BioPerl-1.6.1/t/Tools/Run/StandAloneBlast.t BioPerl-1.6.1/t/Tools/Run/WrapperBase.t BioPerl-1.6.1/t/Tools/Signalp BioPerl-1.6.1/t/Tools/Signalp/ExtendedSignalp.t BioPerl-1.6.1/t/Tools/Spidey BioPerl-1.6.1/t/Tools/Spidey/Spidey.t BioPerl-1.6.1/t/Tree BioPerl-1.6.1/t/Tree/Compatible.t BioPerl-1.6.1/t/Tree/Node.t BioPerl-1.6.1/t/Tree/RandomTreeFactory.t BioPerl-1.6.1/t/Tree/Tree.t BioPerl-1.6.1/t/Tree/TreeIO.t BioPerl-1.6.1/t/Tree/TreeStatistics.t BioPerl-1.6.1/t/Tree/PhyloNetwork BioPerl-1.6.1/t/Tree/PhyloNetwork/Factory.t BioPerl-1.6.1/t/Tree/PhyloNetwork/GraphViz.t BioPerl-1.6.1/t/Tree/PhyloNetwork/MuVector.t BioPerl-1.6.1/t/Tree/PhyloNetwork/PhyloNetwork.t BioPerl-1.6.1/t/Tree/PhyloNetwork/RandomFactory.t BioPerl-1.6.1/t/Tree/PhyloNetwork/TreeFactory.t BioPerl-1.6.1/t/Tree/TreeIO BioPerl-1.6.1/t/Tree/TreeIO/lintree.t BioPerl-1.6.1/t/Tree/TreeIO/newick.t BioPerl-1.6.1/t/Tree/TreeIO/nexus.t BioPerl-1.6.1/t/Tree/TreeIO/nhx.t BioPerl-1.6.1/t/Tree/TreeIO/phyloxml.t BioPerl-1.6.1/t/Tree/TreeIO/svggraph.t BioPerl-1.6.1/t/Tree/TreeIO/tabtree.t BioPerl-1.6.1/t/Variation BioPerl-1.6.1/t/Variation/AAChange.t BioPerl-1.6.1/t/Variation/AAReverseMutate.t BioPerl-1.6.1/t/Variation/Allele.t BioPerl-1.6.1/t/Variation/DNAMutation.t BioPerl-1.6.1/t/Variation/RNAChange.t BioPerl-1.6.1/t/Variation/SeqDiff.t BioPerl-1.6.1/t/Variation/SNP.t BioPerl-1.6.1/t/Variation/Variation_IO.t CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz >>> C:\Perl-5.8\bin\perl.exe Makefile.PL # running Build.PL - ERROR: DB_File is not installed (I think I'm being run by CPAN/CPANPLUS, so will rely on it to handle prerequisite installation) I'll get CPAN to prepend the installation of this Install [a]ll optional external modules, [n]one, or choose [i]nteractively? [n] Checking prerequisites... recommends: * Optional prerequisite Bio::ASN1::EntrezGene is not installed (wanted for parsing entrezgene, used by Bio::SeqIO::entrezgene [circular dependency!]) * Optional prerequisite GraphViz is not installed (wanted for Phylogenetic Network Visulization, used by Bio::PhyloNetwork::GraphViz) * This feature isn't supported under your OS (mswin) - DB_File is not installed - DBD::Pg is not installed ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions of the modules indicated above before proceeding with this installation Checking features: Network...................enabled BioDBSeqFeature_mysql.....enabled BioDBGFF..................disabled BioDBSeqFeature_BDB.......disabled BioDBSeqFeature_SQLite....enabled BioDBSeqFeature_Pg........disabled Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts Do you want to run tests that require connection to servers across the internet (likely to cause some failures)? y/n [n] Encountered CODE ref, using dummy placeholder at C:/cpanfly-5.8/var/megalib/Data/Dumper.pm line 190. Could not get valid metadata. Error is: Invalid metadata structure. Errors: 'Perl_5' for 'license' does not have a URL scheme (resources -> license) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::FeatureIO::gff -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::WebAgent -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::EUtilParameters -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::OntologyIO::InterProParser -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Biblio::IO::medlinexml -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::strider -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::PhyloNetwork::RandomFactory -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::Analysis::DNA::ESEfinder -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::game::gameSubs -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::FeatureIO::interpro -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::GFF::Adaptor::berkeleydb -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::entrezgene -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::tinyseq -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::chadoxml -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::game::gameWriter -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::FileCache -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::bsml_sax -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::Primer3 -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::GFF::Adaptor::ace -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::PopGen::HtSNP -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tree::Compatible -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::Ace -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::Taxonomy::entrez -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::agave -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::PopGen::TagHaplotype -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::SeqFeature::Store::FeatureFileLoader -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::* -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::Analysis::Protein* -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SearchIO::blastxml -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::EUtilities -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tree::Draw::Cladogram -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::SeqPattern -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::tigrxml -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqFeature::Collection -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Draw::Pictogram -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SearchIO::Writer::BSMLResultWriter -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::Query::HIVQuery -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::TreeIO::svggraph -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::Biblio::eutils -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::PhyloNetwork -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::SeqPattern::BackTranslate -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::Query::GenBank -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Variation::IO::xml -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::PhyloNetwork::GraphViz -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqFeature::Annotated -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::NCBIHelper -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::HIV -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::Analysis::DNA* -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Tools::Run::RemoteBlast -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::SeqIO::excel -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::ClusterIO::dbsnp -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::Microarray::Tools::ReseqChip -> requires) [Validation: 1.2], Expected a map structure from string or file. (optional_features -> Bio::DB::Biblio::soap -> requires) [Validation: 1.2] at C:/cpanfly-5.8/var/megalib/Module/Build/Base.pm line 4559 Could not create MYMETA files - will not run internet-requiring tests Creating new 'Build' script for 'BioPerl' version '1.006001' ---- Unsatisfied dependencies detected during ---- ---- CJFIELDS/BioPerl-1.6.1.tar.gz ---- DB_File [requires] Running make test Delayed until after prerequisites Running test for module 'DB_File' ______________________ D i s t r o P r e f s ______________________ DB_File.yml[0] Running make for P/PM/PMQS/DB_File-1.822.tar.gz Disabled via prefs file 'C:\cpanfly-5.8\etc\distroprefs\DB_File.yml' doc 0 PMQS/DB_File-1.822.tar.gz [disabled] -- NA Disabled via prefs file 'C:\cpanfly-5.8\etc\distroprefs\DB_File.yml' doc 0 Running make for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz Has already been unwrapped into directory C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz Warning: Prerequisite 'DB_File => 0' for 'CJFIELDS/BioPerl-1.6.1.tar.gz' failed when processing 'PMQS/DB_File-1.822.tar.gz' with 'unwrapped => NO Disabled via prefs file 'C:\cpanfly-5.8\etc\distroprefs\DB_File.yml' doc 0'. Continuing, but chances to succeed are limited. >>> nmake Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl-5.8\bin\perl.exe Build --makefile_env_macros 1 Building BioPerl blib\script\load_gff.PLS -> blib\script\bp_load_gff.pl blib\script\search2alnblocks.PLS -> blib\script\bp_search2alnblocks.pl blib\script\blast2tree.PLS -> blib\script\bp_blast2tree.pl blib\script\bioflat_index.PLS -> blib\script\bp_bioflat_index.pl blib\script\mask_by_search.PLS -> blib\script\bp_mask_by_search.pl blib\script\bp_mrtrans.PLS -> blib\script\bp_mrtrans.pl blib\script\bp_sreformat.PLS -> blib\script\bp_sreformat.pl blib\script\search2gff.PLS -> blib\script\bp_search2gff.pl blib\script\mutate.PLS -> blib\script\bp_mutate.pl blib\script\chaos_plot.PLS -> blib\script\bp_chaos_plot.pl blib\script\unflatten_seq.PLS -> blib\script\bp_unflatten_seq.pl blib\script\hmmer_to_table.PLS -> blib\script\bp_hmmer_to_table.pl blib\script\fast_load_gff.PLS -> blib\script\bp_fast_load_gff.pl blib\script\bulk_load_gff.PLS -> blib\script\bp_bulk_load_gff.pl blib\script\revtrans-motif.PLS -> blib\script\bp_revtrans-motif.pl blib\script\seqconvert.PLS -> blib\script\bp_seqconvert.pl blib\script\search2table.PLS -> blib\script\bp_search2table.pl blib\script\flanks.PLS -> blib\script\bp_flanks.pl blib\script\seq_length.PLS -> blib\script\bp_seq_length.pl blib\script\bp_seqret.PLS -> blib\script\bp_seqret.pl blib\script\composite_LD.PLS -> blib\script\bp_composite_LD.pl blib\script\hivq.PLS -> blib\script\bp_hivq.pl blib\script\genbank2gff.PLS -> blib\script\bp_genbank2gff.pl blib\script\einfo.PLS -> blib\script\bp_einfo.pl blib\script\bp_seqfeature_delete.PLS -> blib\script\bp_seqfeature_delete.pl blib\script\process_gadfly.PLS -> blib\script\bp_process_gadfly.pl blib\script\split_seq.PLS -> blib\script\bp_split_seq.pl blib\script\biblio.PLS -> blib\script\bp_biblio.pl blib\script\parse_hmmsearch.PLS -> blib\script\bp_parse_hmmsearch.pl blib\script\bp_seqfeature_gff3.PLS -> blib\script\bp_seqfeature_gff3.pl blib\script\process_wormbase.PLS -> blib\script\bp_process_wormbase.pl blib\script\bp_seqfeature_load.PLS -> blib\script\bp_seqfeature_load.pl blib\script\download_query_genbank.PLS -> blib\script\bp_download_query_genbank.pl blib\script\extract_feature_seq.PLS -> blib\script\bp_extract_feature_seq.pl blib\script\make_mrna_protein.PLS -> blib\script\bp_make_mrna_protein.pl blib\script\biofetch_genbank_proxy.PLS -> blib\script\bp_biofetch_genbank_proxy.pl blib\script\aacomp.PLS -> blib\script\bp_aacomp.pl blib\script\nexus2nh.PLS -> blib\script\bp_nexus2nh.pl blib\script\filter_search.PLS -> blib\script\bp_filter_search.pl blib\script\bp_nrdb.PLS -> blib\script\bp_nrdb.pl blib\script\bp_fetch.PLS -> blib\script\bp_fetch.pl blib\script\heterogeneity_test.PLS -> blib\script\bp_heterogeneity_test.pl blib\script\tree2pag.PLS -> blib\script\bp_tree2pag.pl blib\script\taxid4species.PLS -> blib\script\bp_taxid4species.pl blib\script\local_taxonomydb_query.PLS -> blib\script\bp_local_taxonomydb_query.pl blib\script\taxonomy2tree.PLS -> blib\script\bp_taxonomy2tree.pl blib\script\genbank2gff3.PLS -> blib\script\bp_genbank2gff3.pl blib\script\search2BSML.PLS -> blib\script\bp_search2BSML.pl blib\script\oligo_count.PLS -> blib\script\bp_oligo_count.pl blib\script\meta_gff.PLS -> blib\script\bp_meta_gff.pl blib\script\process_sgd.PLS -> blib\script\bp_process_sgd.pl blib\script\seqretsplit.PLS -> blib\script\bp_seqretsplit.pl blib\script\bp_index.PLS -> blib\script\bp_index.pl blib\script\search2tribe.PLS -> blib\script\bp_search2tribe.pl blib\script\generate_histogram.PLS -> blib\script\bp_generate_histogram.pl blib\script\biogetseq.PLS -> blib\script\bp_biogetseq.pl blib\script\gccalc.PLS -> blib\script\bp_gccalc.pl blib\script\translate_seq.PLS -> blib\script\bp_translate_seq.pl blib\script\query_entrez_taxa.PLS -> blib\script\bp_query_entrez_taxa.pl blib\script\fastam9_to_table.PLS -> blib\script\bp_fastam9_to_table.pl blib\script\classify_hits_kingdom.PLS -> blib\script\bp_classify_hits_kingdom.pl blib\script\remote_blast.PLS -> blib\script\bp_remote_blast.pl blib\script\dbsplit.PLS -> blib\script\bp_dbsplit.pl blib\script\pairwise_kaks.PLS -> blib\script\Encountered CODE ref, using dummy placeholder at C:\cpanfly-5.8\var\megalib/Data/Dumper.pm line 190. bp_pairwise_kaks.pl CJFIELDS/BioPerl-1.6.1.tar.gz nmake -- OK Running make test >>> nmake test TEST_VERBOSE=1 Microsoft (R) Program Maintenance Utility Version 7.00.8882 Copyright (C) Microsoft Corp 1988-2000. All rights reserved. C:\Perl-5.8\bin\perl.exe Build --makefile_env_macros 1 test Copying scripts\Bio-DB-GFF\load_gff.PLS -> blib\script\load_gff.PLS Changing sharpbang in blib\script\load_gff.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\load_gff.PLS.bak blib\script\load_gff.PLS -> blib\script\bp_load_gff.pl Copying scripts\utilities\search2alnblocks.PLS -> blib\script\search2alnblocks.PLS Changing sharpbang in blib\script\search2alnblocks.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\search2alnblocks.PLS.bak blib\script\search2alnblocks.PLS -> blib\script\bp_search2alnblocks.pl Copying scripts\tree\blast2tree.PLS -> blib\script\blast2tree.PLS Changing sharpbang in blib\script\blast2tree.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\blast2tree.PLS.bak blib\script\blast2tree.PLS -> blib\script\bp_blast2tree.pl Copying scripts\DB\bioflat_index.PLS -> blib\script\bioflat_index.PLS Changing sharpbang in blib\script\bioflat_index.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bioflat_index.PLS.bak blib\script\bioflat_index.PLS -> blib\script\bp_bioflat_index.pl Copying scripts\utilities\mask_by_search.PLS -> blib\script\mask_by_search.PLS Changing sharpbang in blib\script\mask_by_search.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\mask_by_search.PLS.bak blib\script\mask_by_search.PLS -> blib\script\bp_mask_by_search.pl Copying scripts\utilities\bp_mrtrans.PLS -> blib\script\bp_mrtrans.PLS Changing sharpbang in blib\script\bp_mrtrans.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_mrtrans.PLS.bak blib\script\bp_mrtrans.PLS -> blib\script\bp_mrtrans.pl Copying scripts\utilities\bp_sreformat.PLS -> blib\script\bp_sreformat.PLS Changing sharpbang in blib\script\bp_sreformat.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_sreformat.PLS.bak blib\script\bp_sreformat.PLS -> blib\script\bp_sreformat.pl Copying scripts\utilities\search2gff.PLS -> blib\script\search2gff.PLS Changing sharpbang in blib\script\search2gff.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\search2gff.PLS.bak blib\script\search2gff.PLS -> blib\script\bp_search2gff.pl Copying scripts\utilities\mutate.PLS -> blib\script\mutate.PLS Changing sharpbang in blib\script\mutate.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\mutate.PLS.bak blib\script\mutate.PLS -> blib\script\bp_mutate.pl Copying scripts\seqstats\chaos_plot.PLS -> blib\script\chaos_plot.PLS Changing sharpbang in blib\script\chaos_plot.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\chaos_plot.PLS.bak blib\script\chaos_plot.PLS -> blib\script\bp_chaos_plot.pl Copying scripts\seq\unflatten_seq.PLS -> blib\script\unflatten_seq.PLS Changing sharpbang in blib\script\unflatten_seq.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\unflatten_seq.PLS.bak blib\script\unflatten_seq.PLS -> blib\script\bp_unflatten_seq.pl Copying scripts\searchio\hmmer_to_table.PLS -> blib\script\hmmer_to_table.PLS Changing sharpbang in blib\script\hmmer_to_table.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\hmmer_to_table.PLS.bak blib\script\hmmer_to_table.PLS -> blib\script\bp_hmmer_to_table.pl Copying scripts\Bio-DB-GFF\fast_load_gff.PLS -> blib\script\fast_load_gff.PLS Changing sharpbang in blib\script\fast_load_gff.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\fast_load_gff.PLS.bak blib\script\fast_load_gff.PLS -> blib\script\bp_fast_load_gff.pl Copying scripts\Bio-DB-GFF\bulk_load_gff.PLS -> blib\script\bulk_load_gff.PLS Changing sharpbang in blib\script\bulk_load_gff.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bulk_load_gff.PLS.bak blib\script\bulk_load_gff.PLS -> blib\script\bp_bulk_load_gff.pl Copying scripts\utilities\revtrans-motif.PLS -> blib\script\revtrans-motif.PLS Changing sharpbang in blib\script\revtrans-motif.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\revtrans-motif.PLS.bak blib\script\revtrans-motif.PLS -> blib\script\bp_revtrans-motif.pl Copying scripts\seq\seqconvert.PLS -> blib\script\seqconvert.PLS Changing sharpbang in blib\script\seqconvert.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\seqconvert.PLS.bak blib\script\seqconvert.PLS -> blib\script\bp_seqconvert.pl Copying scripts\searchio\search2table.PLS -> blib\script\search2table.PLS Changing sharpbang in blib\script\search2table.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\search2table.PLS.bak blib\script\search2table.PLS -> blib\script\bp_search2table.pl Copying scripts\DB\flanks.PLS -> blib\script\flanks.PLS Changing sharpbang in blib\script\flanks.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\flanks.PLS.bak blib\script\flanks.PLS -> blib\script\bp_flanks.pl Copying scripts\utilities\seq_length.PLS -> blib\script\seq_length.PLS Changing sharpbang in blib\script\seq_length.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\seq_length.PLS.bak blib\script\seq_length.PLS -> blib\script\bp_seq_length.pl Copying scripts\index\bp_seqret.PLS -> blib\script\bp_seqret.PLS Changing sharpbang in blib\script\bp_seqret.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_seqret.PLS.bak blib\script\bp_seqret.PLS -> blib\script\bp_seqret.pl Copying scripts\popgen\composite_LD.PLS -> blib\script\composite_LD.PLS Changing sharpbang in blib\script\composite_LD.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\composite_LD.PLS.bak blib\script\composite_LD.PLS -> blib\script\bp_composite_LD.pl Copying scripts\DB-HIV\hivq.PLS -> blib\script\hivq.PLS Changing sharpbang in blib\script\hivq.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\hivq.PLS.bak blib\script\hivq.PLS -> blib\script\bp_hivq.pl Copying scripts\Bio-DB-GFF\genbank2gff.PLS -> blib\script\genbank2gff.PLS Changing sharpbang in blib\script\genbank2gff.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\genbank2gff.PLS.bak blib\script\genbank2gff.PLS -> blib\script\bp_genbank2gff.pl Copying scripts\Bio-DB-EUtilities\einfo.PLS -> blib\script\einfo.PLS Changing sharpbang in blib\script\einfo.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\einfo.PLS.bak blib\script\einfo.PLS -> blib\script\bp_einfo.pl Copying scripts\Bio-SeqFeature-Store\bp_seqfeature_delete.PLS -> blib\script\bp_seqfeature_delete.PLS Changing sharpbang in blib\script\bp_seqfeature_delete.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_seqfeature_delete.PLS.bak blib\script\bp_seqfeature_delete.PLS -> blib\script\bp_seqfeature_delete.pl Copying scripts\Bio-DB-GFF\process_gadfly.PLS -> blib\script\process_gadfly.PLS Changing sharpbang in blib\script\process_gadfly.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\process_gadfly.PLS.bak blib\script\process_gadfly.PLS -> blib\script\bp_process_gadfly.pl Copying scripts\seq\split_seq.PLS -> blib\script\split_seq.PLS Changing sharpbang in blib\script\split_seq.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\split_seq.PLS.bak blib\script\split_seq.PLS -> blib\script\bp_split_seq.pl Copying scripts\biblio\biblio.PLS -> blib\script\biblio.PLS Changing sharpbang in blib\script\biblio.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\biblio.PLS.bak blib\script\biblio.PLS -> blib\script\bp_biblio.pl Copying scripts\searchio\parse_hmmsearch.PLS -> blib\script\parse_hmmsearch.PLS Changing sharpbang in blib\script\parse_hmmsearch.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\parse_hmmsearch.PLS.bak blib\script\parse_hmmsearch.PLS -> blib\script\bp_parse_hmmsearch.pl Copying scripts\Bio-SeqFeature-Store\bp_seqfeature_gff3.PLS -> blib\script\bp_seqfeature_gff3.PLS blib\script\bp_seqfeature_gff3.PLS -> blib\script\bp_seqfeature_gff3.pl Copying scripts\Bio-DB-GFF\process_wormbase.PLS -> blib\script\process_wormbase.PLS Changing sharpbang in blib\script\process_wormbase.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\process_wormbase.PLS.bak blib\script\process_wormbase.PLS -> blib\script\bp_process_wormbase.pl Copying scripts\Bio-SeqFeature-Store\bp_seqfeature_load.PLS -> blib\script\bp_seqfeature_load.PLS Changing sharpbang in blib\script\bp_seqfeature_load.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_seqfeature_load.PLS.bak blib\script\bp_seqfeature_load.PLS -> blib\script\bp_seqfeature_load.pl Copying scripts\utilities\download_query_genbank.PLS -> blib\script\download_query_genbank.PLS Changing sharpbang in blib\script\download_query_genbank.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\download_query_genbank.PLS.bak blib\script\download_query_genbank.PLS -> blib\script\bp_download_query_genbank.pl Copying scripts\seq\extract_feature_seq.PLS -> blib\script\extract_feature_seq.PLS Changing sharpbang in blib\script\extract_feature_seq.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\extract_feature_seq.PLS.bak blib\script\extract_feature_seq.PLS -> blib\script\bp_extract_feature_seq.pl Copying scripts\seq\make_mrna_protein.PLS -> blib\script\make_mrna_protein.PLS Changing sharpbang in blib\script\make_mrna_protein.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\make_mrna_protein.PLS.bak blib\script\make_mrna_protein.PLS -> blib\script\bp_make_mrna_protein.pl Copying scripts\DB\biofetch_genbank_proxy.PLS -> blib\script\biofetch_genbank_proxy.PLS Changing sharpbang in blib\script\biofetch_genbank_proxy.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\biofetch_genbank_proxy.PLS.bak blib\script\biofetch_genbank_proxy.PLS -> blib\script\bp_biofetch_genbank_proxy.pl Copying scripts\seqstats\aacomp.PLS -> blib\script\aacomp.PLS Changing sharpbang in blib\script\aacomp.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\aacomp.PLS.bak blib\script\aacomp.PLS -> blib\script\bp_aacomp.pl Copying scripts\tree\nexus2nh.PLS -> blib\script\nexus2nh.PLS Changing sharpbang in blib\script\nexus2nh.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\nexus2nh.PLS.bak blib\script\nexus2nh.PLS -> blib\script\bp_nexus2nh.pl Copying scripts\searchio\filter_search.PLS -> blib\script\filter_search.PLS Changing sharpbang in blib\script\filter_search.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\filter_search.PLS.bak blib\script\filter_search.PLS -> blib\script\bp_filter_search.pl Copying scripts\utilities\bp_nrdb.PLS -> blib\script\bp_nrdb.PLS Changing sharpbang in blib\script\bp_nrdb.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_nrdb.PLS.bak blib\script\bp_nrdb.PLS -> blib\script\bp_nrdb.pl Copying scripts\index\bp_fetch.PLS -> blib\script\bp_fetch.PLS Changing sharpbang in blib\script\bp_fetch.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_fetch.PLS.bak blib\script\bp_fetch.PLS -> blib\script\bp_fetch.pl Copying scripts\popgen\heterogeneity_test.PLS -> blib\script\heterogeneity_test.PLS Changing sharpbang in blib\script\heterogeneity_test.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\heterogeneity_test.PLS.bak blib\script\heterogeneity_test.PLS -> blib\script\bp_heterogeneity_test.pl Copying scripts\tree\tree2pag.PLS -> blib\script\tree2pag.PLS Changing sharpbang in blib\script\tree2pag.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\tree2pag.PLS.bak blib\script\tree2pag.PLS -> blib\script\bp_tree2pag.pl Copying scripts\taxa\taxid4species.PLS -> blib\script\taxid4species.PLS Changing sharpbang in blib\script\taxid4species.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\taxid4species.PLS.bak blib\script\taxid4species.PLS -> blib\script\bp_taxid4species.pl Copying scripts\taxa\local_taxonomydb_query.PLS -> blib\script\local_taxonomydb_query.PLS Changing sharpbang in blib\script\local_taxonomydb_query.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\local_taxonomydb_query.PLS.bak blib\script\local_taxonomydb_query.PLS -> blib\script\bp_local_taxonomydb_query.pl Copying scripts\taxa\taxonomy2tree.PLS -> blib\script\taxonomy2tree.PLS Changing sharpbang in blib\script\taxonomy2tree.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\taxonomy2tree.PLS.bak blib\script\taxonomy2tree.PLS -> blib\script\bp_taxonomy2tree.pl Copying scripts\Bio-DB-GFF\genbank2gff3.PLS -> blib\script\genbank2gff3.PLS Changing sharpbang in blib\script\genbank2gff3.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\genbank2gff3.PLS.bak blib\script\genbank2gff3.PLS -> blib\script\bp_genbank2gff3.pl Copying scripts\utilities\search2BSML.PLS -> blib\script\search2BSML.PLS Changing sharpbang in blib\script\search2BSML.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\search2BSML.PLS.bak blib\script\search2BSML.PLS -> blib\script\bp_search2BSML.pl Copying scripts\seqstats\oligo_count.PLS -> blib\script\oligo_count.PLS Changing sharpbang in blib\script\oligo_count.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\oligo_count.PLS.bak blib\script\oligo_count.PLS -> blib\script\bp_oligo_count.pl Copying scripts\Bio-DB-GFF\meta_gff.PLS -> blib\script\meta_gff.PLS Changing sharpbang in blib\script\meta_gff.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\meta_gff.PLS.bak blib\script\meta_gff.PLS -> blib\script\bp_meta_gff.pl Copying scripts\Bio-DB-GFF\process_sgd.PLS -> blib\script\process_sgd.PLS Changing sharpbang in blib\script\process_sgd.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\process_sgd.PLS.bak blib\script\process_sgd.PLS -> blib\script\bp_process_sgd.pl Copying scripts\seq\seqretsplit.PLS -> blib\script\seqretsplit.PLS Changing sharpbang in blib\script\seqretsplit.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\seqretsplit.PLS.bak blib\script\seqretsplit.PLS -> blib\script\bp_seqretsplit.pl Copying scripts\index\bp_index.PLS -> blib\script\bp_index.PLS Changing sharpbang in blib\script\bp_index.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\bp_index.PLS.bak blib\script\bp_index.PLS -> blib\script\bp_index.pl Copying scripts\utilities\search2tribe.PLS -> blib\script\search2tribe.PLS Changing sharpbang in blib\script\search2tribe.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\search2tribe.PLS.bak blib\script\search2tribe.PLS -> blib\script\bp_search2tribe.pl Copying scripts\Bio-DB-GFF\generate_histogram.PLS -> blib\script\generate_histogram.PLS Changing sharpbang in blib\script\generate_histogram.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\generate_histogram.PLS.bak blib\script\generate_histogram.PLS -> blib\script\bp_generate_histogram.pl Copying scripts\DB\biogetseq.PLS -> blib\script\biogetseq.PLS Changing sharpbang in blib\script\biogetseq.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\biogetseq.PLS.bak blib\script\biogetseq.PLS -> blib\script\bp_biogetseq.pl Copying scripts\seqstats\gccalc.PLS -> blib\script\gccalc.PLS Changing sharpbang in blib\script\gccalc.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\gccalc.PLS.bak blib\script\gccalc.PLS -> blib\script\bp_gccalc.pl Copying scripts\seq\translate_seq.PLS -> blib\script\translate_seq.PLS Changing sharpbang in blib\script\translate_seq.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\translate_seq.PLS.bak blib\script\translate_seq.PLS -> blib\script\bp_translate_seq.pl Copying scripts\taxa\query_entrez_taxa.PLS -> blib\script\query_entrez_taxa.PLS Changing sharpbang in blib\script\query_entrez_taxa.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\query_entrez_taxa.PLS.bak blib\script\query_entrez_taxa.PLS -> blib\script\bp_query_entrez_taxa.pl Copying scripts\searchio\fastam9_to_table.PLS -> blib\script\fastam9_to_table.PLS Changing sharpbang in blib\script\fastam9_to_table.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\fastam9_to_table.PLS.bak blib\script\fastam9_to_table.PLS -> blib\script\bp_fastam9_to_table.pl Copying scripts\taxa\classify_hits_kingdom.PLS -> blib\script\classify_hits_kingdom.PLS Changing sharpbang in blib\script\classify_hits_kingdom.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\classify_hits_kingdom.PLS.bak blib\script\classify_hits_kingdom.PLS -> blib\script\bp_classify_hits_kingdom.pl Copying scripts\utilities\remote_blast.PLS -> blib\script\remote_blast.PLS Changing sharpbang in blib\script\remote_blast.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\remote_blast.PLS.bak blib\script\remote_blast.PLS -> blib\script\bp_remote_blast.pl Copying scripts\utilities\dbsplit.PLS -> blib\script\dbsplit.PLS Changing sharpbang in blib\script\dbsplit.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\dbsplit.PLS.bak blib\script\dbsplit.PLS -> blib\script\bp_dbsplit.pl Copying scripts\utilities\pairwise_kaks.PLS -> blib\script\pairwise_kaks.PLS Changing sharpbang in blib\script\pairwise_kaks.PLS to C:\Perl-5.8\bin\perl.exe Deleting blib\script\pairwise_kaks.PLS.bak blib\script\pairwise_kaks.PLS -> blib\script\bp_pairwise_kaks.pl t/Align/AlignStats.t ......................... 1..43 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::AlignIO; ok 4 - The object isa Bio::Align::AlignI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - The object isa Bio::Align::AlignI ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - The object isa Bio::Align::AlignI ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - The object isa Bio::Align::AlignI ok 38 - The object isa Bio::Matrix::PhylipDist ok 39 ok 40 ok 41 ok 42 - The object isa Bio::PrimarySeqI ok 43 ok t/Align/AlignUtil.t .......................... 1..33 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqIO; ok 4 - The object isa Bio::Align::AlignI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 120. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 120. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 120. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 120. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 120. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 120. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 120. Subroutine new redefined at Bio\Location\Split.pm line 104, line 120. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 120. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 120. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 120. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 120. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 120. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 120. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 120. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 120. Subroutine start redefined at Bio\Location\Split.pm line 401, line 120. Subroutine end redefined at Bio\Location\Split.pm line 420, line 120. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 120. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 120. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 120. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 120. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 120. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 120. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 120. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 120. t/Align/SimpleAlign.t ........................ 1..179 ok 1 - use Bio::SimpleAlign; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Location::Simple; ok 5 - use Bio::Location::Split; ok 6 - The object isa Bio::AlignIO ok 7 - pfam input test ok 8 - match_line ok 9 - The object isa Bio::Align::AlignI ok 10 - num_sequences ok 11 - num_sequences ok 12 - select_noncont ok 13 - select_noncont ok 14 - num_sequences ok 15 - select_noncont ok 16 - select_noncont ok 17 - each_seq ok 18 - get_nse ok 19 - id ok 20 - num_gaps ok 21 - each_alphabetically ok 22 - column_from_residue_number ok 23 - display_name get/set ok 24 - display_name get ok 25 - consensus_string ok 26 - consensus_string ok 27 - consensus_string ok 28 ok 29 - each_seq_with_id ok 30 - is_flush ok 31 - id get/set ok 32 - length ok 33 - num_residues ok 34 - num_sequences ok 35 - overall_percentage_identity ok 36 - overall_percentage_identity ok 37 - overall_percentage_identity ok 38 - overall_percentage_identity ok 39 - average_percentage_identity ok 40 ok 41 - set_displayname_count ok 42 ok 43 - set_displayname_flat ok 44 ok 45 - set_displayname_normal ok 46 ok 47 ok 48 - uppercase, map_chars ok 49 - match_line ok 50 - remove_seqs ok 51 - remove_seqs ok 52 - add_seq ok 53 - add_seq ok 54 - get_seq_by_pos ok 55 - get_seq_by_pos ok 56 ok 57 ok 58 ok 59 - purge ok 60 - purge ok 61 - IO::String consensus_iupac ok 62 - IO::String write_aln normal ok 63 - IO::String write_aln slice ok 64 - IO::String write_aln slice ok 65 - IO::String write_aln slice ok 66 - IO::String write_aln slice ok 67 - IO::String write_aln slice ok 68 ok 69 - remove_columns by position ok 70 - remove_columns by position (wrong order) ok 71 - cigar_line ok 72 - cigar_line ok 73 - cigar_line ok 74 - cigar_line ok 75 - sort_alphabetically - before ok 76 ok 77 - sort_alphabetically - after ok 78 - remove_gaps ok 79 - remove_gaps all_gaps_only ok 80 - set_new_reference ok 81 - set_new_reference ok 82 - uniq_seq ok 83 - bug 2099 ok 84 - bug 2099 ok 85 - bug 2793 ok 86 - bug 2793 ok 87 - bug 2793 ok 88 - bug 2793 ok 89 - Bad sequence, bad! ok 90 - added 3 seqs ok 91 - first 2 features added ok 92 - 3rd feature added not ok 93 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 1. # Overriding value [0] with value 1 for Bio::LocatableSeq::end(). # ? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:181 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:196 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1143 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly-5.8\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly-5.8\var\megalib/Test/Exception.pm:136 # STACK: Test::Exception::lives_ok C:\cpanfly-5.8\var\megalib/Test/Exception.pm:297 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 94 - slice 1 len ok 95 - correct masked seq ok 96 - correct masked seq ok 97 - correct masked seq not ok 98 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 3. # Overriding value [2] with value 3 for Bio::LocatableSeq::end(). # ? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:181 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:196 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1143 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly-5.8\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly-5.8\var\megalib/Test/Exception.pm:136 # STACK: Test::Exception::lives_ok C:\cpanfly-5.8\var\megalib/Test/Exception.pm:297 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 99 - slice 2 len ok 100 - correct masked seq ok 101 - correct masked seq ok 102 - correct masked seq not ok 103 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 3. # Overriding value [1] with value 3 for Bio::LocatableSeq::end(). # ?? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:181 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:196 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1143 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly-5.8\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly-5.8\var\megalib/Test/Exception.pm:136 # STACK: Test::Exception::lives_ok C:\cpanfly-5.8\var\megalib/Test/Exception.pm:297 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 104 - slice 3 len ok 105 - correct masked seq ok 106 - correct masked seq ok 107 - correct masked seq not ok 108 # TODO This should pass but dies; see bug 2842 # Failed (TODO) test at t/Align/SimpleAlign.t line 421. # died: Bio::Root::Exception ( # ------------- EXCEPTION: Bio::Root::Exception ------------- # MSG: In sequence one residue count gives end value 6. # Overriding value [4] with value 6 for Bio::LocatableSeq::end(). # ?? # STACK: Error::throw # STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 # STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:181 # STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:196 # STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1143 # STACK: try{} block t/Align/SimpleAlign.t:421 # STACK: Sub::Uplevel::uplevel C:\cpanfly-5.8\var\megalib/Sub/Uplevel.pm:150 # STACK: Test::Exception::_try_as_caller C:\cpanfly-5.8\var\megalib/Test/Exception.pm:136 # STACK: Test::Exception::lives_ok C:\cpanfly-5.8\var\megalib/Test/Exception.pm:297 # STACK: t/Align/SimpleAlign.t:421 # ----------------------------------------------------------- # ) ok 109 - slice 4 len ok 110 - correct masked seq ok 111 - correct masked seq ok 112 - correct masked seq ok 113 - initial display id ok ok 114 - safe display id ok ok 115 - restored display id ok ok 116 - sort by list ok ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 - BIC:GGATCCATT[C/C]CTACT ok 124 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT ok 125 - BIC:G[G/C]ATCCATT[C/G]CTACT ok 126 - BIC:GGATCCATT[C/G]CTACT ok 127 - BIC:GGATCCATT[C/G]CTAC[T/A] ok 128 - BIC:GGATCCATT[C/G]CTA[C/G][T/A] ok 129 - BIC:GGATCCATT[C/G]CTACT ok 130 - BIC:GGATCCATT{C.C}CTACT ok 131 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT ok 132 - BIC:G{G.C}ATCCATT{C.G}CTACT ok 133 - BIC:GGATCCATT{C.G}CTACT ok 134 - BIC:GGATCCATT{C.G}CTAC{T.A} ok 135 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A} ok 136 - BIC:GGATCCATT{C.G}CTACT ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 - The object isa Bio::SimpleAlign ok 175 - consensus string looks ok ok 176 - looks like correct unmasked alignment (from clustalw) ok 177 - looks like correct masked alignment (from clustalw) ok 178 ok 179 - align after looks ok ok t/Align/TreeBuild.t .......................... 1..13 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::Align::Utilities; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Tree::DistanceFactory; ok 6 - use Bio::TreeIO; ok 7 - SimpleAlign object parsed out isa Bio::SimpleAlign ok 8 - Protein distance matrix retrieved isa Bio::Matrix::MatrixI ok 9 - Tree object gotten back isa Bio::Tree::TreeI ok 10 - NJ calculated Branch length ok 11 - NJ calculated Branch length ok 12 - Make sure two nodes are sister ok 13 - 10 replicates formulated ok t/Align/Utilities.t .......................... 1..13 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::SimpleAlign; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::AlignIO; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 97, line 86. Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 129, line 86. Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 154, line 86. Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 175, line 86. Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 200, line 86. Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 230, line 86. Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 266, line 86. Subroutine new redefined at Bio\Seq\Meta.pm line 226, line 64. Subroutine meta redefined at Bio\Seq\Meta.pm line 270, line 64. Subroutine meta_text redefined at Bio\Seq\Meta.pm line 285, line 64. Subroutine named_meta redefined at Bio\Seq\Meta.pm line 301, line 64. Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 348, line 64. Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 378, line 64. Subroutine submeta redefined at Bio\Seq\Meta.pm line 410, line 64. Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 426, line 64. Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 445, line 64. Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 504, line 64. Subroutine meta_names redefined at Bio\Seq\Meta.pm line 519, line 64. Subroutine meta_length redefined at Bio\Seq\Meta.pm line 541, line 64. Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 557, line 64. Subroutine force_flush redefined at Bio\Seq\Meta.pm line 578, line 64. Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 605, line 64. Subroutine is_flush redefined at Bio\Seq\Meta.pm line 638, line 64. Subroutine revcom redefined at Bio\Seq\Meta.pm line 680, line 64. Subroutine trunc redefined at Bio\Seq\Meta.pm line 703, line 64. Subroutine to_string redefined at Bio\Seq\Meta.pm line 727, line 64. t/AlignIO/AlignIO.t .......................... 1..28 ok 1 - use Bio::AlignIO; ok 2 - input filehandle method test : metafasta ok 3 - input filehandle method test : po ok 4 - input filehandle method test : nexus ok 5 - input filehandle method test : clustalw ok 6 - input filehandle method test : prodom ok 7 - input filehandle method test : fasta ok 8 - input filehandle method test : arp ok 9 - input filehandle method test : xmfa ok 10 - input filehandle method test : mase ok 11 - input filehandle method test : psi ok 12 - input filehandle method test : phylip ok 13 - input filehandle method test : pfam ok 14 - input filehandle method test : selex ok 15 - input filehandle method test : stockholm ok 16 - input filehandle method test : msf ok 17 - filehandle output test : metafasta ok 18 - filehandle output test : po ok 19 - filehandle output test : nexus ok 20 - filehandle output test : clustalw ok 21 - filehandle output test : fasta ok 22 - filehandle output test : xmfa ok 23 - filehandle output test : psi ok 24 - filehandle output test : phylip ok 25 - filehandle output test : pfam ok 26 - filehandle output test : selex ok 27 - filehandle output test : stockholm ok 28 - filehandle output test : msf ok Subroutine next_aln redefined at Bio\AlignIO\arp.pm line 117. Subroutine write_aln redefined at Bio\AlignIO\arp.pm line 200. Subroutine _process_sequence redefined at Bio\AlignIO\arp.pm line 207. Subroutine _process_annotation redefined at Bio\AlignIO\arp.pm line 218. Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 97, line 86. Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 129, line 86. Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 154, line 86. Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 175, line 86. Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 200, line 86. Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 230, line 86. Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 266, line 86. t/AlignIO/arp.t .............................. 1..48 ok 1 - use Bio::AlignIO::arp; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 - ARP get_nse() ok 5 ok 6 - ARP num_sequences() ok 7 - ARP id() ok 8 - ARP description() ok 9 - The object isa Bio::AnnotationCollectionI ok 10 - The object isa Bio::AnnotationI ok 11 ok 12 ok 13 ok 14 ok 15 - The object isa Bio::AlignIO ok 16 - The object isa Bio::Align::AlignI ok 17 - ARP get_nse() ok 18 - ARP num_sequences() ok 19 - ARP id() ok 20 - ARP description() ok 21 - The object isa Bio::AnnotationCollectionI ok 22 - The object isa Bio::AnnotationI ok 23 ok 24 ok 25 ok 26 ok 27 - The object isa Bio::Align::AlignI ok 28 - ARP get_nse() ok 29 - ARP num_sequences() ok 30 - ARP id() ok 31 - ARP description() ok 32 - The object isa Bio::AnnotationCollectionI ok 33 - The object isa Bio::AnnotationI ok 34 ok 35 ok 36 ok 37 ok 38 - The object isa Bio::Align::AlignI ok 39 - ARP get_nse() ok 40 - ARP num_sequences() ok 41 - ARP id() ok 42 - ARP description() ok 43 - The object isa Bio::AnnotationCollectionI ok 44 - The object isa Bio::AnnotationI ok 45 ok 46 ok 47 ok 48 ok Subroutine _initialize redefined at Bio\AlignIO\bl2seq.pm line 125. Subroutine next_aln redefined at Bio\AlignIO\bl2seq.pm line 143. Subroutine write_aln redefined at Bio\AlignIO\bl2seq.pm line 185. Subroutine report_type redefined at Bio\AlignIO\bl2seq.pm line 201. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 64. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 64. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 64. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 64. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 64. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 64. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 64. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 64. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 64. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 64. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 64. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 64. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 64. t/AlignIO/bl2seq.t ........................... 1..3 ok 1 - use Bio::AlignIO::bl2seq; ok 2 - The object isa Bio::Align::AlignI ok 3 - BLAST bl2seq format test ok Subroutine _initialize redefined at Bio\AlignIO\clustalw.pm line 101. Subroutine next_aln redefined at Bio\AlignIO\clustalw.pm line 122. Subroutine write_aln redefined at Bio\AlignIO\clustalw.pm line 232. Subroutine percentages redefined at Bio\AlignIO\clustalw.pm line 331. Subroutine line_length redefined at Bio\AlignIO\clustalw.pm line 350. t/AlignIO/clustalw.t ......................... 1..6 ok 1 - use Bio::AlignIO::clustalw; ok 2 - The object isa Bio::Align::AlignI ok 3 - clustalw consensus_string test ok 4 - clustalw (.aln) output test ok 5 - The object isa Bio::Align::AlignI ok 6 - clustalw (.aln) input test ok Subroutine _initialize redefined at Bio\AlignIO\emboss.pm line 93. Subroutine next_aln redefined at Bio\AlignIO\emboss.pm line 110. Subroutine write_aln redefined at Bio\AlignIO\emboss.pm line 251. t/AlignIO/emboss.t ........................... 1..37 ok 1 - use Bio::AlignIO::emboss; ok 2 - The object isa Bio::Align::AlignI ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - The object isa Bio::Align::AlignI ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Align::AlignI ok 15 ok 16 ok 17 ok 18 - The object isa Bio::Align::AlignI ok 19 ok 20 ok 21 - The object isa Bio::Align::AlignI ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - The object isa Bio::Align::AlignI ok 33 ok 34 ok 35 ok 36 ok 37 ok Subroutine next_aln redefined at Bio\AlignIO\fasta.pm line 81. Subroutine write_aln redefined at Bio\AlignIO\fasta.pm line 182. Subroutine _get_len redefined at Bio\AlignIO\fasta.pm line 225. Subroutine width redefined at Bio\AlignIO\fasta.pm line 244. t/AlignIO/fasta.t ............................ 1..10 ok 1 - use Bio::AlignIO::fasta; ok 2 - The object isa Bio::Align::AlignI ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for end ok 7 - fasta input test for description ok 8 - fasta output test ok 9 - filehandle input test ok 10 - filehandle output test ok Subroutine _initialize redefined at Bio\AlignIO\largemultifasta.pm line 81. Subroutine next_seq redefined at Bio\AlignIO\largemultifasta.pm line 102. Subroutine next_aln redefined at Bio\AlignIO\largemultifasta.pm line 143. Subroutine write_aln redefined at Bio\AlignIO\largemultifasta.pm line 176. t/AlignIO/largemultifasta.t .................. 1..7 ok 1 - use Bio::AlignIO::largemultifasta; ok 2 - The object isa Bio::Align::AlignI ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for description ok 7 - fasta output test ok Subroutine _initialize redefined at Bio\AlignIO\maf.pm line 103. Subroutine next_aln redefined at Bio\AlignIO\maf.pm line 122. Subroutine write_aln redefined at Bio\AlignIO\maf.pm line 186. t/AlignIO/maf.t .............................. 1..11 ok 1 - use Bio::AlignIO::maf; ok 2 - The object isa Bio::Align::AlignI ok 3 - maf input test ok 4 ok 5 - The object isa Bio::Align::AlignI ok 6 - maf input test ok 7 ok 8 - maf input test ok 9 ok 10 - maf input test ok 11 ok Subroutine next_aln redefined at Bio\AlignIO\mase.pm line 83. Subroutine write_aln redefined at Bio\AlignIO\mase.pm line 158. t/AlignIO/mase.t ............................. 1..3 ok 1 - use Bio::AlignIO::mase; ok 2 - The object isa Bio::Align::AlignI ok 3 - mase input test ok Subroutine next_aln redefined at Bio\AlignIO\mega.pm line 116. Subroutine write_aln redefined at Bio\AlignIO\mega.pm line 189. t/AlignIO/mega.t ............................. 1..6 ok 1 - use Bio::AlignIO::mega; ok 2 - The object isa Bio::Align::AlignI ok 3 ok 4 ok 5 ok 6 - mega output test ok Subroutine next_aln redefined at Bio\AlignIO\meme.pm line 105. Subroutine write_aln redefined at Bio\AlignIO\meme.pm line 197. Subroutine _initialize redefined at Bio\AlignIO\meme.pm line 206. t/AlignIO/meme.t ............................. 1..14 ok 1 - use Bio::AlignIO::meme; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 ok 6 ok 7 ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine _initialize redefined at Bio\AlignIO\metafasta.pm line 90. Subroutine next_aln redefined at Bio\AlignIO\metafasta.pm line 108. Subroutine write_aln redefined at Bio\AlignIO\metafasta.pm line 181. Subroutine width redefined at Bio\AlignIO\metafasta.pm line 225. t/AlignIO/metafasta.t ........................ 1..4 ok 1 - use Bio::AlignIO::metafasta; ok 2 - The object isa Bio::Align::AlignI ok 3 - consensus_string on metafasta ok 4 - symbol_chars() using metafasta ok Subroutine next_aln redefined at Bio\AlignIO\msf.pm line 91. Subroutine write_aln redefined at Bio\AlignIO\msf.pm line 173. t/AlignIO/msf.t .............................. 1..4 ok 1 - use Bio::AlignIO::msf; ok 2 - The object isa Bio::Align::AlignI ok 3 - msf input test ok 4 - msf output test ok Subroutine _initialize redefined at Bio\AlignIO\nexus.pm line 104. Subroutine next_aln redefined at Bio\AlignIO\nexus.pm line 143. Subroutine _read_taxlabels redefined at Bio\AlignIO\nexus.pm line 344. Subroutine write_aln redefined at Bio\AlignIO\nexus.pm line 372. Subroutine flag redefined at Bio\AlignIO\nexus.pm line 468. t/AlignIO/nexus.t ............................ 1..43 ok 1 - use Bio::AlignIO::nexus; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - nexus output test ok 6 - The object isa Bio::AlignIO ok 7 - The object isa Bio::Align::AlignI ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 - The object isa Bio::AlignIO ok 11 - The object isa Bio::Align::AlignI ok 12 - The object isa Bio::AlignIO ok 13 - The object isa Bio::Align::AlignI ok 14 - The object isa Bio::AlignIO ok 15 - The object isa Bio::Align::AlignI ok 16 - The object isa Bio::AlignIO ok 17 - The object isa Bio::Align::AlignI ok 18 - The object isa Bio::AlignIO ok 19 - The object isa Bio::Align::AlignI ok 20 - The object isa Bio::AlignIO ok 21 - The object isa Bio::Align::AlignI ok 22 - The object isa Bio::AlignIO ok 23 - The object isa Bio::Align::AlignI ok 24 - The object isa Bio::AlignIO ok 25 - The object isa Bio::Align::AlignI ok 26 - The object isa Bio::AlignIO ok 27 - The object isa Bio::Align::AlignI ok 28 - The object isa Bio::AlignIO ok 29 - The object isa Bio::Align::AlignI ok 30 - The object isa Bio::AlignIO ok 31 - The object isa Bio::Align::AlignI ok 32 - The object isa Bio::AlignIO ok 33 - The object isa Bio::Align::AlignI ok 34 - The object isa Bio::AlignIO ok 35 - The object isa Bio::Align::AlignI ok 36 - The object isa Bio::AlignIO ok 37 - The object isa Bio::Align::AlignI ok 38 - The object isa Bio::AlignIO ok 39 - The object isa Bio::Align::AlignI ok 40 - The object isa Bio::AlignIO ok 41 - The object isa Bio::Align::AlignI ok 42 - The object isa Bio::AlignIO ok 43 - The object isa Bio::Align::AlignI ok Subroutine next_aln redefined at Bio\AlignIO\pfam.pm line 82. Subroutine write_aln redefined at Bio\AlignIO\pfam.pm line 140. t/AlignIO/pfam.t ............................. 1..5 ok 1 - use Bio::AlignIO::pfam; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - pfam output test ok Subroutine _initialize redefined at Bio\AlignIO\phylip.pm line 135. Subroutine next_aln redefined at Bio\AlignIO\phylip.pm line 172. Subroutine write_aln redefined at Bio\AlignIO\phylip.pm line 312. Subroutine interleaved redefined at Bio\AlignIO\phylip.pm line 432. Subroutine flag_SI redefined at Bio\AlignIO\phylip.pm line 455. Subroutine idlength redefined at Bio\AlignIO\phylip.pm line 475. Subroutine line_length redefined at Bio\AlignIO\phylip.pm line 494. Subroutine tag_length redefined at Bio\AlignIO\phylip.pm line 515. Subroutine id_linebreak redefined at Bio\AlignIO\phylip.pm line 535. Subroutine wrap_sequential redefined at Bio\AlignIO\phylip.pm line 555. Subroutine longid redefined at Bio\AlignIO\phylip.pm line 574. t/AlignIO/phylip.t ........................... 1..11 ok 1 - use Bio::AlignIO::phylip; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - phylip output test ok 6 - The object isa Bio::Align::AlignI ok 7 ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 ok 11 ok Subroutine next_aln redefined at Bio\AlignIO\po.pm line 83. Subroutine write_aln redefined at Bio\AlignIO\po.pm line 226. t/AlignIO/po.t ............................... 1..11 ok 1 - use Bio::AlignIO::po; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 - The object isa Bio::AlignIO ok 6 - The object isa Bio::Align::AlignI ok 7 - po output test ok 8 - The object isa Bio::AlignIO ok 9 - The object isa Bio::Align::AlignI ok 10 ok 11 ok Subroutine next_aln redefined at Bio\AlignIO\prodom.pm line 82. Subroutine write_aln redefined at Bio\AlignIO\prodom.pm line 134. t/AlignIO/prodom.t ........................... 1..3 ok 1 - use Bio::AlignIO::prodom; ok 2 - The object isa Bio::Align::AlignI ok 3 - prodom input test ok Subroutine next_aln redefined at Bio\AlignIO\psi.pm line 108. Subroutine write_aln redefined at Bio\AlignIO\psi.pm line 147. t/AlignIO/psi.t .............................. 1..5 ok 1 - use Bio::AlignIO::psi; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 ok Subroutine next_aln redefined at Bio\AlignIO\selex.pm line 96. Subroutine write_aln redefined at Bio\AlignIO\selex.pm line 162. t/AlignIO/selex.t ............................ 1..4 ok 1 - use Bio::AlignIO::selex; ok 2 - The object isa Bio::Align::AlignI ok 3 - selex format test ok 4 - selex output test ok Subroutine _initialize redefined at Bio\AlignIO\stockholm.pm line 355. Subroutine next_aln redefined at Bio\AlignIO\stockholm.pm line 380. Subroutine write_aln redefined at Bio\AlignIO\stockholm.pm line 515. Subroutine line_length redefined at Bio\AlignIO\stockholm.pm line 660. Subroutine alphabet redefined at Bio\AlignIO\stockholm.pm line 678. Subroutine spaces redefined at Bio\AlignIO\stockholm.pm line 698. Subroutine alignhandler redefined at Bio\AlignIO\stockholm.pm line 714. Subroutine _print_seqs redefined at Bio\AlignIO\stockholm.pm line 726. Subroutine new redefined at Bio\Seq\Meta.pm line 226, line 64. Subroutine meta redefined at Bio\Seq\Meta.pm line 270, line 64. Subroutine meta_text redefined at Bio\Seq\Meta.pm line 285, line 64. Subroutine named_meta redefined at Bio\Seq\Meta.pm line 301, line 64. Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 348, line 64. Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 378, line 64. Subroutine submeta redefined at Bio\Seq\Meta.pm line 410, line 64. Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 426, line 64. Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 445, line 64. Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 504, line 64. Subroutine meta_names redefined at Bio\Seq\Meta.pm line 519, line 64. Subroutine meta_length redefined at Bio\Seq\Meta.pm line 541, line 64. Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 557, line 64. Subroutine force_flush redefined at Bio\Seq\Meta.pm line 578, line 64. Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 605, line 64. Subroutine is_flush redefined at Bio\Seq\Meta.pm line 638, line 64. Subroutine revcom redefined at Bio\Seq\Meta.pm line 680, line 64. Subroutine trunc redefined at Bio\Seq\Meta.pm line 703, line 64. Subroutine to_string redefined at Bio\Seq\Meta.pm line 727, line 64. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 196. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 196. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 196. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 196. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 196. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 196. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 196. t/AlignIO/stockholm.t ........................ 1..83 ok 1 - use Bio::AlignIO::stockholm; ok 2 - The object isa Bio::AlignIO ok 3 - The object isa Bio::Align::AlignI ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - The object isa Bio::Annotation::Comment ok 10 - Stockholm annotation ok 11 - Stockholm annotation ok 12 - stockholm output test ok 13 - The object isa Bio::Align::AlignI ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 - Stockholm annotation isa Bio::Annotation::Reference ok 21 - Stockholm annotation ok 22 - Stockholm annotation ok 23 - Stockholm annotation ok 24 - Stockholm annotation ok 25 - The object isa Bio::Seq::MetaI ok 26 - Rfam meta data ok 27 - Rfam meta data ok 28 ok 29 - The object isa Bio::Align::AlignI ok 30 ok 31 ok 32 ok 33 ok 34 - The object isa Bio::Seq::MetaI ok 35 - Rfam meta data ok 36 - Rfam meta data ok 37 - The object isa Bio::AlignIO ok 38 ok 39 - The object isa Bio::Align::AlignI ok 40 ok 41 ok 42 ok 43 ok 44 - The object isa Bio::Annotation::SimpleValue ok 45 - Pfam annotation ok 46 ok 47 - The object isa Bio::Align::AlignI ok 48 ok 49 ok 50 ok 51 ok 52 - The object isa Bio::Align::AlignI ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 - The object isa Bio::Seq::MetaI ok 59 - Pfam aln meta data ok 60 - Pfam aln meta data ok 61 - Pfam aln meta data ok 62 - Pfam aln meta data ok 63 - Pfam aln meta data ok 64 - Pfam aln meta data ok 65 - Pfam seq meta data ok 66 - Pfam seq meta data ok 67 - Pfam seq meta data ok 68 - Pfam seq meta data ok 69 ok 70 - The object isa Bio::SeqFeatureI ok 71 - The object isa Bio::Seq::Meta ok 72 - The object isa Bio::AnnotationI ok 73 - The object isa Bio::Annotation::DBLink ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok Subroutine next_aln redefined at Bio\AlignIO\xmfa.pm line 88. Subroutine write_aln redefined at Bio\AlignIO\xmfa.pm line 142. Subroutine _get_len redefined at Bio\AlignIO\xmfa.pm line 195. Subroutine width redefined at Bio\AlignIO\xmfa.pm line 213. Subroutine _process_seq redefined at Bio\AlignIO\xmfa.pm line 222. t/AlignIO/xmfa.t ............................. 1..16 ok 1 - use Bio::AlignIO::xmfa; ok 2 - The object isa Bio::Align::AlignI ok 3 - xmfa input test ok 4 - xmfa input test for description ok 5 - xmfa input test for id ok 6 - xmfa input test for end ok 7 - xmfa input test for end ok 8 - xmfa alignment score ok 9 - The object isa Bio::Align::AlignI ok 10 - xmfa input test ok 11 - xmfa input test for description ok 12 - xmfa input test for id ok 13 - xmfa input test for end ok 14 - xmfa input test for end ok 15 - xmfa alignment score ok 16 - xmfa output test ok t/Alphabet.t ................................. 1..100 ok 1 - use Bio::Symbol::Alphabet; ok 2 - use Bio::Symbol::Symbol; ok 3 - use Bio::Symbol::DNAAlphabet; ok 4 - use Bio::Symbol::ProteinAlphabet; ok 5 - The object isa Bio::Symbol::Alphabet ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - The object isa Bio::Symbol::AlphabetI ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - The object isa Bio::Symbol::AlphabetI ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok Subroutine new redefined at Bio\Annotation\SimpleValue.pm line 97. Subroutine as_text redefined at Bio\Annotation\SimpleValue.pm line 129. Subroutine display_text redefined at Bio\Annotation\SimpleValue.pm line 154. Subroutine hash_tree redefined at Bio\Annotation\SimpleValue.pm line 175. Subroutine tagname redefined at Bio\Annotation\SimpleValue.pm line 200. Subroutine value redefined at Bio\Annotation\SimpleValue.pm line 230. Subroutine tag_term redefined at Bio\Annotation\SimpleValue.pm line 266. Subroutine new redefined at Bio\Annotation\OntologyTerm.pm line 129. Subroutine as_text redefined at Bio\Annotation\OntologyTerm.pm line 173. Subroutine display_text redefined at Bio\Annotation\OntologyTerm.pm line 198. Subroutine hash_tree redefined at Bio\Annotation\OntologyTerm.pm line 219. Subroutine tagname redefined at Bio\Annotation\OntologyTerm.pm line 247. Subroutine term redefined at Bio\Annotation\OntologyTerm.pm line 275. Subroutine identifier redefined at Bio\Annotation\OntologyTerm.pm line 298. Subroutine name redefined at Bio\Annotation\OntologyTerm.pm line 314. Subroutine definition redefined at Bio\Annotation\OntologyTerm.pm line 331. Subroutine ontology redefined at Bio\Annotation\OntologyTerm.pm line 349. Subroutine is_obsolete redefined at Bio\Annotation\OntologyTerm.pm line 365. Subroutine comment redefined at Bio\Annotation\OntologyTerm.pm line 381. Subroutine get_synonyms redefined at Bio\Annotation\OntologyTerm.pm line 395. Subroutine add_synonym redefined at Bio\Annotation\OntologyTerm.pm line 411. Subroutine remove_synonyms redefined at Bio\Annotation\OntologyTerm.pm line 426. Subroutine get_dblinks redefined at Bio\Annotation\OntologyTerm.pm line 442. Subroutine get_dbxrefs redefined at Bio\Annotation\OntologyTerm.pm line 458. Subroutine add_dblink redefined at Bio\Annotation\OntologyTerm.pm line 478. Subroutine add_dbxref redefined at Bio\Annotation\OntologyTerm.pm line 497. Subroutine remove_dblinks redefined at Bio\Annotation\OntologyTerm.pm line 513. Subroutine remove_dbxrefs redefined at Bio\Annotation\OntologyTerm.pm line 529. Subroutine get_secondary_ids redefined at Bio\Annotation\OntologyTerm.pm line 547. Subroutine add_secondary_id redefined at Bio\Annotation\OntologyTerm.pm line 564. Subroutine remove_secondary_ids redefined at Bio\Annotation\OntologyTerm.pm line 579. Subroutine new redefined at Bio\Annotation\Comment.pm line 65. Subroutine as_text redefined at Bio\Annotation\Comment.pm line 93. Subroutine display_text redefined at Bio\Annotation\Comment.pm line 118. Subroutine hash_tree redefined at Bio\Annotation\Comment.pm line 139. Subroutine tagname redefined at Bio\Annotation\Comment.pm line 167. Subroutine text redefined at Bio\Annotation\Comment.pm line 194. Subroutine type redefined at Bio\Annotation\Comment.pm line 232. Subroutine Bio::Annotation::Comment::value redefined at Bio\Annotation\Comment.pm line 216. Subroutine new redefined at Bio\Annotation\Target.pm line 68. Subroutine as_text redefined at Bio\Annotation\Target.pm line 105. Subroutine display_text redefined at Bio\Annotation\Target.pm line 135. Subroutine tagname redefined at Bio\Annotation\Target.pm line 164. Subroutine target_id redefined at Bio\Annotation\Target.pm line 199. Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. Subroutine new redefined at Bio\Annotation\Tree.pm line 73. Subroutine as_text redefined at Bio\Annotation\Tree.pm line 114. Subroutine display_text redefined at Bio\Annotation\Tree.pm line 141. Subroutine hash_tree redefined at Bio\Annotation\Tree.pm line 161. Subroutine tagname redefined at Bio\Annotation\Tree.pm line 185. Subroutine tree_id redefined at Bio\Annotation\Tree.pm line 206. Subroutine tree redefined at Bio\Annotation\Tree.pm line 223. Subroutine new redefined at Bio\Annotation\TagTree.pm line 139. Subroutine as_text redefined at Bio\Annotation\TagTree.pm line 178. Subroutine display_text redefined at Bio\Annotation\TagTree.pm line 202. Subroutine hash_tree redefined at Bio\Annotation\TagTree.pm line 223. Subroutine tagname redefined at Bio\Annotation\TagTree.pm line 243. Subroutine value redefined at Bio\Annotation\TagTree.pm line 265. Subroutine tagformat redefined at Bio\Annotation\TagTree.pm line 313. Subroutine node redefined at Bio\Annotation\TagTree.pm line 336. Subroutine element redefined at Bio\Annotation\TagTree.pm line 378. Subroutine data redefined at Bio\Annotation\TagTree.pm line 394. Subroutine children redefined at Bio\Annotation\TagTree.pm line 418. Subroutine subnodes redefined at Bio\Annotation\TagTree.pm line 436. Subroutine get redefined at Bio\Annotation\TagTree.pm line 453. Subroutine find redefined at Bio\Annotation\TagTree.pm line 470. Subroutine findnode redefined at Bio\Annotation\TagTree.pm line 487. Subroutine findval redefined at Bio\Annotation\TagTree.pm line 503. Subroutine addchild redefined at Bio\Annotation\TagTree.pm line 526. Subroutine add redefined at Bio\Annotation\TagTree.pm line 561. Subroutine set redefined at Bio\Annotation\TagTree.pm line 583. Subroutine unset redefined at Bio\Annotation\TagTree.pm line 604. Subroutine free redefined at Bio\Annotation\TagTree.pm line 619. Subroutine hash redefined at Bio\Annotation\TagTree.pm line 635. Subroutine pairs redefined at Bio\Annotation\TagTree.pm line 652. Subroutine qmatch redefined at Bio\Annotation\TagTree.pm line 668. Subroutine tnodes redefined at Bio\Annotation\TagTree.pm line 683. Subroutine ntnodes redefined at Bio\Annotation\TagTree.pm line 698. Subroutine get_all_values redefined at Bio\Annotation\TagTree.pm line 721. t/Annotation/Annotation.t .................... 