PATH=/usr/bin:/bin:/home/fly1800/cpanfly-5.18/var/megalib/bin
Start 2016-01-27T04:16:21
ActivePerl-1800 CPAN-2.10
Reading '/home/fly1800/cpanfly-5.18/var/cpan/Metadata'
Database was generated on Wed, 27 Jan 2016 05:53:39 GMT
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz ok
Bundle-BDFOY-20160101/
Bundle-BDFOY-20160101/Changes
Bundle-BDFOY-20160101/INSTALL.SKIP
Bundle-BDFOY-20160101/lib/
Bundle-BDFOY-20160101/LICENSE
Bundle-BDFOY-20160101/Makefile.PL
Bundle-BDFOY-20160101/MANIFEST
Bundle-BDFOY-20160101/MANIFEST.SKIP
Bundle-BDFOY-20160101/META.json
Bundle-BDFOY-20160101/META.yml
Bundle-BDFOY-20160101/README.pod
Bundle-BDFOY-20160101/t/
Bundle-BDFOY-20160101/xt/
Bundle-BDFOY-20160101/xt/changes.t
Bundle-BDFOY-20160101/t/load.t
Bundle-BDFOY-20160101/t/pod.t
Bundle-BDFOY-20160101/lib/Bundle/
Bundle-BDFOY-20160101/lib/Task/
Bundle-BDFOY-20160101/lib/Task/BDFOY.pm
/bin/tar: Read 8192 bytes from -
Bundle-BDFOY-20160101/lib/Bundle/BDFOY.pm
Configuring B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite App::scriptdist 0 not found.
Warning: prerequisite Distribution::Cooker 0 not found.
Warning: prerequisite File::Fingerprint 0 not found.
Warning: prerequisite HTTP::Cookies::Omniweb 0 not found.
Warning: prerequisite HTTP::Cookies::Safari 0 not found.
Warning: prerequisite HTTP::Cookies::iCab 0 not found.
Warning: prerequisite Mac::OSVersion 0 not found.
Warning: prerequisite Mac::iPhoto::Shell 0 not found.
Warning: prerequisite Mac::iTerm::LaunchPad 0 not found.
Warning: prerequisite MacOSX::Alias 0 not found.
Warning: prerequisite MyCPAN::App::DPAN 0 not found.
Warning: prerequisite MyCPAN::Indexer 0 not found.
Warning: prerequisite Net::SSH::Perl::ProxiedIPC 0 not found.
Warning: prerequisite Net::SSH::Perl::WithSocks 0 not found.
Warning: prerequisite PPI::App::ppi_version::BDFOY 0 not found.
Warning: prerequisite PeGS::PDF 0 not found.
Warning: prerequisite PerlPowerTools 0 not found.
Warning: prerequisite Pod::PseudoPod::PerlTricks 0 not found.
Warning: prerequisite Pod::SpeakIt::MacSpeech 0 not found.
Warning: prerequisite Psychic::Ninja 0 not found.
Warning: prerequisite ReturnValue 0 not found.
Warning: prerequisite Task::MasteringPerl 0 not found.
Warning: prerequisite Test::WWW::Accessibility 0 not found.
Warning: prerequisite Unicode::Support 0 not found.
Warning: prerequisite Unicode::Tussle 0 not found.
Warning: prerequisite WordPress::Grep 0 not found.
Warning: prerequisite github_creator 0 not found.
Warning: prerequisite perlbench 0 not found.
Warning: prerequisite scriptdist 0 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Bundle::BDFOY
Writing MYMETA.yml and MYMETA.json
BDFOY/Bundle-BDFOY-20160101.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz
---- Unsatisfied dependencies detected during ----
---- BDFOY/Bundle-BDFOY-20160101.tar.gz ----
PeGS::PDF [requires]
Pod::PseudoPod::PerlTricks [requires]
Net::SSH::Perl::WithSocks [requires]
github_creator [requires]
Net::SSH::Perl::ProxiedIPC [requires]
HTTP::Cookies::Omniweb [requires]
PPI::App::ppi_version::BDFOY [requires]
Pod::SpeakIt::MacSpeech [requires]
App::scriptdist [requires]
MyCPAN::App::DPAN [requires]
WordPress::Grep [requires]
HTTP::Cookies::iCab [requires]
Test::WWW::Accessibility [requires]
Psychic::Ninja [requires]
PerlPowerTools [requires]
Mac::iTerm::LaunchPad [requires]
perlbench [requires]
Mac::OSVersion [requires]
HTTP::Cookies::Safari [requires]
MyCPAN::Indexer [requires]
scriptdist [requires]
Unicode::Support [requires]
File::Fingerprint [requires]
Task::MasteringPerl [requires]
Mac::iPhoto::Shell [requires]
ReturnValue [requires]
Distribution::Cooker [requires]
Unicode::Tussle [requires]
MacOSX::Alias [requires]
Running test for module 'PeGS::PDF'
The module PeGS::PDF isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i PeGS::PDF'.
Running test for module 'Pod::PseudoPod::PerlTricks'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Pod-PseudoPod-PerlTricks-0.012.tar.gz ok
Pod-PseudoPod-PerlTricks-0.012/
Pod-PseudoPod-PerlTricks-0.012/Changes
Pod-PseudoPod-PerlTricks-0.012/examples/
Pod-PseudoPod-PerlTricks-0.012/lib/
Pod-PseudoPod-PerlTricks-0.012/LICENSE
Pod-PseudoPod-PerlTricks-0.012/Makefile.PL
Pod-PseudoPod-PerlTricks-0.012/MANIFEST
Pod-PseudoPod-PerlTricks-0.012/MANIFEST.SKIP
Pod-PseudoPod-PerlTricks-0.012/META.json
Pod-PseudoPod-PerlTricks-0.012/META.yml
Pod-PseudoPod-PerlTricks-0.012/perltricks.html
Pod-PseudoPod-PerlTricks-0.012/README.pod
Pod-PseudoPod-PerlTricks-0.012/t/
Pod-PseudoPod-PerlTricks-0.012/test-corpus/
Pod-PseudoPod-PerlTricks-0.012/xt/
Pod-PseudoPod-PerlTricks-0.012/xt/changes.t
Pod-PseudoPod-PerlTricks-0.012/test-corpus/test.html
Pod-PseudoPod-PerlTricks-0.012/test-corpus/test.html.debug
Pod-PseudoPod-PerlTricks-0.012/test-corpus/test.pod
Pod-PseudoPod-PerlTricks-0.012/t/convert_pod.t
Pod-PseudoPod-PerlTricks-0.012/t/lib/
Pod-PseudoPod-PerlTricks-0.012/t/load.t
Pod-PseudoPod-PerlTricks-0.012/t/perltricks.t
Pod-PseudoPod-PerlTricks-0.012/t/pod.t
Pod-PseudoPod-PerlTricks-0.012/t/pod_coverage.t
Pod-PseudoPod-PerlTricks-0.012/t/test_manifest
Pod-PseudoPod-PerlTricks-0.012/t/lib/transform_file.pl
Pod-PseudoPod-PerlTricks-0.012/lib/Pod/
Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/
Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/PerlTricks/
Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/PerlTricks.pm
Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/PerlTricks/HTML.pm
/bin/tar: Read 9216 bytes from -
Pod-PseudoPod-PerlTricks-0.012/examples/pod2perltricks
Configuring B/BD/BDFOY/Pod-PseudoPod-PerlTricks-0.012.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Perl v5.20.0 required--this is only v5.18.0, stopped at (eval 12) line 1.
Warning: No success on command[/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL]
BDFOY/Pod-PseudoPod-PerlTricks-0.012.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- NOT OK
Running test for module 'Net::SSH::Perl::WithSocks'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz ok
Net-SSH-Perl-WithSocks-0.02/
Net-SSH-Perl-WithSocks-0.02/Changes
Net-SSH-Perl-WithSocks-0.02/lib/
Net-SSH-Perl-WithSocks-0.02/LICENSE
Net-SSH-Perl-WithSocks-0.02/Makefile.PL
Net-SSH-Perl-WithSocks-0.02/MANIFEST
Net-SSH-Perl-WithSocks-0.02/META.yml
Net-SSH-Perl-WithSocks-0.02/MYMETA.yml
Net-SSH-Perl-WithSocks-0.02/README
Net-SSH-Perl-WithSocks-0.02/t/
Net-SSH-Perl-WithSocks-0.02/t/load.t
Net-SSH-Perl-WithSocks-0.02/t/pod.t
Net-SSH-Perl-WithSocks-0.02/t/pod_coverage.t
Net-SSH-Perl-WithSocks-0.02/t/prereq.t
Net-SSH-Perl-WithSocks-0.02/t/test_manifest
Net-SSH-Perl-WithSocks-0.02/lib/Net/
Net-SSH-Perl-WithSocks-0.02/lib/Net/SSH/
Net-SSH-Perl-WithSocks-0.02/lib/Net/SSH/Perl/
Net-SSH-Perl-WithSocks-0.02/lib/Net/SSH/Perl/WithSocks.pm
Configuring B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite Net::SSH::Perl 0 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Net::SSH::Perl::WithSocks
Writing MYMETA.yml and MYMETA.json
BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
---- Unsatisfied dependencies detected during ----
---- BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz ----
Net::SSH::Perl [requires]
Running test for module 'Net::SSH::Perl'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz ok
Net-SSH-Perl-1.42/
Net-SSH-Perl-1.42/t/
Net-SSH-Perl-1.42/t/05-cipher.t
Net-SSH-Perl-1.42/t/00-signature.t
Net-SSH-Perl-1.42/t/config
Net-SSH-Perl-1.42/t/psshd
Net-SSH-Perl-1.42/t/03-packet.t
Net-SSH-Perl-1.42/t/test-common.pl
Net-SSH-Perl-1.42/t/99-perlcritic.t
Net-SSH-Perl-1.42/t/06-auth.t
Net-SSH-Perl-1.42/t/04-config.t
Net-SSH-Perl-1.42/t/99-pod.t
Net-SSH-Perl-1.42/t/01-compile.t
Net-SSH-Perl-1.42/t/99-yaml.t
Net-SSH-Perl-1.42/t/99-spellcheck.t
Net-SSH-Perl-1.42/t/06-circular.t
Net-SSH-Perl-1.42/t/02-buffer.t
Net-SSH-Perl-1.42/.perlcriticrc
Net-SSH-Perl-1.42/lib/
Net-SSH-Perl-1.42/lib/Net/
Net-SSH-Perl-1.42/lib/Net/SSH/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/AuthMgr.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Buffer.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Agent.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/SSH2.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Authfile.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Hosts.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/SSH1Misc.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/RSA.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/SSH1MP.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Win32.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Term.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/SSH2MP.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Comp.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/DSA.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/RSA.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/RSA1.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/RC4.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/CFB.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/CBC.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/DES.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/DES3.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/IDEA.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/Blowfish.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Constants.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/SSH1.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Channel.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/Rhosts.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/RSA.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/PublicKey.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/KeyboardInteractive.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/KeyboardInt.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/ChallengeResponse.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/Password.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/Rhosts_RSA.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Comp/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Comp/Zlib.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle/SSH2.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle/SSH1.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Config.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Mac.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Subsystem/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Subsystem/Server.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Subsystem/Client.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/DH14.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/DH1.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/DH.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Packet.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/ChannelMgr.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth.pm
Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key.pm
Net-SSH-Perl-1.42/MANIFEST.SKIP
Net-SSH-Perl-1.42/Makefile.PL
Net-SSH-Perl-1.42/LICENSE
Net-SSH-Perl-1.42/META.yml
Net-SSH-Perl-1.42/eg/
Net-SSH-Perl-1.42/eg/pscp
Net-SSH-Perl-1.42/eg/cmd.pl
Net-SSH-Perl-1.42/eg/remoteinteract.pl
Net-SSH-Perl-1.42/eg/remoteinteract2.pl
Net-SSH-Perl-1.42/eg/pssh-keygen
Net-SSH-Perl-1.42/eg/pssh
Net-SSH-Perl-1.42/Changes
Net-SSH-Perl-1.42/MANIFEST
Net-SSH-Perl-1.42/README
Net-SSH-Perl-1.42/SIGNATURE
Net-SSH-Perl-1.42/ToDo
Configuring S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
This is Net::SSH::Perl.
As of version 1.00, Net::SSH::Perl supports both the SSH1 and
SSH2 protocols natively. The two protocols have different
module prerequisitives, so you need to decide which protocol(s)
you plan to use. If you use one or the other, only those modules
for your chosen protocol will be installed; if you choose both,
all of the supporting modules will be installed. Please choose
the protocols you'd like to use from the following list ("Both"
is the default).
[1] SSH1
[2] SSH2
[3] Both SSH1 and SSH2
Which protocol(s) do you plan to use? [3] 3
Some of the Net::SSH::Perl ciphers depend on a Crypt:: module from
CPAN. You may already have the necessary modules installed, in which
case you don't need to bother with this step. Otherwise you'll need
to install at least one cipher to use Net::SSH::Perl. Please choose
at least one from the following list (Crypt::IDEA is the default).
[1] IDEA
[2] DES
[3] DES3
[4] Blowfish
[5] RC4
Enter your choices, separated by spaces: [1] 1
Warning: prerequisite Crypt::DH 0.01 not found.
Checking for optional modules
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Net::SSH::Perl
Writing MYMETA.yml and MYMETA.json
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz
---- Unsatisfied dependencies detected during ----
---- SCHWIGON/Net-SSH-Perl-1.42.tar.gz ----
Crypt::DH [requires]
Running test for module 'Crypt::DH'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/M/MI/MITHALDU/Crypt-DH-0.07.tar.gz ok
./
./Crypt-DH-0.07/
./Crypt-DH-0.07/Changes
./Crypt-DH-0.07/inc/
./Crypt-DH-0.07/inc/Devel/
./Crypt-DH-0.07/inc/Devel/CheckLib.pm
./Crypt-DH-0.07/inc/Module/
./Crypt-DH-0.07/inc/Module/AutoInstall.pm
./Crypt-DH-0.07/inc/Module/Install/
./Crypt-DH-0.07/inc/Module/Install/AutoInstall.pm
./Crypt-DH-0.07/inc/Module/Install/Base.pm
./Crypt-DH-0.07/inc/Module/Install/Can.pm
./Crypt-DH-0.07/inc/Module/Install/CheckLib.pm
./Crypt-DH-0.07/inc/Module/Install/Fetch.pm
./Crypt-DH-0.07/inc/Module/Install/GithubMeta.pm
./Crypt-DH-0.07/inc/Module/Install/Include.pm
./Crypt-DH-0.07/inc/Module/Install/Makefile.pm
./Crypt-DH-0.07/inc/Module/Install/Metadata.pm
./Crypt-DH-0.07/inc/Module/Install/ReadmeFromPod.pm
./Crypt-DH-0.07/inc/Module/Install/Win32.pm
./Crypt-DH-0.07/inc/Module/Install/WriteAll.pm
./Crypt-DH-0.07/inc/Module/Install.pm
./Crypt-DH-0.07/inc/Test/
./Crypt-DH-0.07/inc/Test/More.pm
./Crypt-DH-0.07/lib/
./Crypt-DH-0.07/lib/Crypt/
./Crypt-DH-0.07/lib/Crypt/DH.pm
./Crypt-DH-0.07/Makefile.PL
./Crypt-DH-0.07/MANIFEST
./Crypt-DH-0.07/META.yml
./Crypt-DH-0.07/README
./Crypt-DH-0.07/t/
./Crypt-DH-0.07/t/00-compile.t
./Crypt-DH-0.07/t/01-dh.t
./Crypt-DH-0.07/ToDo
Configuring M/MI/MITHALDU/Crypt-DH-0.07.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
*** Module::AutoInstall version 1.06
*** Checking for Perl dependencies...
*** Since we're running under CPAN, I'll just let it take care
of the dependency's installation later.
[Core Features]
- Test::More ...loaded. (0.98 >= 0.47)
- Math::BigInt::GMP ...missing. (would need 1.24)
- Math::BigInt ...loaded. (1.999715 >= 1.60)
*** Module::AutoInstall configuration finished.
Warning: prerequisite Math::BigInt::GMP 1.24 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Crypt::DH
Writing MYMETA.yml and MYMETA.json
MITHALDU/Crypt-DH-0.07.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for M/MI/MITHALDU/Crypt-DH-0.07.tar.gz
---- Unsatisfied dependencies detected during ----
---- MITHALDU/Crypt-DH-0.07.tar.gz ----
Math::BigInt::GMP [requires]
Running test for module 'Math::BigInt::GMP'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/P/PJ/PJACKLAM/Math-BigInt-GMP-1.49.tar.gz ok
Math-BigInt-GMP-1.49/
Math-BigInt-GMP-1.49/BUGS
Math-BigInt-GMP-1.49/build/
Math-BigInt-GMP-1.49/build/leak.pl
Math-BigInt-GMP-1.49/build/leaktest
Math-BigInt-GMP-1.49/build/README
Math-BigInt-GMP-1.49/CHANGES
Math-BigInt-GMP-1.49/CREDITS
Math-BigInt-GMP-1.49/GMP.xs
Math-BigInt-GMP-1.49/inc/
Math-BigInt-GMP-1.49/inc/Devel/
Math-BigInt-GMP-1.49/inc/Devel/CheckLib.pm
Math-BigInt-GMP-1.49/INSTALL
Math-BigInt-GMP-1.49/lib/
Math-BigInt-GMP-1.49/lib/Math/
Math-BigInt-GMP-1.49/lib/Math/BigInt/
Math-BigInt-GMP-1.49/lib/Math/BigInt/GMP.pm
Math-BigInt-GMP-1.49/LICENSE
Math-BigInt-GMP-1.49/Makefile.PL
Math-BigInt-GMP-1.49/MANIFEST
Math-BigInt-GMP-1.49/MANIFEST.SKIP
Math-BigInt-GMP-1.49/META.json
Math-BigInt-GMP-1.49/META.yml
Math-BigInt-GMP-1.49/README
Math-BigInt-GMP-1.49/SIGNATURE
Math-BigInt-GMP-1.49/t/
Math-BigInt-GMP-1.49/t/00sig.t
Math-BigInt-GMP-1.49/t/01load.t
Math-BigInt-GMP-1.49/t/02pod.t
Math-BigInt-GMP-1.49/t/03podcov.t
Math-BigInt-GMP-1.49/t/bigfltpm.inc
Math-BigInt-GMP-1.49/t/bigfltpm.t
Math-BigInt-GMP-1.49/t/bigintg.t
Math-BigInt-GMP-1.49/t/bigintpm.inc
Math-BigInt-GMP-1.49/t/bigintpm.t
Math-BigInt-GMP-1.49/t/biglog.t
Math-BigInt-GMP-1.49/t/bigroot.t
Math-BigInt-GMP-1.49/t/mbi-from-big-scalar.t
Math-BigInt-GMP-1.49/t/storable.t
Math-BigInt-GMP-1.49/t/threads.t
Math-BigInt-GMP-1.49/TODO
Math-BigInt-GMP-1.49/typemap
Configuring P/PJ/PJACKLAM/Math-BigInt-GMP-1.49.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Math::BigInt::GMP
Writing MYMETA.yml and MYMETA.json
PJACKLAM/Math-BigInt-GMP-1.49.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for P/PJ/PJACKLAM/Math-BigInt-GMP-1.49.tar.gz
>>> make
cp lib/Math/BigInt/GMP.pm blib/lib/Math/BigInt/GMP.pm
Running Mkbootstrap for Math::BigInt::GMP ()
chmod 644 "GMP.bs"
"/home/fly1800/ap1800-297235/bin/perl-static" "/home/fly1800/cpanfly-5.18/var/megalib/ExtUtils/xsubpp" -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" -typemap "typemap" GMP.xs > GMP.xsc && mv GMP.xsc GMP.c
gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"1.49\" -DXS_VERSION=\"1.49\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" GMP.c
rm -f blib/arch/auto/Math/BigInt/GMP/GMP.so
LD_RUN_PATH="/usr/lib" gcc -shared -O2 -fstack-protector GMP.o -o blib/arch/auto/Math/BigInt/GMP/GMP.so \
-lgmp \
chmod 755 blib/arch/auto/Math/BigInt/GMP/GMP.so
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::Command::MM -e 'cp_nonempty' -- GMP.bs blib/arch/auto/Math/BigInt/GMP/GMP.bs 644
Manifying 1 pod document
PJACKLAM/Math-BigInt-GMP-1.49.tar.gz
make -- OK
Running make test
>>> make test TEST_VERBOSE=1
Running Mkbootstrap for Math::BigInt::GMP ()
chmod 644 "GMP.bs"
PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t
t/00sig.t ................ skipped: Set the environment variable TEST_SIGNATURE to enable this test.
#
# Testing with Perl 5.018000, /home/fly1800/ap1800-297235/bin/perl-static
#
# Version Module
# ------- ------
# 1.49 Math::BigInt::GMP
# 1.999715 Math::BigInt
#
t/01load.t ...............
1..2
ok 1 - use Math::BigInt::GMP;
ok 2 - use Math::BigInt;
ok
t/02pod.t ................
1..1
ok 1 - POD test for blib/lib/Math/BigInt/GMP.pm
ok
t/03podcov.t .............
1..1
ok 1 - All modules are covered
ok
t/bigfltpm.t .............
1..2414
ok 1 - Math::BigFloat->config()->{class}
ok 2 - Math::BigFloat->config()->{with}
ok 3 - $c = Math::BigFloat -> new("123.3"); $y = $c -> bsub("123")
ok 4 - 0.008 / 3 = 0.0027
ok 5 # skip skipping test which is not for this backend
ok 6 - Math::BigFloat->config()->{lib}
ok 7 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y);
ok 8 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y);
ok 9 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y);
ok 10 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y);
ok 11 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y);
ok 12 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y);
ok 13 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y);
ok 14 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y);
ok 15 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y);
ok 16 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y);
ok 17 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y);
ok 18 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y);
ok 19 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y);
ok 20 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y);
ok 21 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y);
ok 22 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y);
ok 23 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y);
ok 24 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y);
ok 25 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y);
ok 26 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y);
ok 27 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y);
ok 28 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y);
ok 29 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y);
ok 30 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y);
ok 31 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y);
ok 32 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y);
ok 33 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y);
ok 34 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y);
ok 35 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); Math::BigFloat::bgcd($x, $y);
ok 36 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); Math::BigFloat::bgcd($x, $y);
ok 37 - $x = Math::BigFloat->new("+3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y);
ok 38 - $x = Math::BigFloat->new("+3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y);
ok 39 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y);
ok 40 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y);
ok 41 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-2"); Math::BigFloat::bgcd($x, $y);
ok 42 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-2"); Math::BigFloat::bgcd($x, $y);
ok 43 - $x = Math::BigFloat->new("-144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y);
ok 44 - $x = Math::BigFloat->new("-144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y);
ok 45 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y);
ok 46 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y);
ok 47 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("60"); Math::BigFloat::bgcd($x, $y);
ok 48 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("60"); Math::BigFloat::bgcd($x, $y);
ok 49 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("625"); Math::BigFloat::bgcd($x, $y);
ok 50 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("625"); Math::BigFloat::bgcd($x, $y);
ok 51 - $x = Math::BigFloat->new("4096"); $y = Math::BigFloat->new("81"); Math::BigFloat::bgcd($x, $y);
ok 52 - $x = Math::BigFloat->new("4096"); $y = Math::BigFloat->new("81"); Math::BigFloat::bgcd($x, $y);
ok 53 - $x = Math::BigFloat->new("1034"); $y = Math::BigFloat->new("804"); Math::BigFloat::bgcd($x, $y);
ok 54 - $x = Math::BigFloat->new("1034"); $y = Math::BigFloat->new("804"); Math::BigFloat::bgcd($x, $y);
ok 55 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("56"); Math::BigFloat::bgcd($x, $y, $z);
ok 56 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("56"); Math::BigFloat::bgcd($x, $y, $z);
ok 57 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("54"); Math::BigFloat::bgcd($x, $y, $z);
ok 58 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("54"); Math::BigFloat::bgcd($x, $y, $z);
ok 59 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y);
ok 60 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y);
ok 61 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y);
ok 62 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y);
ok 63 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y);
ok 64 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y);
ok 65 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y);
ok 66 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y);
ok 67 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y);
ok 68 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y);
ok 69 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::blcm($x, $y);
ok 70 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::blcm($x, $y);
ok 71 - $x = Math::BigFloat->new("+27"); $y = Math::BigFloat->new("+90"); Math::BigFloat::blcm($x, $y);
ok 72 - $x = Math::BigFloat->new("+27"); $y = Math::BigFloat->new("+90"); Math::BigFloat::blcm($x, $y);
ok 73 - $x = Math::BigFloat->new("+1034"); $y = Math::BigFloat->new("+804"); Math::BigFloat::blcm($x, $y);
ok 74 - $x = Math::BigFloat->new("+1034"); $y = Math::BigFloat->new("+804"); Math::BigFloat::blcm($x, $y);
ok 75 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("10"); $x->bcos($y);
ok 76 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("10"); $x->bcos($y);
ok 77 - $x = Math::BigFloat->new("2.4"); $y = Math::BigFloat->new("12"); $x->bcos($y);
ok 78 - $x = Math::BigFloat->new("2.4"); $y = Math::BigFloat->new("12"); $x->bcos($y);
ok 79 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bcos($y);
ok 80 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bcos($y);
ok 81 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bcos($y);
ok 82 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bcos($y);
ok 83 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bcos($y);
ok 84 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bcos($y);
ok 85 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("12"); $x->bcos($y);
ok 86 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("12"); $x->bcos($y);
ok 87 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bsin($y);
ok 88 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bsin($y);
ok 89 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bsin($y);
ok 90 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bsin($y);
ok 91 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bsin($y);
ok 92 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bsin($y);
ok 93 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("12"); $x->bsin($y);
ok 94 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("12"); $x->bsin($y);
ok 95 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("13"); $x->bsin($y);
ok 96 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("13"); $x->bsin($y);
ok 97 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->bsin($y);
ok 98 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->bsin($y);
ok 99 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("12"); $x->bsin($y);
ok 100 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("12"); $x->bsin($y);
ok 101 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("10"); $x->batan($y);
ok 102 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("10"); $x->batan($y);
ok 103 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 104 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 105 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 106 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 107 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 108 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 109 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->batan($y);
ok 110 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->batan($y);
ok 111 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 112 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 113 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->batan($y);
ok 114 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->batan($y);
ok 115 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 116 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 117 - $x = Math::BigFloat->new("0.5"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 118 - $x = Math::BigFloat->new("0.5"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 119 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 120 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 121 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 122 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 123 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 124 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 125 - $x = Math::BigFloat->new("2.0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 126 - $x = Math::BigFloat->new("2.0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 127 - $x = Math::BigFloat->new("2.5"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 128 - $x = Math::BigFloat->new("2.5"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 129 - $x = Math::BigFloat->new("3.0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 130 - $x = Math::BigFloat->new("3.0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 131 - $x = Math::BigFloat->new("6.0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 132 - $x = Math::BigFloat->new("6.0"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 133 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 134 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 135 - $x = Math::BigFloat->new("24"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 136 - $x = Math::BigFloat->new("24"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 137 - $x = Math::BigFloat->new("48"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 138 - $x = Math::BigFloat->new("48"); $y = Math::BigFloat->new("14"); $x->batan($y);
ok 139 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z);
ok 140 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z);
ok 141 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z);
ok 142 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z);
ok 143 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z);
ok 144 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z);
ok 145 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 146 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 147 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 148 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 149 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 150 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 151 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 152 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 153 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 154 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 155 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 156 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 157 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 158 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 159 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 160 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 161 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 162 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 163 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 164 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 165 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 166 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 167 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 168 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 169 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 170 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 171 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 172 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 173 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 174 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 175 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 176 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 177 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 178 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 179 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 180 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 181 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 182 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 183 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 184 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 185 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 186 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 187 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 188 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 189 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 190 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 191 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 192 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 193 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 194 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 195 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("13"); $x->batan2($y, $z);
ok 196 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("13"); $x->batan2($y, $z);
ok 197 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 198 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 199 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 200 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 201 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 202 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 203 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("11"); $x->batan2($y, $z);
ok 204 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("11"); $x->batan2($y, $z);
ok 205 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z);
ok 206 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z);
ok 207 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z);
ok 208 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z);
ok 209 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 210 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 211 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 212 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 213 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 214 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 215 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 216 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 217 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("24"); $x->batan2($y, $z);
ok 218 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("24"); $x->batan2($y, $z);
ok 219 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 220 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 221 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 222 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z);
ok 223 - $x = Math::BigFloat->new("150"); Math::BigFloat->bpi($x);
ok 224 - $x = Math::BigFloat->new("150"); Math::BigFloat->bpi($x);
ok 225 - $x = Math::BigFloat->new("77"); Math::BigFloat->bpi($x);
ok 226 - $x = Math::BigFloat->new("77"); Math::BigFloat->bpi($x);
ok 227 - $x = Math::BigFloat->new("+0"); Math::BigFloat->bpi($x);
ok 228 - $x = Math::BigFloat->new("+0"); Math::BigFloat->bpi($x);
ok 229 - $x = Math::BigFloat->new("11"); Math::BigFloat->bpi($x);
ok 230 - $x = Math::BigFloat->new("11"); Math::BigFloat->bpi($x);
ok 231 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("10"); $x->bnok($y);
ok 232 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("10"); $x->bnok($y);
ok 233 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $x->bnok($y);
ok 234 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $x->bnok($y);
ok 235 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x->bnok($y);
ok 236 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x->bnok($y);
ok 237 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x->bnok($y);
ok 238 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x->bnok($y);
ok 239 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x->bnok($y);
ok 240 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x->bnok($y);
ok 241 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x->bnok($y);
ok 242 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x->bnok($y);
ok 243 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("3"); $x->bnok($y);
ok 244 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("3"); $x->bnok($y);
ok 245 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-2"); $x->bnok($y);
ok 246 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-2"); $x->bnok($y);
ok 247 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("3"); $x->bnok($y);
ok 248 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("3"); $x->bnok($y);
ok 249 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("6"); $x->bnok($y);
ok 250 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("6"); $x->bnok($y);
ok 251 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("90"); $x->bnok($y);
ok 252 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("90"); $x->bnok($y);
ok 253 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("95"); $x->bnok($y);
ok 254 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("95"); $x->bnok($y);
ok 255 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $x->bnok($y);
ok 256 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $x->bnok($y);
ok 257 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("0"); $x->bnok($y);
ok 258 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("0"); $x->bnok($y);
ok 259 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x->bnok($y);
ok 260 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x->bnok($y);
ok 261 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 262 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 263 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 264 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 265 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 266 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 267 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(-1); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 268 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(-1); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 269 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(0); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 270 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(0); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 271 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 272 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 273 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 274 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 275 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 276 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 277 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(2); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 278 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(2); $Math::BigFloat::div_scale = 40; $x->blog($y);
ok 279 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 280 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 281 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 282 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 283 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 20; $x->blog();
ok 284 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 20; $x->blog();
ok 285 - $x = Math::BigFloat->new("123"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 286 - $x = Math::BigFloat->new("123"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 287 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 288 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 289 - $x = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 290 - $x = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 291 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 292 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 293 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 294 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 295 - $x = Math::BigFloat->new("3.1415"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 296 - $x = Math::BigFloat->new("3.1415"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 297 - $x = Math::BigFloat->new("12345"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 298 - $x = Math::BigFloat->new("12345"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 299 - $x = Math::BigFloat->new("0.001"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 300 - $x = Math::BigFloat->new("0.001"); $Math::BigFloat::div_scale = 15; $x->blog();
ok 301 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new(10); $Math::BigFloat::div_scale = 15; $x->blog($y);
ok 302 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new(10); $Math::BigFloat::div_scale = 15; $x->blog($y);
ok 303 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new(100); $Math::BigFloat::div_scale = 15; $x->blog($y);
ok 304 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new(100); $Math::BigFloat::div_scale = 15; $x->blog($y);
ok 305 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 306 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog();
ok 307 - $x = Math::BigFloat->new("NaNbrsft"); $y = Math::BigFloat->new("2"); $x >> $y;
ok 308 - $x = Math::BigFloat->new("NaNbrsft"); $y = Math::BigFloat->new("2"); $x >> $y;
ok 309 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $x >> $y;
ok 310 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $x >> $y;
ok 311 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 312 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 313 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 314 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 315 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 316 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 317 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 318 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("1"); $x >> $y;
ok 319 - $x = Math::BigFloat->new("32"); $y = Math::BigFloat->new("3"); $x >> $y;
ok 320 - $x = Math::BigFloat->new("32"); $y = Math::BigFloat->new("3"); $x >> $y;
ok 321 - $x = Math::BigFloat->new("NaNblsft"); $y = Math::BigFloat->new("0"); $x << $y;
ok 322 - $x = Math::BigFloat->new("NaNblsft"); $y = Math::BigFloat->new("0"); $x << $y;
ok 323 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x << $y;
ok 324 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x << $y;
ok 325 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x << $y;
ok 326 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x << $y;
ok 327 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("3"); $x << $y;
ok 328 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("3"); $x << $y;
ok 329 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x << $y;
ok 330 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x << $y;
ok 331 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("5"); $x << $y;
ok 332 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("5"); $x << $y;
ok 333 - $x = Math::BigFloat->new("1"); $x;
ok 334 - $x = Math::BigFloat->new("1"); $x;
ok 335 - $x = Math::BigFloat->new("-0"); $x;
ok 336 - $x = Math::BigFloat->new("-0"); $x;
ok 337 - $x = Math::BigFloat->new("bnormNaN"); $x;
ok 338 - $x = Math::BigFloat->new("bnormNaN"); $x;
ok 339 - $x = Math::BigFloat->new("+inf"); $x;
ok 340 - $x = Math::BigFloat->new("+inf"); $x;
ok 341 - $x = Math::BigFloat->new("-inf"); $x;
ok 342 - $x = Math::BigFloat->new("-inf"); $x;
ok 343 - $x = Math::BigFloat->new("123"); $x;
ok 344 - $x = Math::BigFloat->new("123"); $x;
ok 345 - $x = Math::BigFloat->new("-123.4567"); $x;
ok 346 - $x = Math::BigFloat->new("-123.4567"); $x;
ok 347 - $x = Math::BigFloat->new("1__2"); $x;
ok 348 - $x = Math::BigFloat->new("1__2"); $x;
ok 349 - $x = Math::BigFloat->new("1E1__2"); $x;
ok 350 - $x = Math::BigFloat->new("1E1__2"); $x;
ok 351 - $x = Math::BigFloat->new("11__2E2"); $x;
ok 352 - $x = Math::BigFloat->new("11__2E2"); $x;
ok 353 - $x = Math::BigFloat->new(".2E-3."); $x;
ok 354 - $x = Math::BigFloat->new(".2E-3."); $x;
ok 355 - $x = Math::BigFloat->new("1e3e4"); $x;
ok 356 - $x = Math::BigFloat->new("1e3e4"); $x;
ok 357 - $x = Math::BigFloat->new(".2E2"); $x;
ok 358 - $x = Math::BigFloat->new(".2E2"); $x;
ok 359 - $x = Math::BigFloat->new("1.E3"); $x;
ok 360 - $x = Math::BigFloat->new("1.E3"); $x;
ok 361 - $x = Math::BigFloat->new("0e0"); $x;
ok 362 - $x = Math::BigFloat->new("0e0"); $x;
ok 363 - $x = Math::BigFloat->new("+0e0"); $x;
ok 364 - $x = Math::BigFloat->new("+0e0"); $x;
ok 365 - $x = Math::BigFloat->new("+0e+0"); $x;
ok 366 - $x = Math::BigFloat->new("+0e+0"); $x;
ok 367 - $x = Math::BigFloat->new("-0e+0"); $x;
ok 368 - $x = Math::BigFloat->new("-0e+0"); $x;
ok 369 - $x = Math::BigFloat->new("0e-0"); $x;
ok 370 - $x = Math::BigFloat->new("0e-0"); $x;
ok 371 - $x = Math::BigFloat->new("-0e-0"); $x;
ok 372 - $x = Math::BigFloat->new("-0e-0"); $x;
ok 373 - $x = Math::BigFloat->new("+0e-0"); $x;
ok 374 - $x = Math::BigFloat->new("+0e-0"); $x;
ok 375 - $x = Math::BigFloat->new("000"); $x;
ok 376 - $x = Math::BigFloat->new("000"); $x;
ok 377 - $x = Math::BigFloat->new("00e2"); $x;
ok 378 - $x = Math::BigFloat->new("00e2"); $x;
ok 379 - $x = Math::BigFloat->new("00e02"); $x;
ok 380 - $x = Math::BigFloat->new("00e02"); $x;
ok 381 - $x = Math::BigFloat->new("000e002"); $x;
ok 382 - $x = Math::BigFloat->new("000e002"); $x;
ok 383 - $x = Math::BigFloat->new("000e1230"); $x;
ok 384 - $x = Math::BigFloat->new("000e1230"); $x;
ok 385 - $x = Math::BigFloat->new("00e-3"); $x;
ok 386 - $x = Math::BigFloat->new("00e-3"); $x;
ok 387 - $x = Math::BigFloat->new("00e+3"); $x;
ok 388 - $x = Math::BigFloat->new("00e+3"); $x;
ok 389 - $x = Math::BigFloat->new("00e-03"); $x;
ok 390 - $x = Math::BigFloat->new("00e-03"); $x;
ok 391 - $x = Math::BigFloat->new("00e+03"); $x;
ok 392 - $x = Math::BigFloat->new("00e+03"); $x;
ok 393 - $x = Math::BigFloat->new("-000"); $x;
ok 394 - $x = Math::BigFloat->new("-000"); $x;
ok 395 - $x = Math::BigFloat->new("-00e2"); $x;
ok 396 - $x = Math::BigFloat->new("-00e2"); $x;
ok 397 - $x = Math::BigFloat->new("-00e02"); $x;
ok 398 - $x = Math::BigFloat->new("-00e02"); $x;
ok 399 - $x = Math::BigFloat->new("-000e002"); $x;
ok 400 - $x = Math::BigFloat->new("-000e002"); $x;
ok 401 - $x = Math::BigFloat->new("-000e1230"); $x;
ok 402 - $x = Math::BigFloat->new("-000e1230"); $x;
ok 403 - $x = Math::BigFloat->new("-00e-3"); $x;
ok 404 - $x = Math::BigFloat->new("-00e-3"); $x;
ok 405 - $x = Math::BigFloat->new("-00e+3"); $x;
ok 406 - $x = Math::BigFloat->new("-00e+3"); $x;
ok 407 - $x = Math::BigFloat->new("-00e-03"); $x;
ok 408 - $x = Math::BigFloat->new("-00e-03"); $x;
ok 409 - $x = Math::BigFloat->new("-00e+03"); $x;
ok 410 - $x = Math::BigFloat->new("-00e+03"); $x;
ok 411 - $x = Math::BigFloat->new("0"); $x->as_number();
ok 412 - $x = Math::BigFloat->new("1"); $x->as_number();
ok 413 - $x = Math::BigFloat->new("1.2"); $x->as_number();
ok 414 - $x = Math::BigFloat->new("2.345"); $x->as_number();
ok 415 - $x = Math::BigFloat->new("-2"); $x->as_number();
ok 416 - $x = Math::BigFloat->new("-123.456"); $x->as_number();
ok 417 - $x = Math::BigFloat->new("-200"); $x->as_number();
ok 418 - $x = Math::BigFloat->new("-inf"); $x->as_number();
ok 419 - $x = Math::BigFloat->new("inf"); $x->as_number();
ok 420 - $x = Math::BigFloat->new("NaN"); $x->as_number();
ok 421 - $x = Math::BigFloat->new("71243225429896467497217836789578596379"); $x->as_number();
ok 422 - $x = Math::BigFloat->new("0.000641"); $x->as_number();
ok 423 - $x = Math::BigFloat->new("0.0006412"); $x->as_number();
ok 424 - $x = Math::BigFloat->new("0.00064123"); $x->as_number();
ok 425 - $x = Math::BigFloat->new("0.000641234"); $x->as_number();
ok 426 - $x = Math::BigFloat->new("0.0006412345"); $x->as_number();
ok 427 - $x = Math::BigFloat->new("0.00064123456"); $x->as_number();
ok 428 - $x = Math::BigFloat->new("0.000641234567"); $x->as_number();
ok 429 - $x = Math::BigFloat->new("0.0006412345678"); $x->as_number();
ok 430 - $x = Math::BigFloat->new("0.00064123456789"); $x->as_number();
ok 431 - $x = Math::BigFloat->new("0.1"); $x->as_number();
ok 432 - $x = Math::BigFloat->new("0.01"); $x->as_number();
ok 433 - $x = Math::BigFloat->new("0.001"); $x->as_number();
ok 434 - $x = Math::BigFloat->new("0.0001"); $x->as_number();
ok 435 - $x = Math::BigFloat->new("0.00001"); $x->as_number();
ok 436 - $x = Math::BigFloat->new("0.000001"); $x->as_number();
ok 437 - $x = Math::BigFloat->new("0.0000001"); $x->as_number();
ok 438 - $x = Math::BigFloat->new("0.00000001"); $x->as_number();
ok 439 - $x = Math::BigFloat->new("0.000000001"); $x->as_number();
ok 440 - $x = Math::BigFloat->new("0.0000000001"); $x->as_number();
ok 441 - $x = Math::BigFloat->new("0.00000000001"); $x->as_number();
ok 442 - $x = Math::BigFloat->new("0.12345"); $x->as_number();
ok 443 - $x = Math::BigFloat->new("0.123456"); $x->as_number();
ok 444 - $x = Math::BigFloat->new("0.1234567"); $x->as_number();
ok 445 - $x = Math::BigFloat->new("0.12345678"); $x->as_number();
ok 446 - $x = Math::BigFloat->new("0.123456789"); $x->as_number();
ok 447 - $x = Math::BigFloat->new("1"); $x->binf("+");
ok 448 - $x = Math::BigFloat->new("1"); $x->binf("+");
ok 449 - $x = Math::BigFloat->new("2"); $x->binf("-");
ok 450 - $x = Math::BigFloat->new("2"); $x->binf("-");
ok 451 - $x = Math::BigFloat->new("3"); $x->binf("abc");
ok 452 - $x = Math::BigFloat->new("3"); $x->binf("abc");
ok 453 - $x = Math::BigFloat->new("+inf"); $x->as_hex();
ok 454 - $x = Math::BigFloat->new("-inf"); $x->as_hex();
ok 455 - $x = Math::BigFloat->new("hexNaN"); $x->as_hex();
ok 456 - $x = Math::BigFloat->new("0"); $x->as_hex();
ok 457 - $x = Math::BigFloat->new("5"); $x->as_hex();
ok 458 - $x = Math::BigFloat->new("-5"); $x->as_hex();
ok 459 - $x = Math::BigFloat->new("+inf"); $x->as_bin();
ok 460 - $x = Math::BigFloat->new("-inf"); $x->as_bin();
ok 461 - $x = Math::BigFloat->new("hexNaN"); $x->as_bin();
ok 462 - $x = Math::BigFloat->new("0"); $x->as_bin();
ok 463 - $x = Math::BigFloat->new("5"); $x->as_bin();
ok 464 - $x = Math::BigFloat->new("-5"); $x->as_bin();
ok 465 - $x = Math::BigFloat->new("0"); $x->numify();
ok 466 - $x = Math::BigFloat->new("+1"); $x->numify();
ok 467 - $x = Math::BigFloat->new("1234"); $x->numify();
ok 468 - $x = Math::BigFloat->new("-5"); $x->numify();
ok 469 - $x = Math::BigFloat->new("100"); $x->numify();
ok 470 - $x = Math::BigFloat->new("-100"); $x->numify();
ok 471 - $x = Math::BigFloat->new("abc"); $x->bnan();
ok 472 - $x = Math::BigFloat->new("abc"); $x->bnan();
ok 473 - $x = Math::BigFloat->new("2"); $x->bnan();
ok 474 - $x = Math::BigFloat->new("2"); $x->bnan();
ok 475 - $x = Math::BigFloat->new("-2"); $x->bnan();
ok 476 - $x = Math::BigFloat->new("-2"); $x->bnan();
ok 477 - $x = Math::BigFloat->new("0"); $x->bnan();
ok 478 - $x = Math::BigFloat->new("0"); $x->bnan();
ok 479 - $x = Math::BigFloat->new("2"); $x->bone("+");
ok 480 - $x = Math::BigFloat->new("2"); $x->bone("+");
ok 481 - $x = Math::BigFloat->new("-2"); $x->bone("-");
ok 482 - $x = Math::BigFloat->new("-2"); $x->bone("-");
ok 483 - $x = Math::BigFloat->new("-2"); $x->bone("+");
ok 484 - $x = Math::BigFloat->new("-2"); $x->bone("+");
ok 485 - $x = Math::BigFloat->new("2"); $x->bone("-");
ok 486 - $x = Math::BigFloat->new("2"); $x->bone("-");
ok 487 - $x = Math::BigFloat->new("0"); $x->bone("");
ok 488 - $x = Math::BigFloat->new("0"); $x->bone("");
ok 489 - $x = Math::BigFloat->new("-2"); $x->bone("");
ok 490 - $x = Math::BigFloat->new("-2"); $x->bone("");
ok 491 - $x = Math::BigFloat->new("abc"); $x->bone("");
ok 492 - $x = Math::BigFloat->new("abc"); $x->bone("");
ok 493 - $x = Math::BigFloat->new("2"); $x->bone("abc");
ok 494 - $x = Math::BigFloat->new("2"); $x->bone("abc");
ok 495 - $x = Math::BigFloat->new("+inf"); $x->bsstr();
ok 496 - $x = Math::BigFloat->new("-inf"); $x->bsstr();
ok 497 - $x = Math::BigFloat->new("abcfsstr"); $x->bsstr();
ok 498 - $x = Math::BigFloat->new("-abcfsstr"); $x->bsstr();
ok 499 - $x = Math::BigFloat->new("1234.567"); $x->bsstr();
ok 500 - $x = Math::BigFloat->new("123"); $x->bsstr();
ok 501 - $x = Math::BigFloat->new("-5"); $x->bsstr();
ok 502 - $x = Math::BigFloat->new("-100"); $x->bsstr();
ok 503 - $x = Math::BigFloat->new("+inf"); $x->accuracy(); $x->precision(); $x->bstr();
ok 504 - $x = Math::BigFloat->new("-inf"); $x->accuracy(); $x->precision(); $x->bstr();
ok 505 - $x = Math::BigFloat->new("abcfstr"); $x->accuracy(); $x->precision(); $x->bstr();
ok 506 - $x = Math::BigFloat->new("1234.567"); $x->accuracy(9); $x->precision(); $x->bstr();
ok 507 - $x = Math::BigFloat->new("1234.567"); $x->accuracy(); $x->precision(-6); $x->bstr();
ok 508 - $x = Math::BigFloat->new("12345"); $x->accuracy(5); $x->precision(); $x->bstr();
ok 509 - $x = Math::BigFloat->new("0.001234"); $x->accuracy(6); $x->precision(); $x->bstr();
ok 510 - $x = Math::BigFloat->new("0.001234"); $x->accuracy(); $x->precision(-8); $x->bstr();
ok 511 - $x = Math::BigFloat->new("0"); $x->accuracy(4); $x->precision(); $x->bstr();
ok 512 - $x = Math::BigFloat->new("0"); $x->accuracy(); $x->precision(-4); $x->bstr();
ok 513 - $x = Math::BigFloat->new("inf"); $x;
ok 514 - $x = Math::BigFloat->new("inf"); $x;
ok 515 - $x = Math::BigFloat->new("+inf"); $x;
ok 516 - $x = Math::BigFloat->new("+inf"); $x;
ok 517 - $x = Math::BigFloat->new("-inf"); $x;
ok 518 - $x = Math::BigFloat->new("-inf"); $x;
ok 519 - $x = Math::BigFloat->new("+infinity"); $x;
ok 520 - $x = Math::BigFloat->new("+infinity"); $x;
ok 521 - $x = Math::BigFloat->new("+-inf"); $x;
ok 522 - $x = Math::BigFloat->new("+-inf"); $x;
ok 523 - $x = Math::BigFloat->new("abc"); $x;
ok 524 - $x = Math::BigFloat->new("abc"); $x;
ok 525 - $x = Math::BigFloat->new(" 1 a"); $x;
ok 526 - $x = Math::BigFloat->new(" 1 a"); $x;
ok 527 - $x = Math::BigFloat->new("1bcd2"); $x;
ok 528 - $x = Math::BigFloat->new("1bcd2"); $x;
ok 529 - $x = Math::BigFloat->new("11111b"); $x;
ok 530 - $x = Math::BigFloat->new("11111b"); $x;
ok 531 - $x = Math::BigFloat->new("+1z"); $x;
ok 532 - $x = Math::BigFloat->new("+1z"); $x;
ok 533 - $x = Math::BigFloat->new("-1z"); $x;
ok 534 - $x = Math::BigFloat->new("-1z"); $x;
ok 535 - $x = Math::BigFloat->new("0e999"); $x;
ok 536 - $x = Math::BigFloat->new("0e999"); $x;
ok 537 - $x = Math::BigFloat->new("0e-999"); $x;
ok 538 - $x = Math::BigFloat->new("0e-999"); $x;
ok 539 - $x = Math::BigFloat->new("-0e999"); $x;
ok 540 - $x = Math::BigFloat->new("-0e999"); $x;
ok 541 - $x = Math::BigFloat->new("-0e-999"); $x;
ok 542 - $x = Math::BigFloat->new("-0e-999"); $x;
ok 543 - $x = Math::BigFloat->new("0"); $x;
ok 544 - $x = Math::BigFloat->new("0"); $x;
ok 545 - $x = Math::BigFloat->new("+0"); $x;
ok 546 - $x = Math::BigFloat->new("+0"); $x;
ok 547 - $x = Math::BigFloat->new("+00"); $x;
ok 548 - $x = Math::BigFloat->new("+00"); $x;
ok 549 - $x = Math::BigFloat->new("+0_0_0"); $x;
ok 550 - $x = Math::BigFloat->new("+0_0_0"); $x;
ok 551 - $x = Math::BigFloat->new("000000_0000000_00000"); $x;
ok 552 - $x = Math::BigFloat->new("000000_0000000_00000"); $x;
ok 553 - $x = Math::BigFloat->new("-0"); $x;
ok 554 - $x = Math::BigFloat->new("-0"); $x;
ok 555 - $x = Math::BigFloat->new("-0000"); $x;
ok 556 - $x = Math::BigFloat->new("-0000"); $x;
ok 557 - $x = Math::BigFloat->new("+1"); $x;
ok 558 - $x = Math::BigFloat->new("+1"); $x;
ok 559 - $x = Math::BigFloat->new("+01"); $x;
ok 560 - $x = Math::BigFloat->new("+01"); $x;
ok 561 - $x = Math::BigFloat->new("+001"); $x;
ok 562 - $x = Math::BigFloat->new("+001"); $x;
ok 563 - $x = Math::BigFloat->new("+00000100000"); $x;
ok 564 - $x = Math::BigFloat->new("+00000100000"); $x;
ok 565 - $x = Math::BigFloat->new("123456789"); $x;
ok 566 - $x = Math::BigFloat->new("123456789"); $x;
ok 567 - $x = Math::BigFloat->new("-1"); $x;
ok 568 - $x = Math::BigFloat->new("-1"); $x;
ok 569 - $x = Math::BigFloat->new("-01"); $x;
ok 570 - $x = Math::BigFloat->new("-01"); $x;
ok 571 - $x = Math::BigFloat->new("-001"); $x;
ok 572 - $x = Math::BigFloat->new("-001"); $x;
ok 573 - $x = Math::BigFloat->new("-123456789"); $x;
ok 574 - $x = Math::BigFloat->new("-123456789"); $x;
ok 575 - $x = Math::BigFloat->new("-00000100000"); $x;
ok 576 - $x = Math::BigFloat->new("-00000100000"); $x;
ok 577 - $x = Math::BigFloat->new("123.456a"); $x;
ok 578 - $x = Math::BigFloat->new("123.456a"); $x;
ok 579 - $x = Math::BigFloat->new("123.456"); $x;
ok 580 - $x = Math::BigFloat->new("123.456"); $x;
ok 581 - $x = Math::BigFloat->new("0.01"); $x;
ok 582 - $x = Math::BigFloat->new("0.01"); $x;
ok 583 - $x = Math::BigFloat->new(".002"); $x;
ok 584 - $x = Math::BigFloat->new(".002"); $x;
ok 585 - $x = Math::BigFloat->new("+.2"); $x;
ok 586 - $x = Math::BigFloat->new("+.2"); $x;
ok 587 - $x = Math::BigFloat->new("-0.0003"); $x;
ok 588 - $x = Math::BigFloat->new("-0.0003"); $x;
ok 589 - $x = Math::BigFloat->new("-.0000000004"); $x;
ok 590 - $x = Math::BigFloat->new("-.0000000004"); $x;
ok 591 - $x = Math::BigFloat->new("123456E2"); $x;
ok 592 - $x = Math::BigFloat->new("123456E2"); $x;
ok 593 - $x = Math::BigFloat->new("123456E-2"); $x;
ok 594 - $x = Math::BigFloat->new("123456E-2"); $x;
ok 595 - $x = Math::BigFloat->new("-123456E2"); $x;
ok 596 - $x = Math::BigFloat->new("-123456E2"); $x;
ok 597 - $x = Math::BigFloat->new("-123456E-2"); $x;
ok 598 - $x = Math::BigFloat->new("-123456E-2"); $x;
ok 599 - $x = Math::BigFloat->new("1e1"); $x;
ok 600 - $x = Math::BigFloat->new("1e1"); $x;
ok 601 - $x = Math::BigFloat->new("2e-11"); $x;
ok 602 - $x = Math::BigFloat->new("2e-11"); $x;
ok 603 - $x = Math::BigFloat->new(" .02e-1"); $x;
ok 604 - $x = Math::BigFloat->new(" .02e-1"); $x;
ok 605 - $x = Math::BigFloat->new(" 000001"); $x;
ok 606 - $x = Math::BigFloat->new(" 000001"); $x;
ok 607 - $x = Math::BigFloat->new(" -00001"); $x;
ok 608 - $x = Math::BigFloat->new(" -00001"); $x;
ok 609 - $x = Math::BigFloat->new(" -1"); $x;
ok 610 - $x = Math::BigFloat->new(" -1"); $x;
ok 611 - $x = Math::BigFloat->new(" 000.01"); $x;
ok 612 - $x = Math::BigFloat->new(" 000.01"); $x;
ok 613 - $x = Math::BigFloat->new(" -000.0023"); $x;
ok 614 - $x = Math::BigFloat->new(" -000.0023"); $x;
ok 615 - $x = Math::BigFloat->new(" 1.1e1"); $x;
ok 616 - $x = Math::BigFloat->new(" 1.1e1"); $x;
ok 617 - $x = Math::BigFloat->new("-3e111"); $x;
ok 618 - $x = Math::BigFloat->new("-3e111"); $x;
ok 619 - $x = Math::BigFloat->new("-4e-1111"); $x;
ok 620 - $x = Math::BigFloat->new("-4e-1111"); $x;
ok 621 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x ** $y;
ok 622 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x ** $y;
ok 623 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 624 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 625 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-1"); $x ** $y;
ok 626 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-1"); $x ** $y;
ok 627 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 628 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 629 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-21"); $x ** $y;
ok 630 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-21"); $x ** $y;
ok 631 - $x = Math::BigFloat->new("-21"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 632 - $x = Math::BigFloat->new("-21"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 633 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("21"); $x ** $y;
ok 634 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("21"); $x ** $y;
ok 635 - $x = Math::BigFloat->new("21"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 636 - $x = Math::BigFloat->new("21"); $y = Math::BigFloat->new("NaN"); $x ** $y;
ok 637 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x ** $y;
ok 638 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x ** $y;
ok 639 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x ** $y;
ok 640 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x ** $y;
ok 641 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("9"); $x ** $y;
ok 642 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("9"); $x ** $y;
ok 643 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-2"); $x ** $y;
ok 644 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-2"); $x ** $y;
ok 645 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 646 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 647 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 648 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 649 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 650 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 651 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 652 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 653 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 654 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 655 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 656 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 657 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-2"); $x ** $y;
ok 658 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-2"); $x ** $y;
ok 659 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-3"); $x ** $y;
ok 660 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-3"); $x ** $y;
ok 661 - $x = Math::BigFloat->new("128"); $y = Math::BigFloat->new("-2"); $x ** $y;
ok 662 - $x = Math::BigFloat->new("128"); $y = Math::BigFloat->new("-2"); $x ** $y;
ok 663 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("123.456"); $x ** $y;
ok 664 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("123.456"); $x ** $y;
ok 665 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("abc"); $x ** $y;
ok 666 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("abc"); $x ** $y;
ok 667 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.45"); $x ** $y;
ok 668 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.45"); $x ** $y;
ok 669 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.45"); $x ** $y;
ok 670 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.45"); $x ** $y;
ok 671 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y;
ok 672 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y;
ok 673 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y;
ok 674 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y;
ok 675 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 676 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 677 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 678 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 679 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("4"); $x ** $y;
ok 680 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("4"); $x ** $y;
ok 681 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("5"); $x ** $y;
ok 682 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("5"); $x ** $y;
ok 683 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 684 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("2"); $x ** $y;
ok 685 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 686 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("3"); $x ** $y;
ok 687 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $x ** $y;
ok 688 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $x ** $y;
ok 689 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("5"); $x ** $y;
ok 690 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("5"); $x ** $y;
ok 691 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0.5"); $x ** $y;
ok 692 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0.5"); $x ** $y;
ok 693 - $x = Math::BigFloat->new("bnegNaN"); $x->bneg();
ok 694 - $x = Math::BigFloat->new("bnegNaN"); $x->bneg();
ok 695 - $x = Math::BigFloat->new("+inf"); $x->bneg();
ok 696 - $x = Math::BigFloat->new("+inf"); $x->bneg();
ok 697 - $x = Math::BigFloat->new("-inf"); $x->bneg();
ok 698 - $x = Math::BigFloat->new("-inf"); $x->bneg();
ok 699 - $x = Math::BigFloat->new("+0"); $x->bneg();
ok 700 - $x = Math::BigFloat->new("+0"); $x->bneg();
ok 701 - $x = Math::BigFloat->new("+1"); $x->bneg();
ok 702 - $x = Math::BigFloat->new("+1"); $x->bneg();
ok 703 - $x = Math::BigFloat->new("-1"); $x->bneg();
ok 704 - $x = Math::BigFloat->new("-1"); $x->bneg();
ok 705 - $x = Math::BigFloat->new("+123456789"); $x->bneg();
ok 706 - $x = Math::BigFloat->new("+123456789"); $x->bneg();
ok 707 - $x = Math::BigFloat->new("-123456789"); $x->bneg();
ok 708 - $x = Math::BigFloat->new("-123456789"); $x->bneg();
ok 709 - $x = Math::BigFloat->new("+123.456789"); $x->bneg();
ok 710 - $x = Math::BigFloat->new("+123.456789"); $x->bneg();
ok 711 - $x = Math::BigFloat->new("-123456.789"); $x->bneg();
ok 712 - $x = Math::BigFloat->new("-123456.789"); $x->bneg();
ok 713 - $x = Math::BigFloat->new("babsNaN"); $x->babs();
ok 714 - $x = Math::BigFloat->new("babsNaN"); $x->babs();
ok 715 - $x = Math::BigFloat->new("+inf"); $x->babs();
ok 716 - $x = Math::BigFloat->new("+inf"); $x->babs();
ok 717 - $x = Math::BigFloat->new("-inf"); $x->babs();
ok 718 - $x = Math::BigFloat->new("-inf"); $x->babs();
ok 719 - $x = Math::BigFloat->new("+0"); $x->babs();
ok 720 - $x = Math::BigFloat->new("+0"); $x->babs();
ok 721 - $x = Math::BigFloat->new("+1"); $x->babs();
ok 722 - $x = Math::BigFloat->new("+1"); $x->babs();
ok 723 - $x = Math::BigFloat->new("-1"); $x->babs();
ok 724 - $x = Math::BigFloat->new("-1"); $x->babs();
ok 725 - $x = Math::BigFloat->new("+123456789"); $x->babs();
ok 726 - $x = Math::BigFloat->new("+123456789"); $x->babs();
ok 727 - $x = Math::BigFloat->new("-123456789"); $x->babs();
ok 728 - $x = Math::BigFloat->new("-123456789"); $x->babs();
ok 729 - $x = Math::BigFloat->new("+123.456789"); $x->babs();
ok 730 - $x = Math::BigFloat->new("+123.456789"); $x->babs();
ok 731 - $x = Math::BigFloat->new("-123456.789"); $x->babs();
ok 732 - $x = Math::BigFloat->new("-123456.789"); $x->babs();
ok 733 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 734 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 735 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 736 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 737 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 738 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 739 - $x = Math::BigFloat->new("NaNfround"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 740 - $x = Math::BigFloat->new("NaNfround"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 741 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 742 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 743 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 744 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 745 - $x = Math::BigFloat->new("+10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 746 - $x = Math::BigFloat->new("+10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 747 - $x = Math::BigFloat->new("-10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 748 - $x = Math::BigFloat->new("-10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5);
ok 749 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9);
ok 750 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9);
ok 751 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9);
ok 752 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9);
ok 753 - $x = Math::BigFloat->new("+101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6);
ok 754 - $x = Math::BigFloat->new("+101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6);
ok 755 - $x = Math::BigFloat->new("-101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6);
ok 756 - $x = Math::BigFloat->new("-101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6);
ok 757 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 758 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 759 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 760 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 761 - $x = Math::BigFloat->new("+20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 762 - $x = Math::BigFloat->new("+20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 763 - $x = Math::BigFloat->new("-20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 764 - $x = Math::BigFloat->new("-20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5);
ok 765 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9);
ok 766 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9);
ok 767 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9);
ok 768 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9);
ok 769 - $x = Math::BigFloat->new("+201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6);
ok 770 - $x = Math::BigFloat->new("+201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6);
ok 771 - $x = Math::BigFloat->new("-201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6);
ok 772 - $x = Math::BigFloat->new("-201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6);
ok 773 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 774 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 775 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 776 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 777 - $x = Math::BigFloat->new("+30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 778 - $x = Math::BigFloat->new("+30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 779 - $x = Math::BigFloat->new("-30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 780 - $x = Math::BigFloat->new("-30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5);
ok 781 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9);
ok 782 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9);
ok 783 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9);
ok 784 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9);
ok 785 - $x = Math::BigFloat->new("+301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6);
ok 786 - $x = Math::BigFloat->new("+301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6);
ok 787 - $x = Math::BigFloat->new("-301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6);
ok 788 - $x = Math::BigFloat->new("-301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6);
ok 789 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 790 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 791 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 792 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 793 - $x = Math::BigFloat->new("+40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 794 - $x = Math::BigFloat->new("+40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 795 - $x = Math::BigFloat->new("-40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 796 - $x = Math::BigFloat->new("-40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5);
ok 797 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9);
ok 798 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9);
ok 799 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9);
ok 800 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9);
ok 801 - $x = Math::BigFloat->new("+401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6);
ok 802 - $x = Math::BigFloat->new("+401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6);
ok 803 - $x = Math::BigFloat->new("-401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6);
ok 804 - $x = Math::BigFloat->new("-401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6);
ok 805 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 806 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 807 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 808 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 809 - $x = Math::BigFloat->new("+50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 810 - $x = Math::BigFloat->new("+50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 811 - $x = Math::BigFloat->new("-50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 812 - $x = Math::BigFloat->new("-50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5);
ok 813 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9);
ok 814 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9);
ok 815 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9);
ok 816 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9);
ok 817 - $x = Math::BigFloat->new("+501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6);
ok 818 - $x = Math::BigFloat->new("+501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6);
ok 819 - $x = Math::BigFloat->new("-501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6);
ok 820 - $x = Math::BigFloat->new("-501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6);
ok 821 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 822 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 823 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 824 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 825 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9);
ok 826 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9);
ok 827 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9);
ok 828 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9);
ok 829 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6);
ok 830 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6);
ok 831 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6);
ok 832 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6);
ok 833 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 834 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 835 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 836 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5);
ok 837 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 838 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 839 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 840 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 841 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 842 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 843 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 844 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 845 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9);
ok 846 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9);
ok 847 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9);
ok 848 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9);
ok 849 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 850 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 851 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 852 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 853 - $x = Math::BigFloat->new("+601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 854 - $x = Math::BigFloat->new("+601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 855 - $x = Math::BigFloat->new("-601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 856 - $x = Math::BigFloat->new("-601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 857 - $x = Math::BigFloat->new("+601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 858 - $x = Math::BigFloat->new("+601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 859 - $x = Math::BigFloat->new("-601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 860 - $x = Math::BigFloat->new("-601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 861 - $x = Math::BigFloat->new("+601234300"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 862 - $x = Math::BigFloat->new("+601234300"); $Math::BigFloat::round_mode = "common"; $x->bround(6);
ok 863 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 864 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 865 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 866 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5);
ok 867 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 868 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 869 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 870 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 871 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 872 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 873 - $x = Math::BigFloat->new("NaNffround"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 874 - $x = Math::BigFloat->new("NaNffround"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5);
ok 875 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 876 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 877 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 878 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 879 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 880 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 881 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 882 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 883 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 884 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 885 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 886 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 887 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 888 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 889 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 890 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 891 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 892 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 893 - $x = Math::BigFloat->new("-1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 894 - $x = Math::BigFloat->new("-1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 895 - $x = Math::BigFloat->new("+1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 896 - $x = Math::BigFloat->new("+1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 897 - $x = Math::BigFloat->new("-1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 898 - $x = Math::BigFloat->new("-1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 899 - $x = Math::BigFloat->new("+1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 900 - $x = Math::BigFloat->new("+1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 901 - $x = Math::BigFloat->new("-1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 902 - $x = Math::BigFloat->new("-1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 903 - $x = Math::BigFloat->new("+1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 904 - $x = Math::BigFloat->new("+1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 905 - $x = Math::BigFloat->new("-1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 906 - $x = Math::BigFloat->new("-1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 907 - $x = Math::BigFloat->new("-0.0061234567890"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 908 - $x = Math::BigFloat->new("-0.0061234567890"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 909 - $x = Math::BigFloat->new("-0.0061"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 910 - $x = Math::BigFloat->new("-0.0061"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 911 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 912 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 913 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 914 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 915 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 916 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1);
ok 917 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 918 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 919 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 920 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2);
ok 921 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 922 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 923 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3);
ok 924 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-4);
ok 925 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-5);
ok 926 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 927 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 928 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 929 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 930 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 931 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 932 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 933 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0);
ok 934 - $x = Math::BigFloat->new("+2.23"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 935 - $x = Math::BigFloat->new("-2.23"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 936 - $x = Math::BigFloat->new("+2.27"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 937 - $x = Math::BigFloat->new("-2.27"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 938 - $x = Math::BigFloat->new("+2.25"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 939 - $x = Math::BigFloat->new("-2.25"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 940 - $x = Math::BigFloat->new("+2.35"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 941 - $x = Math::BigFloat->new("-2.35"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 942 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 943 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1);
ok 944 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-2);
ok 945 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-3);
ok 946 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-4);
ok 947 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-5);
ok 948 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 949 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 950 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 951 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 952 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 953 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 954 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 955 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0);
ok 956 - $x = Math::BigFloat->new("+3.23"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 957 - $x = Math::BigFloat->new("-3.23"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 958 - $x = Math::BigFloat->new("+3.27"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 959 - $x = Math::BigFloat->new("-3.27"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 960 - $x = Math::BigFloat->new("+3.25"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 961 - $x = Math::BigFloat->new("-3.25"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 962 - $x = Math::BigFloat->new("+3.35"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 963 - $x = Math::BigFloat->new("-3.35"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 964 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 965 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1);
ok 966 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-2);
ok 967 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-3);
ok 968 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-4);
ok 969 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-5);
ok 970 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 971 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 972 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 973 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 974 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 975 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 976 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 977 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0);
ok 978 - $x = Math::BigFloat->new("+4.23"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 979 - $x = Math::BigFloat->new("-4.23"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 980 - $x = Math::BigFloat->new("+4.27"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 981 - $x = Math::BigFloat->new("-4.27"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 982 - $x = Math::BigFloat->new("+4.25"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 983 - $x = Math::BigFloat->new("-4.25"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 984 - $x = Math::BigFloat->new("+4.35"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 985 - $x = Math::BigFloat->new("-4.35"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 986 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 987 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1);
ok 988 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-2);
ok 989 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-3);
ok 990 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-4);
ok 991 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-5);
ok 992 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 993 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 994 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 995 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 996 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 997 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 998 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 999 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0);
ok 1000 - $x = Math::BigFloat->new("+5.23"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1001 - $x = Math::BigFloat->new("-5.23"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1002 - $x = Math::BigFloat->new("+5.27"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1003 - $x = Math::BigFloat->new("-5.27"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1004 - $x = Math::BigFloat->new("+5.25"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1005 - $x = Math::BigFloat->new("-5.25"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1006 - $x = Math::BigFloat->new("+5.35"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1007 - $x = Math::BigFloat->new("-5.35"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1008 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1009 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1);
ok 1010 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-2);
ok 1011 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-3);
ok 1012 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-4);
ok 1013 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-5);
ok 1014 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1015 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1016 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1017 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1018 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1019 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1020 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1021 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0);
ok 1022 - $x = Math::BigFloat->new("+6.23"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1023 - $x = Math::BigFloat->new("-6.23"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1024 - $x = Math::BigFloat->new("+6.27"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1025 - $x = Math::BigFloat->new("-6.27"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1026 - $x = Math::BigFloat->new("+6.25"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1027 - $x = Math::BigFloat->new("-6.25"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1028 - $x = Math::BigFloat->new("+6.35"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1029 - $x = Math::BigFloat->new("-6.35"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1030 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1031 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1);
ok 1032 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-2);
ok 1033 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-3);
ok 1034 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-4);
ok 1035 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-5);
ok 1036 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1037 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1038 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1039 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1040 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1041 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1042 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1043 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "even"; $x->bfround(0);
ok 1044 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-3);
ok 1045 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-3);
ok 1046 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-4);
ok 1047 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-4);
ok 1048 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-5);
ok 1049 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-5);
ok 1050 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-6);
ok 1051 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-6);
ok 1052 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-7);
ok 1053 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-7);
ok 1054 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-8);
ok 1055 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-8);
ok 1056 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-9);
ok 1057 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-9);
ok 1058 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-12);
ok 1059 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-12);
ok 1060 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("bcmpNaN"); $x->bcmp($y);
ok 1061 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("+0"); $x->bcmp($y);
ok 1062 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("bcmpNaN"); $x->bcmp($y);
ok 1063 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x->bcmp($y);
ok 1064 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x->bcmp($y);
ok 1065 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x->bcmp($y);
ok 1066 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x->bcmp($y);
ok 1067 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x->bcmp($y);
ok 1068 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x->bcmp($y);
ok 1069 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x->bcmp($y);
ok 1070 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x->bcmp($y);
ok 1071 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x->bcmp($y);
ok 1072 - $x = Math::BigFloat->new("-1.1"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1073 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1.1"); $x->bcmp($y);
ok 1074 - $x = Math::BigFloat->new("+1.1"); $y = Math::BigFloat->new("+0"); $x->bcmp($y);
ok 1075 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1.1"); $x->bcmp($y);
ok 1076 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+123"); $x->bcmp($y);
ok 1077 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+12"); $x->bcmp($y);
ok 1078 - $x = Math::BigFloat->new("+12"); $y = Math::BigFloat->new("+123"); $x->bcmp($y);
ok 1079 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-123"); $x->bcmp($y);
ok 1080 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-12"); $x->bcmp($y);
ok 1081 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("-123"); $x->bcmp($y);
ok 1082 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+124"); $x->bcmp($y);
ok 1083 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+123"); $x->bcmp($y);
ok 1084 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-124"); $x->bcmp($y);
ok 1085 - $x = Math::BigFloat->new("-124"); $y = Math::BigFloat->new("-123"); $x->bcmp($y);
ok 1086 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.01"); $x->bcmp($y);
ok 1087 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y);
ok 1088 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001"); $x->bcmp($y);
ok 1089 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.1"); $x->bcmp($y);
ok 1090 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1091 - $x = Math::BigFloat->new("0.00001"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1092 - $x = Math::BigFloat->new("-0.0001"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1093 - $x = Math::BigFloat->new("-0.1"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1094 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001234"); $x->bcmp($y);
ok 1095 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001234"); $x->bcmp($y);
ok 1096 - $x = Math::BigFloat->new("0.0001234"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1097 - $x = Math::BigFloat->new("-0.0001234"); $y = Math::BigFloat->new("0"); $x->bcmp($y);
ok 1098 - $x = Math::BigFloat->new("0.0001"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y);
ok 1099 - $x = Math::BigFloat->new("0.0005"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y);
ok 1100 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y);
ok 1101 - $x = Math::BigFloat->new("0.001"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y);
ok 1102 - $x = Math::BigFloat->new("0.000001"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y);
ok 1103 - $x = Math::BigFloat->new("0.00000123"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y);
ok 1104 - $x = Math::BigFloat->new("0.00512"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y);
ok 1105 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.000112"); $x->bcmp($y);
ok 1106 - $x = Math::BigFloat->new("0.00123"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y);
ok 1107 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("2"); $x->bcmp($y);
ok 1108 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.5"); $x->bcmp($y);
ok 1109 - $x = Math::BigFloat->new("1.54321"); $y = Math::BigFloat->new("234"); $x->bcmp($y);
ok 1110 - $x = Math::BigFloat->new("234"); $y = Math::BigFloat->new("1.54321"); $x->bcmp($y);
ok 1111 - $x = Math::BigFloat->new("1e1234567890987654321"); $y = Math::BigFloat->new("1e1234567890987654320"); $x->bcmp($y);
ok 1112 - $x = Math::BigFloat->new("1e-1234567890987654321"); $y = Math::BigFloat->new("1e-1234567890987654320"); $x->bcmp($y);
ok 1113 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5432112345"); $x->bcmp($y);
ok 1114 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("5432112345"); $x->bcmp($y);
ok 1115 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5432112345"); $x->bcmp($y);
ok 1116 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-5432112345"); $x->bcmp($y);
ok 1117 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("54321.12345"); $x->bcmp($y);
ok 1118 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("54321.12345"); $x->bcmp($y);
ok 1119 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bcmp($y);
ok 1120 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bcmp($y);
ok 1121 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x->bcmp($y);
ok 1122 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x->bcmp($y);
ok 1123 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x->bcmp($y);
ok 1124 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x->bcmp($y);
ok 1125 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaN"); $x->bcmp($y);
ok 1126 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $x->bcmp($y);
ok 1127 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaN"); $x->bcmp($y);
ok 1128 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-inf"); $x->bcmp($y);
ok 1129 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("bcmpNaN"); $x->bacmp($y);
ok 1130 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("+0"); $x->bacmp($y);
ok 1131 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("bcmpNaN"); $x->bacmp($y);
ok 1132 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x->bacmp($y);
ok 1133 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x->bacmp($y);
ok 1134 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x->bacmp($y);
ok 1135 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x->bacmp($y);
ok 1136 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x->bacmp($y);
ok 1137 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x->bacmp($y);
ok 1138 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x->bacmp($y);
ok 1139 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x->bacmp($y);
ok 1140 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x->bacmp($y);
ok 1141 - $x = Math::BigFloat->new("-1.1"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1142 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1.1"); $x->bacmp($y);
ok 1143 - $x = Math::BigFloat->new("+1.1"); $y = Math::BigFloat->new("+0"); $x->bacmp($y);
ok 1144 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1.1"); $x->bacmp($y);
ok 1145 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+123"); $x->bacmp($y);
ok 1146 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+12"); $x->bacmp($y);
ok 1147 - $x = Math::BigFloat->new("+12"); $y = Math::BigFloat->new("+123"); $x->bacmp($y);
ok 1148 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-123"); $x->bacmp($y);
ok 1149 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-12"); $x->bacmp($y);
ok 1150 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("-123"); $x->bacmp($y);
ok 1151 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+124"); $x->bacmp($y);
ok 1152 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+123"); $x->bacmp($y);
ok 1153 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-124"); $x->bacmp($y);
ok 1154 - $x = Math::BigFloat->new("-124"); $y = Math::BigFloat->new("-123"); $x->bacmp($y);
ok 1155 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.01"); $x->bacmp($y);
ok 1156 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y);
ok 1157 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001"); $x->bacmp($y);
ok 1158 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.1"); $x->bacmp($y);
ok 1159 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1160 - $x = Math::BigFloat->new("0.00001"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1161 - $x = Math::BigFloat->new("-0.0001"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1162 - $x = Math::BigFloat->new("-0.1"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1163 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001234"); $x->bacmp($y);
ok 1164 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001234"); $x->bacmp($y);
ok 1165 - $x = Math::BigFloat->new("0.0001234"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1166 - $x = Math::BigFloat->new("-0.0001234"); $y = Math::BigFloat->new("0"); $x->bacmp($y);
ok 1167 - $x = Math::BigFloat->new("0.0001"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y);
ok 1168 - $x = Math::BigFloat->new("0.0005"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y);
ok 1169 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y);
ok 1170 - $x = Math::BigFloat->new("0.001"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y);
ok 1171 - $x = Math::BigFloat->new("0.000001"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y);
ok 1172 - $x = Math::BigFloat->new("0.00000123"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y);
ok 1173 - $x = Math::BigFloat->new("0.00512"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y);
ok 1174 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.000112"); $x->bacmp($y);
ok 1175 - $x = Math::BigFloat->new("0.00123"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y);
ok 1176 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("2"); $x->bacmp($y);
ok 1177 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.5"); $x->bacmp($y);
ok 1178 - $x = Math::BigFloat->new("1.54321"); $y = Math::BigFloat->new("234"); $x->bacmp($y);
ok 1179 - $x = Math::BigFloat->new("234"); $y = Math::BigFloat->new("1.54321"); $x->bacmp($y);
ok 1180 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5432112345"); $x->bacmp($y);
ok 1181 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("5432112345"); $x->bacmp($y);
ok 1182 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5432112345"); $x->bacmp($y);
ok 1183 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-5432112345"); $x->bacmp($y);
ok 1184 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("54321.12345"); $x->bacmp($y);
ok 1185 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("54321.12345"); $x->bacmp($y);
ok 1186 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bacmp($y);
ok 1187 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bacmp($y);
ok 1188 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x->bacmp($y);
ok 1189 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y);
ok 1190 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y);
ok 1191 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x->bacmp($y);
ok 1192 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("inf"); $x->bacmp($y);
ok 1193 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("inf"); $x->bacmp($y);
ok 1194 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y);
ok 1195 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y);
ok 1196 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("bacmpNaN"); $x->bacmp($y);
ok 1197 - $x = Math::BigFloat->new("bacmpNaN"); $y = Math::BigFloat->new("inf"); $x->bacmp($y);
ok 1198 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("bacmpNaN"); $x->bacmp($y);
ok 1199 - $x = Math::BigFloat->new("bacmpNaN"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y);
ok 1200 - $x = Math::BigFloat->new("bdecNaN"); --$x;
ok 1201 - $x = Math::BigFloat->new("bdecNaN"); --$x;
ok 1202 - $x = Math::BigFloat->new("+inf"); --$x;
ok 1203 - $x = Math::BigFloat->new("+inf"); --$x;
ok 1204 - $x = Math::BigFloat->new("-inf"); --$x;
ok 1205 - $x = Math::BigFloat->new("-inf"); --$x;
ok 1206 - $x = Math::BigFloat->new("+0"); --$x;
ok 1207 - $x = Math::BigFloat->new("+0"); --$x;
ok 1208 - $x = Math::BigFloat->new("+1"); --$x;
ok 1209 - $x = Math::BigFloat->new("+1"); --$x;
ok 1210 - $x = Math::BigFloat->new("-1"); --$x;
ok 1211 - $x = Math::BigFloat->new("-1"); --$x;
ok 1212 - $x = Math::BigFloat->new("1.23"); --$x;
ok 1213 - $x = Math::BigFloat->new("1.23"); --$x;
ok 1214 - $x = Math::BigFloat->new("-1.23"); --$x;
ok 1215 - $x = Math::BigFloat->new("-1.23"); --$x;
ok 1216 - $x = Math::BigFloat->new("100"); --$x;
ok 1217 - $x = Math::BigFloat->new("100"); --$x;
ok 1218 - $x = Math::BigFloat->new("101"); --$x;
ok 1219 - $x = Math::BigFloat->new("101"); --$x;
ok 1220 - $x = Math::BigFloat->new("-100"); --$x;
ok 1221 - $x = Math::BigFloat->new("-100"); --$x;
ok 1222 - $x = Math::BigFloat->new("-99"); --$x;
ok 1223 - $x = Math::BigFloat->new("-99"); --$x;
ok 1224 - $x = Math::BigFloat->new("-98"); --$x;
ok 1225 - $x = Math::BigFloat->new("-98"); --$x;
ok 1226 - $x = Math::BigFloat->new("99"); --$x;
ok 1227 - $x = Math::BigFloat->new("99"); --$x;
ok 1228 - $x = Math::BigFloat->new("bincNaN"); ++$x;
ok 1229 - $x = Math::BigFloat->new("bincNaN"); ++$x;
ok 1230 - $x = Math::BigFloat->new("+inf"); ++$x;
ok 1231 - $x = Math::BigFloat->new("+inf"); ++$x;
ok 1232 - $x = Math::BigFloat->new("-inf"); ++$x;
ok 1233 - $x = Math::BigFloat->new("-inf"); ++$x;
ok 1234 - $x = Math::BigFloat->new("+0"); ++$x;
ok 1235 - $x = Math::BigFloat->new("+0"); ++$x;
ok 1236 - $x = Math::BigFloat->new("+1"); ++$x;
ok 1237 - $x = Math::BigFloat->new("+1"); ++$x;
ok 1238 - $x = Math::BigFloat->new("-1"); ++$x;
ok 1239 - $x = Math::BigFloat->new("-1"); ++$x;
ok 1240 - $x = Math::BigFloat->new("1.23"); ++$x;
ok 1241 - $x = Math::BigFloat->new("1.23"); ++$x;
ok 1242 - $x = Math::BigFloat->new("-1.23"); ++$x;
ok 1243 - $x = Math::BigFloat->new("-1.23"); ++$x;
ok 1244 - $x = Math::BigFloat->new("100"); ++$x;
ok 1245 - $x = Math::BigFloat->new("100"); ++$x;
ok 1246 - $x = Math::BigFloat->new("-100"); ++$x;
ok 1247 - $x = Math::BigFloat->new("-100"); ++$x;
ok 1248 - $x = Math::BigFloat->new("-99"); ++$x;
ok 1249 - $x = Math::BigFloat->new("-99"); ++$x;
ok 1250 - $x = Math::BigFloat->new("-101"); ++$x;
ok 1251 - $x = Math::BigFloat->new("-101"); ++$x;
ok 1252 - $x = Math::BigFloat->new("99"); ++$x;
ok 1253 - $x = Math::BigFloat->new("99"); ++$x;
ok 1254 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x + $y;
ok 1255 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x + $y;
ok 1256 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1257 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1258 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x + $y;
ok 1259 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x + $y;
ok 1260 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x + $y;
ok 1261 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x + $y;
ok 1262 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1263 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1264 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1265 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1266 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x + $y;
ok 1267 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x + $y;
ok 1268 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1269 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1270 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1271 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y;
ok 1272 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y;
ok 1273 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y;
ok 1274 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y;
ok 1275 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y;
ok 1276 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1277 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1278 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1279 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1280 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1281 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1282 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1283 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1284 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1285 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x + $y;
ok 1286 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1287 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1288 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1289 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1290 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1291 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1292 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1293 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1294 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1295 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1296 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1297 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1298 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1299 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1300 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1301 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1302 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1303 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1304 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1305 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1306 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1307 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1308 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1309 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1310 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1311 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1312 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1313 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1314 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1315 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x + $y;
ok 1316 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1317 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1318 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1319 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1320 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1321 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1322 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1323 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1324 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1325 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1326 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1327 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1328 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1329 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1330 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1331 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1332 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1333 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1334 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1335 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x + $y;
ok 1336 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y;
ok 1337 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y;
ok 1338 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y;
ok 1339 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y;
ok 1340 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y;
ok 1341 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y;
ok 1342 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y;
ok 1343 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y;
ok 1344 - $x = Math::BigFloat->new("0.001234"); $y = Math::BigFloat->new("0.0001234"); $x + $y;
ok 1345 - $x = Math::BigFloat->new("0.001234"); $y = Math::BigFloat->new("0.0001234"); $x + $y;
ok 1346 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x - $y;
ok 1347 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x - $y;
ok 1348 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1349 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1350 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x - $y;
ok 1351 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x - $y;
ok 1352 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x - $y;
ok 1353 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x - $y;
ok 1354 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1355 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1356 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1357 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1358 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x - $y;
ok 1359 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x - $y;
ok 1360 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1361 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1362 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1363 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y;
ok 1364 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y;
ok 1365 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y;
ok 1366 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y;
ok 1367 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y;
ok 1368 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1369 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1370 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1371 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1372 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1373 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1374 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1375 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1376 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1377 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x - $y;
ok 1378 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1379 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1380 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1381 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1382 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1383 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1384 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1385 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1386 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1387 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1388 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1389 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1390 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1391 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1392 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1393 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1394 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1395 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1396 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1397 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1398 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1399 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1400 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1401 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1402 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1403 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1404 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1405 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1406 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1407 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x - $y;
ok 1408 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1409 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1410 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1411 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1412 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1413 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1414 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1415 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1416 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1417 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1418 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1419 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1420 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1421 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1422 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1423 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1424 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1425 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1426 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1427 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x - $y;
ok 1428 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y;
ok 1429 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y;
ok 1430 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y;
ok 1431 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y;
ok 1432 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y;
ok 1433 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y;
ok 1434 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y;
ok 1435 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y;
ok 1436 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1437 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1438 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1439 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1440 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1441 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1442 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("abc"); $x->bmuladd($y, $z);
ok 1443 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("abc"); $x->bmuladd($y, $z);
ok 1444 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1445 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1446 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1447 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1448 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1449 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1450 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1451 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1452 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1453 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1454 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1455 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1456 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1457 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1458 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1459 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1460 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1461 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1462 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1463 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1464 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1465 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1466 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1467 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1468 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1469 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1470 - $x = Math::BigFloat->new("123456789123456789"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1471 - $x = Math::BigFloat->new("123456789123456789"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1472 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("123456789123456789"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1473 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("123456789123456789"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1474 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1475 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1476 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1477 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1478 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1479 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1480 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1481 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1482 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1483 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1484 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1485 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1486 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1487 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1488 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1489 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1490 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1491 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1492 - $x = Math::BigFloat->new("111"); $y = Math::BigFloat->new("111"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1493 - $x = Math::BigFloat->new("111"); $y = Math::BigFloat->new("111"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1494 - $x = Math::BigFloat->new("10101"); $y = Math::BigFloat->new("10101"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1495 - $x = Math::BigFloat->new("10101"); $y = Math::BigFloat->new("10101"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1496 - $x = Math::BigFloat->new("1001001"); $y = Math::BigFloat->new("1001001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1497 - $x = Math::BigFloat->new("1001001"); $y = Math::BigFloat->new("1001001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1498 - $x = Math::BigFloat->new("100010001"); $y = Math::BigFloat->new("100010001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1499 - $x = Math::BigFloat->new("100010001"); $y = Math::BigFloat->new("100010001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1500 - $x = Math::BigFloat->new("10000100001"); $y = Math::BigFloat->new("10000100001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1501 - $x = Math::BigFloat->new("10000100001"); $y = Math::BigFloat->new("10000100001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1502 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1503 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1504 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1505 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1506 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1507 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1508 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1509 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1510 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1511 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1512 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1513 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1514 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1515 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1516 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1517 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1518 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1519 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z);
ok 1520 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1521 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1522 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1523 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1524 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1525 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1526 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1527 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1528 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1529 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1530 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1531 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1532 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1533 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1534 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1535 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1536 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1537 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z);
ok 1538 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1539 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1540 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1541 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1542 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1543 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1544 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1545 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z);
ok 1546 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z);
ok 1547 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z);
ok 1548 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z);
ok 1549 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z);
ok 1550 - $x = Math::BigFloat->new("9999999999999999999"); $y = Math::BigFloat->new("10000000000000000000"); $z = Math::BigFloat->new("1234567890"); $x->bmuladd($y, $z);
ok 1551 - $x = Math::BigFloat->new("9999999999999999999"); $y = Math::BigFloat->new("10000000000000000000"); $z = Math::BigFloat->new("1234567890"); $x->bmuladd($y, $z);
ok 1552 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("5.7"); $z = Math::BigFloat->new("8.9"); $x->bmuladd($y, $z);
ok 1553 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("5.7"); $z = Math::BigFloat->new("8.9"); $x->bmuladd($y, $z);
ok 1554 - $x = Math::BigFloat->new("-3.2"); $y = Math::BigFloat->new("5.197"); $z = Math::BigFloat->new("6.05"); $x->bmuladd($y, $z);
ok 1555 - $x = Math::BigFloat->new("-3.2"); $y = Math::BigFloat->new("5.197"); $z = Math::BigFloat->new("6.05"); $x->bmuladd($y, $z);
ok 1556 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("8"); $x->bmodpow($y, $z);
ok 1557 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("8"); $x->bmodpow($y, $z);
ok 1558 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z);
ok 1559 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z);
ok 1560 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z);
ok 1561 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z);
ok 1562 - $x = Math::BigFloat->new("77777"); $y = Math::BigFloat->new("777"); $z = Math::BigFloat->new("123456789"); $x->bmodpow($y, $z);
ok 1563 - $x = Math::BigFloat->new("77777"); $y = Math::BigFloat->new("777"); $z = Math::BigFloat->new("123456789"); $x->bmodpow($y, $z);
ok 1564 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("6.2"); $z = Math::BigFloat->new("5.2"); $x->bmodpow($y, $z);
ok 1565 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("6.2"); $z = Math::BigFloat->new("5.2"); $x->bmodpow($y, $z);
ok 1566 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x * $y;
ok 1567 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x * $y;
ok 1568 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1569 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1570 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x * $y;
ok 1571 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x * $y;
ok 1572 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y;
ok 1573 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y;
ok 1574 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y;
ok 1575 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y;
ok 1576 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1577 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1578 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1579 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1580 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1581 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1582 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1583 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1584 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1585 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1586 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1587 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1588 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.34"); $x * $y;
ok 1589 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.34"); $x * $y;
ok 1590 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.34"); $x * $y;
ok 1591 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.34"); $x * $y;
ok 1592 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.34"); $x * $y;
ok 1593 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.34"); $x * $y;
ok 1594 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.34"); $x * $y;
ok 1595 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.34"); $x * $y;
ok 1596 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1597 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1598 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1599 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("+inf"); $x * $y;
ok 1600 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1601 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1602 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1603 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("-inf"); $x * $y;
ok 1604 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1605 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1606 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x * $y;
ok 1607 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x * $y;
ok 1608 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1609 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1610 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x * $y;
ok 1611 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x * $y;
ok 1612 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1613 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1614 - $x = Math::BigFloat->new("+123456789123456789"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1615 - $x = Math::BigFloat->new("+123456789123456789"); $y = Math::BigFloat->new("+0"); $x * $y;
ok 1616 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+123456789123456789"); $x * $y;
ok 1617 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+123456789123456789"); $x * $y;
ok 1618 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x * $y;
ok 1619 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x * $y;
ok 1620 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x * $y;
ok 1621 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x * $y;
ok 1622 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x * $y;
ok 1623 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x * $y;
ok 1624 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x * $y;
ok 1625 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x * $y;
ok 1626 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $x * $y;
ok 1627 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $x * $y;
ok 1628 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $x * $y;
ok 1629 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $x * $y;
ok 1630 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $x * $y;
ok 1631 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $x * $y;
ok 1632 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x * $y;
ok 1633 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x * $y;
ok 1634 - $x = Math::BigFloat->new("+111"); $y = Math::BigFloat->new("+111"); $x * $y;
ok 1635 - $x = Math::BigFloat->new("+111"); $y = Math::BigFloat->new("+111"); $x * $y;
ok 1636 - $x = Math::BigFloat->new("+10101"); $y = Math::BigFloat->new("+10101"); $x * $y;
ok 1637 - $x = Math::BigFloat->new("+10101"); $y = Math::BigFloat->new("+10101"); $x * $y;
ok 1638 - $x = Math::BigFloat->new("+1001001"); $y = Math::BigFloat->new("+1001001"); $x * $y;
ok 1639 - $x = Math::BigFloat->new("+1001001"); $y = Math::BigFloat->new("+1001001"); $x * $y;
ok 1640 - $x = Math::BigFloat->new("+100010001"); $y = Math::BigFloat->new("+100010001"); $x * $y;
ok 1641 - $x = Math::BigFloat->new("+100010001"); $y = Math::BigFloat->new("+100010001"); $x * $y;
ok 1642 - $x = Math::BigFloat->new("+10000100001"); $y = Math::BigFloat->new("+10000100001"); $x * $y;
ok 1643 - $x = Math::BigFloat->new("+10000100001"); $y = Math::BigFloat->new("+10000100001"); $x * $y;
ok 1644 - $x = Math::BigFloat->new("+11111111111"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1645 - $x = Math::BigFloat->new("+11111111111"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1646 - $x = Math::BigFloat->new("+22222222222"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1647 - $x = Math::BigFloat->new("+22222222222"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1648 - $x = Math::BigFloat->new("+33333333333"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1649 - $x = Math::BigFloat->new("+33333333333"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1650 - $x = Math::BigFloat->new("+44444444444"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1651 - $x = Math::BigFloat->new("+44444444444"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1652 - $x = Math::BigFloat->new("+55555555555"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1653 - $x = Math::BigFloat->new("+55555555555"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1654 - $x = Math::BigFloat->new("+66666666666"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1655 - $x = Math::BigFloat->new("+66666666666"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1656 - $x = Math::BigFloat->new("+77777777777"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1657 - $x = Math::BigFloat->new("+77777777777"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1658 - $x = Math::BigFloat->new("+88888888888"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1659 - $x = Math::BigFloat->new("+88888888888"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1660 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1661 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+9"); $x * $y;
ok 1662 - $x = Math::BigFloat->new("6"); $y = Math::BigFloat->new("120"); $x * $y;
ok 1663 - $x = Math::BigFloat->new("6"); $y = Math::BigFloat->new("120"); $x * $y;
ok 1664 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("10000"); $x * $y;
ok 1665 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("10000"); $x * $y;
ok 1666 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1667 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1668 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("4"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1669 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("5"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1670 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1671 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1672 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1673 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y));
ok 1674 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1675 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1676 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1677 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1678 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1679 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1680 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1681 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1682 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1683 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1684 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1685 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1686 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1687 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1688 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1689 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1690 - $x = Math::BigFloat->new("+3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1691 - $x = Math::BigFloat->new("+3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1692 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1693 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1694 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1695 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1696 - $x = Math::BigFloat->new("-3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1697 - $x = Math::BigFloat->new("-3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1698 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1699 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1700 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1701 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1702 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1703 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1704 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1705 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1706 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+2"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1707 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+2"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1708 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1709 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1710 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1711 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1712 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1713 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1714 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("+5"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1715 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("+5"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1716 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("+4"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1717 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("+4"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1718 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("+8"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1719 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("+8"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1720 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("+16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1721 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("+16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1722 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1723 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1724 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1725 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1726 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+99"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1727 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+99"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1728 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1729 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1730 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1731 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1732 - $x = Math::BigFloat->new("+999999999999999"); $y = Math::BigFloat->new("+99999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1733 - $x = Math::BigFloat->new("+999999999999999"); $y = Math::BigFloat->new("+99999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1734 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1735 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1736 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1737 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1738 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1739 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1740 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1741 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1742 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1743 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1744 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1745 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1746 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1747 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1748 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1749 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1750 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1751 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1752 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1753 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1754 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1755 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1756 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1757 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1758 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1759 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1760 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("25.024996000799840031993601279744051189762"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1761 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("25.024996000799840031993601279744051189762"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1762 - $x = Math::BigFloat->new("123456"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1763 - $x = Math::BigFloat->new("123456"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y;
ok 1764 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1765 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1766 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1767 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1768 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1769 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1770 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1771 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1772 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1773 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1774 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1775 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1776 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1777 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1778 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1779 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1780 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1781 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1782 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1783 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1784 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1785 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1786 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1787 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1788 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10000"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1789 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10000"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1790 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("504"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1791 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("504"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1792 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.987654321"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1793 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.987654321"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1794 - $x = Math::BigFloat->new("123456789.123456789123456789123456789"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1795 - $x = Math::BigFloat->new("123456789.123456789123456789123456789"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1796 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1797 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1798 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1799 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1800 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1801 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1802 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1803 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 20; $x / $y;
ok 1804 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 1; $x / $y;
ok 1805 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 1; $x / $y;
ok 1806 - $x = Math::BigFloat->new("123456789.1234"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 1; $x / $y;
ok 1807 - $x = Math::BigFloat->new("123456789.1234"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 1; $x / $y;
ok 1808 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("4"); $x % $y;
ok 1809 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("4"); $x % $y;
ok 1810 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1811 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1812 - $x = Math::BigFloat->new("+9000"); $y = Math::BigFloat->new("56"); $x % $y;
ok 1813 - $x = Math::BigFloat->new("+9000"); $y = Math::BigFloat->new("56"); $x % $y;
ok 1814 - $x = Math::BigFloat->new("+56"); $y = Math::BigFloat->new("9000"); $x % $y;
ok 1815 - $x = Math::BigFloat->new("+56"); $y = Math::BigFloat->new("9000"); $x % $y;
ok 1816 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1817 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1818 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1819 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1820 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1821 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1822 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1823 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1824 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1825 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1826 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1827 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1828 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1829 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1830 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1831 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1832 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1833 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1834 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1835 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1836 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1837 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1838 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1839 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1840 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1841 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1842 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1843 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1844 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1845 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("inf"); $x % $y;
ok 1846 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1847 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); $x % $y;
ok 1848 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1849 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1850 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1851 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1852 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1853 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1854 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1855 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1856 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1857 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1858 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x % $y;
ok 1859 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x % $y;
ok 1860 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1861 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1862 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("abc"); $x % $y;
ok 1863 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("abc"); $x % $y;
ok 1864 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1865 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1866 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1867 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1868 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1869 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1870 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1871 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $x % $y;
ok 1872 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1873 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1874 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1875 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1876 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1877 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1878 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1879 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1880 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x % $y;
ok 1881 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x % $y;
ok 1882 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1883 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1884 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1885 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1886 - $x = Math::BigFloat->new("2000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1887 - $x = Math::BigFloat->new("2000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1888 - $x = Math::BigFloat->new("3000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1889 - $x = Math::BigFloat->new("3000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1890 - $x = Math::BigFloat->new("4000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1891 - $x = Math::BigFloat->new("4000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1892 - $x = Math::BigFloat->new("5000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1893 - $x = Math::BigFloat->new("5000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1894 - $x = Math::BigFloat->new("6000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1895 - $x = Math::BigFloat->new("6000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1896 - $x = Math::BigFloat->new("7000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1897 - $x = Math::BigFloat->new("7000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1898 - $x = Math::BigFloat->new("8000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1899 - $x = Math::BigFloat->new("8000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1900 - $x = Math::BigFloat->new("9000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1901 - $x = Math::BigFloat->new("9000000000"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1902 - $x = Math::BigFloat->new("35500000"); $y = Math::BigFloat->new("113"); $x % $y;
ok 1903 - $x = Math::BigFloat->new("35500000"); $y = Math::BigFloat->new("113"); $x % $y;
ok 1904 - $x = Math::BigFloat->new("71000000"); $y = Math::BigFloat->new("226"); $x % $y;
ok 1905 - $x = Math::BigFloat->new("71000000"); $y = Math::BigFloat->new("226"); $x % $y;
ok 1906 - $x = Math::BigFloat->new("106500000"); $y = Math::BigFloat->new("339"); $x % $y;
ok 1907 - $x = Math::BigFloat->new("106500000"); $y = Math::BigFloat->new("339"); $x % $y;
ok 1908 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1909 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1910 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1911 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("5"); $x % $y;
ok 1912 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("4"); $x % $y;
ok 1913 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("4"); $x % $y;
ok 1914 - $x = Math::BigFloat->new("1000"); $y = Math::BigFloat->new("8"); $x % $y;
ok 1915 - $x = Math::BigFloat->new("1000"); $y = Math::BigFloat->new("8"); $x % $y;
ok 1916 - $x = Math::BigFloat->new("10000"); $y = Math::BigFloat->new("16"); $x % $y;
ok 1917 - $x = Math::BigFloat->new("10000"); $y = Math::BigFloat->new("16"); $x % $y;
ok 1918 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1919 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9"); $x % $y;
ok 1920 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("99"); $x % $y;
ok 1921 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("99"); $x % $y;
ok 1922 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("999"); $x % $y;
ok 1923 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("999"); $x % $y;
ok 1924 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9999"); $x % $y;
ok 1925 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9999"); $x % $y;
ok 1926 - $x = Math::BigFloat->new("999999999999999"); $y = Math::BigFloat->new("99999"); $x % $y;
ok 1927 - $x = Math::BigFloat->new("999999999999999"); $y = Math::BigFloat->new("99999"); $x % $y;
ok 1928 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("+5"); $x % $y;
ok 1929 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("+5"); $x % $y;
ok 1930 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1931 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1932 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1933 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("-5"); $x % $y;
ok 1934 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1935 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1936 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1937 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1938 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1939 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1940 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1941 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1942 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1943 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1944 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1945 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1946 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1947 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1948 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1949 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-3"); $x % $y;
ok 1950 - $x = Math::BigFloat->new("4095"); $y = Math::BigFloat->new("4095"); $x % $y;
ok 1951 - $x = Math::BigFloat->new("4095"); $y = Math::BigFloat->new("4095"); $x % $y;
ok 1952 - $x = Math::BigFloat->new("100041000510123"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1953 - $x = Math::BigFloat->new("100041000510123"); $y = Math::BigFloat->new("3"); $x % $y;
ok 1954 - $x = Math::BigFloat->new("152403346"); $y = Math::BigFloat->new("12345"); $x % $y;
ok 1955 - $x = Math::BigFloat->new("152403346"); $y = Math::BigFloat->new("12345"); $x % $y;
ok 1956 - $x = Math::BigFloat->new("87654321"); $y = Math::BigFloat->new("87654321"); $x % $y;
ok 1957 - $x = Math::BigFloat->new("87654321"); $y = Math::BigFloat->new("87654321"); $x % $y;
ok 1958 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("2.5"); $x % $y;
ok 1959 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("2.5"); $x % $y;
ok 1960 - $x = Math::BigFloat->new("1230"); $y = Math::BigFloat->new("2.5"); $x % $y;
ok 1961 - $x = Math::BigFloat->new("1230"); $y = Math::BigFloat->new("2.5"); $x % $y;
ok 1962 - $x = Math::BigFloat->new("123.4"); $y = Math::BigFloat->new("2.5"); $x % $y;
ok 1963 - $x = Math::BigFloat->new("123.4"); $y = Math::BigFloat->new("2.5"); $x % $y;
ok 1964 - $x = Math::BigFloat->new("123e1"); $y = Math::BigFloat->new("25"); $x % $y;
ok 1965 - $x = Math::BigFloat->new("123e1"); $y = Math::BigFloat->new("25"); $x % $y;
ok 1966 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1967 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1968 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1969 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1970 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1971 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1972 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1973 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1974 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1975 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1976 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1977 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("1"); $x % $y;
ok 1978 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1979 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1980 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1981 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-1"); $x % $y;
ok 1982 - $x = Math::BigFloat->new("Nanfac"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1983 - $x = Math::BigFloat->new("Nanfac"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1984 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1985 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1986 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1987 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1988 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1989 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1990 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1991 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1992 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1993 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1994 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1995 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1996 - $x = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1997 - $x = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1998 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 1999 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2000 - $x = Math::BigFloat->new("5"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2001 - $x = Math::BigFloat->new("5"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2002 - $x = Math::BigFloat->new("6"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2003 - $x = Math::BigFloat->new("6"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2004 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2005 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2006 - $x = Math::BigFloat->new("11"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2007 - $x = Math::BigFloat->new("11"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2008 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2009 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bfac();
ok 2010 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2011 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2012 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2013 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2014 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2015 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2016 - $x = Math::BigFloat->new("-123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2017 - $x = Math::BigFloat->new("-123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2018 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2019 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2020 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2021 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2022 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2023 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2024 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2025 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2026 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2027 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2028 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2029 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2030 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2031 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2032 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2033 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2034 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2035 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2036 - $x = Math::BigFloat->new("15241.38393"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2037 - $x = Math::BigFloat->new("15241.38393"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2038 - $x = Math::BigFloat->new("1.44"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2039 - $x = Math::BigFloat->new("1.44"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2040 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2041 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2042 - $x = Math::BigFloat->new("0.49"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2043 - $x = Math::BigFloat->new("0.49"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2044 - $x = Math::BigFloat->new("0.0049"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2045 - $x = Math::BigFloat->new("0.0049"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2046 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2047 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2048 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2049 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2050 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2051 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2052 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2053 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2054 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2055 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2056 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2057 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2058 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2059 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2060 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2061 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2062 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2063 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2064 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2065 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2066 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2067 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2068 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2069 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2070 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2071 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2072 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2073 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2074 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2075 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2076 - $x = Math::BigFloat->new("-123.45"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2077 - $x = Math::BigFloat->new("-123.45"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2078 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2079 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2080 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2081 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2082 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2083 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2084 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2085 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2086 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2087 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2088 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2089 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2090 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2091 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2092 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2093 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2094 - $x = Math::BigFloat->new("81"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2095 - $x = Math::BigFloat->new("81"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y);
ok 2096 - $x = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2097 - $x = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2098 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2099 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2100 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2101 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2102 - $x = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2103 - $x = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2104 - $x = Math::BigFloat->new("-123.45"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2105 - $x = Math::BigFloat->new("-123.45"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2106 - $x = Math::BigFloat->new("nanbsqrt"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2107 - $x = Math::BigFloat->new("nanbsqrt"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2108 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2109 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2110 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2111 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2112 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2113 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2114 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2115 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2116 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2117 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2118 - $x = Math::BigFloat->new("9"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2119 - $x = Math::BigFloat->new("9"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2120 - $x = Math::BigFloat->new("16"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2121 - $x = Math::BigFloat->new("16"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2122 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2123 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2124 - $x = Math::BigFloat->new("123.456"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2125 - $x = Math::BigFloat->new("123.456"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2126 - $x = Math::BigFloat->new("15241.38393"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2127 - $x = Math::BigFloat->new("15241.38393"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2128 - $x = Math::BigFloat->new("1.44"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2129 - $x = Math::BigFloat->new("1.44"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2130 - $x = Math::BigFloat->new("1.44E10"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2131 - $x = Math::BigFloat->new("1.44E10"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2132 - $x = Math::BigFloat->new("2e10"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2133 - $x = Math::BigFloat->new("2e10"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2134 - $x = Math::BigFloat->new("144e20"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2135 - $x = Math::BigFloat->new("144e20"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2136 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2137 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2138 - $x = Math::BigFloat->new("0.49"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2139 - $x = Math::BigFloat->new("0.49"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2140 - $x = Math::BigFloat->new("0.0049"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2141 - $x = Math::BigFloat->new("0.0049"); $Math::BigFloat::div_scale = 40; $x->bsqrt();
ok 2142 - $x = Math::BigFloat->new("123"); $x->is_nan();
ok 2143 - $x = Math::BigFloat->new("abc"); $x->is_nan();
ok 2144 - $x = Math::BigFloat->new("NaN"); $x->is_nan();
ok 2145 - $x = Math::BigFloat->new("-123"); $x->is_nan();
ok 2146 - $x = Math::BigFloat->new("+inf"); $x->is_inf("");
ok 2147 - $x = Math::BigFloat->new("-inf"); $x->is_inf("");
ok 2148 - $x = Math::BigFloat->new("abc"); $x->is_inf("");
ok 2149 - $x = Math::BigFloat->new("1"); $x->is_inf("");
ok 2150 - $x = Math::BigFloat->new("NaN"); $x->is_inf("");
ok 2151 - $x = Math::BigFloat->new("-1"); $x->is_inf("");
ok 2152 - $x = Math::BigFloat->new("+inf"); $x->is_inf("-");
ok 2153 - $x = Math::BigFloat->new("+inf"); $x->is_inf("+");
ok 2154 - $x = Math::BigFloat->new("-inf"); $x->is_inf("-");
ok 2155 - $x = Math::BigFloat->new("-inf"); $x->is_inf("+");
ok 2156 - $x = Math::BigFloat->new("-inf"); $x->is_inf("-inf");
ok 2157 - $x = Math::BigFloat->new("-inf"); $x->is_inf("+inf");
ok 2158 - $x = Math::BigFloat->new("+inf"); $x->is_inf("-inf");
ok 2159 - $x = Math::BigFloat->new("+inf"); $x->is_inf("+inf");
ok 2160 - $x = Math::BigFloat->new("+iNfInItY"); $x->is_inf("");
ok 2161 - $x = Math::BigFloat->new("-InFiNiTy"); $x->is_inf("");
ok 2162 - $x = Math::BigFloat->new("abc"); $x->is_odd();
ok 2163 - $x = Math::BigFloat->new("0"); $x->is_odd();
ok 2164 - $x = Math::BigFloat->new("-1"); $x->is_odd();
ok 2165 - $x = Math::BigFloat->new("-3"); $x->is_odd();
ok 2166 - $x = Math::BigFloat->new("1"); $x->is_odd();
ok 2167 - $x = Math::BigFloat->new("3"); $x->is_odd();
ok 2168 - $x = Math::BigFloat->new("1000001"); $x->is_odd();
ok 2169 - $x = Math::BigFloat->new("1000002"); $x->is_odd();
ok 2170 - $x = Math::BigFloat->new("+inf"); $x->is_odd();
ok 2171 - $x = Math::BigFloat->new("-inf"); $x->is_odd();
ok 2172 - $x = Math::BigFloat->new("123.45"); $x->is_odd();
ok 2173 - $x = Math::BigFloat->new("-123.45"); $x->is_odd();
ok 2174 - $x = Math::BigFloat->new("2"); $x->is_odd();
ok 2175 - $x = Math::BigFloat->new("NaNis_int"); $x->is_int();
ok 2176 - $x = Math::BigFloat->new("0"); $x->is_int();
ok 2177 - $x = Math::BigFloat->new("1"); $x->is_int();
ok 2178 - $x = Math::BigFloat->new("2"); $x->is_int();
ok 2179 - $x = Math::BigFloat->new("-2"); $x->is_int();
ok 2180 - $x = Math::BigFloat->new("-1"); $x->is_int();
ok 2181 - $x = Math::BigFloat->new("-inf"); $x->is_int();
ok 2182 - $x = Math::BigFloat->new("+inf"); $x->is_int();
ok 2183 - $x = Math::BigFloat->new("123.4567"); $x->is_int();
ok 2184 - $x = Math::BigFloat->new("-0.1"); $x->is_int();
ok 2185 - $x = Math::BigFloat->new("-0.002"); $x->is_int();
ok 2186 - $x = Math::BigFloat->new("abc"); $x->is_even();
ok 2187 - $x = Math::BigFloat->new("0"); $x->is_even();
ok 2188 - $x = Math::BigFloat->new("-1"); $x->is_even();
ok 2189 - $x = Math::BigFloat->new("-3"); $x->is_even();
ok 2190 - $x = Math::BigFloat->new("1"); $x->is_even();
ok 2191 - $x = Math::BigFloat->new("3"); $x->is_even();
ok 2192 - $x = Math::BigFloat->new("1000001"); $x->is_even();
ok 2193 - $x = Math::BigFloat->new("1000002"); $x->is_even();
ok 2194 - $x = Math::BigFloat->new("2"); $x->is_even();
ok 2195 - $x = Math::BigFloat->new("+inf"); $x->is_even();
ok 2196 - $x = Math::BigFloat->new("-inf"); $x->is_even();
ok 2197 - $x = Math::BigFloat->new("123.456"); $x->is_even();
ok 2198 - $x = Math::BigFloat->new("-123.456"); $x->is_even();
ok 2199 - $x = Math::BigFloat->new("0.01"); $x->is_even();
ok 2200 - $x = Math::BigFloat->new("-0.01"); $x->is_even();
ok 2201 - $x = Math::BigFloat->new("120"); $x->is_even();
ok 2202 - $x = Math::BigFloat->new("1200"); $x->is_even();
ok 2203 - $x = Math::BigFloat->new("-1200"); $x->is_even();
ok 2204 - $x = Math::BigFloat->new("0"); $x->is_positive();
ok 2205 - $x = Math::BigFloat->new("1"); $x->is_positive();
ok 2206 - $x = Math::BigFloat->new("-1"); $x->is_positive();
ok 2207 - $x = Math::BigFloat->new("-123"); $x->is_positive();
ok 2208 - $x = Math::BigFloat->new("NaN"); $x->is_positive();
ok 2209 - $x = Math::BigFloat->new("-inf"); $x->is_positive();
ok 2210 - $x = Math::BigFloat->new("+inf"); $x->is_positive();
ok 2211 - $x = Math::BigFloat->new("0"); $x->is_negative();
ok 2212 - $x = Math::BigFloat->new("1"); $x->is_negative();
ok 2213 - $x = Math::BigFloat->new("-1"); $x->is_negative();
ok 2214 - $x = Math::BigFloat->new("-123"); $x->is_negative();
ok 2215 - $x = Math::BigFloat->new("NaN"); $x->is_negative();
ok 2216 - $x = Math::BigFloat->new("-inf"); $x->is_negative();
ok 2217 - $x = Math::BigFloat->new("+inf"); $x->is_negative();
ok 2218 - $x = Math::BigFloat->new("0"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2219 - $x = Math::BigFloat->new("1"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2220 - $x = Math::BigFloat->new("123"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2221 - $x = Math::BigFloat->new("-123"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2222 - $x = Math::BigFloat->new("-1200"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2223 - $x = Math::BigFloat->new("NaNparts"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2224 - $x = Math::BigFloat->new("+inf"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2225 - $x = Math::BigFloat->new("-inf"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b";
ok 2226 - $x = Math::BigFloat->new("0"); $x->exponent()->bstr();
ok 2227 - $x = Math::BigFloat->new("1"); $x->exponent()->bstr();
ok 2228 - $x = Math::BigFloat->new("123"); $x->exponent()->bstr();
ok 2229 - $x = Math::BigFloat->new("-123"); $x->exponent()->bstr();
ok 2230 - $x = Math::BigFloat->new("-1200"); $x->exponent()->bstr();
ok 2231 - $x = Math::BigFloat->new("+inf"); $x->exponent()->bstr();
ok 2232 - $x = Math::BigFloat->new("-inf"); $x->exponent()->bstr();
ok 2233 - $x = Math::BigFloat->new("NaNexponent"); $x->exponent()->bstr();
ok 2234 - $x = Math::BigFloat->new("0"); $x->mantissa()->bstr();
ok 2235 - $x = Math::BigFloat->new("1"); $x->mantissa()->bstr();
ok 2236 - $x = Math::BigFloat->new("123"); $x->mantissa()->bstr();
ok 2237 - $x = Math::BigFloat->new("-123"); $x->mantissa()->bstr();
ok 2238 - $x = Math::BigFloat->new("-1200"); $x->mantissa()->bstr();
ok 2239 - $x = Math::BigFloat->new("+inf"); $x->mantissa()->bstr();
ok 2240 - $x = Math::BigFloat->new("-inf"); $x->mantissa()->bstr();
ok 2241 - $x = Math::BigFloat->new("NaNmantissa"); $x->mantissa()->bstr();
ok 2242 - $x = Math::BigFloat->new("123"); $x->length();
ok 2243 - $x = Math::BigFloat->new("-123"); $x->length();
ok 2244 - $x = Math::BigFloat->new("0"); $x->length();
ok 2245 - $x = Math::BigFloat->new("1"); $x->length();
ok 2246 - $x = Math::BigFloat->new("12345678901234567890"); $x->length();
ok 2247 - $x = Math::BigFloat->new("NaNzero"); $x->is_zero();
ok 2248 - $x = Math::BigFloat->new("+inf"); $x->is_zero();
ok 2249 - $x = Math::BigFloat->new("-inf"); $x->is_zero();
ok 2250 - $x = Math::BigFloat->new("0"); $x->is_zero();
ok 2251 - $x = Math::BigFloat->new("-1"); $x->is_zero();
ok 2252 - $x = Math::BigFloat->new("1"); $x->is_zero();
ok 2253 - $x = Math::BigFloat->new("NaNone"); $x->is_one();
ok 2254 - $x = Math::BigFloat->new("+inf"); $x->is_one();
ok 2255 - $x = Math::BigFloat->new("-inf"); $x->is_one();
ok 2256 - $x = Math::BigFloat->new("0"); $x->is_one();
ok 2257 - $x = Math::BigFloat->new("2"); $x->is_one();
ok 2258 - $x = Math::BigFloat->new("1"); $x->is_one();
ok 2259 - $x = Math::BigFloat->new("-1"); $x->is_one();
ok 2260 - $x = Math::BigFloat->new("-2"); $x->is_one();
ok 2261 - $x = Math::BigFloat->new("0"); $x->bfloor();
ok 2262 - $x = Math::BigFloat->new("0"); $x->bfloor();
ok 2263 - $x = Math::BigFloat->new("abc"); $x->bfloor();
ok 2264 - $x = Math::BigFloat->new("abc"); $x->bfloor();
ok 2265 - $x = Math::BigFloat->new("+inf"); $x->bfloor();
ok 2266 - $x = Math::BigFloat->new("+inf"); $x->bfloor();
ok 2267 - $x = Math::BigFloat->new("-inf"); $x->bfloor();
ok 2268 - $x = Math::BigFloat->new("-inf"); $x->bfloor();
ok 2269 - $x = Math::BigFloat->new("1"); $x->bfloor();
ok 2270 - $x = Math::BigFloat->new("1"); $x->bfloor();
ok 2271 - $x = Math::BigFloat->new("-51"); $x->bfloor();
ok 2272 - $x = Math::BigFloat->new("-51"); $x->bfloor();
ok 2273 - $x = Math::BigFloat->new("-51.2"); $x->bfloor();
ok 2274 - $x = Math::BigFloat->new("-51.2"); $x->bfloor();
ok 2275 - $x = Math::BigFloat->new("12.2"); $x->bfloor();
ok 2276 - $x = Math::BigFloat->new("12.2"); $x->bfloor();
ok 2277 - $x = Math::BigFloat->new("0.12345"); $x->bfloor();
ok 2278 - $x = Math::BigFloat->new("0.12345"); $x->bfloor();
ok 2279 - $x = Math::BigFloat->new("0.123456"); $x->bfloor();
ok 2280 - $x = Math::BigFloat->new("0.123456"); $x->bfloor();
ok 2281 - $x = Math::BigFloat->new("0.1234567"); $x->bfloor();
ok 2282 - $x = Math::BigFloat->new("0.1234567"); $x->bfloor();
ok 2283 - $x = Math::BigFloat->new("0.12345678"); $x->bfloor();
ok 2284 - $x = Math::BigFloat->new("0.12345678"); $x->bfloor();
ok 2285 - $x = Math::BigFloat->new("0.123456789"); $x->bfloor();
ok 2286 - $x = Math::BigFloat->new("0.123456789"); $x->bfloor();
ok 2287 - $x = Math::BigFloat->new("0"); $x->bceil();
ok 2288 - $x = Math::BigFloat->new("0"); $x->bceil();
ok 2289 - $x = Math::BigFloat->new("abc"); $x->bceil();
ok 2290 - $x = Math::BigFloat->new("abc"); $x->bceil();
ok 2291 - $x = Math::BigFloat->new("+inf"); $x->bceil();
ok 2292 - $x = Math::BigFloat->new("+inf"); $x->bceil();
ok 2293 - $x = Math::BigFloat->new("-inf"); $x->bceil();
ok 2294 - $x = Math::BigFloat->new("-inf"); $x->bceil();
ok 2295 - $x = Math::BigFloat->new("1"); $x->bceil();
ok 2296 - $x = Math::BigFloat->new("1"); $x->bceil();
ok 2297 - $x = Math::BigFloat->new("-51"); $x->bceil();
ok 2298 - $x = Math::BigFloat->new("-51"); $x->bceil();
ok 2299 - $x = Math::BigFloat->new("-51.2"); $x->bceil();
ok 2300 - $x = Math::BigFloat->new("-51.2"); $x->bceil();
ok 2301 - $x = Math::BigFloat->new("12.2"); $x->bceil();
ok 2302 - $x = Math::BigFloat->new("12.2"); $x->bceil();
ok 2303 - $x = Math::BigFloat->new("-0.4"); $x->bceil();
ok 2304 - $x = Math::BigFloat->new("-0.4"); $x->bceil();
ok 2305 - $x = Math::BigFloat->new("0"); $x->bint();
ok 2306 - $x = Math::BigFloat->new("0"); $x->bint();
ok 2307 - $x = Math::BigFloat->new("NaN"); $x->bint();
ok 2308 - $x = Math::BigFloat->new("NaN"); $x->bint();
ok 2309 - $x = Math::BigFloat->new("+inf"); $x->bint();
ok 2310 - $x = Math::BigFloat->new("+inf"); $x->bint();
ok 2311 - $x = Math::BigFloat->new("-inf"); $x->bint();
ok 2312 - $x = Math::BigFloat->new("-inf"); $x->bint();
ok 2313 - $x = Math::BigFloat->new("1"); $x->bint();
ok 2314 - $x = Math::BigFloat->new("1"); $x->bint();
ok 2315 - $x = Math::BigFloat->new("-51"); $x->bint();
ok 2316 - $x = Math::BigFloat->new("-51"); $x->bint();
ok 2317 - $x = Math::BigFloat->new("-51.2"); $x->bint();
ok 2318 - $x = Math::BigFloat->new("-51.2"); $x->bint();
ok 2319 - $x = Math::BigFloat->new("12.2"); $x->bint();
ok 2320 - $x = Math::BigFloat->new("12.2"); $x->bint();
ok 2321 - $x = Math::BigFloat->new("-0.4"); $x->bint();
ok 2322 - $x = Math::BigFloat->new("-0.4"); $x->bint();
ok 2323 - $x = Math::BigFloat->new("-1"); $x = log($x);
ok 2324 - $x = Math::BigFloat->new("-1"); $x = log($x);
ok 2325 - $x = Math::BigFloat->new("0"); $x = log($x);
ok 2326 - $x = Math::BigFloat->new("0"); $x = log($x);
ok 2327 - $x = Math::BigFloat->new("1"); $x = log($x);
ok 2328 - $x = Math::BigFloat->new("1"); $x = log($x);
ok 2329 - $x = Math::BigFloat->new("2"); $x = log($x);
ok 2330 - $x = Math::BigFloat->new("2"); $x = log($x);
ok 2331 - $x = Math::BigFloat->new("3"); $x = log($x);
ok 2332 - $x = Math::BigFloat->new("3"); $x = log($x);
ok 2333 - $x = Math::BigFloat->new("123456789"); $x = log($x);
ok 2334 - $x = Math::BigFloat->new("123456789"); $x = log($x);
ok 2335 - $x = Math::BigFloat->new("1234567890987654321"); $x = log($x);
ok 2336 - $x = Math::BigFloat->new("1234567890987654321"); $x = log($x);
ok 2337 - $x = Math::BigFloat->new("-inf"); $x = log($x);
ok 2338 - $x = Math::BigFloat->new("-inf"); $x = log($x);
ok 2339 - $x = Math::BigFloat->new("inf"); $x = log($x);
ok 2340 - $x = Math::BigFloat->new("inf"); $x = log($x);
ok 2341 - $x = Math::BigFloat->new("NaN"); $x = log($x);
ok 2342 - $x = Math::BigFloat->new("NaN"); $x = log($x);
ok 2343 - $x = Math::BigInt->new(1200); $y = $CLASS->new($x); \# check $y
ok 2344 - $x = Math::BigInt->new(1200); $y = $CLASS->new($x); \# check $x
ok 2345 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->bsstr()
ok 2346 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->exponent()
ok 2347 - Math::BigFloat->new("1e1234567890123456789012345678901234567890") > 0
ok 2348 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->bsub("1e1234567890123456789012345678901234567890")
ok 2349 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->bmul(2)->bsstr()
ok 2350 - Math::BigFloat->new("1234567890123456789012345678901234567890e2")->mantissa()
ok 2351 - $x = Math::BigFloat->new(2); $x->bzero(); $x->{_a}
ok 2352 - $x = Math::BigFloat->new(2); $x->bzero(); $x->{_p}
ok 2353 - $x = Math::BigFloat->new(2); $x->binf(); $x->{_a}
ok 2354 - $x = Math::BigFloat->new(2); $x->binf(); $x->{_p}
ok 2355 - $x = Math::BigFloat->new(2); $x->bone(); $x->{_a}
ok 2356 - $x = Math::BigFloat->new(2); $x->bone(); $x->{_p}
ok 2357 - $x = Math::BigFloat->new(2); $x->bnan(); $x->{_a}
ok 2358 - $x = Math::BigFloat->new(2); $x->bnan(); $x->{_p}
ok 2359 - Math::BigFloat->bzero()
ok 2360 - Math::BigFloat->bone()
ok 2361 - Math::BigFloat->bone("+")
ok 2362 - Math::BigFloat->bone("-")
ok 2363 - Math::BigFloat->bnan()
ok 2364 - Math::BigFloat->binf()
ok 2365 - Math::BigFloat->binf("+")
ok 2366 - Math::BigFloat->binf("-")
ok 2367 - Math::BigFloat->binf("-inf")
ok 2368 - $x = Math::BigFloat->new("0.008"); $y = Math::BigFloat->new(2); $x->bdiv(3, $y);
ok 2369 - Math::BigFloat->new("12345e67")->numify()
ok 2370 - Math::BigFloat->new("1e-9999")->numify()
ok 2371 - Math::BigFloat->new("1e9999")->numify()
ok 2372 - numify of +Inf
ok 2373 - numify of -Inf
ok 2374 - numify of NaN
ok 2375 - $x = Math::BigFloat->new(12); Math::BigFloat->precision(-2); $x->bsqrt();
ok 2376 - Math::BigFloat->precision(undef); $x = Math::BigFloat->new(12); Math::BigFloat->precision(0); $x->bsqrt();
ok 2377 - Math::BigFloat->precision(-3); $x = Math::BigFloat->new(12); $x->bsqrt();
ok 2378 - A and P set => NaN
ok 2379 - supplied arg overrides set global
ok 2380 - @args = Math::BigFloat::objectify(2, Math::BigFloat, 4, 5); join(" ", @args);
ok 2381 - Math::BigFloat->new(-1)->is_one()
ok 2382 - Math::BigFloat->new(-1)->is_one("-")
ok 2383 - Math::BigFloat->new(1)->bdiv("0.5")->bsstr()
ok 2384 - $x = Math::BigFloat->new(3); $x -= $x;
ok 2385 - $x = Math::BigFloat->new(-3); $x -= $x;
ok 2386 - $x = Math::BigFloat->new(3); $x += $x;
ok 2387 - $x = Math::BigFloat->new(-3); $x += $x;
ok 2388 - $x = Math::BigFloat->new("NaN"); $x -= $x;
ok 2389 - $x = Math::BigFloat->new("inf"); $x -= $x;
ok 2390 - $x = Math::BigFloat->new("-inf"); $x -= $x;
ok 2391 - $x = Math::BigFloat->new("NaN"); $x += $x;
ok 2392 - $x = Math::BigFloat->new("inf"); $x += $x;
ok 2393 - $x = Math::BigFloat->new("-inf"); $x += $x;
ok 2394 - $x = Math::BigFloat->new("3.14"); $x -= $x;
ok 2395 - $x = Math::BigFloat->new("-3.14"); $x -= $x;
ok 2396 - 6.28 = Math::BigFloat->new("3.14"); 6.28 += 6.28;
ok 2397 - -6.28 = Math::BigFloat->new("-3.14"); -6.28 += -6.28;
ok 2398 - 9.8596 = Math::BigFloat->new("3.14"); 9.8596 *= 9.8596;
ok 2399 - 9.8596 = Math::BigFloat->new("-3.14"); 9.8596 *= 9.8596;
ok 2400 - 1 = Math::BigFloat->new("3.14"); 1 /= 1;
ok 2401 - 1 = Math::BigFloat->new("-3.14"); 1 /= 1;
ok 2402 - 0 = Math::BigFloat->new("3.14"); 0 %= 0;
ok 2403 - 0 = Math::BigFloat->new("-3.14"); 0 %= 0;
ok 2404 - $x = Math::BigFloat->new(0); $y = Math::BigFloat->new("0.1"); $x ** $y
ok 2405 - 1 = Math::BigFloat->new(".222222222222222222222222222222222222222222"); 1->bceil();
ok 2406 - value of ((2**148)+1)/17
ok 2407 - number of digits in ((2**148)+1)/17
ok 2408 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y
ok 2409 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y; $x
ok 2410 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y; $x >>= $y
ok 2411 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y; $x >>= $y; $x
ok 2412 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18.2"); $x <<= $y; $x->copy()->bfround(-9);
ok 2413 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18.2"); $x <<= $y; $x->copy()->bfround(-9); $x >>= $y
ok 2414 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18.2"); $x <<= $y; $x->copy()->bfround(-9); $x >>= $y; $x
ok
t/bigintg.t ..............