1..158 ok 1 - use Bio::Annotation::Collection; ok 2 - use Bio::Annotation::DBLink; ok 3 - use Bio::Annotation::Comment; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Target; ok 7 - use Bio::Annotation::AnnotationFactory; ok 8 - use Bio::Annotation::StructuredValue; ok 9 - use Bio::Annotation::TagTree; ok 10 - use Bio::Annotation::Tree; ok 11 - use Bio::Seq; ok 12 - use Bio::SimpleAlign; ok 13 - use Bio::Cluster::UniGene; ok 14 - The object isa Bio::AnnotationI ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - The object isa Bio::AnnotationI ok 22 ok 23 ok 24 ok 25 - The object isa Bio::AnnotationCollectionI ok 26 ok 27 ok 28 - The object isa Bio::AnnotationI ok 29 ok 30 - The object isa Bio::AnnotationI ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - The object isa Bio::AnnotationI ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 - The object isa Bio::AnnotationCollectionI ok 69 ok 70 ok 71 ok 72 ok 73 - The object isa Bio::Annotation::StructuredValue ok 74 ok 75 ok 76 ok 77 ok 78 - use Bio::Annotation::OntologyTerm; ok 79 - The object isa Bio::Ontology::Term ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 - The object isa Bio::AnnotatableI ok 86 - isa SeqFeatureI isa Bio::SeqFeatureI ok 87 - isa AnnotatableI isa Bio::AnnotatableI ok 88 - isa SeqFeatureI isa Bio::SeqFeatureI ok 89 - isa AnnotatableI isa Bio::AnnotatableI ok 90 - The object isa Bio::AnnotatableI ok 91 - The object isa Bio::AnnotatableI ok 92 - The object isa Bio::Factory::ObjectFactoryI ok 93 - The object isa Bio::Annotation::SimpleValue ok 94 ok 95 - The object isa Bio::Annotation::OntologyTerm ok 96 - Bio::Annotation::Comment ok 97 - The object isa Bio::Annotation::Comment ok 98 ok 99 - Bio::Annotation::Comment ok 100 - The object isa Bio::Annotation::Comment ok 101 - Bio::Annotation::Comment ok 102 - The object isa Bio::Annotation::Comment ok 103 ok 104 - The object isa Bio::Annotation::Target ok 105 ok 106 ok 107 - The object isa Bio::AnnotationI ok 108 - tree_id() ok 109 - tagname() ok 110 - The object isa Bio::AnnotatableI ok 111 - add tree to AlignI ok 112 - get seq from node id ok 113 ok 114 - The object isa Bio::Annotation::Tree ok 115 - The object isa Bio::AnnotationI ok 116 - default itext ok 117 - roundtrip ok 118 - itext ok 119 - spxr ok 120 - indent ok 121 - xml ok 122 - The object isa Data::Stag::StagI ok 123 ok 124 - child changes ok 125 - The object isa Data::Stag::StagI ok 126 ok 127 - child changes ok 128 - The object isa Data::Stag::StagI ok 129 ok 130 - child changes ok 131 - child changes in parent node ok 132 - no tags ok 133 - before Stag node ok 134 - after Stag node ok 135 - both stag nodes ok 136 - different instances ok 137 - before TagTree ok 138 - after TagTree ok 139 - both stag nodes ok 140 - different instances ok 141 - before TagTree ok 142 - after TagTree ok 143 - stag nodes ok 144 - same instance ok 145 - before TagTree ok 146 - after TagTree ok 147 - stag nodes ok 148 - different instance ok 149 - The object isa Bio::AnnotationI ok 150 - The object isa Data::Stag::StagI ok 151 - child changes ok 152 - The object isa Data::Stag::StagI ok 153 - child changes ok 154 - The object isa Data::Stag::StagI ok 155 - child changes ok 156 ok 157 ok 158 - The object isa Bio::Annotation::TagTree ok t/Annotation/AnnotationAdaptor.t ............. 1..23 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::AnnotationAdaptor; ok 3 - use Bio::Annotation::DBLink; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Assembly/Assembly.t ........................ skipped: The optional module DB_File (or dependencies thereof) was not installed Bio::Assembly::IO: could not load tigr - for more details on supported formats please see the Assembly::IO docs Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::Assembly::IO::tigr. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio/SeqFeature/Collection.pm line 147. BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 147. Compilation failed in require at Bio/Assembly/Contig.pm line 223. BEGIN failed--compilation aborted at Bio/Assembly/Contig.pm line 223. Compilation failed in require at Bio\Assembly\IO\tigr.pm line 236. BEGIN failed--compilation aborted at Bio\Assembly\IO\tigr.pm line 236. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:192 STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:133 STACK: t/Assembly/ContigSpectrum.t:11 ----------------------------------------------------------- # Failed test 'The thing isa Bio::Assembly::IO' # at t/Assembly/ContigSpectrum.t line 15. # The thing isn't defined Can't call method "next_assembly" on an undefined value at t/Assembly/ContigSpectrum.t line 16. # Looks like you planned 134 tests but ran 3. # Looks like you failed 1 test of 3 run. # Looks like your test exited with 2 just after 3. t/Assembly/ContigSpectrum.t .................. 1..134 ok 1 - use Bio::Assembly::IO; ok 2 - use Bio::Assembly::Tools::ContigSpectrum; not ok 3 - The thing isa Bio::Assembly::IO Dubious, test returned 2 (wstat 512, 0x200) Failed 132/134 subtests t/Biblio/Biblio.t ............................ 1..24 ok 1 - use Bio::Biblio; ok 2 - use Bio::Biblio::IO; ok 3 ok 4 ok 5 - citation 1 ok 6 - citation 2 ok 7 - citation 3 ok 8 - in callback ok 9 - in callback ok 10 - in callback ok 11 - calling callback ok 12 - citation 1 ok 13 - citation 2 ok 14 - citation 1 ok 15 - citation 2 ok 16 ok 17 - citation 1 ok 18 - citation 2 ok 19 - citation 3 ok 20 - citation 4 ok 21 - filehandle test ok 22 - filehandle test ok 23 - filehandle test ok 24 - filehandle test ok t/Biblio/References.t ........................ 1..537 ok 1 - use Bio::Biblio::Article; ok 2 - use Bio::Biblio::Book; ok 3 - use Bio::Biblio::BookArticle; ok 4 - use Bio::Biblio::Journal; ok 5 - use Bio::Biblio::JournalArticle; ok 6 - use Bio::Biblio::MedlineArticle; ok 7 - use Bio::Biblio::MedlineBook; ok 8 - use Bio::Biblio::MedlineBookArticle; ok 9 - use Bio::Biblio::MedlineJournal; ok 10 - use Bio::Biblio::MedlineJournalArticle; ok 11 - use Bio::Biblio::Organisation; ok 12 - use Bio::Biblio::Patent; ok 13 - use Bio::Biblio::Person; ok 14 - use Bio::Biblio::Proceeding; ok 15 - use Bio::Biblio::Provider; ok 16 - use Bio::Biblio::Ref; ok 17 - use Bio::Biblio::Service; ok 18 - use Bio::Biblio::TechReport; ok 19 - use Bio::Biblio::Thesis; ok 20 - use Bio::Biblio::WebResource; ok 21 - use Bio::Biblio::PubmedArticle; ok 22 - use Bio::Biblio::PubmedBookArticle; ok 23 - use Bio::Biblio::PubmedJournalArticle; ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 - set 'abstract' ok 48 - get 'abstract' ok 49 - set 'abstract_language' ok 50 - get 'abstract_language' ok 51 - set 'abstract_type' ok 52 - get 'abstract_type' ok 53 - set 'author_list_complete' ok 54 - get 'author_list_complete' ok 55 - set 'cross_references_list_complete' ok 56 - get 'cross_references_list_complete' ok 57 - set 'date' ok 58 - get 'date' ok 59 - set 'date_completed' ok 60 - get 'date_completed' ok 61 - set 'date_created' ok 62 - get 'date_created' ok 63 - set 'date_revised' ok 64 - get 'date_revised' ok 65 - set 'format' ok 66 - get 'format' ok 67 - set 'identifier' ok 68 - get 'identifier' ok 69 - set 'language' ok 70 - get 'language' ok 71 - set 'last_modified_date' ok 72 - get 'last_modified_date' ok 73 - set 'repository_subset' ok 74 - get 'repository_subset' ok 75 - set 'rights' ok 76 - get 'rights' ok 77 - set 'spatial_location' ok 78 - get 'spatial_location' ok 79 - set 'subject_headings_source' ok 80 - get 'subject_headings_source' ok 81 - set 'temporal_period' ok 82 - get 'temporal_period' ok 83 - set 'title' ok 84 - get 'title' ok 85 - set 'toc' ok 86 - get 'toc' ok 87 - set 'toc_type' ok 88 - get 'toc_type' ok 89 - set 'type' ok 90 - get 'type' ok 91 - set 'first_page' ok 92 - get 'first_page' ok 93 - set 'last_page' ok 94 - get 'last_page' ok 95 - set 'issue' ok 96 - get 'issue' ok 97 - set 'issue_supplement' ok 98 - get 'issue_supplement' ok 99 - set 'volume' ok 100 - get 'volume' ok 101 - set 'affiliation' ok 102 - get 'affiliation' ok 103 - set 'citation_owner' ok 104 - get 'citation_owner' ok 105 - set 'date_of_electronic_publication' ok 106 - get 'date_of_electronic_publication' ok 107 - set 'gene_symbols' ok 108 - get 'gene_symbols' ok 109 - set 'grant_list_complete' ok 110 - get 'grant_list_complete' ok 111 - set 'medline_date' ok 112 - get 'medline_date' ok 113 - set 'medline_id' ok 114 - get 'medline_id' ok 115 - set 'medline_page' ok 116 - get 'medline_page' ok 117 - set 'number_of_references' ok 118 - get 'number_of_references' ok 119 - set 'other_languages' ok 120 - get 'other_languages' ok 121 - set 'pmid' ok 122 - get 'pmid' ok 123 - set 'season' ok 124 - get 'season' ok 125 - set 'status' ok 126 - get 'status' ok 127 - set 'vernacular_title' ok 128 - get 'vernacular_title' ok 129 ok 130 - abstract ok 131 - abstract_language ok 132 - abstract_type ok 133 - author_list_complete ok 134 - cross_references_list_complete ok 135 - date ok 136 - date_completed ok 137 - date_created ok 138 - date_revised ok 139 - format ok 140 - identifier ok 141 - language ok 142 - last_modified_date ok 143 - repository_subset ok 144 - rights ok 145 - spatial_location ok 146 - subject_headings_source ok 147 - temporal_period ok 148 - title ok 149 - toc ok 150 - toc_type ok 151 - type ok 152 - first_page ok 153 - last_page ok 154 - issue ok 155 - issue_supplement ok 156 - volume ok 157 - affiliation ok 158 - citation_owner ok 159 - date_of_electronic_publication ok 160 - gene_symbols ok 161 - grant_list_complete ok 162 - medline_date ok 163 - medline_id ok 164 - medline_page ok 165 - number_of_references ok 166 - other_languages ok 167 - pmid ok 168 - season ok 169 - status ok 170 - vernacular_title ok 171 - get 'authors' ok 172 - get 'cross_references' ok 173 - get 'codes' ok 174 - get 'contributors' ok 175 - get 'keywords' ok 176 - get 'publisher' ok 177 - get 'subject_headings' ok 178 - get 'journal' ok 179 - get 'chemicals' ok 180 - get 'comment_ins' ok 181 - get 'comment_ons' ok 182 - get 'erratum_fors' ok 183 - get 'erratum_ins' ok 184 - get 'general_notes' ok 185 - get 'grants' ok 186 - get 'mesh_headings' ok 187 - get 'original_report_ins' ok 188 - get 'other_abstracts' ok 189 - get 'other_ids' ok 190 - get 'republished_froms' ok 191 - get 'republished_ins' ok 192 - get 'retraction_ins' ok 193 - get 'retraction_ofs' ok 194 - get 'summary_for_patients_ins' ok 195 - get 'update_ins' ok 196 - get 'update_ofs' ok 197 - get 'journal' ok 198 - add_author 1 ok 199 - add_author 2 ok 200 - get authors ok 201 - add_contributor 1 ok 202 - add_contributor 2 ok 203 - get contributors ok 204 - add_cross_reference 1 ok 205 - add_cross_reference 2 ok 206 - get cross_references ok 207 - get cross_references ok 208 - set 'abstract' ok 209 - get 'abstract' ok 210 - set 'abstract_language' ok 211 - get 'abstract_language' ok 212 - set 'abstract_type' ok 213 - get 'abstract_type' ok 214 - set 'author_list_complete' ok 215 - get 'author_list_complete' ok 216 - set 'cross_references_list_complete' ok 217 - get 'cross_references_list_complete' ok 218 - set 'date' ok 219 - get 'date' ok 220 - set 'date_completed' ok 221 - get 'date_completed' ok 222 - set 'date_created' ok 223 - get 'date_created' ok 224 - set 'date_revised' ok 225 - get 'date_revised' ok 226 - set 'format' ok 227 - get 'format' ok 228 - set 'identifier' ok 229 - get 'identifier' ok 230 - set 'language' ok 231 - get 'language' ok 232 - set 'last_modified_date' ok 233 - get 'last_modified_date' ok 234 - set 'repository_subset' ok 235 - get 'repository_subset' ok 236 - set 'rights' ok 237 - get 'rights' ok 238 - set 'spatial_location' ok 239 - get 'spatial_location' ok 240 - set 'subject_headings_source' ok 241 - get 'subject_headings_source' ok 242 - set 'temporal_period' ok 243 - get 'temporal_period' ok 244 - set 'title' ok 245 - get 'title' ok 246 - set 'toc' ok 247 - get 'toc' ok 248 - set 'toc_type' ok 249 - get 'toc_type' ok 250 - set 'type' ok 251 - get 'type' ok 252 - set 'first_page' ok 253 - get 'first_page' ok 254 - set 'last_page' ok 255 - get 'last_page' ok 256 - set 'affiliation' ok 257 - get 'affiliation' ok 258 - set 'citation_owner' ok 259 - get 'citation_owner' ok 260 - set 'date_of_electronic_publication' ok 261 - get 'date_of_electronic_publication' ok 262 - set 'gene_symbols' ok 263 - get 'gene_symbols' ok 264 - set 'grant_list_complete' ok 265 - get 'grant_list_complete' ok 266 - set 'medline_date' ok 267 - get 'medline_date' ok 268 - set 'medline_id' ok 269 - get 'medline_id' ok 270 - set 'medline_page' ok 271 - get 'medline_page' ok 272 - set 'number_of_references' ok 273 - get 'number_of_references' ok 274 - set 'other_languages' ok 275 - get 'other_languages' ok 276 - set 'pmid' ok 277 - get 'pmid' ok 278 - set 'season' ok 279 - get 'season' ok 280 - set 'status' ok 281 - get 'status' ok 282 - set 'vernacular_title' ok 283 - get 'vernacular_title' ok 284 ok 285 - abstract ok 286 - abstract_language ok 287 - abstract_type ok 288 - author_list_complete ok 289 - cross_references_list_complete ok 290 - date ok 291 - date_completed ok 292 - date_created ok 293 - date_revised ok 294 - format ok 295 - identifier ok 296 - language ok 297 - last_modified_date ok 298 - repository_subset ok 299 - rights ok 300 - spatial_location ok 301 - subject_headings_source ok 302 - temporal_period ok 303 - title ok 304 - toc ok 305 - toc_type ok 306 - type ok 307 - first_page ok 308 - last_page ok 309 - affiliation ok 310 - citation_owner ok 311 - date_of_electronic_publication ok 312 - gene_symbols ok 313 - grant_list_complete ok 314 - medline_date ok 315 - medline_id ok 316 - medline_page ok 317 - number_of_references ok 318 - other_languages ok 319 - pmid ok 320 - season ok 321 - status ok 322 - vernacular_title ok 323 - get 'authors' ok 324 - get 'cross_references' ok 325 - get 'codes' ok 326 - get 'contributors' ok 327 - get 'keywords' ok 328 - get 'publisher' ok 329 - get 'subject_headings' ok 330 - get 'book' ok 331 - get 'chemicals' ok 332 - get 'comment_ins' ok 333 - get 'comment_ons' ok 334 - get 'erratum_fors' ok 335 - get 'erratum_ins' ok 336 - get 'general_notes' ok 337 - get 'grants' ok 338 - get 'mesh_headings' ok 339 - get 'original_report_ins' ok 340 - get 'other_abstracts' ok 341 - get 'other_ids' ok 342 - get 'republished_froms' ok 343 - get 'republished_ins' ok 344 - get 'retraction_ins' ok 345 - get 'retraction_ofs' ok 346 - get 'summary_for_patients_ins' ok 347 - get 'update_ins' ok 348 - get 'update_ofs' ok 349 - get 'book' ok 350 - set 'abstract' ok 351 - get 'abstract' ok 352 - set 'abstract_language' ok 353 - get 'abstract_language' ok 354 - set 'abstract_type' ok 355 - get 'abstract_type' ok 356 - set 'author_list_complete' ok 357 - get 'author_list_complete' ok 358 - set 'cross_references_list_complete' ok 359 - get 'cross_references_list_complete' ok 360 - set 'date' ok 361 - get 'date' ok 362 - set 'date_completed' ok 363 - get 'date_completed' ok 364 - set 'date_created' ok 365 - get 'date_created' ok 366 - set 'date_revised' ok 367 - get 'date_revised' ok 368 - set 'format' ok 369 - get 'format' ok 370 - set 'identifier' ok 371 - get 'identifier' ok 372 - set 'language' ok 373 - get 'language' ok 374 - set 'last_modified_date' ok 375 - get 'last_modified_date' ok 376 - set 'repository_subset' ok 377 - get 'repository_subset' ok 378 - set 'rights' ok 379 - get 'rights' ok 380 - set 'spatial_location' ok 381 - get 'spatial_location' ok 382 - set 'subject_headings_source' ok 383 - get 'subject_headings_source' ok 384 - set 'temporal_period' ok 385 - get 'temporal_period' ok 386 - set 'title' ok 387 - get 'title' ok 388 - set 'toc' ok 389 - get 'toc' ok 390 - set 'toc_type' ok 391 - get 'toc_type' ok 392 - set 'type' ok 393 - get 'type' ok 394 - set 'edition' ok 395 - get 'edition' ok 396 - set 'isbn' ok 397 - get 'isbn' ok 398 - set 'series' ok 399 - get 'series' ok 400 - set 'volume' ok 401 - get 'volume' ok 402 ok 403 - abstract ok 404 - abstract_language ok 405 - abstract_type ok 406 - author_list_complete ok 407 - cross_references_list_complete ok 408 - date ok 409 - date_completed ok 410 - date_created ok 411 - date_revised ok 412 - format ok 413 - identifier ok 414 - language ok 415 - last_modified_date ok 416 - repository_subset ok 417 - rights ok 418 - spatial_location ok 419 - subject_headings_source ok 420 - temporal_period ok 421 - title ok 422 - toc ok 423 - toc_type ok 424 - type ok 425 - edition ok 426 - isbn ok 427 - series ok 428 - volume ok 429 - get 'authors' ok 430 - get 'cross_references' ok 431 - get 'codes' ok 432 - get 'contributors' ok 433 - get 'keywords' ok 434 - get 'publisher' ok 435 - get 'subject_headings' ok 436 - get 'editor' ok 437 - set 'abbreviation' ok 438 - get 'abbreviation' ok 439 - set 'issn' ok 440 - get 'issn' ok 441 - set 'name' ok 442 - get 'name' ok 443 - set 'coden' ok 444 - get 'coden' ok 445 - set 'country' ok 446 - get 'country' ok 447 - set 'medline_code' ok 448 - get 'medline_code' ok 449 - set 'medline_ta' ok 450 - get 'medline_ta' ok 451 - set 'nlm_unique_id' ok 452 - get 'nlm_unique_id' ok 453 ok 454 - abbreviation ok 455 - issn ok 456 - name ok 457 - coden ok 458 - country ok 459 - medline_code ok 460 - medline_ta ok 461 - nlm_unique_id ok 462 - set 'doc_number' ok 463 - get 'doc_number' ok 464 - set 'doc_office' ok 465 - get 'doc_office' ok 466 - set 'doc_type' ok 467 - get 'doc_type' ok 468 ok 469 - doc_number ok 470 - doc_office ok 471 - doc_type ok 472 - get 'applicants' ok 473 - set 'url' ok 474 - get 'url' ok 475 - set 'estimated_size' ok 476 - get 'estimated_size' ok 477 - set 'cost' ok 478 - get 'cost' ok 479 ok 480 - url ok 481 - estimated_size ok 482 - cost ok 483 - set 'type' ok 484 - get 'type' ok 485 - set 'affiliation' ok 486 - get 'affiliation' ok 487 - set 'email' ok 488 - get 'email' ok 489 - set 'firstname' ok 490 - get 'firstname' ok 491 - set 'forename' ok 492 - get 'forename' ok 493 - set 'initials' ok 494 - get 'initials' ok 495 - set 'lastname' ok 496 - get 'lastname' ok 497 - set 'middlename' ok 498 - get 'middlename' ok 499 - set 'postal_address' ok 500 - get 'postal_address' ok 501 - set 'suffix' ok 502 - get 'suffix' ok 503 ok 504 - type ok 505 - affiliation ok 506 - email ok 507 - firstname ok 508 - forename ok 509 - initials ok 510 - lastname ok 511 - middlename ok 512 - postal_address ok 513 - suffix ok 514 - set 'type' ok 515 - get 'type' ok 516 - set 'name' ok 517 - get 'name' ok 518 ok 519 - type ok 520 - name ok 521 - set 'type' ok 522 - get 'type' ok 523 - set 'name' ok 524 - get 'name' ok 525 ok 526 - type ok 527 - name ok 528 - set 'pubmed_status' ok 529 - get 'pubmed_status' ok 530 - set 'pubmed_provider_id' ok 531 - get 'pubmed_provider_id' ok 532 ok 533 - pubmed_status ok 534 - pubmed_provider_id ok 535 - get 'pubmed_history_list' ok 536 - get 'pubmed_article_id_list' ok 537 - get 'pubmed_url_list' ok t/Biblio/biofetch.t .......................... skipped: Network tests have not been requested t/Biblio/eutils.t ............................ skipped: Network tests have not been requested t/ClusterIO/ClusterIO.t ...................... 1..12 ok 1 - use Bio::ClusterIO; ok 2 - use Bio::Cluster::ClusterFactory; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - The object isa Bio::Cluster::UniGeneI ok 12 - The object isa Bio::Cluster::UniGeneI ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 70. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 70. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 70. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 70. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 70. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 70. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 70. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 142. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 142. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 142. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 142. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 142. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 142. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 142. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 142. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 142. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 142. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 142. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 142. t/ClusterIO/SequenceFamily.t ................. 1..19 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Cluster::SequenceFamily; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok Subroutine new redefined at Bio\Cluster\UniGene.pm line 259. Subroutine unigene_id redefined at Bio\Cluster\UniGene.pm line 321. Subroutine title redefined at Bio\Cluster\UniGene.pm line 343. Subroutine gene redefined at Bio\Cluster\UniGene.pm line 364. Subroutine cytoband redefined at Bio\Cluster\UniGene.pm line 382. Subroutine mgi redefined at Bio\Cluster\UniGene.pm line 399. Subroutine locuslink redefined at Bio\Cluster\UniGene.pm line 427. Subroutine homol redefined at Bio\Cluster\UniGene.pm line 456. Subroutine restr_expr redefined at Bio\Cluster\UniGene.pm line 473. Subroutine gnm_terminus redefined at Bio\Cluster\UniGene.pm line 491. Subroutine scount redefined at Bio\Cluster\UniGene.pm line 507. Subroutine express redefined at Bio\Cluster\UniGene.pm line 529. Subroutine chromosome redefined at Bio\Cluster\UniGene.pm line 547. Subroutine sts redefined at Bio\Cluster\UniGene.pm line 565. Subroutine txmap redefined at Bio\Cluster\UniGene.pm line 583. Subroutine protsim redefined at Bio\Cluster\UniGene.pm line 601. Subroutine sequences redefined at Bio\Cluster\UniGene.pm line 624. Subroutine species redefined at Bio\Cluster\UniGene.pm line 644. Subroutine display_id redefined at Bio\Cluster\UniGene.pm line 676. Subroutine description redefined at Bio\Cluster\UniGene.pm line 693. Subroutine size redefined at Bio\Cluster\UniGene.pm line 711. Subroutine cluster_score redefined at Bio\Cluster\UniGene.pm line 743. Subroutine get_members redefined at Bio\Cluster\UniGene.pm line 766. Subroutine annotation redefined at Bio\Cluster\UniGene.pm line 815. Subroutine add_member redefined at Bio\Cluster\UniGene.pm line 847. Subroutine remove_members redefined at Bio\Cluster\UniGene.pm line 877. Subroutine next_locuslink redefined at Bio\Cluster\UniGene.pm line 906. Subroutine next_express redefined at Bio\Cluster\UniGene.pm line 932. Subroutine next_chromosome redefined at Bio\Cluster\UniGene.pm line 959. Subroutine next_protsim redefined at Bio\Cluster\UniGene.pm line 986. Subroutine next_sts redefined at Bio\Cluster\UniGene.pm line 1013. Subroutine next_txmap redefined at Bio\Cluster\UniGene.pm line 1040. Subroutine _next_element redefined at Bio\Cluster\UniGene.pm line 1053. Subroutine object_id redefined at Bio\Cluster\UniGene.pm line 1090. Subroutine version redefined at Bio\Cluster\UniGene.pm line 1112. Subroutine authority redefined at Bio\Cluster\UniGene.pm line 1134. Subroutine namespace redefined at Bio\Cluster\UniGene.pm line 1156. Subroutine display_name redefined at Bio\Cluster\UniGene.pm line 1184. Subroutine next_seq redefined at Bio\Cluster\UniGene.pm line 1235. Subroutine sequence_factory redefined at Bio\Cluster\UniGene.pm line 1293. Subroutine _annotation_value redefined at Bio\Cluster\UniGene.pm line 1321. Subroutine _annotation_value_ary redefined at Bio\Cluster\UniGene.pm line 1362. Subroutine _annotation_dblink redefined at Bio\Cluster\UniGene.pm line 1398. Subroutine _remove_dblink redefined at Bio\Cluster\UniGene.pm line 1433. Subroutine Bio::Cluster::UniGene::sequence redefined at Bio\Cluster\UniGene.pm line 1457. t/ClusterIO/unigene.t ........................ 1..73 ok 1 - use Bio::ClusterIO; ok 2 - new Bio::ClusterIO object defined ok 3 ok 4 - The object isa Bio::Cluster::UniGeneI ok 5 - The object isa Bio::ClusterI ok 6 - The object isa Bio::IdentifiableI ok 7 - The object isa Bio::DescribableI ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - The object isa Bio::PrimarySeqI ok 49 ok 50 ok 51 - annotation object defined ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 - The object isa Bio::PrimarySeqI ok 67 ok 68 - next cluster ok 69 ok 70 ok 71 ok 72 ok 73 ok t/Coordinate/CoordinateGraph.t ............... 1..7 ok 1 - use Bio::Coordinate::Graph; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine add_sub_Location redefined at Bio\Coordinate\Result.pm line 101. Subroutine add_result redefined at Bio\Coordinate\Result.pm line 131. Subroutine seq_id redefined at Bio\Coordinate\Result.pm line 155. Subroutine each_gap redefined at Bio\Coordinate\Result.pm line 186. Subroutine each_match redefined at Bio\Coordinate\Result.pm line 211. Subroutine match redefined at Bio\Coordinate\Result.pm line 232. Subroutine gap redefined at Bio\Coordinate\Result.pm line 255. Subroutine purge_gaps redefined at Bio\Coordinate\Result.pm line 278. Subroutine new redefined at Bio\Location\Split.pm line 104. Subroutine each_Location redefined at Bio\Location\Split.pm line 136. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234. Subroutine splittype redefined at Bio\Location\Split.pm line 258. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311. Subroutine strand redefined at Bio\Location\Split.pm line 339. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380. Subroutine start redefined at Bio\Location\Split.pm line 401. Subroutine end redefined at Bio\Location\Split.pm line 420. Subroutine min_start redefined at Bio\Location\Split.pm line 439. Subroutine max_start redefined at Bio\Location\Split.pm line 461. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484. Subroutine min_end redefined at Bio\Location\Split.pm line 505. Subroutine max_end redefined at Bio\Location\Split.pm line 528. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552. Subroutine seq_id redefined at Bio\Location\Split.pm line 578. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624. t/Coordinate/CoordinateMapper.t .............. 1..175 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::Result::Match; ok 4 - use Bio::Coordinate::Result::Gap; ok 5 - use Bio::Coordinate::Chain; ok 6 - use Bio::Coordinate::Collection; ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Coordinate::Result ok 15 - The object isa Bio::Location::SplitLocationI ok 16 ok 17 ok 18 ok 19 - The object isa Bio::LocationI ok 20 - The object isa Bio::Coordinate::Result::Match ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - The object isa Bio::Coordinate::Result::Gap ok 38 - The object isa Bio::LocationI ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - The object isa Bio::Coordinate::Result::Match ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Match: |314696| Test: 314696| ok 139 ok 140 ok 141 ok 142 - Match: |341| Test: 341| ok 143 ok 144 ok 145 ok 146 - Match: |315843| Test: 315843| ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - Match: |627011| Test: 627011| ok 153 ok 154 ok 155 ok 156 - Match: |chr1| Test: chr1| ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine add_sub_Location redefined at Bio\Coordinate\Result.pm line 101. Subroutine add_result redefined at Bio\Coordinate\Result.pm line 131. Subroutine seq_id redefined at Bio\Coordinate\Result.pm line 155. Subroutine each_gap redefined at Bio\Coordinate\Result.pm line 186. Subroutine each_match redefined at Bio\Coordinate\Result.pm line 211. Subroutine match redefined at Bio\Coordinate\Result.pm line 232. Subroutine gap redefined at Bio\Coordinate\Result.pm line 255. Subroutine purge_gaps redefined at Bio\Coordinate\Result.pm line 278. Subroutine new redefined at Bio\Location\Split.pm line 104. Subroutine each_Location redefined at Bio\Location\Split.pm line 136. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234. Subroutine splittype redefined at Bio\Location\Split.pm line 258. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311. Subroutine strand redefined at Bio\Location\Split.pm line 339. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380. Subroutine start redefined at Bio\Location\Split.pm line 401. Subroutine end redefined at Bio\Location\Split.pm line 420. Subroutine min_start redefined at Bio\Location\Split.pm line 439. Subroutine max_start redefined at Bio\Location\Split.pm line 461. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484. Subroutine min_end redefined at Bio\Location\Split.pm line 505. Subroutine max_end redefined at Bio\Location\Split.pm line 528. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552. Subroutine seq_id redefined at Bio\Location\Split.pm line 578. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624. t/Coordinate/GeneCoordinateMapper.t .......... 1..116 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::ExtrapolatingPair; ok 4 - use Bio::Coordinate::GeneMapper; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Location::Simple ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 - The object isa Bio::Location::Simple ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/LiveSeq/Chain.t ............................ 1..45 ok 1 - use Bio::LiveSeq::Chain; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 48. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 48. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 48. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 48. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 48. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 48. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 48. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 57. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 57. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 57. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 57. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 57. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 57. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 57. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 57. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 57. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 57. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 57. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 57. Subroutine new redefined at Bio\Location\Split.pm line 104, line 74. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 74. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 74. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 74. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 74. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 74. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 74. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 74. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 74. Subroutine start redefined at Bio\Location\Split.pm line 401, line 74. Subroutine end redefined at Bio\Location\Split.pm line 420, line 74. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 74. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 74. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 74. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 74. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 74. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 74. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 74. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 74. t/LiveSeq/LiveSeq.t .......................... 1..48 ok 1 - use Bio::LiveSeq::IO::BioPerl; ok 2 ok 3 ok 4 - Bio::LiveSeq::Gene ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok t/LiveSeq/Mutation.t ......................... 1..19 ok 1 - use Bio::LiveSeq::Mutation; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 40. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 40. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 40. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 40. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 40. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 40. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 40. Subroutine new redefined at Bio\Location\Split.pm line 104, line 67. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 67. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 67. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 67. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 67. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 67. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 67. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 67. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 67. Subroutine start redefined at Bio\Location\Split.pm line 401, line 67. Subroutine end redefined at Bio\Location\Split.pm line 420, line 67. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 67. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 67. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 67. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 67. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 67. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 67. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 67. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 67. t/LiveSeq/Mutator.t .......................... 1..24 ok 1 - use Bio::LiveSeq::Mutator; ok 2 - use Bio::LiveSeq::IO::BioPerl; ok 3 - use Bio::Variation::IO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/LocalDB/BioDBGFF.t ......................... 1..279 ok 1 - use Bio::DB::GFF; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 # skip fetch_feature_by_gid() not implemented by this adaptor ok 104 # skip fetch_feature_by_gid() not implemented by this adaptor ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 # skip delete_groups() not implemented by this adaptor ok 135 # skip delete_groups() not implemented by this adaptor ok 136 # skip Not compatible with your Operating System ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 # skip fetch_feature_by_gid() not implemented by this adaptor ok 243 # skip fetch_feature_by_gid() not implemented by this adaptor ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 # skip preferred groups are not supported by gff3 ok 251 # skip preferred groups are not supported by gff3 ok 252 # skip preferred groups are not supported by gff3 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 # skip delete_groups() not implemented by this adaptor ok 274 # skip delete_groups() not implemented by this adaptor ok 275 # skip Not compatible with your Operating System ok 276 ok 277 ok 278 ok 279 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. t/LocalDB/BlastIndex.t ....................... 1..26 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::Blast; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/LocalDB/DBFasta.t .......................... 1..15 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/LocalDB/DBQual.t ........................... 1..38 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Seq::PrimaryQual ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - The object isa Bio::Seq::PrimaryQual ok 26 ok 27 ok 28 - The object isa Bio::Seq::PrimaryQual ok 29 ok 30 ok 31 ok 32 - The object isa Bio::Seq::PrimaryQual ok 33 ok 34 - The object isa Bio::Seq::PrimaryQual ok 35 ok 36 ok 37 ok 38 ok t/LocalDB/Flat.t ............................. skipped: The optional module DB_File (or dependencies thereof) was not installed t/LocalDB/Index.t ............................ skipped: The optional module DB_File (or dependencies thereof) was not installed t/LocalDB/Registry.t ......................... 1..14 ok 1 - use Bio::DB::Registry; ok 2 - use Bio::DB::Flat; ok 3 ok 4 # skip The optional module DB_File (or dependencies thereof) was not installed ok 5 # skip The optional module DB_File (or dependencies thereof) was not installed ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok # Failed test 'use Bio::DB::SeqFeature::Store::GFF3Loader;' # at t/LocalDB/SeqFeature.t line 17. # Tried to use 'Bio::DB::SeqFeature::Store::GFF3Loader'. # Error: Can't locate DB_File.pm in @INC (@INC contains: . /home/lstein/projects/bioperl-live C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio/DB/SeqFeature/Store/LoadHelper.pm line 39. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/LoadHelper.pm line 39. # Compilation failed in require at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 73. # BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 73. # Compilation failed in require at (eval 48) line 2. # BEGIN failed--compilation aborted at (eval 48) line 2. # Looks like you failed 1 test of 69. t/LocalDB/SeqFeature.t ....................... 1..69 ok 1 - use Bio::DB::SeqFeature::Store; not ok 2 - use Bio::DB::SeqFeature::Store::GFF3Loader; ok 3 ok 4 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 5 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 6 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 7 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 8 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 9 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 10 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 11 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 12 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 13 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 14 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 15 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 16 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 17 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 18 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 19 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 20 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 21 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 22 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 23 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 24 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 25 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 26 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 27 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 28 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 29 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 30 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 31 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 32 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 33 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 34 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 35 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 36 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 37 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 38 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 39 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 40 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 41 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 42 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 43 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 44 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 45 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 46 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 47 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 48 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 49 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 50 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 51 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 52 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 53 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 54 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 55 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 56 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 57 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 58 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 59 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 60 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 61 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 62 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 63 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 64 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 65 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 66 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 67 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 68 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # ok 69 # skip GFF3 loader failed? Skipping all! Can't locate object method "new" via package "Bio::DB::SeqFeature::Store::GFF3Loader" at t/LocalDB/SeqFeature.t line 32. # Dubious, test returned 1 (wstat 256, 0x100) Failed 1/69 subtests (less 66 skipped subtests: 2 okay) ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio\DB\Taxonomy\flatfile.pm line 90. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 90. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:264 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:115 STACK: t/LocalDB/transfac_pro.t:18 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio\DB\Taxonomy\flatfile.pm line 90. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 90. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:264 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:115 STACK: t/LocalDB/transfac_pro.t:18 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio\DB\TFBS\transfac_pro.pm line 118. BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151 STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130 STACK: t/LocalDB/transfac_pro.t:25 ----------------------------------------------------------- Bio::DB::TFBS: transfac_pro cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio\DB\TFBS\transfac_pro.pm line 118. BEGIN failed--compilation aborted at Bio\DB\TFBS\transfac_pro.pm line 118. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151 STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130 STACK: t/LocalDB/transfac_pro.t:25 ----------------------------------------------------------- For more information about the Bio::DB::TFBS system please see the Bio::DB::TFBS docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/LocalDB/transfac_pro.t line 25. Can't call method "get_reference_ids" on an undefined value at t/LocalDB/transfac_pro.t line 33. # Looks like you planned 115 tests but ran 4. # Looks like you failed 1 test of 4 run. # Looks like your test exited with 2 just after 4. t/LocalDB/transfac_pro.t ..................... 1..115 ok 1 - use Bio::Matrix::PSM::IO; ok 2 - use Bio::DB::TFBS; ok 3 - use Bio::DB::Taxonomy; not ok 4 Dubious, test returned 2 (wstat 512, 0x200) Failed 112/115 subtests t/Map/Cyto.t ................................. 1..110 ok 1 - use Bio::Map::CytoMap; ok 2 - use Bio::Map::CytoPosition; ok 3 - use Bio::Map::CytoMarker; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::Map::CytoPosition ok 15 ok 16 ok 17 ok 18 - The object isa Bio::Range ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok t/Map/Linkage.t .............................. 1..18 ok 1 - use Bio::Map::LinkagePosition; ok 2 - use Bio::Map::Microsatellite; ok 3 - use Bio::Map::LinkageMap; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/Map/Map.t .................................. 1..267 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Marker; ok 3 - use Bio::Map::Position; ok 4 - use Bio::Map::Relative; ok 5 - use Bio::Map::Mappable; ok 6 ok 7 ok 8 ok 9 ok 10 - Length is 0 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 - use Bio::Map::Gene; ok 152 - use Bio::Map::GeneMap; ok 153 - use Bio::Map::TranscriptionFactor; ok 154 - use Bio::Map::GeneRelative; ok 155 - use Bio::Map::GenePosition; ok 156 - use Bio::Map::Prediction; ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok t/Map/MapIO.t ................................ 1..51 ok 1 - use Bio::MapIO; ok 2 ok 3 - The object isa Bio::Map::MapI ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Map/MicrosatelliteMarker.t ................. 1..8 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Position; ok 3 - use Bio::Map::Microsatellite; ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Map/Physical.t ............................. 1..39 ok 1 - use Bio::Map::Physical; ok 2 - use Bio::MapIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - code holds and returns a string, definition requires a boolean ok 13 - code holds and returns a string, definition requires a boolean ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok t/Matrix/IO/masta.t .......................... 1..16 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/Matrix/IO/psm.t ............................ 1..63 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Matrix/InstanceSite.t ...................... 1..6 ok 1 - use Bio::Matrix::PSM::InstanceSite; ok 2 ok 3 ok 4 ok 5 ok 6 ok t/Matrix/Matrix.t ............................ 1..77 ok 1 - use Bio::Matrix::Generic; ok 2 - use Bio::Matrix::IO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - The object isa Bio::Matrix::Scoring ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - The object isa Bio::Matrix::Scoring ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok t/Matrix/ProtMatrix.t ........................ 1..14 ok 1 - use Bio::Matrix::PSM::ProtMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Matrix/ProtPsm.t ........................... 1..14 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 # skip TODO: Module incomplete ok 6 # skip TODO: Module incomplete ok 7 # skip TODO: Module incomplete ok 8 # skip TODO: Module incomplete ok 9 # skip TODO: Module incomplete ok 10 # skip TODO: Module incomplete ok 11 # skip TODO: Module incomplete ok 12 # skip TODO: Module incomplete ok 13 # skip TODO: Module incomplete ok 14 # skip TODO: Module incomplete ok t/Matrix/SiteMatrix.t ........................ 1..14 ok 1 - use Bio::Matrix::PSM::SiteMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Ontology/GOterm.t .......................... 1..62 ok 1 - use Bio::Ontology::GOterm; ok 2 - use Bio::Ontology::Ontology; ok 3 - use Bio::Annotation::DBLink; ok 4 - The object isa Bio::Ontology::GOterm ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok t/Ontology/GraphAdaptor.t .................... 1..28 ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Ontology/IO/go.t ........................... 1..102 ok 1 - use Bio::OntologyIO; ok 2 ok 3 - The object isa Bio::Ontology::OntologyI ok 4 ok 5 - The object isa Bio::Ontology::OntologyEngineI ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/Ontology/IO/interpro.t ..................... 1..47 ok 1 - use Bio::OntologyIO; ok 2 ok 3 ok 4 ok 5 ok 6 - term Integrins alpha chain in ontology InterPro ok 7 ok 8 - term post-translational modification in ontology InterPro ok 9 ok 10 - term Repeat in ontology InterPro ok 11 ok 12 - term Binding Site in ontology InterPro ok 13 ok 14 - term Cdc20/Fizzy in ontology InterPro ok 15 ok 16 - term Kringle in ontology InterPro ok 17 ok 18 - term Helix-turn-helix, AraC type in ontology InterPro ok 19 ok 20 - term Active Site in ontology InterPro ok 21 ok 22 - term Active Site in ontology InterPro ok 23 ok 24 - term Binding Site in ontology InterPro ok 25 ok 26 - term Domain in ontology InterPro ok 27 ok 28 - term Family in ontology InterPro ok 29 ok 30 - term Repeat in ontology InterPro ok 31 ok 32 - term post-translational modification in ontology InterPro ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/Ontology/IO/obo.t .......................... 1..83 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - got a ontology IO handler isa Bio::OntologyIO ok 47 - got ontology parser2 isa Bio::Ontology::Ontology ok 48 - got OBO engine object isa Bio::Ontology::OBOEngine ok 49 - got ontology parser2 isa Bio::Ontology::Ontology ok 50 - got OBO engine object isa Bio::Ontology::OBOEngine ok 51 - got ontology parser2 isa Bio::Ontology::Ontology ok 52 - got OBO engine object isa Bio::Ontology::OBOEngine ok 53 - Gene ontology ok 54 - biological process ok 55 - molecular function ok 56 - Got root ok 57 - Got root ok 58 - Got regulates # from gene_ontology ok 59 - Got # positively regulates from gene_ontology ok 60 - Got # regulates from biological_process ok 61 - Got # positively regulates from biological_process ok 62 - Got predicates for gene_ontology ok 63 - Got predicates for biological_process ok 64 - Got regulates predicate ok 65 - Got positively regulates predicate ok 66 - Got relationships for biological_process ok 67 - Got relationships for molecular_function ok 68 - Got is a relationship from # molecular_function ok 69 - Got term object isa Bio::Ontology::Term ok 70 - Got term id ok 71 - Got term name ok 72 - Got regulated object isa Bio::Ontology::Term ok 73 - Got regulated term1 id ok 74 - Got term1 object isa Bio::Ontology::Term ok 75 - Got back the child ok 76 - Got term object isa Bio::Ontology::Term ok 77 - Got term id ok 78 - Got term name ok 79 - Got regulated object isa Bio::Ontology::Term ok 80 - Got regulated term1 id ok 81 - Got identical regulation ok 82 - Got term1 object isa Bio::Ontology::Term ok 83 - Got back the child ok t/Ontology/Ontology.t ........................ 1..52 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok Subroutine new redefined at Bio\Ontology\Relationship.pm line 140. Subroutine init redefined at Bio\Ontology\Relationship.pm line 191. Subroutine identifier redefined at Bio\Ontology\Relationship.pm line 216. Subroutine subject_term redefined at Bio\Ontology\Relationship.pm line 246. Subroutine object_term redefined at Bio\Ontology\Relationship.pm line 277. Subroutine predicate_term redefined at Bio\Ontology\Relationship.pm line 308. Subroutine ontology redefined at Bio\Ontology\Relationship.pm line 334. Subroutine to_string redefined at Bio\Ontology\Relationship.pm line 362. Subroutine _check_class redefined at Bio\Ontology\Relationship.pm line 384. Subroutine Bio::Ontology::Relationship::child_term redefined at Bio\Ontology\Relationship.pm line 410. Subroutine Bio::Ontology::Relationship::parent_term redefined at Bio\Ontology\Relationship.pm line 411. Subroutine Bio::Ontology::Relationship::relationship_type redefined at Bio\Ontology\Relationship.pm line 412. t/Ontology/OntologyEngine.t .................. 1..27 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::Relationship; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - use Bio::Ontology::SimpleOntologyEngine; ok 5 - use Bio::Ontology::Ontology; ok 6 - The object isa Bio::Ontology::OntologyEngineI ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Ontology/OntologyStore.t ................... skipped: Network tests have not been requested t/Ontology/Relationship.t .................... 1..12 ok 1 - use Bio::Ontology::Relationship; ok 2 - use Bio::Ontology::GOterm; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - The object isa Bio::Ontology::RelationshipType ok 5 - The object isa Bio::Ontology::GOterm ok 6 - The object isa Bio::Ontology::GOterm ok 7 - The object isa Bio::Ontology::Relationship ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Ontology/RelationshipType.t ................ 1..23 ok 1 - use Bio::Ontology::RelationshipType; ok 2 - use Bio::Ontology::Ontology; ok 3 - The object isa Bio::Ontology::RelationshipType ok 4 - The object isa Bio::Ontology::TermI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok Constant subroutine Bio::Ontology::Term::TRUE redefined at C:\cpanfly-5.8\var\megalib/constant.pm line 131. Constant subroutine Bio::Ontology::Term::FALSE redefined at C:\cpanfly-5.8\var\megalib/constant.pm line 131. Subroutine new redefined at Bio\Ontology\Term.pm line 146. Subroutine init redefined at Bio\Ontology\Term.pm line 196. Subroutine identifier redefined at Bio\Ontology\Term.pm line 227. Subroutine name redefined at Bio\Ontology\Term.pm line 247. Subroutine definition redefined at Bio\Ontology\Term.pm line 267. Subroutine ontology redefined at Bio\Ontology\Term.pm line 295. Subroutine version redefined at Bio\Ontology\Term.pm line 325. Subroutine is_obsolete redefined at Bio\Ontology\Term.pm line 344. Subroutine comment redefined at Bio\Ontology\Term.pm line 364. Subroutine get_synonyms redefined at Bio\Ontology\Term.pm line 381. Subroutine add_synonym redefined at Bio\Ontology\Term.pm line 401. Subroutine remove_synonyms redefined at Bio\Ontology\Term.pm line 425. Subroutine get_dblinks redefined at Bio\Ontology\Term.pm line 448. Subroutine get_dbxrefs redefined at Bio\Ontology\Term.pm line 474. Subroutine get_dblink_context redefined at Bio\Ontology\Term.pm line 499. Subroutine get_dbxref_context redefined at Bio\Ontology\Term.pm line 515. Subroutine add_dblink redefined at Bio\Ontology\Term.pm line 535. Subroutine add_dbxref redefined at Bio\Ontology\Term.pm line 562. Subroutine has_dblink redefined at Bio\Ontology\Term.pm line 598. Subroutine has_dbxref redefined at Bio\Ontology\Term.pm line 616. Subroutine add_dblink_context redefined at Bio\Ontology\Term.pm line 647. Subroutine remove_dblinks redefined at Bio\Ontology\Term.pm line 668. Subroutine remove_dbxrefs redefined at Bio\Ontology\Term.pm line 685. Subroutine get_references redefined at Bio\Ontology\Term.pm line 707. Subroutine add_reference redefined at Bio\Ontology\Term.pm line 723. Subroutine remove_references redefined at Bio\Ontology\Term.pm line 746. Subroutine get_secondary_ids redefined at Bio\Ontology\Term.pm line 767. Subroutine add_secondary_id redefined at Bio\Ontology\Term.pm line 787. Subroutine remove_secondary_ids redefined at Bio\Ontology\Term.pm line 811. Subroutine _is_true_or_false redefined at Bio\Ontology\Term.pm line 825. Subroutine object_id redefined at Bio\Ontology\Term.pm line 850. Subroutine authority redefined at Bio\Ontology\Term.pm line 871. Subroutine namespace redefined at Bio\Ontology\Term.pm line 900. Subroutine display_name redefined at Bio\Ontology\Term.pm line 924. Subroutine description redefined at Bio\Ontology\Term.pm line 948. Subroutine each_dblink redefined at Bio\Ontology\Term.pm line 962. Subroutine add_dblinks redefined at Bio\Ontology\Term.pm line 963. Subroutine Bio::Ontology::Term::each_synonym redefined at Bio\Ontology\Term.pm line 964. Subroutine Bio::Ontology::Term::add_synonyms redefined at Bio\Ontology\Term.pm line 965. t/Ontology/Term.t ............................ 1..54 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::TermFactory; ok 3 - use Bio::Annotation::DBLink; ok 4 - The object isa Bio::Ontology::TermI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - The object isa Bio::Ontology::TermI ok 45 ok 46 - The object isa Bio::Ontology::TermI ok 47 - The object isa Bio::Ontology::GOterm ok 48 ok 49 ok 50 - The object isa Bio::Ontology::TermI ok 51 - The object isa Bio::AnnotationI ok 52 ok 53 ok 54 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 31. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 31. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 31. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 31. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 31. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 31. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 31. Subroutine new redefined at Bio\Location\Split.pm line 104, line 42. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 42. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 42. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 42. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 42. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 42. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 42. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 42. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 42. Subroutine start redefined at Bio\Location\Split.pm line 401, line 42. Subroutine end redefined at Bio\Location\Split.pm line 420, line 42. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 42. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 42. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 42. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 42. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 42. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 42. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 42. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 42. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 42. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 42. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 42. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 42. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 42. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 42. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 42. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 42. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 42. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 42. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 42. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 42. t/Perl.t ..................................... 1..29 ok 1 - use Bio::Perl; ok 2 ok 3 - The object isa Bio::SeqI ok 4 ok 5 - The object isa Bio::SeqI ok 6 ok 7 - The object isa Bio::SeqI ok 8 - The object isa Bio::SeqI ok 9 ok 10 ok 11 - The object isa Bio::SeqI ok 12 ok 13 - The object isa Bio::SeqI ok 14 ok 15 - The object isa Bio::PrimarySeqI ok 16 ok 17 ok 18 ok 19 ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok t/Phenotype/Correlate.t ...................... 1..17 ok 1 - use Bio::Phenotype::Correlate; ok 2 - use Bio::Species; ok 3 - The object isa Bio::Phenotype::Correlate ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/Phenotype/MeSH.t ........................... 1..24 ok 1 - use Bio::Phenotype::MeSH::Term; ok 2 - use Bio::Phenotype::MeSH::Twig; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Phenotype/Measure.t ........................ 1..21 ok 1 - use Bio::Phenotype::Measure; ok 2 - The object isa Bio::Phenotype::Measure ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Phenotype/MiniMIMentry.t ................... 1..15 ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 2 - The object isa Bio::Phenotype::OMIM::MiniMIMentry ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/Phenotype/OMIMentry.t ...................... 1..153 ok 1 - use Bio::Phenotype::OMIM::OMIMentry; ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 3 - use Bio::Species; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Map::CytoPosition; ok 6 - use Bio::Phenotype::Correlate; ok 7 - use Bio::Phenotype::Measure; ok 8 - use Bio::Annotation::DBLink; ok 9 - The object isa Bio::Phenotype::OMIM::OMIMentry ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - operator overloading in AnnotationI is deprecated ok 80 - operator overloading in AnnotationI is deprecated ok 81 ok 82 ok 83 - operator overloading in AnnotationI is deprecated ok 84 - operator overloading in AnnotationI is deprecated ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - operator overloading in AnnotationI is deprecated ok 137 - operator overloading in AnnotationI is deprecated ok 138 ok 139 ok 140 - operator overloading in AnnotationI is deprecated ok 141 - operator overloading in AnnotationI is deprecated ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok t/Phenotype/OMIMentryAllelicVariant.t ........ 1..27 ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant; ok 2 - The object isa Bio::Phenotype::OMIM::OMIMentryAllelicVariant ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Phenotype/OMIMparser.t ..................... 1..175 ok 1 - use Bio::Phenotype::OMIM::OMIMparser; ok 2 - The object isa Bio::Phenotype::OMIM::OMIMparser ok 3 - The object isa Bio::Phenotype::OMIM::OMIMentry ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - The object isa Bio::Phenotype::OMIM::MiniMIMentry ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - The object isa Bio::Phenotype::OMIM::OMIMentry ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - The object isa Bio::Phenotype::OMIM::MiniMIMentry ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - missing linebreak caught ok t/Phenotype/Phenotype.t ...................... 1..116 ok 1 - use Bio::Phenotype::Phenotype; ok 2 - use Bio::Species; ok 3 - use Bio::Annotation::Reference; ok 4 - use Bio::Map::CytoPosition; ok 5 - use Bio::Phenotype::Correlate; ok 6 - use Bio::Phenotype::Measure; ok 7 - use Bio::Annotation::DBLink; ok 8 - The object isa Bio::Phenotype::PhenotypeI ok 9 - The object isa Bio::Phenotype::Phenotype ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - operator overloading in AnnotationI is deprecated ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 - operator overloading in AnnotationI is deprecated ok 47 - operator overloading in AnnotationI is deprecated ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - operator overloading in AnnotationI is deprecated ok 100 - operator overloading in AnnotationI is deprecated ok 101 ok 102 ok 103 - operator overloading in AnnotationI is deprecated ok 104 - operator overloading in AnnotationI is deprecated ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/PodSyntax.t ................................ 1..999 ok 1 - POD test for Bio\AlignIO.pm ok 2 - POD test for Bio\AnalysisI.pm ok 3 - POD test for Bio\AnalysisParserI.pm ok 4 - POD test for Bio\AnalysisResultI.pm ok 5 - POD test for Bio\AnnotatableI.pm ok 6 - POD test for Bio\AnnotationCollectionI.pm ok 7 - POD test for Bio\AnnotationI.pm ok 8 - POD test for Bio\Biblio.pm ok 9 - POD test for Bio\ClusterI.pm ok 10 - POD test for Bio\ClusterIO.pm ok 11 - POD test for Bio\DasI.pm ok 12 - POD test for Bio\DBLinkContainerI.pm ok 13 - POD test for Bio\DescribableI.pm ok 14 - POD test for Bio\FeatureHolderI.pm ok 15 - POD test for Bio\FeatureIO.pm ok 16 - POD test for Bio\HandlerBaseI.pm ok 17 - POD test for Bio\IdCollectionI.pm ok 18 - POD test for Bio\IdentifiableI.pm ok 19 - POD test for Bio\LocatableSeq.pm ok 20 - POD test for Bio\LocationI.pm ok 21 - POD test for Bio\MapIO.pm ok 22 - POD test for Bio\OntologyIO.pm ok 23 - POD test for Bio\ParameterBaseI.pm ok 24 - POD test for Bio\Perl.pm ok 25 - POD test for Bio\PhyloNetwork.pm ok 26 - POD test for Bio\PrimarySeq.pm ok 27 - POD test for Bio\PrimarySeqI.pm ok 28 - POD test for Bio\PullParserI.pm ok 29 - POD test for Bio\Range.pm ok 30 - POD test for Bio\RangeI.pm ok 31 - POD test for Bio\SearchDist.pm ok 32 - POD test for Bio\SearchIO.pm ok 33 - POD test for Bio\Seq.pm ok 34 - POD test for Bio\SeqAnalysisParserI.pm ok 35 - POD test for Bio\SeqFeatureI.pm ok 36 - POD test for Bio\SeqI.pm ok 37 - POD test for Bio\SeqIO.pm ok 38 - POD test for Bio\SeqUtils.pm ok 39 - POD test for Bio\SimpleAlign.pm ok 40 - POD test for Bio\SimpleAnalysisI.pm ok 41 - POD test for Bio\Species.pm ok 42 - POD test for Bio\Taxon.pm ok 43 - POD test for Bio\Taxonomy.pm ok 44 - POD test for Bio\TreeIO.pm ok 45 - POD test for Bio\UpdateableSeqI.pm ok 46 - POD test for Bio\WebAgent.pm ok 47 - POD test for examples\bioperl.pl (no pod) ok 48 - POD test for examples\generate_random_seq.pl (no pod) ok 49 - POD test for examples\longorf.pl ok 50 - POD test for examples\make_primers.pl (no pod) ok 51 - POD test for examples\revcom_dir.pl (no pod) ok 52 - POD test for examples\rev_and_trans.pl (no pod) ok 53 - POD test for examples\subsequence.cgi (no pod) ok 54 - POD test for maintenance\authors.pl ok 55 - POD test for maintenance\check_NAME.pl ok 56 - POD test for maintenance\check_URLs.pl ok 57 - POD test for maintenance\cvs2cl_by_file.pl ok 58 - POD test for maintenance\dependencies.pl ok 59 - POD test for maintenance\deprecated.pl ok 60 - POD test for maintenance\modules.pl ok 61 - POD test for maintenance\module_usage.pl (no pod) ok 62 - POD test for maintenance\ncbi_blast_switches.pl (no pod) ok 63 - POD test for maintenance\pod.pl ok 64 - POD test for maintenance\symlink_script.pl ok 65 - POD test for maintenance\version.pl ok 66 - POD test for Bio\Align\AlignI.pm ok 67 - POD test for Bio\Align\DNAStatistics.pm ok 68 - POD test for Bio\Align\PairwiseStatistics.pm ok 69 - POD test for Bio\Align\ProteinStatistics.pm ok 70 - POD test for Bio\Align\StatisticsI.pm ok 71 - POD test for Bio\Align\Utilities.pm ok 72 - POD test for Bio\AlignIO\arp.pm ok 73 - POD test for Bio\AlignIO\bl2seq.pm ok 74 - POD test for Bio\AlignIO\clustalw.pm ok 75 - POD test for Bio\AlignIO\emboss.pm ok 76 - POD test for Bio\AlignIO\fasta.pm ok 77 - POD test for Bio\AlignIO\largemultifasta.pm ok 78 - POD test for Bio\AlignIO\maf.pm ok 79 - POD test for Bio\AlignIO\mase.pm ok 80 - POD test for Bio\AlignIO\mega.pm ok 81 - POD test for Bio\AlignIO\meme.pm ok 82 - POD test for Bio\AlignIO\metafasta.pm ok 83 - POD test for Bio\AlignIO\msf.pm ok 84 - POD test for Bio\AlignIO\nexus.pm ok 85 - POD test for Bio\AlignIO\pfam.pm ok 86 - POD test for Bio\AlignIO\phylip.pm ok 87 - POD test for Bio\AlignIO\po.pm ok 88 - POD test for Bio\AlignIO\proda.pm ok 89 - POD test for Bio\AlignIO\prodom.pm ok 90 - POD test for Bio\AlignIO\psi.pm ok 91 - POD test for Bio\AlignIO\selex.pm ok 92 - POD test for Bio\AlignIO\stockholm.pm ok 93 - POD test for Bio\AlignIO\xmfa.pm ok 94 - POD test for Bio\Annotation\AnnotationFactory.pm ok 95 - POD test for Bio\Annotation\Collection.pm ok 96 - POD test for Bio\Annotation\Comment.pm ok 97 - POD test for Bio\Annotation\DBLink.pm ok 98 - POD test for Bio\Annotation\OntologyTerm.pm ok 99 - POD test for Bio\Annotation\Reference.pm ok 100 - POD test for Bio\Annotation\Relation.pm ok 101 - POD test for Bio\Annotation\SimpleValue.pm ok 102 - POD test for Bio\Annotation\StructuredValue.pm ok 103 - POD test for Bio\Annotation\TagTree.pm ok 104 - POD test for Bio\Annotation\Target.pm ok 105 - POD test for Bio\Annotation\Tree.pm ok 106 - POD test for Bio\Annotation\TypeManager.pm ok 107 - POD test for Bio\Assembly\Contig.pm ok 108 - POD test for Bio\Assembly\ContigAnalysis.pm ok 109 - POD test for Bio\Assembly\IO.pm ok 110 - POD test for Bio\Assembly\Scaffold.pm ok 111 - POD test for Bio\Assembly\ScaffoldI.pm ok 112 - POD test for Bio\Assembly\Singlet.pm ok 113 - POD test for Bio\Biblio\Article.pm ok 114 - POD test for Bio\Biblio\BiblioBase.pm ok 115 - POD test for Bio\Biblio\Book.pm ok 116 - POD test for Bio\Biblio\BookArticle.pm ok 117 - POD test for Bio\Biblio\IO.pm ok 118 - POD test for Bio\Biblio\Journal.pm ok 119 - POD test for Bio\Biblio\JournalArticle.pm ok 120 - POD test for Bio\Biblio\MedlineArticle.pm ok 121 - POD test for Bio\Biblio\MedlineBook.pm ok 122 - POD test for Bio\Biblio\MedlineBookArticle.pm ok 123 - POD test for Bio\Biblio\MedlineJournal.pm ok 124 - POD test for Bio\Biblio\MedlineJournalArticle.pm ok 125 - POD test for Bio\Biblio\Organisation.pm ok 126 - POD test for Bio\Biblio\Patent.pm ok 127 - POD test for Bio\Biblio\Person.pm ok 128 - POD test for Bio\Biblio\Proceeding.pm ok 129 - POD test for Bio\Biblio\Provider.pm ok 130 - POD test for Bio\Biblio\PubmedArticle.pm ok 131 - POD test for Bio\Biblio\PubmedBookArticle.pm ok 132 - POD test for Bio\Biblio\PubmedJournalArticle.pm ok 133 - POD test for Bio\Biblio\Ref.pm ok 134 - POD test for Bio\Biblio\Service.pm ok 135 - POD test for Bio\Biblio\TechReport.pm ok 136 - POD test for Bio\Biblio\Thesis.pm ok 137 - POD test for Bio\Biblio\WebResource.pm ok 138 - POD test for Bio\Cluster\ClusterFactory.pm ok 139 - POD test for Bio\Cluster\FamilyI.pm ok 140 - POD test for Bio\Cluster\SequenceFamily.pm ok 141 - POD test for Bio\Cluster\UniGene.pm ok 142 - POD test for Bio\Cluster\UniGeneI.pm ok 143 - POD test for Bio\ClusterIO\dbsnp.pm ok 144 - POD test for Bio\ClusterIO\unigene.pm ok 145 - POD test for Bio\CodonUsage\IO.pm ok 146 - POD test for Bio\CodonUsage\Table.pm ok 147 - POD test for Bio\Coordinate\Chain.pm ok 148 - POD test for Bio\Coordinate\Collection.pm ok 149 - POD test for Bio\Coordinate\ExtrapolatingPair.pm ok 150 - POD test for Bio\Coordinate\GeneMapper.pm ok 151 - POD test for Bio\Coordinate\Graph.pm ok 152 - POD test for Bio\Coordinate\MapperI.pm ok 153 - POD test for Bio\Coordinate\Pair.pm ok 154 - POD test for Bio\Coordinate\Result.pm ok 155 - POD test for Bio\Coordinate\ResultI.pm ok 156 - POD test for Bio\Coordinate\Utils.pm ok 157 - POD test for Bio\Das\FeatureTypeI.pm ok 158 - POD test for Bio\Das\SegmentI.pm ok 159 - POD test for Bio\DB\Ace.pm ok 160 - POD test for Bio\DB\BiblioI.pm ok 161 - POD test for Bio\DB\BioFetch.pm ok 162 - POD test for Bio\DB\CUTG.pm ok 163 - POD test for Bio\DB\DBFetch.pm ok 164 - POD test for Bio\DB\EMBL.pm ok 165 - POD test for Bio\DB\EntrezGene.pm ok 166 - POD test for Bio\DB\EUtilities.pm ok 167 - POD test for Bio\DB\Expression.pm ok 168 - POD test for Bio\DB\Failover.pm ok 169 - POD test for Bio\DB\Fasta.pm ok 170 - POD test for Bio\DB\FileCache.pm ok 171 - POD test for Bio\DB\Flat.pm ok 172 - POD test for Bio\DB\GenBank.pm ok 173 - POD test for Bio\DB\GenericWebAgent.pm ok 174 - POD test for Bio\DB\GenPept.pm ok 175 - POD test for Bio\DB\GFF.pm ok 176 - POD test for Bio\DB\HIV.pm ok 177 - POD test for Bio\DB\InMemoryCache.pm ok 178 - POD test for Bio\DB\LocationI.pm ok 179 - POD test for Bio\DB\MeSH.pm ok 180 - POD test for Bio\DB\NCBIHelper.pm ok 181 - POD test for Bio\DB\Qual.pm ok 182 - POD test for Bio\DB\QueryI.pm ok 183 - POD test for Bio\DB\RandomAccessI.pm ok 184 - POD test for Bio\DB\ReferenceI.pm ok 185 - POD test for Bio\DB\RefSeq.pm ok 186 - POD test for Bio\DB\Registry.pm ok 187 - POD test for Bio\DB\SeqFeature.pm ok 188 - POD test for Bio\DB\SeqHound.pm ok 189 - POD test for Bio\DB\SeqI.pm ok 190 - POD test for Bio\DB\SeqVersion.pm ok 191 - POD test for Bio\DB\SwissProt.pm ok 192 - POD test for Bio\DB\Taxonomy.pm ok 193 - POD test for Bio\DB\TFBS.pm ok 194 - POD test for Bio\DB\Universal.pm ok 195 - POD test for Bio\DB\UpdateableSeqI.pm ok 196 - POD test for Bio\DB\WebDBSeqI.pm ok 197 - POD test for Bio\Event\EventGeneratorI.pm ok 198 - POD test for Bio\Event\EventHandlerI.pm ok 199 - POD test for Bio\Expression\Contact.pm ok 200 - POD test for Bio\Expression\DataSet.pm ok 201 - POD test for Bio\Expression\FeatureGroup.pm ok 202 - POD test for Bio\Expression\FeatureI.pm ok 203 - POD test for Bio\Expression\Platform.pm ok 204 - POD test for Bio\Expression\ProbeI.pm ok 205 - POD test for Bio\Expression\Sample.pm ok 206 - POD test for Bio\Factory\AnalysisI.pm ok 207 - POD test for Bio\Factory\ApplicationFactoryI.pm ok 208 - POD test for Bio\Factory\DriverFactory.pm ok 209 - POD test for Bio\Factory\FTLocationFactory.pm ok 210 - POD test for Bio\Factory\LocationFactoryI.pm ok 211 - POD test for Bio\Factory\MapFactoryI.pm ok 212 - POD test for Bio\Factory\ObjectBuilderI.pm ok 213 - POD test for Bio\Factory\ObjectFactory.pm ok 214 - POD test for Bio\Factory\ObjectFactoryI.pm ok 215 - POD test for Bio\Factory\SeqAnalysisParserFactory.pm ok 216 - POD test for Bio\Factory\SeqAnalysisParserFactoryI.pm ok 217 - POD test for Bio\Factory\SequenceFactoryI.pm ok 218 - POD test for Bio\Factory\SequenceProcessorI.pm ok 219 - POD test for Bio\Factory\SequenceStreamI.pm ok 220 - POD test for Bio\Factory\TreeFactoryI.pm ok 221 - POD test for Bio\FeatureIO\bed.pm ok 222 - POD test for Bio\FeatureIO\gff.pm ok 223 - POD test for Bio\FeatureIO\gtf.pm ok 224 - POD test for Bio\FeatureIO\interpro.pm ok 225 - POD test for Bio\FeatureIO\ptt.pm ok 226 - POD test for Bio\FeatureIO\vecscreen_simple.pm ok 227 - POD test for Bio\Index\Abstract.pm ok 228 - POD test for Bio\Index\AbstractSeq.pm ok 229 - POD test for Bio\Index\Blast.pm ok 230 - POD test for Bio\Index\BlastTable.pm ok 231 - POD test for Bio\Index\EMBL.pm ok 232 - POD test for Bio\Index\Fasta.pm ok 233 - POD test for Bio\Index\Fastq.pm ok 234 - POD test for Bio\Index\GenBank.pm ok 235 - POD test for Bio\Index\Hmmer.pm ok 236 - POD test for Bio\Index\Qual.pm ok 237 - POD test for Bio\Index\Stockholm.pm ok 238 - POD test for Bio\Index\SwissPfam.pm ok 239 - POD test for Bio\Index\Swissprot.pm ok 240 - POD test for Bio\LiveSeq\AARange.pm ok 241 - POD test for Bio\LiveSeq\Chain.pm ok 242 - POD test for Bio\LiveSeq\ChainI.pm ok 243 - POD test for Bio\LiveSeq\DNA.pm ok 244 - POD test for Bio\LiveSeq\Exon.pm ok 245 - POD test for Bio\LiveSeq\Gene.pm ok 246 - POD test for Bio\LiveSeq\Intron.pm ok 247 - POD test for Bio\LiveSeq\Mutation.pm ok 248 - POD test for Bio\LiveSeq\Mutator.pm ok 249 - POD test for Bio\LiveSeq\Prim_Transcript.pm ok 250 - POD test for Bio\LiveSeq\Range.pm ok 251 - POD test for Bio\LiveSeq\Repeat_Region.pm ok 252 - POD test for Bio\LiveSeq\Repeat_Unit.pm ok 253 - POD test for Bio\LiveSeq\SeqI.pm ok 254 - POD test for Bio\LiveSeq\Transcript.pm ok 255 - POD test for Bio\LiveSeq\Translation.pm ok 256 - POD test for Bio\Location\Atomic.pm ok 257 - POD test for Bio\Location\AvWithinCoordPolicy.pm ok 258 - POD test for Bio\Location\CoordinatePolicyI.pm ok 259 - POD test for Bio\Location\Fuzzy.pm ok 260 - POD test for Bio\Location\FuzzyLocationI.pm ok 261 - POD test for Bio\Location\NarrowestCoordPolicy.pm ok 262 - POD test for Bio\Location\Simple.pm ok 263 - POD test for Bio\Location\Split.pm ok 264 - POD test for Bio\Location\SplitLocationI.pm ok 265 - POD test for Bio\Location\WidestCoordPolicy.pm ok 266 - POD test for Bio\Map\Clone.pm ok 267 - POD test for Bio\Map\Contig.pm ok 268 - POD test for Bio\Map\CytoMap.pm ok 269 - POD test for Bio\Map\CytoMarker.pm ok 270 - POD test for Bio\Map\CytoPosition.pm ok 271 - POD test for Bio\Map\EntityI.pm ok 272 - POD test for Bio\Map\FPCMarker.pm ok 273 - POD test for Bio\Map\Gene.pm ok 274 - POD test for Bio\Map\GeneMap.pm ok 275 - POD test for Bio\Map\GenePosition.pm ok 276 - POD test for Bio\Map\GeneRelative.pm ok 277 - POD test for Bio\Map\LinkageMap.pm ok 278 - POD test for Bio\Map\LinkagePosition.pm ok 279 - POD test for Bio\Map\MapI.pm ok 280 - POD test for Bio\Map\Mappable.pm ok 281 - POD test for Bio\Map\MappableI.pm ok 282 - POD test for Bio\Map\Marker.pm ok 283 - POD test for Bio\Map\MarkerI.pm ok 284 - POD test for Bio\Map\Microsatellite.pm ok 285 - POD test for Bio\Map\OrderedPosition.pm ok 286 - POD test for Bio\Map\OrderedPositionWithDistance.pm ok 287 - POD test for Bio\Map\Physical.pm ok 288 - POD test for Bio\Map\Position.pm ok 289 - POD test for Bio\Map\PositionHandler.pm ok 290 - POD test for Bio\Map\PositionHandlerI.pm ok 291 - POD test for Bio\Map\PositionI.pm ok 292 - POD test for Bio\Map\PositionWithSequence.pm ok 293 - POD test for Bio\Map\Prediction.pm ok 294 - POD test for Bio\Map\Relative.pm ok 295 - POD test for Bio\Map\RelativeI.pm ok 296 - POD test for Bio\Map\SimpleMap.pm ok 297 - POD test for Bio\Map\TranscriptionFactor.pm ok 298 - POD test for Bio\MapIO\fpc.pm ok 299 - POD test for Bio\MapIO\mapmaker.pm ok 300 - POD test for Bio\Matrix\Generic.pm ok 301 - POD test for Bio\Matrix\IO.pm ok 302 - POD test for Bio\Matrix\MatrixI.pm ok 303 - POD test for Bio\Matrix\Mlagan.pm ok 304 - POD test for Bio\Matrix\PhylipDist.pm ok 305 - POD test for Bio\Matrix\Scoring.pm ok 306 - POD test for Bio\MolEvol\CodonModel.pm ok 307 - POD test for Bio\Ontology\DocumentRegistry.pm ok 308 - POD test for Bio\Ontology\GOterm.pm ok 309 - POD test for Bio\Ontology\InterProTerm.pm ok 310 - POD test for Bio\Ontology\OBOEngine.pm ok 311 - POD test for Bio\Ontology\OBOterm.pm ok 312 - POD test for Bio\Ontology\Ontology.pm ok 313 - POD test for Bio\Ontology\OntologyEngineI.pm ok 314 - POD test for Bio\Ontology\OntologyI.pm ok 315 - POD test for Bio\Ontology\OntologyStore.pm ok 316 - POD test for Bio\Ontology\Path.pm ok 317 - POD test for Bio\Ontology\PathI.pm ok 318 - POD test for Bio\Ontology\Relationship.pm ok 319 - POD test for Bio\Ontology\RelationshipFactory.pm ok 320 - POD test for Bio\Ontology\RelationshipI.pm ok 321 - POD test for Bio\Ontology\RelationshipType.pm ok 322 - POD test for Bio\Ontology\SimpleOntologyEngine.pm ok 323 - POD test for Bio\Ontology\Term.pm ok 324 - POD test for Bio\Ontology\TermFactory.pm ok 325 - POD test for Bio\Ontology\TermI.pm ok 326 - POD test for Bio\OntologyIO\dagflat.pm ok 327 - POD test for Bio\OntologyIO\goflat.pm ok 328 - POD test for Bio\OntologyIO\InterProParser.pm ok 329 - POD test for Bio\OntologyIO\obo.pm ok 330 - POD test for Bio\OntologyIO\simplehierarchy.pm ok 331 - POD test for Bio\OntologyIO\soflat.pm ok 332 - POD test for Bio\Phenotype\Correlate.pm ok 333 - POD test for Bio\Phenotype\Measure.pm ok 334 - POD test for Bio\Phenotype\Phenotype.pm ok 335 - POD test for Bio\Phenotype\PhenotypeI.pm ok 336 - POD test for Bio\PhyloNetwork\Factory.pm ok 337 - POD test for Bio\PhyloNetwork\FactoryX.pm ok 338 - POD test for Bio\PhyloNetwork\GraphViz.pm ok 339 - POD test for Bio\PhyloNetwork\muVector.pm ok 340 - POD test for Bio\PhyloNetwork\RandomFactory.pm ok 341 - POD test for Bio\PhyloNetwork\TreeFactory.pm ok 342 - POD test for Bio\PhyloNetwork\TreeFactoryMulti.pm ok 343 - POD test for Bio\PhyloNetwork\TreeFactoryX.pm ok 344 - POD test for Bio\PopGen\Genotype.pm ok 345 - POD test for Bio\PopGen\GenotypeI.pm ok 346 - POD test for Bio\PopGen\HtSNP.pm ok 347 - POD test for Bio\PopGen\Individual.pm ok 348 - POD test for Bio\PopGen\IndividualI.pm ok 349 - POD test for Bio\PopGen\IO.pm ok 350 - POD test for Bio\PopGen\Marker.pm ok 351 - POD test for Bio\PopGen\MarkerI.pm ok 352 - POD test for Bio\PopGen\PopStats.pm ok 353 - POD test for Bio\PopGen\Population.pm ok 354 - POD test for Bio\PopGen\PopulationI.pm ok 355 - POD test for Bio\PopGen\Statistics.pm ok 356 - POD test for Bio\PopGen\TagHaplotype.pm ok 357 - POD test for Bio\PopGen\Utilities.pm ok 358 - POD test for Bio\Restriction\Analysis.pm ok 359 - POD test for Bio\Restriction\Enzyme.pm ok 360 - POD test for Bio\Restriction\EnzymeCollection.pm ok 361 - POD test for Bio\Restriction\EnzymeI.pm ok 362 - POD test for Bio\Restriction\IO.pm ok 363 - POD test for Bio\Root\Build.pm ok 364 - POD test for Bio\Root\Exception.pm ok 365 - POD test for Bio\Root\HTTPget.pm ok 366 - POD test for Bio\Root\IO.pm ok 367 - POD test for Bio\Root\Root.pm ok 368 - POD test for Bio\Root\RootI.pm ok 369 - POD test for Bio\Root\Storable.pm ok 370 - POD test for Bio\Root\Test.pm ok 371 - POD test for Bio\Root\Utilities.pm ok 372 - POD test for Bio\Root\Version.pm ok 373 - POD test for Bio\Search\BlastStatistics.pm ok 374 - POD test for Bio\Search\BlastUtils.pm ok 375 - POD test for Bio\Search\DatabaseI.pm ok 376 - POD test for Bio\Search\GenericDatabase.pm ok 377 - POD test for Bio\Search\GenericStatistics.pm ok 378 - POD test for Bio\Search\Processor.pm ok 379 - POD test for Bio\Search\SearchUtils.pm ok 380 - POD test for Bio\Search\StatisticsI.pm ok 381 - POD test for Bio\SearchIO\axt.pm ok 382 - POD test for Bio\SearchIO\blast.pm ok 383 - POD test for Bio\SearchIO\blasttable.pm ok 384 - POD test for Bio\SearchIO\blastxml.pm ok 385 - POD test for Bio\SearchIO\blast_pull.pm ok 386 - POD test for Bio\SearchIO\cross_match.pm ok 387 - POD test for Bio\SearchIO\erpin.pm ok 388 - POD test for Bio\SearchIO\EventHandlerI.pm ok 389 - POD test for Bio\SearchIO\exonerate.pm ok 390 - POD test for Bio\SearchIO\fasta.pm ok 391 - POD test for Bio\SearchIO\FastHitEventBuilder.pm ok 392 - POD test for Bio\SearchIO\gmap_f9.pm ok 393 - POD test for Bio\SearchIO\hmmer.pm ok 394 - POD test for Bio\SearchIO\hmmer_pull.pm ok 395 - POD test for Bio\SearchIO\infernal.pm ok 396 - POD test for Bio\SearchIO\IteratedSearchResultEventBuilder.pm ok 397 - POD test for Bio\SearchIO\megablast.pm ok 398 - POD test for Bio\SearchIO\psl.pm ok 399 - POD test for Bio\SearchIO\rnamotif.pm ok 400 - POD test for Bio\SearchIO\SearchResultEventBuilder.pm ok 401 - POD test for Bio\SearchIO\SearchWriterI.pm ok 402 - POD test for Bio\SearchIO\sim4.pm ok 403 - POD test for Bio\SearchIO\waba.pm ok 404 - POD test for Bio\SearchIO\wise.pm ok 405 - POD test for Bio\Seq\BaseSeqProcessor.pm ok 406 - POD test for Bio\Seq\EncodedSeq.pm ok 407 - POD test for Bio\Seq\LargeLocatableSeq.pm ok 408 - POD test for Bio\Seq\LargePrimarySeq.pm ok 409 - POD test for Bio\Seq\LargeSeq.pm ok 410 - POD test for Bio\Seq\LargeSeqI.pm ok 411 - POD test for Bio\Seq\Meta.pm ok 412 - POD test for Bio\Seq\MetaI.pm ok 413 - POD test for Bio\Seq\PrimaryQual.pm ok 414 - POD test for Bio\Seq\PrimedSeq.pm ok 415 - POD test for Bio\Seq\QualI.pm ok 416 - POD test for Bio\Seq\Quality.pm ok 417 - POD test for Bio\Seq\RichSeq.pm ok 418 - POD test for Bio\Seq\RichSeqI.pm ok 419 - POD test for Bio\Seq\SeqBuilder.pm ok 420 - POD test for Bio\Seq\SeqFactory.pm ok 421 - POD test for Bio\Seq\SeqFastaSpeedFactory.pm ok 422 - POD test for Bio\Seq\SequenceTrace.pm ok 423 - POD test for Bio\Seq\SeqWithQuality.pm ok 424 - POD test for Bio\Seq\TraceI.pm ok 425 - POD test for Bio\SeqEvolution\DNAPoint.pm ok 426 - POD test for Bio\SeqEvolution\EvolutionI.pm ok 427 - POD test for Bio\SeqEvolution\Factory.pm ok 428 - POD test for Bio\SeqFeature\Annotated.pm ok 429 - POD test for Bio\SeqFeature\AnnotationAdaptor.pm ok 430 - POD test for Bio\SeqFeature\Collection.pm ok 431 - POD test for Bio\SeqFeature\CollectionI.pm ok 432 - POD test for Bio\SeqFeature\Computation.pm ok 433 - POD test for Bio\SeqFeature\FeaturePair.pm ok 434 - POD test for Bio\SeqFeature\Generic.pm ok 435 - POD test for Bio\SeqFeature\Lite.pm ok 436 - POD test for Bio\SeqFeature\PositionProxy.pm ok 437 - POD test for Bio\SeqFeature\Primer.pm ok 438 - POD test for Bio\SeqFeature\Similarity.pm ok 439 - POD test for Bio\SeqFeature\SimilarityPair.pm ok 440 - POD test for Bio\SeqFeature\TypedSeqFeatureI.pm ok 441 - POD test for Bio\SeqIO\abi.pm ok 442 - POD test for Bio\SeqIO\ace.pm ok 443 - POD test for Bio\SeqIO\agave.pm ok 444 - POD test for Bio\SeqIO\alf.pm ok 445 - POD test for Bio\SeqIO\asciitree.pm ok 446 - POD test for Bio\SeqIO\bsml.pm ok 447 - POD test for Bio\SeqIO\bsml_sax.pm ok 448 - POD test for Bio\SeqIO\chadoxml.pm ok 449 - POD test for Bio\SeqIO\chaos.pm ok 450 - POD test for Bio\SeqIO\chaosxml.pm ok 451 - POD test for Bio\SeqIO\ctf.pm ok 452 - POD test for Bio\SeqIO\embl.pm ok 453 - POD test for Bio\SeqIO\embldriver.pm ok 454 - POD test for Bio\SeqIO\entrezgene.pm ok 455 - POD test for Bio\SeqIO\excel.pm ok 456 - POD test for Bio\SeqIO\exp.pm ok 457 - POD test for Bio\SeqIO\fasta.pm ok 458 - POD test for Bio\SeqIO\fastq.pm ok 459 - POD test for Bio\SeqIO\flybase_chadoxml.pm ok 460 - POD test for Bio\SeqIO\FTHelper.pm ok 461 - POD test for Bio\SeqIO\game.pm ok 462 - POD test for Bio\SeqIO\gbdriver.pm ok 463 - POD test for Bio\SeqIO\gcg.pm ok 464 - POD test for Bio\SeqIO\genbank.pm ok 465 - POD test for Bio\SeqIO\interpro.pm ok 466 - POD test for Bio\SeqIO\kegg.pm ok 467 - POD test for Bio\SeqIO\largefasta.pm ok 468 - POD test for Bio\SeqIO\lasergene.pm ok 469 - POD test for Bio\SeqIO\locuslink.pm ok 470 - POD test for Bio\SeqIO\metafasta.pm ok 471 - POD test for Bio\SeqIO\MultiFile.pm ok 472 - POD test for Bio\SeqIO\phd.pm ok 473 - POD test for Bio\SeqIO\pir.pm ok 474 - POD test for Bio\SeqIO\pln.pm ok 475 - POD test for Bio\SeqIO\qual.pm ok 476 - POD test for Bio\SeqIO\raw.pm ok 477 - POD test for Bio\SeqIO\scf.pm ok 478 - POD test for Bio\SeqIO\strider.pm ok 479 - POD test for Bio\SeqIO\swiss.pm ok 480 - POD test for Bio\SeqIO\swissdriver.pm ok 481 - POD test for Bio\SeqIO\tab.pm ok 482 - POD test for Bio\SeqIO\table.pm ok 483 - POD test for Bio\SeqIO\tigr.pm ok 484 - POD test for Bio\SeqIO\tigrxml.pm ok 485 - POD test for Bio\SeqIO\tinyseq.pm ok 486 - POD test for Bio\SeqIO\ztr.pm ok 487 - POD test for Bio\Structure\Atom.pm ok 488 - POD test for Bio\Structure\Chain.pm ok 489 - POD test for Bio\Structure\Entry.pm ok 490 - POD test for Bio\Structure\IO.pm ok 491 - POD test for Bio\Structure\Model.pm ok 492 - POD test for Bio\Structure\Residue.pm ok 493 - POD test for Bio\Structure\StructureI.pm ok 494 - POD test for Bio\Symbol\Alphabet.pm ok 495 - POD test for Bio\Symbol\AlphabetI.pm ok 496 - POD test for Bio\Symbol\DNAAlphabet.pm ok 497 - POD test for Bio\Symbol\ProteinAlphabet.pm ok 498 - POD test for Bio\Symbol\Symbol.pm ok 499 - POD test for Bio\Symbol\SymbolI.pm ok 500 - POD test for Bio\Taxonomy\FactoryI.pm ok 501 - POD test for Bio\Taxonomy\Node.pm ok 502 - POD test for Bio\Taxonomy\Taxon.pm ok 503 - POD test for Bio\Taxonomy\Tree.pm ok 504 - POD test for Bio\Tools\AlignFactory.pm ok 505 - POD test for Bio\Tools\AnalysisResult.pm ok 506 - POD test for Bio\Tools\Blat.pm ok 507 - POD test for Bio\Tools\CodonTable.pm ok 508 - POD test for Bio\Tools\Coil.pm ok 509 - POD test for Bio\Tools\dpAlign.pm ok 510 - POD test for Bio\Tools\ECnumber.pm ok 511 - POD test for Bio\Tools\EPCR.pm ok 512 - POD test for Bio\Tools\Eponine.pm ok 513 - POD test for Bio\Tools\ERPIN.pm ok 514 - POD test for Bio\Tools\Est2Genome.pm ok 515 - POD test for Bio\Tools\ESTScan.pm ok 516 - POD test for Bio\Tools\EUtilities.pm ok 517 - POD test for Bio\Tools\Fgenesh.pm ok 518 - POD test for Bio\Tools\FootPrinter.pm ok 519 - POD test for Bio\Tools\Gel.pm ok 520 - POD test for Bio\Tools\Geneid.pm ok 521 - POD test for Bio\Tools\Genemark.pm ok 522 - POD test for Bio\Tools\Genewise.pm ok 523 - POD test for Bio\Tools\Genomewise.pm ok 524 - POD test for Bio\Tools\Genscan.pm ok 525 - POD test for Bio\Tools\GFF.pm ok 526 - POD test for Bio\Tools\Glimmer.pm ok 527 - POD test for Bio\Tools\Grail.pm ok 528 - POD test for Bio\Tools\GuessSeqFormat.pm ok 529 - POD test for Bio\Tools\Hmmpfam.pm ok 530 - POD test for Bio\Tools\Infernal.pm ok 531 - POD test for Bio\Tools\ipcress.pm ok 532 - POD test for Bio\Tools\isPcr.pm ok 533 - POD test for Bio\Tools\IUPAC.pm ok 534 - POD test for Bio\Tools\Lucy.pm ok 535 - POD test for Bio\Tools\Match.pm ok 536 - POD test for Bio\Tools\MZEF.pm ok 537 - POD test for Bio\Tools\OddCodes.pm ok 538 - POD test for Bio\Tools\pICalculator.pm ok 539 - POD test for Bio\Tools\Primer3.pm ok 540 - POD test for Bio\Tools\Prints.pm ok 541 - POD test for Bio\Tools\Profile.pm ok 542 - POD test for Bio\Tools\Promoterwise.pm ok 543 - POD test for Bio\Tools\PrositeScan.pm ok 544 - POD test for Bio\Tools\Protparam.pm ok 545 - POD test for Bio\Tools\Pseudowise.pm ok 546 - POD test for Bio\Tools\pSW.pm ok 547 - POD test for Bio\Tools\QRNA.pm ok 548 - POD test for Bio\Tools\RandomDistFunctions.pm ok 549 - POD test for Bio\Tools\RepeatMasker.pm ok 550 - POD test for Bio\Tools\RNAMotif.pm ok 551 - POD test for Bio\Tools\Seg.pm ok 552 - POD test for Bio\Tools\SeqPattern.pm ok 553 - POD test for Bio\Tools\SeqStats.pm ok 554 - POD test for Bio\Tools\SeqWords.pm ok 555 - POD test for Bio\Tools\Sigcleave.pm ok 556 - POD test for Bio\Tools\Signalp.pm ok 557 - POD test for Bio\Tools\SiRNA.pm ok 558 - POD test for Bio\Tools\TandemRepeatsFinder.pm ok 559 - POD test for Bio\Tools\TargetP.pm ok 560 - POD test for Bio\Tools\Tmhmm.pm ok 561 - POD test for Bio\Tools\tRNAscanSE.pm ok 562 - POD test for Bio\Tree\AlleleNode.pm ok 563 - POD test for Bio\Tree\AnnotatableNode.pm ok 564 - POD test for Bio\Tree\Compatible.pm ok 565 - POD test for Bio\Tree\DistanceFactory.pm ok 566 - POD test for Bio\Tree\Node.pm ok 567 - POD test for Bio\Tree\NodeI.pm ok 568 - POD test for Bio\Tree\NodeNHX.pm ok 569 - POD test for Bio\Tree\RandomFactory.pm ok 570 - POD test for Bio\Tree\Statistics.pm ok 571 - POD test for Bio\Tree\Tree.pm ok 572 - POD test for Bio\Tree\TreeFunctionsI.pm ok 573 - POD test for Bio\Tree\TreeI.pm ok 574 - POD test for Bio\TreeIO\cluster.pm ok 575 - POD test for Bio\TreeIO\lintree.pm ok 576 - POD test for Bio\TreeIO\newick.pm ok 577 - POD test for Bio\TreeIO\nexus.pm ok 578 - POD test for Bio\TreeIO\nhx.pm ok 579 - POD test for Bio\TreeIO\pag.pm ok 580 - POD test for Bio\TreeIO\phyloxml.pm ok 581 - POD test for Bio\TreeIO\svggraph.pm ok 582 - POD test for Bio\TreeIO\tabtree.pm ok 583 - POD test for Bio\TreeIO\TreeEventBuilder.pm ok 584 - POD test for Bio\Variation\AAChange.pm ok 585 - POD test for Bio\Variation\AAReverseMutate.pm ok 586 - POD test for Bio\Variation\Allele.pm ok 587 - POD test for Bio\Variation\DNAMutation.pm ok 588 - POD test for Bio\Variation\IO.pm ok 589 - POD test for Bio\Variation\RNAChange.pm ok 590 - POD test for Bio\Variation\SeqDiff.pm ok 591 - POD test for Bio\Variation\SNP.pm ok 592 - POD test for Bio\Variation\VariantI.pm ok 593 - POD test for scripts\biblio\biblio.PLS ok 594 - POD test for scripts\Bio-DB-EUtilities\einfo.PLS ok 595 - POD test for scripts\Bio-DB-GFF\bulk_load_gff.PLS ok 596 - POD test for scripts\Bio-DB-GFF\fast_load_gff.PLS ok 597 - POD test for scripts\Bio-DB-GFF\genbank2gff.PLS ok 598 - POD test for scripts\Bio-DB-GFF\genbank2gff3.PLS ok 599 - POD test for scripts\Bio-DB-GFF\generate_histogram.PLS ok 600 - POD test for scripts\Bio-DB-GFF\load_gff.PLS ok 601 - POD test for scripts\Bio-DB-GFF\meta_gff.PLS ok 602 - POD test for scripts\Bio-DB-GFF\process_gadfly.PLS ok 603 - POD test for scripts\Bio-DB-GFF\process_sgd.PLS ok 604 - POD test for scripts\Bio-DB-GFF\process_wormbase.PLS ok 605 - POD test for scripts\Bio-SeqFeature-Store\bp_seqfeature_delete.PLS (no pod) ok 606 - POD test for scripts\Bio-SeqFeature-Store\bp_seqfeature_gff3.PLS (no pod) ok 607 - POD test for scripts\Bio-SeqFeature-Store\bp_seqfeature_load.PLS (no pod) ok 608 - POD test for scripts\DB\biofetch_genbank_proxy.PLS ok 609 - POD test for scripts\DB\bioflat_index.PLS ok 610 - POD test for scripts\DB\biogetseq.PLS ok 611 - POD test for scripts\DB\flanks.PLS ok 612 - POD test for scripts\DB-HIV\hivq.PLS ok 613 - POD test for scripts\index\bp_fetch.PLS ok 614 - POD test for scripts\index\bp_index.PLS ok 615 - POD test for scripts\index\bp_seqret.PLS ok 616 - POD test for scripts\popgen\composite_LD.PLS ok 617 - POD test for scripts\popgen\heterogeneity_test.PLS ok 618 - POD test for scripts\searchio\fastam9_to_table.PLS ok 619 - POD test for scripts\searchio\filter_search.PLS ok 620 - POD test for scripts\searchio\hmmer_to_table.PLS ok 621 - POD test for scripts\searchio\parse_hmmsearch.PLS ok 622 - POD test for scripts\searchio\search2table.PLS ok 623 - POD test for scripts\seq\extract_feature_seq.PLS ok 624 - POD test for scripts\seq\make_mrna_protein.PLS ok 625 - POD test for scripts\seq\seqconvert.PLS ok 626 - POD test for scripts\seq\seqretsplit.PLS ok 627 - POD test for scripts\seq\split_seq.PLS ok 628 - POD test for scripts\seq\translate_seq.PLS ok 629 - POD test for scripts\seq\unflatten_seq.PLS ok 630 - POD test for scripts\seqstats\aacomp.PLS ok 631 - POD test for scripts\seqstats\chaos_plot.PLS ok 632 - POD test for scripts\seqstats\gccalc.PLS ok 633 - POD test for scripts\seqstats\oligo_count.PLS ok 634 - POD test for scripts\taxa\classify_hits_kingdom.PLS ok 635 - POD test for scripts\taxa\local_taxonomydb_query.PLS ok 636 - POD test for scripts\taxa\query_entrez_taxa.PLS ok 637 - POD test for scripts\taxa\taxid4species.PLS ok 638 - POD test for scripts\taxa\taxonomy2tree.PLS ok 639 - POD test for scripts\tree\blast2tree.PLS ok 640 - POD test for scripts\tree\nexus2nh.PLS ok 641 - POD test for scripts\tree\tree2pag.PLS ok 642 - POD test for scripts\utilities\bp_mrtrans.PLS ok 643 - POD test for scripts\utilities\bp_nrdb.PLS ok 644 - POD test for scripts\utilities\bp_sreformat.PLS ok 645 - POD test for scripts\utilities\dbsplit.PLS ok 646 - POD test for scripts\utilities\download_query_genbank.PLS ok 647 - POD test for scripts\utilities\mask_by_search.PLS ok 648 - POD test for scripts\utilities\mutate.PLS ok 649 - POD test for scripts\utilities\pairwise_kaks.PLS ok 650 - POD test for scripts\utilities\remote_blast.PLS ok 651 - POD test for scripts\utilities\revtrans-motif.PLS ok 652 - POD test for scripts\utilities\search2alnblocks.PLS ok 653 - POD test for scripts\utilities\search2BSML.PLS ok 654 - POD test for scripts\utilities\search2gff.PLS ok 655 - POD test for scripts\utilities\search2tribe.PLS ok 656 - POD test for scripts\utilities\seq_length.PLS ok 657 - POD test for examples\align\aligntutorial.pl (no pod) ok 658 - POD test for examples\align\align_on_codons.pl (no pod) ok 659 - POD test for examples\align\clustalw.pl (no pod) ok 660 - POD test for examples\align\simplealign.pl (no pod) ok 661 - POD test for examples\biblio\biblio-eutils-example.pl ok 662 - POD test for examples\biblio\biblio-soap-example.pl ok 663 - POD test for examples\biblio\biblio_soap.pl (no pod) ok 664 - POD test for examples\Bio-DB-GFF\load_ucsc.pl (no pod) ok 665 - POD test for examples\cluster\dbsnp.pl (no pod) ok 666 - POD test for examples\contributed\nmrpdb_parse.pl (no pod) ok 667 - POD test for examples\contributed\prosite2perl.pl (no pod) ok 668 - POD test for examples\contributed\rebase2list.pl (no pod) ok 669 - POD test for examples\db\dbfetch ok 670 - POD test for examples\db\est_tissue_query.pl (no pod) ok 671 - POD test for examples\db\gb2features.pl (no pod) ok 672 - POD test for examples\db\getGenBank.pl (no pod) ok 673 - POD test for examples\db\get_seqs.pl (no pod) ok 674 - POD test for examples\db\rfetch.pl (no pod) ok 675 - POD test for examples\db\use_registry.pl (no pod) ok 676 - POD test for examples\liveseq\change_gene.pl (no pod) ok 677 - POD test for examples\popgen\parse_calc_stats.pl (no pod) ok 678 - POD test for examples\quality\svgtrace.pl (no pod) ok 679 - POD test for examples\root\exceptions1.pl (no pod) ok 680 - POD test for examples\root\exceptions2.pl (no pod) ok 681 - POD test for examples\root\exceptions3.pl (no pod) ok 682 - POD test for examples\root\exceptions4.pl (no pod) ok 683 - POD test for examples\searchio\blast_example.pl (no pod) ok 684 - POD test for examples\searchio\custom_writer.pl (no pod) ok 685 - POD test for examples\searchio\hitwriter.pl (no pod) ok 686 - POD test for examples\searchio\hspwriter.pl (no pod) ok 687 - POD test for examples\searchio\htmlwriter.pl (no pod) ok 688 - POD test for examples\searchio\psiblast_features.pl (no pod) ok 689 - POD test for examples\searchio\psiblast_iterations.pl (no pod) ok 690 - POD test for examples\searchio\rawwriter.pl (no pod) ok 691 - POD test for examples\searchio\resultwriter.pl (no pod) ok 692 - POD test for examples\searchio\waba2gff.pl (no pod) ok 693 - POD test for examples\searchio\waba2gff3.pl ok 694 - POD test for examples\sirna\rnai_finder.cgi ok 695 - POD test for examples\structure\structure-io.pl (no pod) ok 696 - POD test for examples\tk\gsequence.pl (no pod) ok 697 - POD test for examples\tk\hitdisplay.pl (no pod) ok 698 - POD test for examples\tools\extract_genes.pl ok 699 - POD test for examples\tools\gb_to_gff.pl (no pod) ok 700 - POD test for examples\tools\gff2ps.pl ok 701 - POD test for examples\tools\parse_codeml.pl (no pod) ok 702 - POD test for examples\tools\psw.pl (no pod) ok 703 - POD test for examples\tools\reverse-translate.pl ok 704 - POD test for examples\tools\run_genscan.pl (no pod) ok 705 - POD test for examples\tools\run_primer3.pl ok 706 - POD test for examples\tools\seq_pattern.pl (no pod) ok 707 - POD test for examples\tools\standaloneblast.pl (no pod) ok 708 - POD test for examples\tree\paup2phylip.pl (no pod) ok 709 - POD test for Bio\AlignIO\Handler\GenericAlignHandler.pm ok 710 - POD test for Bio\Assembly\IO\ace.pm ok 711 - POD test for Bio\Assembly\IO\phrap.pm ok 712 - POD test for Bio\Assembly\IO\tigr.pm ok 713 - POD test for Bio\Assembly\Tools\ContigSpectrum.pm ok 714 - POD test for Bio\Biblio\IO\medline2ref.pm ok 715 - POD test for Bio\Biblio\IO\medlinexml.pm ok 716 - POD test for Bio\Biblio\IO\pubmed2ref.pm ok 717 - POD test for Bio\Biblio\IO\pubmedxml.pm ok 718 - POD test for Bio\Coordinate\Result\Gap.pm ok 719 - POD test for Bio\Coordinate\Result\Match.pm ok 720 - POD test for Bio\DB\Biblio\biofetch.pm ok 721 - POD test for Bio\DB\Biblio\eutils.pm ok 722 - POD test for Bio\DB\Biblio\soap.pm ok 723 - POD test for Bio\DB\Expression\geo.pm ok 724 - POD test for Bio\DB\Flat\BDB.pm ok 725 - POD test for Bio\DB\Flat\BinarySearch.pm ok 726 - POD test for Bio\DB\GFF\Aggregator.pm ok 727 - POD test for Bio\DB\GFF\Featname.pm ok 728 - POD test for Bio\DB\GFF\Feature.pm ok 729 - POD test for Bio\DB\GFF\Homol.pm ok 730 - POD test for Bio\DB\GFF\RelSegment.pm ok 731 - POD test for Bio\DB\GFF\Segment.pm ok 732 - POD test for Bio\DB\GFF\Typename.pm ok 733 - POD test for Bio\DB\HIV\HIVAnnotProcessor.pm ok 734 - POD test for Bio\DB\HIV\HIVQueryHelper.pm ok 735 - POD test for Bio\DB\Query\GenBank.pm ok 736 - POD test for Bio\DB\Query\HIVQuery.pm ok 737 - POD test for Bio\DB\Query\WebQuery.pm ok 738 - POD test for Bio\DB\SeqFeature\NormalizedFeature.pm ok 739 - POD test for Bio\DB\SeqFeature\NormalizedFeatureI.pm ok 740 - POD test for Bio\DB\SeqFeature\NormalizedTableFeatureI.pm ok 741 - POD test for Bio\DB\SeqFeature\Segment.pm ok 742 - POD test for Bio\DB\SeqFeature\Store.pm ok 743 - POD test for Bio\DB\SeqVersion\gi.pm ok 744 - POD test for Bio\DB\Taxonomy\entrez.pm ok 745 - POD test for Bio\DB\Taxonomy\flatfile.pm ok 746 - POD test for Bio\DB\Taxonomy\list.pm ok 747 - POD test for Bio\DB\TFBS\transfac_pro.pm ok 748 - POD test for Bio\Expression\FeatureGroup\FeatureGroupMas50.pm ok 749 - POD test for Bio\Expression\FeatureSet\FeatureSetMas50.pm ok 750 - POD test for Bio\LiveSeq\IO\BioPerl.pm ok 751 - POD test for Bio\LiveSeq\IO\Loader.pm ok 752 - POD test for Bio\Matrix\IO\mlagan.pm ok 753 - POD test for Bio\Matrix\IO\phylip.pm ok 754 - POD test for Bio\Matrix\IO\scoring.pm ok 755 - POD test for Bio\Matrix\PSM\InstanceSite.pm ok 756 - POD test for Bio\Matrix\PSM\InstanceSiteI.pm ok 757 - POD test for Bio\Matrix\PSM\IO.pm ok 758 - POD test for Bio\Matrix\PSM\ProtMatrix.pm ok 759 - POD test for Bio\Matrix\PSM\ProtPsm.pm ok 760 - POD test for Bio\Matrix\PSM\Psm.pm ok 761 - POD test for Bio\Matrix\PSM\PsmHeader.pm ok 762 - POD test for Bio\Matrix\PSM\PsmHeaderI.pm ok 763 - POD test for Bio\Matrix\PSM\PsmI.pm ok 764 - POD test for Bio\Matrix\PSM\SiteMatrix.pm ok 765 - POD test for Bio\Matrix\PSM\SiteMatrixI.pm ok 766 - POD test for Bio\Ontology\SimpleGOEngine\GraphAdaptor.pm ok 767 - POD test for Bio\Ontology\SimpleGOEngine\GraphAdaptor02.pm ok 768 - POD test for Bio\OntologyIO\Handlers\BaseSAXHandler.pm ok 769 - POD test for Bio\OntologyIO\Handlers\InterProHandler.pm ok 770 - POD test for Bio\OntologyIO\Handlers\InterPro_BioSQL_Handler.pm ok 771 - POD test for Bio\Phenotype\MeSH\Term.pm ok 772 - POD test for Bio\Phenotype\MeSH\Twig.pm ok 773 - POD test for Bio\Phenotype\OMIM\MiniMIMentry.pm ok 774 - POD test for Bio\Phenotype\OMIM\OMIMentry.pm ok 775 - POD test for Bio\Phenotype\OMIM\OMIMentryAllelicVariant.pm ok 776 - POD test for Bio\Phenotype\OMIM\OMIMparser.pm ok 777 - POD test for Bio\PopGen\IO\csv.pm ok 778 - POD test for Bio\PopGen\IO\hapmap.pm ok 779 - POD test for Bio\PopGen\IO\phase.pm ok 780 - POD test for Bio\PopGen\IO\prettybase.pm ok 781 - POD test for Bio\PopGen\Simulation\Coalescent.pm ok 782 - POD test for Bio\PopGen\Simulation\GeneticDrift.pm ok 783 - POD test for Bio\Restriction\Enzyme\MultiCut.pm ok 784 - POD test for Bio\Restriction\Enzyme\MultiSite.pm ok 785 - POD test for Bio\Restriction\IO\bairoch.pm ok 786 - POD test for Bio\Restriction\IO\base.pm ok 787 - POD test for Bio\Restriction\IO\itype2.pm ok 788 - POD test for Bio\Restriction\IO\prototype.pm ok 789 - POD test for Bio\Restriction\IO\withrefm.pm ok 790 - POD test for Bio\Root\Test\Warn.pm ok 791 - POD test for Bio\Search\Hit\BlastHit.pm ok 792 - POD test for Bio\Search\Hit\BlastPullHit.pm ok 793 - POD test for Bio\Search\Hit\Fasta.pm ok 794 - POD test for Bio\Search\Hit\GenericHit.pm ok 795 - POD test for Bio\Search\Hit\HitFactory.pm ok 796 - POD test for Bio\Search\Hit\HitI.pm ok 797 - POD test for Bio\Search\Hit\HMMERHit.pm ok 798 - POD test for Bio\Search\Hit\HmmpfamHit.pm ok 799 - POD test for Bio\Search\Hit\ModelHit.pm ok 800 - POD test for Bio\Search\Hit\PsiBlastHit.pm ok 801 - POD test for Bio\Search\Hit\PullHitI.pm ok 802 - POD test for Bio\Search\HSP\BlastHSP.pm ok 803 - POD test for Bio\Search\HSP\BlastPullHSP.pm ok 804 - POD test for Bio\Search\HSP\FastaHSP.pm ok 805 - POD test for Bio\Search\HSP\GenericHSP.pm ok 806 - POD test for Bio\Search\HSP\HMMERHSP.pm ok 807 - POD test for Bio\Search\HSP\HmmpfamHSP.pm ok 808 - POD test for Bio\Search\HSP\HSPFactory.pm ok 809 - POD test for Bio\Search\HSP\HSPI.pm ok 810 - POD test for Bio\Search\HSP\ModelHSP.pm ok 811 - POD test for Bio\Search\HSP\PsiBlastHSP.pm ok 812 - POD test for Bio\Search\HSP\PSLHSP.pm ok 813 - POD test for Bio\Search\HSP\PullHSPI.pm ok 814 - POD test for Bio\Search\HSP\WABAHSP.pm ok 815 - POD test for Bio\Search\Iteration\GenericIteration.pm ok 816 - POD test for Bio\Search\Iteration\IterationI.pm ok 817 - POD test for Bio\Search\Result\BlastPullResult.pm ok 818 - POD test for Bio\Search\Result\BlastResult.pm ok 819 - POD test for Bio\Search\Result\CrossMatchResult.pm ok 820 - POD test for Bio\Search\Result\GenericResult.pm ok 821 - POD test for Bio\Search\Result\HMMERResult.pm ok 822 - POD test for Bio\Search\Result\HmmpfamResult.pm ok 823 - POD test for Bio\Search\Result\PullResultI.pm ok 824 - POD test for Bio\Search\Result\ResultFactory.pm ok 825 - POD test for Bio\Search\Result\ResultI.pm ok 826 - POD test for Bio\Search\Result\WABAResult.pm ok 827 - POD test for Bio\Search\Tiling\MapTileUtils.pm ok 828 - POD test for Bio\Search\Tiling\MapTiling.pm ok 829 - POD test for Bio\Search\Tiling\TilingI.pm ok 830 - POD test for Bio\SearchIO\Writer\BSMLResultWriter.pm ok 831 - POD test for Bio\SearchIO\Writer\GbrowseGFF.pm ok 832 - POD test for Bio\SearchIO\Writer\HitTableWriter.pm ok 833 - POD test for Bio\SearchIO\Writer\HSPTableWriter.pm ok 834 - POD test for Bio\SearchIO\Writer\HTMLResultWriter.pm ok 835 - POD test for Bio\SearchIO\Writer\ResultTableWriter.pm ok 836 - POD test for Bio\SearchIO\Writer\TextResultWriter.pm ok 837 - POD test for Bio\SearchIO\XML\BlastHandler.pm ok 838 - POD test for Bio\SearchIO\XML\PsiBlastHandler.pm ok 839 - POD test for Bio\Seq\Meta\Array.pm ok 840 - POD test for Bio\SeqFeature\Gene\Exon.pm ok 841 - POD test for Bio\SeqFeature\Gene\ExonI.pm ok 842 - POD test for Bio\SeqFeature\Gene\GeneStructure.pm ok 843 - POD test for Bio\SeqFeature\Gene\GeneStructureI.pm ok 844 - POD test for Bio\SeqFeature\Gene\Intron.pm ok 845 - POD test for Bio\SeqFeature\Gene\NC_Feature.pm ok 846 - POD test for Bio\SeqFeature\Gene\Poly_A_site.pm ok 847 - POD test for Bio\SeqFeature\Gene\Promoter.pm ok 848 - POD test for Bio\SeqFeature\Gene\Transcript.pm ok 849 - POD test for Bio\SeqFeature\Gene\TranscriptI.pm ok 850 - POD test for Bio\SeqFeature\Gene\UTR.pm ok 851 - POD test for Bio\SeqFeature\SiRNA\Oligo.pm ok 852 - POD test for Bio\SeqFeature\SiRNA\Pair.pm ok 853 - POD test for Bio\SeqFeature\Tools\FeatureNamer.pm ok 854 - POD test for Bio\SeqFeature\Tools\IDHandler.pm ok 855 - POD test for Bio\SeqFeature\Tools\TypeMapper.pm ok 856 - POD test for Bio\SeqFeature\Tools\Unflattener.pm ok 857 - POD test for Bio\SeqIO\game\featHandler.pm ok 858 - POD test for Bio\SeqIO\game\gameHandler.pm ok 859 - POD test for Bio\SeqIO\game\gameSubs.pm ok 860 - POD test for Bio\SeqIO\game\gameWriter.pm ok 861 - POD test for Bio\SeqIO\game\seqHandler.pm ok 862 - POD test for Bio\SeqIO\Handler\GenericRichSeqHandler.pm ok 863 - POD test for Bio\SeqIO\tinyseq\tinyseqHandler.pm ok 864 - POD test for Bio\Structure\IO\pdb.pm ok 865 - POD test for Bio\Tools\Alignment\Consed.pm ok 866 - POD test for Bio\Tools\Alignment\Trim.pm ok 867 - POD test for Bio\Tools\Analysis\SimpleAnalysisBase.pm ok 868 - POD test for Bio\Tools\EMBOSS\Palindrome.pm ok 869 - POD test for Bio\Tools\EUtilities\Cookie.pm ok 870 - POD test for Bio\Tools\EUtilities\EUtilDataI.pm ok 871 - POD test for Bio\Tools\EUtilities\EUtilParameters.pm ok 872 - POD test for Bio\Tools\EUtilities\History.pm ok 873 - POD test for Bio\Tools\EUtilities\HistoryI.pm ok 874 - POD test for Bio\Tools\EUtilities\Info.pm ok 875 - POD test for Bio\Tools\EUtilities\Link.pm ok 876 - POD test for Bio\Tools\EUtilities\Query.pm ok 877 - POD test for Bio\Tools\EUtilities\Summary.pm ok 878 - POD test for Bio\Tools\HMMER\Domain.pm ok 879 - POD test for Bio\Tools\HMMER\Results.pm ok 880 - POD test for Bio\Tools\HMMER\Set.pm ok 881 - POD test for Bio\Tools\Phylo\Gerp.pm ok 882 - POD test for Bio\Tools\Phylo\Gumby.pm ok 883 - POD test for Bio\Tools\Phylo\Molphy.pm ok 884 - POD test for Bio\Tools\Phylo\PAML.pm ok 885 - POD test for Bio\Tools\Prediction\Exon.pm ok 886 - POD test for Bio\Tools\Prediction\Gene.pm ok 887 - POD test for Bio\Tools\Primer\AssessorI.pm ok 888 - POD test for Bio\Tools\Primer\Feature.pm ok 889 - POD test for Bio\Tools\Primer\Pair.pm ok 890 - POD test for Bio\Tools\Run\GenericParameters.pm ok 891 - POD test for Bio\Tools\Run\ParametersI.pm ok 892 - POD test for Bio\Tools\Run\RemoteBlast.pm ok 893 - POD test for Bio\Tools\Run\StandAloneBlast.pm ok 894 - POD test for Bio\Tools\Run\StandAloneNCBIBlast.pm ok 895 - POD test for Bio\Tools\Run\StandAloneWUBlast.pm ok 896 - POD test for Bio\Tools\Run\WrapperBase.pm ok 897 - POD test for Bio\Tools\SeqPattern\Backtranslate.pm ok 898 - POD test for Bio\Tools\Signalp\ExtendedSignalp.pm ok 899 - POD test for Bio\Tools\Sim4\Exon.pm ok 900 - POD test for Bio\Tools\Sim4\Results.pm ok 901 - POD test for Bio\Tools\Spidey\Exon.pm ok 902 - POD test for Bio\Tools\Spidey\Results.pm ok 903 - POD test for Bio\Tree\Draw\Cladogram.pm ok 904 - POD test for Bio\Variation\IO\flat.pm ok 905 - POD test for Bio\Variation\IO\xml.pm ok 906 - POD test for examples\root\lib\TestInterface.pm ok 907 - POD test for examples\root\lib\TestObject.pm ok 908 - POD test for Bio\DB\Flat\BDB\embl.pm ok 909 - POD test for Bio\DB\Flat\BDB\fasta.pm ok 910 - POD test for Bio\DB\Flat\BDB\genbank.pm ok 911 - POD test for Bio\DB\Flat\BDB\swiss.pm ok 912 - POD test for Bio\DB\GFF\Adaptor\ace.pm ok 913 - POD test for Bio\DB\GFF\Adaptor\berkeleydb.pm ok 914 - POD test for Bio\DB\GFF\Adaptor\biofetch.pm ok 915 - POD test for Bio\DB\GFF\Adaptor\biofetch_oracle.pm ok 916 - POD test for Bio\DB\GFF\Adaptor\dbi.pm ok 917 - POD test for Bio\DB\GFF\Adaptor\memory.pm ok 918 - POD test for Bio\DB\GFF\Aggregator\alignment.pm ok 919 - POD test for Bio\DB\GFF\Aggregator\clone.pm ok 920 - POD test for Bio\DB\GFF\Aggregator\coding.pm ok 921 - POD test for Bio\DB\GFF\Aggregator\gene.pm ok 922 - POD test for Bio\DB\GFF\Aggregator\match.pm ok 923 - POD test for Bio\DB\GFF\Aggregator\none.pm ok 924 - POD test for Bio\DB\GFF\Aggregator\orf.pm ok 925 - POD test for Bio\DB\GFF\Aggregator\processed_transcript.pm ok 926 - POD test for Bio\DB\GFF\Aggregator\so_transcript.pm ok 927 - POD test for Bio\DB\GFF\Aggregator\transcript.pm ok 928 - POD test for Bio\DB\GFF\Aggregator\ucsc_acembly.pm ok 929 - POD test for Bio\DB\GFF\Aggregator\ucsc_ensgene.pm ok 930 - POD test for Bio\DB\GFF\Aggregator\ucsc_genscan.pm ok 931 - POD test for Bio\DB\GFF\Aggregator\ucsc_refgene.pm ok 932 - POD test for Bio\DB\GFF\Aggregator\ucsc_sanger22.pm ok 933 - POD test for Bio\DB\GFF\Aggregator\ucsc_sanger22pseudo.pm ok 934 - POD test for Bio\DB\GFF\Aggregator\ucsc_softberry.pm ok 935 - POD test for Bio\DB\GFF\Aggregator\ucsc_twinscan.pm ok 936 - POD test for Bio\DB\GFF\Aggregator\ucsc_unigene.pm ok 937 - POD test for Bio\DB\GFF\Util\Binning.pm ok 938 - POD test for Bio\DB\GFF\Util\Rearrange.pm ok 939 - POD test for Bio\DB\SeqFeature\Store\bdb.pm ok 940 - POD test for Bio\DB\SeqFeature\Store\berkeleydb.pm ok 941 - POD test for Bio\DB\SeqFeature\Store\berkeleydb3.pm ok 942 - POD test for Bio\DB\SeqFeature\Store\FeatureFileLoader.pm ok 943 - POD test for Bio\DB\SeqFeature\Store\GFF2Loader.pm ok 944 - POD test for Bio\DB\SeqFeature\Store\GFF3Loader.pm ok 945 - POD test for Bio\DB\SeqFeature\Store\Loader.pm ok 946 - POD test for Bio\DB\SeqFeature\Store\LoadHelper.pm ok 947 - POD test for Bio\DB\SeqFeature\Store\memory.pm ok 948 - POD test for Bio\Matrix\PSM\IO\mast.pm ok 949 - POD test for Bio\Matrix\PSM\IO\masta.pm ok 950 - POD test for Bio\Matrix\PSM\IO\meme.pm ok 951 - POD test for Bio\Matrix\PSM\IO\psiblast.pm ok 952 - POD test for Bio\Matrix\PSM\IO\transfac.pm ok 953 - POD test for Bio\Structure\SecStr\DSSP\Res.pm ok 954 - POD test for Bio\Structure\SecStr\STRIDE\Res.pm ok 955 - POD test for Bio\Tools\Analysis\DNA\ESEfinder.pm ok 956 - POD test for Bio\Tools\Analysis\Protein\Domcut.pm ok 957 - POD test for Bio\Tools\Analysis\Protein\ELM.pm ok 958 - POD test for Bio\Tools\Analysis\Protein\GOR4.pm ok 959 - POD test for Bio\Tools\Analysis\Protein\HNN.pm ok 960 - POD test for Bio\Tools\Analysis\Protein\Mitoprot.pm ok 961 - POD test for Bio\Tools\Analysis\Protein\NetPhos.pm ok 962 - POD test for Bio\Tools\Analysis\Protein\Scansite.pm ok 963 - POD test for Bio\Tools\Analysis\Protein\Sopma.pm ok 964 - POD test for Bio\Tools\EUtilities\Info\FieldInfo.pm ok 965 - POD test for Bio\Tools\EUtilities\Info\LinkInfo.pm ok 966 - POD test for Bio\Tools\EUtilities\Link\LinkSet.pm ok 967 - POD test for Bio\Tools\EUtilities\Link\UrlLink.pm ok 968 - POD test for Bio\Tools\EUtilities\Query\GlobalQuery.pm ok 969 - POD test for Bio\Tools\EUtilities\Summary\DocSum.pm ok 970 - POD test for Bio\Tools\EUtilities\Summary\Item.pm ok 971 - POD test for Bio\Tools\EUtilities\Summary\ItemContainerI.pm ok 972 - POD test for Bio\Tools\Phylo\Molphy\Result.pm ok 973 - POD test for Bio\Tools\Phylo\PAML\ModelResult.pm ok 974 - POD test for Bio\Tools\Phylo\PAML\Result.pm ok 975 - POD test for Bio\Tools\Phylo\Phylip\ProtDist.pm ok 976 - POD test for Bio\Tools\Primer\Assessor\Base.pm ok 977 - POD test for Bio\Tools\SiRNA\Ruleset\saigo.pm ok 978 - POD test for Bio\Tools\SiRNA\Ruleset\tuschl.pm ok 979 - POD test for examples\root\lib\Bio\PrimarySeq.pm ok 980 - POD test for examples\root\lib\Bio\PrimarySeqI.pm ok 981 - POD test for examples\root\lib\Bio\Seq.pm ok 982 - POD test for examples\root\lib\Bio\SeqI.pm ok 983 - POD test for Bio\DB\GFF\Adaptor\berkeleydb\iterator.pm ok 984 - POD test for Bio\DB\GFF\Adaptor\dbi\caching_handle.pm ok 985 - POD test for Bio\DB\GFF\Adaptor\dbi\iterator.pm ok 986 - POD test for Bio\DB\GFF\Adaptor\dbi\mysql.pm ok 987 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlace.pm ok 988 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlcmap.pm ok 989 - POD test for Bio\DB\GFF\Adaptor\dbi\mysqlopt.pm ok 990 - POD test for Bio\DB\GFF\Adaptor\dbi\oracle.pm ok 991 - POD test for Bio\DB\GFF\Adaptor\dbi\oracleace.pm ok 992 - POD test for Bio\DB\GFF\Adaptor\dbi\pg.pm ok 993 - POD test for Bio\DB\GFF\Adaptor\dbi\pg_fts.pm ok 994 - POD test for Bio\DB\GFF\Adaptor\memory\feature_serializer.pm ok 995 - POD test for Bio\DB\GFF\Adaptor\memory\iterator.pm ok 996 - POD test for Bio\DB\SeqFeature\Store\DBI\Iterator.pm ok 997 - POD test for Bio\DB\SeqFeature\Store\DBI\mysql.pm ok 998 - POD test for Bio\DB\SeqFeature\Store\DBI\Pg.pm ok 999 - POD test for Bio\DB\SeqFeature\Store\DBI\SQLite.pm ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/PopGen/Coalescent.t ........................ 1..13 ok 1 - use Bio::PopGen::Simulation::Coalescent; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 - pi ok 7 - theta ok 8 - tajimaD ok 9 - all the mutations should be polymorphic (by definition) ok 10 - fu and li D ok 11 - fu and li D* ok 12 - fu and li F ok 13 - fu and li F ok t/PopGen/HtSNP.t ............................. 1..8 ok 1 - use Bio::PopGen::HtSNP; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/PopGen/MK.t ................................ 1..46 ok 1 - use Bio::AlignIO; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::PopGen::Utilities; ok 4 - The object isa Bio::PopGen::Statistics ok 5 - The object isa Bio::SimpleAlign ok 6 - The object isa Bio::PopGen::Population ok 7 - Marker Names ok 8 - Number of Inds ok 9 - number of ingroup sequences ok 10 - number of outgroup1 sequences ok 11 - number of outgroup2 sequences ok 12 - NSpoly ok 13 - NSfixed ok 14 - Spoly ok 15 - Sfixed ok 16 - McDonald Kreitman ok 17 - NSpoly ok 18 - NSfixed ok 19 - Spoly ok 20 - Sfixed ok 21 - McDonald Kreitman ok 22 - NSpoly ok 23 - NSfixed ok 24 - Spoly ok 25 - Sfixed ok 26 - The object isa Bio::SimpleAlign ok 27 - The object isa Bio::PopGen::Population ok 28 - Marker Names ok 29 - Number of Inds ok 30 - number of ingroup sequences ok 31 - number of outgroup1 sequences ok 32 - number of outgroup2 sequences ok 33 - NSpoly ok 34 - NSfixed ok 35 - Spoly ok 36 - Sfixed ok 37 - McDonald Kreitman ok 38 - NSpoly ok 39 - NSfixed ok 40 - Spoly ok 41 - Sfixed ok 42 - McDonald Kreitman ok 43 - NSpoly ok 44 - NSfixed ok 45 - Spoly ok 46 - Sfixed ok t/PopGen/PopGen.t ............................ 1..100 ok 1 - use Bio::PopGen::Individual; ok 2 - use Bio::PopGen::Genotype; ok 3 - use Bio::PopGen::Population; ok 4 - use Bio::PopGen::IO; ok 5 - use Bio::PopGen::PopStats; ok 6 - use Bio::AlignIO; ok 7 - use Bio::PopGen::Statistics; ok 8 - use Bio::PopGen::Utilities; ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - mrsa,mssa aflp1 ok 38 - all pops, aflp1 ok 39 - mrsa,envpop aflp1,aflp2 ok 40 ok 41 ok 42 ok 43 - mssa,mrsa all_bands ok 44 - env,mssa mkr1 ok 45 - env,mssa,mrsa all bands ok 46 - env,mssa,mrsa mkr2 ok 47 - mrsa,nc all_bands ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - Pi on 3-allele data ok 100 - Theta on 3-allele data ok t/PopGen/PopGenSims.t ........................ 1..23 ok 1 - use Bio::PopGen::Simulation::GeneticDrift; ok 2 - Allele freqs should sum to 1 ok 3 - Allele freqs should sum to 1 ok 4 - Allele freqs should sum to 1 ok 5 - Allele freqs should sum to 1 ok 6 - Allele freqs should sum to 1 ok 7 - Allele freqs should sum to 1 ok 8 - Allele freqs should sum to 1 ok 9 - Allele freqs should sum to 1 ok 10 - Allele freqs should sum to 1 ok 11 - Allele freqs should sum to 1 ok 12 ok 13 - All frequencies should be <= 1 ok 14 - Allele freqs should sum to 1 ok 15 - Allele freqs should sum to 1 ok 16 - Allele freqs should sum to 1 ok 17 - Allele freqs should sum to 1 ok 18 - Allele freqs should sum to 1 ok 19 - Allele freqs should sum to 1 ok 20 - Allele freqs should sum to 1 ok 21 - Allele freqs should sum to 1 ok 22 - Allele freqs should sum to 1 ok 23 - Allele freqs should sum to 1 ok t/PopGen/TagHaplotype.t ...................... 1..3 ok 1 - use Bio::PopGen::TagHaplotype; ok 2 ok 3 ok t/RemoteDB/BioFetch.t ........................ skipped: Network tests have not been requested t/RemoteDB/CUTG.t ............................ 1..37 ok 1 - use Bio::DB::CUTG; ok 2 - use Bio::CodonUsage::Table; ok 3 - use Bio::CodonUsage::IO; ok 4 - use Bio::SeqIO; ok 5 - use Bio::Tools::SeqStats; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok t/RemoteDB/EMBL.t ............................ skipped: Network tests have not been requested t/RemoteDB/EUtilities.t ...................... skipped: Network tests have not been requested t/RemoteDB/EntrezGene.t ...................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/RemoteDB/GenBank.t ......................... skipped: Network tests have not been requested t/RemoteDB/GenPept.t ......................... skipped: Network tests have not been requested t/RemoteDB/HIV/HIV.t ......................... 1..30 ok 1 - use Bio::DB::HIV; ok 2 - use Bio::DB::WebDBSeqI; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - The object isa Bio::DB::HIV ok 5 - The object isa Bio::Root::Root ok 6 - Bio::DB::HIV->can(...) ok 7 - Bio::DB::HIV->can(...) ok 8 - Bio::DB::HIV->can(...) ok 9 - lanl_base set in default object ok 10 - map_db set in default object ok 11 - make_search_if set in default object ok 12 - search_ set in default object ok 13 - url_base_address set in default object ok 14 - default sequence request format (fasta) ok 15 - sorry till implemented ok 16 - sorry till implemented ok 17 - HIVQuery type exception check ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVAnnotProcessor.t ........... 1..11 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - The object isa Bio::DB::HIV::HIVAnnotProcessor ok 5 - The object isa Bio::Root::Root ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...) ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query') ok 8 - bad type set exception ok 9 - attach stream ok 10 - write exception ok 11 - access stream ok Use of uninitialized value in join or string at (eval 73) line 15. t/RemoteDB/HIV/HIVQuery.t .................... 1..41 ok 1 - use Bio::DB::Query::HIVQuery; ok 2 - use Bio::DB::HIV; ok 3 - use Bio::Annotation::Collection; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::Reference; ok 6 - use Bio::DB::HIV::HIVQueryHelper; ok 7 - The object isa Bio::DB::Query::HIVQuery ok 8 - The object isa Bio::Root::Root ok 9 - Bio::DB::Query::HIVQuery->can(...) ok 10 - Bio::DB::Query::HIVQuery->can(...) ok 11 - Bio::DB::Query::HIVQuery->can(...) ok 12 - _map_db_uri set in default object ok 13 - _make_search_if_uri set in default object ok 14 - _search_uri set in default object ok 15 - _schema_file set in default object ok 16 - _run_option set in default object ok 17 - annotations container available ok 18 - query syntax check 1 ok 19 - query syntax check 2 ok 20 - query syntax check 3 ok 21 - query parser check ok 22 - multiquery parse check ok 23 - use HTML::Parser; ok 24 - help html to file ok 25 - help html parsed ok 26 - bad field exception check ok 27 - bad match data exception check ok 28 - empty field not ok exception check ok 29 - uninitialized schema exception check ok 30 - query not run (level 1) warning check ok 31 - query not run (level 2) warning check ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVQueryHelper.t .............. 1..40 ok 1 - use Bio::DB::HIV::HIVQueryHelper; ok 2 - The object isa HIVSchema ok 3 - The object isa QRY ok 4 - The object isa R ok 5 - The object isa Q ok 6 - schema load ok 7 - HIVSchema->can(...) ok 8 - fields complete ok 9 - tables complete ok 10 - aliases complete ok 11 ok 12 - test field syntax ok ok 13 - test field syntax ok ok 14 - test alias by field name ok 15 - correct primary key for SequenceEntry ok 16 - correct number of foreign keys for AUthor ok 17 - correct foreign table for au_pub_id ok 18 - correct annotation key hash ok 19 - QRY->can(...) ok 20 - R->can(...) ok 21 - Q->can(...) ok 22 - null QRY ok 23 - null R (request object) ok 24 - null Q (atomic query object) ok 25 - R obj create and init (1) ok 26 - R obj create and init (2) ok 27 - R::In ok 28 - !R::In ok 29 - R::Eq ok 30 - QRY obj create and init (1) ok 31 - QRY obj create and init (2) ok 32 - QRY obj create and init (3) ok 33 - QRY overload | ok 34 - QRY overload & ok 35 - QRY nontrivial & ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]} ok 37 - make: 2 queries returned ok 38 - {annotation fields} parsed correctly ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]} ok 40 - above query is null ok t/RemoteDB/MeSH.t ............................ skipped: Network tests have not been requested t/RemoteDB/Query/GenBank.t ................... skipped: Network tests have not been requested t/RemoteDB/RefSeq.t .......................... 1..16 ok 1 - use Bio::DB::RefSeq; ok 2 - use Bio::DB::GenBank; ok 3 - use Bio::DB::EMBL; ok 4 ok 5 ok 6 ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok t/RemoteDB/SeqHound.t ........................ skipped: Network tests have not been requested t/RemoteDB/SeqRead_fail.t .................... skipped: Network tests have not been requested t/RemoteDB/SeqVersion.t ...................... 1..10 ok 1 - use Bio::DB::SeqVersion; ok 2 ok 3 # skip Network tests have not been requested ok 4 # skip Network tests have not been requested ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok t/RemoteDB/SwissProt.t ....................... skipped: Network tests have not been requested ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio\DB\Taxonomy\flatfile.pm line 90. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 90. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:264 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:115 STACK: t/RemoteDB/Taxonomy.t:24 ----------------------------------------------------------- Bio::DB::Taxonomy: flatfile cannot be found Exception ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't locate DB_File.pm in @INC (@INC contains: . C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\lib C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe\blib\arch C:/cpanfly-5.8/var/cpan/build/BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\cpan\build\BioPerl-1.6.1-HRYBhe C:\cpanfly-5.8\var\megalib C:\Perl-5.8\site\lib C:\Perl-5.8\lib C:/cpanfly-5.8/var/megalib C:/Perl-5.8/site/lib C:/Perl-5.8/lib) at Bio\DB\Taxonomy\flatfile.pm line 90. BEGIN failed--compilation aborted at Bio\DB\Taxonomy\flatfile.pm line 90. Compilation failed in require at Bio/Root/Root.pm line 439. STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:368 STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:441 STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:264 STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:115 STACK: t/RemoteDB/Taxonomy.t:24 ----------------------------------------------------------- For more information about the Bio::DB::Taxonomy system please see the Bio::DB::Taxonomy docs. This includes ways of checking for formats at compile time, not run time. # Failed test at t/RemoteDB/Taxonomy.t line 24. Use of uninitialized value in string eq at t/RemoteDB/Taxonomy.t line 32. Can't call method "get_taxon" on an undefined value at t/RemoteDB/Taxonomy.t line 124. # Looks like you planned 103 tests but ran 82. # Looks like you failed 1 test of 82 run. # Looks like your test exited with 255 just after 82. t/RemoteDB/Taxonomy.t ........................ 1..103 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 not ok 4 ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok 42 # skip Network tests have not been requested ok 43 # skip Unable to connect to entrez database; no network or server busy? ok 44 # skip Unable to connect to entrez database; no network or server busy? ok 45 # skip Unable to connect to entrez database; no network or server busy? ok 46 # skip Unable to connect to entrez database; no network or server busy? ok 47 # skip Unable to connect to entrez database; no network or server busy? ok 48 # skip Unable to connect to entrez database; no network or server busy? ok 49 # skip Unable to connect to entrez database; no network or server busy? ok 50 # skip Unable to connect to entrez database; no network or server busy? ok 51 # skip Unable to connect to entrez database; no network or server busy? ok 52 # skip Unable to connect to entrez database; no network or server busy? ok 53 # skip Unable to connect to entrez database; no network or server busy? ok 54 # skip Unable to connect to entrez database; no network or server busy? ok 55 # skip Unable to connect to entrez database; no network or server busy? ok 56 # skip Unable to connect to entrez database; no network or server busy? ok 57 # skip Unable to connect to entrez database; no network or server busy? ok 58 # skip Unable to connect to entrez database; no network or server busy? ok 59 # skip Unable to connect to entrez database; no network or server busy? ok 60 # skip Unable to connect to entrez database; no network or server busy? ok 61 # skip Unable to connect to entrez database; no network or server busy? ok 62 # skip Unable to connect to entrez database; no network or server busy? ok 63 # skip Unable to connect to entrez database; no network or server busy? ok 64 # skip Unable to connect to entrez database; no network or server busy? ok 65 # skip Unable to connect to entrez database; no network or server busy? ok 66 # skip Unable to connect to entrez database; no network or server busy? ok 67 # skip Unable to connect to entrez database; no network or server busy? ok 68 # skip Unable to connect to entrez database; no network or server busy? ok 69 # skip Unable to connect to entrez database; no network or server busy? ok 70 # skip Unable to connect to entrez database; no network or server busy? ok 71 # skip Unable to connect to entrez database; no network or server busy? ok 72 # skip Unable to connect to entrez database; no network or server busy? ok 73 # skip Unable to connect to entrez database; no network or server busy? ok 74 # skip Unable to connect to entrez database; no network or server busy? ok 75 # skip Unable to connect to entrez database; no network or server busy? ok 76 # skip Unable to connect to entrez database; no network or server busy? ok 77 # skip Unable to connect to entrez database; no network or server busy? ok 78 # skip Unable to connect to entrez database; no network or server busy? ok 79 # skip Unable to connect to entrez database; no network or server busy? ok 80 # skip Unable to connect to entrez database; no network or server busy? ok 81 ok 82 Dubious, test returned 255 (wstat 65280, 0xff00) Failed 22/103 subtests (less 76 skipped subtests: 5 okay) t/Restriction/Analysis-refac.t ............... 1..29 ok 1 - use Bio::Restriction::IO; ok 2 - use Bio::Restriction::Analysis; ok 3 - read withrefm file ok 4 - parse withrefm file ok 5 - HindIII: nonambiguous intrasite cutter ok 6 - AarI: nonambiguous extrasite cutter ok 7 - AasI: ambiguous intrasite cutter ok 8 - BceSI: ambiguous extrasite cutter ok 9 - AjuI: cutter with central recog site ok 10 - TaqII: multi-extrasite cutter ok 11 ok 12 - HindIII plus ok 13 - HindIII minus ok 14 - AasI plus ok 15 - AasI minus ok 16 - AarI plus ok 17 - AarI minus ok 18 - BceSI plus ok 19 - BceSI minus ok 20 - AjuI plus ok 21 - AjuI minus ok 22 - TaqII plus ok 23 - TaqII minus ok 24 - build real B:R::Analysis object ok 25 - 13 fragments ok 26 - circularize ok 27 - recut ok 28 - circ: AasI # site at origin ok 29 - circ: still 13 fragments (cut site at origin) ok t/Restriction/Analysis.t ..................... 1..177 ok 1 - use Bio::Restriction::Enzyme; ok 2 - use Bio::Restriction::Enzyme::MultiCut; ok 3 - use Bio::Restriction::Enzyme::MultiSite; ok 4 - use Bio::Restriction::EnzymeCollection; ok 5 - use Bio::Restriction::Analysis; ok 6 - use Bio::SeqIO; ok 7 ok 8 - The object isa Bio::Restriction::EnzymeI ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - The object isa Bio::PrimarySeqI ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - bug 2179 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - The object isa Bio::Restriction::EnzymeI ok 77 - The object isa Bio::Restriction::EnzymeI ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - The object isa Bio::Restriction::EnzymeI ok 88 - The object isa Bio::Restriction::EnzymeI ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - The object isa Bio::Restriction::Enzyme ok 100 ok 101 ok 102 - The object isa Bio::Restriction::Enzyme ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 - number of unique cutters ok 119 - number of RsaI fragments ok 120 - number of maximum cutters ok 121 - number of zero cutters ok 122 - number of cutters ok 123 - number of 3x cutters ok 124 - 4 MseI fragments ok 125 - 3 MseI cut sites ok 126 - expected 2 PspEI fragments ok 127 ok 128 ok 129 - expected 2 sizes for PspEI ok 130 ok 131 - not circular expected 1 fragments for MwoI as it doesnt cut ok 132 ok 133 ok 134 - number of RsaI fragments ok 135 - 3 circular MseI fragments ok 136 - 3 circular MseI cut sites ok 137 - number for AciI a non-palindromic enzyme ok 138 - 1 fragment for MwoI as it cuts across the circ point ok 139 ok 140 ok 141 ok 142 ok 143 - 7 fragments in the multiple digest ok 144 - 7 positions in the multiple digest ok 145 - 7 sizes in the multiple digest ok 146 ok 147 - expected 9 cuts for HindI ok 148 - expect 9 fragment maps for HindI ok 149 - sequence for GT ok 150 - start at 40 ok 151 - end at 41 ok 152 - sequence for GGATTAAAAAAAGAGT ok 153 - start at 42 ok 154 - end at 57 ok 155 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT ok 156 - start at 58 ok 157 - end at 92 ok 158 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA ok 159 - start at 93 ok 160 - end at 123 ok 161 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA ok 162 - start at 124 ok 163 - end at 155 ok 164 - sequence for CAGACAGATAAAAATTACAGAGTACA ok 165 - start at 156 ok 166 - end at 181 ok 167 - sequence for CAACATCCATGAAACGCATTAGCA ok 168 - start at 182 ok 169 - end at 205 ok 170 - sequence for CCA ok 171 - start at 206 ok 172 - end at 208 ok 173 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT ok 174 - start at 209 ok 175 - end at 39 ok 176 ok 177 - bug 2139 ok t/Restriction/Gel.t .......................... 1..9 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Tools::Gel; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok Subroutine new redefined at Bio/Restriction/IO/base.pm line 91, line 532. Subroutine _initialize redefined at Bio/Restriction/IO/base.pm line 115, line 532. Subroutine read redefined at Bio/Restriction/IO/base.pm line 145, line 532. Subroutine _xln_sub redefined at Bio/Restriction/IO/base.pm line 173, line 532. Subroutine write redefined at Bio/Restriction/IO/base.pm line 190, line 532. Subroutine verify_prototype redefined at Bio/Restriction/IO/base.pm line 222, line 532. Subroutine _cuts_from_site redefined at Bio/Restriction/IO/base.pm line 259, line 532. Subroutine _meth redefined at Bio/Restriction/IO/base.pm line 280, line 532. Subroutine _coordinate_shift_to_cut redefined at Bio/Restriction/IO/base.pm line 306, line 532. Subroutine _make_multisites redefined at Bio/Restriction/IO/base.pm line 328, line 532. Subroutine _make_multicuts redefined at Bio/Restriction/IO/base.pm line 413, line 532. Subroutine _companies redefined at Bio/Restriction/IO/base.pm line 442, line 532. t/Restriction/IO.t ........................... 1..18 ok 1 - use Bio::Restriction::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT! # Failed (TODO) test at t/Restriction/IO.t line 31. ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok t/Root/Exception.t ........................... 1..8 ok 1 - use TestObject; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Root/RootI.t ............................... 1..56 ok 1 - use Bio::Root::Root; ok 2 - use Bio::Seq; ok 3 ok 4 - The object isa Bio::Root::RootI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - simple ok 16 - simple ok 17 - warns for versions below current version 1.006001 ok 18 - warns for versions below current version 1.006001 ok 19 - throws for versions above 1.006001 ok 20 - throws for versions above 1.006001 ok 21 - throws for versions equal to 1.006001 ok 22 - simple ok 23 - simple ok 24 - warns for versions below current version 1.006001 ok 25 - warns for versions below current version 1.006001 ok 26 - throws for versions above 1.006001 ok 27 - throws for versions above 1.006001 ok 28 - arg callable since method was created ok 29 - mal-formed arg callable since method was created with good name ok 30 - Bio::Foo2->can('t3') ok 31 - Methods don't pollute original Bio::Root::Root namespace ok 32 - Bio::Foo2->can('test_4') ok 33 - Methods don't pollute original Bio::Root::Root namespace ok 34 - Bio::Foo3->can('t5') ok 35 - arg not in method list not created ok 36 - Bio::Foo3->can('t5') ok 37 - Methods don't pollute original Bio::Root::Root namespace ok 38 - verbose was set correctly ok 39 - synonym was set correctly ok 40 - real method of synonym was set correctly ok 41 - mal-formed arg correctly resolved to created method ok 42 - synonym of set method was set correctly ok 43 - Bio::Foo4->can('t7') ok 44 - Methods don't pollute original Bio::Root::Root namespace ok 45 - Bio::Foo4->can('test7') ok 46 - Methods don't pollute original Bio::Root::Root namespace ok 47 - Bio::Foo4->can('test_8') ok 48 - Methods don't pollute original Bio::Root::Root namespace ok 49 - Bio::Foo4->can('t8') ok 50 - Methods don't pollute original Bio::Root::Root namespace ok 51 - must use proper versioning scheme ok 52 - warns for versions >= 1.006001 ok 53 - warns for versions >= 1.006001 ok 54 - throws for versions >= 1.006001 ok 55 - throws for versions >= 1.006001 ok 56 - No warnings/exceptions below 1.006001 ok t/Root/RootIO.t .............................. 