1..356
# Running under perl version 5.018000 for linux
# Current time local: Wed Jan 27 04:16:32 2016
# Current time GMT: Wed Jan 27 12:16:32 2016
# Using Test.pm version 1.26
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok
t/bigintpm.t .............
1..3730
ok 1 - Math::BigInt->from_hex("0xcafe")
ok 2 - Math::BigInt->from_hex("0xcafebabedead")
ok 3 - Math::BigInt->from_bin("0b1001")
ok 4 - Math::BigInt->from_bin("0b1001100110011001100110011001");
ok 5 - Math::BigInt->from_oct("0775");
ok 6 - Math::BigInt->from_oct("07777777777777711111111222222222");
ok 7 - Math::BigInt->config()->{lib}
ok 8 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("-345"); $x .= $y;
ok 9 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x += $y;
ok 10 - is a valid object
ok 11 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $x += $y;
ok 12 - is a valid object
ok 13 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x -= $y;
ok 14 - is a valid object
ok 15 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $x -= $y;
ok 16 - is a valid object
ok 17 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x *= $y;
ok 18 - is a valid object
ok 19 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("5"); $x *= $y;
ok 20 - is a valid object
ok 21 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("3"); $x %= $y;
ok 22 - is a valid object
ok 23 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("9"); $x %= $y;
ok 24 - is a valid object
ok 25 - $x = Math::BigInt->new("-629"); $y = Math::BigInt->new("5033"); $x %= $y;
ok 26 - is a valid object
ok 27 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("3"); $x /= $y;
ok 28 - is a valid object
ok 29 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("2"); $x /= $y;
ok 30 - is a valid object
ok 31 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x |= $y;
ok 32 - is a valid object
ok 33 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("7"); $x &= $y;
ok 34 - is a valid object
ok 35 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("7"); $x ^= $y;
ok 36 - is a valid object
ok 37 - $x = Math::BigInt->new("NaNlog"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 38 - is a valid object
ok 39 - $x = Math::BigInt->new("122"); $y = Math::BigInt->new("NaNlog"); $x->blog($y);
ok 40 - is a valid object
ok 41 - $x = Math::BigInt->new("NaNlog1"); $y = Math::BigInt->new("NaNlog"); $x->blog($y);
ok 42 - is a valid object
ok 43 - $x = Math::BigInt->new("122"); $y = Math::BigInt->new("inf"); $x->blog($y);
ok 44 - is a valid object
ok 45 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("122"); $x->blog($y);
ok 46 - is a valid object
ok 47 - $x = Math::BigInt->new("122"); $y = Math::BigInt->new("-inf"); $x->blog($y);
ok 48 - is a valid object
ok 49 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("122"); $x->blog($y);
ok 50 - is a valid object
ok 51 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->blog($y);
ok 52 - is a valid object
ok 53 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $x->blog($y);
ok 54 - is a valid object
ok 55 - $x = Math::BigInt->new("-21"); $y = Math::BigInt->new("4"); $x->blog($y);
ok 56 - is a valid object
ok 57 - $x = Math::BigInt->new("21"); $y = Math::BigInt->new("-21"); $x->blog($y);
ok 58 - is a valid object
ok 59 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x->blog($y);
ok 60 - is a valid object
ok 61 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x->blog($y);
ok 62 - is a valid object
ok 63 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->blog($y);
ok 64 - is a valid object
ok 65 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->blog($y);
ok 66 - is a valid object
ok 67 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x->blog($y);
ok 68 - is a valid object
ok 69 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-inf"); $x->blog($y);
ok 70 - is a valid object
ok 71 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x->blog($y);
ok 72 - is a valid object
ok 73 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x->blog($y);
ok 74 - is a valid object
ok 75 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->blog($y);
ok 76 - is a valid object
ok 77 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $x->blog($y);
ok 78 - is a valid object
ok 79 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("inf"); $x->blog($y);
ok 80 - is a valid object
ok 81 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x->blog($y);
ok 82 - is a valid object
ok 83 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-1"); $x->blog($y);
ok 84 - is a valid object
ok 85 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); $x->blog($y);
ok 86 - is a valid object
ok 87 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("1"); $x->blog($y);
ok 88 - is a valid object
ok 89 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("4"); $x->blog($y);
ok 90 - is a valid object
ok 91 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); $x->blog($y);
ok 92 - is a valid object
ok 93 - $x = Math::BigInt->new("1024"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 94 - is a valid object
ok 95 - $x = Math::BigInt->new("81"); $y = Math::BigInt->new("3"); $x->blog($y);
ok 96 - is a valid object
ok 97 - $x = Math::BigInt->new("82"); $y = Math::BigInt->new("3"); $x->blog($y);
ok 98 - is a valid object
ok 99 - $x = Math::BigInt->new("80"); $y = Math::BigInt->new("3"); $x->blog($y);
ok 100 - is a valid object
ok 101 - $x = Math::BigInt->new("4096"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 102 - is a valid object
ok 103 - $x = Math::BigInt->new("15625"); $y = Math::BigInt->new("5"); $x->blog($y);
ok 104 - is a valid object
ok 105 - $x = Math::BigInt->new("15626"); $y = Math::BigInt->new("5"); $x->blog($y);
ok 106 - is a valid object
ok 107 - $x = Math::BigInt->new("15624"); $y = Math::BigInt->new("5"); $x->blog($y);
ok 108 - is a valid object
ok 109 - $x = Math::BigInt->new("1000"); $y = Math::BigInt->new("10"); $x->blog($y);
ok 110 - is a valid object
ok 111 - $x = Math::BigInt->new("10000"); $y = Math::BigInt->new("10"); $x->blog($y);
ok 112 - is a valid object
ok 113 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("10"); $x->blog($y);
ok 114 - is a valid object
ok 115 - $x = Math::BigInt->new("1000000"); $y = Math::BigInt->new("10"); $x->blog($y);
ok 116 - is a valid object
ok 117 - $x = Math::BigInt->new("10000000"); $y = Math::BigInt->new("10"); $x->blog($y);
ok 118 - is a valid object
ok 119 - $x = Math::BigInt->new("100000000"); $y = Math::BigInt->new("10"); $x->blog($y);
ok 120 - is a valid object
ok 121 - $x = Math::BigInt->new("8916100448256"); $y = Math::BigInt->new("12"); $x->blog($y);
ok 122 - is a valid object
ok 123 - $x = Math::BigInt->new("8916100448257"); $y = Math::BigInt->new("12"); $x->blog($y);
ok 124 - is a valid object
ok 125 - $x = Math::BigInt->new("8916100448255"); $y = Math::BigInt->new("12"); $x->blog($y);
ok 126 - is a valid object
ok 127 - $x = Math::BigInt->new("2251799813685248"); $y = Math::BigInt->new("8"); $x->blog($y);
ok 128 - is a valid object
ok 129 - $x = Math::BigInt->new("72057594037927936"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 130 - is a valid object
ok 131 - $x = Math::BigInt->new("144115188075855872"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 132 - is a valid object
ok 133 - $x = Math::BigInt->new("288230376151711744"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 134 - is a valid object
ok 135 - $x = Math::BigInt->new("576460752303423488"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 136 - is a valid object
ok 137 - $x = Math::BigInt->new("1329227995784915872903807060280344576"); $y = Math::BigInt->new("2"); $x->blog($y);
ok 138 - is a valid object
ok 139 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $x->blog($y);
ok 140 - is a valid object
ok 141 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $x->blog($y);
ok 142 - is a valid object
ok 143 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->blog($y);
ok 144 - is a valid object
ok 145 - $x = Math::BigInt->new("0"); $x->is_negative() || 0;
ok 146 - $x = Math::BigInt->new("-1"); $x->is_negative() || 0;
ok 147 - $x = Math::BigInt->new("1"); $x->is_negative() || 0;
ok 148 - $x = Math::BigInt->new("+inf"); $x->is_negative() || 0;
ok 149 - $x = Math::BigInt->new("-inf"); $x->is_negative() || 0;
ok 150 - $x = Math::BigInt->new("NaNneg"); $x->is_negative() || 0;
ok 151 - $x = Math::BigInt->new("0"); $x->is_positive() || 0;
ok 152 - $x = Math::BigInt->new("-1"); $x->is_positive() || 0;
ok 153 - $x = Math::BigInt->new("1"); $x->is_positive() || 0;
ok 154 - $x = Math::BigInt->new("+inf"); $x->is_positive() || 0;
ok 155 - $x = Math::BigInt->new("-inf"); $x->is_positive() || 0;
ok 156 - $x = Math::BigInt->new("NaNneg"); $x->is_positive() || 0;
ok 157 - $x = Math::BigInt->new("-inf"); $x->is_int() || 0;
ok 158 - $x = Math::BigInt->new("+inf"); $x->is_int() || 0;
ok 159 - $x = Math::BigInt->new("NaNis_int"); $x->is_int() || 0;
ok 160 - $x = Math::BigInt->new("1"); $x->is_int() || 0;
ok 161 - $x = Math::BigInt->new("0"); $x->is_int() || 0;
ok 162 - $x = Math::BigInt->new("123e12"); $x->is_int() || 0;
ok 163 - $x = Math::BigInt->new("abc"); $x->is_odd() || 0;
ok 164 - $x = Math::BigInt->new("0"); $x->is_odd() || 0;
ok 165 - $x = Math::BigInt->new("1"); $x->is_odd() || 0;
ok 166 - $x = Math::BigInt->new("3"); $x->is_odd() || 0;
ok 167 - $x = Math::BigInt->new("-1"); $x->is_odd() || 0;
ok 168 - $x = Math::BigInt->new("-3"); $x->is_odd() || 0;
ok 169 - $x = Math::BigInt->new("10000001"); $x->is_odd() || 0;
ok 170 - $x = Math::BigInt->new("10000002"); $x->is_odd() || 0;
ok 171 - $x = Math::BigInt->new("2"); $x->is_odd() || 0;
ok 172 - $x = Math::BigInt->new("120"); $x->is_odd() || 0;
ok 173 - $x = Math::BigInt->new("121"); $x->is_odd() || 0;
ok 174 - $x = Math::BigInt->new("abc"); $x->is_even() || 0;
ok 175 - $x = Math::BigInt->new("0"); $x->is_even() || 0;
ok 176 - $x = Math::BigInt->new("1"); $x->is_even() || 0;
ok 177 - $x = Math::BigInt->new("3"); $x->is_even() || 0;
ok 178 - $x = Math::BigInt->new("-1"); $x->is_even() || 0;
ok 179 - $x = Math::BigInt->new("-3"); $x->is_even() || 0;
ok 180 - $x = Math::BigInt->new("10000001"); $x->is_even() || 0;
ok 181 - $x = Math::BigInt->new("10000002"); $x->is_even() || 0;
ok 182 - $x = Math::BigInt->new("2"); $x->is_even() || 0;
ok 183 - $x = Math::BigInt->new("120"); $x->is_even() || 0;
ok 184 - $x = Math::BigInt->new("121"); $x->is_even() || 0;
ok 185 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-0"); $x->bacmp($y);
ok 186 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $x->bacmp($y);
ok 187 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x->bacmp($y);
ok 188 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x->bacmp($y);
ok 189 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+2"); $x->bacmp($y);
ok 190 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-1"); $x->bacmp($y);
ok 191 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("+987654321"); $x->bacmp($y);
ok 192 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x->bacmp($y);
ok 193 - $x = Math::BigInt->new("+987654321"); $y = Math::BigInt->new("+123456789"); $x->bacmp($y);
ok 194 - $x = Math::BigInt->new("-987654321"); $y = Math::BigInt->new("+123456789"); $x->bacmp($y);
ok 195 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("+4567889"); $x->bacmp($y);
ok 196 - $x = Math::BigInt->new("acmpNaN"); $y = Math::BigInt->new("123"); $x->bacmp($y);
ok 197 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("acmpNaN"); $x->bacmp($y);
ok 198 - $x = Math::BigInt->new("acmpNaN"); $y = Math::BigInt->new("acmpNaN"); $x->bacmp($y);
ok 199 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x->bacmp($y);
ok 200 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->bacmp($y);
ok 201 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x->bacmp($y);
ok 202 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x->bacmp($y);
ok 203 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("123"); $x->bacmp($y);
ok 204 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("123"); $x->bacmp($y);
ok 205 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-123"); $x->bacmp($y);
ok 206 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-123"); $x->bacmp($y);
ok 207 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-inf"); $x->bacmp($y);
ok 208 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("inf"); $x->bacmp($y);
ok 209 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-inf"); $x->bacmp($y);
ok 210 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("inf"); $x->bacmp($y);
ok 211 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaN"); $x->bacmp($y);
ok 212 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->bacmp($y);
ok 213 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x->bacmp($y);
ok 214 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("-inf"); $x->bacmp($y);
ok 215 - $x = Math::BigInt->bnorm("0e999");
ok 216 - is a valid object
ok 217 - $x = Math::BigInt->bnorm("0e-999");
ok 218 - is a valid object
ok 219 - $x = Math::BigInt->bnorm("-0e999");
ok 220 - is a valid object
ok 221 - $x = Math::BigInt->bnorm("-0e-999");
ok 222 - is a valid object
ok 223 - $x = Math::BigInt->bnorm("123");
ok 224 - is a valid object
ok 225 - $x = Math::BigInt->bnorm("123.000");
ok 226 - is a valid object
ok 227 - $x = Math::BigInt->bnorm("123e0");
ok 228 - is a valid object
ok 229 - $x = Math::BigInt->bnorm("123e+0");
ok 230 - is a valid object
ok 231 - $x = Math::BigInt->bnorm("123e-0");
ok 232 - is a valid object
ok 233 - $x = Math::BigInt->bnorm("123.000e0");
ok 234 - is a valid object
ok 235 - $x = Math::BigInt->bnorm("123.000e+0");
ok 236 - is a valid object
ok 237 - $x = Math::BigInt->bnorm("123.000e-0");
ok 238 - is a valid object
ok 239 - $x = Math::BigInt->bnorm("0babc");
ok 240 - is a valid object
ok 241 - $x = Math::BigInt->bnorm("0b123");
ok 242 - is a valid object
ok 243 - $x = Math::BigInt->bnorm("0b0");
ok 244 - is a valid object
ok 245 - $x = Math::BigInt->bnorm("-0b0");
ok 246 - is a valid object
ok 247 - $x = Math::BigInt->bnorm("-0b1");
ok 248 - is a valid object
ok 249 - $x = Math::BigInt->bnorm("0b0001");
ok 250 - is a valid object
ok 251 - $x = Math::BigInt->bnorm("0b001");
ok 252 - is a valid object
ok 253 - $x = Math::BigInt->bnorm("0b011");
ok 254 - is a valid object
ok 255 - $x = Math::BigInt->bnorm("0b101");
ok 256 - is a valid object
ok 257 - $x = Math::BigInt->bnorm("0b1001");
ok 258 - is a valid object
ok 259 - $x = Math::BigInt->bnorm("0b10001");
ok 260 - is a valid object
ok 261 - $x = Math::BigInt->bnorm("0b100001");
ok 262 - is a valid object
ok 263 - $x = Math::BigInt->bnorm("0b1000001");
ok 264 - is a valid object
ok 265 - $x = Math::BigInt->bnorm("0b10000001");
ok 266 - is a valid object
ok 267 - $x = Math::BigInt->bnorm("0b100000001");
ok 268 - is a valid object
ok 269 - $x = Math::BigInt->bnorm("0b1000000001");
ok 270 - is a valid object
ok 271 - $x = Math::BigInt->bnorm("0b10000000001");
ok 272 - is a valid object
ok 273 - $x = Math::BigInt->bnorm("0b100000000001");
ok 274 - is a valid object
ok 275 - $x = Math::BigInt->bnorm("0b1000000000001");
ok 276 - is a valid object
ok 277 - $x = Math::BigInt->bnorm("0b10000000000001");
ok 278 - is a valid object
ok 279 - $x = Math::BigInt->bnorm("0b100000000000001");
ok 280 - is a valid object
ok 281 - $x = Math::BigInt->bnorm("0b1000000000000001");
ok 282 - is a valid object
ok 283 - $x = Math::BigInt->bnorm("0b10000000000000001");
ok 284 - is a valid object
ok 285 - $x = Math::BigInt->bnorm("0b100000000000000001");
ok 286 - is a valid object
ok 287 - $x = Math::BigInt->bnorm("0b1000000000000000001");
ok 288 - is a valid object
ok 289 - $x = Math::BigInt->bnorm("0b10000000000000000001");
ok 290 - is a valid object
ok 291 - $x = Math::BigInt->bnorm("0b100000000000000000001");
ok 292 - is a valid object
ok 293 - $x = Math::BigInt->bnorm("0b1000000000000000000001");
ok 294 - is a valid object
ok 295 - $x = Math::BigInt->bnorm("0b10000000000000000000001");
ok 296 - is a valid object
ok 297 - $x = Math::BigInt->bnorm("0b100000000000000000000001");
ok 298 - is a valid object
ok 299 - $x = Math::BigInt->bnorm("0b1000000000000000000000001");
ok 300 - is a valid object
ok 301 - $x = Math::BigInt->bnorm("0b10000000000000000000000001");
ok 302 - is a valid object
ok 303 - $x = Math::BigInt->bnorm("0b100000000000000000000000001");
ok 304 - is a valid object
ok 305 - $x = Math::BigInt->bnorm("0b1000000000000000000000000001");
ok 306 - is a valid object
ok 307 - $x = Math::BigInt->bnorm("0b10000000000000000000000000001");
ok 308 - is a valid object
ok 309 - $x = Math::BigInt->bnorm("0b100000000000000000000000000001");
ok 310 - is a valid object
ok 311 - $x = Math::BigInt->bnorm("0b1000000000000000000000000000001");
ok 312 - is a valid object
ok 313 - $x = Math::BigInt->bnorm("0b10000000000000000000000000000001");
ok 314 - is a valid object
ok 315 - $x = Math::BigInt->bnorm("0b100000000000000000000000000000001");
ok 316 - is a valid object
ok 317 - $x = Math::BigInt->bnorm("0b1000000000000000000000000000000001");
ok 318 - is a valid object
ok 319 - $x = Math::BigInt->bnorm("0b10000000000000000000000000000000001");
ok 320 - is a valid object
ok 321 - $x = Math::BigInt->bnorm("0b__101");
ok 322 - is a valid object
ok 323 - $x = Math::BigInt->bnorm("0b1_0_1");
ok 324 - is a valid object
ok 325 - $x = Math::BigInt->bnorm("0b0_0_0_1");
ok 326 - is a valid object
ok 327 - $x = Math::BigInt->bnorm("-0x0");
ok 328 - is a valid object
ok 329 - $x = Math::BigInt->bnorm("0xabcdefgh");
ok 330 - is a valid object
ok 331 - $x = Math::BigInt->bnorm("0x1234");
ok 332 - is a valid object
ok 333 - $x = Math::BigInt->bnorm("0xabcdef");
ok 334 - is a valid object
ok 335 - $x = Math::BigInt->bnorm("-0xABCDEF");
ok 336 - is a valid object
ok 337 - $x = Math::BigInt->bnorm("-0x1234");
ok 338 - is a valid object
ok 339 - $x = Math::BigInt->bnorm("0x12345678");
ok 340 - is a valid object
ok 341 - $x = Math::BigInt->bnorm("0x1_2_3_4_56_78");
ok 342 - is a valid object
ok 343 - $x = Math::BigInt->bnorm("0xa_b_c_d_e_f");
ok 344 - is a valid object
ok 345 - $x = Math::BigInt->bnorm("0x__123");
ok 346 - is a valid object
ok 347 - $x = Math::BigInt->bnorm("0x9");
ok 348 - is a valid object
ok 349 - $x = Math::BigInt->bnorm("0x11");
ok 350 - is a valid object
ok 351 - $x = Math::BigInt->bnorm("0x21");
ok 352 - is a valid object
ok 353 - $x = Math::BigInt->bnorm("0x41");
ok 354 - is a valid object
ok 355 - $x = Math::BigInt->bnorm("0x81");
ok 356 - is a valid object
ok 357 - $x = Math::BigInt->bnorm("0x101");
ok 358 - is a valid object
ok 359 - $x = Math::BigInt->bnorm("0x201");
ok 360 - is a valid object
ok 361 - $x = Math::BigInt->bnorm("0x401");
ok 362 - is a valid object
ok 363 - $x = Math::BigInt->bnorm("0x801");
ok 364 - is a valid object
ok 365 - $x = Math::BigInt->bnorm("0x1001");
ok 366 - is a valid object
ok 367 - $x = Math::BigInt->bnorm("0x2001");
ok 368 - is a valid object
ok 369 - $x = Math::BigInt->bnorm("0x4001");
ok 370 - is a valid object
ok 371 - $x = Math::BigInt->bnorm("0x8001");
ok 372 - is a valid object
ok 373 - $x = Math::BigInt->bnorm("0x10001");
ok 374 - is a valid object
ok 375 - $x = Math::BigInt->bnorm("0x20001");
ok 376 - is a valid object
ok 377 - $x = Math::BigInt->bnorm("0x40001");
ok 378 - is a valid object
ok 379 - $x = Math::BigInt->bnorm("0x80001");
ok 380 - is a valid object
ok 381 - $x = Math::BigInt->bnorm("0x100001");
ok 382 - is a valid object
ok 383 - $x = Math::BigInt->bnorm("0x200001");
ok 384 - is a valid object
ok 385 - $x = Math::BigInt->bnorm("0x400001");
ok 386 - is a valid object
ok 387 - $x = Math::BigInt->bnorm("0x800001");
ok 388 - is a valid object
ok 389 - $x = Math::BigInt->bnorm("0x1000001");
ok 390 - is a valid object
ok 391 - $x = Math::BigInt->bnorm("0x2000001");
ok 392 - is a valid object
ok 393 - $x = Math::BigInt->bnorm("0x4000001");
ok 394 - is a valid object
ok 395 - $x = Math::BigInt->bnorm("0x8000001");
ok 396 - is a valid object
ok 397 - $x = Math::BigInt->bnorm("0x10000001");
ok 398 - is a valid object
ok 399 - $x = Math::BigInt->bnorm("0x20000001");
ok 400 - is a valid object
ok 401 - $x = Math::BigInt->bnorm("0x40000001");
ok 402 - is a valid object
ok 403 - $x = Math::BigInt->bnorm("0x80000001");
ok 404 - is a valid object
ok 405 - $x = Math::BigInt->bnorm("0x100000001");
ok 406 - is a valid object
ok 407 - $x = Math::BigInt->bnorm("0x200000001");
ok 408 - is a valid object
ok 409 - $x = Math::BigInt->bnorm("0x400000001");
ok 410 - is a valid object
ok 411 - $x = Math::BigInt->bnorm("0x800000001");
ok 412 - is a valid object
ok 413 - $x = Math::BigInt->bnorm("0x2dd59e18a125dbed30a6ab1d93e9c855569f44f75806f0645dc9a2e98b808c3");
ok 414 - is a valid object
ok 415 - $x = Math::BigInt->bnorm("inf");
ok 416 - is a valid object
ok 417 - $x = Math::BigInt->bnorm("+inf");
ok 418 - is a valid object
ok 419 - $x = Math::BigInt->bnorm("-inf");
ok 420 - is a valid object
ok 421 - $x = Math::BigInt->bnorm("0inf");
ok 422 - is a valid object
ok 423 - $x = Math::BigInt->bnorm("");
ok 424 - is a valid object
ok 425 - $x = Math::BigInt->bnorm("abc");
ok 426 - is a valid object
ok 427 - $x = Math::BigInt->bnorm(" 1 a");
ok 428 - is a valid object
ok 429 - $x = Math::BigInt->bnorm("1bcd2");
ok 430 - is a valid object
ok 431 - $x = Math::BigInt->bnorm("11111b");
ok 432 - is a valid object
ok 433 - $x = Math::BigInt->bnorm("+1z");
ok 434 - is a valid object
ok 435 - $x = Math::BigInt->bnorm("-1z");
ok 436 - is a valid object
ok 437 - $x = Math::BigInt->bnorm("_123");
ok 438 - is a valid object
ok 439 - $x = Math::BigInt->bnorm("_123_");
ok 440 - is a valid object
ok 441 - $x = Math::BigInt->bnorm("123_");
ok 442 - is a valid object
ok 443 - $x = Math::BigInt->bnorm("1__23");
ok 444 - is a valid object
ok 445 - $x = Math::BigInt->bnorm("1E1__2");
ok 446 - is a valid object
ok 447 - $x = Math::BigInt->bnorm("1_E12");
ok 448 - is a valid object
ok 449 - $x = Math::BigInt->bnorm("1E_12");
ok 450 - is a valid object
ok 451 - $x = Math::BigInt->bnorm("1_E_12");
ok 452 - is a valid object
ok 453 - $x = Math::BigInt->bnorm("+_1E12");
ok 454 - is a valid object
ok 455 - $x = Math::BigInt->bnorm("+0_1E2");
ok 456 - is a valid object
ok 457 - $x = Math::BigInt->bnorm("+0_0_1E2");
ok 458 - is a valid object
ok 459 - $x = Math::BigInt->bnorm("-0_0_1E2");
ok 460 - is a valid object
ok 461 - $x = Math::BigInt->bnorm("-0_0_1E+0_0_2");
ok 462 - is a valid object
ok 463 - $x = Math::BigInt->bnorm("E1");
ok 464 - is a valid object
ok 465 - $x = Math::BigInt->bnorm("E23");
ok 466 - is a valid object
ok 467 - $x = Math::BigInt->bnorm("1.23E1");
ok 468 - is a valid object
ok 469 - $x = Math::BigInt->bnorm("1.23E-1");
ok 470 - is a valid object
ok 471 - $x = Math::BigInt->bnorm("1e2e3");
ok 472 - is a valid object
ok 473 - $x = Math::BigInt->bnorm("1e2r");
ok 474 - is a valid object
ok 475 - $x = Math::BigInt->bnorm("1e2.0");
ok 476 - is a valid object
ok 477 - $x = Math::BigInt->bnorm("1.2.2");
ok 478 - is a valid object
ok 479 - $x = Math::BigInt->bnorm("1.2.3e1");
ok 480 - is a valid object
ok 481 - $x = Math::BigInt->bnorm("-1.2.3");
ok 482 - is a valid object
ok 483 - $x = Math::BigInt->bnorm("-1.2.3e-4");
ok 484 - is a valid object
ok 485 - $x = Math::BigInt->bnorm("1.2e3.4");
ok 486 - is a valid object
ok 487 - $x = Math::BigInt->bnorm("1.2e-3.4");
ok 488 - is a valid object
ok 489 - $x = Math::BigInt->bnorm("1.2.3.4");
ok 490 - is a valid object
ok 491 - $x = Math::BigInt->bnorm("1.2.t");
ok 492 - is a valid object
ok 493 - $x = Math::BigInt->bnorm("1..2");
ok 494 - is a valid object
ok 495 - $x = Math::BigInt->bnorm("1..2e1");
ok 496 - is a valid object
ok 497 - $x = Math::BigInt->bnorm("1..2e1..1");
ok 498 - is a valid object
ok 499 - $x = Math::BigInt->bnorm("12e1..1");
ok 500 - is a valid object
ok 501 - $x = Math::BigInt->bnorm("..2");
ok 502 - is a valid object
ok 503 - $x = Math::BigInt->bnorm(".-2");
ok 504 - is a valid object
ok 505 - $x = Math::BigInt->bnorm("012");
ok 506 - is a valid object
ok 507 - $x = Math::BigInt->bnorm("0123");
ok 508 - is a valid object
ok 509 - $x = Math::BigInt->bnorm("01234");
ok 510 - is a valid object
ok 511 - $x = Math::BigInt->bnorm("012345");
ok 512 - is a valid object
ok 513 - $x = Math::BigInt->bnorm("0123456");
ok 514 - is a valid object
ok 515 - $x = Math::BigInt->bnorm("01234567");
ok 516 - is a valid object
ok 517 - $x = Math::BigInt->bnorm("012345678");
ok 518 - is a valid object
ok 519 - $x = Math::BigInt->bnorm("0123456789");
ok 520 - is a valid object
ok 521 - $x = Math::BigInt->bnorm("01234567891");
ok 522 - is a valid object
ok 523 - $x = Math::BigInt->bnorm("012345678912");
ok 524 - is a valid object
ok 525 - $x = Math::BigInt->bnorm("0123456789123");
ok 526 - is a valid object
ok 527 - $x = Math::BigInt->bnorm("01234567891234");
ok 528 - is a valid object
ok 529 - $x = Math::BigInt->bnorm("0e0");
ok 530 - is a valid object
ok 531 - $x = Math::BigInt->bnorm("+0e0");
ok 532 - is a valid object
ok 533 - $x = Math::BigInt->bnorm("+0e+0");
ok 534 - is a valid object
ok 535 - $x = Math::BigInt->bnorm("-0e+0");
ok 536 - is a valid object
ok 537 - $x = Math::BigInt->bnorm("0e-0");
ok 538 - is a valid object
ok 539 - $x = Math::BigInt->bnorm("-0e-0");
ok 540 - is a valid object
ok 541 - $x = Math::BigInt->bnorm("+0e-0");
ok 542 - is a valid object
ok 543 - $x = Math::BigInt->bnorm("000");
ok 544 - is a valid object
ok 545 - $x = Math::BigInt->bnorm("00e2");
ok 546 - is a valid object
ok 547 - $x = Math::BigInt->bnorm("00e02");
ok 548 - is a valid object
ok 549 - $x = Math::BigInt->bnorm("000e002");
ok 550 - is a valid object
ok 551 - $x = Math::BigInt->bnorm("000e1230");
ok 552 - is a valid object
ok 553 - $x = Math::BigInt->bnorm("00e-3");
ok 554 - is a valid object
ok 555 - $x = Math::BigInt->bnorm("00e+3");
ok 556 - is a valid object
ok 557 - $x = Math::BigInt->bnorm("00e-03");
ok 558 - is a valid object
ok 559 - $x = Math::BigInt->bnorm("00e+03");
ok 560 - is a valid object
ok 561 - $x = Math::BigInt->bnorm("-000");
ok 562 - is a valid object
ok 563 - $x = Math::BigInt->bnorm("-00e2");
ok 564 - is a valid object
ok 565 - $x = Math::BigInt->bnorm("-00e02");
ok 566 - is a valid object
ok 567 - $x = Math::BigInt->bnorm("-000e002");
ok 568 - is a valid object
ok 569 - $x = Math::BigInt->bnorm("-000e1230");
ok 570 - is a valid object
ok 571 - $x = Math::BigInt->bnorm("-00e-3");
ok 572 - is a valid object
ok 573 - $x = Math::BigInt->bnorm("-00e+3");
ok 574 - is a valid object
ok 575 - $x = Math::BigInt->bnorm("-00e-03");
ok 576 - is a valid object
ok 577 - $x = Math::BigInt->bnorm("-00e+03");
ok 578 - is a valid object
ok 579 - $x = Math::BigInt->bnorm("0");
ok 580 - is a valid object
ok 581 - $x = Math::BigInt->bnorm("+0");
ok 582 - is a valid object
ok 583 - $x = Math::BigInt->bnorm("+00");
ok 584 - is a valid object
ok 585 - $x = Math::BigInt->bnorm("+000");
ok 586 - is a valid object
ok 587 - $x = Math::BigInt->bnorm("000000000000000000");
ok 588 - is a valid object
ok 589 - $x = Math::BigInt->bnorm("-0");
ok 590 - is a valid object
ok 591 - $x = Math::BigInt->bnorm("-0000");
ok 592 - is a valid object
ok 593 - $x = Math::BigInt->bnorm("+1");
ok 594 - is a valid object
ok 595 - $x = Math::BigInt->bnorm("+01");
ok 596 - is a valid object
ok 597 - $x = Math::BigInt->bnorm("+001");
ok 598 - is a valid object
ok 599 - $x = Math::BigInt->bnorm("+00000100000");
ok 600 - is a valid object
ok 601 - $x = Math::BigInt->bnorm("123456789");
ok 602 - is a valid object
ok 603 - $x = Math::BigInt->bnorm("-1");
ok 604 - is a valid object
ok 605 - $x = Math::BigInt->bnorm("-01");
ok 606 - is a valid object
ok 607 - $x = Math::BigInt->bnorm("-001");
ok 608 - is a valid object
ok 609 - $x = Math::BigInt->bnorm("-123456789");
ok 610 - is a valid object
ok 611 - $x = Math::BigInt->bnorm("-00000100000");
ok 612 - is a valid object
ok 613 - $x = Math::BigInt->bnorm("1_2_3");
ok 614 - is a valid object
ok 615 - $x = Math::BigInt->bnorm("10000000000E-1_0");
ok 616 - is a valid object
ok 617 - $x = Math::BigInt->bnorm("1E2");
ok 618 - is a valid object
ok 619 - $x = Math::BigInt->bnorm("1E1");
ok 620 - is a valid object
ok 621 - $x = Math::BigInt->bnorm("1E0");
ok 622 - is a valid object
ok 623 - $x = Math::BigInt->bnorm("1.23E2");
ok 624 - is a valid object
ok 625 - $x = Math::BigInt->bnorm("100E-1");
ok 626 - is a valid object
ok 627 - $x = Math::BigInt->bnorm("1.E3");
ok 628 - is a valid object
ok 629 - $x = Math::BigInt->bnorm("1.01E2");
ok 630 - is a valid object
ok 631 - $x = Math::BigInt->bnorm("1010E-1");
ok 632 - is a valid object
ok 633 - $x = Math::BigInt->bnorm("-1010E0");
ok 634 - is a valid object
ok 635 - $x = Math::BigInt->bnorm("-1010E1");
ok 636 - is a valid object
ok 637 - $x = Math::BigInt->bnorm("1234.00");
ok 638 - is a valid object
ok 639 - $x = Math::BigInt->bnorm("-1010E-2");
ok 640 - is a valid object
ok 641 - $x = Math::BigInt->bnorm("-1.01E+1");
ok 642 - is a valid object
ok 643 - $x = Math::BigInt->bnorm("-1.01E-1");
ok 644 - is a valid object
ok 645 - $x = Math::BigInt->bnorm("1E-999999");
ok 646 - is a valid object
ok 647 - $x = Math::BigInt->bnorm("0.5");
ok 648 - is a valid object
ok 649 - $x = Math::BigInt->new("1"); $x->bnan();
ok 650 - is a valid object
ok 651 - $x = Math::BigInt->new("2"); $x->bnan();
ok 652 - is a valid object
ok 653 - $x = Math::BigInt->new("abc"); $x->bnan();
ok 654 - is a valid object
ok 655 - $x = Math::BigInt->new("2"); $x->bone("+");
ok 656 - is a valid object
ok 657 - $x = Math::BigInt->new("2"); $x->bone("-");
ok 658 - is a valid object
ok 659 - $x = Math::BigInt->new("boneNaN"); $x->bone("-");
ok 660 - is a valid object
ok 661 - $x = Math::BigInt->new("boneNaN"); $x->bone("+");
ok 662 - is a valid object
ok 663 - $x = Math::BigInt->new("2"); $x->bone("abc");
ok 664 - is a valid object
ok 665 - $x = Math::BigInt->new("3"); $x->bone("");
ok 666 - is a valid object
ok 667 - $x = Math::BigInt->new("1"); $x->binf("+");
ok 668 - is a valid object
ok 669 - $x = Math::BigInt->new("2"); $x->binf("-");
ok 670 - is a valid object
ok 671 - $x = Math::BigInt->new("3"); $x->binf("abc");
ok 672 - is a valid object
ok 673 - $x = Math::BigInt->new("123"); $x->is_nan() || 0;
ok 674 - $x = Math::BigInt->new("abc"); $x->is_nan() || 0;
ok 675 - $x = Math::BigInt->new("NaN"); $x->is_nan() || 0;
ok 676 - $x = Math::BigInt->new("-123"); $x->is_nan() || 0;
ok 677 - $x = Math::BigInt->new("+inf"); $x->is_inf("");
ok 678 - $x = Math::BigInt->new("-inf"); $x->is_inf("");
ok 679 - $x = Math::BigInt->new("abc"); $x->is_inf("");
ok 680 - $x = Math::BigInt->new("1"); $x->is_inf("");
ok 681 - $x = Math::BigInt->new("NaN"); $x->is_inf("");
ok 682 - $x = Math::BigInt->new("-1"); $x->is_inf("");
ok 683 - $x = Math::BigInt->new("+inf"); $x->is_inf("-");
ok 684 - $x = Math::BigInt->new("+inf"); $x->is_inf("+");
ok 685 - $x = Math::BigInt->new("-inf"); $x->is_inf("-");
ok 686 - $x = Math::BigInt->new("-inf"); $x->is_inf("+");
ok 687 - $x = Math::BigInt->new("-inf"); $x->is_inf("-inf");
ok 688 - $x = Math::BigInt->new("-inf"); $x->is_inf("+inf");
ok 689 - $x = Math::BigInt->new("+inf"); $x->is_inf("-inf");
ok 690 - $x = Math::BigInt->new("+inf"); $x->is_inf("+inf");
ok 691 - $x = Math::BigInt->new("+iNfInItY"); $x->is_inf("");
ok 692 - $x = Math::BigInt->new("-InFiNiTy"); $x->is_inf("");
ok 693 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x << $y;
ok 694 - is a valid object
ok 695 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+2"); $x << $y;
ok 696 - is a valid object
ok 697 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+32"); $x << $y;
ok 698 - is a valid object
ok 699 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+48"); $x << $y;
ok 700 - is a valid object
ok 701 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("-2"); $x << $y;
ok 702 - is a valid object
ok 703 - $x = Math::BigInt->new("+12345"); $y = Math::BigInt->new("4"); $x->blsft($y, 10);
ok 704 - is a valid object
ok 705 - $x = Math::BigInt->new("-1234"); $y = Math::BigInt->new("0"); $x->blsft($y, 10);
ok 706 - is a valid object
ok 707 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("0"); $x->blsft($y, 10);
ok 708 - is a valid object
ok 709 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("2"); $x->blsft($y, 10);
ok 710 - is a valid object
ok 711 - $x = Math::BigInt->new("+12"); $y = Math::BigInt->new("2"); $x->blsft($y, 10);
ok 712 - is a valid object
ok 713 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("-3"); $x->blsft($y, 10);
ok 714 - is a valid object
ok 715 - $x = Math::BigInt->new("1234567890123"); $y = Math::BigInt->new("12"); $x->blsft($y, 10);
ok 716 - is a valid object
ok 717 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("1"); $x->blsft($y, 2);
ok 718 - is a valid object
ok 719 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("1"); $x->blsft($y, 2);
ok 720 - is a valid object
ok 721 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $x->blsft($y, 2);
ok 722 - is a valid object
ok 723 - $x = Math::BigInt->new("-102533203"); $y = Math::BigInt->new("1"); $x->blsft($y, 2);
ok 724 - is a valid object
ok 725 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x >> $y;
ok 726 - is a valid object
ok 727 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x >> $y;
ok 728 - is a valid object
ok 729 - $x = Math::BigInt->new("+4294967296"); $y = Math::BigInt->new("+32"); $x >> $y;
ok 730 - is a valid object
ok 731 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("+48"); $x >> $y;
ok 732 - is a valid object
ok 733 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-2"); $x >> $y;
ok 734 - is a valid object
ok 735 - $x = Math::BigInt->new("-1234"); $y = Math::BigInt->new("0"); $x->brsft($y, 10);
ok 736 - is a valid object
ok 737 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("0"); $x->brsft($y, 10);
ok 738 - is a valid object
ok 739 - $x = Math::BigInt->new("+200"); $y = Math::BigInt->new("2"); $x->brsft($y, 10);
ok 740 - is a valid object
ok 741 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("3"); $x->brsft($y, 10);
ok 742 - is a valid object
ok 743 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("2"); $x->brsft($y, 10);
ok 744 - is a valid object
ok 745 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("-3"); $x->brsft($y, 10);
ok 746 - is a valid object
ok 747 - $x = Math::BigInt->new("310000"); $y = Math::BigInt->new("4"); $x->brsft($y, 10);
ok 748 - is a valid object
ok 749 - $x = Math::BigInt->new("12300000"); $y = Math::BigInt->new("5"); $x->brsft($y, 10);
ok 750 - is a valid object
ok 751 - $x = Math::BigInt->new("1230000000000"); $y = Math::BigInt->new("10"); $x->brsft($y, 10);
ok 752 - is a valid object
ok 753 - $x = Math::BigInt->new("09876123456789067890"); $y = Math::BigInt->new("12"); $x->brsft($y, 10);
ok 754 - is a valid object
ok 755 - $x = Math::BigInt->new("1234561234567890123"); $y = Math::BigInt->new("13"); $x->brsft($y, 10);
ok 756 - is a valid object
ok 757 - $x = Math::BigInt->new("820265627"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 758 - is a valid object
ok 759 - $x = Math::BigInt->new("-15"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 760 - is a valid object
ok 761 - $x = Math::BigInt->new("-14"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 762 - is a valid object
ok 763 - $x = Math::BigInt->new("-13"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 764 - is a valid object
ok 765 - $x = Math::BigInt->new("-12"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 766 - is a valid object
ok 767 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 768 - is a valid object
ok 769 - $x = Math::BigInt->new("-10"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 770 - is a valid object
ok 771 - $x = Math::BigInt->new("-9"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 772 - is a valid object
ok 773 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 774 - is a valid object
ok 775 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 776 - is a valid object
ok 777 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 778 - is a valid object
ok 779 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 780 - is a valid object
ok 781 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 782 - is a valid object
ok 783 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 784 - is a valid object
ok 785 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 786 - is a valid object
ok 787 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 788 - is a valid object
ok 789 - $x = Math::BigInt->new("-1640531254"); $y = Math::BigInt->new("2"); $x->brsft($y, 2);
ok 790 - is a valid object
ok 791 - $x = Math::BigInt->new("-1640531254"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 792 - is a valid object
ok 793 - $x = Math::BigInt->new("-820265627"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 794 - is a valid object
ok 795 - $x = Math::BigInt->new("-205066405"); $y = Math::BigInt->new("1"); $x->brsft($y, 2);
ok 796 - is a valid object
ok 797 - $x = Math::BigInt->new("+inf"); $x->bsstr();
ok 798 - $x = Math::BigInt->new("-inf"); $x->bsstr();
ok 799 - $x = Math::BigInt->new("1e+34"); $x->bsstr();
ok 800 - $x = Math::BigInt->new("123.456E3"); $x->bsstr();
ok 801 - $x = Math::BigInt->new("100"); $x->bsstr();
ok 802 - $x = Math::BigInt->new("bsstrabc"); $x->bsstr();
ok 803 - $x = Math::BigInt->new("-5"); $x->bsstr();
ok 804 - $x = Math::BigInt->new("-100"); $x->bsstr();
ok 805 - $x = Math::BigInt->new("5"); $x->numify();
ok 806 - $x = Math::BigInt->new("-5"); $x->numify();
ok 807 - $x = Math::BigInt->new("100"); $x->numify();
ok 808 - $x = Math::BigInt->new("-100"); $x->numify();
ok 809 - $x = Math::BigInt->new("bnegNaN"); $x->bneg();
ok 810 - is a valid object
ok 811 - $x = Math::BigInt->new("+inf"); $x->bneg();
ok 812 - is a valid object
ok 813 - $x = Math::BigInt->new("-inf"); $x->bneg();
ok 814 - is a valid object
ok 815 - $x = Math::BigInt->new("abd"); $x->bneg();
ok 816 - is a valid object
ok 817 - $x = Math::BigInt->new("0"); $x->bneg();
ok 818 - is a valid object
ok 819 - $x = Math::BigInt->new("1"); $x->bneg();
ok 820 - is a valid object
ok 821 - $x = Math::BigInt->new("-1"); $x->bneg();
ok 822 - is a valid object
ok 823 - $x = Math::BigInt->new("+123456789"); $x->bneg();
ok 824 - is a valid object
ok 825 - $x = Math::BigInt->new("-123456789"); $x->bneg();
ok 826 - is a valid object
ok 827 - $x = Math::BigInt->new("babsNaN"); $x->babs();
ok 828 - is a valid object
ok 829 - $x = Math::BigInt->new("+inf"); $x->babs();
ok 830 - is a valid object
ok 831 - $x = Math::BigInt->new("-inf"); $x->babs();
ok 832 - is a valid object
ok 833 - $x = Math::BigInt->new("0"); $x->babs();
ok 834 - is a valid object
ok 835 - $x = Math::BigInt->new("1"); $x->babs();
ok 836 - is a valid object
ok 837 - $x = Math::BigInt->new("-1"); $x->babs();
ok 838 - is a valid object
ok 839 - $x = Math::BigInt->new("+123456789"); $x->babs();
ok 840 - is a valid object
ok 841 - $x = Math::BigInt->new("-123456789"); $x->babs();
ok 842 - is a valid object
ok 843 - $x = Math::BigInt->new("NaN"); $x->bsgn();
ok 844 - is a valid object
ok 845 - $x = Math::BigInt->new("+inf"); $x->bsgn();
ok 846 - is a valid object
ok 847 - $x = Math::BigInt->new("-inf"); $x->bsgn();
ok 848 - is a valid object
ok 849 - $x = Math::BigInt->new("0"); $x->bsgn();
ok 850 - is a valid object
ok 851 - $x = Math::BigInt->new("+123456789"); $x->bsgn();
ok 852 - is a valid object
ok 853 - $x = Math::BigInt->new("-123456789"); $x->bsgn();
ok 854 - is a valid object
ok 855 - $x = Math::BigInt->new("bcmpNaN"); $y = Math::BigInt->new("bcmpNaN"); $x->bcmp($y);
ok 856 - $x = Math::BigInt->new("bcmpNaN"); $y = Math::BigInt->new("0"); $x->bcmp($y);
ok 857 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("bcmpNaN"); $x->bcmp($y);
ok 858 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->bcmp($y);
ok 859 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x->bcmp($y);
ok 860 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x->bcmp($y);
ok 861 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x->bcmp($y);
ok 862 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->bcmp($y);
ok 863 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->bcmp($y);
ok 864 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x->bcmp($y);
ok 865 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x->bcmp($y);
ok 866 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->bcmp($y);
ok 867 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("123"); $x->bcmp($y);
ok 868 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("12"); $x->bcmp($y);
ok 869 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("123"); $x->bcmp($y);
ok 870 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-123"); $x->bcmp($y);
ok 871 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-12"); $x->bcmp($y);
ok 872 - $x = Math::BigInt->new("-12"); $y = Math::BigInt->new("-123"); $x->bcmp($y);
ok 873 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("124"); $x->bcmp($y);
ok 874 - $x = Math::BigInt->new("124"); $y = Math::BigInt->new("123"); $x->bcmp($y);
ok 875 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-124"); $x->bcmp($y);
ok 876 - $x = Math::BigInt->new("-124"); $y = Math::BigInt->new("-123"); $x->bcmp($y);
ok 877 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("5"); $x->bcmp($y);
ok 878 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("987654321"); $x->bcmp($y);
ok 879 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x->bcmp($y);
ok 880 - $x = Math::BigInt->new("-987654321"); $y = Math::BigInt->new("123456789"); $x->bcmp($y);
ok 881 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5432112345"); $x->bcmp($y);
ok 882 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("5432112345"); $x->bcmp($y);
ok 883 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5432112345"); $x->bcmp($y);
ok 884 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-5432112345"); $x->bcmp($y);
ok 885 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x->bcmp($y);
ok 886 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->bcmp($y);
ok 887 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x->bcmp($y);
ok 888 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x->bcmp($y);
ok 889 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x->bcmp($y);
ok 890 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x->bcmp($y);
ok 891 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x->bcmp($y);
ok 892 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x->bcmp($y);
ok 893 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaN"); $x->bcmp($y);
ok 894 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->bcmp($y);
ok 895 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x->bcmp($y);
ok 896 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("-inf"); $x->bcmp($y);
ok 897 - $x = Math::BigInt->new("abc"); $x->binc();
ok 898 - is a valid object
ok 899 - $x = Math::BigInt->new("+inf"); $x->binc();
ok 900 - is a valid object
ok 901 - $x = Math::BigInt->new("-inf"); $x->binc();
ok 902 - is a valid object
ok 903 - $x = Math::BigInt->new("+0"); $x->binc();
ok 904 - is a valid object
ok 905 - $x = Math::BigInt->new("+1"); $x->binc();
ok 906 - is a valid object
ok 907 - $x = Math::BigInt->new("-1"); $x->binc();
ok 908 - is a valid object
ok 909 - $x = Math::BigInt->new("abc"); $x->bdec();
ok 910 - is a valid object
ok 911 - $x = Math::BigInt->new("+inf"); $x->bdec();
ok 912 - is a valid object
ok 913 - $x = Math::BigInt->new("-inf"); $x->bdec();
ok 914 - is a valid object
ok 915 - $x = Math::BigInt->new("+0"); $x->bdec();
ok 916 - is a valid object
ok 917 - $x = Math::BigInt->new("+1"); $x->bdec();
ok 918 - is a valid object
ok 919 - $x = Math::BigInt->new("-1"); $x->bdec();
ok 920 - is a valid object
ok 921 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x + $y;
ok 922 - is a valid object
ok 923 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x + $y;
ok 924 - is a valid object
ok 925 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $x + $y;
ok 926 - is a valid object
ok 927 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x + $y;
ok 928 - is a valid object
ok 929 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x + $y;
ok 930 - is a valid object
ok 931 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x + $y;
ok 932 - is a valid object
ok 933 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x + $y;
ok 934 - is a valid object
ok 935 - $x = Math::BigInt->new("baddNaN"); $y = Math::BigInt->new("+inf"); $x + $y;
ok 936 - is a valid object
ok 937 - $x = Math::BigInt->new("baddNaN"); $y = Math::BigInt->new("+inf"); $x + $y;
ok 938 - is a valid object
ok 939 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("baddNaN"); $x + $y;
ok 940 - is a valid object
ok 941 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("baddNaN"); $x + $y;
ok 942 - is a valid object
ok 943 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x + $y;
ok 944 - is a valid object
ok 945 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x + $y;
ok 946 - is a valid object
ok 947 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x + $y;
ok 948 - is a valid object
ok 949 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x + $y;
ok 950 - is a valid object
ok 951 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x + $y;
ok 952 - is a valid object
ok 953 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x + $y;
ok 954 - is a valid object
ok 955 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x + $y;
ok 956 - is a valid object
ok 957 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x + $y;
ok 958 - is a valid object
ok 959 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x + $y;
ok 960 - is a valid object
ok 961 - $x = Math::BigInt->new("+9"); $y = Math::BigInt->new("+1"); $x + $y;
ok 962 - is a valid object
ok 963 - $x = Math::BigInt->new("+99"); $y = Math::BigInt->new("+1"); $x + $y;
ok 964 - is a valid object
ok 965 - $x = Math::BigInt->new("+999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 966 - is a valid object
ok 967 - $x = Math::BigInt->new("+9999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 968 - is a valid object
ok 969 - $x = Math::BigInt->new("+99999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 970 - is a valid object
ok 971 - $x = Math::BigInt->new("+999999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 972 - is a valid object
ok 973 - $x = Math::BigInt->new("+9999999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 974 - is a valid object
ok 975 - $x = Math::BigInt->new("+99999999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 976 - is a valid object
ok 977 - $x = Math::BigInt->new("+999999999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 978 - is a valid object
ok 979 - $x = Math::BigInt->new("+9999999999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 980 - is a valid object
ok 981 - $x = Math::BigInt->new("+99999999999"); $y = Math::BigInt->new("+1"); $x + $y;
ok 982 - is a valid object
ok 983 - $x = Math::BigInt->new("+10"); $y = Math::BigInt->new("-1"); $x + $y;
ok 984 - is a valid object
ok 985 - $x = Math::BigInt->new("+100"); $y = Math::BigInt->new("-1"); $x + $y;
ok 986 - is a valid object
ok 987 - $x = Math::BigInt->new("+1000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 988 - is a valid object
ok 989 - $x = Math::BigInt->new("+10000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 990 - is a valid object
ok 991 - $x = Math::BigInt->new("+100000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 992 - is a valid object
ok 993 - $x = Math::BigInt->new("+1000000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 994 - is a valid object
ok 995 - $x = Math::BigInt->new("+10000000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 996 - is a valid object
ok 997 - $x = Math::BigInt->new("+100000000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 998 - is a valid object
ok 999 - $x = Math::BigInt->new("+1000000000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 1000 - is a valid object
ok 1001 - $x = Math::BigInt->new("+10000000000"); $y = Math::BigInt->new("-1"); $x + $y;
ok 1002 - is a valid object
ok 1003 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("987654321"); $x + $y;
ok 1004 - is a valid object
ok 1005 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("987654321"); $x + $y;
ok 1006 - is a valid object
ok 1007 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("-987654321"); $x + $y;
ok 1008 - is a valid object
ok 1009 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x + $y;
ok 1010 - is a valid object
ok 1011 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10001"); $x + $y;
ok 1012 - is a valid object
ok 1013 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("100001"); $x + $y;
ok 1014 - is a valid object
ok 1015 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1000001"); $x + $y;
ok 1016 - is a valid object
ok 1017 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10000001"); $x + $y;
ok 1018 - is a valid object
ok 1019 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("100000001"); $x + $y;
ok 1020 - is a valid object
ok 1021 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1000000001"); $x + $y;
ok 1022 - is a valid object
ok 1023 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10000000001"); $x + $y;
ok 1024 - is a valid object
ok 1025 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("100000000001"); $x + $y;
ok 1026 - is a valid object
ok 1027 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1000000000001"); $x + $y;
ok 1028 - is a valid object
ok 1029 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10000000000001"); $x + $y;
ok 1030 - is a valid object
ok 1031 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10001"); $x + $y;
ok 1032 - is a valid object
ok 1033 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-100001"); $x + $y;
ok 1034 - is a valid object
ok 1035 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1000001"); $x + $y;
ok 1036 - is a valid object
ok 1037 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10000001"); $x + $y;
ok 1038 - is a valid object
ok 1039 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-100000001"); $x + $y;
ok 1040 - is a valid object
ok 1041 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1000000001"); $x + $y;
ok 1042 - is a valid object
ok 1043 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10000000001"); $x + $y;
ok 1044 - is a valid object
ok 1045 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-100000000001"); $x + $y;
ok 1046 - is a valid object
ok 1047 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1000000000001"); $x + $y;
ok 1048 - is a valid object
ok 1049 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10000000000001"); $x + $y;
ok 1050 - is a valid object
ok 1051 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x - $y;
ok 1052 - is a valid object
ok 1053 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); $x - $y;
ok 1054 - is a valid object
ok 1055 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $x - $y;
ok 1056 - is a valid object
ok 1057 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x - $y;
ok 1058 - is a valid object
ok 1059 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x - $y;
ok 1060 - is a valid object
ok 1061 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x - $y;
ok 1062 - is a valid object
ok 1063 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x - $y;
ok 1064 - is a valid object
ok 1065 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); $x - $y;
ok 1066 - is a valid object
ok 1067 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); $x - $y;
ok 1068 - is a valid object
ok 1069 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1070 - is a valid object
ok 1071 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1072 - is a valid object
ok 1073 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+0"); $x - $y;
ok 1074 - is a valid object
ok 1075 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1076 - is a valid object
ok 1077 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1078 - is a valid object
ok 1079 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1080 - is a valid object
ok 1081 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1082 - is a valid object
ok 1083 - $x = Math::BigInt->new("+9"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1084 - is a valid object
ok 1085 - $x = Math::BigInt->new("+99"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1086 - is a valid object
ok 1087 - $x = Math::BigInt->new("+999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1088 - is a valid object
ok 1089 - $x = Math::BigInt->new("+9999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1090 - is a valid object
ok 1091 - $x = Math::BigInt->new("+99999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1092 - is a valid object
ok 1093 - $x = Math::BigInt->new("+999999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1094 - is a valid object
ok 1095 - $x = Math::BigInt->new("+9999999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1096 - is a valid object
ok 1097 - $x = Math::BigInt->new("+99999999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1098 - is a valid object
ok 1099 - $x = Math::BigInt->new("+999999999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1100 - is a valid object
ok 1101 - $x = Math::BigInt->new("+9999999999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1102 - is a valid object
ok 1103 - $x = Math::BigInt->new("+99999999999"); $y = Math::BigInt->new("+1"); $x - $y;
ok 1104 - is a valid object
ok 1105 - $x = Math::BigInt->new("+10"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1106 - is a valid object
ok 1107 - $x = Math::BigInt->new("+100"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1108 - is a valid object
ok 1109 - $x = Math::BigInt->new("+1000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1110 - is a valid object
ok 1111 - $x = Math::BigInt->new("+10000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1112 - is a valid object
ok 1113 - $x = Math::BigInt->new("+100000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1114 - is a valid object
ok 1115 - $x = Math::BigInt->new("+1000000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1116 - is a valid object
ok 1117 - $x = Math::BigInt->new("+10000000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1118 - is a valid object
ok 1119 - $x = Math::BigInt->new("+100000000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1120 - is a valid object
ok 1121 - $x = Math::BigInt->new("+1000000000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1122 - is a valid object
ok 1123 - $x = Math::BigInt->new("+10000000000"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1124 - is a valid object
ok 1125 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("+987654321"); $x - $y;
ok 1126 - is a valid object
ok 1127 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("+987654321"); $x - $y;
ok 1128 - is a valid object
ok 1129 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("-987654321"); $x - $y;
ok 1130 - is a valid object
ok 1131 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x - $y;
ok 1132 - is a valid object
ok 1133 - $x = Math::BigInt->new("10001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1134 - is a valid object
ok 1135 - $x = Math::BigInt->new("100001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1136 - is a valid object
ok 1137 - $x = Math::BigInt->new("1000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1138 - is a valid object
ok 1139 - $x = Math::BigInt->new("10000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1140 - is a valid object
ok 1141 - $x = Math::BigInt->new("100000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1142 - is a valid object
ok 1143 - $x = Math::BigInt->new("1000000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1144 - is a valid object
ok 1145 - $x = Math::BigInt->new("10000000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1146 - is a valid object
ok 1147 - $x = Math::BigInt->new("100000000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1148 - is a valid object
ok 1149 - $x = Math::BigInt->new("1000000000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1150 - is a valid object
ok 1151 - $x = Math::BigInt->new("10000000000001"); $y = Math::BigInt->new("1"); $x - $y;
ok 1152 - is a valid object
ok 1153 - $x = Math::BigInt->new("10001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1154 - is a valid object
ok 1155 - $x = Math::BigInt->new("100001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1156 - is a valid object
ok 1157 - $x = Math::BigInt->new("1000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1158 - is a valid object
ok 1159 - $x = Math::BigInt->new("10000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1160 - is a valid object
ok 1161 - $x = Math::BigInt->new("100000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1162 - is a valid object
ok 1163 - $x = Math::BigInt->new("1000000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1164 - is a valid object
ok 1165 - $x = Math::BigInt->new("10000000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1166 - is a valid object
ok 1167 - $x = Math::BigInt->new("100000000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1168 - is a valid object
ok 1169 - $x = Math::BigInt->new("1000000000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1170 - is a valid object
ok 1171 - $x = Math::BigInt->new("10000000000001"); $y = Math::BigInt->new("-1"); $x - $y;
ok 1172 - is a valid object
ok 1173 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1174 - is a valid object
ok 1175 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1176 - is a valid object
ok 1177 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1178 - is a valid object
ok 1179 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("abc"); $x->bmuladd($y, $z);
ok 1180 - is a valid object
ok 1181 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("+inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1182 - is a valid object
ok 1183 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("-inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1184 - is a valid object
ok 1185 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaNmul"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1186 - is a valid object
ok 1187 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaNmul"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1188 - is a valid object
ok 1189 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1190 - is a valid object
ok 1191 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1192 - is a valid object
ok 1193 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1194 - is a valid object
ok 1195 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1196 - is a valid object
ok 1197 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1198 - is a valid object
ok 1199 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1200 - is a valid object
ok 1201 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1202 - is a valid object
ok 1203 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1204 - is a valid object
ok 1205 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1206 - is a valid object
ok 1207 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1208 - is a valid object
ok 1209 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("123456789123456789"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1210 - is a valid object
ok 1211 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1212 - is a valid object
ok 1213 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1214 - is a valid object
ok 1215 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1216 - is a valid object
ok 1217 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1218 - is a valid object
ok 1219 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1220 - is a valid object
ok 1221 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1222 - is a valid object
ok 1223 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("+3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1224 - is a valid object
ok 1225 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1226 - is a valid object
ok 1227 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1228 - is a valid object
ok 1229 - $x = Math::BigInt->new("111"); $y = Math::BigInt->new("111"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1230 - is a valid object
ok 1231 - $x = Math::BigInt->new("10101"); $y = Math::BigInt->new("10101"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1232 - is a valid object
ok 1233 - $x = Math::BigInt->new("1001001"); $y = Math::BigInt->new("1001001"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1234 - is a valid object
ok 1235 - $x = Math::BigInt->new("100010001"); $y = Math::BigInt->new("100010001"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1236 - is a valid object
ok 1237 - $x = Math::BigInt->new("10000100001"); $y = Math::BigInt->new("10000100001"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1238 - is a valid object
ok 1239 - $x = Math::BigInt->new("11111111111"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1240 - is a valid object
ok 1241 - $x = Math::BigInt->new("22222222222"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1242 - is a valid object
ok 1243 - $x = Math::BigInt->new("33333333333"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1244 - is a valid object
ok 1245 - $x = Math::BigInt->new("44444444444"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1246 - is a valid object
ok 1247 - $x = Math::BigInt->new("55555555555"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1248 - is a valid object
ok 1249 - $x = Math::BigInt->new("66666666666"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1250 - is a valid object
ok 1251 - $x = Math::BigInt->new("77777777777"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1252 - is a valid object
ok 1253 - $x = Math::BigInt->new("88888888888"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1254 - is a valid object
ok 1255 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z);
ok 1256 - is a valid object
ok 1257 - $x = Math::BigInt->new("11111111111"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1258 - is a valid object
ok 1259 - $x = Math::BigInt->new("22222222222"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1260 - is a valid object
ok 1261 - $x = Math::BigInt->new("33333333333"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1262 - is a valid object
ok 1263 - $x = Math::BigInt->new("44444444444"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1264 - is a valid object
ok 1265 - $x = Math::BigInt->new("55555555555"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1266 - is a valid object
ok 1267 - $x = Math::BigInt->new("66666666666"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1268 - is a valid object
ok 1269 - $x = Math::BigInt->new("77777777777"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1270 - is a valid object
ok 1271 - $x = Math::BigInt->new("88888888888"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1272 - is a valid object
ok 1273 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z);
ok 1274 - is a valid object
ok 1275 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("-4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z);
ok 1276 - is a valid object
ok 1277 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z);
ok 1278 - is a valid object
ok 1279 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z);
ok 1280 - is a valid object
ok 1281 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z);
ok 1282 - is a valid object
ok 1283 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("5"); $x->bmuladd($y, $z);
ok 1284 - is a valid object
ok 1285 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-4"); $z = Math::BigInt->new("5"); $x->bmuladd($y, $z);
ok 1286 - is a valid object
ok 1287 - $x = Math::BigInt->new("9999999999999999999"); $y = Math::BigInt->new("10000000000000000000"); $z = Math::BigInt->new("1234567890"); $x->bmuladd($y, $z);
ok 1288 - is a valid object
ok 1289 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("12345678901234567890"); $x->bmuladd($y, $z);
ok 1290 - is a valid object
ok 1291 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x * $y;
ok 1292 - is a valid object
ok 1293 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); $x * $y;
ok 1294 - is a valid object
ok 1295 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $x * $y;
ok 1296 - is a valid object
ok 1297 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("+inf"); $x * $y;
ok 1298 - is a valid object
ok 1299 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("-inf"); $x * $y;
ok 1300 - is a valid object
ok 1301 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaNmul"); $x * $y;
ok 1302 - is a valid object
ok 1303 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaNmul"); $x * $y;
ok 1304 - is a valid object
ok 1305 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x * $y;
ok 1306 - is a valid object
ok 1307 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x * $y;
ok 1308 - is a valid object
ok 1309 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x * $y;
ok 1310 - is a valid object
ok 1311 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x * $y;
ok 1312 - is a valid object
ok 1313 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); $x * $y;
ok 1314 - is a valid object
ok 1315 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $x * $y;
ok 1316 - is a valid object
ok 1317 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); $x * $y;
ok 1318 - is a valid object
ok 1319 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-1"); $x * $y;
ok 1320 - is a valid object
ok 1321 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+0"); $x * $y;
ok 1322 - is a valid object
ok 1323 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("0"); $x * $y;
ok 1324 - is a valid object
ok 1325 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("123456789123456789"); $x * $y;
ok 1326 - is a valid object
ok 1327 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x * $y;
ok 1328 - is a valid object
ok 1329 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x * $y;
ok 1330 - is a valid object
ok 1331 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x * $y;
ok 1332 - is a valid object
ok 1333 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); $x * $y;
ok 1334 - is a valid object
ok 1335 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+3"); $x * $y;
ok 1336 - is a valid object
ok 1337 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("+3"); $x * $y;
ok 1338 - is a valid object
ok 1339 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-3"); $x * $y;
ok 1340 - is a valid object
ok 1341 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x * $y;
ok 1342 - is a valid object
ok 1343 - $x = Math::BigInt->new("111"); $y = Math::BigInt->new("111"); $x * $y;
ok 1344 - is a valid object
ok 1345 - $x = Math::BigInt->new("10101"); $y = Math::BigInt->new("10101"); $x * $y;
ok 1346 - is a valid object
ok 1347 - $x = Math::BigInt->new("1001001"); $y = Math::BigInt->new("1001001"); $x * $y;
ok 1348 - is a valid object
ok 1349 - $x = Math::BigInt->new("100010001"); $y = Math::BigInt->new("100010001"); $x * $y;
ok 1350 - is a valid object
ok 1351 - $x = Math::BigInt->new("10000100001"); $y = Math::BigInt->new("10000100001"); $x * $y;
ok 1352 - is a valid object
ok 1353 - $x = Math::BigInt->new("11111111111"); $y = Math::BigInt->new("9"); $x * $y;
ok 1354 - is a valid object
ok 1355 - $x = Math::BigInt->new("22222222222"); $y = Math::BigInt->new("9"); $x * $y;
ok 1356 - is a valid object
ok 1357 - $x = Math::BigInt->new("33333333333"); $y = Math::BigInt->new("9"); $x * $y;
ok 1358 - is a valid object
ok 1359 - $x = Math::BigInt->new("44444444444"); $y = Math::BigInt->new("9"); $x * $y;
ok 1360 - is a valid object
ok 1361 - $x = Math::BigInt->new("55555555555"); $y = Math::BigInt->new("9"); $x * $y;
ok 1362 - is a valid object
ok 1363 - $x = Math::BigInt->new("66666666666"); $y = Math::BigInt->new("9"); $x * $y;
ok 1364 - is a valid object
ok 1365 - $x = Math::BigInt->new("77777777777"); $y = Math::BigInt->new("9"); $x * $y;
ok 1366 - is a valid object
ok 1367 - $x = Math::BigInt->new("88888888888"); $y = Math::BigInt->new("9"); $x * $y;
ok 1368 - is a valid object
ok 1369 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("9"); $x * $y;
ok 1370 - is a valid object
ok 1371 - $x = Math::BigInt->new("+25"); $y = Math::BigInt->new("+25"); $x * $y;
ok 1372 - is a valid object
ok 1373 - $x = Math::BigInt->new("+12345"); $y = Math::BigInt->new("+12345"); $x * $y;
ok 1374 - is a valid object
ok 1375 - $x = Math::BigInt->new("+99999"); $y = Math::BigInt->new("+11111"); $x * $y;
ok 1376 - is a valid object
ok 1377 - $x = Math::BigInt->new("9999"); $y = Math::BigInt->new("10000"); $x * $y;
ok 1378 - is a valid object
ok 1379 - $x = Math::BigInt->new("99999"); $y = Math::BigInt->new("100000"); $x * $y;
ok 1380 - is a valid object
ok 1381 - $x = Math::BigInt->new("999999"); $y = Math::BigInt->new("1000000"); $x * $y;
ok 1382 - is a valid object
ok 1383 - $x = Math::BigInt->new("9999999"); $y = Math::BigInt->new("10000000"); $x * $y;
ok 1384 - is a valid object
ok 1385 - $x = Math::BigInt->new("99999999"); $y = Math::BigInt->new("100000000"); $x * $y;
ok 1386 - is a valid object
ok 1387 - $x = Math::BigInt->new("999999999"); $y = Math::BigInt->new("1000000000"); $x * $y;
ok 1388 - is a valid object
ok 1389 - $x = Math::BigInt->new("9999999999"); $y = Math::BigInt->new("10000000000"); $x * $y;
ok 1390 - is a valid object
ok 1391 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("100000000000"); $x * $y;
ok 1392 - is a valid object
ok 1393 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("1000000000000"); $x * $y;
ok 1394 - is a valid object
ok 1395 - $x = Math::BigInt->new("9999999999999"); $y = Math::BigInt->new("10000000000000"); $x * $y;
ok 1396 - is a valid object
ok 1397 - $x = Math::BigInt->new("99999999999999"); $y = Math::BigInt->new("100000000000000"); $x * $y;
ok 1398 - is a valid object
ok 1399 - $x = Math::BigInt->new("999999999999999"); $y = Math::BigInt->new("1000000000000000"); $x * $y;
ok 1400 - is a valid object
ok 1401 - $x = Math::BigInt->new("9999999999999999"); $y = Math::BigInt->new("10000000000000000"); $x * $y;
ok 1402 - is a valid object
ok 1403 - $x = Math::BigInt->new("99999999999999999"); $y = Math::BigInt->new("100000000000000000"); $x * $y;
ok 1404 - is a valid object
ok 1405 - $x = Math::BigInt->new("999999999999999999"); $y = Math::BigInt->new("1000000000000000000"); $x * $y;
ok 1406 - is a valid object
ok 1407 - $x = Math::BigInt->new("9999999999999999999"); $y = Math::BigInt->new("10000000000000000000"); $x * $y;
ok 1408 - is a valid object
ok 1409 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("20"); join (",", $x->bdiv($y));
ok 1410 - $x = Math::BigInt->new("4095"); $y = Math::BigInt->new("4095"); join (",", $x->bdiv($y));
ok 1411 - $x = Math::BigInt->new("-4095"); $y = Math::BigInt->new("-4095"); join (",", $x->bdiv($y));
ok 1412 - $x = Math::BigInt->new("4095"); $y = Math::BigInt->new("-4095"); join (",", $x->bdiv($y));
ok 1413 - $x = Math::BigInt->new("-4095"); $y = Math::BigInt->new("4095"); join (",", $x->bdiv($y));
ok 1414 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("2"); join (",", $x->bdiv($y));
ok 1415 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y));
ok 1416 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("4"); join (",", $x->bdiv($y));
ok 1417 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("8"); join (",", $x->bdiv($y));
ok 1418 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("8"); join (",", $x->bdiv($y));
ok 1419 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("2"); join (",", $x->bdiv($y));
ok 1420 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("-2"); join (",", $x->bdiv($y));
ok 1421 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("2"); join (",", $x->bdiv($y));
ok 1422 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y));
ok 1423 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y));
ok 1424 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y));
ok 1425 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y));
ok 1426 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y));
ok 1427 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y));
ok 1428 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y));
ok 1429 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y));
ok 1430 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-5"); join (",", $x->bdiv($y));
ok 1431 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5"); join (",", $x->bdiv($y));
ok 1432 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y));
ok 1433 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-5"); join (",", $x->bdiv($y));
ok 1434 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y));
ok 1435 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y));
ok 1436 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y));
ok 1437 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y));
ok 1438 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y));
ok 1439 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y));
ok 1440 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y));
ok 1441 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y));
ok 1442 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y));
ok 1443 - $x = Math::BigInt->new("1234567812345678"); $y = Math::BigInt->new("123456712345678"); join (",", $x->bdiv($y));
ok 1444 - $x = Math::BigInt->new("12345671234567"); $y = Math::BigInt->new("1234561234567"); join (",", $x->bdiv($y));
ok 1445 - $x = Math::BigInt->new("123456123456"); $y = Math::BigInt->new("12345123456"); join (",", $x->bdiv($y));
ok 1446 - $x = Math::BigInt->new("1234512345"); $y = Math::BigInt->new("123412345"); join (",", $x->bdiv($y));
ok 1447 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("1234567890"); join (",", $x->bdiv($y));
ok 1448 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("1234567890"); join (",", $x->bdiv($y));
ok 1449 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("9876543210"); join (",", $x->bdiv($y));
ok 1450 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("9876543210"); join (",", $x->bdiv($y));
ok 1451 - $x = Math::BigInt->new("96969696969696969696969696969678787878626262626262626262626262"); $y = Math::BigInt->new("484848484848484848484848486666666666666689898989898989898989"); join (",", $x->bdiv($y));
ok 1452 - $x = Math::BigInt->new("1267650600228229401496703205375"); $y = Math::BigInt->new("1267650600228229401496703205376"); join (",", $x->bdiv($y));
ok 1453 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("999999999999999999999999999999999"); join (",", $x->bdiv($y));
ok 1454 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("888888888888888888888888888888888"); join (",", $x->bdiv($y));
ok 1455 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("777777777777777777777777777777777"); join (",", $x->bdiv($y));
ok 1456 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("666666666666666666666666666666666"); join (",", $x->bdiv($y));
ok 1457 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("555555555555555555555555555555555"); join (",", $x->bdiv($y));
ok 1458 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("444444444444444444444444444444444"); join (",", $x->bdiv($y));
ok 1459 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("333333333333333333333333333333333"); join (",", $x->bdiv($y));
ok 1460 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("222222222222222222222222222222222"); join (",", $x->bdiv($y));
ok 1461 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("111111111111111111111111111111111"); join (",", $x->bdiv($y));
ok 1462 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_3333333_3333333_3333333"); join (",", $x->bdiv($y));
ok 1463 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1464 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3000000_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1465 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("2000000_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1466 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000000_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1467 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100000_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1468 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10000_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1469 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1470 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1471 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1472 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1_0000000_0000000_0000000"); join (",", $x->bdiv($y));
ok 1473 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x / $y;
ok 1474 - is a valid object
ok 1475 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("1"); $x / $y;
ok 1476 - is a valid object
ok 1477 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("abc"); $x / $y;
ok 1478 - is a valid object
ok 1479 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x / $y;
ok 1480 - is a valid object
ok 1481 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x / $y;
ok 1482 - is a valid object
ok 1483 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x / $y;
ok 1484 - is a valid object
ok 1485 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x / $y;
ok 1486 - is a valid object
ok 1487 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); $x / $y;
ok 1488 - is a valid object
ok 1489 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("inf"); $x / $y;
ok 1490 - is a valid object
ok 1491 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x / $y;
ok 1492 - is a valid object
ok 1493 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $x / $y;
ok 1494 - is a valid object
ok 1495 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); $x / $y;
ok 1496 - is a valid object
ok 1497 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-5"); $x / $y;
ok 1498 - is a valid object
ok 1499 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5"); $x / $y;
ok 1500 - is a valid object
ok 1501 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); $x / $y;
ok 1502 - is a valid object
ok 1503 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-5"); $x / $y;
ok 1504 - is a valid object
ok 1505 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); $x / $y;
ok 1506 - is a valid object
ok 1507 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x / $y;
ok 1508 - is a valid object
ok 1509 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); $x / $y;
ok 1510 - is a valid object
ok 1511 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x / $y;
ok 1512 - is a valid object
ok 1513 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("0"); $x / $y;
ok 1514 - is a valid object
ok 1515 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); $x / $y;
ok 1516 - is a valid object
ok 1517 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("0"); $x / $y;
ok 1518 - is a valid object
ok 1519 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); $x / $y;
ok 1520 - is a valid object
ok 1521 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x / $y;
ok 1522 - is a valid object
ok 1523 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("2"); $x / $y;
ok 1524 - is a valid object
ok 1525 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("-2"); $x / $y;
ok 1526 - is a valid object
ok 1527 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("2"); $x / $y;
ok 1528 - is a valid object
ok 1529 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("-2"); $x / $y;
ok 1530 - is a valid object
ok 1531 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x / $y;
ok 1532 - is a valid object
ok 1533 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x / $y;
ok 1534 - is a valid object
ok 1535 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x / $y;
ok 1536 - is a valid object
ok 1537 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x / $y;
ok 1538 - is a valid object
ok 1539 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x / $y;
ok 1540 - is a valid object
ok 1541 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x / $y;
ok 1542 - is a valid object
ok 1543 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x / $y;
ok 1544 - is a valid object
ok 1545 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x / $y;
ok 1546 - is a valid object
ok 1547 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("26"); $x / $y;
ok 1548 - is a valid object
ok 1549 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1550 - is a valid object
ok 1551 - $x = Math::BigInt->new("2000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1552 - is a valid object
ok 1553 - $x = Math::BigInt->new("3000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1554 - is a valid object
ok 1555 - $x = Math::BigInt->new("4000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1556 - is a valid object
ok 1557 - $x = Math::BigInt->new("5000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1558 - is a valid object
ok 1559 - $x = Math::BigInt->new("6000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1560 - is a valid object
ok 1561 - $x = Math::BigInt->new("7000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1562 - is a valid object
ok 1563 - $x = Math::BigInt->new("8000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1564 - is a valid object
ok 1565 - $x = Math::BigInt->new("9000000000"); $y = Math::BigInt->new("9"); $x / $y;
ok 1566 - is a valid object
ok 1567 - $x = Math::BigInt->new("35500000"); $y = Math::BigInt->new("113"); $x / $y;
ok 1568 - is a valid object
ok 1569 - $x = Math::BigInt->new("71000000"); $y = Math::BigInt->new("226"); $x / $y;
ok 1570 - is a valid object
ok 1571 - $x = Math::BigInt->new("106500000"); $y = Math::BigInt->new("339"); $x / $y;
ok 1572 - is a valid object
ok 1573 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("3"); $x / $y;
ok 1574 - is a valid object
ok 1575 - $x = Math::BigInt->new("+10"); $y = Math::BigInt->new("+5"); $x / $y;
ok 1576 - is a valid object
ok 1577 - $x = Math::BigInt->new("+100"); $y = Math::BigInt->new("+4"); $x / $y;
ok 1578 - is a valid object
ok 1579 - $x = Math::BigInt->new("+1000"); $y = Math::BigInt->new("+8"); $x / $y;
ok 1580 - is a valid object
ok 1581 - $x = Math::BigInt->new("+10000"); $y = Math::BigInt->new("+16"); $x / $y;
ok 1582 - is a valid object
ok 1583 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9"); $x / $y;
ok 1584 - is a valid object
ok 1585 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("99"); $x / $y;
ok 1586 - is a valid object
ok 1587 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("999"); $x / $y;
ok 1588 - is a valid object
ok 1589 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9999"); $x / $y;
ok 1590 - is a valid object
ok 1591 - $x = Math::BigInt->new("999999999999999"); $y = Math::BigInt->new("99999"); $x / $y;
ok 1592 - is a valid object
ok 1593 - $x = Math::BigInt->new("+1111088889"); $y = Math::BigInt->new("99999"); $x / $y;
ok 1594 - is a valid object
ok 1595 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-3"); $x / $y;
ok 1596 - is a valid object
ok 1597 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("3"); $x / $y;
ok 1598 - is a valid object
ok 1599 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $x / $y;
ok 1600 - is a valid object
ok 1601 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-3"); $x / $y;
ok 1602 - is a valid object
ok 1603 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x / $y;
ok 1604 - is a valid object
ok 1605 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-3"); $x / $y;
ok 1606 - is a valid object
ok 1607 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x / $y;
ok 1608 - is a valid object
ok 1609 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x / $y;
ok 1610 - is a valid object
ok 1611 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("3"); $x / $y;
ok 1612 - is a valid object
ok 1613 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("3"); $x / $y;
ok 1614 - is a valid object
ok 1615 - $x = Math::BigInt->new("14"); $y = Math::BigInt->new("-3"); $x / $y;
ok 1616 - is a valid object
ok 1617 - $x = Math::BigInt->new("-14"); $y = Math::BigInt->new("3"); $x / $y;
ok 1618 - is a valid object
ok 1619 - $x = Math::BigInt->new("-14"); $y = Math::BigInt->new("-3"); $x / $y;
ok 1620 - is a valid object
ok 1621 - $x = Math::BigInt->new("14"); $y = Math::BigInt->new("3"); $x / $y;
ok 1622 - is a valid object
ok 1623 - $x = Math::BigInt->new("10000000000000000000000000000000000000000000000000000000000000000000000000000000000"); $y = Math::BigInt->new("10000000375084540248994272022843165711074"); $x / $y;
ok 1624 - is a valid object
ok 1625 - $x = Math::BigInt->new("1234567812345678"); $y = Math::BigInt->new("123456712345678"); $x / $y;
ok 1626 - is a valid object
ok 1627 - $x = Math::BigInt->new("12345671234567"); $y = Math::BigInt->new("1234561234567"); $x / $y;
ok 1628 - is a valid object
ok 1629 - $x = Math::BigInt->new("123456123456"); $y = Math::BigInt->new("12345123456"); $x / $y;
ok 1630 - is a valid object
ok 1631 - $x = Math::BigInt->new("1234512345"); $y = Math::BigInt->new("123412345"); $x / $y;
ok 1632 - is a valid object
ok 1633 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("1234567890"); $x / $y;
ok 1634 - is a valid object
ok 1635 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("1234567890"); $x / $y;
ok 1636 - is a valid object
ok 1637 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("9876543210"); $x / $y;
ok 1638 - is a valid object
ok 1639 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("9876543210"); $x / $y;
ok 1640 - is a valid object
ok 1641 - $x = Math::BigInt->new("96969696969696969696969696969678787878626262626262626262626262"); $y = Math::BigInt->new("484848484848484848484848486666666666666689898989898989898989"); $x / $y;
ok 1642 - is a valid object
ok 1643 - $x = Math::BigInt->new("84696969696969696956565656566184292929292929292847474747436308080808080808086765396464646464646465"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y;
ok 1644 - is a valid object
ok 1645 - $x = Math::BigInt->new("84696969696969696943434343434871161616161616161452525252486813131313131313143230042929292929292930"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y;
ok 1646 - is a valid object
ok 1647 - $x = Math::BigInt->new("84696969696969696969696969697497424242424242424242424242385803030303030303030300750000000000000000"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y;
ok 1648 - is a valid object
ok 1649 - $x = Math::BigInt->new("84696969696969696930303030303558030303030303030057575757537318181818181818199694689393939393939395"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y;
ok 1650 - is a valid object
ok 1651 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("999999999999999999999999999999999"); $x / $y;
ok 1652 - is a valid object
ok 1653 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("888888888888888888888888888888888"); $x / $y;
ok 1654 - is a valid object
ok 1655 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("777777777777777777777777777777777"); $x / $y;
ok 1656 - is a valid object
ok 1657 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("666666666666666666666666666666666"); $x / $y;
ok 1658 - is a valid object
ok 1659 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("555555555555555555555555555555555"); $x / $y;
ok 1660 - is a valid object
ok 1661 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("444444444444444444444444444444444"); $x / $y;
ok 1662 - is a valid object
ok 1663 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("333333333333333333333333333333333"); $x / $y;
ok 1664 - is a valid object
ok 1665 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("222222222222222222222222222222222"); $x / $y;
ok 1666 - is a valid object
ok 1667 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("111111111111111111111111111111111"); $x / $y;
ok 1668 - is a valid object
ok 1669 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_3333333_3333333_3333333"); $x / $y;
ok 1670 - is a valid object
ok 1671 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_0000000_0000000_0000000"); $x / $y;
ok 1672 - is a valid object
ok 1673 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3000000_0000000_0000000_0000000"); $x / $y;
ok 1674 - is a valid object
ok 1675 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("2000000_0000000_0000000_0000000"); $x / $y;
ok 1676 - is a valid object
ok 1677 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000000_0000000_0000000_0000000"); $x / $y;
ok 1678 - is a valid object
ok 1679 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100000_0000000_0000000_0000000"); $x / $y;
ok 1680 - is a valid object
ok 1681 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10000_0000000_0000000_0000000"); $x / $y;
ok 1682 - is a valid object
ok 1683 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000_0000000_0000000_0000000"); $x / $y;
ok 1684 - is a valid object
ok 1685 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100_0000000_0000000_0000000"); $x / $y;
ok 1686 - is a valid object
ok 1687 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10_0000000_0000000_0000000"); $x / $y;
ok 1688 - is a valid object
ok 1689 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1_0000000_0000000_0000000"); $x / $y;
ok 1690 - is a valid object
ok 1691 - $x = Math::BigInt->new("949418181818187070707070707070707070"); $y = Math::BigInt->new("181818181853535353535353535353535353"); $x / $y;
ok 1692 - is a valid object
ok 1693 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x->bmodinv($y);
ok 1694 - is a valid object
ok 1695 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("5"); $x->bmodinv($y);
ok 1696 - is a valid object
ok 1697 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("abc"); $x->bmodinv($y);
ok 1698 - is a valid object
ok 1699 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->bmodinv($y);
ok 1700 - is a valid object
ok 1701 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("5"); $x->bmodinv($y);
ok 1702 - is a valid object
ok 1703 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-5"); $x->bmodinv($y);
ok 1704 - is a valid object
ok 1705 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("5"); $x->bmodinv($y);
ok 1706 - is a valid object
ok 1707 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("5033"); $x->bmodinv($y);
ok 1708 - is a valid object
ok 1709 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("13"); $x->bmodinv($y);
ok 1710 - is a valid object
ok 1711 - $x = Math::BigInt->new("-1234567891"); $y = Math::BigInt->new("13"); $x->bmodinv($y);
ok 1712 - is a valid object
ok 1713 - $x = Math::BigInt->new("324958749843759385732954874325984357439658735983745"); $y = Math::BigInt->new("2348249874968739"); $x->bmodinv($y);
ok 1714 - is a valid object
ok 1715 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1716 - is a valid object
ok 1717 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1718 - is a valid object
ok 1719 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1720 - is a valid object
ok 1721 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1722 - is a valid object
ok 1723 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1724 - is a valid object
ok 1725 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1726 - is a valid object
ok 1727 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $x->bmodinv($y);
ok 1728 - is a valid object
ok 1729 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1730 - is a valid object
ok 1731 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1732 - is a valid object
ok 1733 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1734 - is a valid object
ok 1735 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1736 - is a valid object
ok 1737 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1738 - is a valid object
ok 1739 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1740 - is a valid object
ok 1741 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $x->bmodinv($y);
ok 1742 - is a valid object
ok 1743 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1744 - is a valid object
ok 1745 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1746 - is a valid object
ok 1747 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1748 - is a valid object
ok 1749 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1750 - is a valid object
ok 1751 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1752 - is a valid object
ok 1753 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1754 - is a valid object
ok 1755 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $x->bmodinv($y);
ok 1756 - is a valid object
ok 1757 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $x->bmodinv($y);
ok 1758 - is a valid object
ok 1759 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x->bmodinv($y);
ok 1760 - is a valid object
ok 1761 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); $x->bmodinv($y);
ok 1762 - is a valid object
ok 1763 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); $x->bmodinv($y);
ok 1764 - is a valid object
ok 1765 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z);
ok 1766 - is a valid object
ok 1767 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z);
ok 1768 - is a valid object
ok 1769 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z);
ok 1770 - is a valid object
ok 1771 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z);
ok 1772 - is a valid object
ok 1773 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z);
ok 1774 - is a valid object
ok 1775 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z);
ok 1776 - is a valid object
ok 1777 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z);
ok 1778 - is a valid object
ok 1779 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("0"); $x->bmodpow($y, $z);
ok 1780 - is a valid object
ok 1781 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("2"); $x->bmodpow($y, $z);
ok 1782 - is a valid object
ok 1783 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("2"); $x->bmodpow($y, $z);
ok 1784 - is a valid object
ok 1785 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z);
ok 1786 - is a valid object
ok 1787 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1788 - is a valid object
ok 1789 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1790 - is a valid object
ok 1791 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1792 - is a valid object
ok 1793 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1794 - is a valid object
ok 1795 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1796 - is a valid object
ok 1797 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1798 - is a valid object
ok 1799 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1800 - is a valid object
ok 1801 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1802 - is a valid object
ok 1803 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1804 - is a valid object
ok 1805 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1806 - is a valid object
ok 1807 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1808 - is a valid object
ok 1809 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1810 - is a valid object
ok 1811 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1812 - is a valid object
ok 1813 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1814 - is a valid object
ok 1815 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1816 - is a valid object
ok 1817 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1818 - is a valid object
ok 1819 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1820 - is a valid object
ok 1821 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1822 - is a valid object
ok 1823 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1824 - is a valid object
ok 1825 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1826 - is a valid object
ok 1827 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1828 - is a valid object
ok 1829 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1830 - is a valid object
ok 1831 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1832 - is a valid object
ok 1833 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1834 - is a valid object
ok 1835 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1836 - is a valid object
ok 1837 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1838 - is a valid object
ok 1839 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1840 - is a valid object
ok 1841 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1842 - is a valid object
ok 1843 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1844 - is a valid object
ok 1845 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1846 - is a valid object
ok 1847 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1848 - is a valid object
ok 1849 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1850 - is a valid object
ok 1851 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1852 - is a valid object
ok 1853 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1854 - is a valid object
ok 1855 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1856 - is a valid object
ok 1857 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1858 - is a valid object
ok 1859 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1860 - is a valid object
ok 1861 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1862 - is a valid object
ok 1863 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1864 - is a valid object
ok 1865 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1866 - is a valid object
ok 1867 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1868 - is a valid object
ok 1869 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1870 - is a valid object
ok 1871 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1872 - is a valid object
ok 1873 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1874 - is a valid object
ok 1875 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1876 - is a valid object
ok 1877 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1878 - is a valid object
ok 1879 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1880 - is a valid object
ok 1881 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1882 - is a valid object
ok 1883 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 1884 - is a valid object
ok 1885 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1886 - is a valid object
ok 1887 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1888 - is a valid object
ok 1889 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1890 - is a valid object
ok 1891 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1892 - is a valid object
ok 1893 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1894 - is a valid object
ok 1895 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1896 - is a valid object
ok 1897 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1898 - is a valid object
ok 1899 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1900 - is a valid object
ok 1901 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1902 - is a valid object
ok 1903 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1904 - is a valid object
ok 1905 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1906 - is a valid object
ok 1907 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1908 - is a valid object
ok 1909 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1910 - is a valid object
ok 1911 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1912 - is a valid object
ok 1913 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1914 - is a valid object
ok 1915 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1916 - is a valid object
ok 1917 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1918 - is a valid object
ok 1919 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1920 - is a valid object
ok 1921 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1922 - is a valid object
ok 1923 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1924 - is a valid object
ok 1925 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1926 - is a valid object
ok 1927 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1928 - is a valid object
ok 1929 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1930 - is a valid object
ok 1931 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1932 - is a valid object
ok 1933 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1934 - is a valid object
ok 1935 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1936 - is a valid object
ok 1937 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1938 - is a valid object
ok 1939 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1940 - is a valid object
ok 1941 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1942 - is a valid object
ok 1943 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1944 - is a valid object
ok 1945 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1946 - is a valid object
ok 1947 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1948 - is a valid object
ok 1949 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1950 - is a valid object
ok 1951 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1952 - is a valid object
ok 1953 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1954 - is a valid object
ok 1955 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1956 - is a valid object
ok 1957 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1958 - is a valid object
ok 1959 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1960 - is a valid object
ok 1961 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1962 - is a valid object
ok 1963 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1964 - is a valid object
ok 1965 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1966 - is a valid object
ok 1967 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1968 - is a valid object
ok 1969 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1970 - is a valid object
ok 1971 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1972 - is a valid object
ok 1973 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1974 - is a valid object
ok 1975 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1976 - is a valid object
ok 1977 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1978 - is a valid object
ok 1979 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1980 - is a valid object
ok 1981 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z);
ok 1982 - is a valid object
ok 1983 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1984 - is a valid object
ok 1985 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1986 - is a valid object
ok 1987 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1988 - is a valid object
ok 1989 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1990 - is a valid object
ok 1991 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1992 - is a valid object
ok 1993 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1994 - is a valid object
ok 1995 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1996 - is a valid object
ok 1997 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 1998 - is a valid object
ok 1999 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2000 - is a valid object
ok 2001 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2002 - is a valid object
ok 2003 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2004 - is a valid object
ok 2005 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2006 - is a valid object
ok 2007 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2008 - is a valid object
ok 2009 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2010 - is a valid object
ok 2011 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2012 - is a valid object
ok 2013 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2014 - is a valid object
ok 2015 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2016 - is a valid object
ok 2017 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2018 - is a valid object
ok 2019 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2020 - is a valid object
ok 2021 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2022 - is a valid object
ok 2023 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2024 - is a valid object
ok 2025 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2026 - is a valid object
ok 2027 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2028 - is a valid object
ok 2029 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2030 - is a valid object
ok 2031 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2032 - is a valid object
ok 2033 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2034 - is a valid object
ok 2035 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2036 - is a valid object
ok 2037 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2038 - is a valid object
ok 2039 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2040 - is a valid object
ok 2041 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2042 - is a valid object
ok 2043 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2044 - is a valid object
ok 2045 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2046 - is a valid object
ok 2047 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2048 - is a valid object
ok 2049 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2050 - is a valid object
ok 2051 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2052 - is a valid object
ok 2053 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2054 - is a valid object
ok 2055 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2056 - is a valid object
ok 2057 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2058 - is a valid object
ok 2059 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2060 - is a valid object
ok 2061 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2062 - is a valid object
ok 2063 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2064 - is a valid object
ok 2065 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2066 - is a valid object
ok 2067 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2068 - is a valid object
ok 2069 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2070 - is a valid object
ok 2071 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2072 - is a valid object
ok 2073 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2074 - is a valid object
ok 2075 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2076 - is a valid object
ok 2077 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2078 - is a valid object
ok 2079 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z);
ok 2080 - is a valid object
ok 2081 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("16"); $x->bmodpow($y, $z);
ok 2082 - is a valid object
ok 2083 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("5033"); $x->bmodpow($y, $z);
ok 2084 - is a valid object
ok 2085 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("7"); $z = Math::BigInt->new("5032"); $x->bmodpow($y, $z);
ok 2086 - is a valid object
ok 2087 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("8"); $z = Math::BigInt->new("-5"); $x->bmodpow($y, $z);
ok 2088 - is a valid object
ok 2089 - $x = Math::BigInt->new("1e50"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z);
ok 2090 - is a valid object
ok 2091 - $x = Math::BigInt->new("98436739867439843769485798542749827593285729587325"); $y = Math::BigInt->new("43698764986460981048259837659386739857456983759328457"); $z = Math::BigInt->new("6943857329857295827698367"); $x->bmodpow($y, $z);
ok 2092 - is a valid object
ok 2093 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("13"); $x->bmodpow($y, $z);
ok 2094 - is a valid object
ok 2095 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $z = Math::BigInt->new("13"); $x->bmodpow($y, $z);
ok 2096 - is a valid object
ok 2097 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x % $y;
ok 2098 - is a valid object
ok 2099 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x % $y;
ok 2100 - is a valid object
ok 2101 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x % $y;
ok 2102 - is a valid object
ok 2103 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); $x % $y;
ok 2104 - is a valid object
ok 2105 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("inf"); $x % $y;
ok 2106 - is a valid object
ok 2107 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x % $y;
ok 2108 - is a valid object
ok 2109 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $x % $y;
ok 2110 - is a valid object
ok 2111 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); $x % $y;
ok 2112 - is a valid object
ok 2113 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-5"); $x % $y;
ok 2114 - is a valid object
ok 2115 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5"); $x % $y;
ok 2116 - is a valid object
ok 2117 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); $x % $y;
ok 2118 - is a valid object
ok 2119 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-5"); $x % $y;
ok 2120 - is a valid object
ok 2121 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); $x % $y;
ok 2122 - is a valid object
ok 2123 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x % $y;
ok 2124 - is a valid object
ok 2125 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); $x % $y;
ok 2126 - is a valid object
ok 2127 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x % $y;
ok 2128 - is a valid object
ok 2129 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("0"); $x % $y;
ok 2130 - is a valid object
ok 2131 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); $x % $y;
ok 2132 - is a valid object
ok 2133 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); $x % $y;
ok 2134 - is a valid object
ok 2135 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("0"); $x % $y;
ok 2136 - is a valid object
ok 2137 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x % $y;
ok 2138 - is a valid object
ok 2139 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x % $y;
ok 2140 - is a valid object
ok 2141 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("1"); $x % $y;
ok 2142 - is a valid object
ok 2143 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("abc"); $x % $y;
ok 2144 - is a valid object
ok 2145 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x % $y;
ok 2146 - is a valid object
ok 2147 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x % $y;
ok 2148 - is a valid object
ok 2149 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x % $y;
ok 2150 - is a valid object
ok 2151 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x % $y;
ok 2152 - is a valid object
ok 2153 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x % $y;
ok 2154 - is a valid object
ok 2155 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x % $y;
ok 2156 - is a valid object
ok 2157 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x % $y;
ok 2158 - is a valid object
ok 2159 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x % $y;
ok 2160 - is a valid object
ok 2161 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x % $y;
ok 2162 - is a valid object
ok 2163 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x % $y;
ok 2164 - is a valid object
ok 2165 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2166 - is a valid object
ok 2167 - $x = Math::BigInt->new("2000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2168 - is a valid object
ok 2169 - $x = Math::BigInt->new("3000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2170 - is a valid object
ok 2171 - $x = Math::BigInt->new("4000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2172 - is a valid object
ok 2173 - $x = Math::BigInt->new("5000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2174 - is a valid object
ok 2175 - $x = Math::BigInt->new("6000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2176 - is a valid object
ok 2177 - $x = Math::BigInt->new("7000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2178 - is a valid object
ok 2179 - $x = Math::BigInt->new("8000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2180 - is a valid object
ok 2181 - $x = Math::BigInt->new("9000000000"); $y = Math::BigInt->new("9"); $x % $y;
ok 2182 - is a valid object
ok 2183 - $x = Math::BigInt->new("35500000"); $y = Math::BigInt->new("113"); $x % $y;
ok 2184 - is a valid object
ok 2185 - $x = Math::BigInt->new("71000000"); $y = Math::BigInt->new("226"); $x % $y;
ok 2186 - is a valid object
ok 2187 - $x = Math::BigInt->new("106500000"); $y = Math::BigInt->new("339"); $x % $y;
ok 2188 - is a valid object
ok 2189 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("3"); $x % $y;
ok 2190 - is a valid object
ok 2191 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("5"); $x % $y;
ok 2192 - is a valid object
ok 2193 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("4"); $x % $y;
ok 2194 - is a valid object
ok 2195 - $x = Math::BigInt->new("1000"); $y = Math::BigInt->new("8"); $x % $y;
ok 2196 - is a valid object
ok 2197 - $x = Math::BigInt->new("10000"); $y = Math::BigInt->new("16"); $x % $y;
ok 2198 - is a valid object
ok 2199 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9"); $x % $y;
ok 2200 - is a valid object
ok 2201 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("99"); $x % $y;
ok 2202 - is a valid object
ok 2203 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("999"); $x % $y;
ok 2204 - is a valid object
ok 2205 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9999"); $x % $y;
ok 2206 - is a valid object
ok 2207 - $x = Math::BigInt->new("999999999999999"); $y = Math::BigInt->new("99999"); $x % $y;
ok 2208 - is a valid object
ok 2209 - $x = Math::BigInt->new("-9"); $y = Math::BigInt->new("+5"); $x % $y;
ok 2210 - is a valid object
ok 2211 - $x = Math::BigInt->new("+9"); $y = Math::BigInt->new("-5"); $x % $y;
ok 2212 - is a valid object
ok 2213 - $x = Math::BigInt->new("-9"); $y = Math::BigInt->new("-5"); $x % $y;
ok 2214 - is a valid object
ok 2215 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("3"); $x % $y;
ok 2216 - is a valid object
ok 2217 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x % $y;
ok 2218 - is a valid object
ok 2219 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $x % $y;
ok 2220 - is a valid object
ok 2221 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x % $y;
ok 2222 - is a valid object
ok 2223 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-3"); $x % $y;
ok 2224 - is a valid object
ok 2225 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x % $y;
ok 2226 - is a valid object
ok 2227 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-3"); $x % $y;
ok 2228 - is a valid object
ok 2229 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-3"); $x % $y;
ok 2230 - is a valid object
ok 2231 - $x = Math::BigInt->new("4095"); $y = Math::BigInt->new("4095"); $x % $y;
ok 2232 - is a valid object
ok 2233 - $x = Math::BigInt->new("100041000510123"); $y = Math::BigInt->new("3"); $x % $y;
ok 2234 - is a valid object
ok 2235 - $x = Math::BigInt->new("152403346"); $y = Math::BigInt->new("12345"); $x % $y;
ok 2236 - is a valid object
ok 2237 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("5"); $x % $y;
ok 2238 - is a valid object
ok 2239 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("9"); $x % $y;
ok 2240 - is a valid object
ok 2241 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("9"); $x % $y;
ok 2242 - is a valid object
ok 2243 - $x = Math::BigInt->new("12345678"); $y = Math::BigInt->new("9"); $x % $y;
ok 2244 - is a valid object
ok 2245 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("9"); $x % $y;
ok 2246 - is a valid object
ok 2247 - $x = Math::BigInt->new("123456789123"); $y = Math::BigInt->new("9"); $x % $y;
ok 2248 - is a valid object
ok 2249 - $x = Math::BigInt->new("12345678912345"); $y = Math::BigInt->new("9"); $x % $y;
ok 2250 - is a valid object
ok 2251 - $x = Math::BigInt->new("1234567891234567"); $y = Math::BigInt->new("9"); $x % $y;
ok 2252 - is a valid object
ok 2253 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("9"); $x % $y;
ok 2254 - is a valid object
ok 2255 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("10"); $x % $y;
ok 2256 - is a valid object
ok 2257 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("10"); $x % $y;
ok 2258 - is a valid object
ok 2259 - $x = Math::BigInt->new("12345678"); $y = Math::BigInt->new("10"); $x % $y;
ok 2260 - is a valid object
ok 2261 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("10"); $x % $y;
ok 2262 - is a valid object
ok 2263 - $x = Math::BigInt->new("123456789123"); $y = Math::BigInt->new("10"); $x % $y;
ok 2264 - is a valid object
ok 2265 - $x = Math::BigInt->new("12345678912345"); $y = Math::BigInt->new("10"); $x % $y;
ok 2266 - is a valid object
ok 2267 - $x = Math::BigInt->new("1234567891234567"); $y = Math::BigInt->new("10"); $x % $y;
ok 2268 - is a valid object
ok 2269 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("10"); $x % $y;
ok 2270 - is a valid object
ok 2271 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("113"); $x % $y;
ok 2272 - is a valid object
ok 2273 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("113"); $x % $y;
ok 2274 - is a valid object
ok 2275 - $x = Math::BigInt->new("12345678"); $y = Math::BigInt->new("113"); $x % $y;
ok 2276 - is a valid object
ok 2277 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("113"); $x % $y;
ok 2278 - is a valid object
ok 2279 - $x = Math::BigInt->new("123456789123"); $y = Math::BigInt->new("113"); $x % $y;
ok 2280 - is a valid object
ok 2281 - $x = Math::BigInt->new("12345678912345"); $y = Math::BigInt->new("113"); $x % $y;
ok 2282 - is a valid object
ok 2283 - $x = Math::BigInt->new("1234567891234567"); $y = Math::BigInt->new("113"); $x % $y;
ok 2284 - is a valid object
ok 2285 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("113"); $x % $y;
ok 2286 - is a valid object
ok 2287 - $x = Math::BigInt->new("-629"); $y = Math::BigInt->new("5033"); $x % $y;
ok 2288 - is a valid object
ok 2289 - $x = Math::BigInt->new("111111111111111111111111111111"); $y = Math::BigInt->new("111111111111111111111111111111"); $x % $y;
ok 2290 - is a valid object
ok 2291 - $x = Math::BigInt->new("12345678901234567890"); $y = Math::BigInt->new("12345678901234567890"); $x % $y;
ok 2292 - is a valid object
ok 2293 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("12"); Math::BigInt::bgcd($x, $y);
ok 2294 - is a valid object
ok 2295 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("12"); Math::BigInt::bgcd($x, $y);
ok 2296 - is a valid object
ok 2297 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("inf"); Math::BigInt::bgcd($x, $y);
ok 2298 - is a valid object
ok 2299 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("-inf"); Math::BigInt::bgcd($x, $y);
ok 2300 - is a valid object
ok 2301 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); Math::BigInt::bgcd($x, $y);
ok 2302 - is a valid object
ok 2303 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); Math::BigInt::bgcd($x, $y);
ok 2304 - is a valid object
ok 2305 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); Math::BigInt::bgcd($x, $y);
ok 2306 - is a valid object
ok 2307 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); Math::BigInt::bgcd($x, $y);
ok 2308 - is a valid object
ok 2309 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); Math::BigInt::bgcd($x, $y);
ok 2310 - is a valid object
ok 2311 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); Math::BigInt::bgcd($x, $y);
ok 2312 - is a valid object
ok 2313 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); Math::BigInt::bgcd($x, $y);
ok 2314 - is a valid object
ok 2315 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); Math::BigInt::bgcd($x, $y);
ok 2316 - is a valid object
ok 2317 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); Math::BigInt::bgcd($x, $y);
ok 2318 - is a valid object
ok 2319 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); Math::BigInt::bgcd($x, $y);
ok 2320 - is a valid object
ok 2321 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+3"); Math::BigInt::bgcd($x, $y);
ok 2322 - is a valid object
ok 2323 - $x = Math::BigInt->new("+3"); $y = Math::BigInt->new("+2"); Math::BigInt::bgcd($x, $y);
ok 2324 - is a valid object
ok 2325 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("+2"); Math::BigInt::bgcd($x, $y);
ok 2326 - is a valid object
ok 2327 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("-2"); Math::BigInt::bgcd($x, $y);
ok 2328 - is a valid object
ok 2329 - $x = Math::BigInt->new("-144"); $y = Math::BigInt->new("-60"); Math::BigInt::bgcd($x, $y);
ok 2330 - is a valid object
ok 2331 - $x = Math::BigInt->new("144"); $y = Math::BigInt->new("-60"); Math::BigInt::bgcd($x, $y);
ok 2332 - is a valid object
ok 2333 - $x = Math::BigInt->new("144"); $y = Math::BigInt->new("60"); Math::BigInt::bgcd($x, $y);
ok 2334 - is a valid object
ok 2335 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("625"); Math::BigInt::bgcd($x, $y);
ok 2336 - is a valid object
ok 2337 - $x = Math::BigInt->new("4096"); $y = Math::BigInt->new("81"); Math::BigInt::bgcd($x, $y);
ok 2338 - is a valid object
ok 2339 - $x = Math::BigInt->new("1034"); $y = Math::BigInt->new("804"); Math::BigInt::bgcd($x, $y);
ok 2340 - is a valid object
ok 2341 - $x = Math::BigInt->new("27"); $y = Math::BigInt->new("90"); $z = Math::BigInt->new("56"); Math::BigInt::bgcd($x, $y, $z);
ok 2342 - is a valid object
ok 2343 - $x = Math::BigInt->new("27"); $y = Math::BigInt->new("90"); $z = Math::BigInt->new("54"); Math::BigInt::bgcd($x, $y, $z);
ok 2344 - is a valid object
ok 2345 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); Math::BigInt::blcm($x, $y);
ok 2346 - is a valid object
ok 2347 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); Math::BigInt::blcm($x, $y);
ok 2348 - is a valid object
ok 2349 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); Math::BigInt::blcm($x, $y);
ok 2350 - is a valid object
ok 2351 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); Math::BigInt::blcm($x, $y);
ok 2352 - is a valid object
ok 2353 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); Math::BigInt::blcm($x, $y);
ok 2354 - is a valid object
ok 2355 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); Math::BigInt::blcm($x, $y);
ok 2356 - is a valid object
ok 2357 - $x = Math::BigInt->new("+27"); $y = Math::BigInt->new("+90"); Math::BigInt::blcm($x, $y);
ok 2358 - is a valid object
ok 2359 - $x = Math::BigInt->new("+1034"); $y = Math::BigInt->new("+804"); Math::BigInt::blcm($x, $y);
ok 2360 - is a valid object
ok 2361 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x & $y;
ok 2362 - is a valid object
ok 2363 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x & $y;
ok 2364 - is a valid object
ok 2365 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("abc"); $x & $y;
ok 2366 - is a valid object
ok 2367 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x & $y;
ok 2368 - is a valid object
ok 2369 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $x & $y;
ok 2370 - is a valid object
ok 2371 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x & $y;
ok 2372 - is a valid object
ok 2373 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("0"); $x & $y;
ok 2374 - is a valid object
ok 2375 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("1"); $x & $y;
ok 2376 - is a valid object
ok 2377 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("+281474976710656"); $x & $y;
ok 2378 - is a valid object
ok 2379 - $x = Math::BigInt->new("281474976710656"); $y = Math::BigInt->new("-1"); $x & $y;
ok 2380 - is a valid object
ok 2381 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x & $y;
ok 2382 - is a valid object
ok 2383 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x & $y;
ok 2384 - is a valid object
ok 2385 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("-6"); $x & $y;
ok 2386 - is a valid object
ok 2387 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("-4"); $x & $y;
ok 2388 - is a valid object
ok 2389 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("4"); $x & $y;
ok 2390 - is a valid object
ok 2391 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("7"); $x & $y;
ok 2392 - is a valid object
ok 2393 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-3"); $x & $y;
ok 2394 - is a valid object
ok 2395 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-1"); $x & $y;
ok 2396 - is a valid object
ok 2397 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0xFFFF"); $x & $y;
ok 2398 - is a valid object
ok 2399 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0xFFFFFF"); $x & $y;
ok 2400 - is a valid object
ok 2401 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFF"); $x & $y;
ok 2402 - is a valid object
ok 2403 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x & $y;
ok 2404 - is a valid object
ok 2405 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x & $y;
ok 2406 - is a valid object
ok 2407 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0xF0F0"); $x & $y;
ok 2408 - is a valid object
ok 2409 - $x = Math::BigInt->new("0x0F0F"); $y = Math::BigInt->new("0x0F0F"); $x & $y;
ok 2410 - is a valid object
ok 2411 - $x = Math::BigInt->new("0xF0F0F0"); $y = Math::BigInt->new("0xF0F0F0"); $x & $y;
ok 2412 - is a valid object
ok 2413 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0x0F0F0F"); $x & $y;
ok 2414 - is a valid object
ok 2415 - $x = Math::BigInt->new("0xF0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0"); $x & $y;
ok 2416 - is a valid object
ok 2417 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F"); $x & $y;
ok 2418 - is a valid object
ok 2419 - $x = Math::BigInt->new("0xF0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x & $y;
ok 2420 - is a valid object
ok 2421 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F"); $x & $y;
ok 2422 - is a valid object
ok 2423 - $x = Math::BigInt->new("0xF0F0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x & $y;
ok 2424 - is a valid object
ok 2425 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F0F"); $x & $y;
ok 2426 - is a valid object
ok 2427 - $x = Math::BigInt->new("0x1F0F0F0F0F0F"); $y = Math::BigInt->new("0x3F0F0F0F0F0F"); $x & $y;
ok 2428 - is a valid object
ok 2429 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x | $y;
ok 2430 - is a valid object
ok 2431 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x | $y;
ok 2432 - is a valid object
ok 2433 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("abc"); $x | $y;
ok 2434 - is a valid object
ok 2435 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x | $y;
ok 2436 - is a valid object
ok 2437 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x | $y;
ok 2438 - is a valid object
ok 2439 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("0"); $x | $y;
ok 2440 - is a valid object
ok 2441 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("1"); $x | $y;
ok 2442 - is a valid object
ok 2443 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("281474976710656"); $x | $y;
ok 2444 - is a valid object
ok 2445 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x | $y;
ok 2446 - is a valid object
ok 2447 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x | $y;
ok 2448 - is a valid object
ok 2449 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("-6"); $x | $y;
ok 2450 - is a valid object
ok 2451 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("4"); $x | $y;
ok 2452 - is a valid object
ok 2453 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("7"); $x | $y;
ok 2454 - is a valid object
ok 2455 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("-1"); $x | $y;
ok 2456 - is a valid object
ok 2457 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-3"); $x | $y;
ok 2458 - is a valid object
ok 2459 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-4"); $x | $y;
ok 2460 - is a valid object
ok 2461 - $x = Math::BigInt->new("300"); $y = Math::BigInt->new("-76"); $x | $y;
ok 2462 - is a valid object
ok 2463 - $x = Math::BigInt->new("-76"); $y = Math::BigInt->new("300"); $x | $y;
ok 2464 - is a valid object
ok 2465 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0xFFFF"); $x | $y;
ok 2466 - is a valid object
ok 2467 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0xFFFFFF"); $x | $y;
ok 2468 - is a valid object
ok 2469 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFF"); $x | $y;
ok 2470 - is a valid object
ok 2471 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x | $y;
ok 2472 - is a valid object
ok 2473 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x | $y;
ok 2474 - is a valid object
ok 2475 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFF"); $x | $y;
ok 2476 - is a valid object
ok 2477 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFF"); $x | $y;
ok 2478 - is a valid object
ok 2479 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFF"); $x | $y;
ok 2480 - is a valid object
ok 2481 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x | $y;
ok 2482 - is a valid object
ok 2483 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x | $y;
ok 2484 - is a valid object
ok 2485 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0"); $x | $y;
ok 2486 - is a valid object
ok 2487 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0"); $x | $y;
ok 2488 - is a valid object
ok 2489 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0"); $x | $y;
ok 2490 - is a valid object
ok 2491 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x | $y;
ok 2492 - is a valid object
ok 2493 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x | $y;
ok 2494 - is a valid object
ok 2495 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0xF0F0"); $x | $y;
ok 2496 - is a valid object
ok 2497 - $x = Math::BigInt->new("0x0F0F"); $y = Math::BigInt->new("0x0F0F"); $x | $y;
ok 2498 - is a valid object
ok 2499 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0x0F0F"); $x | $y;
ok 2500 - is a valid object
ok 2501 - $x = Math::BigInt->new("0xF0F0F0"); $y = Math::BigInt->new("0xF0F0F0"); $x | $y;
ok 2502 - is a valid object
ok 2503 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0x0F0F0F"); $x | $y;
ok 2504 - is a valid object
ok 2505 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0xF0F0F0"); $x | $y;
ok 2506 - is a valid object
ok 2507 - $x = Math::BigInt->new("0xF0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0"); $x | $y;
ok 2508 - is a valid object
ok 2509 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F"); $x | $y;
ok 2510 - is a valid object
ok 2511 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0"); $x | $y;
ok 2512 - is a valid object
ok 2513 - $x = Math::BigInt->new("0xF0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x | $y;
ok 2514 - is a valid object
ok 2515 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F"); $x | $y;
ok 2516 - is a valid object
ok 2517 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x | $y;
ok 2518 - is a valid object
ok 2519 - $x = Math::BigInt->new("0xF0F0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x | $y;
ok 2520 - is a valid object
ok 2521 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F0F"); $x | $y;
ok 2522 - is a valid object
ok 2523 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x | $y;
ok 2524 - is a valid object
ok 2525 - $x = Math::BigInt->new("0x1F0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x | $y;
ok 2526 - is a valid object
ok 2527 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x ^ $y;
ok 2528 - is a valid object
ok 2529 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2530 - is a valid object
ok 2531 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("abc"); $x ^ $y;
ok 2532 - is a valid object
ok 2533 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x ^ $y;
ok 2534 - is a valid object
ok 2535 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x ^ $y;
ok 2536 - is a valid object
ok 2537 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2538 - is a valid object
ok 2539 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("1"); $x ^ $y;
ok 2540 - is a valid object
ok 2541 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("281474976710656"); $x ^ $y;
ok 2542 - is a valid object
ok 2543 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x ^ $y;
ok 2544 - is a valid object
ok 2545 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x ^ $y;
ok 2546 - is a valid object
ok 2547 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("-6"); $x ^ $y;
ok 2548 - is a valid object
ok 2549 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("4"); $x ^ $y;
ok 2550 - is a valid object
ok 2551 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("7"); $x ^ $y;
ok 2552 - is a valid object
ok 2553 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-7"); $x ^ $y;
ok 2554 - is a valid object
ok 2555 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("-7"); $x ^ $y;
ok 2556 - is a valid object
ok 2557 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-3"); $x ^ $y;
ok 2558 - is a valid object
ok 2559 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-4"); $x ^ $y;
ok 2560 - is a valid object
ok 2561 - $x = Math::BigInt->new("300"); $y = Math::BigInt->new("-76"); $x ^ $y;
ok 2562 - is a valid object
ok 2563 - $x = Math::BigInt->new("-76"); $y = Math::BigInt->new("300"); $x ^ $y;
ok 2564 - is a valid object
ok 2565 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0xFFFF"); $x ^ $y;
ok 2566 - is a valid object
ok 2567 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0xFFFFFF"); $x ^ $y;
ok 2568 - is a valid object
ok 2569 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFF"); $x ^ $y;
ok 2570 - is a valid object
ok 2571 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x ^ $y;
ok 2572 - is a valid object
ok 2573 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x ^ $y;
ok 2574 - is a valid object
ok 2575 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFF"); $x ^ $y;
ok 2576 - is a valid object
ok 2577 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFF"); $x ^ $y;
ok 2578 - is a valid object
ok 2579 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFF"); $x ^ $y;
ok 2580 - is a valid object
ok 2581 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x ^ $y;