1..31 ok 1 - use Bio::Root::IO; ok 2 ok 3 - throw() ok 4 - throw() verbose(-1) ok 5 - warn() ok 6 - throw() verbose(1) ok 7 - stack_trace() ok 8 - set verbosity to 1 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - filename, read ok 15 ok 16 - filename, write ok 17 ok 18 ok 19 ok 20 - handle, read ok 21 ok 22 - handle, write ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok t/Root/Storable.t ............................ 1..35 ok 1 - use Bio::Root::Storable; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok t/Root/Tempfile.t ............................ 1..18 ok 1 - use Bio::Root::IO; ok 2 ok 3 - The object isa Bio::Root::IO ok 4 ok 5 ok 6 - auto UNLINK => 1 ok 7 ok 8 ok 9 - tempfile deleted ok 10 ok 11 - UNLINK => 0 ok 12 ok 13 ok 14 ok 15 - tempfile suffix ok 16 ok 17 - tempfile() in scalar context ok 18 ok t/Root/Utilities.t ........................... 1..56 ok 1 - use Bio::Root::Utilities; ok 2 - The object isa Bio::Root::Utilities ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - file_date() ok 38 - unix (\n or 012 or ^J) ok 39 - date format ok 40 - date format ok 41 - date format ok 42 - date format ok 43 - date format ok 44 ok 45 # skip gzip not found, skipping gzip tests ok 46 # skip gzip not found, skipping gzip tests ok 47 # skip gzip not found, skipping gzip tests ok 48 # skip gzip not found, skipping gzip tests ok 49 # skip gzip not found, skipping gzip tests ok 50 # skip gzip not found, skipping gzip tests ok 51 # skip gzip not found, skipping gzip tests ok 52 # skip gzip not found, skipping gzip tests ok 53 # skip gzip not found, skipping gzip tests ok 54 # skip gzip not found, skipping gzip tests ok 55 # skip gzip not found, skipping gzip tests ok 56 # skip gzip not found, skipping gzip tests ok t/SearchDist.t ............................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 434. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 434. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 434. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 434. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 434. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 434. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 434. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 434. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 434. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 434. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 434. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 434. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 434. t/SearchIO/CigarString.t ..................... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/SearchIO.t ........................ 1..19 ok 1 - use Bio::SearchIO; ok 2 - blastxml for f.blastxml ok 3 - fasta for f.fy ok 4 - exonerate for f.exonerate ok 5 - blast for f.tblx ok 6 - fasta for f.fx ok 7 - fasta for f.osearch ok 8 - blast for filename.bls ok 9 - exonerate for f.exon ok 10 - fasta for f.SSEARCH.m9 ok 11 - blast for filename.blast ok 12 - fasta for f.m9 ok 13 - blast for f.blx ok 14 - blastxml for f.xml ok 15 - fasta for f.fasta ok 16 - fasta for f.fa ok 17 - blast for fast.bls ok 18 - fasta for f.ssearch ok 19 - fasta for f.psearch ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 434. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 434. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 434. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 434. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 434. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 434. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 434. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 434. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 434. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 434. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 434. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 434. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 434. t/SearchIO/SimilarityPair.t .................. 1..12 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SeqIO; ok 3 ok 4 - The object isa Bio::SeqI ok 5 ok 6 - The object isa Bio::SearchIO ok 7 ok 8 - The object isa Bio::Search::Hit::HitI ok 9 ok 10 - The object isa Bio::SeqFeatureI ok 11 ok 12 ok Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 128. Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 201. Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 225. Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 245. Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 265. Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 285. Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 305. Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 330. Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 352. Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 375. Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 390. Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 420. Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 448. Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 484. Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 507. Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 528. Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 554. Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 566. Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 595. Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 642. Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 684. Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 730. Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 776. Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 839. Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 877. Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 938. Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1015. Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1083. Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1140. Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1216. Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1264. Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1300. Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1354. Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1390. Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1432. Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1463. Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1525. Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1564. Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1580. Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1608. Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1656. Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1673. Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1691. Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1722. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1323. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1331. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\Search\Hit\BlastHit.pm line 106. Subroutine iteration redefined at Bio\Search\Hit\BlastHit.pm line 135. Subroutine found_again redefined at Bio\Search\Hit\BlastHit.pm line 170. Subroutine expect redefined at Bio\Search\Hit\BlastHit.pm line 177. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 2564. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 2564. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 2564. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 2564. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 2564. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 2564. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 2564. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 2564. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 2564. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 2564. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 2564. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 2564. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 2564. t/SearchIO/Tiling.t .......................... 1..1093 ok 1 - use Bio::Search::Tiling::MapTiling; ok 2 - use Bio::Search::Tiling::MapTileUtils; ok 3 - use Bio::SearchIO; ok 4 - use Bio::Search::Hit::BlastHit; ok 5 - use File::Spec; ok 6 - parse data file ok 7 - got test hit ok 8 - create tiling ok 9 - The object isa Bio::Search::Tiling::TilingI ok 10 - implements 'next_tiling' ok 11 - implements 'rewind_tilings' ok 12 - implements 'identities' ok 13 - implements 'conserved' ok 14 - implements 'length' ok 15 - identities regression test ok 16 - conserved regression test ok 17 - tiling iterator regression test(1) ok 18 - tiling iterator regression test(2) ok 19 - tiling iterator regression test(3, rewind) ok 20 - ecolitst.wublastp ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - dnaEbsub_ecoli.wublastx ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - tricky.wublast ok 37 - tricky.wublast(1) ok 38 - tricky.wublast(2) ok 39 - tricky.wublast(3) ok 40 - tricky.wublast(4) ok 41 - ecolitst.bls ok 42 - tile ecolitst.bls hit 1 \#hsps 1 ok 43 - q id: est (0.98293) = fast (0.98293) ok 44 - q cn: est (0.98293) = fast (0.98293) ok 45 - h id: est (0.98293) = fast (0.98293) ok 46 - h cn: est (0.98293) = fast (0.98293) ok 47 - tile ecolitst.bls hit 2 \#hsps 1 ok 48 - q id: est (0.30074) = fast (0.30074) ok 49 - q cn: est (0.49876) = fast (0.49876) ok 50 - h id: est (0.30759) = fast (0.30759) ok 51 - h cn: est (0.51013) = fast (0.51013) ok 52 - tile ecolitst.bls hit 3 \#hsps 1 ok 53 - q id: est (0.31004) = fast (0.31004) ok 54 - q cn: est (0.49782) = fast (0.49782) ok 55 - h id: est (0.32054) = fast (0.32054) ok 56 - h cn: est (0.51467) = fast (0.51467) ok 57 - tile ecolitst.bls hit 4 \#hsps 1 ok 58 - q id: est (0.30435) = fast (0.30435) ok 59 - q cn: est (0.47826) = fast (0.47826) ok 60 - h id: est (0.29787) = fast (0.29787) ok 61 - h cn: est (0.46809) = fast (0.46809) ok 62 - tricky.wublast ok 63 - tile tricky.wublast hit 1 \#hsps 7 ok 64 - q id: exact (0.22153) ~ est (0.22153) ok 65 - q id: exact (0.22153) <= max (0.22153) ok 66 - q cn: exact (0.42760) ~ est (0.42760) ok 67 - q cn: exact (0.42760) <= max (0.42760) ok 68 - h id: exact (0.22704) ~ est (0.22704) ok 69 - h id: exact (0.22704) <= max (0.22704) ok 70 - h cn: exact (0.43335) ~ est (0.43335) ok 71 - h cn: exact (0.43335) <= max (0.43335) ok 72 - a_thaliana.blastn ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1 ok 74 - q id: est (0.96667) = fast (0.96667) ok 75 - q cn: est (0.96667) = fast (0.96667) ok 76 - h id: est (0.98305) = fast (0.98305) ok 77 - h cn: est (0.98305) = fast (0.98305) ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1 ok 79 - q id: est (0.96667) = fast (0.96667) ok 80 - q cn: est (0.96667) = fast (0.96667) ok 81 - h id: est (0.98305) = fast (0.98305) ok 82 - h cn: est (0.98305) = fast (0.98305) ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1 ok 84 - q id: est (1.00000) = fast (1.00000) ok 85 - q cn: est (1.00000) = fast (1.00000) ok 86 - h id: est (1.00000) = fast (1.00000) ok 87 - h cn: est (1.00000) = fast (1.00000) ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1 ok 89 - q id: est (1.00000) = fast (1.00000) ok 90 - q cn: est (1.00000) = fast (1.00000) ok 91 - h id: est (1.00000) = fast (1.00000) ok 92 - h cn: est (1.00000) = fast (1.00000) ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1 ok 94 - q id: est (0.92308) = fast (0.92308) ok 95 - q cn: est (0.92308) = fast (0.92308) ok 96 - h id: est (0.92308) = fast (0.92308) ok 97 - h cn: est (0.92308) = fast (0.92308) ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1 ok 99 - q id: est (1.00000) = fast (1.00000) ok 100 - q cn: est (1.00000) = fast (1.00000) ok 101 - h id: est (1.00000) = fast (1.00000) ok 102 - h cn: est (1.00000) = fast (1.00000) ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1 ok 104 - q id: est (1.00000) = fast (1.00000) ok 105 - q cn: est (1.00000) = fast (1.00000) ok 106 - h id: est (1.00000) = fast (1.00000) ok 107 - h cn: est (1.00000) = fast (1.00000) ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1 ok 109 - q id: est (1.00000) = fast (1.00000) ok 110 - q cn: est (1.00000) = fast (1.00000) ok 111 - h id: est (1.00000) = fast (1.00000) ok 112 - h cn: est (1.00000) = fast (1.00000) ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1 ok 114 - q id: est (1.00000) = fast (1.00000) ok 115 - q cn: est (1.00000) = fast (1.00000) ok 116 - h id: est (1.00000) = fast (1.00000) ok 117 - h cn: est (1.00000) = fast (1.00000) ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1 ok 119 - q id: est (1.00000) = fast (1.00000) ok 120 - q cn: est (1.00000) = fast (1.00000) ok 121 - h id: est (1.00000) = fast (1.00000) ok 122 - h cn: est (1.00000) = fast (1.00000) ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1 ok 124 - q id: est (1.00000) = fast (1.00000) ok 125 - q cn: est (1.00000) = fast (1.00000) ok 126 - h id: est (1.00000) = fast (1.00000) ok 127 - h cn: est (1.00000) = fast (1.00000) ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1 ok 129 - q id: est (1.00000) = fast (1.00000) ok 130 - q cn: est (1.00000) = fast (1.00000) ok 131 - h id: est (1.00000) = fast (1.00000) ok 132 - h cn: est (1.00000) = fast (1.00000) ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1 ok 134 - q id: est (1.00000) = fast (1.00000) ok 135 - q cn: est (1.00000) = fast (1.00000) ok 136 - h id: est (1.00000) = fast (1.00000) ok 137 - h cn: est (1.00000) = fast (1.00000) ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1 ok 139 - q id: est (1.00000) = fast (1.00000) ok 140 - q cn: est (1.00000) = fast (1.00000) ok 141 - h id: est (1.00000) = fast (1.00000) ok 142 - h cn: est (1.00000) = fast (1.00000) ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1 ok 144 - q id: est (1.00000) = fast (1.00000) ok 145 - q cn: est (1.00000) = fast (1.00000) ok 146 - h id: est (1.00000) = fast (1.00000) ok 147 - h cn: est (1.00000) = fast (1.00000) ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1 ok 149 - q id: est (1.00000) = fast (1.00000) ok 150 - q cn: est (1.00000) = fast (1.00000) ok 151 - h id: est (1.00000) = fast (1.00000) ok 152 - h cn: est (1.00000) = fast (1.00000) ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1 ok 154 - q id: est (1.00000) = fast (1.00000) ok 155 - q cn: est (1.00000) = fast (1.00000) ok 156 - h id: est (1.00000) = fast (1.00000) ok 157 - h cn: est (1.00000) = fast (1.00000) ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1 ok 159 - q id: est (1.00000) = fast (1.00000) ok 160 - q cn: est (1.00000) = fast (1.00000) ok 161 - h id: est (1.00000) = fast (1.00000) ok 162 - h cn: est (1.00000) = fast (1.00000) ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1 ok 164 - q id: est (1.00000) = fast (1.00000) ok 165 - q cn: est (1.00000) = fast (1.00000) ok 166 - h id: est (1.00000) = fast (1.00000) ok 167 - h cn: est (1.00000) = fast (1.00000) ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1 ok 169 - q id: est (0.95238) = fast (0.95238) ok 170 - q cn: est (0.95238) = fast (0.95238) ok 171 - h id: est (0.95238) = fast (0.95238) ok 172 - h cn: est (0.95238) = fast (0.95238) ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1 ok 174 - q id: est (1.00000) = fast (1.00000) ok 175 - q cn: est (1.00000) = fast (1.00000) ok 176 - h id: est (1.00000) = fast (1.00000) ok 177 - h cn: est (1.00000) = fast (1.00000) ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1 ok 179 - q id: est (0.95238) = fast (0.95238) ok 180 - q cn: est (0.95238) = fast (0.95238) ok 181 - h id: est (0.95238) = fast (0.95238) ok 182 - h cn: est (0.95238) = fast (0.95238) ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1 ok 184 - q id: est (1.00000) = fast (1.00000) ok 185 - q cn: est (1.00000) = fast (1.00000) ok 186 - h id: est (1.00000) = fast (1.00000) ok 187 - h cn: est (1.00000) = fast (1.00000) ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1 ok 189 - q id: est (0.95238) = fast (0.95238) ok 190 - q cn: est (0.95238) = fast (0.95238) ok 191 - h id: est (0.95238) = fast (0.95238) ok 192 - h cn: est (0.95238) = fast (0.95238) ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1 ok 194 - q id: est (1.00000) = fast (1.00000) ok 195 - q cn: est (1.00000) = fast (1.00000) ok 196 - h id: est (1.00000) = fast (1.00000) ok 197 - h cn: est (1.00000) = fast (1.00000) ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1 ok 199 - q id: est (1.00000) = fast (1.00000) ok 200 - q cn: est (1.00000) = fast (1.00000) ok 201 - h id: est (1.00000) = fast (1.00000) ok 202 - h cn: est (1.00000) = fast (1.00000) ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1 ok 204 - q id: est (1.00000) = fast (1.00000) ok 205 - q cn: est (1.00000) = fast (1.00000) ok 206 - h id: est (1.00000) = fast (1.00000) ok 207 - h cn: est (1.00000) = fast (1.00000) ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1 ok 209 - q id: est (1.00000) = fast (1.00000) ok 210 - q cn: est (1.00000) = fast (1.00000) ok 211 - h id: est (1.00000) = fast (1.00000) ok 212 - h cn: est (1.00000) = fast (1.00000) ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1 ok 214 - q id: est (1.00000) = fast (1.00000) ok 215 - q cn: est (1.00000) = fast (1.00000) ok 216 - h id: est (1.00000) = fast (1.00000) ok 217 - h cn: est (1.00000) = fast (1.00000) ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1 ok 219 - q id: est (1.00000) = fast (1.00000) ok 220 - q cn: est (1.00000) = fast (1.00000) ok 221 - h id: est (1.00000) = fast (1.00000) ok 222 - h cn: est (1.00000) = fast (1.00000) ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1 ok 224 - q id: est (1.00000) = fast (1.00000) ok 225 - q cn: est (1.00000) = fast (1.00000) ok 226 - h id: est (1.00000) = fast (1.00000) ok 227 - h cn: est (1.00000) = fast (1.00000) ok 228 - brassica_ATH.WUBLASTN ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3 ok 230 - q id: exact (0.82465) ~ est (0.82343) ok 231 - q id: exact (0.82465) <= max (0.83333) ok 232 - q cn: exact (0.85590) ~ est (0.85312) ok 233 - q cn: exact (0.85590) <= max (0.86458) ok 234 - h id: exact (0.83920) ~ est (0.83920) ok 235 - h id: exact (0.83920) <= max (0.83920) ok 236 - h cn: exact (0.86935) ~ est (0.86935) ok 237 - h cn: exact (0.86935) <= max (0.86935) ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2 ok 239 - q id: exact (0.82486) ~ est (0.82486) ok 240 - q id: exact (0.82486) <= max (0.82486) ok 241 - q cn: exact (0.85122) ~ est (0.85122) ok 242 - q cn: exact (0.85122) <= max (0.85122) ok 243 - h id: exact (0.82955) ~ est (0.82955) ok 244 - h id: exact (0.82955) <= max (0.82955) ok 245 - h cn: exact (0.85606) ~ est (0.85606) ok 246 - h cn: exact (0.85606) <= max (0.85606) ok 247 - no_hsps.blastp ok 248 - tile no_hsps.blastp hit 1 \#hsps 0 ok 249 - tile no_hsps.blastp hit 2 \#hsps 0 ok 250 - tile no_hsps.blastp hit 3 \#hsps 0 ok 251 - tile no_hsps.blastp hit 4 \#hsps 0 ok 252 - tile no_hsps.blastp hit 5 \#hsps 0 ok 253 - tile no_hsps.blastp hit 6 \#hsps 0 ok 254 - tile no_hsps.blastp hit 7 \#hsps 0 ok 255 - tile no_hsps.blastp hit 8 \#hsps 0 ok 256 - tile no_hsps.blastp hit 9 \#hsps 0 ok 257 - tile no_hsps.blastp hit 10 \#hsps 0 ok 258 - tile no_hsps.blastp hit 11 \#hsps 0 ok 259 - tile no_hsps.blastp hit 12 \#hsps 0 ok 260 - tile no_hsps.blastp hit 13 \#hsps 0 ok 261 - tile no_hsps.blastp hit 14 \#hsps 0 ok 262 - tile no_hsps.blastp hit 15 \#hsps 0 ok 263 - tile no_hsps.blastp hit 16 \#hsps 0 ok 264 - tile no_hsps.blastp hit 17 \#hsps 0 ok 265 - tile no_hsps.blastp hit 18 \#hsps 0 ok 266 - tile no_hsps.blastp hit 19 \#hsps 0 ok 267 - tile no_hsps.blastp hit 20 \#hsps 0 ok 268 - tile no_hsps.blastp hit 21 \#hsps 0 ok 269 - tile no_hsps.blastp hit 22 \#hsps 0 ok 270 - tile no_hsps.blastp hit 23 \#hsps 0 ok 271 - tile no_hsps.blastp hit 24 \#hsps 0 ok 272 - tile no_hsps.blastp hit 25 \#hsps 0 ok 273 - tile no_hsps.blastp hit 26 \#hsps 0 ok 274 - tile no_hsps.blastp hit 27 \#hsps 0 ok 275 - tile no_hsps.blastp hit 28 \#hsps 0 ok 276 - tile no_hsps.blastp hit 29 \#hsps 0 ok 277 - tile no_hsps.blastp hit 30 \#hsps 0 ok 278 - tile no_hsps.blastp hit 31 \#hsps 0 ok 279 - tile no_hsps.blastp hit 32 \#hsps 0 ok 280 - tile no_hsps.blastp hit 33 \#hsps 0 ok 281 - tile no_hsps.blastp hit 34 \#hsps 0 ok 282 - tile no_hsps.blastp hit 35 \#hsps 0 ok 283 - tile no_hsps.blastp hit 36 \#hsps 0 ok 284 - tile no_hsps.blastp hit 37 \#hsps 0 ok 285 - tile no_hsps.blastp hit 38 \#hsps 0 ok 286 - tile no_hsps.blastp hit 39 \#hsps 0 ok 287 - tile no_hsps.blastp hit 40 \#hsps 0 ok 288 - tile no_hsps.blastp hit 41 \#hsps 0 ok 289 - tile no_hsps.blastp hit 42 \#hsps 0 ok 290 - tile no_hsps.blastp hit 43 \#hsps 0 ok 291 - tile no_hsps.blastp hit 44 \#hsps 0 ok 292 - tile no_hsps.blastp hit 45 \#hsps 0 ok 293 - tile no_hsps.blastp hit 46 \#hsps 0 ok 294 - tile no_hsps.blastp hit 47 \#hsps 0 ok 295 - tile no_hsps.blastp hit 48 \#hsps 0 ok 296 - tile no_hsps.blastp hit 49 \#hsps 0 ok 297 - tile no_hsps.blastp hit 50 \#hsps 0 ok 298 - tile no_hsps.blastp hit 51 \#hsps 0 ok 299 - tile no_hsps.blastp hit 52 \#hsps 0 ok 300 - tile no_hsps.blastp hit 53 \#hsps 0 ok 301 - tile no_hsps.blastp hit 54 \#hsps 0 ok 302 - tile no_hsps.blastp hit 55 \#hsps 0 ok 303 - tile no_hsps.blastp hit 56 \#hsps 0 ok 304 - tile no_hsps.blastp hit 57 \#hsps 0 ok 305 - tile no_hsps.blastp hit 58 \#hsps 0 ok 306 - tile no_hsps.blastp hit 59 \#hsps 0 ok 307 - tile no_hsps.blastp hit 60 \#hsps 0 ok 308 - tile no_hsps.blastp hit 61 \#hsps 0 ok 309 - tile no_hsps.blastp hit 62 \#hsps 0 ok 310 - tile no_hsps.blastp hit 63 \#hsps 0 ok 311 - tile no_hsps.blastp hit 64 \#hsps 0 ok 312 - tile no_hsps.blastp hit 65 \#hsps 0 ok 313 - tile no_hsps.blastp hit 66 \#hsps 0 ok 314 - tile no_hsps.blastp hit 67 \#hsps 0 ok 315 - tile no_hsps.blastp hit 68 \#hsps 0 ok 316 - tile no_hsps.blastp hit 69 \#hsps 0 ok 317 - tile no_hsps.blastp hit 70 \#hsps 0 ok 318 - tile no_hsps.blastp hit 71 \#hsps 0 ok 319 - tile no_hsps.blastp hit 72 \#hsps 0 ok 320 - tile no_hsps.blastp hit 73 \#hsps 0 ok 321 - tile no_hsps.blastp hit 74 \#hsps 0 ok 322 - tile no_hsps.blastp hit 75 \#hsps 0 ok 323 - tile no_hsps.blastp hit 76 \#hsps 0 ok 324 - tile no_hsps.blastp hit 77 \#hsps 0 ok 325 - tile no_hsps.blastp hit 78 \#hsps 0 ok 326 - tile no_hsps.blastp hit 79 \#hsps 0 ok 327 - tile no_hsps.blastp hit 80 \#hsps 0 ok 328 - tile no_hsps.blastp hit 81 \#hsps 0 ok 329 - tile no_hsps.blastp hit 82 \#hsps 0 ok 330 - tile no_hsps.blastp hit 83 \#hsps 0 ok 331 - tile no_hsps.blastp hit 84 \#hsps 0 ok 332 - tile no_hsps.blastp hit 85 \#hsps 0 ok 333 - tile no_hsps.blastp hit 86 \#hsps 0 ok 334 - tile no_hsps.blastp hit 87 \#hsps 0 ok 335 - tile no_hsps.blastp hit 88 \#hsps 0 ok 336 - tile no_hsps.blastp hit 89 \#hsps 0 ok 337 - tile no_hsps.blastp hit 90 \#hsps 0 ok 338 - tile no_hsps.blastp hit 91 \#hsps 0 ok 339 - tile no_hsps.blastp hit 92 \#hsps 0 ok 340 - tile no_hsps.blastp hit 93 \#hsps 0 ok 341 - tile no_hsps.blastp hit 94 \#hsps 0 ok 342 - tile no_hsps.blastp hit 95 \#hsps 0 ok 343 - tile no_hsps.blastp hit 96 \#hsps 0 ok 344 - tile no_hsps.blastp hit 97 \#hsps 0 ok 345 - tile no_hsps.blastp hit 98 \#hsps 0 ok 346 - tile no_hsps.blastp hit 99 \#hsps 0 ok 347 - tile no_hsps.blastp hit 100 \#hsps 0 ok 348 - tile no_hsps.blastp hit 101 \#hsps 0 ok 349 - tile no_hsps.blastp hit 102 \#hsps 0 ok 350 - tile no_hsps.blastp hit 103 \#hsps 0 ok 351 - tile no_hsps.blastp hit 104 \#hsps 0 ok 352 - tile no_hsps.blastp hit 105 \#hsps 0 ok 353 - tile no_hsps.blastp hit 106 \#hsps 0 ok 354 - tile no_hsps.blastp hit 107 \#hsps 0 ok 355 - tile no_hsps.blastp hit 108 \#hsps 0 ok 356 - tile no_hsps.blastp hit 109 \#hsps 0 ok 357 - tile no_hsps.blastp hit 110 \#hsps 0 ok 358 - tile no_hsps.blastp hit 111 \#hsps 0 ok 359 - tile no_hsps.blastp hit 112 \#hsps 0 ok 360 - tile no_hsps.blastp hit 113 \#hsps 0 ok 361 - tile no_hsps.blastp hit 114 \#hsps 0 ok 362 - tile no_hsps.blastp hit 115 \#hsps 0 ok 363 - tile no_hsps.blastp hit 116 \#hsps 0 ok 364 - tile no_hsps.blastp hit 117 \#hsps 0 ok 365 - tile no_hsps.blastp hit 118 \#hsps 0 ok 366 - tile no_hsps.blastp hit 119 \#hsps 0 ok 367 - tile no_hsps.blastp hit 120 \#hsps 0 ok 368 - tile no_hsps.blastp hit 121 \#hsps 0 ok 369 - tile no_hsps.blastp hit 122 \#hsps 0 ok 370 - tile no_hsps.blastp hit 123 \#hsps 0 ok 371 - tile no_hsps.blastp hit 124 \#hsps 0 ok 372 - tile no_hsps.blastp hit 125 \#hsps 0 ok 373 - tile no_hsps.blastp hit 126 \#hsps 0 ok 374 - tile no_hsps.blastp hit 127 \#hsps 0 ok 375 - tile no_hsps.blastp hit 128 \#hsps 0 ok 376 - tile no_hsps.blastp hit 129 \#hsps 0 ok 377 - tile no_hsps.blastp hit 130 \#hsps 0 ok 378 - tile no_hsps.blastp hit 131 \#hsps 0 ok 379 - tile no_hsps.blastp hit 132 \#hsps 0 ok 380 - tile no_hsps.blastp hit 133 \#hsps 0 ok 381 - tile no_hsps.blastp hit 134 \#hsps 0 ok 382 - tile no_hsps.blastp hit 135 \#hsps 0 ok 383 - tile no_hsps.blastp hit 136 \#hsps 0 ok 384 - tile no_hsps.blastp hit 137 \#hsps 0 ok 385 - tile no_hsps.blastp hit 138 \#hsps 0 ok 386 - tile no_hsps.blastp hit 139 \#hsps 0 ok 387 - tile no_hsps.blastp hit 140 \#hsps 0 ok 388 - tile no_hsps.blastp hit 141 \#hsps 0 ok 389 - tile no_hsps.blastp hit 142 \#hsps 0 ok 390 - tile no_hsps.blastp hit 143 \#hsps 0 ok 391 - tile no_hsps.blastp hit 144 \#hsps 0 ok 392 - tile no_hsps.blastp hit 145 \#hsps 0 ok 393 - tile no_hsps.blastp hit 146 \#hsps 0 ok 394 - tile no_hsps.blastp hit 147 \#hsps 0 ok 395 - tile no_hsps.blastp hit 148 \#hsps 0 ok 396 - tile no_hsps.blastp hit 149 \#hsps 0 ok 397 - tile no_hsps.blastp hit 150 \#hsps 0 ok 398 - tile no_hsps.blastp hit 151 \#hsps 0 ok 399 - tile no_hsps.blastp hit 152 \#hsps 0 ok 400 - tile no_hsps.blastp hit 153 \#hsps 0 ok 401 - tile no_hsps.blastp hit 154 \#hsps 0 ok 402 - tile no_hsps.blastp hit 155 \#hsps 0 ok 403 - tile no_hsps.blastp hit 156 \#hsps 0 ok 404 - tile no_hsps.blastp hit 157 \#hsps 0 ok 405 - tile no_hsps.blastp hit 158 \#hsps 0 ok 406 - tile no_hsps.blastp hit 159 \#hsps 0 ok 407 - tile no_hsps.blastp hit 160 \#hsps 0 ok 408 - tile no_hsps.blastp hit 161 \#hsps 0 ok 409 - tile no_hsps.blastp hit 162 \#hsps 0 ok 410 - tile no_hsps.blastp hit 163 \#hsps 0 ok 411 - tile no_hsps.blastp hit 164 \#hsps 0 ok 412 - tile no_hsps.blastp hit 165 \#hsps 0 ok 413 - tile no_hsps.blastp hit 166 \#hsps 0 ok 414 - tile no_hsps.blastp hit 167 \#hsps 0 ok 415 - tile no_hsps.blastp hit 168 \#hsps 0 ok 416 - tile no_hsps.blastp hit 169 \#hsps 0 ok 417 - tile no_hsps.blastp hit 170 \#hsps 0 ok 418 - tile no_hsps.blastp hit 171 \#hsps 0 ok 419 - tile no_hsps.blastp hit 172 \#hsps 0 ok 420 - tile no_hsps.blastp hit 173 \#hsps 0 ok 421 - tile no_hsps.blastp hit 174 \#hsps 0 ok 422 - tile no_hsps.blastp hit 175 \#hsps 0 ok 423 - tile no_hsps.blastp hit 176 \#hsps 0 ok 424 - tile no_hsps.blastp hit 177 \#hsps 0 ok 425 - tile no_hsps.blastp hit 178 \#hsps 0 ok 426 - tile no_hsps.blastp hit 179 \#hsps 0 ok 427 - tile no_hsps.blastp hit 180 \#hsps 0 ok 428 - tile no_hsps.blastp hit 181 \#hsps 0 ok 429 - tile no_hsps.blastp hit 182 \#hsps 0 ok 430 - tile no_hsps.blastp hit 183 \#hsps 0 ok 431 - tile no_hsps.blastp hit 184 \#hsps 0 ok 432 - tile no_hsps.blastp hit 185 \#hsps 0 ok 433 - tile no_hsps.blastp hit 186 \#hsps 0 ok 434 - tile no_hsps.blastp hit 187 \#hsps 0 ok 435 - tile no_hsps.blastp hit 188 \#hsps 0 ok 436 - tile no_hsps.blastp hit 189 \#hsps 0 ok 437 - tile no_hsps.blastp hit 190 \#hsps 0 ok 438 - tile no_hsps.blastp hit 191 \#hsps 0 ok 439 - tile no_hsps.blastp hit 192 \#hsps 0 ok 440 - tile no_hsps.blastp hit 193 \#hsps 0 ok 441 - tile no_hsps.blastp hit 194 \#hsps 0 ok 442 - tile no_hsps.blastp hit 195 \#hsps 0 ok 443 - tile no_hsps.blastp hit 196 \#hsps 0 ok 444 - tile no_hsps.blastp hit 197 \#hsps 0 ok 445 - tile no_hsps.blastp hit 198 \#hsps 0 ok 446 - tile no_hsps.blastp hit 199 \#hsps 0 ok 447 - tile no_hsps.blastp hit 200 \#hsps 0 ok 448 - tile no_hsps.blastp hit 201 \#hsps 0 ok 449 - tile no_hsps.blastp hit 202 \#hsps 0 ok 450 - tile no_hsps.blastp hit 203 \#hsps 0 ok 451 - tile no_hsps.blastp hit 204 \#hsps 0 ok 452 - tile no_hsps.blastp hit 205 \#hsps 0 ok 453 - tile no_hsps.blastp hit 206 \#hsps 0 ok 454 - tile no_hsps.blastp hit 207 \#hsps 0 ok 455 - tile no_hsps.blastp hit 208 \#hsps 0 ok 456 - tile no_hsps.blastp hit 209 \#hsps 0 ok 457 - tile no_hsps.blastp hit 210 \#hsps 0 ok 458 - tile no_hsps.blastp hit 211 \#hsps 0 ok 459 - tile no_hsps.blastp hit 212 \#hsps 0 ok 460 - tile no_hsps.blastp hit 213 \#hsps 0 ok 461 - tile no_hsps.blastp hit 214 \#hsps 0 ok 462 - tile no_hsps.blastp hit 215 \#hsps 0 ok 463 - tile no_hsps.blastp hit 216 \#hsps 0 ok 464 - tile no_hsps.blastp hit 217 \#hsps 0 ok 465 - tile no_hsps.blastp hit 218 \#hsps 0 ok 466 - tile no_hsps.blastp hit 219 \#hsps 0 ok 467 - tile no_hsps.blastp hit 220 \#hsps 0 ok 468 - tile no_hsps.blastp hit 221 \#hsps 0 ok 469 - tile no_hsps.blastp hit 222 \#hsps 0 ok 470 - tile no_hsps.blastp hit 223 \#hsps 0 ok 471 - tile no_hsps.blastp hit 224 \#hsps 0 ok 472 - tile no_hsps.blastp hit 225 \#hsps 0 ok 473 - tile no_hsps.blastp hit 226 \#hsps 0 ok 474 - tile no_hsps.blastp hit 227 \#hsps 0 ok 475 - tile no_hsps.blastp hit 228 \#hsps 0 ok 476 - tile no_hsps.blastp hit 229 \#hsps 0 ok 477 - tile no_hsps.blastp hit 230 \#hsps 0 ok 478 - tile no_hsps.blastp hit 231 \#hsps 0 ok 479 - tile no_hsps.blastp hit 232 \#hsps 0 ok 480 - tile no_hsps.blastp hit 233 \#hsps 0 ok 481 - tile no_hsps.blastp hit 234 \#hsps 0 ok 482 - tile no_hsps.blastp hit 235 \#hsps 0 ok 483 - tile no_hsps.blastp hit 236 \#hsps 0 ok 484 - tile no_hsps.blastp hit 237 \#hsps 0 ok 485 - tile no_hsps.blastp hit 238 \#hsps 0 ok 486 - tile no_hsps.blastp hit 239 \#hsps 0 ok 487 - tile no_hsps.blastp hit 240 \#hsps 0 ok 488 - tile no_hsps.blastp hit 241 \#hsps 0 ok 489 - tile no_hsps.blastp hit 242 \#hsps 0 ok 490 - tile no_hsps.blastp hit 243 \#hsps 0 ok 491 - tile no_hsps.blastp hit 244 \#hsps 0 ok 492 - tile no_hsps.blastp hit 245 \#hsps 0 ok 493 - tile no_hsps.blastp hit 246 \#hsps 0 ok 494 - tile no_hsps.blastp hit 247 \#hsps 0 ok 495 - tile no_hsps.blastp hit 248 \#hsps 0 ok 496 - tile no_hsps.blastp hit 249 \#hsps 0 ok 497 - tile no_hsps.blastp hit 250 \#hsps 0 ok 498 - tile no_hsps.blastp hit 251 \#hsps 0 ok 499 - tile no_hsps.blastp hit 252 \#hsps 0 ok 500 - tile no_hsps.blastp hit 253 \#hsps 0 ok 501 - tile no_hsps.blastp hit 254 \#hsps 0 ok 502 - tile no_hsps.blastp hit 255 \#hsps 0 ok 503 - tile no_hsps.blastp hit 256 \#hsps 0 ok 504 - tile no_hsps.blastp hit 257 \#hsps 0 ok 505 - tile no_hsps.blastp hit 258 \#hsps 0 ok 506 - tile no_hsps.blastp hit 259 \#hsps 0 ok 507 - tile no_hsps.blastp hit 260 \#hsps 0 ok 508 - tile no_hsps.blastp hit 261 \#hsps 0 ok 509 - tile no_hsps.blastp hit 262 \#hsps 0 ok 510 - tile no_hsps.blastp hit 263 \#hsps 0 ok 511 - tile no_hsps.blastp hit 264 \#hsps 0 ok 512 - tile no_hsps.blastp hit 265 \#hsps 0 ok 513 - tile no_hsps.blastp hit 266 \#hsps 0 ok 514 - tile no_hsps.blastp hit 267 \#hsps 0 ok 515 - tile no_hsps.blastp hit 268 \#hsps 0 ok 516 - tile no_hsps.blastp hit 269 \#hsps 0 ok 517 - tile no_hsps.blastp hit 270 \#hsps 0 ok 518 - tile no_hsps.blastp hit 271 \#hsps 0 ok 519 - tile no_hsps.blastp hit 272 \#hsps 0 ok 520 - tile no_hsps.blastp hit 273 \#hsps 0 ok 521 - tile no_hsps.blastp hit 274 \#hsps 0 ok 522 - tile no_hsps.blastp hit 275 \#hsps 0 ok 523 - tile no_hsps.blastp hit 276 \#hsps 0 ok 524 - tile no_hsps.blastp hit 277 \#hsps 0 ok 525 - tile no_hsps.blastp hit 278 \#hsps 0 ok 526 - tile no_hsps.blastp hit 279 \#hsps 0 ok 527 - tile no_hsps.blastp hit 280 \#hsps 0 ok 528 - tile no_hsps.blastp hit 281 \#hsps 0 ok 529 - tile no_hsps.blastp hit 282 \#hsps 0 ok 530 - tile no_hsps.blastp hit 283 \#hsps 0 ok 531 - tile no_hsps.blastp hit 284 \#hsps 0 ok 532 - tile no_hsps.blastp hit 285 \#hsps 0 ok 533 - tile no_hsps.blastp hit 286 \#hsps 0 ok 534 - tile no_hsps.blastp hit 287 \#hsps 0 ok 535 - tile no_hsps.blastp hit 288 \#hsps 0 ok 536 - tile no_hsps.blastp hit 289 \#hsps 0 ok 537 - tile no_hsps.blastp hit 290 \#hsps 0 ok 538 - tile no_hsps.blastp hit 291 \#hsps 0 ok 539 - tile no_hsps.blastp hit 292 \#hsps 0 ok 540 - tile no_hsps.blastp hit 293 \#hsps 0 ok 541 - tile no_hsps.blastp hit 294 \#hsps 0 ok 542 - tile no_hsps.blastp hit 295 \#hsps 0 ok 543 - tile no_hsps.blastp hit 296 \#hsps 0 ok 544 - tile no_hsps.blastp hit 297 \#hsps 0 ok 545 - tile no_hsps.blastp hit 298 \#hsps 0 ok 546 - tile no_hsps.blastp hit 299 \#hsps 0 ok 547 - tile no_hsps.blastp hit 300 \#hsps 0 ok 548 - tile no_hsps.blastp hit 301 \#hsps 0 ok 549 - tile no_hsps.blastp hit 302 \#hsps 0 ok 550 - tile no_hsps.blastp hit 303 \#hsps 0 ok 551 - tile no_hsps.blastp hit 304 \#hsps 0 ok 552 - tile no_hsps.blastp hit 305 \#hsps 0 ok 553 - tile no_hsps.blastp hit 306 \#hsps 0 ok 554 - tile no_hsps.blastp hit 307 \#hsps 0 ok 555 - tile no_hsps.blastp hit 308 \#hsps 0 ok 556 - tile no_hsps.blastp hit 309 \#hsps 0 ok 557 - tile no_hsps.blastp hit 310 \#hsps 0 ok 558 - tile no_hsps.blastp hit 311 \#hsps 0 ok 559 - tile no_hsps.blastp hit 312 \#hsps 0 ok 560 - tile no_hsps.blastp hit 313 \#hsps 0 ok 561 - tile no_hsps.blastp hit 314 \#hsps 0 ok 562 - tile no_hsps.blastp hit 315 \#hsps 0 ok 563 - tile no_hsps.blastp hit 316 \#hsps 0 ok 564 - tile no_hsps.blastp hit 317 \#hsps 0 ok 565 - tile no_hsps.blastp hit 318 \#hsps 0 ok 566 - tile no_hsps.blastp hit 319 \#hsps 0 ok 567 - tile no_hsps.blastp hit 320 \#hsps 0 ok 568 - tile no_hsps.blastp hit 321 \#hsps 0 ok 569 - tile no_hsps.blastp hit 322 \#hsps 0 ok 570 - tile no_hsps.blastp hit 323 \#hsps 0 ok 571 - tile no_hsps.blastp hit 324 \#hsps 0 ok 572 - tile no_hsps.blastp hit 325 \#hsps 0 ok 573 - tile no_hsps.blastp hit 326 \#hsps 0 ok 574 - tile no_hsps.blastp hit 327 \#hsps 0 ok 575 - tile no_hsps.blastp hit 328 \#hsps 0 ok 576 - tile no_hsps.blastp hit 329 \#hsps 0 ok 577 - tile no_hsps.blastp hit 330 \#hsps 0 ok 578 - tile no_hsps.blastp hit 331 \#hsps 0 ok 579 - tile no_hsps.blastp hit 332 \#hsps 0 ok 580 - tile no_hsps.blastp hit 333 \#hsps 0 ok 581 - tile no_hsps.blastp hit 334 \#hsps 0 ok 582 - tile no_hsps.blastp hit 335 \#hsps 0 ok 583 - tile no_hsps.blastp hit 336 \#hsps 0 ok 584 - tile no_hsps.blastp hit 337 \#hsps 0 ok 585 - tile no_hsps.blastp hit 338 \#hsps 0 ok 586 - tile no_hsps.blastp hit 339 \#hsps 0 ok 587 - tile no_hsps.blastp hit 340 \#hsps 0 ok 588 - tile no_hsps.blastp hit 341 \#hsps 0 ok 589 - tile no_hsps.blastp hit 342 \#hsps 0 ok 590 - tile no_hsps.blastp hit 343 \#hsps 0 ok 591 - tile no_hsps.blastp hit 344 \#hsps 0 ok 592 - tile no_hsps.blastp hit 345 \#hsps 0 ok 593 - tile no_hsps.blastp hit 346 \#hsps 0 ok 594 - tile no_hsps.blastp hit 347 \#hsps 0 ok 595 - tile no_hsps.blastp hit 348 \#hsps 0 ok 596 - tile no_hsps.blastp hit 349 \#hsps 0 ok 597 - tile no_hsps.blastp hit 350 \#hsps 0 ok 598 - tile no_hsps.blastp hit 351 \#hsps 0 ok 599 - tile no_hsps.blastp hit 352 \#hsps 0 ok 600 - tile no_hsps.blastp hit 353 \#hsps 0 ok 601 - tile no_hsps.blastp hit 354 \#hsps 0 ok 602 - tile no_hsps.blastp hit 355 \#hsps 0 ok 603 - tile no_hsps.blastp hit 356 \#hsps 0 ok 604 - tile no_hsps.blastp hit 357 \#hsps 0 ok 605 - tile no_hsps.blastp hit 358 \#hsps 0 ok 606 - tile no_hsps.blastp hit 359 \#hsps 0 ok 607 - tile no_hsps.blastp hit 360 \#hsps 0 ok 608 - tile no_hsps.blastp hit 361 \#hsps 0 ok 609 - tile no_hsps.blastp hit 362 \#hsps 0 ok 610 - tile no_hsps.blastp hit 363 \#hsps 0 ok 611 - tile no_hsps.blastp hit 364 \#hsps 0 ok 612 - tile no_hsps.blastp hit 365 \#hsps 0 ok 613 - tile no_hsps.blastp hit 366 \#hsps 0 ok 614 - tile no_hsps.blastp hit 367 \#hsps 0 ok 615 - tile no_hsps.blastp hit 368 \#hsps 0 ok 616 - tile no_hsps.blastp hit 369 \#hsps 0 ok 617 - tile no_hsps.blastp hit 370 \#hsps 0 ok 618 - tile no_hsps.blastp hit 371 \#hsps 0 ok 619 - tile no_hsps.blastp hit 372 \#hsps 0 ok 620 - tile no_hsps.blastp hit 373 \#hsps 0 ok 621 - tile no_hsps.blastp hit 374 \#hsps 0 ok 622 - tile no_hsps.blastp hit 375 \#hsps 0 ok 623 - tile no_hsps.blastp hit 376 \#hsps 0 ok 624 - tile no_hsps.blastp hit 377 \#hsps 0 ok 625 - tile no_hsps.blastp hit 378 \#hsps 0 ok 626 - tile no_hsps.blastp hit 379 \#hsps 0 ok 627 - tile no_hsps.blastp hit 380 \#hsps 0 ok 628 - tile no_hsps.blastp hit 381 \#hsps 0 ok 629 - tile no_hsps.blastp hit 382 \#hsps 0 ok 630 - tile no_hsps.blastp hit 383 \#hsps 0 ok 631 - tile no_hsps.blastp hit 384 \#hsps 0 ok 632 - tile no_hsps.blastp hit 385 \#hsps 0 ok 633 - tile no_hsps.blastp hit 386 \#hsps 0 ok 634 - tile no_hsps.blastp hit 387 \#hsps 0 ok 635 - tile no_hsps.blastp hit 388 \#hsps 0 ok 636 - tile no_hsps.blastp hit 389 \#hsps 0 ok 637 - tile no_hsps.blastp hit 390 \#hsps 0 ok 638 - tile no_hsps.blastp hit 391 \#hsps 0 ok 639 - tile no_hsps.blastp hit 392 \#hsps 0 ok 640 - tile no_hsps.blastp hit 393 \#hsps 0 ok 641 - tile no_hsps.blastp hit 394 \#hsps 0 ok 642 - tile no_hsps.blastp hit 395 \#hsps 0 ok 643 - tile no_hsps.blastp hit 396 \#hsps 0 ok 644 - tile no_hsps.blastp hit 397 \#hsps 0 ok 645 - tile no_hsps.blastp hit 398 \#hsps 0 ok 646 - tile no_hsps.blastp hit 399 \#hsps 0 ok 647 - tile no_hsps.blastp hit 400 \#hsps 0 ok 648 - tile no_hsps.blastp hit 401 \#hsps 0 ok 649 - tile no_hsps.blastp hit 402 \#hsps 0 ok 650 - tile no_hsps.blastp hit 403 \#hsps 0 ok 651 - tile no_hsps.blastp hit 404 \#hsps 0 ok 652 - tile no_hsps.blastp hit 405 \#hsps 0 ok 653 - tile no_hsps.blastp hit 406 \#hsps 0 ok 654 - tile no_hsps.blastp hit 407 \#hsps 0 ok 655 - tile no_hsps.blastp hit 408 \#hsps 0 ok 656 - tile no_hsps.blastp hit 409 \#hsps 0 ok 657 - tile no_hsps.blastp hit 410 \#hsps 0 ok 658 - tile no_hsps.blastp hit 411 \#hsps 0 ok 659 - tile no_hsps.blastp hit 412 \#hsps 0 ok 660 - tile no_hsps.blastp hit 413 \#hsps 0 ok 661 - tile no_hsps.blastp hit 414 \#hsps 0 ok 662 - tile no_hsps.blastp hit 415 \#hsps 0 ok 663 - catalase-webblast.BLASTP ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1 ok 665 - q id: est (1.00000) = fast (1.00000) ok 666 - q cn: est (1.00000) = fast (1.00000) ok 667 - h id: est (1.00000) = fast (1.00000) ok 668 - h cn: est (1.00000) = fast (1.00000) ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1 ok 670 - q id: est (0.80973) = fast (0.80973) ok 671 - q cn: est (0.89006) = fast (0.89006) ok 672 - h id: est (0.82543) = fast (0.82543) ok 673 - h cn: est (0.90733) = fast (0.90733) ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1 ok 675 - q id: est (0.71670) = fast (0.71670) ok 676 - q cn: est (0.84144) = fast (0.84144) ok 677 - h id: est (0.72747) = fast (0.72747) ok 678 - h cn: est (0.85408) = fast (0.85408) ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1 ok 680 - q id: est (0.58910) = fast (0.58910) ok 681 - q cn: est (0.70860) = fast (0.70860) ok 682 - h id: est (0.65654) = fast (0.65654) ok 683 - h cn: est (0.78972) = fast (0.78972) ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1 ok 685 - q id: est (0.49245) = fast (0.49245) ok 686 - q cn: est (0.65257) = fast (0.65257) ok 687 - h id: est (0.49544) = fast (0.49544) ok 688 - h cn: est (0.65653) = fast (0.65653) ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1 ok 690 - q id: est (0.44366) = fast (0.44366) ok 691 - q cn: est (0.58920) = fast (0.58920) ok 692 - h id: est (0.44787) = fast (0.44787) ok 693 - h cn: est (0.59479) = fast (0.59479) ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1 ok 695 - q id: est (0.42564) = fast (0.42564) ok 696 - q cn: est (0.61282) = fast (0.61282) ok 697 - h id: est (0.43229) = fast (0.43229) ok 698 - h cn: est (0.62240) = fast (0.62240) ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1 ok 700 - q id: est (0.48358) = fast (0.48358) ok 701 - q cn: est (0.63881) = fast (0.63881) ok 702 - h id: est (0.48943) = fast (0.48943) ok 703 - h cn: est (0.64653) = fast (0.64653) ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1 ok 705 - q id: est (0.42308) = fast (0.42308) ok 706 - q cn: est (0.61282) = fast (0.61282) ok 707 - h id: est (0.42969) = fast (0.42969) ok 708 - h cn: est (0.62240) = fast (0.62240) ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1 ok 710 - q id: est (0.39675) = fast (0.39675) ok 711 - q cn: est (0.58933) = fast (0.58933) ok 712 - h id: est (0.39767) = fast (0.39767) ok 713 - h cn: est (0.59070) = fast (0.59070) ok 714 - dcr1_sp.WUBLASTP ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1 ok 716 - q id: est (1.00000) = fast (1.00000) ok 717 - q cn: est (1.00000) = fast (1.00000) ok 718 - h id: est (1.00000) = fast (1.00000) ok 719 - h cn: est (1.00000) = fast (1.00000) ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4 ok 721 - q id: exact (0.36876) ~ est (0.36973) ok 722 - q id: exact (0.36876) <= max (0.37070) ok 723 - q cn: exact (0.55022) ~ est (0.55041) ok 724 - q cn: exact (0.55022) <= max (0.55105) ok 725 - h id: exact (0.35111) ~ est (0.35111) ok 726 - h id: exact (0.35111) <= max (0.35111) ok 727 - h cn: exact (0.52305) ~ est (0.52305) ok 728 - h cn: exact (0.52305) <= max (0.52305) ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1 ok 730 - q id: est (0.38685) = fast (0.38685) ok 731 - q cn: est (0.55397) = fast (0.55397) ok 732 - h id: est (0.37613) = fast (0.37613) ok 733 - h cn: est (0.53863) = fast (0.53863) ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1 ok 735 - q id: est (0.38247) = fast (0.38247) ok 736 - q cn: est (0.55068) = fast (0.55068) ok 737 - h id: est (0.37306) = fast (0.37306) ok 738 - h cn: est (0.53715) = fast (0.53715) ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5 ok 740 - q id: exact (0.35010) ~ est (0.35010) ok 741 - q id: exact (0.35010) <= max (0.35010) ok 742 - q cn: exact (0.53183) ~ est (0.53183) ok 743 - q cn: exact (0.53183) <= max (0.53183) ok 744 - h id: exact (0.35082) ~ est (0.35082) ok 745 - h id: exact (0.35082) <= max (0.35082) ok 746 - h cn: exact (0.53292) ~ est (0.53292) ok 747 - h cn: exact (0.53292) <= max (0.53292) ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8 ok 749 - q id: exact (0.30547) ~ est (0.30659) ok 750 - q id: exact (0.30547) <= max (0.30623) ok 751 - q cn: exact (0.50076) ~ est (0.50205) ok 752 - q cn: exact (0.50076) <= max (0.50076) ok 753 - h id: exact (0.31390) ~ est (0.31179) ok 754 - h id: exact (0.31390) <= max (0.31795) ok 755 - h cn: exact (0.50531) ~ est (0.50557) ok 756 - h cn: exact (0.50531) <= max (0.51091) ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7 ok 758 - q id: exact (0.30136) ~ est (0.30184) ok 759 - q id: exact (0.30136) <= max (0.30498) ok 760 - q cn: exact (0.48688) ~ est (0.48742) ok 761 - q cn: exact (0.48688) <= max (0.49140) ok 762 - h id: exact (0.30944) ~ est (0.31034) ok 763 - h id: exact (0.30944) <= max (0.30988) ok 764 - h cn: exact (0.50178) ~ est (0.50277) ok 765 - h cn: exact (0.50178) <= max (0.50223) ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10 ok 767 - q id: exact (0.28918) ~ est (0.28961) ok 768 - q id: exact (0.28918) <= max (0.28955) ok 769 - q cn: exact (0.46418) ~ est (0.46247) ok 770 - q cn: exact (0.46418) <= max (0.46866) ok 771 - h id: exact (0.30166) ~ est (0.30299) ok 772 - h id: exact (0.30166) <= max (0.30800) ok 773 - h cn: exact (0.48179) ~ est (0.48439) ok 774 - h cn: exact (0.48179) <= max (0.48535) ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8 ok 776 - q id: exact (0.30289) ~ est (0.30238) ok 777 - q id: exact (0.30289) <= max (0.30651) ok 778 - q cn: exact (0.49955) ~ est (0.49787) ok 779 - q cn: exact (0.49955) <= max (0.50362) ok 780 - h id: exact (0.31395) ~ est (0.31347) ok 781 - h id: exact (0.31395) <= max (0.31721) ok 782 - h cn: exact (0.51535) ~ est (0.51578) ok 783 - h cn: exact (0.51535) <= max (0.51814) ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5 ok 785 - q id: exact (0.29334) ~ est (0.29534) ok 786 - q id: exact (0.29334) <= max (0.29810) ok 787 - q cn: exact (0.46617) ~ est (0.46719) ok 788 - q cn: exact (0.46617) <= max (0.47040) ok 789 - h id: exact (0.31176) ~ est (0.31176) ok 790 - h id: exact (0.31176) <= max (0.31176) ok 791 - h cn: exact (0.49299) ~ est (0.49299) ok 792 - h cn: exact (0.49299) <= max (0.49299) ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7 ok 794 - q id: exact (0.30456) ~ est (0.30514) ok 795 - q id: exact (0.30456) <= max (0.30650) ok 796 - q cn: exact (0.48739) ~ est (0.48879) ok 797 - q cn: exact (0.48739) <= max (0.49370) ok 798 - h id: exact (0.32062) ~ est (0.31987) ok 799 - h id: exact (0.32062) <= max (0.32932) ok 800 - h cn: exact (0.51071) ~ est (0.51306) ok 801 - h cn: exact (0.51071) <= max (0.52410) ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8 ok 803 - q id: exact (0.29615) ~ est (0.29879) ok 804 - q id: exact (0.29615) <= max (0.30009) ok 805 - q cn: exact (0.47419) ~ est (0.47394) ok 806 - q cn: exact (0.47419) <= max (0.48119) ok 807 - h id: exact (0.31611) ~ est (0.31482) ok 808 - h id: exact (0.31611) <= max (0.32227) ok 809 - h cn: exact (0.49779) ~ est (0.49788) ok 810 - h cn: exact (0.49779) <= max (0.50616) ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8 ok 812 - q id: exact (0.30390) ~ est (0.30440) ok 813 - q id: exact (0.30390) <= max (0.30701) ok 814 - q cn: exact (0.45874) ~ est (0.45993) ok 815 - q cn: exact (0.45874) <= max (0.45963) ok 816 - h id: exact (0.32282) ~ est (0.32324) ok 817 - h id: exact (0.32282) <= max (0.32560) ok 818 - h cn: exact (0.48052) ~ est (0.48136) ok 819 - h cn: exact (0.48052) <= max (0.48330) ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6 ok 821 - q id: exact (0.29769) ~ est (0.29851) ok 822 - q id: exact (0.29769) <= max (0.29769) ok 823 - q cn: exact (0.48480) ~ est (0.48628) ok 824 - q cn: exact (0.48480) <= max (0.48637) ok 825 - h id: exact (0.30704) ~ est (0.30810) ok 826 - h id: exact (0.30704) <= max (0.30917) ok 827 - h cn: exact (0.50107) ~ est (0.50292) ok 828 - h cn: exact (0.50107) <= max (0.50320) ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6 ok 830 - q id: exact (0.27854) ~ est (0.27854) ok 831 - q id: exact (0.27854) <= max (0.27854) ok 832 - q cn: exact (0.48174) ~ est (0.48174) ok 833 - q cn: exact (0.48174) <= max (0.48174) ok 834 - h id: exact (0.28514) ~ est (0.28623) ok 835 - h id: exact (0.28514) <= max (0.28594) ok 836 - h cn: exact (0.49197) ~ est (0.49154) ok 837 - h cn: exact (0.49197) <= max (0.49237) ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8 ok 839 - q id: exact (0.30362) ~ est (0.30824) ok 840 - q id: exact (0.30362) <= max (0.30852) ok 841 - q cn: exact (0.47111) ~ est (0.47587) ok 842 - q cn: exact (0.47111) <= max (0.47405) ok 843 - h id: exact (0.32347) ~ est (0.32392) ok 844 - h id: exact (0.32347) <= max (0.32643) ok 845 - h cn: exact (0.49310) ~ est (0.49360) ok 846 - h cn: exact (0.49310) <= max (0.49606) ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4 ok 848 - q id: exact (0.29174) ~ est (0.29174) ok 849 - q id: exact (0.29174) <= max (0.29174) ok 850 - q cn: exact (0.46230) ~ est (0.46230) ok 851 - q cn: exact (0.46230) <= max (0.46230) ok 852 - h id: exact (0.30204) ~ est (0.30204) ok 853 - h id: exact (0.30204) <= max (0.30204) ok 854 - h cn: exact (0.47862) ~ est (0.47862) ok 855 - h cn: exact (0.47862) <= max (0.47862) ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6 ok 857 - q id: exact (0.29064) ~ est (0.29089) ok 858 - q id: exact (0.29064) <= max (0.29115) ok 859 - q cn: exact (0.48765) ~ est (0.48670) ok 860 - q cn: exact (0.48765) <= max (0.48868) ok 861 - h id: exact (0.29848) ~ est (0.29887) ok 862 - h id: exact (0.29848) <= max (0.29902) ok 863 - h cn: exact (0.50108) ~ est (0.50116) ok 864 - h cn: exact (0.50108) <= max (0.50163) ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5 ok 866 - q id: exact (0.29510) ~ est (0.29505) ok 867 - q id: exact (0.29510) <= max (0.29510) ok 868 - q cn: exact (0.48982) ~ est (0.49039) ok 869 - q cn: exact (0.48982) <= max (0.49029) ok 870 - h id: exact (0.30019) ~ est (0.30019) ok 871 - h id: exact (0.30019) <= max (0.30019) ok 872 - h cn: exact (0.49906) ~ est (0.49906) ok 873 - h cn: exact (0.49906) <= max (0.49906) ok 874 - 503384.MEGABLAST.2 ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5 ok 876 - q id: exact (0.91435) ~ est (0.91435) ok 877 - q id: exact (0.91435) <= max (0.91435) ok 878 - q cn: exact (0.91435) ~ est (0.91435) ok 879 - q cn: exact (0.91435) <= max (0.91435) ok 880 - h id: exact (0.91157) ~ est (0.91157) ok 881 - h id: exact (0.91157) <= max (0.91157) ok 882 - h cn: exact (0.91157) ~ est (0.91157) ok 883 - h cn: exact (0.91157) <= max (0.91157) ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9 ok 885 - q id: exact (0.92895) ~ est (0.92895) ok 886 - q id: exact (0.92895) <= max (0.92895) ok 887 - q cn: exact (0.92895) ~ est (0.92895) ok 888 - q cn: exact (0.92895) <= max (0.92895) ok 889 - h id: exact (0.92854) ~ est (0.92854) ok 890 - h id: exact (0.92854) <= max (0.92854) ok 891 - h cn: exact (0.92854) ~ est (0.92854) ok 892 - h cn: exact (0.92854) <= max (0.92854) ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3 ok 894 - q id: exact (0.93516) ~ est (0.93516) ok 895 - q id: exact (0.93516) <= max (0.93516) ok 896 - q cn: exact (0.93516) ~ est (0.93516) ok 897 - q cn: exact (0.93516) <= max (0.93516) ok 898 - h id: exact (0.93651) ~ est (0.93651) ok 899 - h id: exact (0.93651) <= max (0.93651) ok 900 - h cn: exact (0.93651) ~ est (0.93651) ok 901 - h cn: exact (0.93651) <= max (0.93651) ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3 ok 903 - q id: exact (0.93064) ~ est (0.93064) ok 904 - q id: exact (0.93064) <= max (0.93064) ok 905 - q cn: exact (0.93064) ~ est (0.93064) ok 906 - q cn: exact (0.93064) <= max (0.93064) ok 907 - h id: exact (0.92885) ~ est (0.92885) ok 908 - h id: exact (0.92885) <= max (0.92885) ok 909 - h cn: exact (0.92885) ~ est (0.92885) ok 910 - h cn: exact (0.92885) <= max (0.92885) ok 911 - bl2seq.blastx.out ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6 ok 913 - q id: est (0.71429) = fast (0.71429) ok 914 - q cn: est (1.00000) = fast (1.00000) ok 915 - q id: exact (0.70536) ~ est (0.70495) ok 916 - q id: exact (0.70536) <= max (0.94286) ok 917 - q cn: exact (0.78810) ~ est (0.78803) ok 918 - q cn: exact (0.78810) <= max (0.96429) ok 919 - q id: est (0.35714) = fast (0.35714) ok 920 - q cn: est (0.57143) = fast (0.57143) ok 921 - h id: exact (0.61923) ~ est (0.61955) ok 922 - h id: exact (0.61923) <= max (0.64231) ok 923 - h cn: exact (0.73077) ~ est (0.73077) ok 924 - h cn: exact (0.73077) <= max (0.75000) ok 925 - dnaEbsub_ecoli.wublastx ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1 ok 927 - q id: est (0.36386) = fast (0.36386) ok 928 - q cn: est (0.53735) = fast (0.53735) ok 929 - h id: est (0.36562) = fast (0.36562) ok 930 - h cn: est (0.53995) = fast (0.53995) ok 931 - tblastn.out ok 932 - tile tblastn.out hit 1 \#hsps 2 ok 933 - q id: exact (0.31250) ~ est (0.33325) ok 934 - q id: exact (0.31250) <= max (0.33333) ok 935 - q cn: exact (0.44792) ~ est (0.47055) ok 936 - q cn: exact (0.44792) <= max (0.45833) ok 937 - h id: exact (0.33333) ~ est (0.33333) ok 938 - h id: exact (0.33333) <= max (0.33333) ok 939 - h cn: exact (0.47059) ~ est (0.47059) ok 940 - h cn: exact (0.47059) <= max (0.47059) ok 941 - tile tblastn.out hit 2 \#hsps 2 ok 942 - q id: exact (0.68750) ~ est (0.68750) ok 943 - q id: exact (0.68750) <= max (0.68750) ok 944 - q cn: exact (0.81250) ~ est (0.81250) ok 945 - q cn: exact (0.81250) <= max (0.81250) ok 946 - h id: est (0.66667) = fast (0.66667) ok 947 - h cn: est (0.77778) = fast (0.77778) ok 948 - h id: est (0.71429) = fast (0.71429) ok 949 - h cn: est (0.85714) = fast (0.85714) ok 950 - dnaEbsub_ecoli.wutblastn ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1 ok 952 - q id: est (0.36386) = fast (0.36386) ok 953 - q cn: est (0.53735) = fast (0.53735) ok 954 - h id: est (0.36562) = fast (0.36562) ok 955 - h cn: est (0.53995) = fast (0.53995) ok 956 - HUMBETGLOA.tblastx ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1 ok 958 - q id: est (0.42308) = fast (0.42308) ok 959 - q cn: est (0.61538) = fast (0.61538) ok 960 - h id: est (0.42308) = fast (0.42308) ok 961 - h cn: est (0.61538) = fast (0.61538) ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1 ok 963 - q id: est (0.47059) = fast (0.47059) ok 964 - q cn: est (0.76471) = fast (0.76471) ok 965 - h id: est (0.47059) = fast (0.47059) ok 966 - h cn: est (0.76471) = fast (0.76471) ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1 ok 968 - q id: est (0.36000) = fast (0.36000) ok 969 - q cn: est (0.56000) = fast (0.56000) ok 970 - h id: est (0.36000) = fast (0.36000) ok 971 - h cn: est (0.56000) = fast (0.56000) ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1 ok 973 - q id: est (0.29268) = fast (0.29268) ok 974 - q cn: est (0.58537) = fast (0.58537) ok 975 - h id: est (0.29268) = fast (0.29268) ok 976 - h cn: est (0.58537) = fast (0.58537) ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1 ok 978 - q id: est (0.38889) = fast (0.38889) ok 979 - q cn: est (0.55556) = fast (0.55556) ok 980 - h id: est (0.38889) = fast (0.38889) ok 981 - h cn: est (0.55556) = fast (0.55556) ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1 ok 983 - q id: est (0.43590) = fast (0.43590) ok 984 - q cn: est (0.51282) = fast (0.51282) ok 985 - h id: est (0.43590) = fast (0.43590) ok 986 - h cn: est (0.51282) = fast (0.51282) ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1 ok 988 - q id: est (0.35714) = fast (0.35714) ok 989 - q cn: est (0.42857) = fast (0.42857) ok 990 - h id: est (0.35714) = fast (0.35714) ok 991 - h cn: est (0.42857) = fast (0.42857) ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1 ok 993 - q id: est (0.33333) = fast (0.33333) ok 994 - q cn: est (0.66667) = fast (0.66667) ok 995 - h id: est (0.33333) = fast (0.33333) ok 996 - h cn: est (0.66667) = fast (0.66667) ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2 ok 998 - q id: exact (0.40541) ~ est (0.40541) ok 999 - q id: exact (0.40541) <= max (0.40541) ok 1000 - q cn: exact (0.56757) ~ est (0.56757) ok 1001 - q cn: exact (0.56757) <= max (0.56757) ok 1002 - h id: est (0.36364) = fast (0.36364) ok 1003 - h cn: est (0.63636) = fast (0.63636) ok 1004 - h id: est (0.42308) = fast (0.42308) ok 1005 - h cn: est (0.53846) = fast (0.53846) ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1 ok 1007 - q id: est (0.29167) = fast (0.29167) ok 1008 - q cn: est (0.39583) = fast (0.39583) ok 1009 - h id: est (0.29167) = fast (0.29167) ok 1010 - h cn: est (0.39583) = fast (0.39583) ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1 ok 1012 - q id: est (0.60000) = fast (0.60000) ok 1013 - q cn: est (0.65000) = fast (0.65000) ok 1014 - h id: est (0.60000) = fast (0.60000) ok 1015 - h cn: est (0.65000) = fast (0.65000) ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1 ok 1017 - q id: est (0.50000) = fast (0.50000) ok 1018 - q cn: est (0.68182) = fast (0.68182) ok 1019 - h id: est (0.50000) = fast (0.50000) ok 1020 - h cn: est (0.68182) = fast (0.68182) ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1 ok 1022 - q id: est (0.29630) = fast (0.29630) ok 1023 - q cn: est (0.48148) = fast (0.48148) ok 1024 - h id: est (0.29630) = fast (0.29630) ok 1025 - h cn: est (0.48148) = fast (0.48148) ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1 ok 1027 - q id: est (0.47826) = fast (0.47826) ok 1028 - q cn: est (0.52174) = fast (0.52174) ok 1029 - h id: est (0.47826) = fast (0.47826) ok 1030 - h cn: est (0.52174) = fast (0.52174) ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1 ok 1032 - q id: est (0.47368) = fast (0.47368) ok 1033 - q cn: est (0.63158) = fast (0.63158) ok 1034 - h id: est (0.47368) = fast (0.47368) ok 1035 - h cn: est (0.63158) = fast (0.63158) ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1 ok 1037 - q id: est (0.44444) = fast (0.44444) ok 1038 - q cn: est (0.55556) = fast (0.55556) ok 1039 - h id: est (0.44444) = fast (0.44444) ok 1040 - h cn: est (0.55556) = fast (0.55556) ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1 ok 1042 - q id: est (0.47059) = fast (0.47059) ok 1043 - q cn: est (0.70588) = fast (0.70588) ok 1044 - h id: est (0.47059) = fast (0.47059) ok 1045 - h cn: est (0.70588) = fast (0.70588) ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1 ok 1047 - q id: est (0.38889) = fast (0.38889) ok 1048 - q cn: est (0.66667) = fast (0.66667) ok 1049 - h id: est (0.38889) = fast (0.38889) ok 1050 - h cn: est (0.66667) = fast (0.66667) ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1 ok 1052 - q id: est (0.27660) = fast (0.27660) ok 1053 - q cn: est (0.48936) = fast (0.48936) ok 1054 - h id: est (0.27660) = fast (0.27660) ok 1055 - h cn: est (0.48936) = fast (0.48936) ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1 ok 1057 - q id: est (0.40000) = fast (0.40000) ok 1058 - q cn: est (0.60000) = fast (0.60000) ok 1059 - h id: est (0.40000) = fast (0.40000) ok 1060 - h cn: est (0.60000) = fast (0.60000) ok 1061 - dnaEbsub_ecoli.wutblastx ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12 ok 1063 - q id: exact (0.40224) ~ est (0.40912) ok 1064 - q id: exact (0.40224) <= max (0.42628) ok 1065 - q cn: exact (0.58494) ~ est (0.58968) ok 1066 - q cn: exact (0.58494) <= max (0.62179) ok 1067 - q id: est (0.25352) = fast (0.25352) ok 1068 - q cn: est (0.47887) = fast (0.47887) ok 1069 - q id: est (0.37500) = fast (0.37500) ok 1070 - q cn: est (0.62500) = fast (0.62500) ok 1071 - q id: exact (0.44118) ~ est (0.44118) ok 1072 - q id: exact (0.44118) <= max (0.44118) ok 1073 - q cn: exact (0.54412) ~ est (0.54412) ok 1074 - q cn: exact (0.54412) <= max (0.54412) ok 1075 - h id: est (0.25352) = fast (0.25352) ok 1076 - h cn: est (0.47887) = fast (0.47887) ok 1077 - h id: exact (0.39848) ~ est (0.40304) ok 1078 - h id: exact (0.39848) <= max (0.40355) ok 1079 - h cn: exact (0.58376) ~ est (0.58889) ok 1080 - h cn: exact (0.58376) <= max (0.58883) ok 1081 - h id: exact (0.44118) ~ est (0.44118) ok 1082 - h id: exact (0.44118) <= max (0.44118) ok 1083 - h cn: exact (0.54412) ~ est (0.54412) ok 1084 - h cn: exact (0.54412) <= max (0.54412) ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2 ok 1086 - q id: exact (0.41818) ~ est (0.41818) ok 1087 - q id: exact (0.41818) <= max (0.41818) ok 1088 - q cn: exact (0.52727) ~ est (0.52727) ok 1089 - q cn: exact (0.52727) <= max (0.52727) ok 1090 - h id: est (0.53333) = fast (0.53333) ok 1091 - h cn: est (0.66667) = fast (0.66667) ok 1092 - h id: est (0.37500) = fast (0.37500) ok 1093 - h cn: est (0.47500) = fast (0.47500) ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 193. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 193. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 193. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 193. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 193. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 193. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 193. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 193. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 193. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 193. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 193. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 193. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 193. t/SearchIO/Writer/GbrowseGFF.t ............... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 353. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 353. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 353. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 353. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 353. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 353. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 353. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 353. t/SearchIO/Writer/HSPTableWriter.t ........... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HSPTableWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 353. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 353. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 353. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 353. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 353. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 353. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 353. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 353. t/SearchIO/Writer/HTMLWriter.t ............... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 353. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 353. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 353. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 353. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 353. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 353. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 353. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 353. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 353. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 353. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 353. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 353. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 353. t/SearchIO/Writer/HitTableWriter.t ........... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HitTableWriter; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Align::AlignI ok 8 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 245. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 245. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 245. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 245. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 245. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 245. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 245. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 245. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 245. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 245. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 245. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 245. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 245. t/SearchIO/blast.t ........................... 1..1093 ok 1 - use Bio::SearchIO; ok 2 - database_name() ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 not ok 387 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 543. # '0.852' # > # '0.9' not ok 388 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 544. # '1.599' # <= # '1' ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 - Multiblast query test ok 562 - Multiblast query test ok 563 - Multiblast query test ok 564 - Multiblast query test ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 ok 598 ok 599 ok 600 ok 601 ok 602 ok 603 ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 - The object isa Bio::Search::Result::ResultI ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 - The object isa Bio::Search::Result::ResultI ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 - The object isa Bio::Search::Result::ResultI ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 - The object isa Bio::Search::Result::ResultI ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 - The object isa Bio::Search::Result::ResultI ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 ok 906 ok 907 - The object isa Bio::Search::Result::ResultI ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 ok 930 - The object isa Bio::Search::Result::ResultI ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 - blastxml for f.blastxml ok 944 - fasta for f.fy ok 945 - exonerate for f.exonerate ok 946 - blast for f.tblx ok 947 - fasta for f.fx ok 948 - fasta for f.osearch ok 949 - blast for filename.bls ok 950 - exonerate for f.exon ok 951 - fasta for f.SSEARCH.m9 ok 952 - blast for filename.blast ok 953 - fasta for f.m9 ok 954 - blast for f.blx ok 955 - blastxml for f.xml ok 956 - fasta for f.fasta ok 957 - fasta for f.fa ok 958 - blast for fast.bls ok 959 - fasta for f.ssearch ok 960 - fasta for f.psearch ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 - full hit name ok 975 - hit accession ok 976 ok 977 ok 978 - query start ok 979 - query start ok 980 ok 981 ok 982 ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 ok 1007 ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 ok 1055 ok 1056 ok 1057 ok 1058 ok 1059 ok 1060 ok 1061 ok 1062 ok 1063 ok 1064 ok 1065 ok 1066 ok 1067 ok 1068 ok 1069 ok 1070 ok 1071 ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 ok 1084 ok 1085 ok 1086 ok 1087 ok 1088 ok 1089 ok 1090 ok 1091 ok 1092 ok 1093 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 46. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 46. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 46. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 46. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 46. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 46. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 46. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 46. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 46. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 46. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 46. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 46. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 46. t/SearchIO/blast_pull.t ...................... 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - database_name() ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 not ok 191 # TODO frac_identical failing! # Failed (TODO) test at t/SearchIO/blast_pull.t line 260. # got: '0.946' # expected: '0.943' ok 192 ok 193 ok 194 ok 195 ok 196 - Multiblast query test ok 197 - Multiblast query test ok 198 - Multiblast query test ok 199 - Multiblast query test ok 200 ok 201 ok 202 ok 203 - full hit name ok 204 - hit accession ok 205 ok 206 - query start ok 207 - query start ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio/Search/Hit/GenericHit.pm line 128. Subroutine add_hsp redefined at Bio/Search/Hit/GenericHit.pm line 201. Subroutine hsp_factory redefined at Bio/Search/Hit/GenericHit.pm line 225. Subroutine name redefined at Bio/Search/Hit/GenericHit.pm line 245. Subroutine accession redefined at Bio/Search/Hit/GenericHit.pm line 265. Subroutine description redefined at Bio/Search/Hit/GenericHit.pm line 285. Subroutine length redefined at Bio/Search/Hit/GenericHit.pm line 305. Subroutine algorithm redefined at Bio/Search/Hit/GenericHit.pm line 330. Subroutine raw_score redefined at Bio/Search/Hit/GenericHit.pm line 352. Subroutine score redefined at Bio/Search/Hit/GenericHit.pm line 375. Subroutine significance redefined at Bio/Search/Hit/GenericHit.pm line 390. Subroutine bits redefined at Bio/Search/Hit/GenericHit.pm line 420. Subroutine next_hsp redefined at Bio/Search/Hit/GenericHit.pm line 448. Subroutine hsps redefined at Bio/Search/Hit/GenericHit.pm line 484. Subroutine num_hsps redefined at Bio/Search/Hit/GenericHit.pm line 507. Subroutine rewind redefined at Bio/Search/Hit/GenericHit.pm line 528. Subroutine ambiguous_aln redefined at Bio/Search/Hit/GenericHit.pm line 554. Subroutine overlap redefined at Bio/Search/Hit/GenericHit.pm line 566. Subroutine n redefined at Bio/Search/Hit/GenericHit.pm line 595. Subroutine p redefined at Bio/Search/Hit/GenericHit.pm line 642. Subroutine hsp redefined at Bio/Search/Hit/GenericHit.pm line 684. Subroutine logical_length redefined at Bio/Search/Hit/GenericHit.pm line 730. Subroutine length_aln redefined at Bio/Search/Hit/GenericHit.pm line 776. Subroutine gaps redefined at Bio/Search/Hit/GenericHit.pm line 839. Subroutine matches redefined at Bio/Search/Hit/GenericHit.pm line 877. Subroutine start redefined at Bio/Search/Hit/GenericHit.pm line 938. Subroutine end redefined at Bio/Search/Hit/GenericHit.pm line 1015. Subroutine range redefined at Bio/Search/Hit/GenericHit.pm line 1083. Subroutine frac_identical redefined at Bio/Search/Hit/GenericHit.pm line 1140. Subroutine frac_conserved redefined at Bio/Search/Hit/GenericHit.pm line 1216. Subroutine frac_aligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1264. Subroutine frac_aligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1300. Subroutine num_unaligned_hit redefined at Bio/Search/Hit/GenericHit.pm line 1354. Subroutine num_unaligned_query redefined at Bio/Search/Hit/GenericHit.pm line 1390. Subroutine seq_inds redefined at Bio/Search/Hit/GenericHit.pm line 1432. Subroutine strand redefined at Bio/Search/Hit/GenericHit.pm line 1463. Subroutine frame redefined at Bio/Search/Hit/GenericHit.pm line 1525. Subroutine rank redefined at Bio/Search/Hit/GenericHit.pm line 1564. Subroutine locus redefined at Bio/Search/Hit/GenericHit.pm line 1580. Subroutine each_accession_number redefined at Bio/Search/Hit/GenericHit.pm line 1608. Subroutine tiled_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1656. Subroutine query_length redefined at Bio/Search/Hit/GenericHit.pm line 1673. Subroutine ncbi_gi redefined at Bio/Search/Hit/GenericHit.pm line 1691. Subroutine sort_hsps redefined at Bio/Search/Hit/GenericHit.pm line 1722. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1323. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio/Search/Hit/GenericHit.pm line 1331. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 420. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 420. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 420. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 420. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 420. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 420. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 420. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 420. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 420. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 420. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 420. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 420. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 420. t/SearchIO/blasttable.t ...................... 1..163 ok 1 - use Bio::SearchIO; ok 2 - use Bio::Search::SearchUtils; ok 3 - The object isa Bio::Search::Result::ResultI ok 4 ok 5 ok 6 - hit1_bits ok 7 - hit1_name ok 8 - hsp1_bits ok 9 - hsp1_gaps ok 10 - hsp1_he ok 11 - hsp1_hs ok 12 - hsp1_hstr ok 13 - hsp1_qe ok 14 - hsp1_qs ok 15 - hsp1_qstr ok 16 - hsp2_bits ok 17 - hsp2_gaps ok 18 - hsp2_he ok 19 - hsp2_hs ok 20 - hsp2_hstr ok 21 - hsp2_qe ok 22 - hsp2_qs ok 23 - hsp2_qstr ok 24 - hsp3_bits ok 25 - hsp3_gaps ok 26 - hsp3_he ok 27 - hsp3_hs ok 28 - hsp3_hstr ok 29 - hsp3_qe ok 30 - hsp3_qs ok 31 - hsp3_qstr ok 32 - hsp4_bits ok 33 - hsp4_gaps ok 34 - hsp4_he ok 35 - hsp4_hs ok 36 - hsp4_hstr ok 37 - hsp4_qe ok 38 - hsp4_qs ok 39 - hsp4_qstr ok 40 - hsp5_bits ok 41 - hsp5_gaps ok 42 - hsp5_he ok 43 - hsp5_hs ok 44 - hsp5_hstr ok 45 - hsp5_qe ok 46 - hsp5_qs ok 47 - hsp5_qstr ok 48 - hsp6_bits ok 49 - hsp6_gaps ok 50 - hsp6_he ok 51 - hsp6_hs ok 52 - hsp6_hstr ok 53 - hsp6_qe ok 54 - hsp6_qs ok 55 - hsp6_qstr ok 56 - hsp7_bits ok 57 - hsp7_gaps ok 58 - hsp7_he ok 59 - hsp7_hs ok 60 - hsp7_hstr ok 61 - hsp7_qe ok 62 - hsp7_qs ok 63 - hsp7_qstr ok 64 - hsp8_bits ok 65 - hsp8_gaps ok 66 - hsp8_he ok 67 - hsp8_hs ok 68 - hsp8_hstr ok 69 - hsp8_qe ok 70 - hsp8_qs ok 71 - hsp8_qstr ok 72 - query_name ok 73 - The object isa Bio::Search::Result::ResultI ok 74 ok 75 ok 76 - hit1_bits ok 77 - hit1_name ok 78 - hsp1_bits ok 79 - hsp1_gaps ok 80 - hsp1_he ok 81 - hsp1_hs ok 82 - hsp1_hstr ok 83 - hsp1_qe ok 84 - hsp1_qs ok 85 - hsp1_qstr ok 86 - hsp2_bits ok 87 - hsp2_gaps ok 88 - hsp2_he ok 89 - hsp2_hs ok 90 - hsp2_hstr ok 91 - hsp2_qe ok 92 - hsp2_qs ok 93 - hsp2_qstr ok 94 - hsp3_bits ok 95 - hsp3_gaps ok 96 - hsp3_he ok 97 - hsp3_hs ok 98 - hsp3_hstr ok 99 - hsp3_qe ok 100 - hsp3_qs ok 101 - hsp3_qstr ok 102 - hsp4_bits ok 103 - hsp4_gaps ok 104 - hsp4_he ok 105 - hsp4_hs ok 106 - hsp4_hstr ok 107 - hsp4_qe ok 108 - hsp4_qs ok 109 - hsp4_qstr ok 110 - hsp5_bits ok 111 - hsp5_gaps ok 112 - hsp5_he ok 113 - hsp5_hs ok 114 - hsp5_hstr ok 115 - hsp5_qe ok 116 - hsp5_qs ok 117 - hsp5_qstr ok 118 - hsp6_bits ok 119 - hsp6_gaps ok 120 - hsp6_he ok 121 - hsp6_hs ok 122 - hsp6_hstr ok 123 - hsp6_qe ok 124 - hsp6_qs ok 125 - hsp6_qstr ok 126 - hsp7_bits ok 127 - hsp7_gaps ok 128 - hsp7_he ok 129 - hsp7_hs ok 130 - hsp7_hstr ok 131 - hsp7_qe ok 132 - hsp7_qs ok 133 - hsp7_qstr ok 134 - hsp8_bits ok 135 - hsp8_gaps ok 136 - hsp8_he ok 137 - hsp8_hs ok 138 - hsp8_hstr ok 139 - hsp8_qe ok 140 - hsp8_qs ok 141 - hsp8_qstr ok 142 - query_name ok 143 ok 144 ok 145 ok 146 ok 147 - The object isa Bio::SeqFeatureI ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 - The object isa Bio::SeqFeatureI ok 157 ok 158 ok 159 ok 160 - The object isa Bio::SeqFeatureI ok 161 ok 162 ok 163 ok Subroutine start_document redefined at Bio\SearchIO\XML\BlastHandler.pm line 187. Subroutine end_document redefined at Bio\SearchIO\XML\BlastHandler.pm line 204. Subroutine start_element redefined at Bio\SearchIO\XML\BlastHandler.pm line 224. Subroutine end_element redefined at Bio\SearchIO\XML\BlastHandler.pm line 247. Subroutine characters redefined at Bio\SearchIO\XML\BlastHandler.pm line 304. Subroutine eventHandler redefined at Bio\SearchIO\XML\BlastHandler.pm line 310. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191. Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175, line 617. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261, line 617. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281, line 617. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308, line 617. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334, line 617. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354, line 617. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375, line 617. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396, line 617. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417, line 617. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439, line 617. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462, line 617. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484, line 617. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505, line 617. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520, line 617. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537, line 617. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552, line 617. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571, line 617. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596, line 617. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613, line 617. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626, line 617. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643, line 617. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660, line 617. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677, line 617. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697, line 617. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725, line 617. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744, line 617. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753, line 617. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770, line 617. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791, line 617. t/SearchIO/blastxml.t ........................ 1..391 ok 1 - use Bio::SearchIO; ok 2 ok 3 - The object isa Bio::Search::Result::ResultI ok 4 - database_name() ok 5 - query_name() ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - database_name() ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 - query name on HSP ok 61 - query desc on HSP ok 62 - hitname ok 63 - hitdesc ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - The object isa Bio::Search::Hit::HitI ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 - query name on HSP ok 169 - query desc on HSP ok 170 - hitname ok 171 - hitdesc ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 - query name on HSP ok 215 - query desc on HSP ok 216 - hitname ok 217 - hitdesc ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok Subroutine new redefined at Bio\Search\HSP\GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio\Search\HSP\GenericHSP.pm line 217. Subroutine algorithm redefined at Bio\Search\HSP\GenericHSP.pm line 246. Subroutine pvalue redefined at Bio\Search\HSP\GenericHSP.pm line 268. Subroutine evalue redefined at Bio\Search\HSP\GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio\Search\HSP\GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 354. Subroutine gaps redefined at Bio\Search\HSP\GenericHSP.pm line 387. Subroutine query_string redefined at Bio\Search\HSP\GenericHSP.pm line 417. Subroutine hit_string redefined at Bio\Search\HSP\GenericHSP.pm line 441. Subroutine homology_string redefined at Bio\Search\HSP\GenericHSP.pm line 467. Subroutine length redefined at Bio\Search\HSP\GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio\Search\HSP\GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio\Search\HSP\GenericHSP.pm line 542. Subroutine frame redefined at Bio\Search\HSP\GenericHSP.pm line 582. Subroutine get_aln redefined at Bio\Search\HSP\GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 681. Subroutine num_identical redefined at Bio\Search\HSP\GenericHSP.pm line 705. Subroutine rank redefined at Bio\Search\HSP\GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 875. Subroutine query redefined at Bio\Search\HSP\GenericHSP.pm line 896. Subroutine feature1 redefined at Bio\Search\HSP\GenericHSP.pm line 904. Subroutine hit redefined at Bio\Search\HSP\GenericHSP.pm line 927. Subroutine feature2 redefined at Bio\Search\HSP\GenericHSP.pm line 935. Subroutine significance redefined at Bio\Search\HSP\GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio\Search\HSP\GenericHSP.pm line 1019. Subroutine n redefined at Bio\Search\HSP\GenericHSP.pm line 1191. Subroutine range redefined at Bio\Search\HSP\GenericHSP.pm line 1203. Subroutine links redefined at Bio\Search\HSP\GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio\Search\HSP\GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio\Search\HSP\GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio\Search\HSP\GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio\Search\HSP\GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio\Search\HSP\GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio\Search\HSP\GenericHSP.pm line 1682. Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 128. Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 201. Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 225. Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 245. Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 265. Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 285. Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 305. Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 330. Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 352. Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 375. Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 390. Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 420. Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 448. Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 484. Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 507. Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 528. Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 554. Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 566. Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 595. Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 642. Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 684. Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 730. Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 776. Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 839. Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 877. Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 938. Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1015. Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1083. Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1140. Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1216. Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1264. Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1300. Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1354. Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1390. Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1432. Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1463. Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1525. Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1564. Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1580. Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1608. Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1656. Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1673. Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1691. Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1722. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1323. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1331. Subroutine new redefined at Bio\Search\Result\GenericResult.pm line 175. Subroutine algorithm redefined at Bio\Search\Result\GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio\Search\Result\GenericResult.pm line 281. Subroutine next_hit redefined at Bio\Search\Result\GenericResult.pm line 308. Subroutine query_name redefined at Bio\Search\Result\GenericResult.pm line 334. Subroutine query_accession redefined at Bio\Search\Result\GenericResult.pm line 354. Subroutine query_gi redefined at Bio\Search\Result\GenericResult.pm line 375. Subroutine query_length redefined at Bio\Search\Result\GenericResult.pm line 396. Subroutine query_description redefined at Bio\Search\Result\GenericResult.pm line 417. Subroutine database_name redefined at Bio\Search\Result\GenericResult.pm line 439. Subroutine database_letters redefined at Bio\Search\Result\GenericResult.pm line 462. Subroutine database_entries redefined at Bio\Search\Result\GenericResult.pm line 484. Subroutine get_parameter redefined at Bio\Search\Result\GenericResult.pm line 505. Subroutine available_parameters redefined at Bio\Search\Result\GenericResult.pm line 520. Subroutine get_statistic redefined at Bio\Search\Result\GenericResult.pm line 537. Subroutine available_statistics redefined at Bio\Search\Result\GenericResult.pm line 552. Subroutine add_hit redefined at Bio\Search\Result\GenericResult.pm line 571. Subroutine hit_factory redefined at Bio\Search\Result\GenericResult.pm line 596. Subroutine rewind redefined at Bio\Search\Result\GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio\Search\Result\GenericResult.pm line 626. Subroutine add_parameter redefined at Bio\Search\Result\GenericResult.pm line 643. Subroutine add_statistic redefined at Bio\Search\Result\GenericResult.pm line 660. Subroutine num_hits redefined at Bio\Search\Result\GenericResult.pm line 677. Subroutine hits redefined at Bio\Search\Result\GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio\Search\Result\GenericResult.pm line 725. Subroutine program_reference redefined at Bio\Search\Result\GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio\Search\Result\GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio\Search\Result\GenericResult.pm line 770. Subroutine to_string redefined at Bio\Search\Result\GenericResult.pm line 791. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 41. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 41. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 41. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 41. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 41. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 41. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 41. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 41. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 41. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 41. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 41. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 41. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 41. t/SearchIO/cross_match.t ..................... 1..15 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 28. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 28. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 28. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 28. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 28. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 28. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 28. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 28. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 28. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 28. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 28. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 28. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 28. t/SearchIO/erpin.t ........................... 1..91 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::Search::Result::ResultI ok 3 - Result ERPIN ok 4 - Result ERPIN reference ok 5 - Result ERPIN version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_name ok 16 - The object isa Bio::Search::Hit::HitI ok 17 - Hit accession ok 18 - Hit GI ok 19 - Hit algorithm ok 20 - Hit bits ok 21 - Hit description ok 22 - Hit length ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit overlap ok 28 - Hit query_length ok 29 - Hit rank ok 30 - Hit raw_score ok 31 - Hit score ok 32 ok 33 - The object isa Bio::Search::HSP::HSPI ok 34 - HSP algorithm ok 35 ok 36 - The object isa Bio::SeqFeature::Similarity ok 37 - The object isa Bio::SeqFeature::Similarity ok 38 - HSP frame ok 39 - HSP gaps ok 40 - HSP hit isa Bio::SeqFeature::Similarity ok 41 - HSP hit_string ok 42 - HSP homology_string ok 43 - HSP hsp_group ok 44 - HSP hsp_length ok 45 - HSP length ok 46 - HSP links ok 47 - HSP query isa Bio::SeqFeature::Similarity ok 48 - HSP query_string ok 49 - HSP range ok 50 - HSP rank ok 51 ok 52 - HSP expect ok 53 - The object isa Bio::LocatableSeq ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 ok 59 ok 60 - HSP strand ok 61 ok 62 ok 63 - ERPIN get_aln warning ok 64 - The object isa Bio::Search::HSP::HSPI ok 65 - HSP algorithm ok 66 ok 67 - The object isa Bio::SeqFeature::Similarity ok 68 - The object isa Bio::SeqFeature::Similarity ok 69 - HSP frame ok 70 - HSP gaps ok 71 - HSP hit isa Bio::SeqFeature::Similarity ok 72 - HSP hit_string ok 73 - HSP homology_string ok 74 - HSP query_string ok 75 - HSP hsp_group ok 76 - HSP hsp_length ok 77 - HSP length ok 78 - HSP links ok 79 - The object isa Bio::SeqFeature::Similarity ok 80 - HSP range ok 81 - HSP rank ok 82 ok 83 - HSP end ok 84 - HSP expect ok 85 - The object isa Bio::LocatableSeq ok 86 - HSP seq_str ok 87 - HSP start ok 88 - HSP custom_score ok 89 ok 90 ok 91 - HSP strand ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 42. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 42. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 42. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 42. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 42. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 42. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 42. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 42. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 42. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 42. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 42. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 42. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 42. t/SearchIO/exonerate.t ....................... 1..49 ok 1 - use Bio::SearchIO; ok 2 ok 3 # skip no query length available in default output ok 4 ok 5 # skip no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # skip no query length available in default output ok 26 ok 27 # skip no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - query_name ok 47 ok 48 - query_name ok 49 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 2549. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 2549. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 2549. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 2549. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 2549. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 2549. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 2549. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 2549. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 2549. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 2549. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 2549. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 2549. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 2549. t/SearchIO/fasta.t ........................... 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 - TFASTXY ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 - num_identical() ok 289 - num_conserved() ok Subroutine new redefined at Bio\Search\HSP\GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio\Search\HSP\GenericHSP.pm line 217. Subroutine algorithm redefined at Bio\Search\HSP\GenericHSP.pm line 246. Subroutine pvalue redefined at Bio\Search\HSP\GenericHSP.pm line 268. Subroutine evalue redefined at Bio\Search\HSP\GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio\Search\HSP\GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 354. Subroutine gaps redefined at Bio\Search\HSP\GenericHSP.pm line 387. Subroutine query_string redefined at Bio\Search\HSP\GenericHSP.pm line 417. Subroutine hit_string redefined at Bio\Search\HSP\GenericHSP.pm line 441. Subroutine homology_string redefined at Bio\Search\HSP\GenericHSP.pm line 467. Subroutine length redefined at Bio\Search\HSP\GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio\Search\HSP\GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio\Search\HSP\GenericHSP.pm line 542. Subroutine frame redefined at Bio\Search\HSP\GenericHSP.pm line 582. Subroutine get_aln redefined at Bio\Search\HSP\GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio\Search\HSP\GenericHSP.pm line 681. Subroutine num_identical redefined at Bio\Search\HSP\GenericHSP.pm line 705. Subroutine rank redefined at Bio\Search\HSP\GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio\Search\HSP\GenericHSP.pm line 875. Subroutine query redefined at Bio\Search\HSP\GenericHSP.pm line 896. Subroutine feature1 redefined at Bio\Search\HSP\GenericHSP.pm line 904. Subroutine hit redefined at Bio\Search\HSP\GenericHSP.pm line 927. Subroutine feature2 redefined at Bio\Search\HSP\GenericHSP.pm line 935. Subroutine significance redefined at Bio\Search\HSP\GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio\Search\HSP\GenericHSP.pm line 1019. Subroutine n redefined at Bio\Search\HSP\GenericHSP.pm line 1191. Subroutine range redefined at Bio\Search\HSP\GenericHSP.pm line 1203. Subroutine links redefined at Bio\Search\HSP\GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio\Search\HSP\GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio\Search\HSP\GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio\Search\HSP\GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio\Search\HSP\GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio\Search\HSP\GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio\Search\HSP\GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio\Search\HSP\GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio\Search\HSP\GenericHSP.pm line 1682. Subroutine new redefined at Bio\Search\Hit\GenericHit.pm line 128. Subroutine add_hsp redefined at Bio\Search\Hit\GenericHit.pm line 201. Subroutine hsp_factory redefined at Bio\Search\Hit\GenericHit.pm line 225. Subroutine name redefined at Bio\Search\Hit\GenericHit.pm line 245. Subroutine accession redefined at Bio\Search\Hit\GenericHit.pm line 265. Subroutine description redefined at Bio\Search\Hit\GenericHit.pm line 285. Subroutine length redefined at Bio\Search\Hit\GenericHit.pm line 305. Subroutine algorithm redefined at Bio\Search\Hit\GenericHit.pm line 330. Subroutine raw_score redefined at Bio\Search\Hit\GenericHit.pm line 352. Subroutine score redefined at Bio\Search\Hit\GenericHit.pm line 375. Subroutine significance redefined at Bio\Search\Hit\GenericHit.pm line 390. Subroutine bits redefined at Bio\Search\Hit\GenericHit.pm line 420. Subroutine next_hsp redefined at Bio\Search\Hit\GenericHit.pm line 448. Subroutine hsps redefined at Bio\Search\Hit\GenericHit.pm line 484. Subroutine num_hsps redefined at Bio\Search\Hit\GenericHit.pm line 507. Subroutine rewind redefined at Bio\Search\Hit\GenericHit.pm line 528. Subroutine ambiguous_aln redefined at Bio\Search\Hit\GenericHit.pm line 554. Subroutine overlap redefined at Bio\Search\Hit\GenericHit.pm line 566. Subroutine n redefined at Bio\Search\Hit\GenericHit.pm line 595. Subroutine p redefined at Bio\Search\Hit\GenericHit.pm line 642. Subroutine hsp redefined at Bio\Search\Hit\GenericHit.pm line 684. Subroutine logical_length redefined at Bio\Search\Hit\GenericHit.pm line 730. Subroutine length_aln redefined at Bio\Search\Hit\GenericHit.pm line 776. Subroutine gaps redefined at Bio\Search\Hit\GenericHit.pm line 839. Subroutine matches redefined at Bio\Search\Hit\GenericHit.pm line 877. Subroutine start redefined at Bio\Search\Hit\GenericHit.pm line 938. Subroutine end redefined at Bio\Search\Hit\GenericHit.pm line 1015. Subroutine range redefined at Bio\Search\Hit\GenericHit.pm line 1083. Subroutine frac_identical redefined at Bio\Search\Hit\GenericHit.pm line 1140. Subroutine frac_conserved redefined at Bio\Search\Hit\GenericHit.pm line 1216. Subroutine frac_aligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1264. Subroutine frac_aligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1300. Subroutine num_unaligned_hit redefined at Bio\Search\Hit\GenericHit.pm line 1354. Subroutine num_unaligned_query redefined at Bio\Search\Hit\GenericHit.pm line 1390. Subroutine seq_inds redefined at Bio\Search\Hit\GenericHit.pm line 1432. Subroutine strand redefined at Bio\Search\Hit\GenericHit.pm line 1463. Subroutine frame redefined at Bio\Search\Hit\GenericHit.pm line 1525. Subroutine rank redefined at Bio\Search\Hit\GenericHit.pm line 1564. Subroutine locus redefined at Bio\Search\Hit\GenericHit.pm line 1580. Subroutine each_accession_number redefined at Bio\Search\Hit\GenericHit.pm line 1608. Subroutine tiled_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1656. Subroutine query_length redefined at Bio\Search\Hit\GenericHit.pm line 1673. Subroutine ncbi_gi redefined at Bio\Search\Hit\GenericHit.pm line 1691. Subroutine sort_hsps redefined at Bio\Search\Hit\GenericHit.pm line 1722. Subroutine Bio::Search::Hit::GenericHit::frac_aligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1323. Subroutine Bio::Search::Hit::GenericHit::num_unaligned_sbjct redefined at Bio\Search\Hit\GenericHit.pm line 1331. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 313. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 313. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 313. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 313. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 313. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 313. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 313. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 313. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 313. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 313. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 313. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 313. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 313. t/SearchIO/gmap_f9.t ......................... 1..47 ok 1 - use Bio::SearchIO; ok 2 - Did we get a Result? isa Bio::Search::Result::GenericResult ok 3 - Did we get the expected number of hits? ok 4 - Did we get the expected algorithm? ok 5 - Did we get the expected query_name? ok 6 - Did we get a Hit? isa Bio::Search::Hit::GenericHit ok 7 - The object isa Bio::Search::Hit::HitI ok 8 - Check the name ok 9 - Check the hit length ok 10 - Check the number of hsps ok 11 - The object isa Bio::Search::HSP::HSPI ok 12 - Check the algorithm ok 13 - Count gaps in the query ok 14 - Count gaps in the hit ok 15 - Length of the query ok 16 - Length of the hit ok 17 - Query sequence ok 18 - Hit sequence ok 19 - Check query start ok 20 - Check query end ok 21 - Check query end ok 22 - Check hit start ok 23 - Check hit end ok 24 - Check hit end ok 25 - Did we get a Result? isa Bio::Search::Result::GenericResult ok 26 - Did we get the expected number of hits? ok 27 - Did we get the expected algorithm? ok 28 - Did we get the expected query_name? ok 29 - The object isa Bio::Search::Hit::HitI ok 30 - Check the name ok 31 - Check the hit length ok 32 - Check the number of hsps ok 33 - The object isa Bio::Search::HSP::HSPI ok 34 - Check the algorithm ok 35 - Count gaps in the query ok 36 - Count gaps in the hit ok 37 - Length of the query ok 38 - Length of the hit ok 39 - Query sequence ok 40 - Hit sequence ok 41 - Check query start ok 42 - Check query end ok 43 - Check query end ok 44 - Check hit start ok 45 - Check hit end ok 46 - Check hit end ok 47 - Can we loop over multiple results properly (expecting 58)? ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 41. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 41. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 41. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 41. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 41. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 41. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 41. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 41. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 41. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 41. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 41. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 41. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 41. t/SearchIO/hmmer.t ........................... 1..116 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 14. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 14. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 14. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 14. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 14. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 14. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 14. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 14. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 14. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 14. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 14. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 14. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 14. t/SearchIO/hmmer_pull.t ...................... 1..290 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 80. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 80. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 80. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 80. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 80. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 80. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 80. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 80. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 80. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 80. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 80. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 80. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 80. t/SearchIO/infernal.t ........................ 1..412 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::Search::Result::ResultI ok 3 - Result ok 4 - Result reference ok 5 - Result version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_length ok 16 - Result query_name ok 17 - The object isa Bio::Search::Hit::HitI ok 18 - Hit GI ok 19 - Hit accession ok 20 - Hit algorithm ok 21 - Hit bits ok 22 - Hit description ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit length_aln() not implemented ok 28 - Hit num_unaligned_hit() not implemented ok 29 - Hit num_unaligned_query() not implemented ok 30 - Hit num_unaligned_sbjct() not implemented ok 31 - Hit start not implemented ok 32 - Hit end not implemented ok 33 - Hit strand not implemented ok 34 - Hit logical_length not implemented ok 35 - Hit frac_aligned_hit not implemented ok 36 - Hit frac_aligned_query not implemented ok 37 - Hit frac_conserved not implemented ok 38 - Hit frac_identical not implemented ok 39 - Hit matches not implemented ok 40 - Hit gaps not implemented ok 41 - Hit frame not implemented ok 42 - Hit range not implemented ok 43 - Hit seq_inds not implemented ok 44 - Hit length ok 45 - Hit overlap ok 46 - Hit query_length ok 47 - Hit rank ok 48 - Hit raw_score ok 49 - Hit score ok 50 - Hit p ok 51 ok 52 - The object isa Bio::Search::HSP::HSPI ok 53 - HSP algorithm ok 54 ok 55 - The object isa Bio::SeqFeature::Similarity ok 56 - The object isa Bio::SeqFeature::Similarity ok 57 ok 58 ok 59 - HSP frame ok 60 - HSP gaps ok 61 - Hit length ok 62 - The object isa Bio::Align::AlignI ok 63 - HSP hit isa Bio::SeqFeature::Similarity ok 64 - HSP hit_string ok 65 - HSP homology_string ok 66 - HSP hsp_group ok 67 - HSP hsp_length ok 68 - HSP length ok 69 - HSP links ok 70 - HSP n ok 71 - HSP pvalue ok 72 - HSP query isa Bio::SeqFeature::Similarity ok 73 - HSP query_string ok 74 - HSP range ok 75 - HSP rank ok 76 ok 77 - HSP end ok 78 - HSP expect ok 79 - HSP seq_inds not implemented ok 80 - HSP matches not implemented ok 81 - HSP frac_conserved not implemented ok 82 - HSP frac_identical not implemented ok 83 - HSP num_conserved not implemented ok 84 - HSP num_identical not implemented ok 85 - HSP percent_identity not implemented ok 86 - HSP cigar_string not implemented ok 87 - HSP cigar_string not implemented ok 88 - The object isa Bio::LocatableSeq ok 89 - HSP seq_str ok 90 - HSP start ok 91 - HSP custom_score ok 92 - HSP meta ok 93 - HSP strand ok 94 - The object isa Bio::Search::HSP::HSPI ok 95 - HSP algorithm ok 96 ok 97 - The object isa Bio::SeqFeature::Similarity ok 98 - The object isa Bio::SeqFeature::Similarity ok 99 - HSP frame ok 100 - HSP gaps ok 101 - The object isa Bio::Align::AlignI ok 102 - HSP hit isa Bio::SeqFeature::Similarity ok 103 - HSP hit_string ok 104 - HSP homology_string ok 105 - HSP hsp_group ok 106 - HSP hsp_length ok 107 - HSP length ok 108 - HSP links ok 109 - HSP n ok 110 - HSP pvalue ok 111 - HSP query isa Bio::SeqFeature::Similarity ok 112 - HSP query_string ok 113 - HSP range ok 114 - HSP rank ok 115 ok 116 - HSP end ok 117 - HSP expect ok 118 - The object isa Bio::LocatableSeq ok 119 - HSP seq_str ok 120 - HSP start ok 121 - HSP custom_score ok 122 - HSP meta ok 123 - HSP strand ok 124 - The object isa Bio::Search::Result::ResultI ok 125 - Result CMSEARCH ok 126 - Result CMSEARCH reference ok 127 - Result CMSEARCH version ok 128 - Result parameters ok 129 - Result statistics ok 130 - Result entries ok 131 - Result letters ok 132 - Result database_name ok 133 - Result num_hits ok 134 - Result program_reference ok 135 - Result query_accession ok 136 - Result query_description ok 137 - Result query_length ok 138 - Result query_name ok 139 - The object isa Bio::Search::Hit::HitI ok 140 - Hit GI ok 141 - Hit accession ok 142 - Hit algorithm ok 143 - Hit bits ok 144 - Hit description ok 145 - Hit locus ok 146 - Hit n ok 147 - Hit name ok 148 - Hit num_hsps ok 149 - No p values ok 150 - Hit length ok 151 - Hit overlap ok 152 - Hit query_length ok 153 - Hit rank ok 154 - Hit raw_score ok 155 - Hit score ok 156 ok 157 - The object isa Bio::Search::HSP::HSPI ok 158 - HSP algorithm ok 159 ok 160 - The object isa Bio::SeqFeature::Similarity ok 161 - The object isa Bio::SeqFeature::Similarity ok 162 ok 163 ok 164 - HSP frame ok 165 - HSP gaps ok 166 - Hit length ok 167 - The object isa Bio::Align::AlignI ok 168 - HSP hit isa Bio::SeqFeature::Similarity ok 169 - HSP hit_string ok 170 - HSP homology_string ok 171 - HSP hsp_group ok 172 - HSP hsp_length ok 173 - HSP length ok 174 - HSP links ok 175 - HSP n ok 176 - HSP pvalue ok 177 - HSP query isa Bio::SeqFeature::Similarity ok 178 - HSP query_string ok 179 - HSP range ok 180 - HSP rank ok 181 ok 182 - HSP end ok 183 - HSP expect ok 184 - The object isa Bio::LocatableSeq ok 185 - HSP seq_str ok 186 - HSP start ok 187 - HSP custom_score ok 188 - HSP meta ok 189 - HSP strand ok 190 - The object isa Bio::Search::HSP::HSPI ok 191 - HSP algorithm ok 192 ok 193 - The object isa Bio::SeqFeature::Similarity ok 194 - The object isa Bio::SeqFeature::Similarity ok 195 - HSP frame ok 196 - HSP gaps ok 197 - The object isa Bio::Align::AlignI ok 198 - HSP hit isa Bio::SeqFeature::Similarity ok 199 - HSP hit_string ok 200 - HSP homology_string ok 201 - HSP hsp_group ok 202 - HSP hsp_length ok 203 - HSP length ok 204 - HSP links ok 205 - HSP n ok 206 - HSP pvalue ok 207 - HSP query isa Bio::SeqFeature::Similarity ok 208 - HSP query_string ok 209 - HSP range ok 210 - HSP rank ok 211 ok 212 - HSP end ok 213 - HSP expect ok 214 - The object isa Bio::LocatableSeq ok 215 - HSP seq_str ok 216 - HSP start ok 217 - HSP custom_score ok 218 - HSP meta ok 219 - HSP strand ok 220 - The object isa Bio::Search::Hit::HitI ok 221 - Hit accession ok 222 - Hit GI ok 223 - Hit algorithm ok 224 - Hit bits ok 225 - Hit description ok 226 - Hit length ok 227 - Hit locus ok 228 - Hit n ok 229 - Hit name ok 230 - Hit num_hsps ok 231 - Hit overlap ok 232 - Hit query_length ok 233 - Hit rank ok 234 - Hit raw_score ok 235 - Hit score ok 236 ok 237 - The object isa Bio::Search::HSP::HSPI ok 238 - HSP algorithm ok 239 ok 240 - The object isa Bio::SeqFeature::Similarity ok 241 - The object isa Bio::SeqFeature::Similarity ok 242 - HSP frame ok 243 - HSP gaps ok 244 - The object isa Bio::Align::AlignI ok 245 - HSP hit isa Bio::SeqFeature::Similarity ok 246 - HSP hit_string ok 247 - HSP homology_string ok 248 - HSP hsp_group ok 249 - HSP hsp_length ok 250 - HSP length ok 251 - HSP links ok 252 - HSP n ok 253 - HSP query isa Bio::SeqFeature::Similarity ok 254 - HSP query_string ok 255 - HSP range ok 256 - HSP rank ok 257 ok 258 - HSP end ok 259 - HSP expect ok 260 - The object isa Bio::LocatableSeq ok 261 - HSP seq_str ok 262 - HSP start ok 263 - HSP custom_score ok 264 - HSP meta ok 265 - HSP strand ok 266 - HSP meta gap bug ok 267 - HSP meta ok 268 - HSP meta ok 269 ok 270 ok 271 - The object isa Bio::Search::Result::ResultI ok 272 - Result CMSEARCH ok 273 - Result CMSEARCH reference ok 274 - Result CMSEARCH version ok 275 - Result parameters ok 276 - Result statistics ok 277 - Result entries ok 278 - Result letters ok 279 - Result database_name ok 280 - Result num_hits ok 281 - Result program_reference ok 282 - Result query_accession ok 283 - Result query_description ok 284 - Result query_length ok 285 - Result query_name ok 286 - The object isa Bio::Search::Hit::HitI ok 287 - Hit GI ok 288 - Hit accession ok 289 - Hit algorithm ok 290 - Hit bits ok 291 - Hit description ok 292 - Hit locus ok 293 - Hit n ok 294 - Hit name ok 295 - Hit num_hsps ok 296 - No p values ok 297 - Hit length ok 298 - Hit overlap ok 299 - Hit query_length ok 300 - Hit rank ok 301 - Hit raw_score ok 302 - Hit score ok 303 ok 304 - The object isa Bio::Search::HSP::HSPI ok 305 - HSP algorithm ok 306 ok 307 - The object isa Bio::SeqFeature::Similarity ok 308 - The object isa Bio::SeqFeature::Similarity ok 309 ok 310 ok 311 - HSP frame ok 312 - HSP gaps ok 313 - Hit length ok 314 - The object isa Bio::Align::AlignI ok 315 - HSP hit isa Bio::SeqFeature::Similarity ok 316 - HSP hit_string ok 317 - HSP homology_string ok 318 - HSP hsp_group ok 319 - HSP hsp_length ok 320 - HSP length ok 321 - HSP links ok 322 - HSP n ok 323 - HSP pvalue ok 324 - HSP query isa Bio::SeqFeature::Similarity ok 325 - HSP query_string ok 326 - HSP range ok 327 - HSP rank ok 328 ok 329 - HSP end ok 330 - HSP expect ok 331 - The object isa Bio::LocatableSeq ok 332 - HSP seq_str ok 333 - HSP start ok 334 - HSP custom_score ok 335 - HSP meta ok 336 - HSP strand ok 337 - The object isa Bio::Search::HSP::HSPI ok 338 - HSP algorithm ok 339 ok 340 - The object isa Bio::SeqFeature::Similarity ok 341 - The object isa Bio::SeqFeature::Similarity ok 342 - HSP frame ok 343 - HSP gaps ok 344 - The object isa Bio::Align::AlignI ok 345 - HSP hit isa Bio::SeqFeature::Similarity ok 346 - HSP hit_string ok 347 - HSP homology_string ok 348 - HSP hsp_group ok 349 - HSP hsp_length ok 350 - HSP length ok 351 - HSP links ok 352 - HSP n ok 353 - HSP pvalue ok 354 - HSP query isa Bio::SeqFeature::Similarity ok 355 - HSP query_string ok 356 - HSP range ok 357 - HSP rank ok 358 ok 359 - HSP end ok 360 - HSP expect ok 361 - The object isa Bio::LocatableSeq ok 362 - HSP seq_str ok 363 - HSP start ok 364 - HSP custom_score ok 365 - HSP meta ok 366 - HSP strand ok 367 - The object isa Bio::Search::Hit::HitI ok 368 - Hit accession ok 369 - Hit GI ok 370 - Hit algorithm ok 371 - Hit bits ok 372 - Hit description ok 373 - Hit length ok 374 - Hit locus ok 375 - Hit n ok 376 - Hit name ok 377 - Hit num_hsps ok 378 - Hit overlap ok 379 - Hit query_length ok 380 - Hit rank ok 381 - Hit raw_score ok 382 - Hit score ok 383 ok 384 - The object isa Bio::Search::HSP::HSPI ok 385 - HSP algorithm ok 386 ok 387 - The object isa Bio::SeqFeature::Similarity ok 388 - The object isa Bio::SeqFeature::Similarity ok 389 - HSP frame ok 390 - HSP gaps ok 391 - The object isa Bio::Align::AlignI ok 392 - HSP hit isa Bio::SeqFeature::Similarity ok 393 - HSP hit_string ok 394 - HSP homology_string ok 395 - HSP hsp_group ok 396 - HSP hsp_length ok 397 - HSP length ok 398 - HSP links ok 399 - HSP n ok 400 - HSP query isa Bio::SeqFeature::Similarity ok 401 - HSP query_string ok 402 - HSP range ok 403 - HSP rank ok 404 ok 405 - HSP end ok 406 - HSP expect ok 407 - The object isa Bio::LocatableSeq ok 408 - HSP seq_str ok 409 - HSP start ok 410 - HSP custom_score ok 411 - HSP meta ok 412 - HSP strand ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 21. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 21. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 21. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 21. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 21. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 21. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 21. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 21. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 21. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 21. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 21. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 21. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 21. t/SearchIO/megablast.t ....................... 1..31 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 4. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 4. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 4. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 4. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 4. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 4. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 4. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 4. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 4. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 4. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 4. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 4. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 4. t/SearchIO/psl.t ............................. 1..53 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - next_hsp should be undef ok 51 - next_hit should be undef not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string # Failed (TODO) test 'next_result should be undef' # at t/SearchIO/psl.t line 97. # got: '' # expected: undef ok 53 ok Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 199. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 199. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 199. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 199. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 199. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 199. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 199. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 199. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 199. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 199. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 199. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 199. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 199. t/SearchIO/rnamotif.t ........................ 1..60 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::Search::Result::ResultI ok 3 - Result RNAMOTIF ok 4 - Result RNAMOTIF reference ok 5 - Result RNAMOTIF version ok 6 - Result entries ok 7 - Result letters ok 8 - Result database_name ok 9 - Result num_hits ok 10 - Result program_reference ok 11 - Result query_accession ok 12 - Result query_description ok 13 - Result query_length ok 14 - Result query_name ok 15 - The object isa Bio::Search::Hit::HitI ok 16 - Hit accession ok 17 - Hit GI ok 18 - Hit algorithm ok 19 - Hit description ok 20 - Hit length ok 21 - Hit locus ok 22 - Hit n ok 23 - Hit name ok 24 - Hit num_hsps ok 25 - Hit overlap ok 26 - Hit rank ok 27 - Hit raw_score ok 28 - Hit score ok 29 ok 30 - The object isa Bio::Search::HSP::HSPI ok 31 - HSP algorithm ok 32 ok 33 - The object isa Bio::SeqFeature::Similarity ok 34 - The object isa Bio::SeqFeature::Similarity ok 35 - HSP frame ok 36 - HSP gaps ok 37 - RNAMotif get_aln warning ok 38 - HSP hit isa Bio::SeqFeature::Similarity ok 39 - HSP hit_string ok 40 - HSP homology_string ok 41 - HSP hsp_group ok 42 - HSP hsp_length ok 43 - HSP length ok 44 - HSP links ok 45 - HSP n ok 46 - HSP query isa Bio::SeqFeature::Similarity ok 47 - HSP query_string ok 48 - HSP range ok 49 - HSP rank ok 50 ok 51 - HSP end ok 52 - HSP expect ok 53 - The object isa Bio::LocatableSeq ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 - HSP strand ok 59 ok 60 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 6. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 6. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 6. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 6. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 6. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 6. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 6. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 6. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 6. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 6. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 6. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 6. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 6. t/SearchIO/sim4.t ............................ 1..102 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok Subroutine new redefined at Bio/Search/Result/GenericResult.pm line 175. Subroutine algorithm redefined at Bio/Search/Result/GenericResult.pm line 261. Subroutine algorithm_version redefined at Bio/Search/Result/GenericResult.pm line 281. Subroutine next_hit redefined at Bio/Search/Result/GenericResult.pm line 308. Subroutine query_name redefined at Bio/Search/Result/GenericResult.pm line 334. Subroutine query_accession redefined at Bio/Search/Result/GenericResult.pm line 354. Subroutine query_gi redefined at Bio/Search/Result/GenericResult.pm line 375. Subroutine query_length redefined at Bio/Search/Result/GenericResult.pm line 396. Subroutine query_description redefined at Bio/Search/Result/GenericResult.pm line 417. Subroutine database_name redefined at Bio/Search/Result/GenericResult.pm line 439. Subroutine database_letters redefined at Bio/Search/Result/GenericResult.pm line 462. Subroutine database_entries redefined at Bio/Search/Result/GenericResult.pm line 484. Subroutine get_parameter redefined at Bio/Search/Result/GenericResult.pm line 505. Subroutine available_parameters redefined at Bio/Search/Result/GenericResult.pm line 520. Subroutine get_statistic redefined at Bio/Search/Result/GenericResult.pm line 537. Subroutine available_statistics redefined at Bio/Search/Result/GenericResult.pm line 552. Subroutine add_hit redefined at Bio/Search/Result/GenericResult.pm line 571. Subroutine hit_factory redefined at Bio/Search/Result/GenericResult.pm line 596. Subroutine rewind redefined at Bio/Search/Result/GenericResult.pm line 613. Subroutine _nexthitindex redefined at Bio/Search/Result/GenericResult.pm line 626. Subroutine add_parameter redefined at Bio/Search/Result/GenericResult.pm line 643. Subroutine add_statistic redefined at Bio/Search/Result/GenericResult.pm line 660. Subroutine num_hits redefined at Bio/Search/Result/GenericResult.pm line 677. Subroutine hits redefined at Bio/Search/Result/GenericResult.pm line 697. Subroutine algorithm_reference redefined at Bio/Search/Result/GenericResult.pm line 725. Subroutine program_reference redefined at Bio/Search/Result/GenericResult.pm line 744. Subroutine no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 753. Subroutine set_no_hits_found redefined at Bio/Search/Result/GenericResult.pm line 770. Subroutine to_string redefined at Bio/Search/Result/GenericResult.pm line 791. Subroutine new redefined at Bio/Search/HSP/GenericHSP.pm line 176. Subroutine _logical_length redefined at Bio/Search/HSP/GenericHSP.pm line 217. Subroutine algorithm redefined at Bio/Search/HSP/GenericHSP.pm line 246. Subroutine pvalue redefined at Bio/Search/HSP/GenericHSP.pm line 268. Subroutine evalue redefined at Bio/Search/HSP/GenericHSP.pm line 287. Subroutine frac_identical redefined at Bio/Search/HSP/GenericHSP.pm line 312. Subroutine frac_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 354. Subroutine gaps redefined at Bio/Search/HSP/GenericHSP.pm line 387. Subroutine query_string redefined at Bio/Search/HSP/GenericHSP.pm line 417. Subroutine hit_string redefined at Bio/Search/HSP/GenericHSP.pm line 441. Subroutine homology_string redefined at Bio/Search/HSP/GenericHSP.pm line 467. Subroutine length redefined at Bio/Search/HSP/GenericHSP.pm line 497. Subroutine hsp_length redefined at Bio/Search/HSP/GenericHSP.pm line 529. Subroutine percent_identity redefined at Bio/Search/HSP/GenericHSP.pm line 542. Subroutine frame redefined at Bio/Search/HSP/GenericHSP.pm line 582. Subroutine get_aln redefined at Bio/Search/HSP/GenericHSP.pm line 626. Subroutine num_conserved redefined at Bio/Search/HSP/GenericHSP.pm line 681. Subroutine num_identical redefined at Bio/Search/HSP/GenericHSP.pm line 705. Subroutine rank redefined at Bio/Search/HSP/GenericHSP.pm line 728. Subroutine seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 780. Subroutine ambiguous_seq_inds redefined at Bio/Search/HSP/GenericHSP.pm line 875. Subroutine query redefined at Bio/Search/HSP/GenericHSP.pm line 896. Subroutine feature1 redefined at Bio/Search/HSP/GenericHSP.pm line 904. Subroutine hit redefined at Bio/Search/HSP/GenericHSP.pm line 927. Subroutine feature2 redefined at Bio/Search/HSP/GenericHSP.pm line 935. Subroutine significance redefined at Bio/Search/HSP/GenericHSP.pm line 961. Subroutine _calculate_seq_positions redefined at Bio/Search/HSP/GenericHSP.pm line 1019. Subroutine n redefined at Bio/Search/HSP/GenericHSP.pm line 1191. Subroutine range redefined at Bio/Search/HSP/GenericHSP.pm line 1203. Subroutine links redefined at Bio/Search/HSP/GenericHSP.pm line 1234. Subroutine hsp_group redefined at Bio/Search/HSP/GenericHSP.pm line 1253. Subroutine hit_features redefined at Bio/Search/HSP/GenericHSP.pm line 1273. Subroutine cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1330. Subroutine generate_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1352. Subroutine _sub_cigar_string redefined at Bio/Search/HSP/GenericHSP.pm line 1384. Subroutine _pre_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1401. Subroutine _query_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1441. Subroutine _subject_seq_feature redefined at Bio/Search/HSP/GenericHSP.pm line 1519. Subroutine _pre_similar_stats redefined at Bio/Search/HSP/GenericHSP.pm line 1590. Subroutine _pre_frac redefined at Bio/Search/HSP/GenericHSP.pm line 1618. Subroutine _pre_gaps redefined at Bio/Search/HSP/GenericHSP.pm line 1652. Subroutine _pre_pi redefined at Bio/Search/HSP/GenericHSP.pm line 1682. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 13. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 13. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 13. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 13. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 13. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 13. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 13. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 13. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 13. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 13. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 13. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 13. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 13. t/SearchIO/waba.t ............................ 1..64 ok 1 - use Bio::SearchIO; ok 2 - The object isa Bio::SearchIO ok 3 - query_name ok 4 - query database ok 5 - database name ok 6 - name ok 7 - hsps ok 8 - total length ok 9 - start ok 10 - end ok 11 - strand ok 12 - start ok 13 - end ok 14 - strand ok 15 - query string ok 16 - hit_string ok 17 - hmmstate string ok 18 ok 19 ok 20 ok 21 - total length ok 22 - start ok 23 - end ok 24 - strand ok 25 - start ok 26 - end ok 27 - strand ok 28 - query string ok 29 - hit_string ok 30 - hmmstate string ok 31 ok 32 ok 33 ok 34 - total length ok 35 - start ok 36 - end ok 37 - strand ok 38 - start ok 39 - end ok 40 - strand ok 41 - query string ok 42 - hit_string ok 43 - hmmstate string ok 44 ok 45 ok 46 ok 47 - query_name ok 48 - query database ok 49 - database name ok 50 - name ok 51 - hsps ok 52 - total length ok 53 - start ok 54 - end ok 55 - strand ok 56 - start ok 57 - end ok 58 - strand ok 59 - query string ok 60 - hit_string ok 61 - hmmstate string ok 62 ok 63 ok 64 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, chunk 2. Subroutine start redefined at Bio\Location\Simple.pm line 115, chunk 2. Subroutine end redefined at Bio\Location\Simple.pm line 144, chunk 2. Subroutine length redefined at Bio\Location\Simple.pm line 190, chunk 2. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, chunk 2. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, chunk 2. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, chunk 2. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154, chunk 2. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, chunk 2. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260, chunk 2. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281, chunk 2. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311, chunk 2. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328, chunk 2. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345, chunk 2. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362, chunk 2. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379, chunk 2. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413, chunk 2. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441, chunk 2. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460, chunk 2. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478, chunk 2. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493, chunk 2. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513, chunk 2. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539, chunk 2. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555, chunk 2. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580, chunk 2. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609, chunk 2. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651, chunk 2. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674, chunk 2. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691, chunk 2. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715, chunk 2. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746, chunk 2. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770, chunk 2. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809, chunk 2. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841, chunk 2. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871, chunk 2. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894, chunk 2. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931, chunk 2. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953, chunk 2. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984, chunk 2. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001, chunk 2. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017, chunk 2. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023, chunk 2. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030, chunk 2. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031, chunk 2. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042, chunk 2. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035, chunk 2. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039, chunk 2. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 3. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 3. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 3. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 3. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 3. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 3. t/SearchIO/wise.t ............................ 1..20 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 35. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 35. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 35. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 35. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 35. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 35. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 35. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 48. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 48. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 48. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 48. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 48. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 48. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 48. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 48. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 48. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 48. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 48. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 48. t/Seq/DBLink.t ............................... 1..131 ok 1 - use Bio::SeqIO; ok 2 - "swissprot:K1C9_HUMAN" ok 3 - no double colon ok 4 - no trailing colon ok 5 - no double space ok 6 - dblink value is splittable ok 7 - "GenBank:Z29074.1" ok 8 - no double colon ok 9 - no trailing colon ok 10 - no double space ok 11 - dblink value is splittable ok 12 - "GenPept:CAA82315.1" ok 13 - no double colon ok 14 - no trailing colon ok 15 - no double space ok 16 - dblink value is splittable ok 17 - "GenBank:S69510.1" ok 18 - no double colon ok 19 - no trailing colon ok 20 - no double space ok 21 - dblink value is splittable ok 22 - "GenPept:AAC60619.1" ok 23 - no double colon ok 24 - no trailing colon ok 25 - no double space ok 26 - dblink value is splittable ok 27 - "GenBank:X75015.1" ok 28 - no double colon ok 29 - no trailing colon ok 30 - no double space ok 31 - dblink value is splittable ok 32 - "GenPept:CAA52924.1" ok 33 - no double colon ok 34 - no trailing colon ok 35 - no double space ok 36 - dblink value is splittable ok 37 - "GenBank:AB001594.1" ok 38 - no double colon ok 39 - no trailing colon ok 40 - no double space ok 41 - dblink value is splittable ok 42 - "GenPept:BAA19418.1" ok 43 - no double colon ok 44 - no trailing colon ok 45 - no double space ok 46 - dblink value is splittable ok 47 - "GenBank:I37984" ok 48 - no double colon ok 49 - no trailing colon ok 50 - no double space ok 51 - dblink value is splittable ok 52 - "HSSP:P08670" ok 53 - no double colon ok 54 - no trailing colon ok 55 - no double space ok 56 - dblink value is splittable ok 57 - "IntAct:P35527" ok 58 - no double colon ok 59 - no trailing colon ok 60 - no double space ok 61 - dblink value is splittable ok 62 - "Ensembl:ENSG00000171403" ok 63 - no double colon ok 64 - no trailing colon ok 65 - no double space ok 66 - dblink value is splittable ok 67 - "KEGG:hsa:3857" ok 68 - no double colon ok 69 - no trailing colon ok 70 - no double space ok 71 - dblink value is splittable ok 72 - "HGNC:6447" ok 73 - no double colon ok 74 - no trailing colon ok 75 - no double space ok 76 - dblink value is splittable ok 77 - "MIM:144200" ok 78 - no double colon ok 79 - no trailing colon ok 80 - no double space ok 81 - dblink value is splittable ok 82 - "MIM:607606" ok 83 - no double colon ok 84 - no trailing colon ok 85 - no double space ok 86 - dblink value is splittable ok 87 - "ArrayExpress:P35527" ok 88 - no double colon ok 89 - no trailing colon ok 90 - no double space ok 91 - dblink value is splittable ok 92 - "GO:0005200" ok 93 - no double colon ok 94 - no trailing colon ok 95 - no double space ok 96 - dblink value is splittable ok 97 - "GO:0008544" ok 98 - no double colon ok 99 - no trailing colon ok 100 - no double space ok 101 - dblink value is splittable ok 102 - "InterPro:IPR011000" ok 103 - no double colon ok 104 - no trailing colon ok 105 - no double space ok 106 - dblink value is splittable ok 107 - "InterPro:IPR001664" ok 108 - no double colon ok 109 - no trailing colon ok 110 - no double space ok 111 - dblink value is splittable ok 112 - "InterPro:IPR002957" ok 113 - no double colon ok 114 - no trailing colon ok 115 - no double space ok 116 - dblink value is splittable ok 117 - "Pfam:PF00038" ok 118 - no double colon ok 119 - no trailing colon ok 120 - no double space ok 121 - dblink value is splittable ok 122 - "PRINTS:PR01248" ok 123 - no double colon ok 124 - no trailing colon ok 125 - no double space ok 126 - dblink value is splittable ok 127 - "PROSITE:PS00226" ok 128 - no double colon ok 129 - no trailing colon ok 130 - no double space ok 131 - dblink value is splittable ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Seq/EncodedSeq.t ........................... 