ok 2582 - is a valid object
ok 2583 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x ^ $y;
ok 2584 - is a valid object
ok 2585 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2586 - is a valid object
ok 2587 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2588 - is a valid object
ok 2589 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2590 - is a valid object
ok 2591 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2592 - is a valid object
ok 2593 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y;
ok 2594 - is a valid object
ok 2595 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0xF0F0"); $x ^ $y;
ok 2596 - is a valid object
ok 2597 - $x = Math::BigInt->new("0x0F0F"); $y = Math::BigInt->new("0x0F0F"); $x ^ $y;
ok 2598 - is a valid object
ok 2599 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0x0F0F"); $x ^ $y;
ok 2600 - is a valid object
ok 2601 - $x = Math::BigInt->new("0xF0F0F0"); $y = Math::BigInt->new("0xF0F0F0"); $x ^ $y;
ok 2602 - is a valid object
ok 2603 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0x0F0F0F"); $x ^ $y;
ok 2604 - is a valid object
ok 2605 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0xF0F0F0"); $x ^ $y;
ok 2606 - is a valid object
ok 2607 - $x = Math::BigInt->new("0xF0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0"); $x ^ $y;
ok 2608 - is a valid object
ok 2609 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F"); $x ^ $y;
ok 2610 - is a valid object
ok 2611 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0"); $x ^ $y;
ok 2612 - is a valid object
ok 2613 - $x = Math::BigInt->new("0xF0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x ^ $y;
ok 2614 - is a valid object
ok 2615 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F"); $x ^ $y;
ok 2616 - is a valid object
ok 2617 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x ^ $y;
ok 2618 - is a valid object
ok 2619 - $x = Math::BigInt->new("0xF0F0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x ^ $y;
ok 2620 - is a valid object
ok 2621 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F0F"); $x ^ $y;
ok 2622 - is a valid object
ok 2623 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x ^ $y;
ok 2624 - is a valid object
ok 2625 - $x = Math::BigInt->new("abc"); $x->bnot();
ok 2626 - is a valid object
ok 2627 - $x = Math::BigInt->new("+0"); $x->bnot();
ok 2628 - is a valid object
ok 2629 - $x = Math::BigInt->new("+8"); $x->bnot();
ok 2630 - is a valid object
ok 2631 - $x = Math::BigInt->new("+281474976710656"); $x->bnot();
ok 2632 - is a valid object
ok 2633 - $x = Math::BigInt->new("-1"); $x->bnot();
ok 2634 - is a valid object
ok 2635 - $x = Math::BigInt->new("-2"); $x->bnot();
ok 2636 - is a valid object
ok 2637 - $x = Math::BigInt->new("-12"); $x->bnot();
ok 2638 - is a valid object
ok 2639 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->digit($y);
ok 2640 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("0"); $x->digit($y);
ok 2641 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("1"); $x->digit($y);
ok 2642 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("0"); $x->digit($y);
ok 2643 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("1"); $x->digit($y);
ok 2644 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("2"); $x->digit($y);
ok 2645 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-1"); $x->digit($y);
ok 2646 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-2"); $x->digit($y);
ok 2647 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-3"); $x->digit($y);
ok 2648 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("0"); $x->digit($y);
ok 2649 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("1"); $x->digit($y);
ok 2650 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("2"); $x->digit($y);
ok 2651 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("3"); $x->digit($y);
ok 2652 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("4"); $x->digit($y);
ok 2653 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("5"); $x->digit($y);
ok 2654 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("-1"); $x->digit($y);
ok 2655 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("-2"); $x->digit($y);
ok 2656 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("-3"); $x->digit($y);
ok 2657 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("-3"); $x->digit($y);
ok 2658 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("0"); $x->digit($y);
ok 2659 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("1"); $x->digit($y);
ok 2660 - $x = Math::BigInt->new("abc"); $x = $x->mantissa()->bstr();
ok 2661 - $x = Math::BigInt->new("1e4"); $x = $x->mantissa()->bstr();
ok 2662 - $x = Math::BigInt->new("2e0"); $x = $x->mantissa()->bstr();
ok 2663 - $x = Math::BigInt->new("123"); $x = $x->mantissa()->bstr();
ok 2664 - $x = Math::BigInt->new("-1"); $x = $x->mantissa()->bstr();
ok 2665 - $x = Math::BigInt->new("-2"); $x = $x->mantissa()->bstr();
ok 2666 - $x = Math::BigInt->new("+inf"); $x = $x->mantissa()->bstr();
ok 2667 - $x = Math::BigInt->new("-inf"); $x = $x->mantissa()->bstr();
ok 2668 - $x = Math::BigInt->new("abc"); $x = $x->exponent()->bstr();
ok 2669 - $x = Math::BigInt->new("1e4"); $x = $x->exponent()->bstr();
ok 2670 - $x = Math::BigInt->new("2e0"); $x = $x->exponent()->bstr();
ok 2671 - $x = Math::BigInt->new("123"); $x = $x->exponent()->bstr();
ok 2672 - $x = Math::BigInt->new("-1"); $x = $x->exponent()->bstr();
ok 2673 - $x = Math::BigInt->new("-2"); $x = $x->exponent()->bstr();
ok 2674 - $x = Math::BigInt->new("0"); $x = $x->exponent()->bstr();
ok 2675 - $x = Math::BigInt->new("+inf"); $x = $x->exponent()->bstr();
ok 2676 - $x = Math::BigInt->new("-inf"); $x = $x->exponent()->bstr();
ok 2677 - $x = Math::BigInt->new("abc"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2678 - $x = Math::BigInt->new("1e4"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2679 - $x = Math::BigInt->new("2e0"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2680 - $x = Math::BigInt->new("123"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2681 - $x = Math::BigInt->new("-1"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2682 - $x = Math::BigInt->new("-2"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2683 - $x = Math::BigInt->new("0"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2684 - $x = Math::BigInt->new("+inf"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2685 - $x = Math::BigInt->new("-inf"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e";
ok 2686 - $x = Math::BigInt->new("-1"); $x->bfac();
ok 2687 - is a valid object
ok 2688 - $x = Math::BigInt->new("NaNfac"); $x->bfac();
ok 2689 - is a valid object
ok 2690 - $x = Math::BigInt->new("+inf"); $x->bfac();
ok 2691 - is a valid object
ok 2692 - $x = Math::BigInt->new("-inf"); $x->bfac();
ok 2693 - is a valid object
ok 2694 - $x = Math::BigInt->new("0"); $x->bfac();
ok 2695 - is a valid object
ok 2696 - $x = Math::BigInt->new("1"); $x->bfac();
ok 2697 - is a valid object
ok 2698 - $x = Math::BigInt->new("2"); $x->bfac();
ok 2699 - is a valid object
ok 2700 - $x = Math::BigInt->new("3"); $x->bfac();
ok 2701 - is a valid object
ok 2702 - $x = Math::BigInt->new("4"); $x->bfac();
ok 2703 - is a valid object
ok 2704 - $x = Math::BigInt->new("5"); $x->bfac();
ok 2705 - is a valid object
ok 2706 - $x = Math::BigInt->new("6"); $x->bfac();
ok 2707 - is a valid object
ok 2708 - $x = Math::BigInt->new("7"); $x->bfac();
ok 2709 - is a valid object
ok 2710 - $x = Math::BigInt->new("8"); $x->bfac();
ok 2711 - is a valid object
ok 2712 - $x = Math::BigInt->new("9"); $x->bfac();
ok 2713 - is a valid object
ok 2714 - $x = Math::BigInt->new("10"); $x->bfac();
ok 2715 - is a valid object
ok 2716 - $x = Math::BigInt->new("11"); $x->bfac();
ok 2717 - is a valid object
ok 2718 - $x = Math::BigInt->new("12"); $x->bfac();
ok 2719 - is a valid object
ok 2720 - $x = Math::BigInt->new("20"); $x->bfac();
ok 2721 - is a valid object
ok 2722 - $x = Math::BigInt->new("22"); $x->bfac();
ok 2723 - is a valid object
ok 2724 - $x = Math::BigInt->new("69"); $x->bfac();
ok 2725 - is a valid object
ok 2726 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("12"); $x ** $y;
ok 2727 - is a valid object
ok 2728 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("abc"); $x ** $y;
ok 2729 - is a valid object
ok 2730 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x ** $y;
ok 2731 - is a valid object
ok 2732 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x ** $y;
ok 2733 - is a valid object
ok 2734 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2735 - is a valid object
ok 2736 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x ** $y;
ok 2737 - is a valid object
ok 2738 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $x ** $y;
ok 2739 - is a valid object
ok 2740 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x ** $y;
ok 2741 - is a valid object
ok 2742 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x ** $y;
ok 2743 - is a valid object
ok 2744 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2745 - is a valid object
ok 2746 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2747 - is a valid object
ok 2748 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x ** $y;
ok 2749 - is a valid object
ok 2750 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $x ** $y;
ok 2751 - is a valid object
ok 2752 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-3"); $x ** $y;
ok 2753 - is a valid object
ok 2754 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $x ** $y;
ok 2755 - is a valid object
ok 2756 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x ** $y;
ok 2757 - is a valid object
ok 2758 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2759 - is a valid object
ok 2760 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2761 - is a valid object
ok 2762 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2763 - is a valid object
ok 2764 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2765 - is a valid object
ok 2766 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2767 - is a valid object
ok 2768 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $x ** $y;
ok 2769 - is a valid object
ok 2770 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("5"); $x ** $y;
ok 2771 - is a valid object
ok 2772 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $x ** $y;
ok 2773 - is a valid object
ok 2774 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $x ** $y;
ok 2775 - is a valid object
ok 2776 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $x ** $y;
ok 2777 - is a valid object
ok 2778 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $x ** $y;
ok 2779 - is a valid object
ok 2780 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("1234500012"); $x ** $y;
ok 2781 - is a valid object
ok 2782 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("1234500012"); $x ** $y;
ok 2783 - is a valid object
ok 2784 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("1234500013"); $x ** $y;
ok 2785 - is a valid object
ok 2786 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-12345000123"); $x ** $y;
ok 2787 - is a valid object
ok 2788 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-12345000123"); $x ** $y;
ok 2789 - is a valid object
ok 2790 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2791 - is a valid object
ok 2792 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); $x ** $y;
ok 2793 - is a valid object
ok 2794 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-1"); $x ** $y;
ok 2795 - is a valid object
ok 2796 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2797 - is a valid object
ok 2798 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2799 - is a valid object
ok 2800 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2801 - is a valid object
ok 2802 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2803 - is a valid object
ok 2804 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2805 - is a valid object
ok 2806 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2807 - is a valid object
ok 2808 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2809 - is a valid object
ok 2810 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2811 - is a valid object
ok 2812 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2813 - is a valid object
ok 2814 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2815 - is a valid object
ok 2816 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2817 - is a valid object
ok 2818 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x ** $y;
ok 2819 - is a valid object
ok 2820 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("NaN"); $x ** $y;
ok 2821 - is a valid object
ok 2822 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2823 - is a valid object
ok 2824 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("inf"); $x ** $y;
ok 2825 - is a valid object
ok 2826 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-inf"); $x ** $y;
ok 2827 - is a valid object
ok 2828 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x ** $y;
ok 2829 - is a valid object
ok 2830 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $x ** $y;
ok 2831 - is a valid object
ok 2832 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x ** $y;
ok 2833 - is a valid object
ok 2834 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2835 - is a valid object
ok 2836 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2837 - is a valid object
ok 2838 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $x ** $y;
ok 2839 - is a valid object
ok 2840 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("5"); $x ** $y;
ok 2841 - is a valid object
ok 2842 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x ** $y;
ok 2843 - is a valid object
ok 2844 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $x ** $y;
ok 2845 - is a valid object
ok 2846 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-3"); $x ** $y;
ok 2847 - is a valid object
ok 2848 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-4"); $x ** $y;
ok 2849 - is a valid object
ok 2850 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2851 - is a valid object
ok 2852 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2853 - is a valid object
ok 2854 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("4"); $x ** $y;
ok 2855 - is a valid object
ok 2856 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("5"); $x ** $y;
ok 2857 - is a valid object
ok 2858 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("6"); $x ** $y;
ok 2859 - is a valid object
ok 2860 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("7"); $x ** $y;
ok 2861 - is a valid object
ok 2862 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("8"); $x ** $y;
ok 2863 - is a valid object
ok 2864 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("9"); $x ** $y;
ok 2865 - is a valid object
ok 2866 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("20"); $x ** $y;
ok 2867 - is a valid object
ok 2868 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2869 - is a valid object
ok 2870 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2871 - is a valid object
ok 2872 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2873 - is a valid object
ok 2874 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $x ** $y;
ok 2875 - is a valid object
ok 2876 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("5"); $x ** $y;
ok 2877 - is a valid object
ok 2878 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("2"); $x ** $y;
ok 2879 - is a valid object
ok 2880 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("3"); $x ** $y;
ok 2881 - is a valid object
ok 2882 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("4"); $x ** $y;
ok 2883 - is a valid object
ok 2884 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("5"); $x ** $y;
ok 2885 - is a valid object
ok 2886 - $x = Math::BigInt->new("100"); $x->length();
ok 2887 - $x = Math::BigInt->new("10"); $x->length();
ok 2888 - $x = Math::BigInt->new("1"); $x->length();
ok 2889 - $x = Math::BigInt->new("0"); $x->length();
ok 2890 - $x = Math::BigInt->new("12345"); $x->length();
ok 2891 - $x = Math::BigInt->new("10000000000000000"); $x->length();
ok 2892 - $x = Math::BigInt->new("-123"); $x->length();
ok 2893 - $x = Math::BigInt->new("215960156869840440586892398248"); $x->length();
ok 2894 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2895 - is a valid object
ok 2896 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2897 - is a valid object
ok 2898 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2899 - is a valid object
ok 2900 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2901 - is a valid object
ok 2902 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2903 - is a valid object
ok 2904 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2905 - is a valid object
ok 2906 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2907 - is a valid object
ok 2908 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2909 - is a valid object
ok 2910 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2911 - is a valid object
ok 2912 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2913 - is a valid object
ok 2914 - $x = Math::BigInt->new("16"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2915 - is a valid object
ok 2916 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2917 - is a valid object
ok 2918 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2919 - is a valid object
ok 2920 - $x = Math::BigInt->new("15241"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2921 - is a valid object
ok 2922 - $x = Math::BigInt->new("144"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2923 - is a valid object
ok 2924 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2925 - is a valid object
ok 2926 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("NaN"); $x->broot($y);
ok 2927 - is a valid object
ok 2928 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("NaN"); $x->broot($y);
ok 2929 - is a valid object
ok 2930 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("NaN"); $x->broot($y);
ok 2931 - is a valid object
ok 2932 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x->broot($y);
ok 2933 - is a valid object
ok 2934 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaN"); $x->broot($y);
ok 2935 - is a valid object
ok 2936 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2937 - is a valid object
ok 2938 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("2"); $x->broot($y);
ok 2939 - is a valid object
ok 2940 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->broot($y);
ok 2941 - is a valid object
ok 2942 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->broot($y);
ok 2943 - is a valid object
ok 2944 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("-inf"); $x->broot($y);
ok 2945 - is a valid object
ok 2946 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("inf"); $x->broot($y);
ok 2947 - is a valid object
ok 2948 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2949 - is a valid object
ok 2950 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2951 - is a valid object
ok 2952 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2953 - is a valid object
ok 2954 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2955 - is a valid object
ok 2956 - $x = Math::BigInt->new("-123.45"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2957 - is a valid object
ok 2958 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("0"); $x->broot($y);
ok 2959 - is a valid object
ok 2960 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("1"); $x->broot($y);
ok 2961 - is a valid object
ok 2962 - $x = Math::BigInt->new("-12"); $y = Math::BigInt->new("1"); $x->broot($y);
ok 2963 - is a valid object
ok 2964 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("-1"); $x->broot($y);
ok 2965 - is a valid object
ok 2966 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("-1"); $x->broot($y);
ok 2967 - is a valid object
ok 2968 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("3"); $x->broot($y);
ok 2969 - is a valid object
ok 2970 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("3"); $x->broot($y);
ok 2971 - is a valid object
ok 2972 - $x = Math::BigInt->new("16"); $y = Math::BigInt->new("4"); $x->broot($y);
ok 2973 - is a valid object
ok 2974 - $x = Math::BigInt->new("81"); $y = Math::BigInt->new("4"); $x->broot($y);
ok 2975 - is a valid object
ok 2976 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("4"); $x->broot($y);
ok 2977 - is a valid object
ok 2978 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("8"); $x->broot($y);
ok 2979 - is a valid object
ok 2980 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("16"); $x->broot($y);
ok 2981 - is a valid object
ok 2982 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("32"); $x->broot($y);
ok 2983 - is a valid object
ok 2984 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("64"); $x->broot($y);
ok 2985 - is a valid object
ok 2986 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("128"); $x->broot($y);
ok 2987 - is a valid object
ok 2988 - $x = Math::BigInt->new("84274086103068221283760416414557757"); $y = Math::BigInt->new("15"); $x->broot($y);
ok 2989 - is a valid object
ok 2990 - $x = Math::BigInt->new("145"); $x->bsqrt();
ok 2991 - is a valid object
ok 2992 - $x = Math::BigInt->new("144"); $x->bsqrt();
ok 2993 - is a valid object
ok 2994 - $x = Math::BigInt->new("143"); $x->bsqrt();
ok 2995 - is a valid object
ok 2996 - $x = Math::BigInt->new("16"); $x->bsqrt();
ok 2997 - is a valid object
ok 2998 - $x = Math::BigInt->new("170"); $x->bsqrt();
ok 2999 - is a valid object
ok 3000 - $x = Math::BigInt->new("169"); $x->bsqrt();
ok 3001 - is a valid object
ok 3002 - $x = Math::BigInt->new("168"); $x->bsqrt();
ok 3003 - is a valid object
ok 3004 - $x = Math::BigInt->new("4"); $x->bsqrt();
ok 3005 - is a valid object
ok 3006 - $x = Math::BigInt->new("3"); $x->bsqrt();
ok 3007 - is a valid object
ok 3008 - $x = Math::BigInt->new("2"); $x->bsqrt();
ok 3009 - is a valid object
ok 3010 - $x = Math::BigInt->new("9"); $x->bsqrt();
ok 3011 - is a valid object
ok 3012 - $x = Math::BigInt->new("12"); $x->bsqrt();
ok 3013 - is a valid object
ok 3014 - $x = Math::BigInt->new("256"); $x->bsqrt();
ok 3015 - is a valid object
ok 3016 - $x = Math::BigInt->new("100000000"); $x->bsqrt();
ok 3017 - is a valid object
ok 3018 - $x = Math::BigInt->new("4000000000000"); $x->bsqrt();
ok 3019 - is a valid object
ok 3020 - $x = Math::BigInt->new("152399026"); $x->bsqrt();
ok 3021 - is a valid object
ok 3022 - $x = Math::BigInt->new("152399025"); $x->bsqrt();
ok 3023 - is a valid object
ok 3024 - $x = Math::BigInt->new("152399024"); $x->bsqrt();
ok 3025 - is a valid object
ok 3026 - $x = Math::BigInt->new("18446744073709551616"); $x->bsqrt();
ok 3027 - is a valid object
ok 3028 - $x = Math::BigInt->new("84274086103068221283760416414557757"); $x->bsqrt();
ok 3029 - is a valid object
ok 3030 - $x = Math::BigInt->new("1"); $x->bsqrt();
ok 3031 - is a valid object
ok 3032 - $x = Math::BigInt->new("0"); $x->bsqrt();
ok 3033 - is a valid object
ok 3034 - $x = Math::BigInt->new("-2"); $x->bsqrt();
ok 3035 - is a valid object
ok 3036 - $x = Math::BigInt->new("-123"); $x->bsqrt();
ok 3037 - is a valid object
ok 3038 - $x = Math::BigInt->new("Nan"); $x->bsqrt();
ok 3039 - is a valid object
ok 3040 - $x = Math::BigInt->new("+inf"); $x->bsqrt();
ok 3041 - is a valid object
ok 3042 - $x = Math::BigInt->new("-inf"); $x->bsqrt();
ok 3043 - is a valid object
ok 3044 - $x = Math::BigInt->new("NaN"); $x->bexp();
ok 3045 - is a valid object
ok 3046 - $x = Math::BigInt->new("inf"); $x->bexp();
ok 3047 - is a valid object
ok 3048 - $x = Math::BigInt->new("1"); $x->bexp();
ok 3049 - is a valid object
ok 3050 - $x = Math::BigInt->new("2"); $x->bexp();
ok 3051 - is a valid object
ok 3052 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("1"); $x->batan2($y);
ok 3053 - is a valid object
ok 3054 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("NaN"); $x->batan2($y);
ok 3055 - is a valid object
ok 3056 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("NaN"); $x->batan2($y);
ok 3057 - is a valid object
ok 3058 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("1"); $x->batan2($y);
ok 3059 - is a valid object
ok 3060 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("1"); $x->batan2($y);
ok 3061 - is a valid object
ok 3062 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x->batan2($y);
ok 3063 - is a valid object
ok 3064 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-inf"); $x->batan2($y);
ok 3065 - is a valid object
ok 3066 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-inf"); $x->batan2($y);
ok 3067 - is a valid object
ok 3068 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x->batan2($y);
ok 3069 - is a valid object
ok 3070 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x->batan2($y);
ok 3071 - is a valid object
ok 3072 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->batan2($y);
ok 3073 - is a valid object
ok 3074 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("+inf"); $x->batan2($y);
ok 3075 - is a valid object
ok 3076 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x->batan2($y);
ok 3077 - is a valid object
ok 3078 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->batan2($y);
ok 3079 - is a valid object
ok 3080 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->batan2($y);
ok 3081 - is a valid object
ok 3082 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->batan2($y);
ok 3083 - is a valid object
ok 3084 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->batan2($y);
ok 3085 - is a valid object
ok 3086 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $x->batan2($y);
ok 3087 - is a valid object
ok 3088 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x->batan2($y);
ok 3089 - is a valid object
ok 3090 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("0"); $x->batan2($y);
ok 3091 - is a valid object
ok 3092 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x->batan2($y);
ok 3093 - is a valid object
ok 3094 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $x->batan2($y);
ok 3095 - is a valid object
ok 3096 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $x->batan2($y);
ok 3097 - is a valid object
ok 3098 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("5"); $x->batan2($y);
ok 3099 - is a valid object
ok 3100 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->batan2($y);
ok 3101 - is a valid object
ok 3102 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("8"); $x->batan2($y);
ok 3103 - is a valid object
ok 3104 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("8"); $x->batan2($y);
ok 3105 - is a valid object
ok 3106 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->batan2($y);
ok 3107 - is a valid object
ok 3108 - $x = Math::BigInt->new("77"); Math::BigInt->bpi($x);
ok 3109 - is a valid object
ok 3110 - $x = Math::BigInt->new("+0"); Math::BigInt->bpi($x);
ok 3111 - is a valid object
ok 3112 - $x = Math::BigInt->new("11"); Math::BigInt->bpi($x);
ok 3113 - is a valid object
ok 3114 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("10"); $x->bnok($y);
ok 3115 - is a valid object
ok 3116 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("NaN"); $x->bnok($y);
ok 3117 - is a valid object
ok 3118 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("1"); $x->bnok($y);
ok 3119 - is a valid object
ok 3120 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("NaN"); $x->bnok($y);
ok 3121 - is a valid object
ok 3122 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->bnok($y);
ok 3123 - is a valid object
ok 3124 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x->bnok($y);
ok 3125 - is a valid object
ok 3126 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x->bnok($y);
ok 3127 - is a valid object
ok 3128 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $x->bnok($y);
ok 3129 - is a valid object
ok 3130 - $x = Math::BigInt->new("7"); $y = Math::BigInt->new("3"); $x->bnok($y);
ok 3131 - is a valid object
ok 3132 - $x = Math::BigInt->new("7"); $y = Math::BigInt->new("6"); $x->bnok($y);
ok 3133 - is a valid object
ok 3134 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("90"); $x->bnok($y);
ok 3135 - is a valid object
ok 3136 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("95"); $x->bnok($y);
ok 3137 - is a valid object
ok 3138 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $x->bnok($y);
ok 3139 - is a valid object
ok 3140 - $x = Math::BigInt->new("7"); $y = Math::BigInt->new("0"); $x->bnok($y);
ok 3141 - is a valid object
ok 3142 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x->bnok($y);
ok 3143 - is a valid object
ok 3144 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3145 - is a valid object
ok 3146 - $x = Math::BigInt->new("NaNbround"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3147 - is a valid object
ok 3148 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3149 - is a valid object
ok 3150 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3151 - is a valid object
ok 3152 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("0"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3153 - is a valid object
ok 3154 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("2"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3155 - is a valid object
ok 3156 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3157 - is a valid object
ok 3158 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3159 - is a valid object
ok 3160 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3161 - is a valid object
ok 3162 - $x = Math::BigInt->new("+10123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3163 - is a valid object
ok 3164 - $x = Math::BigInt->new("-10123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3165 - is a valid object
ok 3166 - $x = Math::BigInt->new("+10123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3167 - is a valid object
ok 3168 - $x = Math::BigInt->new("-10123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3169 - is a valid object
ok 3170 - $x = Math::BigInt->new("+101234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3171 - is a valid object
ok 3172 - $x = Math::BigInt->new("-101234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("trunc"); $x->bround($y);
ok 3173 - is a valid object
ok 3174 - $x = Math::BigInt->new("+20123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3175 - is a valid object
ok 3176 - $x = Math::BigInt->new("-20123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3177 - is a valid object
ok 3178 - $x = Math::BigInt->new("+20123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3179 - is a valid object
ok 3180 - $x = Math::BigInt->new("-20123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3181 - is a valid object
ok 3182 - $x = Math::BigInt->new("+201234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3183 - is a valid object
ok 3184 - $x = Math::BigInt->new("-201234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3185 - is a valid object
ok 3186 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3187 - is a valid object
ok 3188 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("zero"); $x->bround($y);
ok 3189 - is a valid object
ok 3190 - $x = Math::BigInt->new("+30123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3191 - is a valid object
ok 3192 - $x = Math::BigInt->new("-30123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3193 - is a valid object
ok 3194 - $x = Math::BigInt->new("+30123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3195 - is a valid object
ok 3196 - $x = Math::BigInt->new("-30123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3197 - is a valid object
ok 3198 - $x = Math::BigInt->new("+301234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3199 - is a valid object
ok 3200 - $x = Math::BigInt->new("-301234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3201 - is a valid object
ok 3202 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3203 - is a valid object
ok 3204 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("+inf"); $x->bround($y);
ok 3205 - is a valid object
ok 3206 - $x = Math::BigInt->new("+40123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3207 - is a valid object
ok 3208 - $x = Math::BigInt->new("-40123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3209 - is a valid object
ok 3210 - $x = Math::BigInt->new("+40123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3211 - is a valid object
ok 3212 - $x = Math::BigInt->new("-40123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3213 - is a valid object
ok 3214 - $x = Math::BigInt->new("+401234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3215 - is a valid object
ok 3216 - $x = Math::BigInt->new("+401234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3217 - is a valid object
ok 3218 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3219 - is a valid object
ok 3220 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("-inf"); $x->bround($y);
ok 3221 - is a valid object
ok 3222 - $x = Math::BigInt->new("+50123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3223 - is a valid object
ok 3224 - $x = Math::BigInt->new("-50123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3225 - is a valid object
ok 3226 - $x = Math::BigInt->new("+50123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3227 - is a valid object
ok 3228 - $x = Math::BigInt->new("-50123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3229 - is a valid object
ok 3230 - $x = Math::BigInt->new("+501234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3231 - is a valid object
ok 3232 - $x = Math::BigInt->new("-501234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3233 - is a valid object
ok 3234 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3235 - is a valid object
ok 3236 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("odd"); $x->bround($y);
ok 3237 - is a valid object
ok 3238 - $x = Math::BigInt->new("+60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3239 - is a valid object
ok 3240 - $x = Math::BigInt->new("-60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3241 - is a valid object
ok 3242 - $x = Math::BigInt->new("+60123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3243 - is a valid object
ok 3244 - $x = Math::BigInt->new("-60123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3245 - is a valid object
ok 3246 - $x = Math::BigInt->new("+601234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3247 - is a valid object
ok 3248 - $x = Math::BigInt->new("-601234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3249 - is a valid object
ok 3250 - $x = Math::BigInt->new("+1234567"); $y = Math::BigInt->new("7"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3251 - is a valid object
ok 3252 - $x = Math::BigInt->new("+1234567"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3253 - is a valid object
ok 3254 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3255 - is a valid object
ok 3256 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("even"); $x->bround($y);
ok 3257 - is a valid object
ok 3258 - $x = Math::BigInt->new("+60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3259 - is a valid object
ok 3260 - $x = Math::BigInt->new("+60123199999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3261 - is a valid object
ok 3262 - $x = Math::BigInt->new("+60123299999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3263 - is a valid object
ok 3264 - $x = Math::BigInt->new("+60123399999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3265 - is a valid object
ok 3266 - $x = Math::BigInt->new("+60123499999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3267 - is a valid object
ok 3268 - $x = Math::BigInt->new("+60123500000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3269 - is a valid object
ok 3270 - $x = Math::BigInt->new("+60123600000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3271 - is a valid object
ok 3272 - $x = Math::BigInt->new("+60123700000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3273 - is a valid object
ok 3274 - $x = Math::BigInt->new("+60123800000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3275 - is a valid object
ok 3276 - $x = Math::BigInt->new("+60123900000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3277 - is a valid object
ok 3278 - $x = Math::BigInt->new("-60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3279 - is a valid object
ok 3280 - $x = Math::BigInt->new("-60123199999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3281 - is a valid object
ok 3282 - $x = Math::BigInt->new("-60123299999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3283 - is a valid object
ok 3284 - $x = Math::BigInt->new("-60123399999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3285 - is a valid object
ok 3286 - $x = Math::BigInt->new("-60123499999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3287 - is a valid object
ok 3288 - $x = Math::BigInt->new("-60123500000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3289 - is a valid object
ok 3290 - $x = Math::BigInt->new("-60123600000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3291 - is a valid object
ok 3292 - $x = Math::BigInt->new("-60123700000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3293 - is a valid object
ok 3294 - $x = Math::BigInt->new("-60123800000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3295 - is a valid object
ok 3296 - $x = Math::BigInt->new("-60123900000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y);
ok 3297 - is a valid object
ok 3298 - $x = Math::BigInt->new("0"); $x->is_zero() || 0;
ok 3299 - $x = Math::BigInt->new("NaNzero"); $x->is_zero() || 0;
ok 3300 - $x = Math::BigInt->new("+inf"); $x->is_zero() || 0;
ok 3301 - $x = Math::BigInt->new("-inf"); $x->is_zero() || 0;
ok 3302 - $x = Math::BigInt->new("123"); $x->is_zero() || 0;
ok 3303 - $x = Math::BigInt->new("-1"); $x->is_zero() || 0;
ok 3304 - $x = Math::BigInt->new("1"); $x->is_zero() || 0;
ok 3305 - $x = Math::BigInt->new("0"); $x->is_one() || 0;
ok 3306 - $x = Math::BigInt->new("NaNone"); $x->is_one() || 0;
ok 3307 - $x = Math::BigInt->new("+inf"); $x->is_one() || 0;
ok 3308 - $x = Math::BigInt->new("-inf"); $x->is_one() || 0;
ok 3309 - $x = Math::BigInt->new("1"); $x->is_one() || 0;
ok 3310 - $x = Math::BigInt->new("2"); $x->is_one() || 0;
ok 3311 - $x = Math::BigInt->new("-1"); $x->is_one() || 0;
ok 3312 - $x = Math::BigInt->new("-2"); $x->is_one() || 0;
ok 3313 - $x = Math::BigInt->new("0"); $x->bfloor();
ok 3314 - is a valid object
ok 3315 - $x = Math::BigInt->new("NaNfloor"); $x->bfloor();
ok 3316 - is a valid object
ok 3317 - $x = Math::BigInt->new("+inf"); $x->bfloor();
ok 3318 - is a valid object
ok 3319 - $x = Math::BigInt->new("-inf"); $x->bfloor();
ok 3320 - is a valid object
ok 3321 - $x = Math::BigInt->new("-1"); $x->bfloor();
ok 3322 - is a valid object
ok 3323 - $x = Math::BigInt->new("-2"); $x->bfloor();
ok 3324 - is a valid object
ok 3325 - $x = Math::BigInt->new("2"); $x->bfloor();
ok 3326 - is a valid object
ok 3327 - $x = Math::BigInt->new("3"); $x->bfloor();
ok 3328 - is a valid object
ok 3329 - $x = Math::BigInt->new("abc"); $x->bfloor();
ok 3330 - is a valid object
ok 3331 - $x = Math::BigInt->new("NaNceil"); $x->bceil();
ok 3332 - is a valid object
ok 3333 - $x = Math::BigInt->new("+inf"); $x->bceil();
ok 3334 - is a valid object
ok 3335 - $x = Math::BigInt->new("-inf"); $x->bceil();
ok 3336 - is a valid object
ok 3337 - $x = Math::BigInt->new("0"); $x->bceil();
ok 3338 - is a valid object
ok 3339 - $x = Math::BigInt->new("-1"); $x->bceil();
ok 3340 - is a valid object
ok 3341 - $x = Math::BigInt->new("-2"); $x->bceil();
ok 3342 - is a valid object
ok 3343 - $x = Math::BigInt->new("2"); $x->bceil();
ok 3344 - is a valid object
ok 3345 - $x = Math::BigInt->new("3"); $x->bceil();
ok 3346 - is a valid object
ok 3347 - $x = Math::BigInt->new("abc"); $x->bceil();
ok 3348 - is a valid object
ok 3349 - $x = Math::BigInt->new("NaN"); $x->bint();
ok 3350 - is a valid object
ok 3351 - $x = Math::BigInt->new("+inf"); $x->bint();
ok 3352 - is a valid object
ok 3353 - $x = Math::BigInt->new("-inf"); $x->bint();
ok 3354 - is a valid object
ok 3355 - $x = Math::BigInt->new("0"); $x->bint();
ok 3356 - is a valid object
ok 3357 - $x = Math::BigInt->new("-1"); $x->bint();
ok 3358 - is a valid object
ok 3359 - $x = Math::BigInt->new("-2"); $x->bint();
ok 3360 - is a valid object
ok 3361 - $x = Math::BigInt->new("2"); $x->bint();
ok 3362 - is a valid object
ok 3363 - $x = Math::BigInt->new("3"); $x->bint();
ok 3364 - is a valid object
ok 3365 - $x = Math::BigInt->new("128"); $x->as_hex();
ok 3366 - $x = Math::BigInt->new("-128"); $x->as_hex();
ok 3367 - $x = Math::BigInt->new("0"); $x->as_hex();
ok 3368 - $x = Math::BigInt->new("-0"); $x->as_hex();
ok 3369 - $x = Math::BigInt->new("1"); $x->as_hex();
ok 3370 - $x = Math::BigInt->new("0x123456789123456789"); $x->as_hex();
ok 3371 - $x = Math::BigInt->new("+inf"); $x->as_hex();
ok 3372 - $x = Math::BigInt->new("-inf"); $x->as_hex();
ok 3373 - $x = Math::BigInt->new("NaNas_hex"); $x->as_hex();
ok 3374 - $x = Math::BigInt->new("128"); $x->as_bin();
ok 3375 - $x = Math::BigInt->new("-128"); $x->as_bin();
ok 3376 - $x = Math::BigInt->new("0"); $x->as_bin();
ok 3377 - $x = Math::BigInt->new("-0"); $x->as_bin();
ok 3378 - $x = Math::BigInt->new("1"); $x->as_bin();
ok 3379 - $x = Math::BigInt->new("0b1010111101010101010110110110110110101"); $x->as_bin();
ok 3380 - $x = Math::BigInt->new("0x123456789123456789"); $x->as_bin();
ok 3381 - $x = Math::BigInt->new("+inf"); $x->as_bin();
ok 3382 - $x = Math::BigInt->new("-inf"); $x->as_bin();
ok 3383 - $x = Math::BigInt->new("NaNas_bin"); $x->as_bin();
ok 3384 - $x = Math::BigInt->new("128"); $x->as_oct();
ok 3385 - $x = Math::BigInt->new("-128"); $x->as_oct();
ok 3386 - $x = Math::BigInt->new("0"); $x->as_oct();
ok 3387 - $x = Math::BigInt->new("-0"); $x->as_oct();
ok 3388 - $x = Math::BigInt->new("1"); $x->as_oct();
ok 3389 - $x = Math::BigInt->new("0b1010111101010101010110110110110110101"); $x->as_oct();
ok 3390 - $x = Math::BigInt->new("0x123456789123456789"); $x->as_oct();
ok 3391 - $x = Math::BigInt->new("+inf"); $x->as_oct();
ok 3392 - $x = Math::BigInt->new("-inf"); $x->as_oct();
ok 3393 - $x = Math::BigInt->new("NaNas_oct"); $x->as_oct();
ok 3394 - $x = Math::BigInt->new("-1"); $x = log($x);
ok 3395 - is a valid object
ok 3396 - $x = Math::BigInt->new("0"); $x = log($x);
ok 3397 - is a valid object
ok 3398 - $x = Math::BigInt->new("1"); $x = log($x);
ok 3399 - is a valid object
ok 3400 - $x = Math::BigInt->new("2"); $x = log($x);
ok 3401 - is a valid object
ok 3402 - $x = Math::BigInt->new("3"); $x = log($x);
ok 3403 - is a valid object
ok 3404 - $x = Math::BigInt->new("123456789"); $x = log($x);
ok 3405 - is a valid object
ok 3406 - $x = Math::BigInt->new("1234567890987654321"); $x = log($x);
ok 3407 - is a valid object
ok 3408 - $x = Math::BigInt->new("-inf"); $x = log($x);
ok 3409 - is a valid object
ok 3410 - $x = Math::BigInt->new("inf"); $x = log($x);
ok 3411 - is a valid object
ok 3412 - $x = Math::BigInt->new("NaN"); $x = log($x);
ok 3413 - is a valid object
ok 3414 - $x = Math::BigInt->new("4294967296"); $a = $x->bmul($x);
ok 3415 - $x = Math::BigInt->new(10); $a = $x->bpow($x);
ok 3416 - $z = $x & $y; $x
ok 3417 - $z = $x & $y; $y
ok 3418 - $z = $x & $y; $z
ok 3419 - $z = $x | $y; $x
ok 3420 - $z = $x | $y; $y
ok 3421 - $z = $x | $y; $z
ok 3422 - $z = $x | $y; $x
ok 3423 - $z = $x | $y; $y
ok 3424 - $z = $x | $y; $z
ok 3425 - $z = $x ^ $y; $x
ok 3426 - $z = $x ^ $y; $y
ok 3427 - $z = $x ^ $y; $z
ok 3428 - $y = -$x; $x
ok 3429 - $y = abs($x); $x
ok 3430 - $x->copy()->bmodpow($y, $z); $u
ok 3431 - $x->copy()->bmodpow($y, $z); $y
ok 3432 - $x->copy()->bmodpow($y, $z); $z
ok 3433 - $y = -$x; $x
ok 3434 - $y = -$x; $y
ok 3435 - $y = $x->copy()->bneg(); $x
ok 3436 - $y = $x->copy()->bneg(); $y
ok 3437 - $x->bmul($y); $x
ok 3438 - $x->bmul($y); $y
ok 3439 - $x->badd($y); $x
ok 3440 - $x->badd($y); $y
ok 3441 - $x->bsub($y); $x
ok 3442 - $x->bsub($y); $y
ok 3443 - $x->bdiv($y); $x
ok 3444 - $x->bdiv($y); $y
ok 3445 - $x->bmod($y); $x
ok 3446 - $x->bmod($y); $y
ok 3447 - $x->bmul($y); $x
ok 3448 - $x->bmul($y); $y
ok 3449 - $x->badd($y); $x
ok 3450 - $x->badd($y); $y
ok 3451 - $x->bsub($y); $x
ok 3452 - $x->bsub($y); $y
ok 3453 - $x->bdiv($y); $x
ok 3454 - $x->bdiv($y); $y
ok 3455 - $x->bmod($y); $x
ok 3456 - $x->bmod($y); $y
ok 3457 - $x->bmul($y); $x
ok 3458 - $x->bmul($y); $y
ok 3459 - $x->badd($y); $x
ok 3460 - $x->badd($y); $y
ok 3461 - $x->bsub($y); $x
ok 3462 - $x->bsub($y); $y
ok 3463 - $x->bdiv($y); $x
ok 3464 - $x->bdiv($y); $y
ok 3465 - $x->bmod($y); $x
ok 3466 - $x->bmod($y); $y
ok 3467 - overloading cmp works
ok 3468 - $x = Math::BigInt->new(10); $x = 2 ** $x; $x == 1024;
ok 3469 - $x = Math::BigInt->new(10); $x = 2 * $x; $x == 20;
ok 3470 - $x = Math::BigInt->new(10); $x = 2 + $x; $x == 12;
ok 3471 - $x = Math::BigInt->new(10); $x = 2 - $x; $x == -8;
ok 3472 - $x = Math::BigInt->new(10); $x = 20 / $x; $x == 2;
ok 3473 - $x = Math::BigInt->new(3); $x = 20 % $x; $x == 2;
ok 3474 - $x = Math::BigInt->new(7); $x = 20 & $x; $x == 4;
ok 3475 - $x = Math::BigInt->new(7); $x = 0x20 | $x; $x == 0x27;
ok 3476 - $x = Math::BigInt->new(7); $x = 0x20 ^ $x; $x == 0x27;
ok 3477 - $x = Math::BigInt->badd(4, 5); $x == 9;
ok 3478 - $x = Math::BigInt->new(1); $x is true
ok 3479 - $x = Math::BigInt->new(0); !$x is false
ok 3480 - objectify(2, 4, 5) gives Math::BigInt, 4, 5
ok 3481 - first arg matches /^Math::BigInt/
ok 3482 - second arg is 4
ok 3483 - third arg is 5
ok 3484 - objectify(0, 4, 5) gives Math::BigInt, 4, 5
ok 3485 - first arg matches /^Math::BigInt/
ok 3486 - second arg is 4
ok 3487 - third arg is 5
ok 3488 - objectify(2, 4, 5) gives Math::BigInt, 4, 5
ok 3489 - first arg matches /^Math::BigInt/
ok 3490 - second arg is 4
ok 3491 - third arg is 5
ok 3492 - objectify(2, 4, 5, 6, 7) gives Math::BigInt, 4, 5, 6, 7
ok 3493 - first arg matches /^Math::BigInt/
ok 3494 - second arg is 4
ok 3495 - second arg is a Math::BigInt object
ok 3496 - third arg is 5
ok 3497 - third arg is a Math::BigInt object
ok 3498 - fourth arg is 6
ok 3499 - fourth arg is a scalar
ok 3500 - fifth arg is 7
ok 3501 - fifth arg is a scalar
ok 3502 - objectify(2, Math::BigInt, 4, 5, 6, 7) gives Math::BigInt, 4, 5, 6, 7
ok 3503 - first arg is Math::BigInt
ok 3504 - second arg is 4
ok 3505 - second arg is a Math::BigInt object
ok 3506 - third arg is 5
ok 3507 - third arg is a Math::BigInt object
ok 3508 - fourth arg is 6
ok 3509 - fourth arg is a scalar
ok 3510 - fifth arg is 7
ok 3511 - fifth arg is a scalar
ok 3512 - Math::BigInt->new(123)->badd(123) = 246
ok 3513 - Math::BigInt->badd(123, 321) = 444
ok 3514 - Math::BigInt->badd(123, Math::BigInt->new(321)) = 444
ok 3515 - Math::BigInt->new(123)->bsub(122) = 1
ok 3516 - Math::BigInt->bsub(321, 123) = 198
ok 3517 - Math::BigInt->bsub(321, Math::BigInt->new(123)) = 198
ok 3518 - Math::BigInt->new(123)->bmul(123) = 15129
ok 3519 - Math::BigInt->bmul(123, 123) = 15129
ok 3520 - Math::BigInt->bmul(123, Math::BigInt->new(123)) = 15129
ok 3521 - Math::BigInt->new(15129)->bdiv(123) = 123
ok 3522 - Math::BigInt->bdiv(15129, 123) = 123
ok 3523 - Math::BigInt->bdiv(15129, Math::BigInt->new(123)) = 123
ok 3524 - Math::BigInt->new(15131)->bmod(123) = 2
ok 3525 - Math::BigInt->bmod(15131, 123) = 2
ok 3526 - Math::BigInt->bmod(15131, Math::BigInt->new(123)) = 2
ok 3527 - Math::BigInt->new(2)->bpow(16) = 65536
ok 3528 - Math::BigInt->bpow(2, 16) = 65536
ok 3529 - Math::BigInt->bpow(2, Math::BigInt->new(16)) = 65536
ok 3530 - Math::BigInt->new(2**15)->brsft(1) = 2**14
ok 3531 - Math::BigInt->brsft(2**15, 1) = 2**14
ok 3532 - Math::BigInt->brsft(2**15, Math::BigInt->new(1)) = 2**14
ok 3533 - Math::BigInt->new(2**13)->blsft(1) = 2**14
ok 3534 - Math::BigInt->blsft(2**13, 1) = 2**14
ok 3535 - Math::BigInt->blsft(2**13, Math::BigInt->new(1)) = 2**14
ok 3536 - $x = Math::BigInt->new(1050000000000000); $x->bsstr() = "105e+13"
ok 3537 - $x = Math::BigInt->new(1e+129); $x->bsstr() = "1e+129"
ok 3538 - Math::BigInt->new("1") = 1
ok 3539 - Math::BigInt->new(" 1") = 1
ok 3540 - Math::BigInt->new("1 ") = 1
ok 3541 - Math::BigInt->new(" 1 ") = 1
ok 3542 - Math::BigInt->new("\n1") = 1
ok 3543 - Math::BigInt->new("1\n") = 1
ok 3544 - Math::BigInt->new("\n1\n") = 1
ok 3545 - Math::BigInt->new(" \n1\n") = 1
ok 3546 - Math::BigInt->new(" \n1 \n") = 1
ok 3547 - Math::BigInt->new(" \n1\n ") = 1
ok 3548 - Math::BigInt->new(" \n1\n1") = 'NaN'
ok 3549 - Math::BigInt->new("1 \n1\n1") = 'NaN'
ok 3550 - Math::BigInt->new("12") = 12
ok 3551 - Math::BigInt->new(" 12") = 12
ok 3552 - Math::BigInt->new("12 ") = 12
ok 3553 - Math::BigInt->new(" 12 ") = 12
ok 3554 - Math::BigInt->new("\n12") = 12
ok 3555 - Math::BigInt->new("12\n") = 12
ok 3556 - Math::BigInt->new("\n12\n") = 12
ok 3557 - Math::BigInt->new(" \n12\n") = 12
ok 3558 - Math::BigInt->new(" \n12 \n") = 12
ok 3559 - Math::BigInt->new(" \n12\n ") = 12
ok 3560 - Math::BigInt->new(" \n12\n1") = 'NaN'
ok 3561 - Math::BigInt->new("1 \n12\n1") = 'NaN'
ok 3562 - Math::BigInt->new("123") = 123
ok 3563 - Math::BigInt->new(" 123") = 123
ok 3564 - Math::BigInt->new("123 ") = 123
ok 3565 - Math::BigInt->new(" 123 ") = 123
ok 3566 - Math::BigInt->new("\n123") = 123
ok 3567 - Math::BigInt->new("123\n") = 123
ok 3568 - Math::BigInt->new("\n123\n") = 123
ok 3569 - Math::BigInt->new(" \n123\n") = 123
ok 3570 - Math::BigInt->new(" \n123 \n") = 123
ok 3571 - Math::BigInt->new(" \n123\n ") = 123
ok 3572 - Math::BigInt->new(" \n123\n1") = 'NaN'
ok 3573 - Math::BigInt->new("1 \n123\n1") = 'NaN'
ok 3574 - Math::BigInt->new("1234") = 1234
ok 3575 - Math::BigInt->new(" 1234") = 1234
ok 3576 - Math::BigInt->new("1234 ") = 1234
ok 3577 - Math::BigInt->new(" 1234 ") = 1234
ok 3578 - Math::BigInt->new("\n1234") = 1234
ok 3579 - Math::BigInt->new("1234\n") = 1234
ok 3580 - Math::BigInt->new("\n1234\n") = 1234
ok 3581 - Math::BigInt->new(" \n1234\n") = 1234
ok 3582 - Math::BigInt->new(" \n1234 \n") = 1234
ok 3583 - Math::BigInt->new(" \n1234\n ") = 1234
ok 3584 - Math::BigInt->new(" \n1234\n1") = 'NaN'
ok 3585 - Math::BigInt->new("1 \n1234\n1") = 'NaN'
ok 3586 - Math::BigInt->new("12345") = 12345
ok 3587 - Math::BigInt->new(" 12345") = 12345
ok 3588 - Math::BigInt->new("12345 ") = 12345
ok 3589 - Math::BigInt->new(" 12345 ") = 12345
ok 3590 - Math::BigInt->new("\n12345") = 12345
ok 3591 - Math::BigInt->new("12345\n") = 12345
ok 3592 - Math::BigInt->new("\n12345\n") = 12345
ok 3593 - Math::BigInt->new(" \n12345\n") = 12345
ok 3594 - Math::BigInt->new(" \n12345 \n") = 12345
ok 3595 - Math::BigInt->new(" \n12345\n ") = 12345
ok 3596 - Math::BigInt->new(" \n12345\n1") = 'NaN'
ok 3597 - Math::BigInt->new("1 \n12345\n1") = 'NaN'
ok 3598 - Math::BigInt->new("123456") = 123456
ok 3599 - Math::BigInt->new(" 123456") = 123456
ok 3600 - Math::BigInt->new("123456 ") = 123456
ok 3601 - Math::BigInt->new(" 123456 ") = 123456
ok 3602 - Math::BigInt->new("\n123456") = 123456
ok 3603 - Math::BigInt->new("123456\n") = 123456
ok 3604 - Math::BigInt->new("\n123456\n") = 123456
ok 3605 - Math::BigInt->new(" \n123456\n") = 123456
ok 3606 - Math::BigInt->new(" \n123456 \n") = 123456
ok 3607 - Math::BigInt->new(" \n123456\n ") = 123456
ok 3608 - Math::BigInt->new(" \n123456\n1") = 'NaN'
ok 3609 - Math::BigInt->new("1 \n123456\n1") = 'NaN'
ok 3610 - Math::BigInt->new("1234567") = 1234567
ok 3611 - Math::BigInt->new(" 1234567") = 1234567
ok 3612 - Math::BigInt->new("1234567 ") = 1234567
ok 3613 - Math::BigInt->new(" 1234567 ") = 1234567
ok 3614 - Math::BigInt->new("\n1234567") = 1234567
ok 3615 - Math::BigInt->new("1234567\n") = 1234567
ok 3616 - Math::BigInt->new("\n1234567\n") = 1234567
ok 3617 - Math::BigInt->new(" \n1234567\n") = 1234567
ok 3618 - Math::BigInt->new(" \n1234567 \n") = 1234567
ok 3619 - Math::BigInt->new(" \n1234567\n ") = 1234567
ok 3620 - Math::BigInt->new(" \n1234567\n1") = 'NaN'
ok 3621 - Math::BigInt->new("1 \n1234567\n1") = 'NaN'
ok 3622 - Math::BigInt->new("12345678") = 12345678
ok 3623 - Math::BigInt->new(" 12345678") = 12345678
ok 3624 - Math::BigInt->new("12345678 ") = 12345678
ok 3625 - Math::BigInt->new(" 12345678 ") = 12345678
ok 3626 - Math::BigInt->new("\n12345678") = 12345678
ok 3627 - Math::BigInt->new("12345678\n") = 12345678
ok 3628 - Math::BigInt->new("\n12345678\n") = 12345678
ok 3629 - Math::BigInt->new(" \n12345678\n") = 12345678
ok 3630 - Math::BigInt->new(" \n12345678 \n") = 12345678
ok 3631 - Math::BigInt->new(" \n12345678\n ") = 12345678
ok 3632 - Math::BigInt->new(" \n12345678\n1") = 'NaN'
ok 3633 - Math::BigInt->new("1 \n12345678\n1") = 'NaN'
ok 3634 - Math::BigInt->new("123456789") = 123456789
ok 3635 - Math::BigInt->new(" 123456789") = 123456789
ok 3636 - Math::BigInt->new("123456789 ") = 123456789
ok 3637 - Math::BigInt->new(" 123456789 ") = 123456789
ok 3638 - Math::BigInt->new("\n123456789") = 123456789
ok 3639 - Math::BigInt->new("123456789\n") = 123456789
ok 3640 - Math::BigInt->new("\n123456789\n") = 123456789
ok 3641 - Math::BigInt->new(" \n123456789\n") = 123456789
ok 3642 - Math::BigInt->new(" \n123456789 \n") = 123456789
ok 3643 - Math::BigInt->new(" \n123456789\n ") = 123456789
ok 3644 - Math::BigInt->new(" \n123456789\n1") = 'NaN'
ok 3645 - Math::BigInt->new("1 \n123456789\n1") = 'NaN'
ok 3646 - Math::BigInt->new("1234567890") = 1234567890
ok 3647 - Math::BigInt->new(" 1234567890") = 1234567890
ok 3648 - Math::BigInt->new("1234567890 ") = 1234567890
ok 3649 - Math::BigInt->new(" 1234567890 ") = 1234567890
ok 3650 - Math::BigInt->new("\n1234567890") = 1234567890
ok 3651 - Math::BigInt->new("1234567890\n") = 1234567890
ok 3652 - Math::BigInt->new("\n1234567890\n") = 1234567890
ok 3653 - Math::BigInt->new(" \n1234567890\n") = 1234567890
ok 3654 - Math::BigInt->new(" \n1234567890 \n") = 1234567890
ok 3655 - Math::BigInt->new(" \n1234567890\n ") = 1234567890
ok 3656 - Math::BigInt->new(" \n1234567890\n1") = 'NaN'
ok 3657 - Math::BigInt->new("1 \n1234567890\n1") = 'NaN'
ok 3658 - value of ((2^148)+1)/17
ok 3659 - number of digits in ((2^148)+1)/17
ok 3660 - value of 2^127-1
ok 3661 - number of digits in 2^127-1
ok 3662 - number of digits in fraction part of 2^127-1
ok 3663 - number of digits in 1_000_000_000_000
ok 3664 - number of digits in fraction part of 1_000_000_000_000
ok 3665 - 2 <<= 18 with Math::BigInt objects
ok 3666 - 2 <<= 18 with Math::BigInt objects
ok 3667 - 2 >>= 18 with Math::BigInt objects
ok 3668 - 2 >>= 18 with Math::BigInt objects
ok 3669 - $x = Math::Foo->new(5); $x = $x - 8; $x = 3
ok 3670 - $x is an object of class "Math::Foo"
ok 3671 - $x = Math::Foo->new(5); $x = 8 - $x; $x = -3
ok 3672 - $x is an object of class "Math::Foo"
ok 3673 - numify of +Inf
ok 3674 - numify of -Inf
ok 3675 - numify of NaN
ok 3676 - Math::BigInt->new("+inf") = "inf"
ok 3677 # skip no 64 bit integer support
ok 3678 # skip no 64 bit integer support
ok 3679 # skip no 64 bit integer support
ok 3680 # skip no 64 bit integer support
ok 3681 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3682 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3683 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3684 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3685 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3686 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3687 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3688 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3689 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3690 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3691 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3692 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3693 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3694 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3695 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3696 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3697 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3698 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3699 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3700 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3701 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3702 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3703 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3704 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3705 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3706 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3707 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3708 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3709 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3710 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3711 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3712 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3713 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3714 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3715 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3716 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3717 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3718 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3719 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3720 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3721 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3722 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3723 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3724 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3725 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3726 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3727 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3728 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3729 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok 3730 # skip skipping tests not intended for the backend Math::BigInt::GMP
ok
t/biglog.t ...............
1..71
ok 1 - GMP loaded
ok 2 - blog(2)
ok 3 - blog(288)
ok 4 - blog(2000)
ok 5 - bexp(1)
ok 6 - bexp(2)
ok 7 - bexp(3)
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41 - blog(100)
ok 42 - 2 ** 32
ok 43 - 3 ** 32
ok 44 - 2 ** 65
ok 45 - blog(777**256, 12345678901234)
ok 46 - blog(777**777, 777)
ok 47 - 14.14213562
ok 48 - 4.472135955
ok 49 - 1.414213562
ok 50 - 0.4472135955
ok 51 - 0.1414213562
ok 52 - 0.7
ok 53 - 0.7000000000
ok 54 - 0.04472135955
ok 55 - 0.01414213562
ok 56 - 0.07
ok 57 - 0.07000000000
ok 58 - 0.001414213562
ok 59 - 0.1449137675
ok 60 - 1.095445115
ok 61 - 1.109053651
ok 62 - 3.507135583
ok 63 - 3.146426545
ok 64 - 3.141500000
ok 65 - 3.1415
ok 66 - 0.5169187652
ok 67 - bexp(1)
ok 68 - bexp(2)
ok 69 - bexp(12.5)
ok 70 - bexp(100)
ok 71 - bexp(12.5) to 91 digits
ok
t/bigroot.t ..............
1..9
ok 1 - GMP loaded
ok 2 - Try: Math::BigFloat 2->bpow(120)->broot(8,undef) == 32768
ok 3 - Try: Math::BigInt 2->bpow(120)->broot(8,undef) == 32768
ok 4 - Try: Math::BigFloat 2->bpow(60)->broot(8,undef) == 181.0193359837561662466161566988413540569
ok 5 - Try: Math::BigInt 2->bpow(60)->broot(8,undef) == 181
ok 6 - Try: Math::BigFloat 2->bpow(60)->broot(9,undef) == 101.5936673259647663841091609134277286651
ok 7 - Try: Math::BigInt 2->bpow(60)->broot(9,undef) == 101
ok 8 - Try: Math::BigFloat 2->bpow(60)->broot(17,undef) == 11.54672461623965153271017217302844672562
ok 9 - Try: Math::BigInt 2->bpow(60)->broot(17,undef) == 11
ok
t/mbi-from-big-scalar.t ..
1..12
ok 1 - new 9223372036854775805
ok 2 - new -9223372036854775805
ok 3 - new 9223372036854775806
ok 4 - new -9223372036854775806
ok 5 - new 9223372036854775807
ok 6 - new -9223372036854775807
ok 7 - new 9223372036854775808
ok 8 - new -9223372036854775808
ok 9 - new 18446744073709551614
ok 10 - new 18446744073709551615
ok 11 - 10 should be less than maxint
ok 12 # skip The following test may hang or cause an exception if incorrect. Set AUTHOR_TESTING to a true value to run this test.
ok
t/storable.t .............
1..1
ok 1
ok
Thread creation failed: pthread_create returned 12 at t/threads.t line 24.
Thread creation failed: pthread_create returned 12 at t/threads.t line 24.
Thread creation failed: pthread_create returned 12 at t/threads.t line 24.
Can't call method "join" on an undefined value at t/threads.t line 27.
# Looks like your test exited with 12 before it could output anything.
t/threads.t ..............
1..22
Dubious, test returned 12 (wstat 3072, 0xc00)
Failed 22/22 subtests
Test Summary Report
-------------------
t/threads.t (Wstat: 3072 Tests: 0 Failed: 0)
Non-zero exit status: 12
Parse errors: Bad plan. You planned 22 tests but ran 0.
Files=12, Tests=6597, 6 wallclock secs ( 0.96 usr 0.10 sys + 4.77 cusr 0.22 csys = 6.05 CPU)
Result: FAIL
Failed 1/12 test programs. 0/6597 subtests failed.
make: *** [test_dynamic] Error 12
PJACKLAM/Math-BigInt-GMP-1.49.tar.gz
make test TEST_VERBOSE=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports PJACKLAM/Math-BigInt-GMP-1.49.tar.gz
MITHALDU/Crypt-DH-0.07.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Crypt-DH-0.07-JEt8dG
MITHALDU/Crypt-DH-0.07.tar.gz
Has already been prepared
Running make for M/MI/MITHALDU/Crypt-DH-0.07.tar.gz
Warning: Prerequisite 'Math::BigInt::GMP => 1.24' for 'MITHALDU/Crypt-DH-0.07.tar.gz' failed when processing 'PJACKLAM/Math-BigInt-GMP-1.49.tar.gz' with 'make_test => NO'. Continuing, but chances to succeed are limited.
>>> make
cp lib/Crypt/DH.pm blib/lib/Crypt/DH.pm
Manifying 1 pod document
MITHALDU/Crypt-DH-0.07.tar.gz
make -- OK
Running make test
>>> make test TEST_VERBOSE=1
PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'inc', 'blib/lib', 'blib/arch')" t/00-compile.t t/01-dh.t
t/00-compile.t ..
1..1
ok 1 - use Crypt::DH;
ok
t/01-dh.t .......
1..21
ok 1 - any2bigint(scalar) returns a defined value
ok 2 - any2bigint(scalar) returns a Math::BigInt
ok 3 - any2bigint(scalar) returns the correct value
ok 4 - any2bigint(Math::BigInt) returns a defined value
ok 5 - any2bigint(Math::BigInt) returns a Math::BigInt
ok 6 - any2bigint(Math::BigInt) returns the correct value
ok 7 - any2bigint(Math::Pari) returns a defined value
ok 8 - any2bigint(Math::Pari) returns a Math::BigInt
ok 9 - any2bigint(Math::Pari) returns the correct value
ok 10 - Key generation did not modify g
ok 11 - Key generation did not modify p
ok 12 - Shared secrets match
ok 13 - Key generation did not modify g
ok 14 - Key generation did not modify p
ok 15 - Shared secrets match
ok 16 - Key generation did not modify g
ok 17 - Key generation did not modify p
ok 18 - Shared secrets match
ok 19 - Key generation did not modify g
ok 20 - Key generation did not modify p
ok 21 - Shared secrets match
ok
All tests successful.
Files=2, Tests=22, 6 wallclock secs ( 0.02 usr 0.01 sys + 5.56 cusr 0.03 csys = 5.62 CPU)
Result: PASS
MITHALDU/Crypt-DH-0.07.tar.gz
Tests succeeded but one dependency not OK (Math::BigInt::GMP)
MITHALDU/Crypt-DH-0.07.tar.gz
[dependencies] -- NA
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-1.42-_2k1Go
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Has already been prepared
Running make for S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Warning: Prerequisite 'Crypt::DH => 0.01' for 'SCHWIGON/Net-SSH-Perl-1.42.tar.gz' failed when processing 'MITHALDU/Crypt-DH-0.07.tar.gz' with 'make_test => NO one dependency not OK (Math::BigInt::GMP)'. Continuing, but chances to succeed are limited.
>>> make
cp lib/Net/SSH/Perl/SSH2.pm blib/lib/Net/SSH/Perl/SSH2.pm
cp lib/Net/SSH/Perl/Cipher.pm blib/lib/Net/SSH/Perl/Cipher.pm
cp lib/Net/SSH/Perl/Kex/DH1.pm blib/lib/Net/SSH/Perl/Kex/DH1.pm
cp lib/Net/SSH/Perl/Subsystem/Server.pm blib/lib/Net/SSH/Perl/Subsystem/Server.pm
cp lib/Net/SSH/Perl/Util/SSH1MP.pm blib/lib/Net/SSH/Perl/Util/SSH1MP.pm
cp lib/Net/SSH/Perl/Subsystem/Client.pm blib/lib/Net/SSH/Perl/Subsystem/Client.pm
cp lib/Net/SSH/Perl/Cipher/DES.pm blib/lib/Net/SSH/Perl/Cipher/DES.pm
cp lib/Net/SSH/Perl/Util/SSH2MP.pm blib/lib/Net/SSH/Perl/Util/SSH2MP.pm
cp lib/Net/SSH/Perl/Cipher/CFB.pm blib/lib/Net/SSH/Perl/Cipher/CFB.pm
cp lib/Net/SSH/Perl/ChannelMgr.pm blib/lib/Net/SSH/Perl/ChannelMgr.pm
cp lib/Net/SSH/Perl/AuthMgr.pm blib/lib/Net/SSH/Perl/AuthMgr.pm
cp lib/Net/SSH/Perl/Auth/RSA.pm blib/lib/Net/SSH/Perl/Auth/RSA.pm
cp lib/Net/SSH/Perl/Kex/DH.pm blib/lib/Net/SSH/Perl/Kex/DH.pm
cp lib/Net/SSH/Perl/Comp/Zlib.pm blib/lib/Net/SSH/Perl/Comp/Zlib.pm
cp lib/Net/SSH/Perl/Auth/Rhosts_RSA.pm blib/lib/Net/SSH/Perl/Auth/Rhosts_RSA.pm
cp lib/Net/SSH/Perl/Buffer.pm blib/lib/Net/SSH/Perl/Buffer.pm
cp lib/Net/SSH/Perl/Channel.pm blib/lib/Net/SSH/Perl/Channel.pm
cp lib/Net/SSH/Perl.pm blib/lib/Net/SSH/Perl.pm
cp lib/Net/SSH/Perl/Auth/PublicKey.pm blib/lib/Net/SSH/Perl/Auth/PublicKey.pm
cp lib/Net/SSH/Perl/Util.pm blib/lib/Net/SSH/Perl/Util.pm
cp lib/Net/SSH/Perl/Auth/Password.pm blib/lib/Net/SSH/Perl/Auth/Password.pm
cp lib/Net/SSH/Perl/Util/Term.pm blib/lib/Net/SSH/Perl/Util/Term.pm
cp lib/Net/SSH/Perl/Kex.pm blib/lib/Net/SSH/Perl/Kex.pm
cp lib/Net/SSH/Perl/Cipher/RC4.pm blib/lib/Net/SSH/Perl/Cipher/RC4.pm
cp lib/Net/SSH/Perl/Comp.pm blib/lib/Net/SSH/Perl/Comp.pm
cp lib/Net/SSH/Perl/Agent.pm blib/lib/Net/SSH/Perl/Agent.pm
cp lib/Net/SSH/Perl/Auth.pm blib/lib/Net/SSH/Perl/Auth.pm
cp lib/Net/SSH/Perl/Util/Hosts.pm blib/lib/Net/SSH/Perl/Util/Hosts.pm
cp lib/Net/SSH/Perl/Packet.pm blib/lib/Net/SSH/Perl/Packet.pm
cp lib/Net/SSH/Perl/Auth/KeyboardInt.pm blib/lib/Net/SSH/Perl/Auth/KeyboardInt.pm
cp lib/Net/SSH/Perl/Handle/SSH1.pm blib/lib/Net/SSH/Perl/Handle/SSH1.pm
cp lib/Net/SSH/Perl/Config.pm blib/lib/Net/SSH/Perl/Config.pm
cp lib/Net/SSH/Perl/Cipher/Blowfish.pm blib/lib/Net/SSH/Perl/Cipher/Blowfish.pm
cp lib/Net/SSH/Perl/Kex/DH14.pm blib/lib/Net/SSH/Perl/Kex/DH14.pm
cp lib/Net/SSH/Perl/Mac.pm blib/lib/Net/SSH/Perl/Mac.pm
cp lib/Net/SSH/Perl/Key/RSA1.pm blib/lib/Net/SSH/Perl/Key/RSA1.pm
cp lib/Net/SSH/Perl/Util/Win32.pm blib/lib/Net/SSH/Perl/Util/Win32.pm
cp lib/Net/SSH/Perl/Util/Authfile.pm blib/lib/Net/SSH/Perl/Util/Authfile.pm
cp lib/Net/SSH/Perl/Key/DSA.pm blib/lib/Net/SSH/Perl/Key/DSA.pm
cp lib/Net/SSH/Perl/SSH1.pm blib/lib/Net/SSH/Perl/SSH1.pm
cp lib/Net/SSH/Perl/Auth/Rhosts.pm blib/lib/Net/SSH/Perl/Auth/Rhosts.pm
cp lib/Net/SSH/Perl/Auth/ChallengeResponse.pm blib/lib/Net/SSH/Perl/Auth/ChallengeResponse.pm
cp lib/Net/SSH/Perl/Cipher/DES3.pm blib/lib/Net/SSH/Perl/Cipher/DES3.pm
cp lib/Net/SSH/Perl/Cipher/IDEA.pm blib/lib/Net/SSH/Perl/Cipher/IDEA.pm
cp lib/Net/SSH/Perl/Util/SSH1Misc.pm blib/lib/Net/SSH/Perl/Util/SSH1Misc.pm
cp lib/Net/SSH/Perl/Constants.pm blib/lib/Net/SSH/Perl/Constants.pm
cp lib/Net/SSH/Perl/Handle/SSH2.pm blib/lib/Net/SSH/Perl/Handle/SSH2.pm
cp lib/Net/SSH/Perl/Key/RSA.pm blib/lib/Net/SSH/Perl/Key/RSA.pm
cp lib/Net/SSH/Perl/Key.pm blib/lib/Net/SSH/Perl/Key.pm
cp lib/Net/SSH/Perl/Auth/KeyboardInteractive.pm blib/lib/Net/SSH/Perl/Auth/KeyboardInteractive.pm
cp lib/Net/SSH/Perl/Util/RSA.pm blib/lib/Net/SSH/Perl/Util/RSA.pm
cp lib/Net/SSH/Perl/Cipher/CBC.pm blib/lib/Net/SSH/Perl/Cipher/CBC.pm
cp lib/Net/SSH/Perl/Handle.pm blib/lib/Net/SSH/Perl/Handle.pm
Manifying 41 pod documents
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
make -- OK
Running make test
>>> make test TEST_VERBOSE=1
PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t
t/00-signature.t ... skipped: Set the environment variable TEST_SIGNATURE to enable this test
t/01-compile.t .....