1..37 ok 1 - use Bio::Seq::EncodedSeq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - The object isa Bio::Location::Simple ok 12 ok 13 ok 14 - The object isa Bio::Location::Simple ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok t/Seq/LargeLocatableSeq.t .................... 1..8 ok 1 - use Bio::Seq::LargeLocatableSeq; ok 2 ok 3 - The object isa Bio::Seq::LargeSeqI ok 4 ok 5 ok 6 ok 7 ok 8 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio\Location\Split.pm line 104. Subroutine each_Location redefined at Bio\Location\Split.pm line 136. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234. Subroutine splittype redefined at Bio\Location\Split.pm line 258. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311. Subroutine strand redefined at Bio\Location\Split.pm line 339. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380. Subroutine start redefined at Bio\Location\Split.pm line 401. Subroutine end redefined at Bio\Location\Split.pm line 420. Subroutine min_start redefined at Bio\Location\Split.pm line 439. Subroutine max_start redefined at Bio\Location\Split.pm line 461. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484. Subroutine min_end redefined at Bio\Location\Split.pm line 505. Subroutine max_end redefined at Bio\Location\Split.pm line 528. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552. Subroutine seq_id redefined at Bio\Location\Split.pm line 578. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581. t/Seq/LargePSeq.t ............................ 1..30 ok 1 - use Bio::Seq::LargePrimarySeq; ok 2 - use Bio::Seq::LargeSeq; ok 3 - use Bio::Location::Simple; ok 4 - use Bio::Location::Fuzzy; ok 5 - use Bio::Location::Split; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 10 - Subseq is GGGGT ok 11 ok 12 ok 13 ok 14 - trunc seq was GGGGTGAA ok 15 ok 16 ok 17 ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 19 ok 20 - output via Bio::SeqIO::fasta ok 21 - Subseq is GGGGT ok 22 - trunc seq was GGGGTGAA ok 23 ok 24 ok 25 ok 26 - Sequence is ATGGGGTGGGGT ok 27 - Subseq is GGGGT ok 28 - trunc seq was GGGGT ok 29 ok 30 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Seq/LocatableSeq.t ......................... 1..118 ok 1 - use Bio::LocatableSeq; ok 2 - use Bio::AlignIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - The object isa Bio::Location::Simple ok 13 ok 14 ok 15 - The object isa Bio::Location::Simple ok 16 ok 17 ok 18 ok 19 not ok 20 # TODO Need to fix columns before start of seq w/ start > 1 # Failed (TODO) test at t/Seq/LocatableSeq.t line 45. # got: 'Bio::Location::Simple=HASH(0x2026e54)' # expected: undef ok 21 ok 22 - The object isa Bio::AlignIO ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 - The object isa Bio::Location::Simple ok 50 ok 51 ok 52 - The object isa Bio::Location::Simple ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - * is counted in length ok 106 - * is counted in length, but end is wrong ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 not ok 117 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 301. # got: '\-\.=~' # expected: '-\?' not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 303. # got: '19' # expected: anything else ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Seq/MetaSeq.t .............................. 1..128 ok 1 - use Bio::Seq::Meta; ok 2 - use Bio::Seq::Meta::Array; ok 3 - use Bio::SeqIO; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Seq::Quality; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - aa-bb bb ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok t/Seq/PrimaryQual.t .......................... 1..35 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio\Location\Split.pm line 104. Subroutine each_Location redefined at Bio\Location\Split.pm line 136. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234. Subroutine splittype redefined at Bio\Location\Split.pm line 258. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311. Subroutine strand redefined at Bio\Location\Split.pm line 339. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380. Subroutine start redefined at Bio\Location\Split.pm line 401. Subroutine end redefined at Bio\Location\Split.pm line 420. Subroutine min_start redefined at Bio\Location\Split.pm line 439. Subroutine max_start redefined at Bio\Location\Split.pm line 461. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484. Subroutine min_end redefined at Bio\Location\Split.pm line 505. Subroutine max_end redefined at Bio\Location\Split.pm line 528. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552. Subroutine seq_id redefined at Bio\Location\Split.pm line 578. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581. t/Seq/PrimarySeq.t ........................... 1..62 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::Location::Split; ok 5 ok 6 - The object isa Bio::PrimarySeqI ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - The object isa Bio::IdentifiableI ok 15 - The object isa Bio::DescribableI ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - The object isa Bio::PrimarySeqI ok 30 ok 31 - The object isa Bio::PrimarySeqI ok 32 ok 33 - The object isa Bio::PrimarySeqI ok 34 ok 35 - The object isa Bio::PrimarySeqI ok 36 ok 37 ok 38 - alphabet copied through revcom not ok 39 - namespace copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms # Failed (TODO) test 'namespace copied through revcom' # at t/Seq/PrimarySeq.t line 109. # got: '' # expected: 't' not ok 40 - namespace_string copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms # Failed (TODO) test 'namespace_string copied through revcom' # at t/Seq/PrimarySeq.t line 110. # got: ':X677667' # expected: 't:X677667.47' not ok 41 - is_circular copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms # Failed (TODO) test 'is_circular copied through revcom' # at t/Seq/PrimarySeq.t line 112. # got: undef # expected: '0' ok 42 - Translation: LVAST ok 43 - Translation: MVAST ok 44 - Translation: MVAST ok 45 - Translation: MVAST* ok 46 - Translation: M* ok 47 - Translation: M ok 48 ok 49 - Translation: MWP ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 - Bug \#2864 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 1. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 1. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 1. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 1. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 1. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 1. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 1. t/Seq/PrimedSeq.t ............................ 1..10 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimedSeq; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok t/Seq/Quality.t .............................. 1..61 ok 1 - use Bio::Seq::Quality; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Seq/Seq.t .................................. 1..62 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::RichSeq; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Species; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 - truncated sequence length ok 11 - truncated sequence string ok 12 ok 13 ok 14 - alphabet ok 15 - id ok 16 - accession number ok 17 - subseq ok 18 - The object isa Bio::IdentifiableI ok 19 - The object isa Bio::DescribableI ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 - translated sequence ok 34 - translated sequence with unambiguous codons ok 35 - translated sequence with unambiguous codons ok 36 - translated sequence with unambiguous codons ok 37 - translated sequence with unambiguous codons ok 38 - translated sequence with unambiguous codons ok 39 - translated sequence with unambigious 2 char codon ok 40 - translated sequence with stop ok 41 - translated sequence ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 - Bug \#2864 ok t/Seq/WithQuality.t .......................... 1..22 ok 1 - use Bio::Seq::SeqWithQuality; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - The object isa Bio::Seq::PrimaryQual ok 20 - The object isa Bio::PrimarySeq ok 21 ok 22 ok Subroutine new redefined at Bio\Seq.pm line 482. Subroutine seq redefined at Bio\Seq.pm line 568. Subroutine validate_seq redefined at Bio\Seq.pm line 595. Subroutine length redefined at Bio\Seq.pm line 610. Subroutine subseq redefined at Bio\Seq.pm line 634. Subroutine display_id redefined at Bio\Seq.pm line 664. Subroutine accession_number redefined at Bio\Seq.pm line 692. Subroutine desc redefined at Bio\Seq.pm line 708. Subroutine primary_id redefined at Bio\Seq.pm line 735. Subroutine can_call_new redefined at Bio\Seq.pm line 775. Subroutine alphabet redefined at Bio\Seq.pm line 797. Subroutine is_circular redefined at Bio\Seq.pm line 813. Subroutine object_id redefined at Bio\Seq.pm line 836. Subroutine version redefined at Bio\Seq.pm line 853. Subroutine authority redefined at Bio\Seq.pm line 870. Subroutine namespace redefined at Bio\Seq.pm line 887. Subroutine display_name redefined at Bio\Seq.pm line 910. Subroutine description redefined at Bio\Seq.pm line 930. Subroutine annotation redefined at Bio\Seq.pm line 952. Subroutine get_SeqFeatures redefined at Bio\Seq.pm line 995. Subroutine feature_count redefined at Bio\Seq.pm line 1037. Subroutine add_SeqFeature redefined at Bio\Seq.pm line 1062. Subroutine remove_SeqFeatures redefined at Bio\Seq.pm line 1096. Subroutine id redefined at Bio\Seq.pm line 1169. Subroutine primary_seq redefined at Bio\Seq.pm line 1192. Subroutine species redefined at Bio\Seq.pm line 1225. Subroutine DESTROY redefined at Bio\Seq.pm line 1239. Subroutine all_SeqFeatures redefined at Bio\Seq.pm line 1254. Subroutine accession redefined at Bio\Seq.pm line 1258. Subroutine Bio::Seq::flush_SeqFeature redefined at Bio\Seq.pm line 1247. Subroutine Bio::Seq::flush_SeqFeatures redefined at Bio\Seq.pm line 1248. Subroutine Bio::Seq::top_SeqFeatures redefined at Bio\Seq.pm line 1251. Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/SeqEvolution.t ............................. 1..39 ok 1 - use Bio::SeqEvolution::Factory; ok 2 - use Bio::PrimarySeq; ok 3 ok 4 - The object isa Bio::SeqEvolution::DNAPoint ok 5 ok 6 - The object isa Bio::SeqEvolution::DNAPoint ok 7 ok 8 - The object isa Bio::SeqEvolution::DNAPoint ok 9 ok 10 ok 11 - get rate() ok 12 - get and set rate() ok 13 - identity() ok 14 - identity() ok 15 - pam() ok 16 - pam() ok 17 - mutation_count() ok 18 - mutation_count() ok 19 - seq_type() ok 20 - seq_type() ok 21 - next_seq() ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - each_mutation() ok 28 ok 29 ok 30 - get_alignment_identity() ok 31 ok 32 ok 33 - get_mutation_counter() ok 34 - get_sequence_counter() ok 35 - reset_sequence_counter() ok 36 - get_sequence_counter() == 0 ok 37 ok 38 ok 39 - The object isa Bio::SimpleAlign ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 2. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 2. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 2. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 2. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 2. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 2. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 2. t/SeqFeature/FeatureIO.t ..................... 1..35 ok 1 - use Bio::FeatureIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - vecscreen_simple gets the correct features ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581. Subroutine new redefined at Bio\Location\Split.pm line 104. Subroutine each_Location redefined at Bio\Location\Split.pm line 136. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234. Subroutine splittype redefined at Bio\Location\Split.pm line 258. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311. Subroutine strand redefined at Bio\Location\Split.pm line 339. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380. Subroutine start redefined at Bio\Location\Split.pm line 401. Subroutine end redefined at Bio\Location\Split.pm line 420. Subroutine min_start redefined at Bio\Location\Split.pm line 439. Subroutine max_start redefined at Bio\Location\Split.pm line 461. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484. Subroutine min_end redefined at Bio\Location\Split.pm line 505. Subroutine max_end redefined at Bio\Location\Split.pm line 528. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552. Subroutine seq_id redefined at Bio\Location\Split.pm line 578. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624. t/SeqFeature/Location.t ...................... 1..103 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Location::Split; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::SeqFeature::SimilarityPair; ok 6 - use Bio::SeqFeature::FeaturePair; ok 7 - The object isa Bio::LocationI ok 8 - The object isa Bio::RangeI ok 9 - Bio::Location::Simple tests ok 10 ok 11 ok 12 ok 13 ok 14 - Bio::SeqFeature::Generic isa Bio::SeqFeatureI ok 15 - The object isa Bio::RangeI ok 16 ok 17 ok 18 - Bio::SeqFeature::FeaturePair tests ok 19 ok 20 ok 21 ok 22 - Bio::SeqFeature::Generic tests ok 23 ok 24 - Bio::Location::Fuzzy tests ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 - Bio::Location::Split tests ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - Bugfix 1074 ok 56 ok 57 ok 58 ok 59 - Positive length ok 60 ok 61 - seq_id() on Bio::Location::Split ok 62 ok 63 ok 64 - The object isa Bio::LocationI ok 65 - The object isa Bio::RangeI ok 66 - Bio::Location::Simple EXACT ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bio::Location::Simple IN-BETWEEN ok 73 ok 74 ok 75 ok 76 ok 77 - Testing error handling ok 78 ok 79 ok 80 ok 81 - use Bio::Location::WidestCoordPolicy; ok 82 - use Bio::Location::NarrowestCoordPolicy; ok 83 - use Bio::Location::AvWithinCoordPolicy; ok 84 - Default coodinate policy ok 85 ok 86 ok 87 ok 88 - The object isa Bio::Location::WidestCoordPolicy ok 89 - Narrowest coodinate policy ok 90 ok 91 ok 92 ok 93 - The object isa Bio::Location::NarrowestCoordPolicy ok 94 - Average coodinate policy ok 95 ok 96 ok 97 ok 98 - The object isa Bio::Location::AvWithinCoordPolicy ok 99 - Widest coodinate policy ok 100 ok 101 ok 102 ok 103 - The object isa Bio::Location::WidestCoordPolicy ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581. Subroutine new redefined at Bio\Location\Split.pm line 104. Subroutine each_Location redefined at Bio\Location\Split.pm line 136. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234. Subroutine splittype redefined at Bio\Location\Split.pm line 258. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311. Subroutine strand redefined at Bio\Location\Split.pm line 339. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380. Subroutine start redefined at Bio\Location\Split.pm line 401. Subroutine end redefined at Bio\Location\Split.pm line 420. Subroutine min_start redefined at Bio\Location\Split.pm line 439. Subroutine max_start redefined at Bio\Location\Split.pm line 461. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484. Subroutine min_end redefined at Bio\Location\Split.pm line 505. Subroutine max_end redefined at Bio\Location\Split.pm line 528. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552. Subroutine seq_id redefined at Bio\Location\Split.pm line 578. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624. t/SeqFeature/LocationFactory.t ............... 1..272 ok 1 - use Bio::Factory::FTLocationFactory; ok 2 - The object isa Bio::Factory::LocationFactoryI ok 3 - Bio::Location::Simple ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - Location String: J00194:100..202 ok 13 ok 14 - Bio::Location::Fuzzy ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - Location String: 1..? ok 24 ok 25 - Bio::Location::Fuzzy ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - Location String: (122.133)..(204.221) ok 35 ok 36 - Bio::Location::Fuzzy ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Location String: (102.110) ok 46 ok 47 - Bio::Location::Simple ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - Location String: 340..565 ok 57 ok 58 - Bio::Location::Split ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - Location String: join(12..78,134..202) ok 68 ok 69 - Bio::Location::Fuzzy ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Location String: ?..? ok 79 ok 80 - Bio::Location::Fuzzy ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - Location String: <345..500 ok 90 ok 91 - Bio::Location::Fuzzy ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 - Location String: ?22..?64 ok 101 ok 102 - Bio::Location::Simple ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 - Location String: J00194:100..202 ok 112 ok 113 - Bio::Location::Simple ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 - Location String: 467 ok 123 ok 124 - Bio::Location::Fuzzy ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 - Location String: (23.45)..600 ok 134 ok 135 - Bio::Location::Simple ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 - Location String: 123^124 ok 145 ok 146 - Bio::Location::Fuzzy ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - Location String: <1..? ok 156 ok 157 - Bio::Location::Fuzzy ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 - Location String: 145^177 ok 167 ok 168 - Bio::Location::Fuzzy ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 - Location String: 22..?64 ok 178 ok 179 - Bio::Location::Fuzzy ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 - Location String: complement(34..(122.126)) ok 189 ok 190 - Bio::Location::Split ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - Location String: complement(join(4918..5163,2691..4571)) ok 200 ok 201 - Bio::Location::Split ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599) ok 211 ok 212 - Bio::Location::Fuzzy ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 - Location String: ?..>393 ok 222 ok 223 - Bio::Location::Fuzzy ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 - Location String: ?2465..2774 ok 233 ok 234 - Bio::Location::Fuzzy ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 - Location String: (122.133)..(204.221) ok 244 ok 245 - Bio::Location::Fuzzy ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 - Location String: ?..536 ok 255 ok 256 - Bio::Location::Fuzzy ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 - Location String: <1..888 ok 266 ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294))) ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081))) ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669))) ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672))) ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000) ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19)) ok t/SeqFeature/Primer.t ........................ 1..18 ok 1 - use Bio::SeqFeature::Primer; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/SeqFeature/Range.t ......................... 1..49 ok 1 - use Bio::Range; ok 2 - BioRange object isa Bio::Range ok 3 ok 4 - BioRange object isa Bio::Range ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - BioRange object isa Bio::Range ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - BioRange object isa Bio::Range ok 26 - BioRange object isa Bio::Range ok 27 - BioRange object isa Bio::Range ok 28 - 1 & -1 ok 29 - 1 & 1 true ok 30 - 1 & 0 true ok 31 - 1 & -1 false ok 32 - 1 & 1 true ok 33 - 1 & 0 false ok 34 - 1 & -1 false ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Bio::Range object isa Bio::Range ok 46 ok 47 ok 48 ok 49 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/SeqFeature/RangeI.t ........................ 1..38 ok 1 - use Bio::SeqFeature::Generic; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 12. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 12. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 12. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 12. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 12. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 12. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 12. t/SeqFeature/SeqAnalysisParser.t ............. 1..14 ok 1 - use Bio::Factory::SeqAnalysisParserFactory; ok 2 - use Bio::SeqIO; ok 3 - The object isa Bio::SeqIO ok 4 - The object isa Bio::PrimarySeqI ok 5 - The object isa Bio::SeqAnalysisParserI ok 6 ok 7 ok 8 ok 9 - The object isa Bio::PrimarySeqI ok 10 - The object isa Bio::SeqAnalysisParserI ok 11 ok 12 ok 13 - The object isa Bio::SeqAnalysisParserI ok 14 ok t/SeqFeature/SeqFeatAnnotated.t .............. skipped: Network tests have not been requested t/SeqFeature/SeqFeatCollection.t ............. skipped: The optional module DB_File (or dependencies thereof) was not installed Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 37. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 37. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 37. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 37. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 37. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 37. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 37. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 37. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 37. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 37. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 37. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 37. Subroutine new redefined at Bio\Location\Split.pm line 104, line 33. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 33. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 33. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 33. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 33. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 33. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 33. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 33. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 33. Subroutine start redefined at Bio\Location\Split.pm line 401, line 33. Subroutine end redefined at Bio\Location\Split.pm line 420, line 33. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 33. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 33. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 33. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 33. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 33. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 33. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 33. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 33. t/SeqFeature/SeqFeature.t .................... 1..222 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::SeqFeature::FeaturePair; ok 5 - use Bio::SeqFeature::Computation; ok 6 - use Bio::SeqFeature::Gene::Transcript; ok 7 - use Bio::SeqFeature::Gene::UTR; ok 8 - use Bio::SeqFeature::Gene::Exon; ok 9 - use Bio::SeqFeature::Gene::Poly_A_site; ok 10 - use Bio::SeqFeature::Gene::GeneStructure; ok 11 - use Bio::Location::Fuzzy; ok 12 - start of feature location ok 13 - end of feature location ok 14 - primary tag ok 15 - source tag ok 16 ok 17 ok 18 - feature1 of pair stored ok 19 - feature2 of pair stored ok 20 - feature start ok 21 - feature end ok 22 - primary tag ok 23 - source tag ok 24 - hstart ok 25 - hend ok 26 - hprimary tag ok 27 - hsource tag ok 28 - inverted end ok 29 ok 30 - seq string ok 31 - sf1 end ok 32 - sf1 start ok 33 ok 34 - sf2 ok 35 ok 36 - computation id ok 37 - score value ok 38 ok 39 ok 40 - sft[0] is exon ok 41 ok 42 - computation id ok 43 ok 44 - score value ok 45 - sfeat start for EXPAND-ED feature (bug \#947) ok 46 - sfeat end for EXPAND-ED feature (bug \#947) ok 47 ok 48 - can create feature starting and ending at 0 ok 49 ok 50 - can create feature starting and ending at 0 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 - mRNA spliced length ok 71 - has 2 UTRs ok 72 ok 73 ok 74 ok 75 ok 76 - The object isa Bio::SeqIO ok 77 - The object isa Bio::Seq ok 78 # skip Network tests have not been requested ok 79 # skip Network tests have not been requested ok 80 # skip Network tests have not been requested ok 81 # skip Network tests have not been requested ok 82 # skip Network tests have not been requested ok 83 - The object isa Bio::SeqIO ok 84 - The object isa Bio::Seq ok 85 # skip Network tests have not been requested ok 86 # skip Network tests have not been requested ok 87 - The object isa Bio::SeqIO ok 88 - spliced seq translation matches expected ok 89 - spliced seq translation matches expected ok 90 - spliced seq translation matches expected ok 91 - spliced seq translation matches expected ok 92 - spliced seq translation matches expected ok 93 - spliced seq translation matches expected ok 94 - spliced seq translation matches expected ok 95 - spliced seq translation matches expected ok 96 - spliced seq translation matches expected ok 97 - spliced seq translation matches expected ok 98 - spliced seq translation matches expected ok 99 - spliced seq translation matches expected ok 100 - spliced seq translation matches expected ok 101 - spliced seq translation matches expected ok 102 - spliced seq translation matches expected ok 103 - spliced seq translation matches expected ok 104 - spliced seq translation matches expected ok 105 - spliced seq translation matches expected ok 106 - spliced seq translation matches expected ok 107 - spliced seq translation matches expected ok 108 - spliced seq translation matches expected ok 109 - spliced seq translation matches expected ok 110 - spliced seq translation matches expected ok 111 - spliced seq translation matches expected ok 112 - spliced seq translation matches expected ok 113 - spliced seq translation matches expected ok 114 - spliced seq translation matches expected ok 115 - spliced seq translation matches expected ok 116 - spliced seq translation matches expected ok 117 - spliced seq translation matches expected ok 118 - spliced seq translation matches expected ok 119 - spliced seq translation matches expected ok 120 - spliced seq translation matches expected ok 121 - spliced seq translation matches expected ok 122 - spliced seq translation matches expected ok 123 - spliced seq translation matches expected ok 124 - spliced seq translation matches expected ok 125 - spliced seq translation matches expected ok 126 - spliced seq translation matches expected ok 127 - spliced seq translation matches expected ok 128 - spliced seq translation matches expected ok 129 - spliced seq translation matches expected ok 130 - spliced seq translation matches expected ok 131 - spliced seq translation matches expected ok 132 - spliced seq translation matches expected ok 133 - spliced seq translation matches expected ok 134 - spliced seq translation matches expected ok 135 - spliced seq translation matches expected ok 136 - spliced seq translation matches expected ok 137 - spliced seq translation matches expected ok 138 - spliced seq translation matches expected ok 139 - spliced seq translation matches expected ok 140 - spliced seq translation matches expected ok 141 - spliced seq translation matches expected ok 142 - spliced seq translation matches expected ok 143 - spliced seq translation matches expected ok 144 - spliced seq translation matches expected ok 145 - spliced seq translation matches expected ok 146 - spliced seq translation matches expected ok 147 - spliced seq translation matches expected ok 148 - spliced seq translation matches expected ok 149 - spliced seq translation matches expected ok 150 - spliced seq translation matches expected ok 151 - spliced seq translation matches expected ok 152 - spliced seq translation matches expected ok 153 - spliced seq translation matches expected ok 154 - spliced seq translation matches expected ok 155 - spliced seq translation matches expected ok 156 - spliced seq translation matches expected ok 157 - spliced seq translation matches expected ok 158 - spliced seq translation matches expected ok 159 - spliced seq translation matches expected ok 160 - spliced seq translation matches expected ok 161 - spliced seq translation matches expected ok 162 - spliced seq translation matches expected ok 163 - spliced seq translation matches expected ok 164 - spliced seq translation matches expected ok 165 - spliced seq translation matches expected ok 166 - spliced seq translation matches expected ok 167 - spliced seq translation matches expected ok 168 - spliced seq translation matches expected ok 169 - spliced seq translation matches expected ok 170 - spliced seq translation matches expected ok 171 - spliced seq translation matches expected ok 172 - spliced seq translation matches expected ok 173 - spliced seq translation matches expected ok 174 - spliced seq translation matches expected ok 175 - spliced seq translation matches expected ok 176 - spliced seq translation matches expected ok 177 - spliced seq translation matches expected ok 178 - spliced seq translation matches expected ok 179 - spliced seq translation matches expected ok 180 - spliced seq translation matches expected ok 181 - spliced seq translation matches expected ok 182 - spliced seq translation matches expected ok 183 - spliced seq translation matches expected ok 184 - spliced seq translation matches expected ok 185 - spliced seq translation matches expected ok 186 - spliced seq translation matches expected ok 187 - spliced seq translation matches expected ok 188 - spliced seq translation matches expected ok 189 - spliced seq translation matches expected ok 190 - spliced seq translation matches expected ok 191 - spliced seq translation matches expected ok 192 - spliced seq translation matches expected ok 193 - spliced seq translation matches expected ok 194 - spliced seq translation matches expected ok 195 - spliced seq translation matches expected ok 196 - spliced seq translation matches expected ok 197 - spliced seq translation matches expected ok 198 - spliced seq translation matches expected ok 199 - spliced seq translation matches expected ok 200 - spliced seq translation matches expected ok 201 - spliced seq translation matches expected ok 202 - spliced seq translation matches expected ok 203 - spliced seq translation matches expected ok 204 - spliced seq translation matches expected ok 205 ok 206 - phase check ok 207 ok 208 - phase check ok 209 ok 210 - phase check ok 211 ok 212 - phase check ok 213 ok 214 - phase check ok 215 - tags found ok 216 - get_tagset_values tag values found ok 217 - get_tagset_values tag values for multiple tags found ok 218 - get_tag_values tag values found ok 219 - get_tag_values lives with tag ok 220 - get_tagset_values no tag values found ok 221 - get_tagset_values lives with no tag ok 222 - get_tag_values throws with no tag ok t/SeqFeature/SeqFeaturePrimer.t .............. 1..8 ok 1 - use Bio::SeqFeature::Primer; ok 2 - The object isa Bio::SeqFeature::Primer ok 3 - The object isa Bio::SeqFeature::Primer ok 4 - The object isa Bio::Seq ok 5 ok 6 ok 7 ok 8 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 106. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 106. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 106. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 106. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 106. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 106. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 106. Subroutine new redefined at Bio\Location\Split.pm line 104, line 117. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 117. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 117. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 117. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 117. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 117. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 117. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 117. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 117. Subroutine start redefined at Bio\Location\Split.pm line 401, line 117. Subroutine end redefined at Bio\Location\Split.pm line 420, line 117. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 117. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 117. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 117. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 117. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 117. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 117. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 117. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 117. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 2111. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 2111. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 2111. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 2111. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 2111. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 2111. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 2111. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 2111. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 2111. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 2111. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 2111. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 2111. t/SeqFeature/Unflattener.t ................... 1..9 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Tools::Unflattener; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 31. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 31. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 31. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 31. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 31. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 31. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 31. Subroutine new redefined at Bio\Location\Split.pm line 104, line 52. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 52. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 52. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 52. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 52. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 52. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 52. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 52. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 52. Subroutine start redefined at Bio\Location\Split.pm line 401, line 52. Subroutine end redefined at Bio\Location\Split.pm line 420, line 52. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 52. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 52. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 52. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 52. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 52. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 52. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 52. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 52. t/SeqFeature/Unflattener2.t .................. 1..12 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Tools::Unflattener; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok t/SeqIO.t .................................... 1..41 ok 1 - use Bio::SeqIO; ok 2 ok 3 - ID for format gcg ok 4 ok 5 ok 6 ok 7 ok 8 - ID for format fasta ok 9 ok 10 ok 11 ok 12 - accession.version ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - ID for format pir ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - ID for format tab ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - ID for format ace ok 32 ok 33 ok 34 ok 35 ok 36 - use Algorithm::Diff; ok 37 - use IO::ScalarArray; ok 38 - use IO::String; ok 39 ok 40 ok 41 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 48. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 48. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 48. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 48. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 48. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 48. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 48. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 35. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 35. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 35. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 35. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 35. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 35. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 35. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 35. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 35. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 35. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 35. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 35. Subroutine new redefined at Bio\Location\Split.pm line 104, line 54. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 54. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 54. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 54. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 54. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 54. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 54. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 54. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 54. Subroutine start redefined at Bio\Location\Split.pm line 401, line 54. Subroutine end redefined at Bio\Location\Split.pm line 420, line 54. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 54. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 54. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 54. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 54. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 54. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 54. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 54. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 54. t/SeqIO/Handler.t ............................ 1..561 ok 1 - use Bio::SeqIO; ok 2 - AI129902 ok 3 ok 4 ok 5 ok 6 - NT_021877 ok 7 ok 8 ok 9 ok 10 ok 11 - BAB68554 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - operator overloading in AnnotationI is deprecated ok 22 - NC_006346 ok 23 ok 24 ok 25 - U71225 ok 26 ok 27 - AB077698 ok 28 ok 29 - DQ018368 ok 30 - D10483 ok 31 ok 32 ok 33 ok 34 - bug 1487 ok 35 ok 36 - bug 1647 ok 37 ok 38 ok 39 - bug 1673 ok 40 ok 41 ok 42 ok 43 - AF165282 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - species parsing incorrect for genbank ok 53 - genus duplicated in genbank parsing ok 54 ok 55 ok 56 - species parsing incorrect for genbank ok 57 - genus duplicated in genbank parsing ok 58 ok 59 ok 60 - species parsing incorrect for genbank ok 61 - genus duplicated in genbank parsing ok 62 ok 63 - streaming ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 - Total number of sequences in test file ok 70 ok 71 - Fuzzy in ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 - Fuzzy out ok 84 - BK000016 ok 85 ok 86 - BK000016 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 - BK000016 ok 102 - roundtrip ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 - revcomp split location ok 121 - Bug 1925 ok 122 ok 123 ok 124 - wgs ok 125 ok 126 - wgs_scafld ok 127 ok 128 - wgs_scafld ok 129 ok 130 ok 131 - BC000007 ok 132 - BK000016-tpa.gbk ok 133 - ay116458.gb ok 134 - ay149291.gb ok 135 - NC_006346.gb ok 136 - ay007676.gb ok 137 - dq519393.gb ok 138 ok 139 - swissprot:K1C9_HUMAN ok 140 ok 141 - swissprot ok 142 ok 143 - GenBank:Z29074.1 ok 144 ok 145 - GenBank ok 146 ok 147 - GenPept:CAA82315.1 ok 148 ok 149 - GenPept ok 150 ok 151 - GenBank:S69510.1 ok 152 ok 153 - GenBank ok 154 ok 155 - GenPept:AAC60619.1 ok 156 ok 157 - GenPept ok 158 ok 159 - GenBank:X75015.1 ok 160 ok 161 - GenBank ok 162 ok 163 - GenPept:CAA52924.1 ok 164 ok 165 - GenPept ok 166 ok 167 - GenBank:AB001594.1 ok 168 ok 169 - GenBank ok 170 ok 171 - GenPept:BAA19418.1 ok 172 ok 173 - GenPept ok 174 ok 175 - GenBank:I37984 ok 176 ok 177 - GenBank ok 178 ok 179 - HSSP:P08670 ok 180 ok 181 - HSSP ok 182 ok 183 - IntAct:P35527 ok 184 ok 185 - IntAct ok 186 ok 187 - Ensembl:ENSG00000171403 ok 188 ok 189 - Ensembl ok 190 ok 191 - KEGG:hsa:3857 ok 192 ok 193 - KEGG ok 194 ok 195 - HGNC:6447 ok 196 ok 197 - HGNC ok 198 ok 199 - MIM:144200 ok 200 ok 201 - MIM ok 202 ok 203 - MIM:607606 ok 204 ok 205 - MIM ok 206 ok 207 - ArrayExpress:P35527 ok 208 ok 209 - ArrayExpress ok 210 ok 211 - GO:0005200 ok 212 ok 213 - GO ok 214 ok 215 - GO:0008544 ok 216 ok 217 - GO ok 218 ok 219 - InterPro:IPR011000 ok 220 ok 221 - InterPro ok 222 ok 223 - InterPro:IPR001664 ok 224 ok 225 - InterPro ok 226 ok 227 - InterPro:IPR002957 ok 228 ok 229 - InterPro ok 230 ok 231 - Pfam:PF00038 ok 232 ok 233 - Pfam ok 234 ok 235 - PRINTS:PR01248 ok 236 ok 237 - PRINTS ok 238 ok 239 - PROSITE:PS00226 ok 240 ok 241 - PROSITE ok 242 ok 243 - Bug 2195 ok 244 - Bug 2195 ok 245 - The object isa Bio::Annotation::SimpleValue ok 246 ok 247 - The object isa Bio::Annotation::SimpleValue ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 - success reading Embl with ^ location and badly split double quotes ok 274 ok 275 ok 276 - success writing Embl format with ^ < and > locations ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 - genus duplication test ok 310 ok 311 ok 312 - The object isa Bio::SeqIO ok 313 - The object isa Bio::Taxon ok 314 ok 315 ok 316 - operator overloading in AnnotationI is deprecated ok 317 ok 318 - dates ok 319 - dates ok 320 - dates ok 321 ok 322 - The object isa Bio::Seq::RichSeqI ok 323 ok 324 ok 325 ok 326 - operator overloading in AnnotationI is deprecated ok 327 ok 328 ok 329 ok 330 ok 331 - id is ROA1_HUMAN ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 - operator overloading in AnnotationI is deprecated ok 340 ok 341 ok 342 ok 343 - The object isa Bio::Seq::RichSeqI ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 - operator overloading in AnnotationI is deprecated ok 354 ok 355 ok 356 ok 357 - GC1QBP ok 358 - HABP1 ok 359 - SF2P32 ok 360 - C1QBP ok 361 ok 362 - The object isa Bio::Seq::RichSeqI ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 - F54H12.1 ok 370 - The object isa Bio::Seq::RichSeqI ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 - The object isa Bio::Seq::RichSeqI ok 383 ok 384 ok 385 ok 386 ok 387 - The object isa Bio::Seq::RichSeqI ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 - The object isa Bio::Seq::RichSeqI ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 - The object isa Bio::Taxon ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 - The object isa Bio::Taxon ok 518 ok 519 ok 520 - operator overloading in AnnotationI is deprecated ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 - P39765 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 - operator overloading in AnnotationI is deprecated ok t/SeqIO/MultiFile.t .......................... 1..3 ok 1 - use Bio::SeqIO::MultiFile; ok 2 ok 3 ok t/SeqIO/Multiple_fasta.t ..................... 1..9 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - all sequences in the file ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 31. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 31. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 31. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 31. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 31. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 31. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 31. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 33. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 33. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 33. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 33. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 33. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 33. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 33. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 33. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 33. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 33. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 33. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 33. Subroutine new redefined at Bio\Location\Split.pm line 104, line 35. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 35. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 35. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 35. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 35. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 35. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 35. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 35. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 35. Subroutine start redefined at Bio\Location\Split.pm line 401, line 35. Subroutine end redefined at Bio\Location\Split.pm line 420, line 35. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 35. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 35. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 35. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 35. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 35. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 35. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 35. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 35. t/SeqIO/SeqBuilder.t ......................... 1..101 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - The object isa Bio::Factory::ObjectBuilderI ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 82. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 82. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 82. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 82. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 82. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 82. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 82. Subroutine new redefined at Bio\Location\Split.pm line 104, line 101. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 101. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 101. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 101. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 101. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 101. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 101. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 101. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 101. Subroutine start redefined at Bio\Location\Split.pm line 401, line 101. Subroutine end redefined at Bio\Location\Split.pm line 420, line 101. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 101. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 101. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 101. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 101. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 101. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 101. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 101. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 101. t/SeqIO/Splicedseq.t ......................... 1..14 ok 1 - use Bio::SeqIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - get_SeqFeatures() ok 12 - protein sequence ok 13 - nucleotide sequence - correct CDS range ok 14 - nucleotide length ok t/SeqIO/abi.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/ace.t ................................ 1..7 ok 1 - use Bio::SeqIO; ok 2 - number of sequence objects ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters ok 4 - alphabets detected ok 5 - alphabets detected ok 6 - writing sequence ok 7 - test output ok t/SeqIO/agave.t .............................. 1..8 ok 1 - use Bio::SeqIO::agave; not ok 2 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 3 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 4 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 5 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 6 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 7 # TODO & SKIP No tests for agave format -- no sample file to test against not ok 8 # TODO & SKIP No tests for agave format -- no sample file to test against ok t/SeqIO/alf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed Subroutine new redefined at Bio\Location\Simple.pm line 93, line 106. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 106. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 106. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 106. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 106. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 106. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 106. Subroutine new redefined at Bio\Location\Split.pm line 104, line 117. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 117. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 117. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 117. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 117. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 117. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 117. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 117. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 117. Subroutine start redefined at Bio\Location\Split.pm line 401, line 117. Subroutine end redefined at Bio\Location\Split.pm line 420, line 117. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 117. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 117. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 117. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 117. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 117. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 117. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 117. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 117. t/SeqIO/asciitree.t .......................... 1..2 ok 1 - use Bio::SeqIO; ok 2 - File exists, has contents on MSWin32 ok Subroutine next_seq redefined at Bio\SeqIO\bsml.pm line 187. Subroutine GETFLOPPIES redefined at Bio\SeqIO\bsml.pm line 428. Subroutine FLOPPYVALS redefined at Bio\SeqIO\bsml.pm line 444. Subroutine FIRSTDATA redefined at Bio\SeqIO\bsml.pm line 464. Subroutine STRIP redefined at Bio\SeqIO\bsml.pm line 481. Subroutine to_bsml redefined at Bio\SeqIO\bsml.pm line 547. Subroutine write_seq redefined at Bio\SeqIO\bsml.pm line 846. Subroutine _parse_location redefined at Bio\SeqIO\bsml.pm line 894. Subroutine _parse_bsml_feature redefined at Bio\SeqIO\bsml.pm line 947. Subroutine _parse_bsml_location redefined at Bio\SeqIO\bsml.pm line 1026. Subroutine _parse_reference redefined at Bio\SeqIO\bsml.pm line 1083. Subroutine _parse_annotation redefined at Bio\SeqIO\bsml.pm line 1149. Subroutine _parse_annotation_old redefined at Bio\SeqIO\bsml.pm line 1221. Subroutine _add_page redefined at Bio\SeqIO\bsml.pm line 1266. Subroutine _addel redefined at Bio\SeqIO\bsml.pm line 1305. Subroutine _show_dna redefined at Bio\SeqIO\bsml.pm line 1329. Subroutine _initialize redefined at Bio\SeqIO\bsml.pm line 1349. Subroutine _parseparams redefined at Bio\SeqIO\bsml.pm line 1388. Subroutine _parse_xml redefined at Bio\SeqIO\bsml.pm line 1415. Subroutine DESTROY redefined at Bio\SeqIO\bsml.pm line 1428. Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/SeqIO/bsml.t ............................... 1..16 ok 1 - use XML::DOM; ok 2 - use Bio::SeqIO::bsml; ok 3 - The object isa Bio::Seq::RichSeqI ok 4 - got correct number of refs ok 5 - display_id ok 6 - molecule ok 7 - is_circular ok 8 - dates ok 9 - accession_number ok 10 - seq_version ok 11 - got correct number of SeqFeatures ok 12 - feature start ok 13 - feature end ok 14 - get_tag_values db_xref ok 15 - get_Annotations reference ok 16 - get_Annotations dblink ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/SeqIO/bsml_sax.t ........................... 1..15 ok 1 - use Bio::SeqIO; ok 2 - The object isa Bio::Seq::RichSeqI ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SeqIO/chadoxml.t ........................... 1..8 ok 1 - use Bio::SeqIO::chadoxml; not ok 2 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 3 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 4 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 5 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 6 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 7 # TODO & SKIP No tests for chadoxml format -- no sample file to test against not ok 8 # TODO & SKIP No tests for chadoxml format -- no sample file to test against ok t/SeqIO/chaos.t .............................. 1..8 ok 1 - use Bio::SeqIO::chaos; not ok 2 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 3 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 4 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 5 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 6 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 7 # TODO & SKIP No tests for chaos format -- no sample file to test against not ok 8 # TODO & SKIP No tests for chaos format -- no sample file to test against ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 106. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 106. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 106. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 106. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 106. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 106. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 106. Subroutine new redefined at Bio\Location\Split.pm line 104, line 117. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 117. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 117. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 117. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 117. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 117. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 117. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 117. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 117. Subroutine start redefined at Bio\Location\Split.pm line 401, line 117. Subroutine end redefined at Bio\Location\Split.pm line 420, line 117. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 117. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 117. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 117. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 117. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 117. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 117. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 117. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 117. t/SeqIO/chaosxml.t ........................... 1..2 ok 1 - use Bio::SeqIO; ok 2 ok t/SeqIO/ctf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\embl.pm line 153. Subroutine next_seq redefined at Bio\SeqIO\embl.pm line 178. Subroutine _write_ID_line redefined at Bio\SeqIO\embl.pm line 477. Subroutine _is_valid_division redefined at Bio\SeqIO\embl.pm line 554. Subroutine _is_valid_molecule_type redefined at Bio\SeqIO\embl.pm line 587. Subroutine write_seq redefined at Bio\SeqIO\embl.pm line 620. Subroutine _print_EMBL_FTHelper redefined at Bio\SeqIO\embl.pm line 903. Subroutine _read_EMBL_References redefined at Bio\SeqIO\embl.pm line 966. Subroutine _read_EMBL_Species redefined at Bio\SeqIO\embl.pm line 1034. Subroutine _read_EMBL_DBLink redefined at Bio\SeqIO\embl.pm line 1138. Subroutine _read_EMBL_TaxID_DBLink redefined at Bio\SeqIO\embl.pm line 1172. Subroutine _filehandle redefined at Bio\SeqIO\embl.pm line 1205. Subroutine _read_FTHelper_EMBL redefined at Bio\SeqIO\embl.pm line 1226. Subroutine _write_line_EMBL redefined at Bio\SeqIO\embl.pm line 1346. Subroutine _write_line_EMBL_regex redefined at Bio\SeqIO\embl.pm line 1382. Subroutine _post_sort redefined at Bio\SeqIO\embl.pm line 1433. Subroutine _show_dna redefined at Bio\SeqIO\embl.pm line 1454. Subroutine _id_generation_func redefined at Bio\SeqIO\embl.pm line 1475. Subroutine _ac_generation_func redefined at Bio\SeqIO\embl.pm line 1496. Subroutine _sv_generation_func redefined at Bio\SeqIO\embl.pm line 1517. Subroutine _kw_generation_func redefined at Bio\SeqIO\embl.pm line 1538. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 45. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 45. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 45. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 45. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 45. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 45. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 45. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 92. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 92. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 92. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 92. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 92. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 92. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 92. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 92. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 92. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 92. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 92. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 92. Subroutine new redefined at Bio\Location\Split.pm line 104, line 135. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 135. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 135. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 135. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 135. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 135. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 135. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 135. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 135. Subroutine start redefined at Bio\Location\Split.pm line 401, line 135. Subroutine end redefined at Bio\Location\Split.pm line 420, line 135. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 135. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 135. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 135. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 135. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 135. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 135. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 135. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 135. t/SeqIO/embl.t ............................... 1..69 ok 1 - use Bio::SeqIO::embl; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - success reading Embl with ^ location and badly split double quotes ok 25 ok 26 - success writing Embl format with ^ < and > locations ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - genus duplication test ok 55 ok 56 ok 57 ok 58 ok 59 - CDS - accession on PA line ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - CDS - OX tagname ok 68 - CDS - OX database ok 69 - CDS - OX primary_id ok t/SeqIO/entrezgene.t ......................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\excel.pm line 134. Subroutine worksheet redefined at Bio\SeqIO\excel.pm line 166. Subroutine close redefined at Bio\SeqIO\excel.pm line 195. Subroutine _worksheet redefined at Bio\SeqIO\excel.pm line 224. Subroutine _next_record redefined at Bio\SeqIO\excel.pm line 249. Subroutine _get_row_values redefined at Bio\SeqIO\excel.pm line 296. t/SeqIO/excel.t .............................. 1..4 ok 1 - use Bio::SeqIO::excel; ok 2 - The object isa Bio::SeqIO ok 3 - Bio::SeqIO::excel->can('next_seq') ok 4 - Bio::SeqIO::excel->can('write_seq') ok t/SeqIO/exp.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed Subroutine _initialize redefined at Bio\SeqIO\fasta.pm line 92. Subroutine next_seq redefined at Bio\SeqIO\fasta.pm line 112. Subroutine write_seq redefined at Bio\SeqIO\fasta.pm line 193. Subroutine width redefined at Bio\SeqIO\fasta.pm line 272. Subroutine preferred_id_type redefined at Bio\SeqIO\fasta.pm line 295. t/SeqIO/fasta.t .............................. 1..22 ok 1 - use Bio::SeqIO::fasta; ok 2 - The object isa Bio::SeqIO ok 3 - Bio::SeqIO::fasta->can('next_seq') ok 4 - Bio::SeqIO::fasta->can('write_seq') ok 5 - The object isa Bio::Seq ok 6 - sequence ok 7 - length ok 8 - primary_id ok 9 - description ok 10 - The object isa Bio::Seq ok 11 - sequence ok 12 - length ok 13 - primary_id ok 14 - description ok 15 - use Algorithm::Diff; ok 16 - use IO::ScalarArray; ok 17 - use IO::String; ok 18 - fasta format can round-trip ok 19 - dies with roa1.genbank ok 20 - dies with test.gcg ok 21 - dies with test.ace ok 22 - dies with test.raw ok Subroutine _initialize redefined at Bio\SeqIO\fastq.pm line 10. Subroutine next_seq redefined at Bio\SeqIO\fastq.pm line 27. Subroutine next_dataset redefined at Bio\SeqIO\fastq.pm line 39. Subroutine write_seq redefined at Bio\SeqIO\fastq.pm line 122. Subroutine write_fastq redefined at Bio\SeqIO\fastq.pm line 181. Subroutine write_fasta redefined at Bio\SeqIO\fastq.pm line 186. Subroutine write_qual redefined at Bio\SeqIO\fastq.pm line 194. Subroutine variant redefined at Bio\SeqIO\fastq.pm line 221. Subroutine _init_tables redefined at Bio\SeqIO\fastq.pm line 232. Subroutine validate redefined at Bio\SeqIO\fastq.pm line 270. Subroutine quality_header redefined at Bio\SeqIO\fastq.pm line 278. t/SeqIO/fastq.t .............................. 1..127 ok 1 - use Bio::SeqIO::fastq; ok 2 - use Bio::Seq::Quality; ok 3 - bug2335 parses ok 4 - correct num. seqs in bug2335 ok 5 - sample sequence obtained ok 6 - The object isa Bio::Seq::Quality ok 7 - seq() matches bug2335 ok 8 - desc() matches bug2335 ok 9 - display_id() matches bug2335 ok 10 - qual() matches bug2335 ok 11 - evil_wrapping parses ok 12 - correct num. seqs in evil_wrapping ok 13 - sample sequence obtained ok 14 - The object isa Bio::Seq::Quality ok 15 - seq() matches evil_wrapping ok 16 - desc() matches evil_wrapping ok 17 - display_id() matches evil_wrapping ok 18 - qual() matches evil_wrapping ok 19 - example parses ok 20 - correct num. seqs in example ok 21 - sample sequence obtained ok 22 - The object isa Bio::Seq::Quality ok 23 - seq() matches example ok 24 - desc() matches example ok 25 - display_id() matches example ok 26 - qual() matches example ok 27 - illumina_faked parses ok 28 - correct num. seqs in illumina_faked ok 29 - sample sequence obtained ok 30 - The object isa Bio::Seq::Quality ok 31 - seq() matches illumina_faked ok 32 - desc() matches illumina_faked ok 33 - display_id() matches illumina_faked ok 34 - qual() matches illumina_faked ok 35 - sanger_93 parses ok 36 - correct num. seqs in sanger_93 ok 37 - sample sequence obtained ok 38 - The object isa Bio::Seq::Quality ok 39 - seq() matches sanger_93 ok 40 - desc() matches sanger_93 ok 41 - display_id() matches sanger_93 ok 42 - qual() matches sanger_93 ok 43 - sanger_faked parses ok 44 - correct num. seqs in sanger_faked ok 45 - sample sequence obtained ok 46 - The object isa Bio::Seq::Quality ok 47 - seq() matches sanger_faked ok 48 - desc() matches sanger_faked ok 49 - display_id() matches sanger_faked ok 50 - qual() matches sanger_faked ok 51 - solexa_example parses ok 52 - correct num. seqs in solexa_example ok 53 - sample sequence obtained ok 54 - The object isa Bio::Seq::Quality ok 55 - seq() matches solexa_example ok 56 - desc() matches solexa_example ok 57 - display_id() matches solexa_example ok 58 - qual() matches solexa_example ok 59 - solexa_faked parses ok 60 - correct num. seqs in solexa_faked ok 61 - sample sequence obtained ok 62 - The object isa Bio::Seq::Quality ok 63 - seq() matches solexa_faked ok 64 - desc() matches solexa_faked ok 65 - display_id() matches solexa_faked ok 66 - qual() matches solexa_faked ok 67 - test1_sanger parses ok 68 - correct num. seqs in test1_sanger ok 69 - sample sequence obtained ok 70 - The object isa Bio::Seq::Quality ok 71 - seq() matches test1_sanger ok 72 - desc() matches test1_sanger ok 73 - display_id() matches test1_sanger ok 74 - qual() matches test1_sanger ok 75 - test2_solexa parses ok 76 - correct num. seqs in test2_solexa ok 77 - sample sequence obtained ok 78 - The object isa Bio::Seq::Quality ok 79 - seq() matches test2_solexa ok 80 - desc() matches test2_solexa ok 81 - display_id() matches test2_solexa ok 82 - qual() matches test2_solexa ok 83 - test3_illumina parses ok 84 - correct num. seqs in test3_illumina ok 85 - sample sequence obtained ok 86 - The object isa Bio::Seq::Quality ok 87 - seq() matches test3_illumina ok 88 - desc() matches test3_illumina ok 89 - display_id() matches test3_illumina ok 90 - qual() matches test3_illumina ok 91 - tricky parses ok 92 - correct num. seqs in tricky ok 93 - sample sequence obtained ok 94 - The object isa Bio::Seq::Quality ok 95 - seq() matches tricky ok 96 - desc() matches tricky ok 97 - display_id() matches tricky ok 98 - qual() matches tricky ok 99 - Conversion from illumina to sanger ok 100 - Conversion from illumina to illumina ok 101 - Conversion from illumina to solexa ok 102 - Conversion from sanger to sanger ok 103 - Conversion from sanger to illumina ok 104 - Conversion from sanger to solexa ok 105 - Conversion from solexa to sanger ok 106 - Conversion from solexa to illumina ok 107 - Conversion from solexa to solexa ok 108 - Exception caught for error_diff_ids ok 109 - Exception caught for error_long_qual ok 110 - Exception caught for error_no_qual ok 111 - Exception caught for error_qual_del ok 112 - Exception caught for error_qual_escape ok 113 - Exception caught for error_qual_null ok 114 - Exception caught for error_qual_space ok 115 - Exception caught for error_qual_tab ok 116 - Exception caught for error_qual_unit_sep ok 117 - Exception caught for error_qual_vtab ok 118 - Exception caught for error_short_qual ok 119 - Exception caught for error_spaces ok 120 - Exception caught for error_tabs ok 121 - Exception caught for error_trunc_at_plus ok 122 - Exception caught for error_trunc_at_qual ok 123 - Exception caught for error_trunc_at_seq ok 124 - Exception caught for error_trunc_in_plus ok 125 - Exception caught for error_trunc_in_qual ok 126 - Exception caught for error_trunc_in_seq ok 127 - Exception caught for error_trunc_in_title ok t/SeqIO/flybase_chadoxml.t ................... 