1..1
ok 1 - use Net::SSH::Perl;
ok
t/02-buffer.t ......
1..19
ok 1 - make a buffer
ok 2 - buffer length is 7
ok 3 - get_str returns "foo"
ok 4 - offset is 7
ok 5 - get_str returns 0
ok 6 - get_int32 returns 999,99,999
ok 7 - get_int8 returns 2
ok 8 - get_char returns "a"
ok 9 - get_mp_int returns very large number
ok 10 - offset is 0 after empty()
ok 11 - length is 0 after empty()
ok 12 - bytes is "" after empty()
ok 13 - length is 6 after append
ok 14 - bytes is "foobar" after append
ok 15 - length is 0 after empty() again
ok 16 - dump returns ""
ok 17 - get_int16 returns 129
ok 18 - dump returns "00 81"
ok 19 - dump(1) returns "81"
ok
t/03-packet.t ......
1..10
ok 1 - created a packet
ok 2 - read a packet back
ok 3 - packet type is SSH_CMSG_USER
ok 4 - get_str returns "foo"
ok 5 - sending success and expecting a failure message croaks
ok 6 - check failure message
ok 7 - read fails after disconnect
ok 8 - error message on read after disconnect
ok 9 - packet type is SSH_SMSG_FAILURE
ok 10 - second packet type is SSH_CMSG_EOF
ok
t/04-config.t ......
1..25
ok 1 - created config object
ok 2 - port is 10000
ok 3 - port was set to 5000
ok 4 - got identity_files config
ok 5 - got two entries
ok 6 - first entry is "identity"
ok 7 - second entry is "identity2"
ok 8 - cipher is IDEA after merge
ok 9 - create a new config with an overridden option
ok 10 - port is 22
ok 11 - auth_rhosts is false
ok 12 - host is "dummy"
ok 13 - port is 5000
ok 14 - interactive is true
ok 15 - make a new SSH object
ok 16 - object has config
ok 17 - port for object is 10000
ok 18 - hostname is foo.bar.com
ok 19 - host key in object is foo.bar.com
ok 20 - port is 22 after override in SSH constructor
ok 21 - port is 22 after override via "options"
ok 22 - auth_rhosts is false
ok 23 - interactive is true
ok 24 - user is "bar"
ok 25 - user is "bar" after ->login
ok
t/05-cipher.t ......
1..60
ok 1 - First argument was true from line 49
ok 2 - Second argument was true from line 49
ok 3 - Values matched from line 49
ok 4 - Values matched from line 49
ok 5 - First argument was true from line 54
ok 6 - Second argument was true from line 54
ok 7 - Values matched from line 54
ok 8 - Values matched from line 54
ok 9 - First argument was true from line 59
ok 10 - Second argument was true from line 59
ok 11 - Values matched from line 59
ok 12 - Values matched from line 59
ok 13 - First argument was true from line 49
ok 14 - Second argument was true from line 49
ok 15 - Values matched from line 49
ok 16 - Values matched from line 49
ok 17 - First argument was true from line 54
ok 18 - Second argument was true from line 54
ok 19 - Values matched from line 54
ok 20 - Values matched from line 54
ok 21 - First argument was true from line 59
ok 22 - Second argument was true from line 59
ok 23 - Values matched from line 59
ok 24 - Values matched from line 59
ok 25 - First argument was true from line 49
ok 26 - Second argument was true from line 49
ok 27 - Values matched from line 49
ok 28 - Values matched from line 49
ok 29 - First argument was true from line 54
ok 30 - Second argument was true from line 54
ok 31 - Values matched from line 54
ok 32 - Values matched from line 54
ok 33 - First argument was true from line 59
ok 34 - Second argument was true from line 59
ok 35 - Values matched from line 59
ok 36 - Values matched from line 59
ok 37 - First argument was true from line 49
ok 38 - Second argument was true from line 49
ok 39 - Values matched from line 49
ok 40 - Values matched from line 49
ok 41 - First argument was true from line 54
ok 42 - Second argument was true from line 54
ok 43 - Values matched from line 54
ok 44 - Values matched from line 54
ok 45 - First argument was true from line 59
ok 46 - Second argument was true from line 59
ok 47 - Values matched from line 59
ok 48 - Values matched from line 59
ok 49 - First argument was true from line 49
ok 50 - Second argument was true from line 49
ok 51 - Values matched from line 49
ok 52 - Values matched from line 49
ok 53 - First argument was true from line 54
ok 54 - Second argument was true from line 54
ok 55 - Values matched from line 54
ok 56 - Values matched from line 54
ok 57 - First argument was true from line 59
ok 58 - Second argument was true from line 59
ok 59 - Values matched from line 59
ok 60 - Values matched from line 59
ok
t/06-auth.t ........ skipped: Test not enabled yet
t/06-circular.t ....
1..1
# Running under perl version 5.018000 for linux
# Current time local: Wed Jan 27 04:16:44 2016
# Current time GMT: Wed Jan 27 12:16:44 2016
# Using Test.pm version 1.26
ok 1
ok
t/99-perlcritic.t .. skipped: Set the environment variable TEST_CRITIC to enable this test
t/99-pod.t ......... skipped: Test not ready yet.
t/99-spellcheck.t .. skipped: Set the environment variable TEST_SPELL to enable this test
t/99-yaml.t ........ skipped: Set the environment variable TEST_AUTHOR to enable this test
All tests successful.
Files=12, Tests=116, 1 wallclock secs ( 0.06 usr 0.02 sys + 0.77 cusr 0.07 csys = 0.92 CPU)
Result: PASS
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Tests succeeded but one dependency not OK (Crypt::DH)
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
[dependencies] -- NA
BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-WithSocks-0.02-LdPRtD
BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
Has already been prepared
Running make for B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
Warning: Prerequisite 'Net::SSH::Perl => 0' for 'BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz' failed when processing 'SCHWIGON/Net-SSH-Perl-1.42.tar.gz' with 'make_test => NO one dependency not OK (Crypt::DH)'. Continuing, but chances to succeed are limited.
>>> make
cp lib/Net/SSH/Perl/WithSocks.pm blib/lib/Net/SSH/Perl/WithSocks.pm
Manifying 1 pod document
BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
make -- OK
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
test file [00-scratch.t] does not exist! Skipping! at -e line 1.
test file [01-sanity.t] does not exist! Skipping! at -e line 1.
Test::Manifest::test_harness found [t/load.t t/pod.t t/pod_coverage.t t/prereq.t]
t/load.t ..........
1..1
ok 1 - use Net::SSH::Perl::WithSocks;
ok
t/pod.t ...........
1..1
ok 1 - POD test for blib/lib/Net/SSH/Perl/WithSocks.pm
ok
t/pod_coverage.t ..
1..1
ok 1 - Pod coverage on Net::SSH::Perl::WithSocks
ok
t/prereq.t ........
1..1
ok 1 - Prereq test
ok
All tests successful.
Files=4, Tests=4, 4 wallclock secs ( 0.03 usr 0.01 sys + 4.34 cusr 0.09 csys = 4.47 CPU)
Result: PASS
BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
Tests succeeded but one dependency not OK (Net::SSH::Perl)
BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz
[dependencies] -- NA
Running test for module 'github_creator'
The module github_creator isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i github_creator'.
Running test for module 'Net::SSH::Perl::ProxiedIPC'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz ok
Net-SSH-Perl-ProxiedIPC-0.02/
Net-SSH-Perl-ProxiedIPC-0.02/Changes
Net-SSH-Perl-ProxiedIPC-0.02/lib/
Net-SSH-Perl-ProxiedIPC-0.02/Makefile.PL
Net-SSH-Perl-ProxiedIPC-0.02/MANIFEST
Net-SSH-Perl-ProxiedIPC-0.02/MANIFEST.SKIP
Net-SSH-Perl-ProxiedIPC-0.02/META.yml
Net-SSH-Perl-ProxiedIPC-0.02/MYMETA.yml
Net-SSH-Perl-ProxiedIPC-0.02/README
Net-SSH-Perl-ProxiedIPC-0.02/t/
Net-SSH-Perl-ProxiedIPC-0.02/t/load.t
Net-SSH-Perl-ProxiedIPC-0.02/t/pod.t
Net-SSH-Perl-ProxiedIPC-0.02/t/pod_coverage.t
Net-SSH-Perl-ProxiedIPC-0.02/t/prereq.t
Net-SSH-Perl-ProxiedIPC-0.02/t/scratch.t
Net-SSH-Perl-ProxiedIPC-0.02/t/test_manifest
Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/
Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/SSH/
Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/SSH/Perl/
Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/SSH/Perl/ProxiedIPC.pm
/bin/tar: Read 3584 bytes from -
Configuring B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite Net::SSH::Perl 0 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Net::SSH::Perl::ProxiedIPC
Writing MYMETA.yml and MYMETA.json
BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
---- Unsatisfied dependencies detected during ----
---- BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz ----
Net::SSH::Perl [requires]
Running test for module 'Net::SSH::Perl'
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-1.42-_2k1Go
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Has already been prepared
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Has already been made
SCHWIGON/Net-SSH-Perl-1.42.tar.gz
Has already been tested within this command
BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-ProxiedIPC-0.02-4vVAw4
BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
Has already been prepared
Running make for B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
Warning: Prerequisite 'Net::SSH::Perl => 0' for 'BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz' failed when processing 'SCHWIGON/Net-SSH-Perl-1.42.tar.gz' with 'make_test => NO one dependency not OK (Crypt::DH)'. Continuing, but chances to succeed are limited.
>>> make
cp lib/Net/SSH/Perl/ProxiedIPC.pm blib/lib/Net/SSH/Perl/ProxiedIPC.pm
Manifying 1 pod document
BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
make -- OK
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/load.t t/pod.t t/pod_coverage.t t/prereq.t t/scratch.t]
t/load.t ..........
1..1
ok 1 - use Net::SSH::Perl::ProxiedIPC;
ok
t/pod.t ...........
1..1
ok 1 - POD test for blib/lib/Net/SSH/Perl/ProxiedIPC.pm
ok
t/pod_coverage.t ..
1..1
ok 1 - Pod coverage on Net::SSH::Perl::ProxiedIPC
ok
t/prereq.t ........
1..1
ok 1 - Prereq test
ok
Can't locate Net/SSH/Perl.pm in @INC (you may need to install the Net::SSH::Perl module) (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-ProxiedIPC-0.02-4vVAw4/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-ProxiedIPC-0.02-4vVAw4/blib/arch /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .) at t/scratch.t line 6.
BEGIN failed--compilation aborted at t/scratch.t line 6.
t/scratch.t .......
Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
Test Summary Report
-------------------
t/scratch.t (Wstat: 512 Tests: 0 Failed: 0)
Non-zero exit status: 2
Parse errors: No plan found in TAP output
Files=5, Tests=4, 4 wallclock secs ( 0.03 usr 0.02 sys + 4.40 cusr 0.13 csys = 4.58 CPU)
Result: FAIL
Failed 1/5 test programs. 0/4 subtests failed.
make: *** [test_dynamic] Error 2
BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
one dependency not OK (Net::SSH::Perl); additionally test harness failed
make test TEST_VERBOSE=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz
Running test for module 'HTTP::Cookies::Omniweb'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz ok
HTTP-Cookies-Omniweb-1.13/
HTTP-Cookies-Omniweb-1.13/Changes
HTTP-Cookies-Omniweb-1.13/examples/
HTTP-Cookies-Omniweb-1.13/lib/
HTTP-Cookies-Omniweb-1.13/LICENSE
HTTP-Cookies-Omniweb-1.13/Makefile.PL
HTTP-Cookies-Omniweb-1.13/MANIFEST
HTTP-Cookies-Omniweb-1.13/META.yml
HTTP-Cookies-Omniweb-1.13/README
HTTP-Cookies-Omniweb-1.13/t/
HTTP-Cookies-Omniweb-1.13/t/compile.t
HTTP-Cookies-Omniweb-1.13/t/Cookies.xml
HTTP-Cookies-Omniweb-1.13/t/load.t
HTTP-Cookies-Omniweb-1.13/t/pod.t
HTTP-Cookies-Omniweb-1.13/t/pod_coverage.t
HTTP-Cookies-Omniweb-1.13/t/prereq.t
HTTP-Cookies-Omniweb-1.13/t/save.t
HTTP-Cookies-Omniweb-1.13/t/test_manifest
HTTP-Cookies-Omniweb-1.13/lib/HTTP/
HTTP-Cookies-Omniweb-1.13/lib/HTTP/Cookies/
HTTP-Cookies-Omniweb-1.13/lib/HTTP/Cookies/Omniweb.pm
/bin/tar: Read 5120 bytes from -
HTTP-Cookies-Omniweb-1.13/examples/README
Configuring B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for HTTP::Cookies::Omniweb
Writing MYMETA.yml and MYMETA.json
BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz
>>> make
cp lib/HTTP/Cookies/Omniweb.pm blib/lib/HTTP/Cookies/Omniweb.pm
Manifying 1 pod document
BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz
make -- OK
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/compile.t t/pod.t t/pod_coverage.t t/load.t t/save.t]
t/compile.t .......
1..1
ok 1 - use HTTP::Cookies::Omniweb;
ok
t/pod.t ...........
1..1
ok 1 - POD test for blib/lib/HTTP/Cookies/Omniweb.pm
ok
t/pod_coverage.t ..
1..1
ok 1 - Pod coverage on HTTP::Cookies::Omniweb
ok
t/load.t ..........
1..5
ok 1 - An object of class 'HTTP::Cookies::Omniweb' isa 'HTTP::Cookies::Omniweb'
ok 2 - Count of domains
ok 3 - .ebay.com has 1 cookies
ok 4 - .usatoday.com has 3 cookies
ok 5 - Cookie has right value
ok
t/save.t ..........
1..2
ok 1 - An object of class 'HTTP::Cookies::Omniweb' isa 'HTTP::Cookies::Omniweb'
ok 2 - Saved file is same as original
ok
All tests successful.
Files=5, Tests=10, 1 wallclock secs ( 0.03 usr 0.02 sys + 0.33 cusr 0.04 csys = 0.42 CPU)
Result: PASS
BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz
make test TEST_VERBOSE=1 -- OK
brian d foy <bdfoy@cpan.org>
Cookie storage and management for Omniweb
>>> (cd /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J && tar cvf - HTTP-Cookies-Omniweb-1.13.ppd blib) | gzip -c >/home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz
HTTP-Cookies-Omniweb-1.13.ppd
blib/
blib/man3/
blib/man3/HTTP::Cookies::Omniweb.3
blib/lib/
blib/lib/HTTP/
blib/lib/HTTP/Cookies/
blib/lib/HTTP/Cookies/Omniweb.pm
>>> mv /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/HTTP-Cookies-Omniweb-1.13.ppd /home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY
Running test for module 'PPI::App::ppi_version::BDFOY'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz ok
PPI-App-ppi_version-BDFOY-0.14/
PPI-App-ppi_version-BDFOY-0.14/Changes
PPI-App-ppi_version-BDFOY-0.14/corpus/
PPI-App-ppi_version-BDFOY-0.14/lib/
PPI-App-ppi_version-BDFOY-0.14/LICENSE
PPI-App-ppi_version-BDFOY-0.14/Makefile.PL
PPI-App-ppi_version-BDFOY-0.14/MANIFEST
PPI-App-ppi_version-BDFOY-0.14/MANIFEST.SKIP
PPI-App-ppi_version-BDFOY-0.14/META.json
PPI-App-ppi_version-BDFOY-0.14/META.yml
PPI-App-ppi_version-BDFOY-0.14/README
PPI-App-ppi_version-BDFOY-0.14/script/
PPI-App-ppi_version-BDFOY-0.14/t/
PPI-App-ppi_version-BDFOY-0.14/t/get_version.t
PPI-App-ppi_version-BDFOY-0.14/t/load.t
PPI-App-ppi_version-BDFOY-0.14/t/pod.t
PPI-App-ppi_version-BDFOY-0.14/t/pod_coverage.t
PPI-App-ppi_version-BDFOY-0.14/t/test_manifest
PPI-App-ppi_version-BDFOY-0.14/script/ppi_version
PPI-App-ppi_version-BDFOY-0.14/lib/PPI/
PPI-App-ppi_version-BDFOY-0.14/lib/PPI/App/
PPI-App-ppi_version-BDFOY-0.14/lib/PPI/App/ppi_version/
PPI-App-ppi_version-BDFOY-0.14/lib/PPI/App/ppi_version/BDFOY.pm
PPI-App-ppi_version-BDFOY-0.14/corpus/our.pm
PPI-App-ppi_version-BDFOY-0.14/corpus/vars.pm
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for PPI::App::ppi_version::BDFOY
Writing MYMETA.yml and MYMETA.json
BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp lib/PPI/App/ppi_version/BDFOY.pm blib/lib/PPI/App/ppi_version/BDFOY.pm
cp script/ppi_version blib/script/ppi_version
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ppi_version
Manifying 1 pod document
BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/load.t t/pod.t t/pod_coverage.t t/get_version.t]
t/load.t ..........
1..1
ok 1 - use PPI::App::ppi_version::BDFOY;
ok
t/pod.t ...........
1..2
ok 1 - POD test for blib/lib/PPI/App/ppi_version/BDFOY.pm
ok 2 - POD test for blib/script/ppi_version (no pod)
ok
t/pod_coverage.t ..
1..1
ok 1 - Pod coverage on PPI::App::ppi_version::BDFOY
ok
t/get_version.t ...
ok 1 - use PPI::App::ppi_version::BDFOY;
ok 2 - PPI::App::ppi_version::BDFOY->can('get_version')
# Subtest: our
ok 1 - get_version returns true for corpus/our.pm
1..1
ok 3 - our
# Subtest: vars
ok 1 - get_version returns true for corpus/vars.pm
1..1
ok 4 - vars
1..4
ok
All tests successful.
Files=4, Tests=8, 1 wallclock secs ( 0.03 usr 0.01 sys + 0.68 cusr 0.09 csys = 0.81 CPU)
Result: PASS
BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz
make test TEST_VERBOSE=1 -- OK
PPD for PPI-App-ppi_version-BDFOY-0.14 already made
Running test for module 'Pod::SpeakIt::MacSpeech'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz ok
Pod-SpeakIt-MacSpeech-0.11/
Pod-SpeakIt-MacSpeech-0.11/bin/
Pod-SpeakIt-MacSpeech-0.11/bin/pod2speech
Pod-SpeakIt-MacSpeech-0.11/Changes
Pod-SpeakIt-MacSpeech-0.11/examples/
Pod-SpeakIt-MacSpeech-0.11/examples/placeholder.pl
Pod-SpeakIt-MacSpeech-0.11/hack/
Pod-SpeakIt-MacSpeech-0.11/hack/audition.pl
Pod-SpeakIt-MacSpeech-0.11/hack/list_voices.pl
Pod-SpeakIt-MacSpeech-0.11/lib/
Pod-SpeakIt-MacSpeech-0.11/lib/MacSpeech.pm
Pod-SpeakIt-MacSpeech-0.11/LICENSE
Pod-SpeakIt-MacSpeech-0.11/Makefile.PL
Pod-SpeakIt-MacSpeech-0.11/MANIFEST
Pod-SpeakIt-MacSpeech-0.11/META.yml
Pod-SpeakIt-MacSpeech-0.11/README
Pod-SpeakIt-MacSpeech-0.11/t/
Pod-SpeakIt-MacSpeech-0.11/t/input_pod_dir/
Pod-SpeakIt-MacSpeech-0.11/t/input_pod_dir/one_para.pod
Pod-SpeakIt-MacSpeech-0.11/t/lib/
Pod-SpeakIt-MacSpeech-0.11/t/lib/speak_pod_file.pl
Pod-SpeakIt-MacSpeech-0.11/t/load.t
Pod-SpeakIt-MacSpeech-0.11/t/one_para.t
Pod-SpeakIt-MacSpeech-0.11/t/pod.t
Pod-SpeakIt-MacSpeech-0.11/t/pod_coverage.t
Pod-SpeakIt-MacSpeech-0.11/t/prereq.t
Pod-SpeakIt-MacSpeech-0.11/t/test_manifest
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite Mac::Carbon 0.77 not found.
Warning: prerequisite Mac::Files 0 not found.
Warning: prerequisite Mac::Speech 0 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Pod::SpeakIt::MacSpeech
Writing MYMETA.yml and MYMETA.json
BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
---- Unsatisfied dependencies detected during ----
---- BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz ----
Mac::Carbon [requires]
Mac::Speech [requires]
Mac::Files [requires]
Running test for module 'Mac::Carbon'
______________________ D i s t r o P r e f s ______________________
Mac-Carbon.yml[0]
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz ok
Mac-Carbon-0.82/
Mac-Carbon-0.82/AppleEvents/
Mac-Carbon-0.82/Carbon.h
Mac-Carbon-0.82/Carbon.pm
Mac-Carbon-0.82/Changes
Mac-Carbon-0.82/common.pl
Mac-Carbon-0.82/Components/
Mac-Carbon-0.82/Files/
Mac-Carbon-0.82/fixargs.pl
Mac-Carbon-0.82/Gestalt/
Mac-Carbon-0.82/InternetConfig/
Mac-Carbon-0.82/MacPerl/
Mac-Carbon-0.82/Makefile.PL
Mac-Carbon-0.82/MANIFEST
Mac-Carbon-0.82/MANIFEST.SKIP
Mac-Carbon-0.82/Memory/
Mac-Carbon-0.82/MoreFiles/
Mac-Carbon-0.82/Notification/
Mac-Carbon-0.82/OSA/
Mac-Carbon-0.82/Processes/
Mac-Carbon-0.82/QuickDraw/
Mac-Carbon-0.82/README
Mac-Carbon-0.82/Resources/
Mac-Carbon-0.82/Sound/
Mac-Carbon-0.82/Speech/
Mac-Carbon-0.82/t/
Mac-Carbon-0.82/typemap
Mac-Carbon-0.82/Types/
Mac-Carbon-0.82/xsubpps/
Mac-Carbon-0.82/xsubpps/xsubpp-5.6.1
Mac-Carbon-0.82/xsubpps/xsubpp-5.8.0
Mac-Carbon-0.82/Types/Makefile.PL
Mac-Carbon-0.82/Types/t/
Mac-Carbon-0.82/Types/Types.pm
Mac-Carbon-0.82/Types/Types.xs
Mac-Carbon-0.82/Types/t/Types.t
Mac-Carbon-0.82/t/Carbon.t
Mac-Carbon-0.82/Speech/eg/
Mac-Carbon-0.82/Speech/Makefile.PL
Mac-Carbon-0.82/Speech/Speech.pm
Mac-Carbon-0.82/Speech/Speech.xs
Mac-Carbon-0.82/Speech/t/
Mac-Carbon-0.82/Speech/typemap
Mac-Carbon-0.82/Speech/t/Speech.t
Mac-Carbon-0.82/Speech/eg/Cellist.plx
Mac-Carbon-0.82/Speech/eg/DumpVoices.plx
Mac-Carbon-0.82/Speech/eg/JukeBox.plx
Mac-Carbon-0.82/Speech/eg/Phonemes.plx
Mac-Carbon-0.82/Sound/Makefile.PL
Mac-Carbon-0.82/Sound/Sound.pm
Mac-Carbon-0.82/Sound/Sound.xs
Mac-Carbon-0.82/Sound/t/
Mac-Carbon-0.82/Sound/typemap
Mac-Carbon-0.82/Sound/t/Scream.rsrc
Mac-Carbon-0.82/Sound/t/Sound.t
Mac-Carbon-0.82/Resources/Makefile.PL
Mac-Carbon-0.82/Resources/Resources.pm
Mac-Carbon-0.82/Resources/Resources.xs
Mac-Carbon-0.82/Resources/t/
Mac-Carbon-0.82/Resources/t/Resources.t
Mac-Carbon-0.82/QuickDraw/typemap
Mac-Carbon-0.82/Processes/eg/
Mac-Carbon-0.82/Processes/Makefile.PL
Mac-Carbon-0.82/Processes/Processes.pm
Mac-Carbon-0.82/Processes/Processes.xs
Mac-Carbon-0.82/Processes/t/
Mac-Carbon-0.82/Processes/typemap
Mac-Carbon-0.82/Processes/t/Processes.t
Mac-Carbon-0.82/Processes/eg/Processes.plx
Mac-Carbon-0.82/OSA/eg/
Mac-Carbon-0.82/OSA/Makefile.PL
Mac-Carbon-0.82/OSA/OSA.pm
Mac-Carbon-0.82/OSA/OSA.xs
Mac-Carbon-0.82/OSA/typemap
Mac-Carbon-0.82/OSA/eg/AppleScript.eg
Mac-Carbon-0.82/OSA/eg/AppleScript2.eg
Mac-Carbon-0.82/OSA/eg/Frontier.eg
Mac-Carbon-0.82/OSA/eg/Record.eg
Mac-Carbon-0.82/Notification/Makefile.PL
Mac-Carbon-0.82/Notification/Notification.pm
Mac-Carbon-0.82/Notification/Notification.xs
Mac-Carbon-0.82/Notification/t/
Mac-Carbon-0.82/Notification/typemap
Mac-Carbon-0.82/Notification/t/Notification.rsrc
Mac-Carbon-0.82/Notification/t/Notification.t
Mac-Carbon-0.82/MoreFiles/eg/
Mac-Carbon-0.82/MoreFiles/Makefile.PL
Mac-Carbon-0.82/MoreFiles/MF.xs
Mac-Carbon-0.82/MoreFiles/MoreFiles.pm
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/
Mac-Carbon-0.82/MoreFiles/t/
Mac-Carbon-0.82/MoreFiles/t/MoreFiles.t
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/DirectoryCopy.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/DirectoryCopy.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FileCopy.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FileCopy.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FSpCompat.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FSpCompat.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FullPath.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FullPath.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/IterateDirectory.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/IterateDirectory.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreDesktopMgr.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreDesktopMgr.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFiles.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFiles.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFilesExtras.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFilesExtras.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/Optimization.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/OptimizationEnd.h
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/Search.c
Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/Search.h
Mac-Carbon-0.82/MoreFiles/eg/Application.plx
Mac-Carbon-0.82/MoreFiles/eg/Iterate.plx
Mac-Carbon-0.82/Memory/Makefile.PL
Mac-Carbon-0.82/Memory/Memory.pm
Mac-Carbon-0.82/Memory/Memory.xs
Mac-Carbon-0.82/Memory/t/
Mac-Carbon-0.82/Memory/t/Memory.t
Mac-Carbon-0.82/MacPerl/MacPerl.pm
Mac-Carbon-0.82/MacPerl/MacPerl.xs
Mac-Carbon-0.82/MacPerl/Makefile.PL
Mac-Carbon-0.82/MacPerl/OSA.xs
Mac-Carbon-0.82/MacPerl/t/
Mac-Carbon-0.82/MacPerl/t/MacPerl.t
Mac-Carbon-0.82/InternetConfig/eg/
Mac-Carbon-0.82/InternetConfig/InternetConfig.pm
Mac-Carbon-0.82/InternetConfig/InternetConfig.xs
Mac-Carbon-0.82/InternetConfig/Makefile.PL
Mac-Carbon-0.82/InternetConfig/typemap
Mac-Carbon-0.82/InternetConfig/eg/IC.plx
Mac-Carbon-0.82/InternetConfig/eg/ICDump.plx
Mac-Carbon-0.82/InternetConfig/eg/ICDumpMap.plx
Mac-Carbon-0.82/Gestalt/Gestalt.pm
Mac-Carbon-0.82/Gestalt/Gestalt.xs
Mac-Carbon-0.82/Gestalt/Makefile.PL
Mac-Carbon-0.82/Gestalt/t/
Mac-Carbon-0.82/Gestalt/t/Gestalt.t
Mac-Carbon-0.82/Files/Files.pm
Mac-Carbon-0.82/Files/Files.xs
Mac-Carbon-0.82/Files/Makefile.PL
Mac-Carbon-0.82/Files/t/
Mac-Carbon-0.82/Files/typemap
Mac-Carbon-0.82/Files/t/Alias.t
Mac-Carbon-0.82/Files/t/Constants.t
Mac-Carbon-0.82/Files/t/Files.t
Mac-Carbon-0.82/Files/t/Info.t
Mac-Carbon-0.82/Components/Components.pm
Mac-Carbon-0.82/Components/Components.xs
Mac-Carbon-0.82/Components/eg/
Mac-Carbon-0.82/Components/Makefile.PL
Mac-Carbon-0.82/Components/t/
Mac-Carbon-0.82/Components/typemap
Mac-Carbon-0.82/Components/t/Components.t
Mac-Carbon-0.82/Components/eg/ListComponents.plx
Mac-Carbon-0.82/AppleEvents/AppleEvents.pm
Mac-Carbon-0.82/AppleEvents/AppleEvents.xs
Mac-Carbon-0.82/AppleEvents/CarbonAE.h
Mac-Carbon-0.82/AppleEvents/eg/
Mac-Carbon-0.82/AppleEvents/Makefile.PL
Mac-Carbon-0.82/AppleEvents/PerlAEUtils.cp
Mac-Carbon-0.82/AppleEvents/PerlAEUtils.h
Mac-Carbon-0.82/AppleEvents/t/
Mac-Carbon-0.82/AppleEvents/t/desc.t
Mac-Carbon-0.82/AppleEvents/t/event.t
Mac-Carbon-0.82/AppleEvents/t/helper.pl
Mac-Carbon-0.82/AppleEvents/eg/AEReceiver.eg
Mac-Carbon-0.82/AppleEvents/eg/AEReceiver2.eg
Mac-Carbon-0.82/AppleEvents/eg/AESender.eg
Mac-Carbon-0.82/AppleEvents/eg/AESender2.eg
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::AppleEvents
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Components
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Files
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Gestalt
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::InternetConfig
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for MacPerl
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Memory
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::MoreFiles
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Notification
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::OSA
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Processes
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Resources
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Sound
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Speech
Writing MYMETA.yml and MYMETA.json
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Mac::Types
Writing MYMETA.yml and MYMETA.json
Generating a Unix-style Makefile
Writing Makefile for Mac::Carbon
Writing MYMETA.yml and MYMETA.json
CNANDOR/Mac-Carbon-0.82.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp Carbon.pm blib/lib/Mac/Carbon.pm
make[1]: Entering directory `/home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1/AppleEvents'
cp AppleEvents.pod ../blib/lib/Mac/AppleEvents.pod
cp AppleEvents.pm ../blib/lib/Mac/AppleEvents.pm
Running Mkbootstrap for Mac::AppleEvents ()
chmod 644 "AppleEvents.bs"
"/home/fly1800/ap1800-297235/bin/perl-static" ../xsubpps/xsubpp-5.8.0 -noprototypes -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" AppleEvents.xs > AppleEvents.xsc && mv AppleEvents.xsc AppleEvents.c
gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"1.32\" -DXS_VERSION=\"1.32\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" AppleEvents.c
In file included from AppleEvents.xs:63:
../Carbon.h:87:20: error: Events.h: No such file or directory
../Carbon.h:88:21: error: Dialogs.h: No such file or directory
../Carbon.h:89:19: error: Files.h: No such file or directory
../Carbon.h:90:19: error: Types.h: No such file or directory
../Carbon.h:91:31: error: ConditionalMacros.h: No such file or directory
In file included from AppleEvents.xs:63:
../Carbon.h:93: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'MacOSRet'
../Carbon.h:94: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'HandleRet'
../Carbon.h:95: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'RawPtr'
../Carbon.h:96: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PtrRet'
In file included from AppleEvents.xs:63:
../Carbon.h:125: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'MacPerl_CopyC2P'
../Carbon.h: In function 'ReadHex':
../Carbon.h:146: error: 'nil' undeclared (first use in this function)
../Carbon.h:146: error: (Each undeclared identifier is reported only once
../Carbon.h:146: error: for each function it appears in.)
../Carbon.h: At top level:
../Carbon.h:159: error: expected ')' before 'dataType'
../Carbon.h:183: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'SecondsMac2Unix'
../Carbon.h:194: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'SecondsUnix2Mac'
../Carbon.h:219: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIFSpUp'
../Carbon.h:239: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIFSpDown'
../Carbon.h:276: error: expected ';', ',' or ')' before '*' token
../Carbon.h:322: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIPath2FSp'
../Carbon.h:403: error: expected ';', ',' or ')' before '*' token
../Carbon.h:415: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSISpecial2FSp'
../Carbon.h:423: error: expected ';', ',' or ')' before '*' token
../Carbon.h:432: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIPath2FS'
../Carbon.h:439: error: expected declaration specifiers or '...' before 'OSType'
../Carbon.h:439: error: expected declaration specifiers or '...' before 'OSType'
../Carbon.h: In function 'fsetfileinfo':
../Carbon.h:441: error: 'FInfo' undeclared (first use in this function)
../Carbon.h:441: error: expected ';' before 'info'
../Carbon.h:442: error: 'FSSpec' undeclared (first use in this function)
../Carbon.h:442: error: 'spec' undeclared (first use in this function)
../Carbon.h:445: error: 'info' undeclared (first use in this function)
../Carbon.h:446: error: 'type' undeclared (first use in this function)
../Carbon.h:447: error: 'creator' undeclared (first use in this function)
../Carbon.h:448: error: 'kHasBeenInited' undeclared (first use in this function)
../Carbon.h: At top level:
../Carbon.h:457: error: expected declaration specifiers or '...' before 'OSType'
../Carbon.h:457: error: expected declaration specifiers or '...' before 'OSType'
../Carbon.h: In function 'fgetfileinfo':
../Carbon.h:459: error: 'FInfo' undeclared (first use in this function)
../Carbon.h:459: error: expected ';' before 'info'
../Carbon.h:460: error: 'FSSpec' undeclared (first use in this function)
../Carbon.h:460: error: 'spec' undeclared (first use in this function)
../Carbon.h:463: error: 'info' undeclared (first use in this function)
../Carbon.h:464: error: 'creator' undeclared (first use in this function)
../Carbon.h:466: error: 'type' undeclared (first use in this function)
../Carbon.h: At top level:
../Carbon.h:476: error: expected ';', ',' or ')' before '*' token
../Carbon.h:488: error: expected ';', ',' or ')' before '*' token
../Carbon.h:499: error: expected ';', ',' or ')' before '*' token
In file included from AppleEvents.xs:64:
CarbonAE.h:30: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gBuildError'
CarbonAE.h: In function 'pAEBuildError':
CarbonAE.h:83: error: 'gBuildError' undeclared (first use in this function)
CarbonAE.h:85: warning: initialization makes pointer from integer without a cast
CarbonAE.h:88: error: 'aeBuildSyntaxBadToken' undeclared (first use in this function)
CarbonAE.h:91: error: 'aeBuildSyntaxBadEOF' undeclared (first use in this function)
CarbonAE.h:94: error: 'aeBuildSyntaxNoEOF' undeclared (first use in this function)
CarbonAE.h:97: error: 'aeBuildSyntaxBadNegative' undeclared (first use in this function)
CarbonAE.h:100: error: 'aeBuildSyntaxMissingQuote' undeclared (first use in this function)
CarbonAE.h:103: error: 'aeBuildSyntaxBadHex' undeclared (first use in this function)
CarbonAE.h:106: error: 'aeBuildSyntaxOddHex' undeclared (first use in this function)
CarbonAE.h:109: error: 'aeBuildSyntaxNoCloseHex' undeclared (first use in this function)
CarbonAE.h:112: error: 'aeBuildSyntaxUncoercedHex' undeclared (first use in this function)
CarbonAE.h:115: error: 'aeBuildSyntaxNoCloseString' undeclared (first use in this function)
CarbonAE.h:118: error: 'aeBuildSyntaxBadDesc' undeclared (first use in this function)
CarbonAE.h:121: error: 'aeBuildSyntaxBadData' undeclared (first use in this function)
CarbonAE.h:124: error: 'aeBuildSyntaxNoCloseParen' undeclared (first use in this function)
CarbonAE.h:127: error: 'aeBuildSyntaxNoCloseBracket' undeclared (first use in this function)
CarbonAE.h:130: error: 'aeBuildSyntaxNoCloseBrace' undeclared (first use in this function)
CarbonAE.h:133: error: 'aeBuildSyntaxNoKey' undeclared (first use in this function)
CarbonAE.h:136: error: 'aeBuildSyntaxNoColon' undeclared (first use in this function)
CarbonAE.h:139: error: 'aeBuildSyntaxCoercedList' undeclared (first use in this function)
CarbonAE.h:142: error: 'aeBuildSyntaxUncoercedDoubleAt' undeclared (first use in this function)
AppleEvents.xs:68:20: error: Memory.h: No such file or directory
AppleEvents.xs:69:25: error: AppleEvents.h: No such file or directory
In file included from AppleEvents.xs:70:
PerlAEUtils.h:39:17: error: OSA.h: No such file or directory
In file included from AppleEvents.xs:70:
PerlAEUtils.h: At top level:
PerlAEUtils.h:45: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAECreate'
PerlAEUtils.h:46: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAESend'
PerlAEUtils.h:47: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEResume'
PerlAEUtils.h:48: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEActive'
PerlAEUtils.h:53: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEInstall'
PerlAEUtils.h:55: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEArgs'
PerlAEUtils.h:58: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEDoNextParam'
PerlAEUtils.h:60: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEInstallEventHandler'
PerlAEUtils.h:61: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEGetEventHandler'
PerlAEUtils.h:62: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAERemoveEventHandler'
PerlAEUtils.h:63: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEDoAppleEvent'
PerlAEUtils.h:64: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEHasOpenHandler'
AppleEvents.c: In function 'XS_AEDesc__new':
AppleEvents.c:98: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:98: error: expected ';' before 'type'
AppleEvents.c:99: error: 'Handle' undeclared (first use in this function)
AppleEvents.c:99: error: expected ';' before 'data'
AppleEvents.c:100: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:100: error: expected ';' before 'RETVAL'
AppleEvents.c:103: error: 'type' undeclared (first use in this function)
AppleEvents.c:103:13: warning: multi-character character constant
AppleEvents.c:110: error: 'data' undeclared (first use in this function)
AppleEvents.c:114: error: expected expression before 'unsigned'
AppleEvents.xs:94: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEDesc_type':
AppleEvents.c:150: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:150: error: expected ';' before 'desc'
AppleEvents.c:151: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:151: error: expected ';' before 'newType'
AppleEvents.c:152: error: expected ';' before 'RETVAL'
AppleEvents.c:155: error: 'desc' undeclared (first use in this function)
AppleEvents.c:160: error: 'newType' undeclared (first use in this function)
AppleEvents.xs:113: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c:175: error: expected ';' before 'hos'
AppleEvents.c:176: error: 'hos' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEDesc_data':
AppleEvents.c:189: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:189: error: expected ';' before 'desc'
AppleEvents.c:190: error: 'Handle' undeclared (first use in this function)
AppleEvents.c:190: error: expected ';' before 'newData'
AppleEvents.c:191: error: expected ';' before 'RETVAL'
AppleEvents.c:194: error: 'desc' undeclared (first use in this function)
AppleEvents.c:199: error: 'newData' undeclared (first use in this function)
AppleEvents.c:203: error: expected expression before 'unsigned'
AppleEvents.xs:132: error: 'Size' undeclared (first use in this function)
AppleEvents.xs:132: error: expected ';' before 'descLen'
AppleEvents.xs:141: error: 'descLen' undeclared (first use in this function)
AppleEvents.xs:142: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEKeyDesc__new':
AppleEvents.c:251: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:251: error: expected ';' before 'key'
AppleEvents.c:252: error: expected ';' before 'type'
AppleEvents.c:253: error: 'Handle' undeclared (first use in this function)
AppleEvents.c:253: error: expected ';' before 'data'
AppleEvents.c:254: error: 'AEKeyDesc' undeclared (first use in this function)
AppleEvents.c:254: error: expected ';' before 'RETVAL'
AppleEvents.c:257: error: 'key' undeclared (first use in this function)
AppleEvents.c:264: error: 'type' undeclared (first use in this function)
AppleEvents.c:264:13: warning: multi-character character constant
AppleEvents.c:271: error: 'data' undeclared (first use in this function)
AppleEvents.c:275: error: expected expression before 'unsigned'
AppleEvents.xs:161: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEKeyDesc_key':
AppleEvents.c:312: error: 'AEKeyDesc' undeclared (first use in this function)
AppleEvents.c:312: error: expected ';' before 'desc'
AppleEvents.c:313: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:313: error: expected ';' before 'newKey'
AppleEvents.c:314: error: expected ';' before 'RETVAL'
AppleEvents.c:317: error: 'desc' undeclared (first use in this function)
AppleEvents.c:322: error: 'newKey' undeclared (first use in this function)
AppleEvents.xs:186: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c:337: error: expected ';' before 'hos'
AppleEvents.c:338: error: 'hos' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEKeyDesc_type':
AppleEvents.c:351: error: 'AEKeyDesc' undeclared (first use in this function)
AppleEvents.c:351: error: expected ';' before 'desc'
AppleEvents.c:352: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:352: error: expected ';' before 'newType'
AppleEvents.c:353: error: expected ';' before 'RETVAL'
AppleEvents.c:356: error: 'desc' undeclared (first use in this function)
AppleEvents.c:361: error: 'newType' undeclared (first use in this function)
AppleEvents.xs:200: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c:376: error: expected ';' before 'hos'
AppleEvents.c:377: error: 'hos' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEKeyDesc_data':
AppleEvents.c:390: error: 'AEKeyDesc' undeclared (first use in this function)
AppleEvents.c:390: error: expected ';' before 'desc'
AppleEvents.c:391: error: 'Handle' undeclared (first use in this function)
AppleEvents.c:391: error: expected ';' before 'newData'
AppleEvents.c:392: error: expected ';' before 'RETVAL'
AppleEvents.c:395: error: 'desc' undeclared (first use in this function)
AppleEvents.c:400: error: 'newData' undeclared (first use in this function)
AppleEvents.c:404: error: expected expression before 'unsigned'
AppleEvents.xs:217: error: 'Size' undeclared (first use in this function)
AppleEvents.xs:217: error: expected ';' before 'descLen'
AppleEvents.xs:225: error: 'descLen' undeclared (first use in this function)
AppleEvents.xs:226: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEKeyDesc_desc':
AppleEvents.c:448: error: 'AEKeyDesc' undeclared (first use in this function)
AppleEvents.c:448: error: expected ';' before 'desc'
AppleEvents.c:449: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:449: error: expected ';' before 'RETVAL'
AppleEvents.c:452: error: 'desc' undeclared (first use in this function)
AppleEvents.xs:240: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AECreateDesc':
AppleEvents.c:475: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:475: error: expected ';' before 'typeCode'
AppleEvents.c:477: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:477: error: expected ';' before 'RETVAL'
AppleEvents.c:479: error: 'typeCode' undeclared (first use in this function)
AppleEvents.xs:266: error: 'OSErr' undeclared (first use in this function)
AppleEvents.xs:266: error: expected ';' before 'error'
AppleEvents.xs:271: error: 'error' undeclared (first use in this function)
AppleEvents.xs:271: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AECoerce':
AppleEvents.c:508: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:508: error: expected ';' before 'typeCode'
AppleEvents.c:510: error: expected ';' before 'toType'
AppleEvents.c:511: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:511: error: expected ';' before 'RETVAL'
AppleEvents.c:513: error: 'typeCode' undeclared (first use in this function)
AppleEvents.c:516: error: 'toType' undeclared (first use in this function)
AppleEvents.xs:295: error: 'OSErr' undeclared (first use in this function)
AppleEvents.xs:295: error: expected ';' before 'error'
AppleEvents.xs:300: error: 'error' undeclared (first use in this function)
AppleEvents.xs:300: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AECoerceDesc':
AppleEvents.c:545: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:545: error: expected ';' before 'theAEDesc'
AppleEvents.c:546: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:546: error: expected ';' before 'toType'
AppleEvents.c:547: error: expected ';' before 'RETVAL'
AppleEvents.c:550: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.c:554: error: 'toType' undeclared (first use in this function)
AppleEvents.xs:312: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDisposeDesc':
AppleEvents.c:572: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:572: error: expected ';' before 'theAEDesc'
AppleEvents.c:573: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:573: error: expected ';' before 'RETVAL'
AppleEvents.c:577: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.c:581: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDuplicateDesc':
AppleEvents.c:594: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:594: error: expected ';' before 'theAEDesc'
AppleEvents.c:595: error: expected ';' before 'RETVAL'
AppleEvents.c:598: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.xs:344: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AECreateList':
AppleEvents.c:618: error: 'Boolean' undeclared (first use in this function)
AppleEvents.c:618: error: expected ';' before 'isRecord'
AppleEvents.c:619: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:619: error: expected ';' before 'RETVAL'
AppleEvents.xs:370: error: 'isRecord' undeclared (first use in this function)
AppleEvents.xs:370: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AECountItems':
AppleEvents.c:642: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:642: error: expected ';' before 'theAEDescList'
AppleEvents.c:646: error: 'theAEDescList' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPut':
AppleEvents.c:670: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:670: error: expected ';' before 'theAEDescList'
AppleEvents.c:672: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:672: error: expected ';' before 'typeCode'
AppleEvents.c:674: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:674: error: expected ';' before 'RETVAL'
AppleEvents.c:678: error: 'theAEDescList' undeclared (first use in this function)
AppleEvents.c:682: error: 'typeCode' undeclared (first use in this function)
AppleEvents.xs:412: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutDesc':
AppleEvents.c:708: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:708: error: expected ';' before 'theAEDescList'
AppleEvents.c:710: error: expected ';' before 'theAEDesc'
AppleEvents.c:711: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:711: error: expected ';' before 'RETVAL'
AppleEvents.c:715: error: 'theAEDescList' undeclared (first use in this function)
AppleEvents.c:720: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.c:724: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutKey':
AppleEvents.c:737: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:737: error: expected ';' before 'theAERecord'
AppleEvents.c:738: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:738: error: expected ';' before 'theAEKeyword'
AppleEvents.c:739: error: expected ';' before 'typeCode'
AppleEvents.c:741: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:741: error: expected ';' before 'RETVAL'
AppleEvents.c:745: error: 'theAERecord' undeclared (first use in this function)
AppleEvents.c:749: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:752: error: 'typeCode' undeclared (first use in this function)
AppleEvents.xs:448: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutKeyDesc':
AppleEvents.c:778: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:778: error: expected ';' before 'theAERecord'
AppleEvents.c:779: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:779: error: expected ';' before 'theAEKeyword'
AppleEvents.c:780: error: expected ';' before 'theAEDesc'
AppleEvents.c:781: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:781: error: expected ';' before 'RETVAL'
AppleEvents.c:785: error: 'theAERecord' undeclared (first use in this function)
AppleEvents.c:789: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:793: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.c:797: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetNthDesc':
AppleEvents.c:811: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:811: error: expected ';' before 'theAEDescList'
AppleEvents.c:813: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:813: error: expected ';' before 'desiredType'
AppleEvents.c:816: error: 'theAEDescList' undeclared (first use in this function)
AppleEvents.c:821: error: 'desiredType' undeclared (first use in this function)
AppleEvents.c:821: error: 'typeWildCard' undeclared (first use in this function)
AppleEvents.xs:480: error: expected ';' before 'kw'
AppleEvents.xs:481: error: expected ';' before 'desc'
AppleEvents.xs:483: error: 'kw' undeclared (first use in this function)
AppleEvents.xs:483: error: 'desc' undeclared (first use in this function)
AppleEvents.xs:492: error: expected ';' before 'hos'
AppleEvents.xs:493: error: 'hos' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetKeyDesc':
AppleEvents.c:858: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:858: error: expected ';' before 'theAEDescList'
AppleEvents.c:859: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:859: error: expected ';' before 'theAEKeyword'
AppleEvents.c:860: error: expected ';' before 'desiredType'
AppleEvents.c:861: error: expected ';' before 'RETVAL'
AppleEvents.c:864: error: 'theAEDescList' undeclared (first use in this function)
AppleEvents.c:868: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:872: error: 'desiredType' undeclared (first use in this function)
AppleEvents.c:872: error: 'typeWildCard' undeclared (first use in this function)
AppleEvents.xs:502: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDeleteItem':
AppleEvents.c:893: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:893: error: expected ';' before 'theAEDescList'
AppleEvents.c:895: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:895: error: expected ';' before 'RETVAL'
AppleEvents.c:899: error: 'theAEDescList' undeclared (first use in this function)
AppleEvents.c:903: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutParam':
AppleEvents.c:916: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:916: error: expected ';' before 'theAppleEvent'
AppleEvents.c:917: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:917: error: expected ';' before 'theAEKeyword'
AppleEvents.c:918: error: expected ';' before 'typeCode'
AppleEvents.c:920: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:920: error: expected ';' before 'RETVAL'
AppleEvents.c:924: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:928: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:931: error: 'typeCode' undeclared (first use in this function)
AppleEvents.xs:539: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutParamDesc':
AppleEvents.c:957: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:957: error: expected ';' before 'theAppleEvent'
AppleEvents.c:958: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:958: error: expected ';' before 'theAEKeyword'
AppleEvents.c:959: error: expected ';' before 'theAEDesc'
AppleEvents.c:960: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:960: error: expected ';' before 'RETVAL'
AppleEvents.c:964: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:968: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:972: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.c:976: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetParamDesc':
AppleEvents.c:989: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:989: error: expected ';' before 'theAppleEvent'
AppleEvents.c:990: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:990: error: expected ';' before 'theAEKeyword'
AppleEvents.c:991: error: expected ';' before 'desiredType'
AppleEvents.c:992: error: expected ';' before 'RETVAL'
AppleEvents.c:995: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:999: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:1003: error: 'desiredType' undeclared (first use in this function)
AppleEvents.c:1003: error: 'typeWildCard' undeclared (first use in this function)
AppleEvents.xs:564: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDeleteParam':
AppleEvents.c:1024: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1024: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1025: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1025: error: expected ';' before 'theAEKeyword'
AppleEvents.c:1026: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1026: error: expected ';' before 'RETVAL'
AppleEvents.c:1030: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1034: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:1037: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetAttributeDesc':
AppleEvents.c:1050: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1050: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1051: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1051: error: expected ';' before 'theAEKeyword'
AppleEvents.c:1052: error: expected ';' before 'desiredType'
AppleEvents.c:1053: error: expected ';' before 'RETVAL'
AppleEvents.c:1056: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1060: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:1064: error: 'desiredType' undeclared (first use in this function)
AppleEvents.c:1064: error: 'typeWildCard' undeclared (first use in this function)
AppleEvents.xs:591: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutAttribute':
AppleEvents.c:1085: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1085: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1086: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1086: error: expected ';' before 'theAEKeyword'
AppleEvents.c:1087: error: expected ';' before 'typeCode'
AppleEvents.c:1089: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1089: error: expected ';' before 'RETVAL'
AppleEvents.c:1093: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1097: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:1100: error: 'typeCode' undeclared (first use in this function)
AppleEvents.xs:619: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutAttributeDesc':
AppleEvents.c:1126: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1126: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1127: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1127: error: expected ';' before 'theAEKeyword'
AppleEvents.c:1128: error: expected ';' before 'theAEDesc'
AppleEvents.c:1129: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1129: error: expected ';' before 'RETVAL'
AppleEvents.c:1133: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1137: error: 'theAEKeyword' undeclared (first use in this function)
AppleEvents.c:1141: error: 'theAEDesc' undeclared (first use in this function)
AppleEvents.c:1145: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AECreateAppleEvent':
AppleEvents.c:1158: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1158: error: expected ';' before 'theAEEventClass'
AppleEvents.c:1159: error: expected ';' before 'theAEEventID'
AppleEvents.c:1160: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1160: error: expected ';' before 'target'
AppleEvents.c:1163: error: expected ';' before 'RETVAL'
AppleEvents.c:1165: error: 'theAEEventClass' undeclared (first use in this function)
AppleEvents.c:1168: error: 'theAEEventID' undeclared (first use in this function)
AppleEvents.c:1172: error: 'target' undeclared (first use in this function)
AppleEvents.c:1177: error: 'kAutoGenerateReturnID' undeclared (first use in this function)
AppleEvents.xs:646: error: 'gPAECreate' undeclared (first use in this function)
AppleEvents.xs:647: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AESend':
AppleEvents.c:1213: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1213: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1217: error: expected ';' before 'RETVAL'
AppleEvents.c:1220: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1225: error: 'kAENormalPriority' undeclared (first use in this function)
AppleEvents.c:1231: error: 'kAEDefaultTimeout' undeclared (first use in this function)
AppleEvents.xs:690: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:690: error: 'nil' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEResetTimer':
AppleEvents.c:1271: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1271: error: expected ';' before 'reply'
AppleEvents.c:1272: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1272: error: expected ';' before 'RETVAL'
AppleEvents.c:1276: error: 'reply' undeclared (first use in this function)
AppleEvents.c:1280: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AESuspendTheCurrentEvent':
AppleEvents.c:1293: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1293: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1294: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1294: error: expected ';' before 'RETVAL'
AppleEvents.c:1298: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1302: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEResumeTheCurrentEvent':
AppleEvents.c:1315: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1315: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1318: error: expected ';' before 'RETVAL'
AppleEvents.c:1321: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1326: error: 'kAENoDispatch' undeclared (first use in this function)
AppleEvents.xs:739: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:739: error: 'AEEventHandlerUPP' undeclared (first use in this function)
AppleEvents.xs:739: error: expected ')' before 'flags'
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetTheCurrentEvent':
AppleEvents.c:1354: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1354: error: expected ';' before 'RETVAL'
AppleEvents.xs:753: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AESetTheCurrentEvent':
AppleEvents.c:1371: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1371: error: expected ';' before 'theAppleEvent'
AppleEvents.c:1372: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1372: error: expected ';' before 'RETVAL'
AppleEvents.c:1376: error: 'theAppleEvent' undeclared (first use in this function)
AppleEvents.c:1380: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs: In function 'XS_Mac__AppleEvents_AEGetInteractionAllowed':
AppleEvents.xs:780: error: 'AEInteractAllowed' undeclared (first use in this function)
AppleEvents.xs:780: error: expected expression before ')' token
AppleEvents.c: In function 'XS_Mac__AppleEvents_AESetInteractionAllowed':
AppleEvents.c:1421: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1421: error: expected ';' before 'RETVAL'
AppleEvents.xs:796: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:796: error: 'AEInteractAllowed' undeclared (first use in this function)
AppleEvents.xs:796: error: expected ')' before 'level'
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEInstallEventHandler':
AppleEvents.c:1438: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1438: error: expected ';' before 'theAEEventClass'
AppleEvents.c:1439: error: expected ';' before 'theAEEventID'
AppleEvents.c:1442: error: 'Boolean' undeclared (first use in this function)
AppleEvents.c:1442: error: expected ';' before 'isSysHandler'
AppleEvents.c:1443: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1443: error: expected ';' before 'RETVAL'
AppleEvents.c:1446: error: 'theAEEventClass' undeclared (first use in this function)
AppleEvents.c:1449: error: 'theAEEventID' undeclared (first use in this function)
AppleEvents.c:1453: error: 'isSysHandler' undeclared (first use in this function)
AppleEvents.xs:831: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AERemoveEventHandler':
AppleEvents.c:1474: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1474: error: expected ';' before 'theAEEventClass'
AppleEvents.c:1475: error: expected ';' before 'theAEEventID'
AppleEvents.c:1476: error: 'Boolean' undeclared (first use in this function)
AppleEvents.c:1476: error: expected ';' before 'isSysHandler'
AppleEvents.c:1477: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1477: error: expected ';' before 'RETVAL'
AppleEvents.c:1480: error: 'theAEEventClass' undeclared (first use in this function)
AppleEvents.c:1483: error: 'theAEEventID' undeclared (first use in this function)
AppleEvents.c:1487: error: 'isSysHandler' undeclared (first use in this function)
AppleEvents.xs:848: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetEventHandler':
AppleEvents.c:1507: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1507: error: expected ';' before 'theAEEventClass'
AppleEvents.c:1508: error: expected ';' before 'theAEEventID'
AppleEvents.c:1509: error: 'Boolean' undeclared (first use in this function)
AppleEvents.c:1509: error: expected ';' before 'isSysHandler'
AppleEvents.c:1511: error: 'theAEEventClass' undeclared (first use in this function)
AppleEvents.c:1514: error: 'theAEEventID' undeclared (first use in this function)
AppleEvents.c:1518: error: 'isSysHandler' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEManagerInfo':
AppleEvents.c:1548: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1548: error: expected ';' before 'keyWord'
AppleEvents.c:1551: error: 'keyWord' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEBuild':
AppleEvents.c:1575: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1575: error: expected ';' before 'RETVAL'
AppleEvents.xs:927: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:927: error: 'gBuildError' undeclared (first use in this function)
AppleEvents.xs:927: error: 'gPAEArgs' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEBuildParameters':
AppleEvents.c:1608: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1608: error: expected ';' before 'event'
AppleEvents.c:1610: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:1610: error: expected ';' before 'RETVAL'
AppleEvents.c:1614: error: 'event' undeclared (first use in this function)
AppleEvents.xs:961: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:961: error: 'gBuildError' undeclared (first use in this function)
AppleEvents.xs:961: error: 'gPAEArgs' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEBuildAppleEvent':
AppleEvents.c:1647: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1647: error: expected ';' before 'theClass'
AppleEvents.c:1648: error: expected ';' before 'theID'
AppleEvents.c:1649: error: expected ';' before 'addressType'
AppleEvents.c:1654: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1654: error: expected ';' before 'RETVAL'
AppleEvents.c:1656: error: 'theClass' undeclared (first use in this function)
AppleEvents.c:1659: error: 'theID' undeclared (first use in this function)
AppleEvents.c:1662: error: 'addressType' undeclared (first use in this function)
AppleEvents.xs:989: error: expected ';' before 'targetDesc'
AppleEvents.xs:990: error: 'OSErr' undeclared (first use in this function)
AppleEvents.xs:990: error: expected ';' before 'error'
AppleEvents.xs:1004: error: 'error' undeclared (first use in this function)
AppleEvents.xs:1004: error: 'targetDesc' undeclared (first use in this function)
AppleEvents.xs:1008: error: 'gPAECreate' undeclared (first use in this function)
AppleEvents.xs:1009: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:1020: error: 'gBuildError' undeclared (first use in this function)
AppleEvents.xs:1020: error: 'gPAEArgs' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPrint':
AppleEvents.c:1721: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1721: error: expected ';' before 'desc'
AppleEvents.c:1725: error: 'desc' undeclared (first use in this function)
AppleEvents.xs:1041: error: 'Handle' undeclared (first use in this function)
AppleEvents.xs:1041: error: expected ';' before 'hand'
AppleEvents.xs:1043: error: 'hand' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDescToSubDesc':
AppleEvents.c:1759: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1759: error: expected ';' before 'desc'
AppleEvents.c:1763: error: 'desc' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetSubDescType':
AppleEvents.c:1790: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1790: error: expected ';' before 'RETVAL'
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetSubDescBasicType':
AppleEvents.c:1842: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1842: error: expected ';' before 'RETVAL'
AppleEvents.c: In function 'XS_Mac__AppleEvents_AESubDescIsListOrRecord':
AppleEvents.c:1894: error: 'Boolean' undeclared (first use in this function)
AppleEvents.c:1894: error: expected ';' before 'RETVAL'
AppleEvents.c: In function 'XS_Mac__AppleEvents_AESubDescToDesc':
AppleEvents.c:1974: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:1974: error: expected ';' before 'desiredType'
AppleEvents.c:1975: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:1975: error: expected ';' before 'RETVAL'
AppleEvents.c:1983: error: 'desiredType' undeclared (first use in this function)
AppleEvents.c:1983: error: 'typeWildCard' undeclared (first use in this function)
AppleEvents.c:1996: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetKeySubDesc':
AppleEvents.c:2084: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2084: error: expected ';' before 'kw'
AppleEvents.c:2092: error: 'kw' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_Open':
AppleEvents.c:2114: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2114: error: expected ';' before 'RETVAL'
AppleEvents.xs:1302: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_CreateEvent':
AppleEvents.c:2135: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2135: error: expected ';' before 'theClass'
AppleEvents.c:2136: error: expected ';' before 'theID'
AppleEvents.c:2137: error: expected ';' before 'addressType'
AppleEvents.c:2141: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2141: error: expected ';' before 'RETVAL'
AppleEvents.c:2143: error: 'theClass' undeclared (first use in this function)
AppleEvents.c:2146: error: 'theID' undeclared (first use in this function)
AppleEvents.c:2149: error: 'addressType' undeclared (first use in this function)
AppleEvents.c:2153: error: 'kAutoGenerateReturnID' undeclared (first use in this function)
AppleEvents.xs:1326: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.xs:1326: error: expected ';' before 'targetDesc'
AppleEvents.xs:1327: error: 'AppleEvent' undeclared (first use in this function)
AppleEvents.xs:1327: error: expected ';' before 'event'
AppleEvents.xs:1328: error: 'OSErr' undeclared (first use in this function)
AppleEvents.xs:1328: error: expected ';' before 'error'
AppleEvents.xs:1333: error: 'error' undeclared (first use in this function)
AppleEvents.xs:1333: error: 'targetDesc' undeclared (first use in this function)
AppleEvents.xs:1337: error: 'gPAECreate' undeclared (first use in this function)
AppleEvents.xs:1338: error: 'event' undeclared (first use in this function)
AppleEvents.xs:1352: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_OpenEvent':
AppleEvents.c:2210: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:2210: error: expected ';' before 'theEvent'
AppleEvents.c:2211: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2211: error: expected ';' before 'RETVAL'
AppleEvents.c:2214: error: 'theEvent' undeclared (first use in this function)
AppleEvents.xs:1373: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_Close':
AppleEvents.c:2237: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2237: error: expected ';' before 'stream'
AppleEvents.c:2238: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:2238: error: expected ';' before 'RETVAL'
AppleEvents.c:2241: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1389: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_Abort':
AppleEvents.c:2262: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2262: error: expected ';' before 'stream'
AppleEvents.c:2263: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2263: error: expected ';' before 'RETVAL'
AppleEvents.c:2267: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1405: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.xs:1405: error: 'nil' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_OpenDesc':
AppleEvents.c:2287: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2287: error: expected ';' before 'stream'
AppleEvents.c:2288: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2288: error: expected ';' before 'type'
AppleEvents.c:2289: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2289: error: expected ';' before 'RETVAL'
AppleEvents.c:2293: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2297: error: 'type' undeclared (first use in this function)
AppleEvents.xs:1430: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_WriteData':
AppleEvents.c:2315: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2315: error: expected ';' before 'stream'
AppleEvents.c:2317: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2317: error: expected ';' before 'RETVAL'
AppleEvents.c:2321: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1449: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_CloseDesc':
AppleEvents.c:2347: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2347: error: expected ';' before 'stream'
AppleEvents.c:2348: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2348: error: expected ';' before 'RETVAL'
AppleEvents.c:2352: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1464: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_WriteDesc':
AppleEvents.c:2371: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2371: error: expected ';' before 'stream'
AppleEvents.c:2372: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2372: error: expected ';' before 'type'
AppleEvents.c:2374: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2374: error: expected ';' before 'RETVAL'
AppleEvents.c:2378: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2382: error: 'type' undeclared (first use in this function)
AppleEvents.xs:1486: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_WriteAEDesc':
AppleEvents.c:2410: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2410: error: expected ';' before 'stream'
AppleEvents.c:2411: error: 'AEDesc' undeclared (first use in this function)
AppleEvents.c:2411: error: expected ';' before 'desc'
AppleEvents.c:2412: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2412: error: expected ';' before 'RETVAL'
AppleEvents.c:2416: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2421: error: 'desc' undeclared (first use in this function)
AppleEvents.xs:1503: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_OpenList':
AppleEvents.c:2440: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2440: error: expected ';' before 'stream'
AppleEvents.c:2441: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2441: error: expected ';' before 'RETVAL'
AppleEvents.c:2445: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1516: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_CloseList':
AppleEvents.c:2464: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2464: error: expected ';' before 'stream'
AppleEvents.c:2465: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2465: error: expected ';' before 'RETVAL'
AppleEvents.c:2469: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1536: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_OpenRecord':
AppleEvents.c:2488: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2488: error: expected ';' before 'stream'
AppleEvents.c:2489: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2489: error: expected ';' before 'type'
AppleEvents.c:2490: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2490: error: expected ';' before 'RETVAL'
AppleEvents.c:2494: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2499: error: 'type' undeclared (first use in this function)
AppleEvents.c:2499: error: 'typeAERecord' undeclared (first use in this function)
AppleEvents.xs:1550: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_SetRecordType':
AppleEvents.c:2520: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2520: error: expected ';' before 'stream'
AppleEvents.c:2521: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2521: error: expected ';' before 'type'
AppleEvents.c:2522: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2522: error: expected ';' before 'RETVAL'
AppleEvents.c:2526: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2530: error: 'type' undeclared (first use in this function)
AppleEvents.xs:1564: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_CloseRecord':
AppleEvents.c:2548: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2548: error: expected ';' before 'stream'
AppleEvents.c:2549: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2549: error: expected ';' before 'RETVAL'
AppleEvents.c:2553: error: 'stream' undeclared (first use in this function)
AppleEvents.xs:1585: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_WriteKeyDesc':
AppleEvents.c:2572: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2572: error: expected ';' before 'stream'
AppleEvents.c:2573: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2573: error: expected ';' before 'key'
AppleEvents.c:2574: error: expected ';' before 'type'
AppleEvents.c:2576: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2576: error: expected ';' before 'RETVAL'
AppleEvents.c:2580: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2584: error: 'key' undeclared (first use in this function)
AppleEvents.c:2587: error: 'type' undeclared (first use in this function)
AppleEvents.xs:1608: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_OpenKeyDesc':
AppleEvents.c:2615: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2615: error: expected ';' before 'stream'
AppleEvents.c:2616: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2616: error: expected ';' before 'key'
AppleEvents.c:2617: error: expected ';' before 'type'
AppleEvents.c:2618: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2618: error: expected ';' before 'RETVAL'
AppleEvents.c:2622: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2626: error: 'key' undeclared (first use in this function)
AppleEvents.c:2629: error: 'type' undeclared (first use in this function)
AppleEvents.xs:1627: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_WriteKey':
AppleEvents.c:2647: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2647: error: expected ';' before 'stream'
AppleEvents.c:2648: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2648: error: expected ';' before 'key'
AppleEvents.c:2649: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2649: error: expected ';' before 'RETVAL'
AppleEvents.c:2653: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2657: error: 'key' undeclared (first use in this function)
AppleEvents.xs:1642: error: 'RETVAL' undeclared (first use in this function)
AppleEvents.c: In function 'XS_AEStream_OptionalParam':
AppleEvents.c:2675: error: 'AEStreamRef' undeclared (first use in this function)
AppleEvents.c:2675: error: expected ';' before 'stream'
AppleEvents.c:2676: error: 'OSType' undeclared (first use in this function)
AppleEvents.c:2676: error: expected ';' before 'key'
AppleEvents.c:2677: error: 'MacOSRet' undeclared (first use in this function)
AppleEvents.c:2677: error: expected ';' before 'RETVAL'
AppleEvents.c:2681: error: 'stream' undeclared (first use in this function)
AppleEvents.c:2685: error: 'key' undeclared (first use in this function)
AppleEvents.xs:1658: error: 'RETVAL' undeclared (first use in this function)
make[1]: *** [AppleEvents.o] Error 1
make[1]: Leaving directory `/home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1/AppleEvents'
make: *** [subdirs] Error 2
CNANDOR/Mac-Carbon-0.82.tar.gz
make -- NOT OK
Running test for module 'Mac::Speech'
CNANDOR/Mac-Carbon-0.82.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1
CNANDOR/Mac-Carbon-0.82.tar.gz
Has already been prepared
CNANDOR/Mac-Carbon-0.82.tar.gz
Could not make: Unknown error
Running test for module 'Mac::Files'
CNANDOR/Mac-Carbon-0.82.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1
CNANDOR/Mac-Carbon-0.82.tar.gz
Has already been prepared
CNANDOR/Mac-Carbon-0.82.tar.gz
Could not make: Unknown error
BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk
BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
Has already been prepared
Running make for B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
Warning: Prerequisite 'Mac::Carbon => 0.77' for 'BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz' failed when processing 'CNANDOR/Mac-Carbon-0.82.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited.
Warning: Prerequisite 'Mac::Speech => 0' for 'BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz' failed when processing 'CNANDOR/Mac-Carbon-0.82.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited.
Warning: Prerequisite 'Mac::Files => 0' for 'BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz' failed when processing 'CNANDOR/Mac-Carbon-0.82.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited.
>>> make
cp lib/MacSpeech.pm blib/lib/Pod/SpeakIt/MacSpeech.pm
cp bin/pod2speech blib/script/pod2speech
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pod2speech
Manifying 1 pod document
Manifying 1 pod document
BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/load.t t/pod.t t/one_para.t]
# Failed test 'use Pod::SpeakIt::MacSpeech;'
# at t/load.t line 10.
# Tried to use 'Pod::SpeakIt::MacSpeech'.
# Error: Can't locate Mac/Files.pm in @INC (you may need to install the Mac::Files module) (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .) at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12.
# BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12.
# Compilation failed in require at t/load.t line 10.
# BEGIN failed--compilation aborted at t/load.t line 10.
# Looks like you failed 1 test of 1.
t/load.t ......
1..1
not ok 1 - use Pod::SpeakIt::MacSpeech;
bail out! Pod::SpeakIt::MacSpeech did not compile
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/1 subtests
t/pod.t .......
1..2
ok 1 - POD test for blib/lib/Pod/SpeakIt/MacSpeech.pm
ok 2 - POD test for blib/script/pod2speech
ok
# Failed test 'use Pod::SpeakIt::MacSpeech;'
# at t/lib/speak_pod_file.pl line 5.
# Tried to use 'Pod::SpeakIt::MacSpeech'.
# Error: Can't locate Mac/Files.pm in @INC (you may need to install the Mac::Files module) (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .) at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12.
# BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12.
# Compilation failed in require at t/lib/speak_pod_file.pl line 5.
# BEGIN failed--compilation aborted at t/lib/speak_pod_file.pl line 5.
# Looks like you failed 1 test of 4.
t/one_para.t ..
not ok 1 - use Pod::SpeakIt::MacSpeech;
ok 2 - Input directory is there
ok 3 - An object of class 'Pod::SpeakIt::MacSpeech' isa 'Pod::SpeakIt::MacSpeech'
ok 4 - Input file is there [t/input_pod_dir/one_para.pod]
1..4
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/4 subtests
Test Summary Report
-------------------
t/load.t (Wstat: 256 Tests: 1 Failed: 1)
Failed test: 1
Non-zero exit status: 1
t/one_para.t (Wstat: 256 Tests: 4 Failed: 1)
Failed test: 1
Non-zero exit status: 1
Files=3, Tests=7, 1 wallclock secs ( 0.03 usr 0.01 sys + 0.26 cusr 0.02 csys = 0.32 CPU)
Result: FAIL
Failed 2/3 test programs. 2/7 subtests failed.
make: *** [test_dynamic] Error 1
BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
3 dependencies missing (Mac::Carbon,Mac::Speech,Mac::Files); additionally test harness failed
make test TEST_VERBOSE=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz
Running test for module 'App::scriptdist'
The module App::scriptdist isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i App::scriptdist'.
Running test for module 'MyCPAN::App::DPAN'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz ok
MyCPAN-App-DPAN-1.28/
MyCPAN-App-DPAN-1.28/Changes
MyCPAN-App-DPAN-1.28/lib/
MyCPAN-App-DPAN-1.28/lib/AsYAML.pm
MyCPAN-App-DPAN-1.28/lib/DPAN.pm
MyCPAN-App-DPAN-1.28/lib/Indexer.pm
MyCPAN-App-DPAN-1.28/lib/Minimal.pm
MyCPAN-App-DPAN-1.28/lib/SkipQueue.pm
MyCPAN-App-DPAN-1.28/LICENSE
MyCPAN-App-DPAN-1.28/Makefile.PL
MyCPAN-App-DPAN-1.28/MANIFEST
MyCPAN-App-DPAN-1.28/META.yml
MyCPAN-App-DPAN-1.28/README
MyCPAN-App-DPAN-1.28/script/
MyCPAN-App-DPAN-1.28/script/backpan_indexer.config.dpan
MyCPAN-App-DPAN-1.28/script/dpan
MyCPAN-App-DPAN-1.28/t/
MyCPAN-App-DPAN-1.28/t/app/
MyCPAN-App-DPAN-1.28/t/app/dpan.t
MyCPAN-App-DPAN-1.28/t/compile.t
MyCPAN-App-DPAN-1.28/t/create_index_files.t
MyCPAN-App-DPAN-1.28/t/get_latest_module_reports.t
MyCPAN-App-DPAN-1.28/t/indexer.t
MyCPAN-App-DPAN-1.28/t/load.t
MyCPAN-App-DPAN-1.28/t/pod.t
MyCPAN-App-DPAN-1.28/t/pod_coverage.t
MyCPAN-App-DPAN-1.28/t/test_manifest
MyCPAN-App-DPAN-1.28/xt/
MyCPAN-App-DPAN-1.28/xt/dpan-corpus.t
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite MyCPAN::Indexer 1.28 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for MyCPAN::App::DPAN
Writing MYMETA.yml and MYMETA.json
BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
---- Unsatisfied dependencies detected during ----
---- BDFOY/MyCPAN-App-DPAN-1.28.tar.gz ----
MyCPAN::Indexer [requires]
Running test for module 'MyCPAN::Indexer'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz ok
MyCPAN-Indexer-1.28/
MyCPAN-Indexer-1.28/Changes
MyCPAN-Indexer-1.28/examples/
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.andya
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.bdfoy
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.dist
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.dpan
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.inject
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.minicpan
MyCPAN-Indexer-1.28/examples/backpan_indexer.config.test_census
MyCPAN-Indexer-1.28/examples/backpan_indexer.pl
MyCPAN-Indexer-1.28/examples/dpan
MyCPAN-Indexer-1.28/examples/time_summary.pl
MyCPAN-Indexer-1.28/lib/
MyCPAN-Indexer-1.28/lib/App/
MyCPAN-Indexer-1.28/lib/App/Indexer.pm
MyCPAN-Indexer-1.28/lib/Component.pm
MyCPAN-Indexer-1.28/lib/Coordinator.pm
MyCPAN-Indexer-1.28/lib/Dispatcher/
MyCPAN-Indexer-1.28/lib/Dispatcher/Parallel.pm
MyCPAN-Indexer-1.28/lib/Dispatcher/Serial.pm
MyCPAN-Indexer-1.28/lib/Indexer.pm
MyCPAN-Indexer-1.28/lib/Interface/
MyCPAN-Indexer-1.28/lib/Interface/ANSIText.pm
MyCPAN-Indexer-1.28/lib/Interface/Curses.pm
MyCPAN-Indexer-1.28/lib/Interface/Text.pm
MyCPAN-Indexer-1.28/lib/Interface/Tk.pm
MyCPAN-Indexer-1.28/lib/Notes.pm
MyCPAN-Indexer-1.28/lib/NullTester.pm
MyCPAN-Indexer-1.28/lib/Queue.pm
MyCPAN-Indexer-1.28/lib/Reporter/
MyCPAN-Indexer-1.28/lib/Reporter/AsYAML.pm
MyCPAN-Indexer-1.28/lib/Reporter/Base.pm
MyCPAN-Indexer-1.28/lib/TestCensus.pm
MyCPAN-Indexer-1.28/lib/Tutorial.pm
MyCPAN-Indexer-1.28/lib/Worker.pm
MyCPAN-Indexer-1.28/LICENSE
MyCPAN-Indexer-1.28/Makefile.PL
MyCPAN-Indexer-1.28/MANIFEST
MyCPAN-Indexer-1.28/META.yml
MyCPAN-Indexer-1.28/README
MyCPAN-Indexer-1.28/t/
MyCPAN-Indexer-1.28/t/app/
MyCPAN-Indexer-1.28/t/app/backpan.t
MyCPAN-Indexer-1.28/t/app/defaults.t
MyCPAN-Indexer-1.28/t/compile.t
MyCPAN-Indexer-1.28/t/extract_package_names.t
MyCPAN-Indexer-1.28/t/guess_package_names.t
MyCPAN-Indexer-1.28/t/load.t
MyCPAN-Indexer-1.28/t/pod.t
MyCPAN-Indexer-1.28/t/pod_coverage.t
MyCPAN-Indexer-1.28/t/reporter/
MyCPAN-Indexer-1.28/t/reporter/base.t
MyCPAN-Indexer-1.28/t/test_manifest
MyCPAN-Indexer-1.28/test-corpus/
MyCPAN-Indexer-1.28/test-corpus/Chemistry-Elements.pm
MyCPAN-Indexer-1.28/test-corpus/Test-Pod.pm
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite Data::UUID 0 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for MyCPAN::Indexer
Writing MYMETA.yml and MYMETA.json
BDFOY/MyCPAN-Indexer-1.28.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
---- Unsatisfied dependencies detected during ----
---- BDFOY/MyCPAN-Indexer-1.28.tar.gz ----
Data::UUID [requires]
Running test for module 'Data::UUID'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/R/RJ/RJBS/Data-UUID-1.221.tar.gz ok
Data-UUID-1.221/
Data-UUID-1.221/Changes
Data-UUID-1.221/LICENSE
Data-UUID-1.221/Makefile.PL
Data-UUID-1.221/MANIFEST
Data-UUID-1.221/META.json
Data-UUID-1.221/META.yml
Data-UUID-1.221/ptable.h
Data-UUID-1.221/README
Data-UUID-1.221/smp-test/
Data-UUID-1.221/t/
Data-UUID-1.221/typemap
Data-UUID-1.221/UUID.h
Data-UUID-1.221/UUID.pm
Data-UUID-1.221/UUID.xs
Data-UUID-1.221/t/basic.t
Data-UUID-1.221/t/from-name-collisions.t
Data-UUID-1.221/t/leaky_dollar_bang.t
Data-UUID-1.221/t/pod-coverage.t
/bin/tar: Read 7168 bytes from -
Data-UUID-1.221/t/pod.t
Data-UUID-1.221/t/segv.t
Data-UUID-1.221/t/threads.t
Data-UUID-1.221/smp-test/collision.t
Data-UUID-1.221/smp-test/uuid-fork.pl
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring R/RJ/RJBS/Data-UUID-1.221.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Configured options (run perl Makefile.PL --help for how to change this):
UUID state storage: /tmp
default umask: 0007
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Data::UUID
Writing MYMETA.yml and MYMETA.json
RJBS/Data-UUID-1.221.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for R/RJ/RJBS/Data-UUID-1.221.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp UUID.pm blib/lib/Data/UUID.pm
Running Mkbootstrap for Data::UUID ()
chmod 644 "UUID.bs"
"/home/fly1800/ap1800-297235/bin/perl-static" "/home/fly1800/cpanfly-5.18/var/megalib/ExtUtils/xsubpp" -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" -typemap "typemap" UUID.xs > UUID.xsc && mv UUID.xsc UUID.c
gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"1.221\" -DXS_VERSION=\"1.221\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" -D_STDIR=\"/tmp\" -D__linux__ -D_DEFAULT_UMASK=0007 UUID.c
UUID.xs: In function 'inc':
UUID.xs:36: warning: cast to pointer from integer of different size
UUID.xs: In function 'XS_Data__UUID_DESTROY':
UUID.xs:583: warning: cast to pointer from integer of different size
rm -f blib/arch/auto/Data/UUID/UUID.so
gcc -shared -O2 -fstack-protector UUID.o -o blib/arch/auto/Data/UUID/UUID.so \
\
chmod 755 blib/arch/auto/Data/UUID/UUID.so
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::Command::MM -e 'cp_nonempty' -- UUID.bs blib/arch/auto/Data/UUID/UUID.bs 644
Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 893.
Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 894.
Manifying 1 pod document
RJBS/Data-UUID-1.221.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
Running Mkbootstrap for Data::UUID ()
chmod 644 "UUID.bs"
PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t
t/basic.t .................
1..28
ok 1 - use Data::UUID;
ok 2 - An object of class 'Data::UUID' isa 'Data::UUID'
ok 3 - create a new uuid
ok 4 - correct length of uuid
ok 5 - hexstringify it
ok 6 - create a uuid from that string
ok 7 - they compare as equal
ok 8 - get base64 string of original uuid
ok 9 - get base64 string of from_string
ok 10 - those base64 strings are equal
ok 11 - make uuid from the base64 string
ok 12 - and it compares at equal, too
ok 13 - we get all unique UUIDs
ok 14 - no carriage return in base64 version
ok 15 - no carriage return in base64 version
ok 16 - no carriage return in base64 version
ok 17 - no carriage return in base64 version
ok 18 - no carriage return in base64 version
ok 19 - no carriage return in base64 version
ok 20 - no carriage return in base64 version
ok 21 - no carriage return in base64 version
ok 22 - no carriage return in base64 version
ok 23 - no carriage return in base64 version
ok 24 - no carriage return in base64 version
ok 25 - no carriage return in base64 version
ok 26 - no carriage return in base64 version
ok 27 - no carriage return in base64 version
ok 28 - no carriage return in base64 version
ok
t/from-name-collisions.t ..
1..1
ok 1 - no collisions
ok
t/leaky_dollar_bang.t .....
1..1
ok 1 - $! didn't leak!
ok
t/pod-coverage.t .......... skipped: Pod coverage tests are not active. Please set $ENV{AUTHOR_TESTING} to activate.
t/pod.t ................... skipped: Pod coverage tests are not active. Please set $ENV{AUTHOR_TESTING} to activate.
t/segv.t ..................
1..2
ok 1
ok 2
ok
Thread creation failed: pthread_create returned 12 at t/threads.t line 21.
Thread creation failed: pthread_create returned 12 at t/threads.t line 21.
Can't call method "join" on an undefined value at t/threads.t line 24.
# Looks like your test exited with 12 before it could output anything.
t/threads.t ...............
1..4
Dubious, test returned 12 (wstat 3072, 0xc00)
Failed 4/4 subtests
Test Summary Report
-------------------
t/threads.t (Wstat: 3072 Tests: 0 Failed: 0)
Non-zero exit status: 12
Parse errors: Bad plan. You planned 4 tests but ran 0.
Files=7, Tests=32, 0 wallclock secs ( 0.03 usr 0.02 sys + 0.36 cusr 0.06 csys = 0.47 CPU)
Result: FAIL
Failed 1/7 test programs. 0/32 subtests failed.
make: *** [test_dynamic] Error 12
RJBS/Data-UUID-1.221.tar.gz
make test TEST_VERBOSE=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports RJBS/Data-UUID-1.221.tar.gz
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-Indexer-1.28-38NSmn
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Has already been prepared
Running make for B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
Warning: Prerequisite 'Data::UUID => 0' for 'BDFOY/MyCPAN-Indexer-1.28.tar.gz' failed when processing 'RJBS/Data-UUID-1.221.tar.gz' with 'make_test => NO'. Continuing, but chances to succeed are limited.
>>> make
cp lib/Interface/Text.pm blib/lib/MyCPAN/Indexer/Interface/Text.pm
cp lib/NullTester.pm blib/lib/MyCPAN/Indexer/NullTester.pm
cp lib/Interface/Tk.pm blib/lib/MyCPAN/Indexer/Interface/Tk.pm
cp lib/Worker.pm blib/lib/MyCPAN/Indexer/Worker.pm
cp lib/Notes.pm blib/lib/MyCPAN/Indexer/Notes.pm
cp lib/Reporter/AsYAML.pm blib/lib/MyCPAN/Indexer/Reporter/AsYAML.pm
cp lib/App/Indexer.pm blib/lib/MyCPAN/App/BackPAN/Indexer.pm
cp lib/Dispatcher/Parallel.pm blib/lib/MyCPAN/Indexer/Dispatcher/Parallel.pm
cp lib/Dispatcher/Serial.pm blib/lib/MyCPAN/Indexer/Dispatcher/Serial.pm
cp lib/Coordinator.pm blib/lib/MyCPAN/Indexer/Coordinator.pm
cp lib/Queue.pm blib/lib/MyCPAN/Indexer/Queue.pm
cp lib/Interface/Curses.pm blib/lib/MyCPAN/Indexer/Interface/Curses.pm
cp lib/Tutorial.pm blib/lib/MyCPAN/Indexer/Tutorial.pm
cp lib/Indexer.pm blib/lib/MyCPAN/Indexer.pm
cp lib/TestCensus.pm blib/lib/MyCPAN/Indexer/TestCensus.pm
cp lib/Component.pm blib/lib/MyCPAN/Indexer/Component.pm
cp lib/Reporter/Base.pm blib/lib/MyCPAN/Indexer/Reporter/Base.pm
BDFOY/MyCPAN-Indexer-1.28.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/load.t t/compile.t t/pod.t t/pod_coverage.t t/extract_package_names.t t/guess_package_names.t t/reporter/base.t t/app/backpan.t t/app/defaults.t]
t/load.t ...................
1..1
ok 1 - use MyCPAN::Indexer;
ok
t/compile.t ................
1..4
ok 1 - examples/backpan_indexer.pl exists
ok 2 - Script examples/backpan_indexer.pl compiles
ok 3 - examples/time_summary.pl exists
ok 4 - Script examples/time_summary.pl compiles
ok
t/pod.t ....................
1..17
ok 1 - POD test for blib/lib/MyCPAN/Indexer.pm
ok 2 - POD test for blib/lib/MyCPAN/App/BackPAN/Indexer.pm (no pod)
ok 3 - POD test for blib/lib/MyCPAN/Indexer/Coordinator.pm
ok 4 - POD test for blib/lib/MyCPAN/Indexer/Queue.pm
ok 5 - POD test for blib/lib/MyCPAN/Indexer/TestCensus.pm
ok 6 - POD test for blib/lib/MyCPAN/Indexer/NullTester.pm
ok 7 - POD test for blib/lib/MyCPAN/Indexer/Component.pm
ok 8 - POD test for blib/lib/MyCPAN/Indexer/Notes.pm
ok 9 - POD test for blib/lib/MyCPAN/Indexer/Tutorial.pm
ok 10 - POD test for blib/lib/MyCPAN/Indexer/Worker.pm
ok 11 - POD test for blib/lib/MyCPAN/Indexer/Dispatcher/Parallel.pm
ok 12 - POD test for blib/lib/MyCPAN/Indexer/Dispatcher/Serial.pm
ok 13 - POD test for blib/lib/MyCPAN/Indexer/Reporter/AsYAML.pm
ok 14 - POD test for blib/lib/MyCPAN/Indexer/Reporter/Base.pm
ok 15 - POD test for blib/lib/MyCPAN/Indexer/Interface/Tk.pm
ok 16 - POD test for blib/lib/MyCPAN/Indexer/Interface/Text.pm
ok 17 - POD test for blib/lib/MyCPAN/Indexer/Interface/Curses.pm
ok
t/pod_coverage.t ...........
1..1
ok 1
ok
t/extract_package_names.t ..
ok 1 - use MyCPAN::Indexer;
ok 2 - MyCPAN::Indexer->can('extract_module_namespaces')
ok 3 - An object of class 'MyCPAN::Indexer' isa 'MyCPAN::Indexer'
ok 4 - test-corpus/Test-Pod.pm exists
ok 5 - 'packages' key is in the result hash
ok 6 - 'packages' value is an array ref
ok 7 - 'primary_package' key is in the result hash
ok 8 - 'primary_package' value is has the right value [Test::Pod]
ok 9 - test-corpus/Chemistry-Elements.pm exists
ok 10 - 'packages' key is in the result hash
ok 11 - 'packages' value is an array ref
ok 12 - 'primary_package' key is in the result hash
ok 13 - 'primary_package' value is has the right value [Chemistry::Elements]
1..13
ok
t/guess_package_names.t ....
ok 1 - use MyCPAN::Indexer;
ok 2 - MyCPAN::Indexer->can('guess_primary_package')
ok 3 - An object of class 'MyCPAN::Indexer' isa 'MyCPAN::Indexer'
ok 4 - Gets right package for Test::Pod
ok 5 - Gets right package for Foo::Bar
ok 6 - Gets right package for Quux
1..6
ok
t/reporter/base.t ..........
ok 1 - use MyCPAN::Indexer::Reporter::Base;
ok 2 - An object of class 'MyCPAN::Indexer::Reporter::Base' isa 'MyCPAN::Indexer::Reporter::Base'
ok 3 - MyCPAN::Indexer::Reporter::Base->can('get_report_file_extension')
ok 4 - eval catches an error
ok 5 - Abstract get_report_file_extension croaks with right message
ok 6 - MyCPAN::Indexer::Reporter::Base->can('get_success_report_subdir')
ok 7
ok 8 - MyCPAN::Indexer::Reporter::Base->can('get_error_report_subdir')
ok 9
ok 10 - Mock::config->can('get')
ok 11
ok 12
ok 13
ok 14
1..14
ok
t/app/backpan.t ............
1..2
ok 1 - use MyCPAN::App::BackPAN::Indexer;
ok 2 - MyCPAN::App::BackPAN::Indexer->can('activate')
ok
t/app/defaults.t ...........
ok 1 - use MyCPAN::App::BackPAN::Indexer;
ok 2 - MyCPAN::App::BackPAN::Indexer->can('default')
ok 3 - alarm in MyCPAN::App::BackPAN::Indexer right
ok 4 - indexer_class in MyCPAN::App::BackPAN::Indexer is right
1..4
ok
All tests successful.
Files=9, Tests=62, 1 wallclock secs ( 0.04 usr 0.03 sys + 1.58 cusr 0.14 csys = 1.79 CPU)
Result: PASS
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Tests succeeded but one dependency not OK (Data::UUID)
BDFOY/MyCPAN-Indexer-1.28.tar.gz
[dependencies] -- NA
BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9
BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
Has already been prepared
Running make for B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
Warning: Prerequisite 'MyCPAN::Indexer => 1.28' for 'BDFOY/MyCPAN-App-DPAN-1.28.tar.gz' failed when processing 'BDFOY/MyCPAN-Indexer-1.28.tar.gz' with 'make_test => NO one dependency not OK (Data::UUID)'. Continuing, but chances to succeed are limited.
>>> make
cp lib/AsYAML.pm blib/lib/MyCPAN/App/DPAN/Reporter/AsYAML.pm
cp lib/DPAN.pm blib/lib/MyCPAN/App/DPAN.pm
cp lib/Minimal.pm blib/lib/MyCPAN/App/DPAN/Reporter/Minimal.pm
cp lib/Indexer.pm blib/lib/MyCPAN/App/DPAN/Indexer.pm
cp lib/SkipQueue.pm blib/lib/MyCPAN/App/DPAN/SkipQueue.pm
cp script/dpan blib/script/dpan
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/dpan
Manifying 1 pod document
BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/load.t t/compile.t t/pod.t t/pod_coverage.t t/indexer.t t/app/dpan.t t/get_latest_module_reports.t t/create_index_files.t t/../xt/dpan-corpus.t]
Bailout called. Further testing stopped: MyCPAN::App::DPAN did not compile
# Failed test 'use MyCPAN::App::DPAN;'
# at t/load.t line 14.
# Tried to use 'MyCPAN::App::DPAN'.
# Error: Base class package "MyCPAN::App::BackPAN::Indexer" is empty.
# (Perhaps you need to 'use' the module which defines that package first,
# or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .).
# at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN.pm line 5.
# BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN.pm line 5.
# Compilation failed in require at t/load.t line 14.
# BEGIN failed--compilation aborted at t/load.t line 14.
# Failed test 'use MyCPAN::App::DPAN::Reporter::AsYAML;'
# at t/load.t line 14.
# Tried to use 'MyCPAN::App::DPAN::Reporter::AsYAML'.
# Error: Base class package "MyCPAN::Indexer::Reporter::AsYAML" is empty.
# (Perhaps you need to 'use' the module which defines that package first,
# or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .).
# at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/AsYAML.pm line 11.
# BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/AsYAML.pm line 11.
# Compilation failed in require at t/load.t line 14.
# BEGIN failed--compilation aborted at t/load.t line 14.
# Failed test 'use MyCPAN::App::DPAN::Reporter::Minimal;'
# at t/load.t line 14.
# Tried to use 'MyCPAN::App::DPAN::Reporter::Minimal'.
# Error: Base class package "MyCPAN::Indexer::Reporter::Base" is empty.
# (Perhaps you need to 'use' the module which defines that package first,
# or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .).
# at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/Minimal.pm line 5.
# BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/Minimal.pm line 5.
# Compilation failed in require at t/load.t line 14.
# BEGIN failed--compilation aborted at t/load.t line 14.
# Failed test 'use MyCPAN::App::DPAN::Indexer;'
# at t/load.t line 14.
# Tried to use 'MyCPAN::App::DPAN::Indexer'.
# Error: Base class package "MyCPAN::App::BackPAN::Indexer" is empty.
# (Perhaps you need to 'use' the module which defines that package first,
# or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .).
# at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Indexer.pm line 11.
# BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Indexer.pm line 11.
# Compilation failed in require at t/load.t line 14.
# BEGIN failed--compilation aborted at t/load.t line 14.
# Looks like you failed 4 tests of 4.
FAILED--Further testing stopped: MyCPAN::App::DPAN did not compile
make: *** [test_dynamic] Error 4
BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
one dependency not OK (MyCPAN::Indexer); additionally test harness failed
make test TEST_VERBOSE=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports BDFOY/MyCPAN-App-DPAN-1.28.tar.gz
Running test for module 'WordPress::Grep'
The module WordPress::Grep isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i WordPress::Grep'.
Running test for module 'HTTP::Cookies::iCab'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz ok
HTTP-Cookies-iCab-1.131/
HTTP-Cookies-iCab-1.131/Changes
HTTP-Cookies-iCab-1.131/examples/
HTTP-Cookies-iCab-1.131/hack/
HTTP-Cookies-iCab-1.131/lib/
HTTP-Cookies-iCab-1.131/LICENSE
HTTP-Cookies-iCab-1.131/Makefile.PL
HTTP-Cookies-iCab-1.131/MANIFEST
HTTP-Cookies-iCab-1.131/META.yml
HTTP-Cookies-iCab-1.131/README
HTTP-Cookies-iCab-1.131/t/
HTTP-Cookies-iCab-1.131/t/compile.t
HTTP-Cookies-iCab-1.131/t/Cookies.dat
HTTP-Cookies-iCab-1.131/t/Cookies2.dat
HTTP-Cookies-iCab-1.131/t/load.t
HTTP-Cookies-iCab-1.131/t/pod.t
HTTP-Cookies-iCab-1.131/t/pod_coverage.t
HTTP-Cookies-iCab-1.131/t/prereq.t
HTTP-Cookies-iCab-1.131/t/save.t
HTTP-Cookies-iCab-1.131/t/test_manifest
HTTP-Cookies-iCab-1.131/lib/HTTP/
HTTP-Cookies-iCab-1.131/lib/HTTP/Cookies/
HTTP-Cookies-iCab-1.131/lib/HTTP/Cookies/iCab.pm
HTTP-Cookies-iCab-1.131/hack/load_real
HTTP-Cookies-iCab-1.131/examples/README
HTTP-Cookies-iCab-1.131/examples/update_dates.pl
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for HTTP::Cookies::iCab
Writing MYMETA.yml and MYMETA.json
BDFOY/HTTP-Cookies-iCab-1.131.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp lib/HTTP/Cookies/iCab.pm blib/lib/HTTP/Cookies/iCab.pm
Manifying 1 pod document
BDFOY/HTTP-Cookies-iCab-1.131.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/compile.t t/pod.t t/pod_coverage.t t/load.t t/save.t]
t/compile.t .......
1..1
ok 1 - use HTTP::Cookies::iCab;
ok
t/pod.t ...........
1..1
ok 1 - POD test for blib/lib/HTTP/Cookies/iCab.pm
ok
t/pod_coverage.t ..
1..1
ok 1 - Pod coverage on HTTP::Cookies::iCab
ok
t/load.t ..........
1..8
ok 1 - use HTTP::Cookies::iCab;
ok 2 - An object of class 'HTTP::Cookies::iCab' isa 'HTTP::Cookies::iCab'
ok 3 - An object of class 'HTTP::Cookies::iCab' isa 'HTTP::Cookies'
ok 4 - Count of domains
ok 5 - .usatoday.com has 3 cookies
ok 6 - .cnn.com has 1 cookies
ok 7 - .doubleclick.net has 1 cookies
ok 8 - Cookie has right value
ok
t/save.t ..........
1..2
ok 1 - An object of class 'HTTP::Cookies::iCab' isa 'HTTP::Cookies::iCab'
not ok 2 - Saved file is same as original # TODO How can I compare these files?
# Failed (TODO) test 'Saved file is same as original'
# at t/save.t line 20.
ok
All tests successful.
Files=5, Tests=13, 1 wallclock secs ( 0.03 usr 0.01 sys + 0.34 cusr 0.04 csys = 0.42 CPU)
Result: PASS
BDFOY/HTTP-Cookies-iCab-1.131.tar.gz
make test TEST_VERBOSE=1 -- OK
brian d foy <bdfoy@cpan.org>
Cookie storage and management for iCab 3
>>> (cd /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo && tar cvf - HTTP-Cookies-iCab-1.131.ppd blib) | gzip -c >/home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz
HTTP-Cookies-iCab-1.131.ppd
blib/
blib/man3/
blib/man3/HTTP::Cookies::iCab.3
blib/lib/
blib/lib/HTTP/
blib/lib/HTTP/Cookies/
blib/lib/HTTP/Cookies/iCab.pm
>>> mv /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/HTTP-Cookies-iCab-1.131.ppd /home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY
Running test for module 'Test::WWW::Accessibility'
The module Test::WWW::Accessibility isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i Test::WWW::Accessibility'.
Running test for module 'Psychic::Ninja'
The module Psychic::Ninja isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i Psychic::Ninja'.
Running test for module 'PerlPowerTools'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/PerlPowerTools-1.006.tar.gz ok
PerlPowerTools-1.006/
PerlPowerTools-1.006/bin/
PerlPowerTools-1.006/Changes
PerlPowerTools-1.006/lib/
PerlPowerTools-1.006/LICENSE
PerlPowerTools-1.006/Makefile.PL
PerlPowerTools-1.006/MANIFEST
PerlPowerTools-1.006/MANIFEST.SKIP
PerlPowerTools-1.006/META.json
PerlPowerTools-1.006/META.yml
PerlPowerTools-1.006/README.pod
PerlPowerTools-1.006/t/
PerlPowerTools-1.006/TODO
PerlPowerTools-1.006/xt/
PerlPowerTools-1.006/xt/changes.t
PerlPowerTools-1.006/t/compile.t
PerlPowerTools-1.006/t/factor.t
PerlPowerTools-1.006/t/false.t
PerlPowerTools-1.006/t/true.t
PerlPowerTools-1.006/lib/PerlPowerTools.pm
PerlPowerTools-1.006/lib/ppt.pm
PerlPowerTools-1.006/bin/addbib
PerlPowerTools-1.006/bin/apply
PerlPowerTools-1.006/bin/ar
PerlPowerTools-1.006/bin/arch
PerlPowerTools-1.006/bin/arithmetic
PerlPowerTools-1.006/bin/asa
PerlPowerTools-1.006/bin/awk
PerlPowerTools-1.006/bin/banner
PerlPowerTools-1.006/bin/basename
PerlPowerTools-1.006/bin/bc
PerlPowerTools-1.006/bin/cal
PerlPowerTools-1.006/bin/cat
PerlPowerTools-1.006/bin/chgrp
PerlPowerTools-1.006/bin/ching
PerlPowerTools-1.006/bin/chmod
PerlPowerTools-1.006/bin/chown
PerlPowerTools-1.006/bin/clear
PerlPowerTools-1.006/bin/cmp
PerlPowerTools-1.006/bin/col
PerlPowerTools-1.006/bin/colrm
PerlPowerTools-1.006/bin/comm
PerlPowerTools-1.006/bin/cp
PerlPowerTools-1.006/bin/cut
PerlPowerTools-1.006/bin/date
PerlPowerTools-1.006/bin/dc
PerlPowerTools-1.006/bin/deroff
PerlPowerTools-1.006/bin/diff
PerlPowerTools-1.006/bin/dirname
PerlPowerTools-1.006/bin/du
PerlPowerTools-1.006/bin/echo
PerlPowerTools-1.006/bin/ed
PerlPowerTools-1.006/bin/env
PerlPowerTools-1.006/bin/expand
PerlPowerTools-1.006/bin/expr
PerlPowerTools-1.006/bin/factor
PerlPowerTools-1.006/bin/false
PerlPowerTools-1.006/bin/file
PerlPowerTools-1.006/bin/find
PerlPowerTools-1.006/bin/fish
PerlPowerTools-1.006/bin/fmt
PerlPowerTools-1.006/bin/fold
PerlPowerTools-1.006/bin/fortune
PerlPowerTools-1.006/bin/from
PerlPowerTools-1.006/bin/glob
PerlPowerTools-1.006/bin/grep
PerlPowerTools-1.006/bin/hangman
PerlPowerTools-1.006/bin/head
PerlPowerTools-1.006/bin/id
PerlPowerTools-1.006/bin/install
PerlPowerTools-1.006/bin/join
PerlPowerTools-1.006/bin/kill
PerlPowerTools-1.006/bin/ln
PerlPowerTools-1.006/bin/lock
PerlPowerTools-1.006/bin/look
PerlPowerTools-1.006/bin/ls
PerlPowerTools-1.006/bin/mail
PerlPowerTools-1.006/bin/make
PerlPowerTools-1.006/bin/man
PerlPowerTools-1.006/bin/maze
PerlPowerTools-1.006/bin/mimedecode
PerlPowerTools-1.006/bin/mkdir
PerlPowerTools-1.006/bin/mkfifo
PerlPowerTools-1.006/bin/moo
PerlPowerTools-1.006/bin/morse
PerlPowerTools-1.006/bin/od
PerlPowerTools-1.006/bin/par
PerlPowerTools-1.006/bin/paste
PerlPowerTools-1.006/bin/patch
PerlPowerTools-1.006/bin/pig
PerlPowerTools-1.006/bin/ping
PerlPowerTools-1.006/bin/pom
PerlPowerTools-1.006/bin/ppt
PerlPowerTools-1.006/bin/pr
PerlPowerTools-1.006/bin/primes
PerlPowerTools-1.006/bin/printenv
PerlPowerTools-1.006/bin/printf
PerlPowerTools-1.006/bin/pwd
PerlPowerTools-1.006/bin/rain
PerlPowerTools-1.006/bin/random
PerlPowerTools-1.006/bin/rev
PerlPowerTools-1.006/bin/rm
PerlPowerTools-1.006/bin/rmdir
PerlPowerTools-1.006/bin/robots
PerlPowerTools-1.006/bin/shar
PerlPowerTools-1.006/bin/sleep
PerlPowerTools-1.006/bin/sort
PerlPowerTools-1.006/bin/spell
PerlPowerTools-1.006/bin/split
PerlPowerTools-1.006/bin/strings
PerlPowerTools-1.006/bin/sum
PerlPowerTools-1.006/bin/tac
PerlPowerTools-1.006/bin/tail
PerlPowerTools-1.006/bin/tar
PerlPowerTools-1.006/bin/tee
PerlPowerTools-1.006/bin/test
PerlPowerTools-1.006/bin/time
PerlPowerTools-1.006/bin/touch
PerlPowerTools-1.006/bin/tr
PerlPowerTools-1.006/bin/true
PerlPowerTools-1.006/bin/tsort
PerlPowerTools-1.006/bin/tty
PerlPowerTools-1.006/bin/uname
PerlPowerTools-1.006/bin/unexpand
PerlPowerTools-1.006/bin/uniq
PerlPowerTools-1.006/bin/units
PerlPowerTools-1.006/bin/unpar
PerlPowerTools-1.006/bin/unshar
PerlPowerTools-1.006/bin/uudecode
PerlPowerTools-1.006/bin/uuencode
PerlPowerTools-1.006/bin/wc
PerlPowerTools-1.006/bin/what
PerlPowerTools-1.006/bin/which
PerlPowerTools-1.006/bin/whois
PerlPowerTools-1.006/bin/words
PerlPowerTools-1.006/bin/wump
/bin/tar: Read 6144 bytes from -
PerlPowerTools-1.006/bin/xargs
PerlPowerTools-1.006/bin/yes
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/PerlPowerTools-1.006.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
----------------------------------------------------------------------
Welcome to Perl Power Tools (http://www.perlpowertools.com).
You didn't specify INSTALL_BASE, so I chose ~/perlpowertools.
You'll need to add this to PATH to be able to use them.
If you want to install them somewhere else, run Makefile.PL again
with your installation location:
perl Makefile.PL INSTALL_BASE=/where/you/want/them/to/go
Most Perl distributions don't do this for you, but I'm doing this
because some of these tools installed in the wrong places can hide
the real tools, which might cause problems. I'm being careful for
you!
----------------------------------------------------------------------
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for PerlPowerTools
Writing MYMETA.yml and MYMETA.json
BDFOY/PerlPowerTools-1.006.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/PerlPowerTools-1.006.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp README.pod blib/lib/README.pod
cp lib/PerlPowerTools.pm blib/lib/PerlPowerTools.pm
cp lib/ppt.pm blib/lib/ppt.pm
cp bin/tail blib/script/tail
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tail
cp bin/shar blib/script/shar
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/shar
cp bin/uname blib/script/uname
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uname
cp bin/tsort blib/script/tsort
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tsort
cp bin/glob blib/script/glob
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/glob
cp bin/chmod blib/script/chmod
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/chmod
cp bin/cmp blib/script/cmp
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cmp
cp bin/sum blib/script/sum
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/sum
cp bin/banner blib/script/banner
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/banner
cp bin/uudecode blib/script/uudecode
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uudecode
cp bin/sleep blib/script/sleep
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/sleep
cp bin/ed blib/script/ed
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ed
cp bin/what blib/script/what
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/what
cp bin/test blib/script/test
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/test
cp bin/ping blib/script/ping
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ping
cp bin/cat blib/script/cat
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cat
cp bin/split blib/script/split
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/split
cp bin/clear blib/script/clear
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/clear
cp bin/uuencode blib/script/uuencode
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uuencode
cp bin/strings blib/script/strings
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/strings
cp bin/mkdir blib/script/mkdir
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mkdir
cp bin/fortune blib/script/fortune
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fortune
cp bin/mail blib/script/mail
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mail
cp bin/moo blib/script/moo
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/moo
cp bin/file blib/script/file
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/file
cp bin/fold blib/script/fold
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fold
cp bin/col blib/script/col
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/col
cp bin/unexpand blib/script/unexpand
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/unexpand
cp bin/grep blib/script/grep
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/grep
cp bin/paste blib/script/paste
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/paste
cp bin/apply blib/script/apply
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/apply
cp bin/join blib/script/join
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/join
cp bin/install blib/script/install
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/install
cp bin/which blib/script/which
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/which
cp bin/units blib/script/units
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/units
cp bin/look blib/script/look
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/look
cp bin/addbib blib/script/addbib
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/addbib
cp bin/kill blib/script/kill
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/kill
cp bin/date blib/script/date
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/date
cp bin/from blib/script/from
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/from
cp bin/unshar blib/script/unshar
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/unshar
cp bin/tac blib/script/tac
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tac
cp bin/dc blib/script/dc
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/dc
cp bin/pwd blib/script/pwd
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pwd
cp bin/find blib/script/find
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/find
cp bin/rev blib/script/rev
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rev
cp bin/fmt blib/script/fmt
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fmt
cp bin/ln blib/script/ln
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ln
cp bin/ar blib/script/ar
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ar
cp bin/expr blib/script/expr
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/expr
cp bin/time blib/script/time
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/time
cp bin/cal blib/script/cal
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cal
cp bin/dirname blib/script/dirname
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/dirname
cp bin/id blib/script/id
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/id
cp bin/tr blib/script/tr
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tr
cp bin/basename blib/script/basename
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/basename
cp bin/arithmetic blib/script/arithmetic
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/arithmetic
cp bin/tee blib/script/tee
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tee
cp bin/expand blib/script/expand
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/expand
cp bin/words blib/script/words
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/words
cp bin/maze blib/script/maze
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/maze
cp bin/hangman blib/script/hangman
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/hangman
cp bin/du blib/script/du
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/du
cp bin/comm blib/script/comm
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/comm
cp bin/chgrp blib/script/chgrp
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/chgrp
cp bin/lock blib/script/lock
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/lock
cp bin/unpar blib/script/unpar
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/unpar
cp bin/tty blib/script/tty
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tty
cp bin/factor blib/script/factor
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/factor
cp bin/ls blib/script/ls
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ls
cp bin/yes blib/script/yes
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/yes
cp bin/true blib/script/true
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/true
cp bin/man blib/script/man
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/man
cp bin/diff blib/script/diff
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/diff
cp bin/pr blib/script/pr
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pr
cp bin/cut blib/script/cut
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cut
cp bin/head blib/script/head
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/head
cp bin/rmdir blib/script/rmdir
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rmdir
cp bin/pig blib/script/pig
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pig
cp bin/rain blib/script/rain
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rain
cp bin/mimedecode blib/script/mimedecode
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mimedecode
cp bin/xargs blib/script/xargs
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/xargs
cp bin/spell blib/script/spell
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/spell
cp bin/touch blib/script/touch
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/touch
cp bin/mkfifo blib/script/mkfifo
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mkfifo
cp bin/whois blib/script/whois
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/whois
cp bin/ching blib/script/ching
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ching
cp bin/env blib/script/env
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/env
cp bin/arch blib/script/arch
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/arch
cp bin/pom blib/script/pom
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pom
cp bin/false blib/script/false
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/false
cp bin/wump blib/script/wump
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/wump
cp bin/printf blib/script/printf
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/printf
cp bin/make blib/script/make
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/make
cp bin/patch blib/script/patch
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/patch
cp bin/uniq blib/script/uniq
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uniq
cp bin/asa blib/script/asa
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/asa
cp bin/ppt blib/script/ppt
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ppt
cp bin/fish blib/script/fish
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fish
cp bin/cp blib/script/cp
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cp
cp bin/od blib/script/od
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/od
cp bin/tar blib/script/tar
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tar
cp bin/awk blib/script/awk
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/awk
cp bin/primes blib/script/primes
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/primes
cp bin/bc blib/script/bc
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bc
cp bin/sort blib/script/sort
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/sort
cp bin/printenv blib/script/printenv
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/printenv
cp bin/deroff blib/script/deroff
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/deroff
cp bin/robots blib/script/robots
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/robots
cp bin/morse blib/script/morse
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/morse
cp bin/chown blib/script/chown
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/chown
cp bin/colrm blib/script/colrm
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/colrm
cp bin/par blib/script/par
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/par
cp bin/rm blib/script/rm
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rm
cp bin/wc blib/script/wc
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/wc
cp bin/echo blib/script/echo
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/echo
cp bin/random blib/script/random
"/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/random
Manifying 117 pod documents
Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 893.
Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 894.
Manifying 2 pod documents
BDFOY/PerlPowerTools-1.006.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t
# Parent @INC:
# /home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/lib
# /home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib
# /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib
# /home/fly1800/cpanfly-5.18/var/megalib
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib
# /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch
# /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib
# /home/fly1800/cpanfly-5.18/var/megalib
# /home/fly1800/ap1800-297235/site/lib
# /home/fly1800/ap1800-297235/lib
# .
#
# PERL5LIB: /home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib:/home/fly1800/cpanfly-5.18/var/megalib:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib:/home/fly1800/cpanfly-5.18/var/megalib:/home/fly1800/ap1800-297235/site/lib:/home/fly1800/ap1800-297235/lib:.
t/compile.t ..
# Subtest: bin/addbib
ok 1 - bin/addbib compiles
1..1
ok 1 - bin/addbib
# Subtest: bin/apply
ok 1 - bin/apply compiles
1..1
ok 2 - bin/apply
# Subtest: bin/ar
ok 1 - bin/ar compiles
1..1
ok 3 - bin/ar
# Subtest: bin/arch
ok 1 - bin/arch compiles
1..1
ok 4 - bin/arch
# Subtest: bin/arithmetic
ok 1 - bin/arithmetic compiles
1..1
ok 5 - bin/arithmetic
# Subtest: bin/asa
ok 1 - bin/asa compiles
1..1
ok 6 - bin/asa
# Subtest: bin/awk
ok 1 - bin/awk compiles
1..1
ok 7 - bin/awk
# Subtest: bin/banner
ok 1 - bin/banner compiles
1..1
ok 8 - bin/banner
# Subtest: bin/basename
ok 1 - bin/basename compiles
1..1
ok 9 - bin/basename
# Subtest: bin/bc
ok 1 - bin/bc compiles
1..1
ok 10 - bin/bc
# Subtest: bin/cal
ok 1 - bin/cal compiles
1..1
ok 11 - bin/cal
# Subtest: bin/cat
ok 1 - bin/cat compiles
1..1
ok 12 - bin/cat
# Subtest: bin/chgrp
ok 1 - bin/chgrp compiles
1..1
ok 13 - bin/chgrp
# Subtest: bin/ching
ok 1 - bin/ching compiles
1..1
ok 14 - bin/ching
# Subtest: bin/chmod
ok 1 - bin/chmod compiles
1..1
ok 15 - bin/chmod
# Subtest: bin/chown
ok 1 - bin/chown compiles
1..1
ok 16 - bin/chown
# Subtest: bin/clear
ok 1 - bin/clear compiles
1..1
ok 17 - bin/clear
# Subtest: bin/cmp
ok 1 - bin/cmp compiles
1..1
ok 18 - bin/cmp
# Subtest: bin/col
ok 1 - bin/col compiles
1..1
ok 19 - bin/col
# Subtest: bin/colrm
ok 1 - bin/colrm compiles
1..1
ok 20 - bin/colrm
# Subtest: bin/comm
ok 1 - bin/comm compiles
1..1
ok 21 - bin/comm
# Subtest: bin/cp
ok 1 - bin/cp compiles
1..1
ok 22 - bin/cp
# Subtest: bin/cut
ok 1 - bin/cut compiles
1..1
ok 23 - bin/cut
# Subtest: bin/date
ok 1 - bin/date compiles
1..1
ok 24 - bin/date
# Subtest: bin/dc
ok 1 - bin/dc compiles
1..1
ok 25 - bin/dc
# Subtest: bin/deroff
ok 1 - bin/deroff compiles
1..1
ok 26 - bin/deroff
# Subtest: bin/diff
ok 1 - bin/diff compiles
1..1
ok 27 - bin/diff
# Subtest: bin/dirname
ok 1 - bin/dirname compiles
1..1
ok 28 - bin/dirname
# Subtest: bin/du
ok 1 - bin/du compiles
1..1
ok 29 - bin/du
# Subtest: bin/echo
ok 1 - bin/echo compiles
1..1
ok 30 - bin/echo
# Subtest: bin/ed
ok 1 - bin/ed compiles
1..1
ok 31 - bin/ed
# Subtest: bin/env
ok 1 - bin/env compiles
1..1
ok 32 - bin/env
# Subtest: bin/expand
ok 1 - bin/expand compiles
1..1
ok 33 - bin/expand
# Subtest: bin/expr
ok 1 - bin/expr compiles
1..1
ok 34 - bin/expr
# Subtest: bin/factor
ok 1 - bin/factor compiles
1..1
ok 35 - bin/factor
# Subtest: bin/false
ok 1 - bin/false compiles
1..1
ok 36 - bin/false
# Subtest: bin/file
ok 1 - bin/file compiles
1..1
ok 37 - bin/file
# Subtest: bin/find
ok 1 - bin/find compiles
1..1
ok 38 - bin/find
# Subtest: bin/fish
ok 1 - bin/fish compiles
1..1
ok 39 - bin/fish
# Subtest: bin/fmt
ok 1 - bin/fmt compiles
1..1
ok 40 - bin/fmt
# Subtest: bin/fold
ok 1 - bin/fold compiles
1..1
ok 41 - bin/fold
# Subtest: bin/fortune
ok 1 - bin/fortune compiles
1..1
ok 42 - bin/fortune
# Subtest: bin/from
ok 1 - bin/from compiles
1..1
ok 43 - bin/from
# Subtest: bin/glob
ok 1 - bin/glob compiles
1..1
ok 44 - bin/glob
# Subtest: bin/grep
ok 1 - bin/grep compiles
1..1
ok 45 - bin/grep
# Subtest: bin/hangman
ok 1 - bin/hangman compiles
1..1
ok 46 - bin/hangman
# Subtest: bin/head
ok 1 - bin/head compiles
1..1
ok 47 - bin/head
# Subtest: bin/id
ok 1 - bin/id compiles
1..1
ok 48 - bin/id
# Subtest: bin/install
ok 1 - bin/install compiles
1..1
ok 49 - bin/install
# Subtest: bin/join
ok 1 - bin/join compiles
1..1
ok 50 - bin/join
# Subtest: bin/kill
ok 1 - bin/kill compiles
1..1
ok 51 - bin/kill
# Subtest: bin/ln
ok 1 - bin/ln compiles
1..1
ok 52 - bin/ln
# Subtest: bin/lock
ok 1 - bin/lock compiles
1..1
ok 53 - bin/lock
# Subtest: bin/look
ok 1 - bin/look compiles
1..1
ok 54 - bin/look
# Subtest: bin/ls
ok 1 - bin/ls compiles
1..1
ok 55 - bin/ls
# Subtest: bin/mail
ok 1 - bin/mail compiles
1..1
ok 56 - bin/mail
# Subtest: bin/make
ok 1 - bin/make compiles
1..1
ok 57 - bin/make
# Subtest: bin/man
ok 1 - bin/man compiles
1..1
ok 58 - bin/man
# Subtest: bin/maze
ok 1 - bin/maze compiles
1..1
ok 59 - bin/maze
# Subtest: bin/mimedecode
ok 1 - bin/mimedecode compiles
1..1
ok 60 - bin/mimedecode
# Subtest: bin/mkdir
ok 1 - bin/mkdir compiles
1..1
ok 61 - bin/mkdir
# Subtest: bin/mkfifo
ok 1 - bin/mkfifo compiles
1..1
ok 62 - bin/mkfifo
# Subtest: bin/moo
ok 1 - bin/moo compiles
1..1
ok 63 - bin/moo
# Subtest: bin/morse
ok 1 - bin/morse compiles
1..1
ok 64 - bin/morse
# Subtest: bin/od
ok 1 - bin/od compiles
1..1
ok 65 - bin/od
# Subtest: bin/par
ok 1 - bin/par compiles
1..1
ok 66 - bin/par
# Subtest: bin/paste
ok 1 - bin/paste compiles
1..1
ok 67 - bin/paste
# Subtest: bin/patch
ok 1 - bin/patch compiles
1..1
ok 68 - bin/patch
# Subtest: bin/pig
ok 1 - bin/pig compiles
1..1
ok 69 - bin/pig
# Subtest: bin/ping
ok 1 - bin/ping compiles
1..1
ok 70 - bin/ping
# Subtest: bin/pom
ok 1 - bin/pom compiles
1..1
ok 71 - bin/pom
# Subtest: bin/ppt
ok 1 - bin/ppt compiles
1..1
ok 72 - bin/ppt
# Subtest: bin/pr
ok 1 - bin/pr compiles
1..1
ok 73 - bin/pr
# Subtest: bin/primes
ok 1 - bin/primes compiles
1..1
ok 74 - bin/primes
# Subtest: bin/printenv
ok 1 - bin/printenv compiles
1..1
ok 75 - bin/printenv
# Subtest: bin/printf
ok 1 - bin/printf compiles
1..1
ok 76 - bin/printf
# Subtest: bin/pwd
ok 1 - bin/pwd compiles
1..1
ok 77 - bin/pwd
# Subtest: bin/rain
ok 1 - bin/rain compiles
1..1
ok 78 - bin/rain
# Subtest: bin/random
ok 1 - bin/random compiles
1..1
ok 79 - bin/random
# Subtest: bin/rev
ok 1 - bin/rev compiles
1..1
ok 80 - bin/rev
# Subtest: bin/rm
ok 1 - bin/rm compiles
1..1
ok 81 - bin/rm
# Subtest: bin/rmdir
ok 1 - bin/rmdir compiles
1..1
ok 82 - bin/rmdir
# Subtest: bin/robots
ok 1 - bin/robots compiles
1..1
ok 83 - bin/robots
# Subtest: bin/shar
ok 1 - bin/shar compiles
1..1
ok 84 - bin/shar
# Subtest: bin/sleep
ok 1 - bin/sleep compiles
1..1
ok 85 - bin/sleep
# Subtest: bin/sort
ok 1 - bin/sort compiles
1..1
ok 86 - bin/sort
# Subtest: bin/spell
ok 1 - bin/spell compiles
1..1
ok 87 - bin/spell
# Subtest: bin/split
ok 1 - bin/split compiles
1..1
ok 88 - bin/split
# Subtest: bin/strings
ok 1 - bin/strings compiles
1..1
ok 89 - bin/strings
# Subtest: bin/sum
ok 1 - bin/sum compiles
1..1
ok 90 - bin/sum
# Subtest: bin/tac
ok 1 - bin/tac compiles
1..1
ok 91 - bin/tac
# Subtest: bin/tail
ok 1 - bin/tail compiles
1..1
ok 92 - bin/tail
# Subtest: bin/tar
ok 1 - bin/tar compiles
1..1
ok 93 - bin/tar
# Subtest: bin/tee
ok 1 - bin/tee compiles
1..1
ok 94 - bin/tee
# Subtest: bin/test
ok 1 - bin/test compiles
1..1
ok 95 - bin/test
# Subtest: bin/time
ok 1 - bin/time compiles
1..1
ok 96 - bin/time
# Subtest: bin/touch
ok 1 - bin/touch compiles
1..1
ok 97 - bin/touch
# Subtest: bin/tr
ok 1 - bin/tr compiles
1..1
ok 98 - bin/tr
# Subtest: bin/true
ok 1 - bin/true compiles
1..1
ok 99 - bin/true
# Subtest: bin/tsort
ok 1 - bin/tsort compiles
1..1
ok 100 - bin/tsort
# Subtest: bin/tty
ok 1 - bin/tty compiles
1..1
ok 101 - bin/tty
# Subtest: bin/uname
ok 1 - bin/uname compiles
1..1
ok 102 - bin/uname
# Subtest: bin/unexpand
ok 1 - bin/unexpand compiles
1..1
ok 103 - bin/unexpand
# Subtest: bin/uniq
ok 1 - bin/uniq compiles
1..1
ok 104 - bin/uniq
# Subtest: bin/units
ok 1 - bin/units compiles
1..1
ok 105 - bin/units
# Subtest: bin/unpar
ok 1 - bin/unpar compiles
1..1
ok 106 - bin/unpar
# Subtest: bin/unshar
ok 1 - bin/unshar compiles
1..1
ok 107 - bin/unshar
# Subtest: bin/uudecode
ok 1 - bin/uudecode compiles
1..1
ok 108 - bin/uudecode
# Subtest: bin/uuencode
ok 1 - bin/uuencode compiles
1..1
ok 109 - bin/uuencode
# Subtest: bin/wc
ok 1 - bin/wc compiles
1..1
ok 110 - bin/wc
# Subtest: bin/what
ok 1 - bin/what compiles
1..1
ok 111 - bin/what
# Subtest: bin/which
ok 1 - bin/which compiles
1..1
ok 112 - bin/which
# Subtest: bin/whois
ok 1 - bin/whois compiles
1..1
ok 113 - bin/whois
# Subtest: bin/words
ok 1 - bin/words compiles
1..1
ok 114 - bin/words
# Subtest: bin/wump
ok 1 - bin/wump compiles
1..1
ok 115 - bin/wump
# Subtest: bin/xargs
ok 1 - bin/xargs compiles
1..1
ok 116 - bin/xargs
# Subtest: bin/yes
ok 1 - bin/yes compiles
1..1
ok 117 - bin/yes
1..117
ok
# Failed test 'PerlPowerTools::factor->can('run')'
# at t/factor.t line 14.
# PerlPowerTools::factor->can('run') failed
# Looks like you failed 1 test of 2.
# Failed test 'setup'
# at t/factor.t line 15.
Can't locate object method "run" via package "PerlPowerTools::factor" (perhaps you forgot to load "PerlPowerTools::factor"?) at t/factor.t line 20.