1..8 ok 1 - use Bio::SeqIO::flybase_chadoxml; not ok 2 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 3 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 4 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 5 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 6 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 7 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against not ok 8 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against ok Subroutine _initialize redefined at Bio\SeqIO\game.pm line 90. Subroutine next_seq redefined at Bio\SeqIO\game.pm line 106. Subroutine write_seq redefined at Bio\SeqIO\game.pm line 131. Subroutine _getseqs redefined at Bio\SeqIO\game.pm line 149. Subroutine _hide_dna redefined at Bio\SeqIO\game.pm line 178. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 934. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 934. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 934. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 934. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 934. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 934. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 934. Subroutine new redefined at Bio\Location\Split.pm line 104, line 934. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 934. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 934. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 934. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 934. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 934. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 934. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 934. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 934. Subroutine start redefined at Bio\Location\Split.pm line 401, line 934. Subroutine end redefined at Bio\Location\Split.pm line 420, line 934. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 934. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 934. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 934. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 934. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 934. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 934. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 934. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 934. t/SeqIO/game.t ............................... 1..24 ok 1 - use Bio::SeqIO::game; ok 2 - The object isa Bio::SeqIO ok 3 - The object isa Bio::Seq::RichSeq ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok Subroutine _initialize redefined at Bio\SeqIO\gcg.pm line 86. Subroutine next_seq redefined at Bio\SeqIO\gcg.pm line 106. Subroutine write_seq redefined at Bio\SeqIO\gcg.pm line 179. Subroutine GCG_checksum redefined at Bio\SeqIO\gcg.pm line 250. Subroutine _validate_checksum redefined at Bio\SeqIO\gcg.pm line 285. t/SeqIO/gcg.t ................................ 1..17 ok 1 - use Bio::SeqIO::gcg; ok 2 - The object isa Bio::SeqIO ok 3 - Bio::SeqIO::gcg->can('next_seq') ok 4 - Bio::SeqIO::gcg->can('write_seq') ok 5 - The object isa Bio::Seq ok 6 - The object isa Bio::Seq::RichSeq ok 7 - sequence ok 8 - length not ok 9 - primary_id # TODO possible bug: RichSeq not setting primary_id? # Failed (TODO) test 'primary_id' # at t/SeqIO/gcg.t line 54. # got: 'Bio::PrimarySeq=HASH(0x22336c0)' # expected: 'roa1_drome' ok 10 - description ok 11 ok 12 - The object isa Bio::SeqI ok 13 ok 14 - use Algorithm::Diff; ok 15 - use IO::ScalarArray; ok 16 - use IO::String; ok 17 - gcg format can round-trip ok Subroutine _initialize redefined at Bio\SeqIO\genbank.pm line 226. Subroutine next_seq redefined at Bio\SeqIO\genbank.pm line 250. Subroutine write_seq redefined at Bio\SeqIO\genbank.pm line 750. Subroutine _print_GenBank_FTHelper redefined at Bio\SeqIO\genbank.pm line 1069. Subroutine _read_GenBank_References redefined at Bio\SeqIO\genbank.pm line 1114. Subroutine _add_ref_to_array redefined at Bio\SeqIO\genbank.pm line 1252. Subroutine _read_GenBank_Species redefined at Bio\SeqIO\genbank.pm line 1298. Subroutine _read_FTHelper_GenBank redefined at Bio\SeqIO\genbank.pm line 1409. Subroutine _write_line_GenBank redefined at Bio\SeqIO\genbank.pm line 1544. Subroutine _write_line_GenBank_regex redefined at Bio\SeqIO\genbank.pm line 1582. Subroutine _post_sort redefined at Bio\SeqIO\genbank.pm line 1629. Subroutine _show_dna redefined at Bio\SeqIO\genbank.pm line 1649. Subroutine _id_generation_func redefined at Bio\SeqIO\genbank.pm line 1668. Subroutine _ac_generation_func redefined at Bio\SeqIO\genbank.pm line 1687. Subroutine _sv_generation_func redefined at Bio\SeqIO\genbank.pm line 1707. Subroutine _kw_generation_func redefined at Bio\SeqIO\genbank.pm line 1728. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 48. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 48. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 48. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 48. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 48. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 48. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 48. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 35. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 35. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 35. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 35. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 35. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 35. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 35. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 35. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 35. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 35. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 35. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 35. Subroutine new redefined at Bio\Location\Split.pm line 104, line 54. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 54. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 54. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 54. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 54. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 54. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 54. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 54. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 54. Subroutine start redefined at Bio\Location\Split.pm line 401, line 54. Subroutine end redefined at Bio\Location\Split.pm line 420, line 54. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 54. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 54. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 54. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 54. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 54. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 54. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 54. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 54. t/SeqIO/genbank.t ............................ 1..260 ok 1 - use Bio::SeqIO::genbank; ok 2 - The object isa Bio::SeqIO ok 3 - AI129902 ok 4 ok 5 ok 6 ok 7 - NT_021877 ok 8 ok 9 ok 10 ok 11 ok 12 - BAB68554 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 - operator overloading in AnnotationI is deprecated ok 23 - NC_006346 ok 24 ok 25 ok 26 - U71225 ok 27 ok 28 - AB077698 ok 29 ok 30 - DQ018368 ok 31 - D10483 ok 32 ok 33 ok 34 ok 35 - bug 1487 ok 36 ok 37 - bug 1647 ok 38 ok 39 ok 40 - bug 1673 ok 41 ok 42 ok 43 ok 44 - AF165282 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - species parsing incorrect for genbank ok 54 - genus duplicated in genbank parsing ok 55 ok 56 ok 57 - species parsing incorrect for genbank ok 58 - genus duplicated in genbank parsing ok 59 ok 60 ok 61 - species parsing incorrect for genbank ok 62 - genus duplicated in genbank parsing ok 63 ok 64 - streaming ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 - Total number of sequences in test file ok 71 ok 72 - Fuzzy in ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 - Fuzzy out ok 85 - BK000016 ok 86 ok 87 - BK000016 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 - BK000016 ok 103 - roundtrip ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 - revcomp split location ok 122 - Bug 1925 ok 123 ok 124 ok 125 - wgs ok 126 ok 127 - wgs_scafld ok 128 ok 129 - wgs_scafld ok 130 ok 131 ok 132 - BC000007 ok 133 - BK000016-tpa.gbk ok 134 - ay116458.gb ok 135 - ay149291.gb ok 136 - NC_006346.gb ok 137 - ay007676.gb ok 138 - dq519393.gb ok 139 ok 140 - swissprot:K1C9_HUMAN ok 141 ok 142 - swissprot ok 143 ok 144 - GenBank:Z29074.1 ok 145 ok 146 - GenBank ok 147 ok 148 - GenPept:CAA82315.1 ok 149 ok 150 - GenPept ok 151 ok 152 - GenBank:S69510.1 ok 153 ok 154 - GenBank ok 155 ok 156 - GenPept:AAC60619.1 ok 157 ok 158 - GenPept ok 159 ok 160 - GenBank:X75015.1 ok 161 ok 162 - GenBank ok 163 ok 164 - GenPept:CAA52924.1 ok 165 ok 166 - GenPept ok 167 ok 168 - GenBank:AB001594.1 ok 169 ok 170 - GenBank ok 171 ok 172 - GenPept:BAA19418.1 ok 173 ok 174 - GenPept ok 175 ok 176 - GenBank:I37984 ok 177 ok 178 - GenBank ok 179 ok 180 - HSSP:P08670 ok 181 ok 182 - HSSP ok 183 ok 184 - IntAct:P35527 ok 185 ok 186 - IntAct ok 187 ok 188 - Ensembl:ENSG00000171403 ok 189 ok 190 - Ensembl ok 191 ok 192 - KEGG:hsa:3857 ok 193 ok 194 - KEGG ok 195 ok 196 - HGNC:6447 ok 197 ok 198 - HGNC ok 199 ok 200 - MIM:144200 ok 201 ok 202 - MIM ok 203 ok 204 - MIM:607606 ok 205 ok 206 - MIM ok 207 ok 208 - ArrayExpress:P35527 ok 209 ok 210 - ArrayExpress ok 211 ok 212 - GO:0005200 ok 213 ok 214 - GO ok 215 ok 216 - GO:0008544 ok 217 ok 218 - GO ok 219 ok 220 - InterPro:IPR011000 ok 221 ok 222 - InterPro ok 223 ok 224 - InterPro:IPR001664 ok 225 ok 226 - InterPro ok 227 ok 228 - InterPro:IPR002957 ok 229 ok 230 - InterPro ok 231 ok 232 - Pfam:PF00038 ok 233 ok 234 - Pfam ok 235 ok 236 - PRINTS:PR01248 ok 237 ok 238 - PRINTS ok 239 ok 240 - PROSITE:PS00226 ok 241 ok 242 - PROSITE ok 243 ok 244 - Bug 2195 ok 245 - Bug 2195 ok 246 - The object isa Bio::Annotation::SimpleValue ok 247 ok 248 - The object isa Bio::Annotation::SimpleValue ok 249 ok 250 - P39765 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 - operator overloading in AnnotationI is deprecated ok Subroutine next_seq redefined at Bio\SeqIO\interpro.pm line 106. Subroutine _initialize redefined at Bio\SeqIO\interpro.pm line 219. Subroutine _sequence_factory redefined at Bio\SeqIO\interpro.pm line 256. Subroutine _xml_parser redefined at Bio\SeqIO\interpro.pm line 274. Subroutine _parse_xml redefined at Bio\SeqIO\interpro.pm line 292. Subroutine _dom redefined at Bio\SeqIO\interpro.pm line 308. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 51. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 51. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 51. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 51. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 51. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 51. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 51. t/SeqIO/interpro.t ........................... 1..20 ok 1 - use Bio::SeqIO::interpro; ok 2 - The object isa Bio::SeqIO ok 3 - seq obj is defined ok 4 - The object isa Bio::Seq::RichSeq ok 5 - right number of SeqFeatures ok 6 - The object isa Bio::SeqFeature::Generic ok 7 - display_name() ok 8 - seq object is defined ok 9 - right number of SeqFeatures ok 10 - there is no next_seq (correctly) ok 11 - bug 1908 ok 12 - right number of SeqFeatures ok 13 - primary_tag() ok 14 - display_name() ok 15 - location->end() ok 16 - right number of dblinks ok 17 - first primary_id ok 18 - second primary_id ok 19 - right number of dblinks ok 20 - primary_id via dblinks ok Subroutine _initialize redefined at Bio\SeqIO\kegg.pm line 150. Subroutine next_seq redefined at Bio\SeqIO\kegg.pm line 173. Subroutine write_seq redefined at Bio\SeqIO\kegg.pm line 324. t/SeqIO/kegg.t ............................... 1..16 ok 1 - use Bio::SeqIO::kegg; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 - The object isa Bio::Seq::RichSeq ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine _initialize redefined at Bio\SeqIO\largefasta.pm line 94. Subroutine next_seq redefined at Bio\SeqIO\largefasta.pm line 114. Subroutine write_seq redefined at Bio\SeqIO\largefasta.pm line 156. t/SeqIO/largefasta.t ......................... 1..16 ok 1 - use Bio::SeqIO::largefasta; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok Subroutine next_seq redefined at Bio\SeqIO\lasergene.pm line 102. Subroutine write_seq redefined at Bio\SeqIO\lasergene.pm line 161. t/SeqIO/lasergene.t .......................... 1..13 ok 1 - use Bio::SeqIO::lasergene; ok 2 ok 3 - The object isa Bio::SeqIO ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine _initialize redefined at Bio\SeqIO\locuslink.pm line 274. Subroutine search_pattern redefined at Bio\SeqIO\locuslink.pm line 307. Subroutine read_species redefined at Bio\SeqIO\locuslink.pm line 328. Subroutine read_dblink redefined at Bio\SeqIO\locuslink.pm line 341. Subroutine read_reference redefined at Bio\SeqIO\locuslink.pm line 359. Subroutine add_annotation redefined at Bio\SeqIO\locuslink.pm line 374. Subroutine add_annotation_ref redefined at Bio\SeqIO\locuslink.pm line 397. Subroutine make_unique redefined at Bio\SeqIO\locuslink.pm line 411. Subroutine next_seq redefined at Bio\SeqIO\locuslink.pm line 428. Subroutine show_obj redefined at Bio\SeqIO\locuslink.pm line 581. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 1. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 1. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 1. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 1. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 1. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 1. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 1. t/SeqIO/locuslink.t .......................... 1..26 ok 1 - use Bio::SeqIO::locuslink; ok 2 - use Bio::SeqFeature::Generic; ok 3 - use Bio::SeqFeature::AnnotationAdaptor; ok 4 ok 5 - The object isa Bio::SeqIO ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine _initialize redefined at Bio\SeqIO\metafasta.pm line 108. Subroutine next_seq redefined at Bio\SeqIO\metafasta.pm line 128. Subroutine write_seq redefined at Bio\SeqIO\metafasta.pm line 207. Subroutine width redefined at Bio\SeqIO\metafasta.pm line 250. t/SeqIO/metafasta.t .......................... 1..6 ok 1 - use Bio::SeqIO::metafasta; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 - The object isa Bio::Seq::Meta ok 5 ok 6 ok Subroutine _initialize redefined at Bio\SeqIO\phd.pm line 88. Subroutine next_seq redefined at Bio\SeqIO\phd.pm line 111. Subroutine write_header redefined at Bio\SeqIO\phd.pm line 211. Subroutine write_seq redefined at Bio\SeqIO\phd.pm line 249. Subroutine Bio::Seq::Quality::attribute redefined at Bio\SeqIO\phd.pm line 283. Subroutine Bio::Seq::Quality::chromat_file redefined at Bio\SeqIO\phd.pm line 321. Subroutine Bio::Seq::Quality::abi_thumbprint redefined at Bio\SeqIO\phd.pm line 336. Subroutine Bio::Seq::Quality::phred_version redefined at Bio\SeqIO\phd.pm line 352. Subroutine Bio::Seq::Quality::call_method redefined at Bio\SeqIO\phd.pm line 368. Subroutine Bio::Seq::Quality::quality_levels redefined at Bio\SeqIO\phd.pm line 383. Subroutine Bio::Seq::Quality::trace_array_min_index redefined at Bio\SeqIO\phd.pm line 398. Subroutine Bio::Seq::Quality::trace_array_max_index redefined at Bio\SeqIO\phd.pm line 413. Subroutine Bio::Seq::Quality::chem redefined at Bio\SeqIO\phd.pm line 428. Subroutine Bio::Seq::Quality::dye redefined at Bio\SeqIO\phd.pm line 443. Subroutine Bio::Seq::Quality::time redefined at Bio\SeqIO\phd.pm line 458. Subroutine Bio::Seq::Quality::touch redefined at Bio\SeqIO\phd.pm line 473. t/SeqIO/phd.t ................................ 1..17 ok 1 - use Bio::SeqIO::phd; ok 2 - The object isa Bio::SeqIO::phd ok 3 - Did you get the 'QUALITY_LEVELS' comment? ok 4 - The object isa Bio::Seq::Quality ok 5 - The object isa Bio::SeqIO::phd ok 6 ok 7 - $seq->subseq() ok 8 - $seq->subqual_tex() ok 9 - $seq->subqual_tex() ok 10 - $phd->chromat_file() ok 11 - $phd->chromat_file() ok 12 - $seq->subseq() ok 13 - $seq->subqual_tex() ok 14 - $seq->subqual_tex() ok 15 - $seq->subseq() ok 16 - $seq->subqual_tex() ok 17 - $seq->subqual_tex() ok Subroutine _initialize redefined at Bio\SeqIO\pir.pm line 90. Subroutine next_seq redefined at Bio\SeqIO\pir.pm line 110. Subroutine write_seq redefined at Bio\SeqIO\pir.pm line 160. t/SeqIO/pir.t ................................ 1..9 ok 1 - use Bio::SeqIO::pir; ok 2 - new instance is defined ok 3 - The object isa Bio::SeqIO ok 4 - checked length ok 5 - checked length ok 6 - checked length ok 7 - checked length ok 8 - checked length ok 9 - checked length ok t/SeqIO/pln.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/qual.t ............................... 1..18 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimaryQual; ok 3 ok 4 - The object isa Bio::Seq::PrimaryQual ok 5 ok 6 - The object isa Bio::Seq::PrimaryQual ok 7 - The object isa Bio::Seq::PrimaryQual ok 8 - The object isa Bio::Seq::PrimaryQual ok 9 - The object isa Bio::Seq::PrimaryQual ok 10 - The object isa Bio::Seq::PrimaryQual ok 11 - The object isa Bio::Seq::PrimaryQual ok 12 - The object isa Bio::Seq::PrimaryQual ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok Subroutine _initialize redefined at Bio\SeqIO\raw.pm line 98. Subroutine next_seq redefined at Bio\SeqIO\raw.pm line 123. Subroutine write_seq redefined at Bio\SeqIO\raw.pm line 150. Subroutine write_qual redefined at Bio\SeqIO\raw.pm line 172. Subroutine variant redefined at Bio\SeqIO\raw.pm line 206. Subroutine _separator redefined at Bio\SeqIO\raw.pm line 221. t/SeqIO/raw.t ................................ 1..25 ok 1 - use Bio::SeqIO::raw; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 - Bio::SeqIO::raw->can('next_seq') ok 5 - Bio::SeqIO::raw->can('write_seq') ok 6 - The object isa Bio::Seq ok 7 - sequence ok 8 - length ok 9 - The object isa Bio::Seq ok 10 - sequence ok 11 - length ok 12 - use Algorithm::Diff; ok 13 - raw format can round-trip ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok Subroutine _initialize redefined at Bio\SeqIO\scf.pm line 96. Subroutine next_seq redefined at Bio\SeqIO\scf.pm line 125. Subroutine _get_v3_quality redefined at Bio\SeqIO\scf.pm line 281. Subroutine _get_v3_peak_indices redefined at Bio\SeqIO\scf.pm line 308. Subroutine _get_v3_base_accuracies redefined at Bio\SeqIO\scf.pm line 327. Subroutine _get_comments redefined at Bio\SeqIO\scf.pm line 361. Subroutine _get_header redefined at Bio\SeqIO\scf.pm line 399. Subroutine _parse_v2_bases redefined at Bio\SeqIO\scf.pm line 434. Subroutine _parse_v2_traces redefined at Bio\SeqIO\scf.pm line 470. Subroutine get_trace_deprecated_use_the_sequencetrace_object_instead redefined at Bio\SeqIO\scf.pm line 490. Subroutine _deprecated_get_peak_indices_deprecated_use_the_sequencetrace_object_instead redefined at Bio\SeqIO\scf.pm line 501. Subroutine get_header redefined at Bio\SeqIO\scf.pm line 519. Subroutine get_comments redefined at Bio\SeqIO\scf.pm line 535. Subroutine _dump_traces_outgoing_deprecated_use_the_sequencetrace_object redefined at Bio\SeqIO\scf.pm line 540. Subroutine _dump_traces_incoming_deprecated_use_the_sequencetrace_object redefined at Bio\SeqIO\scf.pm line 562. Subroutine write_seq redefined at Bio\SeqIO\scf.pm line 610. Subroutine _get_binary_header redefined at Bio\SeqIO\scf.pm line 779. Subroutine _get_binary_traces redefined at Bio\SeqIO\scf.pm line 814. Subroutine _get_binary_bases redefined at Bio\SeqIO\scf.pm line 871. Subroutine _make_trace_string redefined at Bio\SeqIO\scf.pm line 949. Subroutine _get_binary_comments redefined at Bio\SeqIO\scf.pm line 991. Subroutine _delta redefined at Bio\SeqIO\scf.pm line 1052. Subroutine _unpack_magik redefined at Bio\SeqIO\scf.pm line 1132. Subroutine read_from_buffer redefined at Bio\SeqIO\scf.pm line 1156. Subroutine _dump_keys redefined at Bio\SeqIO\scf.pm line 1197. Subroutine _dump_base_accuracies redefined at Bio\SeqIO\scf.pm line 1220. Subroutine _dump_peak_indices_incoming redefined at Bio\SeqIO\scf.pm line 1247. Subroutine _dump_base_accuracies_incoming redefined at Bio\SeqIO\scf.pm line 1268. Subroutine _dump_comments redefined at Bio\SeqIO\scf.pm line 1295. t/SeqIO/scf.t ................................ 1..78 ok 1 - use Bio::SeqIO::scf; ok 2 - use Bio::Seq::SequenceTrace; ok 3 ok 4 - The object isa Bio::Seq::SequenceTrace ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Seq::Quality ok 14 - The object isa Bio::Seq::Quality ok 15 - alphabet ok 16 - display_id ok 17 - primary_id is the stringified memory position ok 18 - set primary_id ok 19 - accession_number ok 20 - desc ok 21 - desc ok 22 - id ok 23 - id ok 24 - seq ok 25 - subseq ok 26 - baseat ok 27 - qualat ok 28 - trace_value_at not ok 29 - accuracies # TODO documentation and code for accuracies() do not match # Failed (TODO) test 'accuracies' # at t/SeqIO/scf.t line 78. # got: 'ARRAY(0x225caa0)' # expected: '482' ok 30 ok 31 - sub_peak_index ok 32 - peak_index_at ok 33 ok 34 ok 35 - The object isa Bio::Seq::SequenceTrace ok 36 - accuracy_at ok 37 - The object isa Bio::Seq::SequenceTrace ok 38 ok 39 ok 40 ok 41 - The object isa Bio::Annotation::Collection ok 42 ok 43 - The object isa Bio::Annotation::Collection ok 44 ok 45 ok 46 - The object isa Bio::Annotation::Collection ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - The object isa Bio::Seq::SequenceTrace ok 55 - The object isa Bio::Annotation::Collection ok 56 ok 57 ok 58 ok 59 ok 60 - The object isa Bio::Seq::SequenceTrace ok 61 ok 62 - The object isa Bio::Seq::SequenceTrace ok 63 - qual scores match ok 64 - The object isa Bio::Seq::SequenceTrace ok 65 ok 66 - The object isa Bio::Seq::SequenceTrace not ok 67 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'ML4942R' # expected: undef ok 68 - qual scores match ok 69 - The object isa Bio::Seq::SequenceTrace ok 70 ok 71 - The object isa Bio::Seq::SequenceTrace not ok 72 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'IIABP1D4373' # expected: undef ok 73 - qual scores match ok 74 - The object isa Bio::Seq::SequenceTrace ok 75 ok 76 - The object isa Bio::Seq::SequenceTrace not ok 77 - display_id matches # TODO display_id doesn't round trip yet # Failed (TODO) test 'display_id matches' # at t/SeqIO/scf.t line 285. # got: 'IIABP1D4373' # expected: undef ok 78 - qual scores match ok t/SeqIO/strider.t ............................ 1..8 ok 1 - use Bio::SeqIO::strider; not ok 2 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 3 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 4 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 5 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 6 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 7 # TODO & SKIP No tests for strider format -- no sample file to test against not ok 8 # TODO & SKIP No tests for strider format -- no sample file to test against ok Subroutine _initialize redefined at Bio\SeqIO\swiss.pm line 228. Subroutine next_seq redefined at Bio\SeqIO\swiss.pm line 252. Subroutine write_seq redefined at Bio\SeqIO\swiss.pm line 494. Subroutine _generateCRCTable redefined at Bio\SeqIO\swiss.pm line 818. Subroutine _crc32 redefined at Bio\SeqIO\swiss.pm line 851. Subroutine _crc64 redefined at Bio\SeqIO\swiss.pm line 883. Subroutine _print_swissprot_FTHelper redefined at Bio\SeqIO\swiss.pm line 935. Subroutine _read_swissprot_References redefined at Bio\SeqIO\swiss.pm line 1022. Subroutine _read_swissprot_Species redefined at Bio\SeqIO\swiss.pm line 1112. Subroutine _read_FTHelper_swissprot redefined at Bio\SeqIO\swiss.pm line 1267. Subroutine _write_line_swissprot redefined at Bio\SeqIO\swiss.pm line 1342. Subroutine _write_line_swissprot_regex redefined at Bio\SeqIO\swiss.pm line 1377. Subroutine _post_sort redefined at Bio\SeqIO\swiss.pm line 1419. Subroutine _show_dna redefined at Bio\SeqIO\swiss.pm line 1440. Subroutine _id_generation_func redefined at Bio\SeqIO\swiss.pm line 1461. Subroutine _ac_generation_func redefined at Bio\SeqIO\swiss.pm line 1482. Subroutine _sv_generation_func redefined at Bio\SeqIO\swiss.pm line 1503. Subroutine _kw_generation_func redefined at Bio\SeqIO\swiss.pm line 1524. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 46. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 46. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 46. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 46. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 46. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 46. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 46. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 46. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 46. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 46. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 46. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 46. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 48. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 48. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 48. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 48. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 48. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 48. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 48. t/SeqIO/swiss.t .............................. 1..240 ok 1 - use Bio::SeqIO::swiss; ok 2 - The object isa Bio::SeqIO ok 3 - The object isa Bio::Taxon ok 4 ok 5 ok 6 - operator overloading in AnnotationI is deprecated ok 7 - dates ok 8 - dates ok 9 - dates ok 10 ok 11 - The object isa Bio::Seq::RichSeqI ok 12 ok 13 ok 14 ok 15 - operator overloading in AnnotationI is deprecated ok 16 ok 17 ok 18 ok 19 ok 20 - id is ROA1_HUMAN ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - operator overloading in AnnotationI is deprecated ok 29 ok 30 ok 31 ok 32 ok 33 - The object isa Bio::Seq::RichSeqI ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 ok 47 - GC1QBP ok 48 - HABP1 ok 49 - SF2P32 ok 50 - C1QBP ok 51 ok 52 - The object isa Bio::Seq::RichSeqI ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - F54H12.1 ok 60 - The object isa Bio::Seq::RichSeqI ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - The object isa Bio::Seq::RichSeqI ok 73 ok 74 ok 75 ok 76 ok 77 - The object isa Bio::Seq::RichSeqI ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 - The object isa Bio::Seq::RichSeqI ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - The object isa Bio::Taxon ok 176 ok 177 ok 178 - operator overloading in AnnotationI is deprecated ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 - The object isa Bio::Taxon ok 208 ok 209 ok 210 - operator overloading in AnnotationI is deprecated ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok Subroutine next_seq redefined at Bio\SeqIO\tab.pm line 124. Subroutine write_seq redefined at Bio\SeqIO\tab.pm line 152. t/SeqIO/tab.t ................................ 1..8 ok 1 - use Bio::SeqIO::tab; ok 2 - The object isa Bio::SeqIO ok 3 - seq is defined ok 4 - check seq length ok 5 - check matching ok 6 - seq is defined ok 7 - check seq length ok 8 - check matching ok Subroutine _initialize redefined at Bio\SeqIO\table.pm line 177. Subroutine next_seq redefined at Bio\SeqIO\table.pm line 283. Subroutine comment_char redefined at Bio\SeqIO\table.pm line 365. Subroutine header redefined at Bio\SeqIO\table.pm line 389. Subroutine delimiter redefined at Bio\SeqIO\table.pm line 411. Subroutine attribute_map redefined at Bio\SeqIO\table.pm line 436. Subroutine annotation_map redefined at Bio\SeqIO\table.pm line 489. Subroutine keep_annotation redefined at Bio\SeqIO\table.pm line 539. Subroutine annotation_columns redefined at Bio\SeqIO\table.pm line 565. Subroutine trim_values redefined at Bio\SeqIO\table.pm line 585. Subroutine _attribute_map redefined at Bio\SeqIO\table.pm line 618. Subroutine _annotation_map redefined at Bio\SeqIO\table.pm line 642. Subroutine _header_skipped redefined at Bio\SeqIO\table.pm line 661. Subroutine _next_record redefined at Bio\SeqIO\table.pm line 691. Subroutine _parse_header redefined at Bio\SeqIO\table.pm line 743. Subroutine _get_row_values redefined at Bio\SeqIO\table.pm line 828. t/SeqIO/table.t .............................. 1..450 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::SeqIO::table; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok t/SeqIO/tigr.t ............................... 1..8 ok 1 - use Bio::SeqIO::tigr; not ok 2 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 3 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 4 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 5 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 6 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 7 # TODO & SKIP No tests for tigr format -- no sample file to test against not ok 8 # TODO & SKIP No tests for tigr format -- no sample file to test against ok Subroutine _initialize redefined at Bio\SeqIO\tigrxml.pm line 98. Subroutine next_seq redefined at Bio\SeqIO\tigrxml.pm line 110. Subroutine start_document redefined at Bio\SeqIO\tigrxml.pm line 122. Subroutine end_document redefined at Bio\SeqIO\tigrxml.pm line 130. Subroutine start_element redefined at Bio\SeqIO\tigrxml.pm line 135. Subroutine end_element redefined at Bio\SeqIO\tigrxml.pm line 359. Subroutine characters redefined at Bio\SeqIO\tigrxml.pm line 485. Subroutine assert redefined at Bio\SeqIO\tigrxml.pm line 542. Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/SeqIO/tigrxml.t ............................ 1..49 ok 1 - use Bio::SeqIO::tigrxml; ok 2 - The object isa Bio::SeqIO ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok Subroutine _initialize redefined at Bio\SeqIO\tinyseq.pm line 95. Subroutine next_seq redefined at Bio\SeqIO\tinyseq.pm line 118. Subroutine write_seq redefined at Bio\SeqIO\tinyseq.pm line 141. Subroutine _get_seqs redefined at Bio\SeqIO\tinyseq.pm line 182. Subroutine _get_species redefined at Bio\SeqIO\tinyseq.pm line 227. Subroutine _create_species redefined at Bio\SeqIO\tinyseq.pm line 248. Subroutine _assign_identifier redefined at Bio\SeqIO\tinyseq.pm line 275. Subroutine _convert_seqtype redefined at Bio\SeqIO\tinyseq.pm line 305. Subroutine _get_idstring redefined at Bio\SeqIO\tinyseq.pm line 325. Subroutine _get_writer redefined at Bio\SeqIO\tinyseq.pm line 347. Subroutine close_writer redefined at Bio\SeqIO\tinyseq.pm line 381. Subroutine _write_species redefined at Bio\SeqIO\tinyseq.pm line 394. Subroutine DESTROY redefined at Bio\SeqIO\tinyseq.pm line 401. t/SeqIO/tinyseq.t ............................ 1..16 ok 1 - use Bio::SeqIO::tinyseq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/SeqIO/ztr.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqTools/Backtranslate.t ................... 1..8 ok 1 - use Bio::Tools::SeqPattern::Backtranslate; ok 2 - Bio::Tools::SeqPattern::Backtranslate->can('_reverse_translate_motif') ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - threw Regexp ((?-xism:syntax token)) ok t/SeqTools/CodonTable.t ...................... 1..56 ok 1 - use Bio::Tools::CodonTable; ok 2 - use Bio::CodonUsage::IO; ok 3 ok 4 - The object isa Bio::Tools::CodonTable ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok t/SeqTools/ECnumber.t ........................ 1..27 ok 1 - use Bio::Tools::ECnumber; ok 2 - The object isa Bio::Tools::ECnumber ok 3 - The object isa Bio::Tools::ECnumber ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 87. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 87. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 87. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 87. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 87. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 87. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 87. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 92. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 92. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 92. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 92. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 92. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 92. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 92. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 92. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 92. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 92. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 92. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 92. Subroutine new redefined at Bio\Location\Split.pm line 104, line 35. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 35. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 35. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 35. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 35. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 35. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 35. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 35. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 35. Subroutine start redefined at Bio\Location\Split.pm line 401, line 35. Subroutine end redefined at Bio\Location\Split.pm line 420, line 35. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 35. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 35. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 35. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 35. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 35. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 35. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 35. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 35. Subroutine _initialize redefined at Bio/SeqIO/gcg.pm line 86. Subroutine next_seq redefined at Bio/SeqIO/gcg.pm line 106. Subroutine write_seq redefined at Bio/SeqIO/gcg.pm line 179. Subroutine GCG_checksum redefined at Bio/SeqIO/gcg.pm line 250. Subroutine _validate_checksum redefined at Bio/SeqIO/gcg.pm line 285. Subroutine new redefined at Bio\Seq\Meta.pm line 226, line 88. Subroutine meta redefined at Bio\Seq\Meta.pm line 270, line 88. Subroutine meta_text redefined at Bio\Seq\Meta.pm line 285, line 88. Subroutine named_meta redefined at Bio\Seq\Meta.pm line 301, line 88. Subroutine _test_gap_positions redefined at Bio\Seq\Meta.pm line 348, line 88. Subroutine named_meta_text redefined at Bio\Seq\Meta.pm line 378, line 88. Subroutine submeta redefined at Bio\Seq\Meta.pm line 410, line 88. Subroutine submeta_text redefined at Bio\Seq\Meta.pm line 426, line 88. Subroutine named_submeta redefined at Bio\Seq\Meta.pm line 445, line 88. Subroutine named_submeta_text redefined at Bio\Seq\Meta.pm line 504, line 88. Subroutine meta_names redefined at Bio\Seq\Meta.pm line 519, line 88. Subroutine meta_length redefined at Bio\Seq\Meta.pm line 541, line 88. Subroutine named_meta_length redefined at Bio\Seq\Meta.pm line 557, line 88. Subroutine force_flush redefined at Bio\Seq\Meta.pm line 578, line 88. Subroutine _do_flush redefined at Bio\Seq\Meta.pm line 605, line 88. Subroutine is_flush redefined at Bio\Seq\Meta.pm line 638, line 88. Subroutine revcom redefined at Bio\Seq\Meta.pm line 680, line 88. Subroutine trunc redefined at Bio\Seq\Meta.pm line 703, line 88. Subroutine to_string redefined at Bio\Seq\Meta.pm line 727, line 88. t/SeqTools/GuessSeqFormat.t .................. 1..49 ok 1 - use Bio::SeqIO; ok 2 - use Bio::AlignIO; ok 3 - use Bio::Tools::GuessSeqFormat; ok 4 ok 5 ok 6 ok 7 - Guessed:ace ok 8 - The object isa Bio::PrimarySeqI ok 9 - Guessed:embl ok 10 - The object isa Bio::SeqI ok 11 - Guessed:fasta ok 12 - The object isa Bio::SeqI ok 13 - Guessed:gcg ok 14 - The object isa Bio::SeqI ok 15 - Guessed:genbank ok 16 - The object isa Bio::SeqI ok 17 - Guessed:mase ok 18 - Guessed:pfam ok 19 - Guessed:pir ok 20 - The object isa Bio::SeqI ok 21 - Guessed:raw ok 22 - The object isa Bio::SeqI ok 23 - Guessed:swiss ok 24 - The object isa Bio::SeqI ok 25 - Guessed:tab ok 26 - The object isa Bio::SeqI ok 27 - Guessed:game ok 28 - The object isa Bio::SeqI ok 29 - clustalw ok 30 - The object isa Bio::Align::AlignI ok 31 - fasta ok 32 - The object isa Bio::Align::AlignI ok 33 - mase ok 34 - The object isa Bio::Align::AlignI ok 35 - msf ok 36 - The object isa Bio::Align::AlignI ok 37 - nexus ok 38 - The object isa Bio::Align::AlignI ok 39 - pfam ok 40 - The object isa Bio::Align::AlignI ok 41 - phylip ok 42 - The object isa Bio::Align::AlignI ok 43 - prodom ok 44 - The object isa Bio::Align::AlignI ok 45 - stockholm ok 46 - The object isa Bio::Align::AlignI ok 47 ok 48 ok 49 - fasta ok t/SeqTools/OddCodes.t ........................ 1..11 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::OddCodes; ok 3 - The object isa Bio::Tools::OddCodes ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok t/SeqTools/SeqPattern.t ...................... 1..28 ok 1 - use Bio::Tools::SeqPattern; ok 2 ok 3 - The object isa Bio::Tools::SeqPattern ok 4 ok 5 ok 6 ok 7 - The object isa Bio::Tools::SeqPattern ok 8 ok 9 ok 10 - The object isa Bio::Tools::SeqPattern ok 11 ok 12 - threw Regexp ((?-xism:revcom for .+ sequence types)) ok 13 - threw Regexp ((?-xism:backtranslate for .+ sequence types)) ok 14 - The object isa Bio::Tools::SeqPattern ok 15 - The object isa Bio::Tools::SeqPattern ok 16 ok 17 - The object isa Bio::Tools::SeqPattern ok 18 - The object isa Bio::Tools::SeqPattern ok 19 ok 20 - The object isa Bio::Tools::SeqPattern ok 21 - The object isa Bio::Tools::SeqPattern ok 22 ok 23 - The object isa Bio::Tools::SeqPattern ok 24 - The object isa Bio::Tools::SeqPattern ok 25 ok 26 - The object isa Bio::Tools::SeqPattern ok 27 - The object isa Bio::Tools::SeqPattern ok 28 ok t/SeqTools/SeqStats.t ........................ 1..44 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqStats; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools:SeqStats object ok 5 - count_monomers() ok 6 - count_codons() ok 7 - get_mol_wt() ok 8 ok 9 - The object isa Bio::Tools::SeqStats ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581. t/SeqTools/SeqUtils.t ........................ 1..51 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqUtils; ok 3 - use Bio::LiveSeq::Mutation; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - cat - has expected tags ok 35 - cat - has expected tag values ok 36 - cat - note tag transfered (no throw) ok 37 - cat - note tag values transfered (correct count) ok 38 - different alphabets ok 39 ok 40 ok 41 ok 42 ok 43 - trunc_with_features - has expected tags ok 44 - trunc_with_features - has expected tag values ok 45 ok 46 ok 47 ok 48 - revcom_with_features - has expected tags ok 49 - revcom_with_features - has expected tag values ok 50 - still not circular ok 51 - still circular ok t/SeqTools/SeqWords.t ........................ 1..22 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Tools::SeqWords; ok 3 - new Bio::Root::IO object ok 4 - new Bio::Tools::SeqWords object ok 5 - count_words ok 6 ok 7 - The object isa Bio::Tools::SeqWords ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - The object isa Bio::Tools::SeqWords ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok t/Species.t .................................. 1..21 ok 1 - use Bio::Species; ok 2 - use Bio::DB::Taxonomy; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok t/Structure/IO.t ............................. 1..14 ok 1 - use Bio::Structure::IO; ok 2 ok 3 ok 4 - The object isa Bio::Structure::Entry ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Structure/Structure.t ...................... 1..51 ok 1 - use Bio::Structure::Entry; ok 2 - use Bio::Structure::Model; ok 3 - use Bio::Structure::Chain; ok 4 - use Bio::Structure::Residue; ok 5 - use Bio::Structure::Atom; ok 6 ok 7 - The object isa Bio::Structure::Entry ok 8 ok 9 - The object isa Bio::Structure::Model ok 10 ok 11 - The object isa Bio::Structure::Chain ok 12 ok 13 - The object isa Bio::Structure::Residue ok 14 ok 15 - The object isa Bio::Structure::Atom ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - The object isa Bio::Structure::Model ok 24 ok 25 ok 26 ok 27 - The object isa Bio::Structure::Chain ok 28 ok 29 ok 30 ok 31 ok 32 - The object isa Bio::Structure::Residue ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Symbol.t ................................... 1..9 ok 1 - use Bio::Symbol::Symbol; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/TaxonTree.t ................................ skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/Alignment/Consed.t ................... skipped: Not compatible with your Operating System t/Tools/Analysis/DNA/ESEfinder.t ............. skipped: Network tests have not been requested t/Tools/Analysis/Protein/Domcut.t ............ skipped: Network tests have not been requested t/Tools/Analysis/Protein/ELM.t ............... skipped: Network tests have not been requested t/Tools/Analysis/Protein/GOR4.t .............. skipped: Network tests have not been requested t/Tools/Analysis/Protein/HNN.t ............... skipped: Network tests have not been requested t/Tools/Analysis/Protein/Mitoprot.t .......... skipped: Network tests have not been requested t/Tools/Analysis/Protein/NetPhos.t ........... skipped: Network tests have not been requested Subroutine new redefined at Bio\Location\Simple.pm line 93, line 70. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 70. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 70. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 70. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 70. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 70. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 70. t/Tools/Analysis/Protein/Scansite.t .......... 1..14 ok 1 - use Bio::Tools::Analysis::Protein::Scansite; ok 2 - use Bio::SeqIO; ok 3 - use Bio::WebAgent; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok t/Tools/Analysis/Protein/Sopma.t ............. 1..16 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::Analysis::Protein::Sopma; ok 3 ok 4 ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154, line 13. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 13. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260, line 13. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281, line 13. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311, line 13. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328, line 13. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345, line 13. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362, line 13. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379, line 13. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413, line 13. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441, line 13. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460, line 13. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478, line 13. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493, line 13. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513, line 13. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539, line 13. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555, line 13. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580, line 13. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609, line 13. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651, line 13. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674, line 13. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691, line 13. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715, line 13. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746, line 13. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770, line 13. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809, line 13. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841, line 13. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871, line 13. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894, line 13. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931, line 13. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953, line 13. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984, line 13. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001, line 13. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017, line 13. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023, line 13. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030, line 13. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031, line 13. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042, line 13. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035, line 13. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036, line 13. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037, line 13. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039, line 13. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 13. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 13. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 13. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 13. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 13. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 13. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 13. t/Tools/EMBOSS/Palindrome.t .................. 1..13 ok 1 - use Bio::Tools::EMBOSS::Palindrome; ok 2 - use Bio::Tools::GFF; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/Tools/EUtilities/EUtilParameters.t ......... 1..13 ok 1 - use Bio::Tools::EUtilities::EUtilParameters; ok 2 ok 3 - The object isa HTTP::Request ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - available_parameters ok 11 - available_parameters ok 12 - get_parameters ok 13 - get_parameters ok t/Tools/EUtilities/egquery.t ................. 1..19 ok 1 - use Bio::Tools::EUtilities; ok 2 - get_db ok 3 - get_database ok 4 - get_databases ok 5 - get_term ok 6 - get_count ok 7 - get_count ok 8 - get_count ok 9 - get_GlobalQueries ok 10 - get_term ok 11 - get_term ok 12 - get_term ok 13 - get_term ok 14 - get_term ok 15 - get_term ok 16 - get_term ok 17 - get_term ok 18 - get_term ok 19 - get_term ok t/Tools/EUtilities/einfo.t ................... 1..51 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - get_available_databases ok 4 - get_databases ok 5 - get_db ok 6 - get_record_count ok 7 - get_menu_name ok 8 - get_last_update ok 9 - get_description ok 10 - FieldInfo ok 11 - LinkInfo ok 12 - get_db ok 13 - get_dbs ok 14 - get_record_count ok 15 - get_menu_name ok 16 - get_last_update ok 17 - get_description ok 18 - FieldInfo ok 19 - get_term_count ok 20 - get_field_name ok 21 - get_field_code ok 22 - get_field_description ok 23 - is_date ok 24 - is_singletoken ok 25 - is_hierarchy ok 26 - is_hidden ok 27 - is_numerical ok 28 - get_term_count ok 29 - get_field_name ok 30 - get_field_code ok 31 - get_field_description ok 32 - is_date ok 33 - is_singletoken ok 34 - is_hierarchy ok 35 - is_hidden ok 36 - is_numerical ok 37 - LinkInfo ok 38 - get_dbto ok 39 - get_dbfrom ok 40 - get_link_name ok 41 - get_link_description ok 42 - get_priority ok 43 - get_html_tag ok 44 - get_url ok 45 - get_dbto ok 46 - get_dbfrom ok 47 - get_link_name ok 48 - get_link_description ok 49 - get_priority ok 50 - get_html_tag ok 51 - get_url ok t/Tools/EUtilities/elink_acheck.t ............ 1..130 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - get_ids ok 7 - uncorrelated LinkSets lump everything together ok 8 ok 9 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 10 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - The object isa Bio::Tools::EUtilities::Link ok 68 ok 69 - get_ids ok 70 - get_ids ok 71 - correlated LinkSets separate ID data ok 72 ok 73 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 74 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok t/Tools/EUtilities/elink_lcheck.t ............ 1..64 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - The object isa Bio::Tools::EUtilities::Link ok 35 ok 36 - get_ids ok 37 - correlated LinkSets separate ID data ok 38 ok 39 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 40 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok t/Tools/EUtilities/elink_llinks.t ............ 1..86 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - The object isa Bio::Tools::EUtilities::Link ok 46 ok 47 - get_ids ok 48 - correlated LinkSets separate ID data ok 49 ok 50 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 51 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok t/Tools/EUtilities/elink_ncheck.t ............ 1..60 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - The object isa Bio::Tools::EUtilities::Link ok 31 ok 32 - get_ids ok 33 - correlated LinkSets separate ID data ok 34 ok 35 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 36 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok t/Tools/EUtilities/elink_neighbor.t .......... 1..63 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - The object isa Bio::Tools::EUtilities::Link ok 35 ok 36 - get_ids ok 37 - correlated LinkSets separate ID data ok 38 ok 39 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 40 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Tools/EUtilities/elink_neighbor_history.t .. 1..65 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 - The object isa Bio::Tools::EUtilities::HistoryI ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - The object isa Bio::Tools::EUtilities::Link ok 36 ok 37 - get_ids ok 38 - correlated LinkSets separate ID data ok 39 ok 40 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 41 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 42 - The object isa Bio::Tools::EUtilities::HistoryI ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok t/Tools/EUtilities/elink_scores.t ............ 1..58 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Link ok 4 ok 5 - get_ids ok 6 - uncorrelated LinkSets lump everything together ok 7 ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - The object isa Bio::Tools::EUtilities::Link::LinkSet ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok t/Tools/EUtilities/epost.t ................... 1..17 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 4 - The object isa Bio::Tools::EUtilities::Query ok 5 - eutil ok 6 - datatype ok 7 - The object isa Bio::Tools::EUtilities::HistoryI ok 8 - The object isa Bio::Tools::EUtilities::EUtilDataI ok 9 - eutil ok 10 - eutil ok 11 - get_webenv ok 12 - get_query_key ok 13 - history ok 14 - get_database ok 15 - get_ids ok 16 - get_database ok 17 - get_ids ok t/Tools/EUtilities/esearch.t ................. 1..33 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - get_count ok 4 ok 5 - get_ids ok 6 - get_retstart ok 7 - get_retmax ok 8 - get_translation_from ok 9 - get_translation_to ok 10 - get_db ok 11 - get_database ok 12 - get_term ok 13 - get_db ok 14 - get_database ok 15 - get_term ok 16 - get_corrected_query ok 17 - get_replaced_terms ok 18 - get_count ok 19 - The object isa Bio::Tools::EUtilities::HistoryI ok 20 - get_webenv ok 21 - get_query_key ok 22 - history ok 23 - get_ids ok 24 - get_retstart ok 25 - get_retmax ok 26 - get_translation_from ok 27 - get_translation_to ok 28 - get_db ok 29 - get_database ok 30 - get_term ok 31 - get_corrected_query ok 32 - get_replaced_terms ok 33 - get_GlobalQueries ok t/Tools/EUtilities/espell.t .................. 1..22 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - get_db ok 4 - get_dbs ok 5 - get_database ok 6 - get_databases ok 7 - get_term ok 8 - get_corrected_query ok 9 - get_replaced_terms ok 10 - get_replaced_terms ok 11 - get_count ok 12 ok 13 - get_ids ok 14 - get_retstart ok 15 - get_retmax ok 16 - get_translation_from ok 17 - get_translation_to ok 18 - get_db ok 19 - get_dbs ok 20 - get_database ok 21 - get_databases ok 22 - get_term ok t/Tools/EUtilities/esummary.t ................ 1..83 ok 1 - use Bio::Tools::EUtilities; ok 2 - use Bio::Tools::EUtilities::EUtilParameters; ok 3 - The object isa Bio::Tools::EUtilities::Summary ok 4 ok 5 - The object isa Bio::Tools::EUtilities::Summary ok 6 ok 7 - get_ids ok 8 ok 9 - The object isa Bio::Tools::EUtilities::Summary::DocSum ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Tools::EUtilities::Summary::Item ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - The object isa Bio::Tools::EUtilities::Summary::Item ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 - The object isa Bio::Tools::EUtilities::Summary ok 53 ok 54 - The object isa Bio::Tools::EUtilities::Summary ok 55 ok 56 - get_ids ok 57 ok 58 - The object isa Bio::Tools::EUtilities::Summary::DocSum ok 59 ok 60 ok 61 ok 62 ok 63 - The object isa Bio::Tools::EUtilities::Summary::Item ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 2. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 2. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 2. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 2. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 2. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 2. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 2. Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 2. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 2. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 2. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 2. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 2. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 2. t/Tools/Est2Genome.t ......................... 1..61 ok 1 - use Bio::Tools::Est2Genome; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, chunk 11. Subroutine start redefined at Bio\Location\Simple.pm line 115, chunk 11. Subroutine end redefined at Bio\Location\Simple.pm line 144, chunk 11. Subroutine length redefined at Bio\Location\Simple.pm line 190, chunk 11. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, chunk 11. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, chunk 11. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, chunk 11. t/Tools/FootPrinter.t ........................ 1..27 ok 1 - use Bio::Tools::FootPrinter; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Tools/GFF.t ................................ 1..34 ok 1 - use Bio::Tools::GFF; ok 2 - use Bio::SeqFeature::Generic; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 5. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 5. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 5. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 5. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 5. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 5. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 5. t/Tools/Geneid.t ............................. 1..26 ok 1 - use Bio::Tools::Geneid; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, chunk 2. Subroutine start redefined at Bio\Location\Simple.pm line 115, chunk 2. Subroutine end redefined at Bio\Location\Simple.pm line 144, chunk 2. Subroutine length redefined at Bio\Location\Simple.pm line 190, chunk 2. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, chunk 2. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, chunk 2. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, chunk 2. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154, chunk 2. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, chunk 2. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260, chunk 2. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281, chunk 2. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311, chunk 2. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328, chunk 2. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345, chunk 2. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362, chunk 2. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379, chunk 2. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413, chunk 2. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441, chunk 2. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460, chunk 2. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478, chunk 2. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493, chunk 2. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513, chunk 2. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539, chunk 2. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555, chunk 2. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580, chunk 2. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609, chunk 2. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651, chunk 2. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674, chunk 2. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691, chunk 2. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715, chunk 2. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746, chunk 2. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770, chunk 2. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809, chunk 2. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841, chunk 2. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871, chunk 2. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894, chunk 2. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931, chunk 2. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953, chunk 2. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984, chunk 2. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001, chunk 2. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017, chunk 2. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023, chunk 2. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030, chunk 2. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031, chunk 2. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042, chunk 2. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035, chunk 2. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037, chunk 2. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039, chunk 2. t/Tools/Genewise.t ........................... 1..33 ok 1 - use Bio::Tools::Genewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 1. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 1. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 1. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 1. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 1. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 1. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 1. t/Tools/Genomewise.t ......................... 1..21 ok 1 - use Bio::Tools::Genomewise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 12. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 12. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 12. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 12. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 12. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 12. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 12. Subroutine new redefined at Bio\Location\Fuzzy.pm line 147, line 10. Subroutine location_type redefined at Bio\Location\Fuzzy.pm line 174, line 10. Subroutine start redefined at Bio\Location\Fuzzy.pm line 236, line 10. Subroutine end redefined at Bio\Location\Fuzzy.pm line 263, line 10. Subroutine min_start redefined at Bio\Location\Fuzzy.pm line 290, line 10. Subroutine max_start redefined at Bio\Location\Fuzzy.pm line 309, line 10. Subroutine start_pos_type redefined at Bio\Location\Fuzzy.pm line 329, line 10. Subroutine min_end redefined at Bio\Location\Fuzzy.pm line 359, line 10. Subroutine max_end redefined at Bio\Location\Fuzzy.pm line 378, line 10. Subroutine end_pos_type redefined at Bio\Location\Fuzzy.pm line 398, line 10. Subroutine to_FTstring redefined at Bio\Location\Fuzzy.pm line 469, line 10. Subroutine _fuzzypointdecode redefined at Bio\Location\Fuzzy.pm line 581, line 10. Subroutine new redefined at Bio\Location\Split.pm line 104, line 256. Subroutine each_Location redefined at Bio\Location\Split.pm line 136, line 256. Subroutine sub_Location redefined at Bio\Location\Split.pm line 165, line 256. Subroutine add_sub_Location redefined at Bio\Location\Split.pm line 234, line 256. Subroutine splittype redefined at Bio\Location\Split.pm line 258, line 256. Subroutine is_single_sequence redefined at Bio\Location\Split.pm line 286, line 256. Subroutine guide_strand redefined at Bio\Location\Split.pm line 311, line 256. Subroutine strand redefined at Bio\Location\Split.pm line 339, line 256. Subroutine flip_strand redefined at Bio\Location\Split.pm line 380, line 256. Subroutine start redefined at Bio\Location\Split.pm line 401, line 256. Subroutine end redefined at Bio\Location\Split.pm line 420, line 256. Subroutine min_start redefined at Bio\Location\Split.pm line 439, line 256. Subroutine max_start redefined at Bio\Location\Split.pm line 461, line 256. Subroutine start_pos_type redefined at Bio\Location\Split.pm line 484, line 256. Subroutine min_end redefined at Bio\Location\Split.pm line 505, line 256. Subroutine max_end redefined at Bio\Location\Split.pm line 528, line 256. Subroutine end_pos_type redefined at Bio\Location\Split.pm line 552, line 256. Subroutine seq_id redefined at Bio\Location\Split.pm line 578, line 256. Subroutine to_FTstring redefined at Bio\Location\Split.pm line 624, line 256. t/Tools/Genpred.t ............................ 1..185 ok 1 - use Bio::Tools::Fgenesh; ok 2 - use Bio::Tools::Genscan; ok 3 - use Bio::Tools::Genemark; ok 4 - use Bio::Tools::Glimmer; ok 5 - use Bio::Tools::MZEF; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 ok 10 - strand match (-1 and -1) ok 11 - score match (1.05 and 1.05) ok 12 ok 13 - predicted and extracted protein seqs match ok 14 - strand match (1 and 1) ok 15 - score match (4.46 and 4.46) ok 16 ok 17 - predicted and extracted protein seqs match ok 18 - initial exons 0 ok 19 - score match 1.74 ok 20 ok 21 - predicted and extracted protein seqs match ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - Genemark tests ok 43 ok 44 ok 45 ok 46 - The object isa Bio::Location::Fuzzy ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - The object isa Bio::Location::Fuzzy ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 - The object isa Bio::Location::SplitLocationI ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 - The object isa Bio::Location::SplitLocationI ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - The object isa Bio::Location::Fuzzy ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 - The object isa Bio::Location::Fuzzy ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039. Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Tools/Hmmer.t .............................. 1..29 ok 1 - use Bio::Tools::HMMER::Domain; ok 2 - use Bio::Tools::HMMER::Set; ok 3 - use Bio::Tools::HMMER::Results; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok t/Tools/IUPAC.t .............................. 1..4 ok 1 - use Bio::Tools::IUPAC; ok 2 - use Bio::Seq; ok 3 ok 4 ok t/Tools/Lucy.t ............................... 1..22 ok 1 - use Bio::Tools::Lucy; ok 2 - The object isa Bio::Tools::Lucy ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 8. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 8. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 8. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 8. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 8. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 8. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 8. t/Tools/Match.t .............................. 1..38 ok 1 - use Bio::Tools::Match; ok 2 ok 3 - The object isa Bio::SeqFeature::Annotated ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature core score correct ok 8 - feature matrix score correct ok 9 - feature matrix id correct ok 10 - The object isa Bio::SeqFeature::Annotated ok 11 - correct source ok 12 - feature start correct ok 13 - feature end correct ok 14 - feature core score correct ok 15 - feature matrix score correct ok 16 - feature matrix id correct ok 17 - The object isa Bio::SeqFeature::Annotated ok 18 - correct source ok 19 - feature start correct ok 20 - feature end correct ok 21 - feature core score correct ok 22 - feature matrix score correct ok 23 - feature matrix id correct ok 24 - The object isa Bio::SeqFeature::Annotated ok 25 - correct source ok 26 - feature start correct ok 27 - feature end correct ok 28 - feature core score correct ok 29 - feature matrix score correct ok 30 - feature matrix id correct ok 31 - The object isa Bio::SeqFeature::Annotated ok 32 - correct source ok 33 - feature start correct ok 34 - feature end correct ok 35 - feature core score correct ok 36 - feature matrix score correct ok 37 - feature matrix id correct ok 38 - correct number of results managed to get tested ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 6. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 6. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 6. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 6. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 6. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 6. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 6. t/Tools/Phylo/Gerp.t ......................... 1..33 ok 1 - use Bio::Tools::Phylo::Gerp; ok 2 ok 3 - The object isa Bio::SeqFeature::Annotated ok 4 - correct source ok 5 - feature start correct ok 6 - feature end correct ok 7 - feature score correct ok 8 - feature pvalue correct ok 9 - The object isa Bio::SeqFeature::Annotated ok 10 - correct source ok 11 - feature start correct ok 12 - feature end correct ok 13 - feature score correct ok 14 - feature pvalue correct ok 15 - The object isa Bio::SeqFeature::Annotated ok 16 - correct source ok 17 - feature start correct ok 18 - feature end correct ok 19 - feature score correct ok 20 - feature pvalue correct ok 21 - The object isa Bio::SeqFeature::Annotated ok 22 - correct source ok 23 - feature start correct ok 24 - feature end correct ok 25 - feature score correct ok 26 - feature pvalue correct ok 27 - The object isa Bio::SeqFeature::Annotated ok 28 - correct source ok 29 - feature start correct ok 30 - feature end correct ok 31 - feature score correct ok 32 - feature pvalue correct ok 33 - correct number of results parsed out ok Subroutine new redefined at Bio\Tree\Tree.pm line 132, line 6. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180, line 6. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197, line 6. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231, line 6. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246, line 6. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270, line 6. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284, line 6. Subroutine id redefined at Bio\Tree\Tree.pm line 307, line 6. Subroutine score redefined at Bio\Tree\Tree.pm line 328, line 6. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376, line 6. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432, line 6. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453, line 6. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473, line 6. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493, line 6. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509, line 6. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525, line 6. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541, line 6. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548, line 6. Subroutine new redefined at Bio\Tree\Node.pm line 113, line 6. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166, line 6. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224, line 6. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262, line 6. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324, line 6. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359, line 6. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393, line 6. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434, line 6. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458, line 6. Subroutine description redefined at Bio\Tree\Node.pm line 479, line 6. Subroutine id redefined at Bio\Tree\Node.pm line 508, line 6. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550, line 6. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564, line 6. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585, line 6. Subroutine height redefined at Bio\Tree\Node.pm line 603, line 6. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628, line 6. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649, line 6. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671, line 6. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692, line 6. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712, line 6. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728, line 6. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746, line 6. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762, line 6. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767, line 6. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794, line 6. t/Tools/Phylo/Molphy.t ....................... 1..18 ok 1 - use Bio::Tools::Phylo::Molphy; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132, line 52. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180, line 52. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197, line 52. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231, line 52. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246, line 52. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270, line 52. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284, line 52. Subroutine id redefined at Bio\Tree\Tree.pm line 307, line 52. Subroutine score redefined at Bio\Tree\Tree.pm line 328, line 52. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376, line 52. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432, line 52. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453, line 52. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473, line 52. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493, line 52. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509, line 52. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525, line 52. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541, line 52. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548, line 52. Subroutine new redefined at Bio\Tree\Node.pm line 113, line 52. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166, line 52. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224, line 52. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262, line 52. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324, line 52. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359, line 52. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393, line 52. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434, line 52. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458, line 52. Subroutine description redefined at Bio\Tree\Node.pm line 479, line 52. Subroutine id redefined at Bio\Tree\Node.pm line 508, line 52. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550, line 52. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564, line 52. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585, line 52. Subroutine height redefined at Bio\Tree\Node.pm line 603, line 52. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628, line 52. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649, line 52. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671, line 52. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692, line 52. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712, line 52. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728, line 52. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746, line 52. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762, line 52. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767, line 52. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794, line 52. t/Tools/Phylo/PAML.t ......................... 1..202 ok 1 - use Bio::Tools::Phylo::PAML; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 - node\#8 reconstructed seq ok 164 - ancestral AA ok 165 - ancestral AA ok 166 - derived AA ok 167 - ancestral AA ok 168 - ancestral AA ok 169 - derived AA ok 170 - derived AA ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok t/Tools/Phylo/Phylip/ProtDist.t .............. 1..47 ok 1 - use Bio::Tools::Phylo::Phylip::ProtDist; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 103. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 103. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 103. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 103. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 103. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 103. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 103. t/Tools/Primer3.t ............................ 1..14 ok 1 - use Bio::Tools::Primer3; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - The object isa Bio::Seq::PrimedSeq ok 11 ok 12 ok 13 ok 14 - bug 2862 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 11. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 11. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 11. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 11. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 11. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 11. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 11. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154, line 11. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 11. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260, line 11. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281, line 11. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311, line 11. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328, line 11. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345, line 11. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362, line 11. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379, line 11. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413, line 11. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441, line 11. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460, line 11. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478, line 11. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493, line 11. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513, line 11. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539, line 11. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555, line 11. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580, line 11. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609, line 11. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651, line 11. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674, line 11. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691, line 11. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715, line 11. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746, line 11. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770, line 11. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809, line 11. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841, line 11. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871, line 11. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894, line 11. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931, line 11. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953, line 11. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984, line 11. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001, line 11. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017, line 11. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023, line 11. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030, line 11. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031, line 11. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042, line 11. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035, line 11. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036, line 11. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037, line 11. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039, line 11. t/Tools/Promoterwise.t ....................... 1..7 ok 1 - use Bio::Tools::Promoterwise; ok 2 - The object isa Bio::Tools::Promoterwise ok 3 ok 4 ok 5 ok 6 ok 7 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 13. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 13. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 13. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 13. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 13. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 13. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 13. t/Tools/Pseudowise.t ......................... 1..21 ok 1 - use Bio::Tools::Pseudowise; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154, line 30. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 30. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260, line 30. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281, line 30. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311, line 30. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328, line 30. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345, line 30. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362, line 30. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379, line 30. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413, line 30. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441, line 30. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460, line 30. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478, line 30. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493, line 30. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513, line 30. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539, line 30. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555, line 30. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580, line 30. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609, line 30. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651, line 30. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674, line 30. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691, line 30. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715, line 30. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746, line 30. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770, line 30. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809, line 30. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841, line 30. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871, line 30. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894, line 30. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931, line 30. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953, line 30. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984, line 30. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001, line 30. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017, line 30. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023, line 30. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030, line 30. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031, line 30. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042, line 30. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035, line 30. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036, line 30. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037, line 30. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039, line 30. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 30. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 30. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 30. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 30. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 30. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 30. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 30. t/Tools/QRNA.t ............................... 1..30 ok 1 - use Bio::Tools::QRNA; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok t/Tools/RandDistFunctions.t .................. 1..5 ok 1 - use Bio::Tools::RandomDistFunctions; ok 2 ok 3 ok 4 ok 5 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 4. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 4. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 4. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 4. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 4. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 4. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 4. Subroutine new redefined at Bio\SeqFeature\Generic.pm line 154, line 4. Subroutine set_attributes redefined at Bio\SeqFeature\Generic.pm line 195, line 4. Subroutine direct_new redefined at Bio\SeqFeature\Generic.pm line 260, line 4. Subroutine location redefined at Bio\SeqFeature\Generic.pm line 281, line 4. Subroutine start redefined at Bio\SeqFeature\Generic.pm line 311, line 4. Subroutine end redefined at Bio\SeqFeature\Generic.pm line 328, line 4. Subroutine length redefined at Bio\SeqFeature\Generic.pm line 345, line 4. Subroutine strand redefined at Bio\SeqFeature\Generic.pm line 362, line 4. Subroutine score redefined at Bio\SeqFeature\Generic.pm line 379, line 4. Subroutine frame redefined at Bio\SeqFeature\Generic.pm line 413, line 4. Subroutine primary_tag redefined at Bio\SeqFeature\Generic.pm line 441, line 4. Subroutine source_tag redefined at Bio\SeqFeature\Generic.pm line 460, line 4. Subroutine has_tag redefined at Bio\SeqFeature\Generic.pm line 478, line 4. Subroutine add_tag_value redefined at Bio\SeqFeature\Generic.pm line 493, line 4. Subroutine get_tag_values redefined at Bio\SeqFeature\Generic.pm line 513, line 4. Subroutine get_all_tags redefined at Bio\SeqFeature\Generic.pm line 539, line 4. Subroutine remove_tag redefined at Bio\SeqFeature\Generic.pm line 555, line 4. Subroutine attach_seq redefined at Bio\SeqFeature\Generic.pm line 580, line 4. Subroutine seq redefined at Bio\SeqFeature\Generic.pm line 609, line 4. Subroutine entire_seq redefined at Bio\SeqFeature\Generic.pm line 651, line 4. Subroutine seq_id redefined at Bio\SeqFeature\Generic.pm line 674, line 4. Subroutine display_name redefined at Bio\SeqFeature\Generic.pm line 691, line 4. Subroutine annotation redefined at Bio\SeqFeature\Generic.pm line 715, line 4. Subroutine get_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 746, line 4. Subroutine add_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 770, line 4. Subroutine remove_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 809, line 4. Subroutine gff_format redefined at Bio\SeqFeature\Generic.pm line 841, line 4. Subroutine gff_string redefined at Bio\SeqFeature\Generic.pm line 871, line 4. Subroutine slurp_gff_file redefined at Bio\SeqFeature\Generic.pm line 894, line 4. Subroutine _from_gff_string redefined at Bio\SeqFeature\Generic.pm line 931, line 4. Subroutine _expand_region redefined at Bio\SeqFeature\Generic.pm line 953, line 4. Subroutine _parse redefined at Bio\SeqFeature\Generic.pm line 984, line 4. Subroutine _tag_value redefined at Bio\SeqFeature\Generic.pm line 1001, line 4. Subroutine seqname redefined at Bio\SeqFeature\Generic.pm line 1017, line 4. Subroutine display_id redefined at Bio\SeqFeature\Generic.pm line 1023, line 4. Subroutine each_tag_value redefined at Bio\SeqFeature\Generic.pm line 1030, line 4. Subroutine all_tags redefined at Bio\SeqFeature\Generic.pm line 1031, line 4. Subroutine cleanup_generic redefined at Bio\SeqFeature\Generic.pm line 1042, line 4. Subroutine Bio::SeqFeature::Generic::sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1035, line 4. Subroutine Bio::SeqFeature::Generic::add_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1036, line 4. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeatures redefined at Bio\SeqFeature\Generic.pm line 1037, line 4. Subroutine Bio::SeqFeature::Generic::flush_sub_SeqFeature redefined at Bio\SeqFeature\Generic.pm line 1039, line 4. t/Tools/RepeatMasker.t ....................... 1..14 ok 1 - use Bio::Tools::RepeatMasker; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Tools/Run/RemoteBlast.t .................... skipped: Network tests have not been requested t/Tools/Run/RemoteBlast_rpsblast.t ........... skipped: Network tests have not been requested t/Tools/Run/StandAloneBlast.t ................ 1..45 ok 1 - use Bio::Tools::Run::StandAloneBlast; ok 2 - use Bio::SeqIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Tools::Run::StandAloneBlast ok 14 - The object isa Bio::Tools::Run::StandAloneNCBIBlast ok 15 - The object isa Bio::Tools::Run::StandAloneBlast ok 16 - The object isa Bio::Tools::Run::StandAloneWUBlast ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 # skip blastall not installed, skipping tests ok 35 # skip blastall not installed, skipping tests ok 36 # skip blastall not installed, skipping tests ok 37 # skip blastall not installed, skipping tests ok 38 # skip blastall not installed, skipping tests ok 39 # skip blastall not installed, skipping tests ok 40 # skip blastall not installed, skipping tests ok 41 # skip blastall not installed, skipping tests ok 42 # skip blastall not installed, skipping tests ok 43 # skip blastall not installed, skipping tests ok 44 # skip blastall not installed, skipping tests ok 45 # skip blastall not installed, skipping tests ok t/Tools/Run/WrapperBase.t .................... 1..27 ok 1 - use Bio::Tools::Run::WrapperBase; ok 2 - The object isa Bio::Tools::Run::WrapperBase ok 3 - run() exists ok 4 - program_dir() exists ok 5 - program_name() exists ok 6 - version() exists ok 7 - error_string could be set ok 8 - arguments could be set ok 9 - no_param_checks could be set ok 10 - save_tempfiles could be set ok 11 - outfile_name could be set ok 12 - quiet could be set ok 13 - tempdir created a directory ok 14 - could create file in tempdir ok 15 - following cleanup() with save_tempfiles unset, tempdir was deleted ok 16 - The object isa Bio::Root::IO ok 17 - io() always returns the same instance of IO ok 18 - program_path was correct ok 19 - pretend program name not found as executable ok 20 - perl found as exectuable ok 21 - params string correct ok 22 - params string correct ok 23 - params string correct ok 24 - params string correct ok 25 - params string correct ok 26 - params string correct ok 27 - params string correct ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 1. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 1. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 1. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 1. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 1. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 1. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 1. t/Tools/Seg.t ................................ 1..15 ok 1 - use Bio::Tools::Seg; ok 2 - parser defined ok 3 ok 4 - seq id for seq 0 identified ok 5 - start for seq 0 identified ok 6 - end for seq 0 identified ok 7 - score for seq 0 identified ok 8 - seq id for seq 1 identified ok 9 - start for seq 1 identified ok 10 - end for seq 1 identified ok 11 - score for seq 1 identified ok 12 - seq id for seq 2 identified ok 13 - start for seq 2 identified ok 14 - end for seq 2 identified ok 15 - score for seq 2 identified ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 42. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 42. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 42. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 42. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 42. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 42. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 42. t/Tools/SiRNA.t .............................. 1..11 ok 1 - use Bio::Tools::SiRNA; ok 2 - use Bio::Seq; ok 3 - use Bio::SeqIO; ok 4 - The object isa Bio::SeqIO ok 5 - The object isa Bio::Tools::SiRNA ok 6 - CDS only: got 65 ok 7 ok 8 ok 9 - The object isa Bio::Seq ok 10 ok 11 ok t/Tools/Sigcleave.t .......................... 1..18 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Tools::Sigcleave; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - unable to get raw sigcleave results ok 16 ok 17 - unable to get raw sigcleave results ok 18 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 187. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 187. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 187. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 187. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 187. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 187. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 187. t/Tools/Signalp.t ............................ 1..11 ok 1 - use Bio::Tools::Signalp; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 62. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 62. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 62. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 62. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 62. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 62. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 62. t/Tools/Signalp/ExtendedSignalp.t ............ 1..185 ok 1 - use Bio::Tools::Signalp::ExtendedSignalp; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 6. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 6. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 6. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 6. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 6. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 6. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 6. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 6. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 6. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 6. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 6. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 6. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 6. t/Tools/Sim4.t ............................... 1..27 ok 1 - use Bio::Tools::Sim4::Results; ok 2 - new Sim4 results instance ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - new Sim4 results instance ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok Subroutine new redefined at Bio\SeqFeature\Similarity.pm line 86, line 6. Subroutine significance redefined at Bio\SeqFeature\Similarity.pm line 123, line 6. Subroutine bits redefined at Bio\SeqFeature\Similarity.pm line 139, line 6. Subroutine frac_identical redefined at Bio\SeqFeature\Similarity.pm line 155, line 6. Subroutine seqlength redefined at Bio\SeqFeature\Similarity.pm line 171, line 6. Subroutine seqdesc redefined at Bio\SeqFeature\Similarity.pm line 191, line 6. Subroutine new redefined at Bio\Location\Simple.pm line 93, line 6. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 6. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 6. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 6. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 6. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 6. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 6. t/Tools/Spidey/Spidey.t ...................... 1..26 ok 1 - use Bio::Tools::Spidey::Results; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 31. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 31. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 31. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 31. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 31. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 31. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 31. t/Tools/TandemRepeatsFinder.t ................ 1..65 ok 1 - use Bio::Tools::TandemRepeatsFinder; ok 2 - Parser created successfully ok 3 - empty results file correctly returns no results ok 4 - Second parser created successfully ok 5 - seq_id for first result correctly parsed ok 6 - start for first result correctly parsed ok 7 - end for first result correctly parsed ok 8 - source tag for first result correctly parsed ok 9 - primary tag for first result correctly parsed ok 10 - score for first result correctly parsed ok 11 - sequence description correctly parsed. ok 12 - correctly parsed all run parameters ok 13 - correctly parsed period_size for first result ok 14 - correctly parsed copy_number for first result ok 15 - correctly parsed consensus_size for first result ok 16 - correctly parsed percent_matches for first result ok 17 - correctly parsed percent_indels for first result ok 18 - correctly parsed percent_a for first result ok 19 - correctly parsed percent_c for first result ok 20 - correctly parsed percent_g for first result ok 21 - correctly parsed percent_t for first result ok 22 - correctly parsed entropy for first result ok 23 - correctly parsed repeat_sequence for first result ok 24 - correctly parsed consensus_sequence for first result ok 25 - seq_id for second result correctly parsed ok 26 - start for second result correctly parsed ok 27 - end for second result correctly parsed ok 28 - source tag for first result correctly parsed ok 29 - primary tag for first result correctly parsed ok 30 - score for first result correctly parsed ok 31 - sequence description correctly parsed. ok 32 - correctly reatained all run parameters for second feature ok 33 - correctly parsed period_size for second result ok 34 - correctly parsed copy_number for second result ok 35 - correctly parsed consensus_size for second result ok 36 - correctly parsed percent_matches for second result ok 37 - correctly parsed percent_indels for second result ok 38 - correctly parsed percent_a for second result ok 39 - correctly parsed percent_c for second result ok 40 - correctly parsed percent_g for second result ok 41 - correctly parsed percent_t for second result ok 42 - correctly parsed entropy for second result ok 43 - correctly parsed repeat_sequence for second result ok 44 - correctly parsed consensus_sequence for second result ok 45 - seq_id for first result correctly parsed ok 46 - start for first result correctly parsed ok 47 - end for first result correctly parsed ok 48 - source tag for first result correctly parsed ok 49 - primary tag for first result correctly parsed ok 50 - score for first result correctly parsed ok 51 - sequence description correctly parsed. ok 52 - correctly reatained all run parameters for third feature ok 53 - correctly parsed period_size for third result ok 54 - correctly parsed copy_number for third result ok 55 - correctly parsed consensus_size for third result ok 56 - correctly parsed percent_matches for third result ok 57 - correctly parsed percent_indels for third result ok 58 - correctly parsed percent_a for third result ok 59 - correctly parsed percent_c for third result ok 60 - correctly parsed percent_g for third result ok 61 - correctly parsed percent_t for third result ok 62 - correctly parsed entropy for third result ok 63 - correctly parsed repeat_sequence for third result ok 64 - correctly parsed consensus_sequence for third result ok 65 - correctly return undef when no features are left ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 8. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 8. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 8. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 8. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 8. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 8. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 8. t/Tools/TargetP.t ............................ 1..124 ok 1 - use Bio::Tools::TargetP; ok 2 ok 3 ok 4 ok 5 - good SeqID ok 6 - good Seqlength ok 7 - correct Mitochondrion cutoff ok 8 - correct signalpPeptide cutoff ok 9 - correct other cutoff ok 10 - correct location ok 11 - correct Reliability class score ok 12 - No peptide signal length reported ok 13 - good SeqID ok 14 - good Seqlength ok 15 - correct Mitochondrion cutoff ok 16 - correct signalpPeptide cutoff ok 17 - correct other cutoff ok 18 - correct location ok 19 - correct Reliability class score ok 20 - correct peptide signal length ok 21 - good SeqID ok 22 - good Seqlength ok 23 - correct Mitochondrion cutoff ok 24 - correct signalpPeptide cutoff ok 25 - correct other cutoff ok 26 - correct location ok 27 - correct Reliability class score ok 28 - correct peptide signal length ok 29 - good SeqID ok 30 - good Seqlength ok 31 - correct Mitochondrion cutoff ok 32 - correct signalpPeptide cutoff ok 33 - correct other cutoff ok 34 - correct location ok 35 - correct Reliability class score ok 36 - No peptide signal length reported ok 37 - good SeqID ok 38 - good Seqlength ok 39 - correct Mitochondrion cutoff ok 40 - correct signalpPeptide cutoff ok 41 - correct other cutoff ok 42 - correct location ok 43 - correct Reliability class score ok 44 - No peptide signal length reported ok 45 - good SeqID ok 46 - good Seqlength ok 47 - correct Mitochondrion cutoff ok 48 - correct signalpPeptide cutoff ok 49 - correct other cutoff ok 50 - correct location ok 51 - correct Reliability class score ok 52 - No peptide signal length reported ok 53 - good SeqID ok 54 - good Seqlength ok 55 - correct Mitochondrion cutoff ok 56 - correct signalpPeptide cutoff ok 57 - correct other cutoff ok 58 - correct location ok 59 - correct Reliability class score ok 60 - No peptide signal length reported ok 61 - good SeqID ok 62 - good Seqlength ok 63 - correct Mitochondrion cutoff ok 64 - correct signalpPeptide cutoff ok 65 - correct other cutoff ok 66 - correct location ok 67 - correct Reliability class score ok 68 - correct peptide signal length ok 69 - good SeqID ok 70 - good Seqlength ok 71 - correct Mitochondrion cutoff ok 72 - correct signalpPeptide cutoff ok 73 - correct other cutoff ok 74 - correct location ok 75 - correct Reliability class score ok 76 - No peptide signal length reported ok 77 - good SeqID ok 78 - good Seqlength ok 79 - correct Mitochondrion cutoff ok 80 - correct signalpPeptide cutoff ok 81 - correct other cutoff ok 82 - correct location ok 83 - correct Reliability class score ok 84 - No peptide signal length reported ok 85 - good SeqID ok 86 - good Seqlength ok 87 - correct Mitochondrion cutoff ok 88 - correct signalpPeptide cutoff ok 89 - correct other cutoff ok 90 - correct location ok 91 - correct Reliability class score ok 92 - No peptide signal length reported ok 93 - good SeqID ok 94 - good Seqlength ok 95 - correct Mitochondrion cutoff ok 96 - correct signalpPeptide cutoff ok 97 - correct other cutoff ok 98 - correct location ok 99 - correct Reliability class score ok 100 - No peptide signal length reported ok 101 - good SeqID ok 102 - good Seqlength ok 103 - correct Mitochondrion cutoff ok 104 - correct signalpPeptide cutoff ok 105 - correct other cutoff ok 106 - correct location ok 107 - correct Reliability class score ok 108 - correct peptide signal length ok 109 - good SeqID ok 110 - good Seqlength ok 111 - correct Mitochondrion cutoff ok 112 - correct signalpPeptide cutoff ok 113 - correct other cutoff ok 114 - correct location ok 115 - correct Reliability class score ok 116 - No peptide signal length reported ok 117 - good SeqID ok 118 - good Seqlength ok 119 - correct Mitochondrion cutoff ok 120 - correct signalpPeptide cutoff ok 121 - correct other cutoff ok 122 - correct location ok 123 - correct Reliability class score ok 124 - No peptide signal length reported ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 7. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 7. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 7. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 7. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 7. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 7. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 7. t/Tools/Tmhmm.t .............................. 1..12 ok 1 - use Bio::Tools::Tmhmm; ok 2 - new() ok 3 - got 3 feat ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, line 1. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 1. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 1. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 1. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 1. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 1. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 1. t/Tools/ePCR.t ............................... 1..27 ok 1 - use Bio::Tools::EPCR; ok 2 - use Bio::SeqIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - got 3 forward strand ePCR hits ok 27 - got 3 reverse strand ePCR hits ok t/Tools/pICalculator.t ....................... 1..38 ok 1 - use Bio::Seq; ok 2 - use Bio::Tools::pICalculator; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/Tools/rnamotif.t ........................... skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated Subroutine new redefined at Bio\Location\Simple.pm line 93, line 4. Subroutine start redefined at Bio\Location\Simple.pm line 115, line 4. Subroutine end redefined at Bio\Location\Simple.pm line 144, line 4. Subroutine length redefined at Bio\Location\Simple.pm line 190, line 4. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, line 4. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, line 4. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, line 4. t/Tools/tRNAscanSE.t ......................... 1..14 ok 1 - use Bio::Tools::tRNAscanSE; ok 2 - The object isa Bio::Tools::tRNAscanSE ok 3 ok 4 - seq_id ok 5 - codon ok 6 - start ok 7 - end ok 8 - strand ok 9 - exons ok 10 - end ok 11 - start ok 12 - start ok 13 - end ok 14 - seq_id ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/Compatible.t .......................... 1..5 ok 1 - use Bio::Tree::Compatible; ok 2 - use Bio::TreeIO; ok 3 ok 4 ok 5 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/Node.t ................................ 1..40 ok 1 - use Bio::Tree::Node; ok 2 - use Bio::Tree::AlleleNode; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - retrieve the first value ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - with fake node ok 37 - after reroot on fake node ok 38 - reroot on B ok 39 - remove fake node, reroot on former B anc ok 40 - roundtrip ok t/Tree/PhyloNetwork/Factory.t ................ 1..70 ok 1 - use Bio::PhyloNetwork::Factory; ok 2 - The object isa Bio::PhyloNetwork::Factory ok 3 - factory ok 4 - seen all the data lines ok 5 - found ok 6 - found ok 7 - found ok 8 - found ok 9 - found ok 10 - found ok 11 - found ok 12 - found ok 13 - found ok 14 - found ok 15 - found ok 16 - found ok 17 - found ok 18 - found ok 19 - found ok 20 - found ok 21 - found ok 22 - found ok 23 - found ok 24 - found ok 25 - found ok 26 - found ok 27 - found ok 28 - found ok 29 - found ok 30 - found ok 31 - found ok 32 - found ok 33 - found ok 34 - found ok 35 - found ok 36 - found ok 37 - found ok 38 - found ok 39 - found ok 40 - found ok 41 - found ok 42 - found ok 43 - found ok 44 - found ok 45 - found ok 46 - found ok 47 - found ok 48 - found ok 49 - found ok 50 - found ok 51 - found ok 52 - found ok 53 - found ok 54 - found ok 55 - found ok 56 - found ok 57 - found ok 58 - found ok 59 - found ok 60 - found ok 61 - found ok 62 - found ok 63 - found ok 64 - found ok 65 - found ok 66 - found ok 67 - found ok 68 - found ok 69 - found ok 70 - found ok t/Tree/PhyloNetwork/GraphViz.t ............... skipped: The optional module GraphViz (or dependencies thereof) was not installed t/Tree/PhyloNetwork/MuVector.t ............... 1..8 ok 1 - use Bio::PhyloNetwork::muVector; ok 2 - The object isa Bio::PhyloNetwork::muVector ok 3 - The object isa Bio::PhyloNetwork::muVector ok 4 - arithmetic ok 5 - display ok 6 - is_positive ok 7 - geq_poset ok 8 - geq_poset ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/PhyloNetwork/PhyloNetwork.t ........... 1..30 ok 1 - use Bio::PhyloNetwork; ok 2 - The object isa Bio::PhyloNetwork ok 3 - is_leaf ok 4 - is_tree_node ok 5 - is_hybrid_node ok 6 - is_root ok 7 - is_tree_child ok 8 - nodes ok 9 - leaves ok 10 - internal_nodes ok 11 - edges ok 12 - tree_edges ok 13 - hybrid_edges ok 14 - mudata ok 15 - build from mudata ok 16 - heights ok 17 - mu_distance ok 18 - time_consistent ok 19 - temporal_representation ok 20 - tripartitions ok 21 - tripartitions ok 22 - tripartition_error ok 23 - weight (manhattan) ok 24 - optimal_alignment (manhattan) ok 25 - weight (hamming) ok 26 - optimal_alignment (hamming) ok 27 - eNewick ok 28 - eNewick_full ok 29 - explode ok 30 - The object isa Bio::Tree::Tree ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/PhyloNetwork/RandomFactory.t .......... 1..70 ok 1 - use Bio::PhyloNetwork::RandomFactory; ok 2 - The object isa Bio::PhyloNetwork::RandomFactory ok 3 - random factory ok 4 ok 5 - found ok 6 - found ok 7 - found ok 8 - found ok 9 - found ok 10 - found ok 11 - found ok 12 - found ok 13 - found ok 14 - found ok 15 - found ok 16 - found ok 17 - found ok 18 - found ok 19 - found ok 20 - found ok 21 - found ok 22 - found ok 23 - found ok 24 - found ok 25 - found ok 26 - found ok 27 - found ok 28 - found ok 29 - found ok 30 - found ok 31 - found ok 32 - found ok 33 - found ok 34 - found ok 35 - found ok 36 - found ok 37 - found ok 38 - found ok 39 - found ok 40 - found ok 41 - found ok 42 - found ok 43 - found ok 44 - found ok 45 - found ok 46 - found ok 47 - found ok 48 - found ok 49 - found ok 50 - found ok 51 - found ok 52 - found ok 53 - found ok 54 - found ok 55 - found ok 56 - found ok 57 - found ok 58 - found ok 59 - found ok 60 - found ok 61 - found ok 62 - found ok 63 - found ok 64 - found ok 65 - found ok 66 - found ok 67 - found ok 68 - found ok 69 - found ok 70 - found ok t/Tree/PhyloNetwork/TreeFactory.t ............ 1..19 ok 1 - use Bio::PhyloNetwork::TreeFactory; ok 2 - The object isa Bio::PhyloNetwork::TreeFactory ok 3 - tree factory ok 4 - seen all the data lines ok 5 - found ok 6 - found ok 7 - found ok 8 - found ok 9 - found ok 10 - found ok 11 - found ok 12 - found ok 13 - found ok 14 - found ok 15 - found ok 16 - found ok 17 - found ok 18 - found ok 19 - found ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/RandomTreeFactory.t ................... 1..5 ok 1 - use Bio::Tree::RandomFactory; ok 2 - use Bio::TreeIO; ok 3 - use Bio::Tree::Statistics; ok 4 ok 5 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\NodeNHX.pm line 110. Subroutine DESTROY redefined at Bio\Tree\NodeNHX.pm line 119. Subroutine to_string redefined at Bio\Tree\NodeNHX.pm line 134. Subroutine nhx_tag redefined at Bio\Tree\NodeNHX.pm line 164. Subroutine new redefined at Bio\Tree\Node.pm line 113, line 1. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166, line 1. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224, line 1. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262, line 1. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324, line 1. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359, line 1. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393, line 1. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434, line 1. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458, line 1. Subroutine description redefined at Bio\Tree\Node.pm line 479, line 1. Subroutine id redefined at Bio\Tree\Node.pm line 508, line 1. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550, line 1. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564, line 1. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585, line 1. Subroutine height redefined at Bio\Tree\Node.pm line 603, line 1. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628, line 1. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649, line 1. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671, line 1. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692, line 1. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712, line 1. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728, line 1. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746, line 1. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762, line 1. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767, line 1. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794, line 1. t/Tree/Tree.t ................................ 1..62 ok 1 - use Bio::TreeIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 - retrieve the first value ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - Number of nodes that have ADH2 as name ok 15 - Test Monophyly ok 16 - Height ok 17 - Depth ok 18 - non-monophyletic group ok 19 - not a binary tree ok 20 - 12 nodes ok 21 - after force_binary() it is ok 22 - and there are more nodes (17) ok 23 - B,C are Monophyletic ok 24 - A,B are Monophyletic ok 25 - B,F are not Monophyletic ok 26 - A,B are Monophyletic ok 27 - A,B,C are not Monophyletic w D as outgroup ok 28 - A,F,E are monophyletic with I as outgroup ok 29 - subtree_length() without attributes is an alias to total_branch_lenght() ok 30 - Length of the tree is larger that lenght of a subtree ok 31 - Can re-root with A as outgroup ok 32 - Count the number of nodes ok 33 - same length ok 34 - Root node is A ok 35 - Root node is A's ancestor ok 36 - Can reroot with C's ancsestor ok 37 - Node count correct ok 38 - Total original branch length is what it is supposed to be ok 39 - Updated total branch length after the reroot ok 40 - Make sure root is really what we asked for ok 41 - Testing for failed re-rerooting ok 42 - Test that rooting succeeded ok 43 - Test that re-rooted tree has proper number of nodes after re-rooting ok 44 - Branch length before rerooting ok 45 - Branch length after rerooting ok 46 - Root is really the ancestor we asked for ok 47 - BFS traversal order ok 48 - DFS travfersal order ok 49 - DFS traversal after removing H ok 50 - DFS traversal after removing G ok 51 - DFS traversal after removing E ok 52 - DFS after removing all but 0,1,2,A,B,C,D ok 53 - Testing bootstrap copy ok 54 - Testing bootstrap copy ok 55 - Testing bootstrap copy ok 56 - Testing bootstrap copy ok 57 - Testing bootstrap copy ok 58 - Testing bootstrap copy ok 59 - Testing auto-boostrap copy during parse ok 60 - Testing auto-boostrap copy during parse ok 61 - Testing auto-boostrap copy during parse ok 62 - Testing auto-boostrap copy during parse ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. Subroutine new redefined at Bio\Tree\NodeNHX.pm line 110, line 1. Subroutine DESTROY redefined at Bio\Tree\NodeNHX.pm line 119, line 1. Subroutine to_string redefined at Bio\Tree\NodeNHX.pm line 134, line 1. Subroutine nhx_tag redefined at Bio\Tree\NodeNHX.pm line 164, line 1. t/Tree/TreeIO.t .............................. 1..74 ok 1 - use Bio::TreeIO; ok 2 ok 3 - The object isa Bio::Tree::TreeI ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Tree::TreeI ok 14 ok 15 ok 16 ok 17 ok 18 - Saw SINFRUP0000006110 as expected ok 19 ok 20 ok 21 ok 22 - The object isa Bio::Tree::TreeI ok 23 - Total Nodes ok 24 ok 25 ok 26 ok 27 - The object isa Bio::Tree::TreeI ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - The object isa Bio::Tree::TreeI ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - The object isa Bio::Tree::TreeI ok 43 - Leaf nodes ok 44 - All nodes ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 - bug 2356 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/TreeIO/lintree.t ...................... 1..24 ok 1 - use Bio::TreeIO; ok 2 - The object isa Bio::Tree::TreeI ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - The object isa Bio::Tree::TreeI ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - The object isa Bio::Tree::TreeI ok 18 - Leaf nodes ok 19 - All nodes ok 20 ok 21 ok 22 ok 23 ok 24 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/TreeIO/newick.t ....................... 1..24 ok 1 - use Bio::TreeIO; ok 2 ok 3 - The object isa Bio::Tree::TreeI ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 - The object isa Bio::Tree::TreeI ok 14 ok 15 ok 16 ok 17 ok 18 - Saw SINFRUP0000006110 as expected ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/TreeIO/nexus.t ........................ 1..24 ok 1 - use Bio::TreeIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - bug 2356 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\NodeNHX.pm line 110. Subroutine DESTROY redefined at Bio\Tree\NodeNHX.pm line 119. Subroutine to_string redefined at Bio\Tree\NodeNHX.pm line 134. Subroutine nhx_tag redefined at Bio\Tree\NodeNHX.pm line 164. t/Tree/TreeIO/nhx.t .......................... 1..7 ok 1 - use Bio::TreeIO; ok 2 ok 3 - The object isa Bio::Tree::TreeI ok 4 - Total Nodes ok 5 ok 6 ok 7 ok Subroutine _initialize redefined at Bio\TreeIO\phyloxml.pm line 91. Subroutine _init_func redefined at Bio\TreeIO\phyloxml.pm line 124. Subroutine DESTROY redefined at Bio\TreeIO\phyloxml.pm line 142. Subroutine next_tree redefined at Bio\TreeIO\phyloxml.pm line 162. Subroutine add_phyloXML_annotation redefined at Bio\TreeIO\phyloxml.pm line 193. Subroutine write_tree redefined at Bio\TreeIO\phyloxml.pm line 241. Subroutine _write_tree_Helper_annotatableNode redefined at Bio\TreeIO\phyloxml.pm line 290. Subroutine _write_tree_Helper_generic redefined at Bio\TreeIO\phyloxml.pm line 353. Subroutine _relation_to_string redefined at Bio\TreeIO\phyloxml.pm line 413. Subroutine read_annotation redefined at Bio\TreeIO\phyloxml.pm line 455. Subroutine _read_annotation_text_Helper redefined at Bio\TreeIO\phyloxml.pm line 473. Subroutine _read_annotation_attr_Helper redefined at Bio\TreeIO\phyloxml.pm line 498. Subroutine processXMLNode redefined at Bio\TreeIO\phyloxml.pm line 534. Subroutine processAttribute redefined at Bio\TreeIO\phyloxml.pm line 588. Subroutine element_phylogeny redefined at Bio\TreeIO\phyloxml.pm line 614. Subroutine end_element_phylogeny redefined at Bio\TreeIO\phyloxml.pm line 638. Subroutine element_clade redefined at Bio\TreeIO\phyloxml.pm line 685. Subroutine end_element_clade redefined at Bio\TreeIO\phyloxml.pm line 726. Subroutine element_relation redefined at Bio\TreeIO\phyloxml.pm line 765. Subroutine end_element_relation redefined at Bio\TreeIO\phyloxml.pm line 781. Subroutine element_default redefined at Bio\TreeIO\phyloxml.pm line 827. Subroutine end_element_default redefined at Bio\TreeIO\phyloxml.pm line 892. Subroutine annotateNode redefined at Bio\TreeIO\phyloxml.pm line 1018. Subroutine current_attr redefined at Bio\TreeIO\phyloxml.pm line 1053. Subroutine prev_attr redefined at Bio\TreeIO\phyloxml.pm line 1073. Subroutine current_element redefined at Bio\TreeIO\phyloxml.pm line 1093. Subroutine prev_element redefined at Bio\TreeIO\phyloxml.pm line 1113. Subroutine treetype redefined at Bio\TreeIO\phyloxml.pm line 1135. Subroutine nodetype redefined at Bio\TreeIO\phyloxml.pm line 1153. Subroutine node_to_string redefined at Bio\TreeIO\phyloxml.pm line 1179. Subroutine print_annotation redefined at Bio\TreeIO\phyloxml.pm line 1230. Subroutine print_attr redefined at Bio\TreeIO\phyloxml.pm line 1287. Subroutine print_seq_annotation redefined at Bio\TreeIO\phyloxml.pm line 1325. Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\AnnotatableNode.pm line 102. Subroutine DESTROY redefined at Bio\Tree\AnnotatableNode.pm line 112. Subroutine annotation redefined at Bio\Tree\AnnotatableNode.pm line 136. Subroutine add_tag_value redefined at Bio\Tree\AnnotatableNode.pm line 167. Subroutine remove_tag redefined at Bio\Tree\AnnotatableNode.pm line 190. Subroutine remove_all_tags redefined at Bio\Tree\AnnotatableNode.pm line 211. Subroutine get_all_tags redefined at Bio\Tree\AnnotatableNode.pm line 228. Subroutine get_tag_values redefined at Bio\Tree\AnnotatableNode.pm line 246. Subroutine has_tag redefined at Bio\Tree\AnnotatableNode.pm line 263. Subroutine to_string_callback redefined at Bio\Tree\AnnotatableNode.pm line 284. Subroutine to_string redefined at Bio\Tree\AnnotatableNode.pm line 299. Subroutine sequence redefined at Bio\Tree\AnnotatableNode.pm line 323. Subroutine has_sequence redefined at Bio\Tree\AnnotatableNode.pm line 348. Subroutine new redefined at Bio\Tree\NodeNHX.pm line 110. Subroutine DESTROY redefined at Bio\Tree\NodeNHX.pm line 119. Subroutine to_string redefined at Bio\Tree\NodeNHX.pm line 134. Subroutine nhx_tag redefined at Bio\Tree\NodeNHX.pm line 164. t/Tree/TreeIO/phyloxml.t ..................... 1..97 ok 1 - use Bio::TreeIO; ok 2 - use Bio::TreeIO::phyloxml; ok 3 ok 4 - The object isa Bio::Tree::TreeI ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - The object isa Bio::Tree::TreeI ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - The object isa Bio::Tree::TreeI ok 24 ok 25 ok 26 ok 27 ok 28 - The object isa Bio::Tree::TreeI ok 29 - The object isa Bio::Annotation::Collection ok 30 - The object isa Bio::Annotation::Collection ok 31 ok 32 - The object isa Bio::Annotation::Collection ok 33 ok 34 - The object isa Bio::SeqI ok 35 - The object isa Bio::Annotation::Collection ok 36 ok 37 ok 38 - The object isa Bio::Tree::TreeI ok 39 ok 40 - The object isa Bio::SeqI ok 41 - The object isa Bio::Annotation::Relation ok 42 ok 43 - The object isa Bio::SeqI ok 44 - The object isa Bio::Annotation::Relation ok 45 ok 46 - The object isa Bio::SeqI ok 47 ok 48 - The object isa Bio::Tree::TreeI ok 49 - The object isa Bio::SeqI ok 50 ok 51 ok 52 ok 53 ok 54 - The object isa Bio::Tree::TreeI ok 55 - The object isa Bio::Annotation::Relation ok 56 ok 57 - The object isa Bio::Tree::AnnotatableNode ok 58 ok 59 ok 60 ok 61 - The object isa Bio::Tree::TreeI ok 62 - The object isa Bio::Tree::AnnotatableNode ok 63 - The object isa Bio::AnnotationCollectionI ok 64 - The object isa Bio::Annotation::Collection ok 65 ok 66 ok 67 ok 68 - The object isa Bio::Tree::TreeI ok 69 - The object isa Bio::Tree::AnnotatableNode ok 70 - The object isa Bio::AnnotationCollectionI ok 71 - The object isa Bio::Annotation::Collection ok 72 ok 73 ok 74 ok 75 - The object isa Bio::Tree::TreeI ok 76 ok 77 - The object isa Bio::Tree::TreeI ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 - The object isa Bio::Tree::TreeI ok 84 ok 85 ok 86 ok 87 ok 88 - The object isa Bio::Tree::TreeI ok 89 ok 90 - The object isa Bio::Tree::AnnotatableNode ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 - The object isa Bio::Tree::TreeI ok 97 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\NodeNHX.pm line 110. Subroutine DESTROY redefined at Bio\Tree\NodeNHX.pm line 119. Subroutine to_string redefined at Bio\Tree\NodeNHX.pm line 134. Subroutine nhx_tag redefined at Bio\Tree\NodeNHX.pm line 164. Subroutine new redefined at Bio\Tree\Node.pm line 113, line 1. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166, line 1. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224, line 1. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262, line 1. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324, line 1. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359, line 1. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393, line 1. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434, line 1. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458, line 1. Subroutine description redefined at Bio\Tree\Node.pm line 479, line 1. Subroutine id redefined at Bio\Tree\Node.pm line 508, line 1. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550, line 1. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564, line 1. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585, line 1. Subroutine height redefined at Bio\Tree\Node.pm line 603, line 1. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628, line 1. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649, line 1. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671, line 1. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692, line 1. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712, line 1. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728, line 1. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746, line 1. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762, line 1. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767, line 1. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794, line 1. Use of uninitialized value in join or string at C:\cpanfly-5.8\var\megalib/SVG/Element.pm line 1202, line 1. t/Tree/TreeIO/svggraph.t ..................... 1..4 ok 1 - use Bio::TreeIO; ok 2 ok 3 ok 4 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/TreeIO/tabtree.t ...................... 1..24 ok 1 - use Bio::TreeIO; ok 2 - The object isa Bio::Tree::TreeI ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - The object isa Bio::Tree::TreeI ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - The object isa Bio::Tree::TreeI ok 18 - Leaf nodes ok 19 - All nodes ok 20 ok 21 ok 22 ok 23 ok 24 ok Subroutine new redefined at Bio\Tree\Tree.pm line 132. Subroutine nodelete redefined at Bio\Tree\Tree.pm line 180. Subroutine get_nodes redefined at Bio\Tree\Tree.pm line 197. Subroutine get_root_node redefined at Bio\Tree\Tree.pm line 231. Subroutine set_root_node redefined at Bio\Tree\Tree.pm line 246. Subroutine total_branch_length redefined at Bio\Tree\Tree.pm line 270. Subroutine subtree_length redefined at Bio\Tree\Tree.pm line 284. Subroutine id redefined at Bio\Tree\Tree.pm line 307. Subroutine score redefined at Bio\Tree\Tree.pm line 328. Subroutine as_text redefined at Bio\Tree\Tree.pm line 376. Subroutine set_tag_value redefined at Bio\Tree\Tree.pm line 432. Subroutine add_tag_value redefined at Bio\Tree\Tree.pm line 453. Subroutine remove_tag redefined at Bio\Tree\Tree.pm line 473. Subroutine remove_all_tags redefined at Bio\Tree\Tree.pm line 493. Subroutine get_all_tags redefined at Bio\Tree\Tree.pm line 509. Subroutine get_tag_values redefined at Bio\Tree\Tree.pm line 525. Subroutine has_tag redefined at Bio\Tree\Tree.pm line 541. Subroutine cleanup_tree redefined at Bio\Tree\Tree.pm line 548. Subroutine new redefined at Bio\Tree\Node.pm line 113. Subroutine create_node_on_branch redefined at Bio\Tree\Node.pm line 166. Subroutine add_Descendent redefined at Bio\Tree\Node.pm line 224. Subroutine each_Descendent redefined at Bio\Tree\Node.pm line 262. Subroutine remove_Descendent redefined at Bio\Tree\Node.pm line 324. Subroutine remove_all_Descendents redefined at Bio\Tree\Node.pm line 359. Subroutine ancestor redefined at Bio\Tree\Node.pm line 393. Subroutine branch_length redefined at Bio\Tree\Node.pm line 434. Subroutine bootstrap redefined at Bio\Tree\Node.pm line 458. Subroutine description redefined at Bio\Tree\Node.pm line 479. Subroutine id redefined at Bio\Tree\Node.pm line 508. Subroutine internal_id redefined at Bio\Tree\Node.pm line 550. Subroutine _creation_id redefined at Bio\Tree\Node.pm line 564. Subroutine is_Leaf redefined at Bio\Tree\Node.pm line 585. Subroutine height redefined at Bio\Tree\Node.pm line 603. Subroutine invalidate_height redefined at Bio\Tree\Node.pm line 628. Subroutine set_tag_value redefined at Bio\Tree\Node.pm line 649. Subroutine add_tag_value redefined at Bio\Tree\Node.pm line 671. Subroutine remove_tag redefined at Bio\Tree\Node.pm line 692. Subroutine remove_all_tags redefined at Bio\Tree\Node.pm line 712. Subroutine get_all_tags redefined at Bio\Tree\Node.pm line 728. Subroutine get_tag_values redefined at Bio\Tree\Node.pm line 746. Subroutine has_tag redefined at Bio\Tree\Node.pm line 762. Subroutine node_cleanup redefined at Bio\Tree\Node.pm line 767. Subroutine reverse_edge redefined at Bio\Tree\Node.pm line 794. t/Tree/TreeStatistics.t ...................... 1..40 ok 1 - use Bio::TreeIO; ok 2 - use Bio::Tree::Statistics; ok 3 - cherries ok 4 - cherries ok 5 - read traits ok 6 - parsimony score ok 7 - subtree parsimony score ok 8 - ps value ok 9 - fitch_down ok 10 - ps value after fitch_down ok 11 - persistence of a leaf ok 12 - persistence of an internal node value ok 13 - persistence of an internal node value ok 14 - persistence of an internal node value ok 15 - leaf node: number of clusters = 0 ok 16 - number of clusters ok 17 - number of clusters ok 18 - number of clusters ok 19 - number of leaves in phylotype ok 20 - number of leaves in phylotype ok 21 - number of leaves in phylotype ok 22 - number of leaves in phylotype ok 23 - phylotype length ok 24 - phylotype length ok 25 - phylotype length ok 26 - phylotype length ok 27 - phylotype length ok 28 - sum of leaf distances ok 29 - sum of leaf distances ok 30 - sum of leaf distances ok 31 - sum of leaf distances ok 32 - sum of leaf distances ok 33 - genetic diversity ok 34 - separation ok 35 - association index ok 36 - subtree association index ok 37 - monophyletic clade size ok 38 - monophyletic clade size ok 39 - monophyletic clade size ok 40 - monophyletic clade size ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Variation/AAChange.t ....................... 1..27 ok 1 - use Bio::Variation::Allele; ok 2 - use Bio::Variation::AAChange; ok 3 - use Bio::Variation::RNAChange; ok 4 ok 5 - The object isa Bio::Variation::AAChange ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - Trivial name is [V3A] ok 27 ok t/Variation/AAReverseMutate.t ................ 1..16 ok 1 - use Bio::Variation::AAReverseMutate; ok 2 ok 3 - The object isa Bio::Variation::AAReverseMutate ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - The object isa Bio::Variation::RNAChange ok 11 ok 12 ok 13 ok 14 - Codon_ori is |ttc| ok 15 ok 16 ok t/Variation/Allele.t ......................... 1..14 ok 1 - use Bio::Variation::Allele; ok 2 - The object isa Bio::Variation::Allele ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Variation/DNAMutation.t .................... 1..37 ok 1 - use Bio::Variation::DNAMutation; ok 2 - use Bio::Variation::Allele; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Variation/RNAChange.t ...................... 1..31 ok 1 - use Bio::Variation::Allele; ok 2 - use Bio::Variation::RNAChange; ok 3 - use Bio::Variation::AAChange; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - label ismissense ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - Codon_ori is |gaa| ok 26 - Codon_mut is |aaa| ok 27 ok 28 ok 29 ok 30 ok 31 ok t/Variation/SNP.t ............................ 1..13 ok 1 - use Bio::Variation::SNP; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok Subroutine new redefined at Bio\Location\Simple.pm line 93. Subroutine start redefined at Bio\Location\Simple.pm line 115. Subroutine end redefined at Bio\Location\Simple.pm line 144. Subroutine length redefined at Bio\Location\Simple.pm line 190. Subroutine location_type redefined at Bio\Location\Simple.pm line 281. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328. Subroutine trunc redefined at Bio\Location\Simple.pm line 370. t/Variation/SeqDiff.t ........................ 1..44 ok 1 - use Bio::Variation::SeqDiff; ok 2 - use Bio::Variation::DNAMutation; ok 3 - use Bio::Variation::Allele; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 - The object isa Bio::Variation::VariantI ok 34 - The object isa Bio::Variation::VariantI ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - The object isa Bio::PrimarySeq ok 43 ok 44 ok Subroutine new redefined at Bio\Location\Simple.pm line 93, chunk 1. Subroutine start redefined at Bio\Location\Simple.pm line 115, chunk 1. Subroutine end redefined at Bio\Location\Simple.pm line 144, chunk 1. Subroutine length redefined at Bio\Location\Simple.pm line 190, chunk 1. Subroutine location_type redefined at Bio\Location\Simple.pm line 281, chunk 1. Subroutine to_FTstring redefined at Bio\Location\Simple.pm line 328, chunk 1. Subroutine trunc redefined at Bio\Location\Simple.pm line 370, chunk 1. t/Variation/Variation_IO.t ................... 1..26 ok 1 - use Bio::Variation::IO; ok 2 ok 3 ok 4 ok 5 ok 6 - test output file compared to input ok 7 ok 8 ok 9 ok 10 ok 11 - test output file compared to input ok 12 ok 13 ok 14 ok 15 ok 16 - test output file compared to input ok 17 ok 18 ok 19 ok 20 ok 21 - test output file compared to input ok 22 ok 23 ok 24 ok 25 ok 26 - test output file compared to input ok Test Summary Report ------------------- t/Assembly/ContigSpectrum.t (Wstat: 512 Tests: 3 Failed: 1) Failed test: 3 Non-zero exit status: 2 Parse errors: Bad plan. You planned 134 tests but ran 3. t/LocalDB/SeqFeature.t (Wstat: 256 Tests: 69 Failed: 1) Failed test: 2 Non-zero exit status: 1 t/LocalDB/transfac_pro.t (Wstat: 512 Tests: 4 Failed: 1) Failed test: 4 Non-zero exit status: 2 Parse errors: Bad plan. You planned 115 tests but ran 4. t/RemoteDB/Taxonomy.t (Wstat: 65280 Tests: 82 Failed: 1) Failed test: 4 Non-zero exit status: 255 Parse errors: Bad plan. You planned 103 tests but ran 82. Files=329, Tests=18283, 190 wallclock secs ( 2.30 usr + 0.17 sys = 2.47 CPU) Result: FAIL Failed 4/329 test programs. 4/18283 subtests failed. NMAKE : fatal error U1077: 'C:\Perl-5.8\bin\perl.exe' : return code '0xff' Stop. CJFIELDS/BioPerl-1.6.1.tar.gz nmake test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports CJFIELDS/BioPerl-1.6.1.tar.gz Finished 2011-08-03T10:00:32