# Child (with_filehandle) exited without calling finalize()
# Failed test 'with_filehandle'
# at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 279.
# Tests were run but no plan was declared and done_testing() was not seen.
# Looks like your test exited with 1 just after 2.
t/factor.t ...
# Subtest: setup
ok 1 - require 'bin/factor';
not ok 2 - PerlPowerTools::factor->can('run')
1..2
not ok 1 - setup
# Subtest: with_filehandle
not ok 2 - with_filehandle
Dubious, test returned 1 (wstat 256, 0x100)
Failed 2/2 subtests
t/false.t ....
# Subtest: check file
ok 1 - blib/script/false exists
ok 2 - blib/script/false is executable
1..2
ok 1 - check file
# Subtest: exit value
ok 1 - false returns a unix false
1..1
ok 2 - exit value
1..2
ok
t/true.t .....
# Subtest: check file
ok 1 - blib/script/true exists
ok 2 - blib/script/true is executable
1..2
ok 1 - check file
# Subtest: exit value
ok 1 - true returns a unix true
1..1
ok 2 - exit value
1..2
ok
Test Summary Report
-------------------
t/factor.t (Wstat: 256 Tests: 2 Failed: 2)
Failed tests: 1-2
Non-zero exit status: 1
Parse errors: No plan found in TAP output
Files=4, Tests=123, 2 wallclock secs ( 0.04 usr 0.06 sys + 1.67 cusr 0.43 csys = 2.20 CPU)
Result: FAIL
Failed 1/4 test programs. 2/123 subtests failed.
make: *** [test_dynamic] Error 255
BDFOY/PerlPowerTools-1.006.tar.gz
make test TEST_VERBOSE=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports BDFOY/PerlPowerTools-1.006.tar.gz
Running test for module 'Mac::iTerm::LaunchPad'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz ok
Mac-iTerm-LaunchPad-1.008/
Mac-iTerm-LaunchPad-1.008/Changes
Mac-iTerm-LaunchPad-1.008/examples/
Mac-iTerm-LaunchPad-1.008/examples/placeholder.pl
Mac-iTerm-LaunchPad-1.008/lib/
Mac-iTerm-LaunchPad-1.008/lib/LaunchPad.pm
Mac-iTerm-LaunchPad-1.008/LICENSE
Mac-iTerm-LaunchPad-1.008/Makefile.PL
Mac-iTerm-LaunchPad-1.008/MANIFEST
Mac-iTerm-LaunchPad-1.008/META.yml
Mac-iTerm-LaunchPad-1.008/README
Mac-iTerm-LaunchPad-1.008/t/
Mac-iTerm-LaunchPad-1.008/t/load.t
Mac-iTerm-LaunchPad-1.008/t/pod.t
Mac-iTerm-LaunchPad-1.008/t/pod_coverage.t
Mac-iTerm-LaunchPad-1.008/t/prereq.t
Mac-iTerm-LaunchPad-1.008/t/test_manifest
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
OS unsupported! You need a Mac for this module!
No 'Makefile' created BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- NOT OK
Running test for module 'perlbench'
The module perlbench isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i perlbench'.
Running test for module 'Mac::OSVersion'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Mac-OSVersion-1.001.tar.gz ok
Mac-OSVersion-1.001/
Mac-OSVersion-1.001/Changes
Mac-OSVersion-1.001/examples/
Mac-OSVersion-1.001/lib/
Mac-OSVersion-1.001/LICENSE
Mac-OSVersion-1.001/Makefile.PL
Mac-OSVersion-1.001/MANIFEST
Mac-OSVersion-1.001/MANIFEST.SKIP
Mac-OSVersion-1.001/META.json
Mac-OSVersion-1.001/META.yml
Mac-OSVersion-1.001/README
Mac-OSVersion-1.001/t/
Mac-OSVersion-1.001/t/build.t
Mac-OSVersion-1.001/t/default.t
Mac-OSVersion-1.001/t/gestalt.t
Mac-OSVersion-1.001/t/kernel.t
Mac-OSVersion-1.001/t/load.t
Mac-OSVersion-1.001/t/major.t
Mac-OSVersion-1.001/t/minor.t
Mac-OSVersion-1.001/t/minor_to_name.t
Mac-OSVersion-1.001/t/name.t
Mac-OSVersion-1.001/t/pod.t
Mac-OSVersion-1.001/t/pod_coverage.t
Mac-OSVersion-1.001/t/point.t
Mac-OSVersion-1.001/t/sw_vers.t
Mac-OSVersion-1.001/t/system_profiler.t
Mac-OSVersion-1.001/t/test_manifest
Mac-OSVersion-1.001/t/uname.t
Mac-OSVersion-1.001/t/version.t
Mac-OSVersion-1.001/lib/Mac/
Mac-OSVersion-1.001/lib/Mac/OSVersion.pm
/bin/tar: Read 5120 bytes from -
Mac-OSVersion-1.001/examples/placeholder.pl
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/Mac-OSVersion-1.001.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
OS unsupported. This module only works on Mac OS X.
Warning: No success on command[/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL]
BDFOY/Mac-OSVersion-1.001.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- NOT OK
Running test for module 'HTTP::Cookies::Safari'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz ok
HTTP-Cookies-Safari-1.15/
HTTP-Cookies-Safari-1.15/Changes
HTTP-Cookies-Safari-1.15/examples/
HTTP-Cookies-Safari-1.15/lib/
HTTP-Cookies-Safari-1.15/LICENSE
HTTP-Cookies-Safari-1.15/Makefile.PL
HTTP-Cookies-Safari-1.15/MANIFEST
HTTP-Cookies-Safari-1.15/MANIFEST.SKIP
HTTP-Cookies-Safari-1.15/META.yml
HTTP-Cookies-Safari-1.15/README
HTTP-Cookies-Safari-1.15/t/
HTTP-Cookies-Safari-1.15/t/compile.t
HTTP-Cookies-Safari-1.15/t/Cookies-2039.plist
HTTP-Cookies-Safari-1.15/t/Cookies.plist
HTTP-Cookies-Safari-1.15/t/epoch-limit.t
HTTP-Cookies-Safari-1.15/t/load.t
HTTP-Cookies-Safari-1.15/t/pod.t
HTTP-Cookies-Safari-1.15/t/pod_coverage.t
HTTP-Cookies-Safari-1.15/t/prereq.t
HTTP-Cookies-Safari-1.15/t/save.t
HTTP-Cookies-Safari-1.15/t/test_manifest
HTTP-Cookies-Safari-1.15/lib/HTTP/
HTTP-Cookies-Safari-1.15/lib/HTTP/Cookies/
HTTP-Cookies-Safari-1.15/lib/HTTP/Cookies/Safari.pm
HTTP-Cookies-Safari-1.15/examples/README
/bin/tar: Read 1024 bytes from -
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for HTTP::Cookies::Safari
Writing MYMETA.yml and MYMETA.json
BDFOY/HTTP-Cookies-Safari-1.15.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp lib/HTTP/Cookies/Safari.pm blib/lib/HTTP/Cookies/Safari.pm
Manifying 1 pod document
BDFOY/HTTP-Cookies-Safari-1.15.tar.gz
make -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running make test
>>> make test TEST_VERBOSE=1
"/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )"
Test::Manifest 2.02
Level is 0
# Test level is 0
Test::Manifest::test_harness found [t/compile.t t/pod.t t/pod_coverage.t t/prereq.t t/load.t t/epoch-limit.t t/save.t]
t/compile.t .......
1..1
ok 1 - use HTTP::Cookies::Safari;
ok
t/pod.t ...........
1..1
ok 1 - POD test for blib/lib/HTTP/Cookies/Safari.pm
ok
t/pod_coverage.t ..
1..1
ok 1 - Pod coverage on HTTP::Cookies::Safari
ok
t/prereq.t ........
1..1
ok 1 - Prereq test
ok
t/load.t ..........
1..5
ok 1 - An object of class 'HTTP::Cookies::Safari' isa 'HTTP::Cookies::Safari'
ok 2 - Count of domains
ok 3 - .usatoday.com has 3 cookies
ok 4 - .cnn.com has 1 cookies
ok 5 - Cookie has right value
ok
t/epoch-limit.t ...
1..5
ok 1 - An object of class 'HTTP::Cookies::Safari' isa 'HTTP::Cookies::Safari'
ok 2 - Count of domains
ok 3 - .cnn.com has 1 cookies
ok 4 - Cookie has right value
ok 5 - Expiry past 2038 is 0xff_ff_ff_ff instead
ok
plist is Mac::PropertyList::array=ARRAY(0x857ebc4)
t/save.t ..........
1..2
ok 1 - An object of class 'HTTP::Cookies::Safari' isa 'HTTP::Cookies::Safari'
not ok 2 - Saved file is same as original # TODO How can I compare these files?
# Failed (TODO) test 'Saved file is same as original'
# at t/save.t line 21.
ok
All tests successful.
Files=7, Tests=16, 9 wallclock secs ( 0.03 usr 0.02 sys + 7.90 cusr 0.28 csys = 8.23 CPU)
Result: PASS
BDFOY/HTTP-Cookies-Safari-1.15.tar.gz
make test TEST_VERBOSE=1 -- OK
brian d foy <bdfoy@cpan.org>
Cookie storage and management for Safari
>>> (cd /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH && tar cvf - HTTP-Cookies-Safari-1.15.ppd blib) | gzip -c >/home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz
HTTP-Cookies-Safari-1.15.ppd
blib/
blib/man3/
blib/man3/HTTP::Cookies::Safari.3
blib/lib/
blib/lib/HTTP/
blib/lib/HTTP/Cookies/
blib/lib/HTTP/Cookies/Safari.pm
>>> mv /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/HTTP-Cookies-Safari-1.15.ppd /home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY
Running test for module 'MyCPAN::Indexer'
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-Indexer-1.28-38NSmn
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Has already been prepared
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Has already been made
BDFOY/MyCPAN-Indexer-1.28.tar.gz
Has already been tested within this command
Running test for module 'scriptdist'
The module scriptdist isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i scriptdist'.
Running test for module 'Unicode::Support'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Unicode-Support-0.001.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Unicode-Support-0.001.tar.gz ok
Unicode-Support-0.001
Unicode-Support-0.001/Build
Unicode-Support-0.001/Build.PL
Unicode-Support-0.001/Changes
Unicode-Support-0.001/LICENSE
Unicode-Support-0.001/MANIFEST
Unicode-Support-0.001/META.json
Unicode-Support-0.001/META.yml
Unicode-Support-0.001/README
Unicode-Support-0.001/lib
Unicode-Support-0.001/lib/Unicode
Unicode-Support-0.001/lib/Unicode/Support.pm
Unicode-Support-0.001/t
Unicode-Support-0.001/t/load.t
Unicode-Support-0.001/t/pod.t
Unicode-Support-0.001/t/pod_coverage.t
Unicode-Support-0.001/t/test_manifest
Unicode-Support-0.001/t/files
Unicode-Support-0.001/t/files/filename_case_folding.t
Unicode-Support-0.001/t/files/filenames.t
Unicode-Support-0.001/t/files/filenames_with_different_nf.t
Unicode-Support-0.001/t/lib
Unicode-Support-0.001/t/lib/file_utils.pl
/bin/tar: Read 3072 bytes from -
Unicode-Support-0.001/t/variables
Unicode-Support-0.001/t/variables/case-folding.t
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/Unicode-Support-0.001.tar.gz with Build.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Build.PL
Created MYMETA.yml and MYMETA.json
Creating new 'Build' script for 'Unicode-Support' version '0.001'
BDFOY/Unicode-Support-0.001.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Build.PL -- OK
Running Build for B/BD/BDFOY/Unicode-Support-0.001.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> ./Build
Building Unicode-Support
BDFOY/Unicode-Support-0.001.tar.gz
./Build -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running Build test
>>> ./Build test verbose=1
test file [files/filename_case_folding.pl] does not exist! Skipping! at /home/fly1800/cpanfly-5.18/var/cpan/build/Unicode-Support-0.001-m3WjYH/_build/lib/Test/Manifest/MB.pm line 18.
Test level is 0
t/load.t ...............................
1..1
ok 1 - use Unicode::Support;
ok
t/pod.t ................................
1..1
ok 1 - POD test for blib/lib/Unicode/Support.pm
ok
t/pod_coverage.t .......................
1..1
ok 1 - Pod coverage on Unicode::Support
ok
# Failed test '-e with NFD returns true (U+0065 U+0301)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFD returns true (U+0065 U+0301) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Failed test '-e with NFKD returns true (U+0065 U+0301)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKD returns true (U+0065 U+0301) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Looks like you failed 4 tests of 11.
# Failed test 'Input filename [é] with code numbers [U+00E9]'
# at t/files/filenames_with_different_nf.t line 88.
# Failed test '-e with NFD returns true (U+0075 U+0308)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFD returns true (U+0075 U+0308) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Failed test '-e with NFKD returns true (U+0075 U+0308)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKD returns true (U+0075 U+0308) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Looks like you failed 4 tests of 11.
# Failed test 'Input filename [ü] with code numbers [U+00FC]'
# at t/files/filenames_with_different_nf.t line 88.
# Failed test '-e with NFD returns true (U+0061 U+030A)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFD returns true (U+0061 U+030A) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Failed test '-e with NFKD returns true (U+0061 U+030A)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKD returns true (U+0061 U+030A) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Looks like you failed 4 tests of 11.
# Failed test 'Input filename [å] with code numbers [U+00E5]'
# at t/files/filenames_with_different_nf.t line 88.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test '-e with NFKC returns true (U+0066 U+0066)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKC returns true (U+0066 U+0066) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Failed test '-e with NFKD returns true (U+0066 U+0066)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKD returns true (U+0066 U+0066) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Looks like you failed 4 tests of 11.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Input filename [ff] with code numbers [U+FB00]'
# at t/files/filenames_with_different_nf.t line 88.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test '-e with NFKC returns true (U+0056 U+0049 U+0049 U+0049)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKC returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Failed test '-e with NFKD returns true (U+0056 U+0049 U+0049 U+0049)'
# at t/files/filenames_with_different_nf.t line 76.
# Failed test 'open() with NFKD returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory'
# at t/files/filenames_with_different_nf.t line 80.
# Looks like you failed 4 tests of 11.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Input filename [â…§] with code numbers [U+2167]'
# at t/files/filenames_with_different_nf.t line 88.
# Failed test 'NFD does not always work'
# at t/files/filenames_with_different_nf.t line 92.
# Failed test 'NFKC does not always work'
# at t/files/filenames_with_different_nf.t line 92.
# Failed test 'NFKD does not always work'
# at t/files/filenames_with_different_nf.t line 92.
# Looks like you failed 8 tests of 11.
t/files/filenames_with_different_nf.t ..
ok 1 - Unlinked 0 of 0 files
# Subtest: Input filename [é] with code numbers [U+00E9]
ok 1 - [é] does not exist before test
ok 2 - There are no files before the test
not ok 3 - -e with NFD returns true (U+0065 U+0301)
not ok 4 - open() with NFD returns true (U+0065 U+0301) error => No such file or directory
ok 5 - -e with NFC returns true (U+00E9)
ok 6 - open() with NFC returns true (U+00E9)
ok 7 - -e with NFKC returns true (U+00E9)
ok 8 - open() with NFKC returns true (U+00E9)
not ok 9 - -e with NFKD returns true (U+0065 U+0301)
not ok 10 - open() with NFKD returns true (U+0065 U+0301) error => No such file or directory
ok 11 - Unlinked 1 of 1 files
1..11
not ok 2 - Input filename [é] with code numbers [U+00E9]
# Subtest: Input filename [ü] with code numbers [U+00FC]
ok 1 - [ü] does not exist before test
ok 2 - There are no files before the test
not ok 3 - -e with NFD returns true (U+0075 U+0308)
not ok 4 - open() with NFD returns true (U+0075 U+0308) error => No such file or directory
ok 5 - -e with NFC returns true (U+00FC)
ok 6 - open() with NFC returns true (U+00FC)
ok 7 - -e with NFKC returns true (U+00FC)
ok 8 - open() with NFKC returns true (U+00FC)
not ok 9 - -e with NFKD returns true (U+0075 U+0308)
not ok 10 - open() with NFKD returns true (U+0075 U+0308) error => No such file or directory
ok 11 - Unlinked 1 of 1 files
1..11
not ok 3 - Input filename [ü] with code numbers [U+00FC]
# Subtest: Input filename [å] with code numbers [U+00E5]
ok 1 - [å] does not exist before test
ok 2 - There are no files before the test
not ok 3 - -e with NFD returns true (U+0061 U+030A)
not ok 4 - open() with NFD returns true (U+0061 U+030A) error => No such file or directory
ok 5 - -e with NFC returns true (U+00E5)
ok 6 - open() with NFC returns true (U+00E5)
ok 7 - -e with NFKC returns true (U+00E5)
ok 8 - open() with NFKC returns true (U+00E5)
not ok 9 - -e with NFKD returns true (U+0061 U+030A)
not ok 10 - open() with NFKD returns true (U+0061 U+030A) error => No such file or directory
ok 11 - Unlinked 1 of 1 files
1..11
not ok 4 - Input filename [å] with code numbers [U+00E5]
# Subtest: Input filename [Ï€] with code numbers [U+03C0]
ok 1 - [Ï€] does not exist before test
ok 2 - There are no files before the test
ok 3 - -e with NFD returns true (U+03C0)
ok 4 - open() with NFD returns true (U+03C0)
ok 5 - -e with NFC returns true (U+03C0)
ok 6 - open() with NFC returns true (U+03C0)
ok 7 - -e with NFKC returns true (U+03C0)
ok 8 - open() with NFKC returns true (U+03C0)
ok 9 - -e with NFKD returns true (U+03C0)
ok 10 - open() with NFKD returns true (U+03C0)
ok 11 - Unlinked 1 of 1 files
1..11
ok 5 - Input filename [Ï€] with code numbers [U+03C0]
# Subtest: Input filename [ff] with code numbers [U+FB00]
ok 1 - [ff] does not exist before test
ok 2 - There are no files before the test
ok 3 - -e with NFD returns true (U+FB00)
ok 4 - open() with NFD returns true (U+FB00)
ok 5 - -e with NFC returns true (U+FB00)
ok 6 - open() with NFC returns true (U+FB00)
not ok 7 - -e with NFKC returns true (U+0066 U+0066)
not ok 8 - open() with NFKC returns true (U+0066 U+0066) error => No such file or directory
not ok 9 - -e with NFKD returns true (U+0066 U+0066)
not ok 10 - open() with NFKD returns true (U+0066 U+0066) error => No such file or directory
ok 11 - Unlinked 1 of 1 files
1..11
not ok 6 - Input filename [ff] with code numbers [U+FB00]
# Subtest: Input filename [â…§] with code numbers [U+2167]
ok 1 - [â…§] does not exist before test
ok 2 - There are no files before the test
ok 3 - -e with NFD returns true (U+2167)
ok 4 - open() with NFD returns true (U+2167)
ok 5 - -e with NFC returns true (U+2167)
ok 6 - open() with NFC returns true (U+2167)
not ok 7 - -e with NFKC returns true (U+0056 U+0049 U+0049 U+0049)
not ok 8 - open() with NFKC returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory
not ok 9 - -e with NFKD returns true (U+0056 U+0049 U+0049 U+0049)
not ok 10 - open() with NFKD returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory
ok 11 - Unlinked 1 of 1 files
1..11
not ok 7 - Input filename [â…§] with code numbers [U+2167]
not ok 8 - NFD does not always work
ok 9 - NFC seems to always work
not ok 10 - NFKC does not always work
not ok 11 - NFKD does not always work
1..11
Dubious, test returned 8 (wstat 2048, 0x800)
Failed 8/11 subtests
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [eÌ]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFKD with filename [eÌ] (U+0065 U+0301)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [ü]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFKD with filename [ü] (U+0075 U+0308)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [aÌŠ]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFKD with filename [aÌŠ] (U+0061 U+030A)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [Ï€]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFKD with filename [Ï€] (U+03C0)'
# at t/files/filenames.t line 93.
# Testing [ff]
# Testing [VIII]
# Looks like you failed 4 tests of 6.
# Failed test 'Testing NFKD'
# at t/files/filenames.t line 96.
# Testing [é]
# Testing [ü]
# Testing [å]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [Ï€]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [ff]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [â…§]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [é]
# Testing [ü]
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
# Failed test 'Tested NFKC with filename [ü] (U+00FC)'
# at t/files/filenames.t line 93.
# Testing [å]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [Ï€]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [ff]
# Testing [VIII]
# Looks like you failed 1 test of 6.
# Failed test 'Testing NFKC'
# at t/files/filenames.t line 96.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [eÌ]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFD with filename [eÌ] (U+0065 U+0301)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [ü]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFD with filename [ü] (U+0075 U+0308)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [aÌŠ]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFD with filename [aÌŠ] (U+0061 U+030A)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [Ï€]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFD with filename [Ï€] (U+03C0)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [ff]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFD with filename [ff] (U+FB00)'
# at t/files/filenames.t line 93.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Testing [â…§]
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Filename comes back as the same NF type'
# at t/files/filenames.t line 87.
# Looks like you failed 1 test of 6.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826.
# Failed test 'Tested NFD with filename [â…§] (U+2167)'
# at t/files/filenames.t line 93.
# Looks like you failed 6 tests of 6.
# Failed test 'Testing NFD'
# at t/files/filenames.t line 96.
# Looks like you failed 3 tests of 5.
t/files/filenames.t ....................
ok 1 - Unlinked 0 of 0 files
# Subtest: Testing NFKD
# Subtest: Tested NFKD with filename [eÌ] (U+0065 U+0301)
ok 1 - [eÌ] does not exist before test
ok 2 - There are no files before the test
ok 3 - [eÌ] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 1 - Tested NFKD with filename [eÌ] (U+0065 U+0301)
# Subtest: Tested NFKD with filename [ü] (U+0075 U+0308)
ok 1 - [ü] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ü] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 2 - Tested NFKD with filename [ü] (U+0075 U+0308)
# Subtest: Tested NFKD with filename [aÌŠ] (U+0061 U+030A)
ok 1 - [aÌŠ] does not exist before test
ok 2 - There are no files before the test
ok 3 - [aÌŠ] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 3 - Tested NFKD with filename [aÌŠ] (U+0061 U+030A)
# Subtest: Tested NFKD with filename [Ï€] (U+03C0)
ok 1 - [Ï€] does not exist before test
ok 2 - There are no files before the test
ok 3 - [Ï€] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 4 - Tested NFKD with filename [Ï€] (U+03C0)
# Subtest: Tested NFKD with filename [ff] (U+0066 U+0066)
ok 1 - [ff] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ff] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 5 - Tested NFKD with filename [ff] (U+0066 U+0066)
# Subtest: Tested NFKD with filename [VIII] (U+0056 U+0049 U+0049 U+0049)
ok 1 - [VIII] does not exist before test
ok 2 - There are no files before the test
ok 3 - [VIII] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 6 - Tested NFKD with filename [VIII] (U+0056 U+0049 U+0049 U+0049)
1..6
not ok 2 - Testing NFKD
# Subtest: Testing NFC
# Subtest: Tested NFC with filename [é] (U+00E9)
ok 1 - [é] does not exist before test
ok 2 - There are no files before the test
ok 3 - [é] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 1 - Tested NFC with filename [é] (U+00E9)
# Subtest: Tested NFC with filename [ü] (U+00FC)
ok 1 - [ü] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ü] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 2 - Tested NFC with filename [ü] (U+00FC)
# Subtest: Tested NFC with filename [å] (U+00E5)
ok 1 - [å] does not exist before test
ok 2 - There are no files before the test
ok 3 - [å] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 3 - Tested NFC with filename [å] (U+00E5)
# Subtest: Tested NFC with filename [Ï€] (U+03C0)
ok 1 - [Ï€] does not exist before test
ok 2 - There are no files before the test
ok 3 - [Ï€] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 4 - Tested NFC with filename [Ï€] (U+03C0)
# Subtest: Tested NFC with filename [ff] (U+FB00)
ok 1 - [ff] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ff] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 5 - Tested NFC with filename [ff] (U+FB00)
# Subtest: Tested NFC with filename [â…§] (U+2167)
ok 1 - [â…§] does not exist before test
ok 2 - There are no files before the test
ok 3 - [â…§] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 6 - Tested NFC with filename [â…§] (U+2167)
1..6
ok 3 - Testing NFC
# Subtest: Testing NFKC
# Subtest: Tested NFKC with filename [é] (U+00E9)
ok 1 - [é] does not exist before test
ok 2 - There are no files before the test
ok 3 - [é] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 1 - Tested NFKC with filename [é] (U+00E9)
# Subtest: Tested NFKC with filename [ü] (U+00FC)
ok 1 - [ü] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ü] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 2 - Tested NFKC with filename [ü] (U+00FC)
# Subtest: Tested NFKC with filename [å] (U+00E5)
ok 1 - [å] does not exist before test
ok 2 - There are no files before the test
ok 3 - [å] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 3 - Tested NFKC with filename [å] (U+00E5)
# Subtest: Tested NFKC with filename [Ï€] (U+03C0)
ok 1 - [Ï€] does not exist before test
ok 2 - There are no files before the test
ok 3 - [Ï€] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 4 - Tested NFKC with filename [Ï€] (U+03C0)
# Subtest: Tested NFKC with filename [ff] (U+0066 U+0066)
ok 1 - [ff] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ff] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 5 - Tested NFKC with filename [ff] (U+0066 U+0066)
# Subtest: Tested NFKC with filename [VIII] (U+0056 U+0049 U+0049 U+0049)
ok 1 - [VIII] does not exist before test
ok 2 - There are no files before the test
ok 3 - [VIII] exists after opening
ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
ok 6 - Tested NFKC with filename [VIII] (U+0056 U+0049 U+0049 U+0049)
1..6
not ok 4 - Testing NFKC
# Subtest: Testing NFD
# Subtest: Tested NFD with filename [eÌ] (U+0065 U+0301)
ok 1 - [eÌ] does not exist before test
ok 2 - There are no files before the test
ok 3 - [eÌ] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 1 - Tested NFD with filename [eÌ] (U+0065 U+0301)
# Subtest: Tested NFD with filename [ü] (U+0075 U+0308)
ok 1 - [ü] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ü] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 2 - Tested NFD with filename [ü] (U+0075 U+0308)
# Subtest: Tested NFD with filename [aÌŠ] (U+0061 U+030A)
ok 1 - [aÌŠ] does not exist before test
ok 2 - There are no files before the test
ok 3 - [aÌŠ] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 3 - Tested NFD with filename [aÌŠ] (U+0061 U+030A)
# Subtest: Tested NFD with filename [Ï€] (U+03C0)
ok 1 - [Ï€] does not exist before test
ok 2 - There are no files before the test
ok 3 - [Ï€] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 4 - Tested NFD with filename [Ï€] (U+03C0)
# Subtest: Tested NFD with filename [ff] (U+FB00)
ok 1 - [ff] does not exist before test
ok 2 - There are no files before the test
ok 3 - [ff] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 5 - Tested NFD with filename [ff] (U+FB00)
# Subtest: Tested NFD with filename [â…§] (U+2167)
ok 1 - [â…§] does not exist before test
ok 2 - There are no files before the test
ok 3 - [â…§] exists after opening
not ok 4 - Filename comes back as the same NF type
ok 5 - There is exactly one file
ok 6 - Unlinked 1 of 1 files
1..6
not ok 6 - Tested NFD with filename [â…§] (U+2167)
1..6
not ok 5 - Testing NFD
1..5
Dubious, test returned 3 (wstat 768, 0x300)
Failed 3/5 subtests
Test Summary Report
-------------------
t/files/filenames_with_different_nf.t (Wstat: 2048 Tests: 11 Failed: 8)
Failed tests: 2-4, 6-8, 10-11
Non-zero exit status: 8
t/files/filenames.t (Wstat: 768 Tests: 5 Failed: 3)
Failed tests: 2, 4-5
Non-zero exit status: 3
Files=5, Tests=19, 0 wallclock secs ( 0.06 usr 0.03 sys + 0.43 cusr 0.09 csys = 0.61 CPU)
Result: FAIL
Failed 2/5 test programs. 11/19 subtests failed.
BDFOY/Unicode-Support-0.001.tar.gz
./Build test verbose=1 -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports BDFOY/Unicode-Support-0.001.tar.gz
Running test for module 'File::Fingerprint'
The module File::Fingerprint isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i File::Fingerprint'.
Running test for module 'Task::MasteringPerl'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Task-MasteringPerl-1.002.tar.gz ok
Task-MasteringPerl-1.002/
Task-MasteringPerl-1.002/Changes
Task-MasteringPerl-1.002/lib/
Task-MasteringPerl-1.002/LICENSE
Task-MasteringPerl-1.002/Makefile.PL
Task-MasteringPerl-1.002/MANIFEST
Task-MasteringPerl-1.002/META.json
Task-MasteringPerl-1.002/META.yml
Task-MasteringPerl-1.002/MYMETA.json
Task-MasteringPerl-1.002/MYMETA.yml
Task-MasteringPerl-1.002/README
Task-MasteringPerl-1.002/t/
Task-MasteringPerl-1.002/t/load.t
Task-MasteringPerl-1.002/t/pod.t
Task-MasteringPerl-1.002/lib/Task/
Task-MasteringPerl-1.002/lib/Task/MasteringPerl.pm
/bin/tar: Read 6144 bytes from -
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring B/BD/BDFOY/Task-MasteringPerl-1.002.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Warning: prerequisite Apache::PerlRun 0 not found.
Warning: prerequisite Apache::Pod 0 not found.
Warning: prerequisite App::Smbxfer 0 not found.
Warning: prerequisite BioPerl 0 not found.
Warning: prerequisite Code::Splice 0 not found.
Warning: prerequisite Config::ApacheFile 0 not found.
Warning: prerequisite Data::Dump::Steamer 0 not found.
Warning: prerequisite Devel::DProf 0 not found.
Warning: prerequisite Devel::MyDebugger 0 not found.
Warning: prerequisite Devel::ebug 0 not found.
Warning: prerequisite Devel::ebug::Console 0 not found.
Warning: prerequisite Git::CPAN::Patch 0 not found.
Warning: prerequisite Hook::Lex::Wrap 0 not found.
Warning: prerequisite JSON::Rabbit 0 not found.
Warning: prerequisite ModPerl::PerlRun 0 not found.
Warning: prerequisite Module::NotThere 0 not found.
Warning: prerequisite Package:Stash 0 not found.
Warning: prerequisite Perl::Critic::DEVELOPER 0 not found.
Warning: prerequisite Pod::Simple::Subclassing 0 not found.
Warning: prerequisite ReturnValue 0 not found.
Warning: prerequisite Some::Module 0 not found.
Warning: prerequisite Tie:: 0 not found.
Warning: prerequisite Tie::File::Timestamp 0 not found.
Warning: prerequisite TryCatch 0 not found.
Warning: prerequisite Vim::Debug 0 not found.
Warning: prerequisite Win32 0 not found.
Warning: prerequisite Win32::Registry 0 not found.
Warning: prerequisite die 0 not found.
Warning: prerequisite perlbench 0 not found.
Warning: prerequisite ptkdb 0 not found.
Warning: prerequisite require 0 not found.
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Task::MasteringPerl
Writing MYMETA.yml and MYMETA.json
BDFOY/Task-MasteringPerl-1.002.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for B/BD/BDFOY/Task-MasteringPerl-1.002.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
---- Unsatisfied dependencies detected during ----
---- BDFOY/Task-MasteringPerl-1.002.tar.gz ----
perlbench [requires]
Devel::DProf [requires]
BioPerl [requires]
Tie::File::Timestamp [requires]
ReturnValue [requires]
Devel::MyDebugger [requires]
App::Smbxfer [requires]
Config::ApacheFile [requires]
Data::Dump::Steamer [requires]
ptkdb [requires]
Win32::Registry [requires]
Devel::ebug [requires]
Devel::ebug::Console [requires]
Vim::Debug [requires]
Apache::PerlRun [requires]
Git::CPAN::Patch [requires]
ModPerl::PerlRun [requires]
JSON::Rabbit [requires]
require [requires]
Some::Module [requires]
die [requires]
Module::NotThere [requires]
Pod::Simple::Subclassing [requires]
TryCatch [requires]
Code::Splice [requires]
Hook::Lex::Wrap [requires]
Apache::Pod [requires]
Win32 [requires]
Perl::Critic::DEVELOPER [requires]
Running test for module 'perlbench'
The module perlbench isn't available on CPAN.
Either the module has not yet been uploaded to CPAN, or it is
temporary unavailable. Please contact the author to find out
more about the status. Try 'i perlbench'.
Running test for module 'Devel::DProf'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Fetching with LWP:
http://ppm.activestate.com/CPAN/authors/id/F/FL/FLORA/Devel-DProf-20110802.00.tar.gz
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/F/FL/FLORA/Devel-DProf-20110802.00.tar.gz ok
Devel-DProf-20110802.00
Devel-DProf-20110802.00/Todo
Devel-DProf-20110802.00/README
Devel-DProf-20110802.00/Changes
Devel-DProf-20110802.00/LICENSE
Devel-DProf-20110802.00/DProf.xs
Devel-DProf-20110802.00/DProf.pm
Devel-DProf-20110802.00/dist.ini
Devel-DProf-20110802.00/META.yml
Devel-DProf-20110802.00/MANIFEST
Devel-DProf-20110802.00/t
Devel-DProf-20110802.00/t/DProf.t
Devel-DProf-20110802.00/META.json
Devel-DProf-20110802.00/dprof
Devel-DProf-20110802.00/dprof/V.pm
Devel-DProf-20110802.00/bin
Devel-DProf-20110802.00/bin/dprofpp
Devel-DProf-20110802.00/Makefile.PL
Devel-DProf-20110802.00/dprof/test3_t
Devel-DProf-20110802.00/dprof/test1_t
Devel-DProf-20110802.00/dprof/test4_v
Devel-DProf-20110802.00/dprof/test2_t
Devel-DProf-20110802.00/dprof/test7_v
Devel-DProf-20110802.00/dprof/test8_v
Devel-DProf-20110802.00/dprof/test7_t
Devel-DProf-20110802.00/dprof/test5_t
Devel-DProf-20110802.00/dprof/test5_v
Devel-DProf-20110802.00/dprof/test6_v
Devel-DProf-20110802.00/dprof/test6_t
Devel-DProf-20110802.00/dprof/test3_v
Devel-DProf-20110802.00/dprof/test2_v
Devel-DProf-20110802.00/dprof/test1_v
Devel-DProf-20110802.00/dprof/test8_t
Devel-DProf-20110802.00/dprof/test4_t
/bin/tar: Read 2048 bytes from -
Devel-DProf-20110802.00/t/release-pod-syntax.t
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring F/FL/FLORA/Devel-DProf-20110802.00.tar.gz with Makefile.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL
Checking if your kit is complete...
Looks good
Have /home/fly1800/cpanfly-5.18/var/megalib
Want /home/fly1800/ap1800-297235/lib
Your perl and your Config.pm seem to have different ideas about the
architecture they are running on.
Perl thinks: [megalib]
Config says: [i686-linux-thread-multi-64int]
This may or may not cause problems. Please check your installation of perl
if you have problems building this extension.
Generating a Unix-style Makefile
Writing Makefile for Devel::DProf
Writing MYMETA.yml and MYMETA.json
FLORA/Devel-DProf-20110802.00.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK
Running make for F/FL/FLORA/Devel-DProf-20110802.00.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> make
cp DProf.pm blib/lib/Devel/DProf.pm
Running Mkbootstrap for Devel::DProf ()
chmod 644 "DProf.bs"
"/home/fly1800/ap1800-297235/bin/perl-static" "/home/fly1800/cpanfly-5.18/var/megalib/ExtUtils/xsubpp" -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" DProf.xs > DProf.xsc && mv DProf.xsc DProf.c
Please specify prototyping behavior for DProf.xs (see perlxs manual)
gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"20110802.00\" -DXS_VERSION=\"20110802.00\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" DProf.c
DProf.c:854: error: static declaration of 'XS_Devel__DProf_END' follows non-static declaration
DProf.xs:107: error: previous declaration of 'XS_Devel__DProf_END' was here
make: *** [DProf.o] Error 1
FLORA/Devel-DProf-20110802.00.tar.gz
make -- NOT OK
Running test for module 'BioPerl'
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get'
Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.923.tar.gz ok
BioPerl-1.6.923
BioPerl-1.6.923/.travis.yml
BioPerl-1.6.923/AUTHORS
BioPerl-1.6.923/BioPerl.pm
BioPerl-1.6.923/BUGS
BioPerl-1.6.923/Build.PL
BioPerl-1.6.923/Changes
BioPerl-1.6.923/DEPENDENCIES
BioPerl-1.6.923/DEPRECATED
BioPerl-1.6.923/INSTALL
BioPerl-1.6.923/INSTALL.SKIP
BioPerl-1.6.923/INSTALL.WIN
BioPerl-1.6.923/LICENSE
BioPerl-1.6.923/MANIFEST
BioPerl-1.6.923/META.json
BioPerl-1.6.923/META.yml
BioPerl-1.6.923/README
BioPerl-1.6.923/README.md
BioPerl-1.6.923/Bio
BioPerl-1.6.923/Bio/AlignIO.pm
BioPerl-1.6.923/Bio/AnalysisI.pm
BioPerl-1.6.923/Bio/AnalysisParserI.pm
BioPerl-1.6.923/Bio/AnalysisResultI.pm
BioPerl-1.6.923/Bio/AnnotatableI.pm
BioPerl-1.6.923/Bio/AnnotationCollectionI.pm
BioPerl-1.6.923/Bio/AnnotationI.pm
BioPerl-1.6.923/Bio/ClusterI.pm
BioPerl-1.6.923/Bio/ClusterIO.pm
BioPerl-1.6.923/Bio/DasI.pm
BioPerl-1.6.923/Bio/DBLinkContainerI.pm
BioPerl-1.6.923/Bio/DescribableI.pm
BioPerl-1.6.923/Bio/FeatureHolderI.pm
BioPerl-1.6.923/Bio/HandlerBaseI.pm
BioPerl-1.6.923/Bio/IdCollectionI.pm
BioPerl-1.6.923/Bio/IdentifiableI.pm
BioPerl-1.6.923/Bio/LocatableSeq.pm
BioPerl-1.6.923/Bio/LocationI.pm
BioPerl-1.6.923/Bio/MapIO.pm
BioPerl-1.6.923/Bio/NexmlIO.pm
BioPerl-1.6.923/Bio/OntologyIO.pm
BioPerl-1.6.923/Bio/ParameterBaseI.pm
BioPerl-1.6.923/Bio/Perl.pm
BioPerl-1.6.923/Bio/PhyloNetwork.pm
BioPerl-1.6.923/Bio/PrimarySeq.pm
BioPerl-1.6.923/Bio/PrimarySeqI.pm
BioPerl-1.6.923/Bio/PullParserI.pm
BioPerl-1.6.923/Bio/Range.pm
BioPerl-1.6.923/Bio/RangeI.pm
BioPerl-1.6.923/Bio/SearchDist.pm
BioPerl-1.6.923/Bio/SearchIO.pm
BioPerl-1.6.923/Bio/Seq.pm
BioPerl-1.6.923/Bio/SeqAnalysisParserI.pm
BioPerl-1.6.923/Bio/SeqFeatureI.pm
BioPerl-1.6.923/Bio/SeqI.pm
BioPerl-1.6.923/Bio/SeqIO.pm
BioPerl-1.6.923/Bio/SeqUtils.pm
BioPerl-1.6.923/Bio/SimpleAlign.pm
BioPerl-1.6.923/Bio/SimpleAnalysisI.pm
BioPerl-1.6.923/Bio/Species.pm
BioPerl-1.6.923/Bio/Taxon.pm
BioPerl-1.6.923/Bio/Taxonomy.pm
BioPerl-1.6.923/Bio/TreeIO.pm
BioPerl-1.6.923/Bio/UpdateableSeqI.pm
BioPerl-1.6.923/Bio/WebAgent.pm
BioPerl-1.6.923/Bio/Align
BioPerl-1.6.923/Bio/Align/AlignI.pm
BioPerl-1.6.923/Bio/Align/DNAStatistics.pm
BioPerl-1.6.923/Bio/Align/Graphics.pm
BioPerl-1.6.923/Bio/Align/PairwiseStatistics.pm
BioPerl-1.6.923/Bio/Align/ProteinStatistics.pm
BioPerl-1.6.923/Bio/Align/StatisticsI.pm
BioPerl-1.6.923/Bio/Align/Utilities.pm
BioPerl-1.6.923/Bio/AlignIO
BioPerl-1.6.923/Bio/AlignIO/arp.pm
BioPerl-1.6.923/Bio/AlignIO/bl2seq.pm
BioPerl-1.6.923/Bio/AlignIO/clustalw.pm
BioPerl-1.6.923/Bio/AlignIO/emboss.pm
BioPerl-1.6.923/Bio/AlignIO/fasta.pm
BioPerl-1.6.923/Bio/AlignIO/largemultifasta.pm
BioPerl-1.6.923/Bio/AlignIO/maf.pm
BioPerl-1.6.923/Bio/AlignIO/mase.pm
BioPerl-1.6.923/Bio/AlignIO/mega.pm
BioPerl-1.6.923/Bio/AlignIO/meme.pm
BioPerl-1.6.923/Bio/AlignIO/metafasta.pm
BioPerl-1.6.923/Bio/AlignIO/msf.pm
BioPerl-1.6.923/Bio/AlignIO/nexml.pm
BioPerl-1.6.923/Bio/AlignIO/nexus.pm
BioPerl-1.6.923/Bio/AlignIO/pfam.pm
BioPerl-1.6.923/Bio/AlignIO/phylip.pm
BioPerl-1.6.923/Bio/AlignIO/po.pm
BioPerl-1.6.923/Bio/AlignIO/proda.pm
BioPerl-1.6.923/Bio/AlignIO/prodom.pm
BioPerl-1.6.923/Bio/AlignIO/psi.pm
BioPerl-1.6.923/Bio/AlignIO/selex.pm
BioPerl-1.6.923/Bio/AlignIO/stockholm.pm
BioPerl-1.6.923/Bio/AlignIO/xmfa.pm
BioPerl-1.6.923/Bio/AlignIO/Handler
BioPerl-1.6.923/Bio/AlignIO/Handler/GenericAlignHandler.pm
BioPerl-1.6.923/Bio/Annotation
BioPerl-1.6.923/Bio/Annotation/AnnotationFactory.pm
BioPerl-1.6.923/Bio/Annotation/Collection.pm
BioPerl-1.6.923/Bio/Annotation/Comment.pm
BioPerl-1.6.923/Bio/Annotation/DBLink.pm
BioPerl-1.6.923/Bio/Annotation/OntologyTerm.pm
BioPerl-1.6.923/Bio/Annotation/Reference.pm
BioPerl-1.6.923/Bio/Annotation/Relation.pm
BioPerl-1.6.923/Bio/Annotation/SimpleValue.pm
BioPerl-1.6.923/Bio/Annotation/StructuredValue.pm
BioPerl-1.6.923/Bio/Annotation/TagTree.pm
BioPerl-1.6.923/Bio/Annotation/Target.pm
BioPerl-1.6.923/Bio/Annotation/Tree.pm
BioPerl-1.6.923/Bio/Annotation/TypeManager.pm
BioPerl-1.6.923/Bio/Assembly
BioPerl-1.6.923/Bio/Assembly/Contig.pm
BioPerl-1.6.923/Bio/Assembly/ContigAnalysis.pm
BioPerl-1.6.923/Bio/Assembly/IO.pm
BioPerl-1.6.923/Bio/Assembly/Scaffold.pm
BioPerl-1.6.923/Bio/Assembly/ScaffoldI.pm
BioPerl-1.6.923/Bio/Assembly/Singlet.pm
BioPerl-1.6.923/Bio/Assembly/IO
BioPerl-1.6.923/Bio/Assembly/IO/ace.pm
BioPerl-1.6.923/Bio/Assembly/IO/bowtie.pm
BioPerl-1.6.923/Bio/Assembly/IO/maq.pm
BioPerl-1.6.923/Bio/Assembly/IO/phrap.pm
BioPerl-1.6.923/Bio/Assembly/IO/sam.pm
BioPerl-1.6.923/Bio/Assembly/IO/tigr.pm
BioPerl-1.6.923/Bio/Assembly/Tools
BioPerl-1.6.923/Bio/Assembly/Tools/ContigSpectrum.pm
BioPerl-1.6.923/Bio/Cluster
BioPerl-1.6.923/Bio/Cluster/ClusterFactory.pm
BioPerl-1.6.923/Bio/Cluster/FamilyI.pm
BioPerl-1.6.923/Bio/Cluster/SequenceFamily.pm
BioPerl-1.6.923/Bio/Cluster/UniGene.pm
BioPerl-1.6.923/Bio/Cluster/UniGeneI.pm
BioPerl-1.6.923/Bio/ClusterIO
BioPerl-1.6.923/Bio/ClusterIO/dbsnp.pm
BioPerl-1.6.923/Bio/ClusterIO/unigene.pm
BioPerl-1.6.923/Bio/CodonUsage
BioPerl-1.6.923/Bio/CodonUsage/IO.pm
BioPerl-1.6.923/Bio/CodonUsage/Table.pm
BioPerl-1.6.923/Bio/Coordinate
BioPerl-1.6.923/Bio/Coordinate/Chain.pm
BioPerl-1.6.923/Bio/Coordinate/Collection.pm
BioPerl-1.6.923/Bio/Coordinate/ExtrapolatingPair.pm
BioPerl-1.6.923/Bio/Coordinate/GeneMapper.pm
BioPerl-1.6.923/Bio/Coordinate/Graph.pm
BioPerl-1.6.923/Bio/Coordinate/MapperI.pm
BioPerl-1.6.923/Bio/Coordinate/Pair.pm
BioPerl-1.6.923/Bio/Coordinate/Result.pm
BioPerl-1.6.923/Bio/Coordinate/ResultI.pm
BioPerl-1.6.923/Bio/Coordinate/Utils.pm
BioPerl-1.6.923/Bio/Coordinate/Result
BioPerl-1.6.923/Bio/Coordinate/Result/Gap.pm
BioPerl-1.6.923/Bio/Coordinate/Result/Match.pm
BioPerl-1.6.923/Bio/Das
BioPerl-1.6.923/Bio/Das/FeatureTypeI.pm
BioPerl-1.6.923/Bio/Das/SegmentI.pm
BioPerl-1.6.923/Bio/DB
BioPerl-1.6.923/Bio/DB/Ace.pm
BioPerl-1.6.923/Bio/DB/BioFetch.pm
BioPerl-1.6.923/Bio/DB/CUTG.pm
BioPerl-1.6.923/Bio/DB/DBFetch.pm
BioPerl-1.6.923/Bio/DB/EMBL.pm
BioPerl-1.6.923/Bio/DB/EntrezGene.pm
BioPerl-1.6.923/Bio/DB/Expression.pm
BioPerl-1.6.923/Bio/DB/Failover.pm
BioPerl-1.6.923/Bio/DB/Fasta.pm
BioPerl-1.6.923/Bio/DB/FileCache.pm
BioPerl-1.6.923/Bio/DB/Flat.pm
BioPerl-1.6.923/Bio/DB/GenBank.pm
BioPerl-1.6.923/Bio/DB/GenericWebAgent.pm
BioPerl-1.6.923/Bio/DB/GenPept.pm
BioPerl-1.6.923/Bio/DB/GFF.pm
BioPerl-1.6.923/Bio/DB/HIV.pm
BioPerl-1.6.923/Bio/DB/IndexedBase.pm
BioPerl-1.6.923/Bio/DB/InMemoryCache.pm
BioPerl-1.6.923/Bio/DB/LocationI.pm
BioPerl-1.6.923/Bio/DB/MeSH.pm
BioPerl-1.6.923/Bio/DB/NCBIHelper.pm
BioPerl-1.6.923/Bio/DB/Qual.pm
BioPerl-1.6.923/Bio/DB/QueryI.pm
BioPerl-1.6.923/Bio/DB/RandomAccessI.pm
BioPerl-1.6.923/Bio/DB/ReferenceI.pm
BioPerl-1.6.923/Bio/DB/RefSeq.pm
BioPerl-1.6.923/Bio/DB/Registry.pm
BioPerl-1.6.923/Bio/DB/SeqFeature.pm
BioPerl-1.6.923/Bio/DB/SeqHound.pm
BioPerl-1.6.923/Bio/DB/SeqI.pm
BioPerl-1.6.923/Bio/DB/SeqVersion.pm
BioPerl-1.6.923/Bio/DB/SwissProt.pm
BioPerl-1.6.923/Bio/DB/Taxonomy.pm
BioPerl-1.6.923/Bio/DB/TFBS.pm
BioPerl-1.6.923/Bio/DB/Universal.pm
BioPerl-1.6.923/Bio/DB/UpdateableSeqI.pm
BioPerl-1.6.923/Bio/DB/WebDBSeqI.pm
BioPerl-1.6.923/Bio/DB/Expression
BioPerl-1.6.923/Bio/DB/Expression/geo.pm
BioPerl-1.6.923/Bio/DB/Flat
BioPerl-1.6.923/Bio/DB/Flat/BDB.pm
BioPerl-1.6.923/Bio/DB/Flat/BinarySearch.pm
BioPerl-1.6.923/Bio/DB/Flat/BDB
BioPerl-1.6.923/Bio/DB/Flat/BDB/embl.pm
BioPerl-1.6.923/Bio/DB/Flat/BDB/fasta.pm
BioPerl-1.6.923/Bio/DB/Flat/BDB/genbank.pm
BioPerl-1.6.923/Bio/DB/Flat/BDB/swiss.pm
BioPerl-1.6.923/Bio/DB/GFF
BioPerl-1.6.923/Bio/DB/GFF/Aggregator.pm
BioPerl-1.6.923/Bio/DB/GFF/Featname.pm
BioPerl-1.6.923/Bio/DB/GFF/Feature.pm
BioPerl-1.6.923/Bio/DB/GFF/Homol.pm
BioPerl-1.6.923/Bio/DB/GFF/RelSegment.pm
BioPerl-1.6.923/Bio/DB/GFF/Segment.pm
BioPerl-1.6.923/Bio/DB/GFF/Typename.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/ace.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/berkeleydb.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/biofetch.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/biofetch_oracle.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/berkeleydb
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/iterator.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysql.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/oracle.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/oracleace.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/pg.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm
BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory/iterator.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/alignment.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/clone.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/coding.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/gene.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/match.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/none.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/orf.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/processed_transcript.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/so_transcript.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/transcript.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_acembly.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_genscan.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_refgene.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_softberry.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm
BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_unigene.pm
BioPerl-1.6.923/Bio/DB/GFF/Util
BioPerl-1.6.923/Bio/DB/GFF/Util/Binning.pm
BioPerl-1.6.923/Bio/DB/GFF/Util/Rearrange.pm
BioPerl-1.6.923/Bio/DB/HIV
BioPerl-1.6.923/Bio/DB/HIV/HIVAnnotProcessor.pm
BioPerl-1.6.923/Bio/DB/HIV/HIVQueryHelper.pm
BioPerl-1.6.923/Bio/DB/HIV/lanl-schema.xml
BioPerl-1.6.923/Bio/DB/Query
BioPerl-1.6.923/Bio/DB/Query/GenBank.pm
BioPerl-1.6.923/Bio/DB/Query/HIVQuery.pm
BioPerl-1.6.923/Bio/DB/Query/WebQuery.pm
BioPerl-1.6.923/Bio/DB/SeqFeature
BioPerl-1.6.923/Bio/DB/SeqFeature/NormalizedFeature.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/NormalizedFeatureI.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Segment.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/bdb.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/berkeleydb.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/berkeleydb3.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/GFF2Loader.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/GFF3Loader.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/Loader.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/LoadHelper.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/memory.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/Iterator.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/mysql.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/Pg.pm
BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/SQLite.pm
BioPerl-1.6.923/Bio/DB/SeqVersion
BioPerl-1.6.923/Bio/DB/SeqVersion/gi.pm
BioPerl-1.6.923/Bio/DB/Taxonomy
BioPerl-1.6.923/Bio/DB/Taxonomy/entrez.pm
BioPerl-1.6.923/Bio/DB/Taxonomy/flatfile.pm
BioPerl-1.6.923/Bio/DB/Taxonomy/greengenes.pm
BioPerl-1.6.923/Bio/DB/Taxonomy/list.pm
BioPerl-1.6.923/Bio/DB/Taxonomy/silva.pm
BioPerl-1.6.923/Bio/DB/TFBS
BioPerl-1.6.923/Bio/DB/TFBS/transfac_pro.pm
BioPerl-1.6.923/Bio/Draw
BioPerl-1.6.923/Bio/Draw/Pictogram.pm
BioPerl-1.6.923/Bio/Event
BioPerl-1.6.923/Bio/Event/EventGeneratorI.pm
BioPerl-1.6.923/Bio/Event/EventHandlerI.pm
BioPerl-1.6.923/Bio/Factory
BioPerl-1.6.923/Bio/Factory/AnalysisI.pm
BioPerl-1.6.923/Bio/Factory/ApplicationFactoryI.pm
BioPerl-1.6.923/Bio/Factory/DriverFactory.pm
BioPerl-1.6.923/Bio/Factory/FTLocationFactory.pm
BioPerl-1.6.923/Bio/Factory/LocationFactoryI.pm
BioPerl-1.6.923/Bio/Factory/MapFactoryI.pm
BioPerl-1.6.923/Bio/Factory/ObjectBuilderI.pm
BioPerl-1.6.923/Bio/Factory/ObjectFactory.pm
BioPerl-1.6.923/Bio/Factory/ObjectFactoryI.pm
BioPerl-1.6.923/Bio/Factory/SeqAnalysisParserFactory.pm
BioPerl-1.6.923/Bio/Factory/SeqAnalysisParserFactoryI.pm
BioPerl-1.6.923/Bio/Factory/SequenceFactoryI.pm
BioPerl-1.6.923/Bio/Factory/SequenceProcessorI.pm
BioPerl-1.6.923/Bio/Factory/SequenceStreamI.pm
BioPerl-1.6.923/Bio/Factory/TreeFactoryI.pm
BioPerl-1.6.923/Bio/Index
BioPerl-1.6.923/Bio/Index/Abstract.pm
BioPerl-1.6.923/Bio/Index/AbstractSeq.pm
BioPerl-1.6.923/Bio/Index/Blast.pm
BioPerl-1.6.923/Bio/Index/BlastTable.pm
BioPerl-1.6.923/Bio/Index/EMBL.pm
BioPerl-1.6.923/Bio/Index/Fasta.pm
BioPerl-1.6.923/Bio/Index/Fastq.pm
BioPerl-1.6.923/Bio/Index/GenBank.pm
BioPerl-1.6.923/Bio/Index/Hmmer.pm
BioPerl-1.6.923/Bio/Index/Qual.pm
BioPerl-1.6.923/Bio/Index/Stockholm.pm
BioPerl-1.6.923/Bio/Index/SwissPfam.pm
BioPerl-1.6.923/Bio/Index/Swissprot.pm
BioPerl-1.6.923/Bio/LiveSeq
BioPerl-1.6.923/Bio/LiveSeq/AARange.pm
BioPerl-1.6.923/Bio/LiveSeq/Chain.pm
BioPerl-1.6.923/Bio/LiveSeq/ChainI.pm
BioPerl-1.6.923/Bio/LiveSeq/DNA.pm
BioPerl-1.6.923/Bio/LiveSeq/Exon.pm
BioPerl-1.6.923/Bio/LiveSeq/Gene.pm
BioPerl-1.6.923/Bio/LiveSeq/Intron.pm
BioPerl-1.6.923/Bio/LiveSeq/Mutation.pm
BioPerl-1.6.923/Bio/LiveSeq/Mutator.pm
BioPerl-1.6.923/Bio/LiveSeq/Prim_Transcript.pm
BioPerl-1.6.923/Bio/LiveSeq/Range.pm
BioPerl-1.6.923/Bio/LiveSeq/Repeat_Region.pm
BioPerl-1.6.923/Bio/LiveSeq/Repeat_Unit.pm
BioPerl-1.6.923/Bio/LiveSeq/SeqI.pm
BioPerl-1.6.923/Bio/LiveSeq/Transcript.pm
BioPerl-1.6.923/Bio/LiveSeq/Translation.pm
BioPerl-1.6.923/Bio/LiveSeq/IO
BioPerl-1.6.923/Bio/LiveSeq/IO/BioPerl.pm
BioPerl-1.6.923/Bio/LiveSeq/IO/Loader.pm
BioPerl-1.6.923/Bio/LiveSeq/IO/README
BioPerl-1.6.923/Bio/Location
BioPerl-1.6.923/Bio/Location/Atomic.pm
BioPerl-1.6.923/Bio/Location/AvWithinCoordPolicy.pm
BioPerl-1.6.923/Bio/Location/CoordinatePolicyI.pm
BioPerl-1.6.923/Bio/Location/Fuzzy.pm
BioPerl-1.6.923/Bio/Location/FuzzyLocationI.pm
BioPerl-1.6.923/Bio/Location/NarrowestCoordPolicy.pm
BioPerl-1.6.923/Bio/Location/Simple.pm
BioPerl-1.6.923/Bio/Location/Split.pm
BioPerl-1.6.923/Bio/Location/SplitLocationI.pm
BioPerl-1.6.923/Bio/Location/WidestCoordPolicy.pm
BioPerl-1.6.923/Bio/Map
BioPerl-1.6.923/Bio/Map/Clone.pm
BioPerl-1.6.923/Bio/Map/Contig.pm
BioPerl-1.6.923/Bio/Map/CytoMap.pm
BioPerl-1.6.923/Bio/Map/CytoMarker.pm
BioPerl-1.6.923/Bio/Map/CytoPosition.pm
BioPerl-1.6.923/Bio/Map/EntityI.pm
BioPerl-1.6.923/Bio/Map/FPCMarker.pm
BioPerl-1.6.923/Bio/Map/Gene.pm
BioPerl-1.6.923/Bio/Map/GeneMap.pm
BioPerl-1.6.923/Bio/Map/GenePosition.pm
BioPerl-1.6.923/Bio/Map/GeneRelative.pm
BioPerl-1.6.923/Bio/Map/LinkageMap.pm
BioPerl-1.6.923/Bio/Map/LinkagePosition.pm
BioPerl-1.6.923/Bio/Map/MapI.pm
BioPerl-1.6.923/Bio/Map/Mappable.pm
BioPerl-1.6.923/Bio/Map/MappableI.pm
BioPerl-1.6.923/Bio/Map/Marker.pm
BioPerl-1.6.923/Bio/Map/MarkerI.pm
BioPerl-1.6.923/Bio/Map/Microsatellite.pm
BioPerl-1.6.923/Bio/Map/OrderedPosition.pm
BioPerl-1.6.923/Bio/Map/OrderedPositionWithDistance.pm
BioPerl-1.6.923/Bio/Map/Physical.pm
BioPerl-1.6.923/Bio/Map/Position.pm
BioPerl-1.6.923/Bio/Map/PositionHandler.pm
BioPerl-1.6.923/Bio/Map/PositionHandlerI.pm
BioPerl-1.6.923/Bio/Map/PositionI.pm
BioPerl-1.6.923/Bio/Map/PositionWithSequence.pm
BioPerl-1.6.923/Bio/Map/Prediction.pm
BioPerl-1.6.923/Bio/Map/Relative.pm
BioPerl-1.6.923/Bio/Map/RelativeI.pm
BioPerl-1.6.923/Bio/Map/SimpleMap.pm
BioPerl-1.6.923/Bio/Map/TranscriptionFactor.pm
BioPerl-1.6.923/Bio/MapIO
BioPerl-1.6.923/Bio/MapIO/fpc.pm
BioPerl-1.6.923/Bio/MapIO/mapmaker.pm
BioPerl-1.6.923/Bio/Matrix
BioPerl-1.6.923/Bio/Matrix/Generic.pm
BioPerl-1.6.923/Bio/Matrix/IO.pm
BioPerl-1.6.923/Bio/Matrix/MatrixI.pm
BioPerl-1.6.923/Bio/Matrix/Mlagan.pm
BioPerl-1.6.923/Bio/Matrix/PhylipDist.pm
BioPerl-1.6.923/Bio/Matrix/Scoring.pm
BioPerl-1.6.923/Bio/Matrix/IO
BioPerl-1.6.923/Bio/Matrix/IO/mlagan.pm
BioPerl-1.6.923/Bio/Matrix/IO/phylip.pm
BioPerl-1.6.923/Bio/Matrix/IO/scoring.pm
BioPerl-1.6.923/Bio/Matrix/PSM
BioPerl-1.6.923/Bio/Matrix/PSM/InstanceSite.pm
BioPerl-1.6.923/Bio/Matrix/PSM/InstanceSiteI.pm
BioPerl-1.6.923/Bio/Matrix/PSM/IO.pm
BioPerl-1.6.923/Bio/Matrix/PSM/ProtMatrix.pm
BioPerl-1.6.923/Bio/Matrix/PSM/ProtPsm.pm
BioPerl-1.6.923/Bio/Matrix/PSM/Psm.pm
BioPerl-1.6.923/Bio/Matrix/PSM/PsmHeader.pm
BioPerl-1.6.923/Bio/Matrix/PSM/PsmHeaderI.pm
BioPerl-1.6.923/Bio/Matrix/PSM/PsmI.pm
BioPerl-1.6.923/Bio/Matrix/PSM/SiteMatrix.pm
BioPerl-1.6.923/Bio/Matrix/PSM/SiteMatrixI.pm
BioPerl-1.6.923/Bio/Matrix/PSM/IO
BioPerl-1.6.923/Bio/Matrix/PSM/IO/mast.pm
BioPerl-1.6.923/Bio/Matrix/PSM/IO/masta.pm
BioPerl-1.6.923/Bio/Matrix/PSM/IO/meme.pm
BioPerl-1.6.923/Bio/Matrix/PSM/IO/psiblast.pm
BioPerl-1.6.923/Bio/Matrix/PSM/IO/transfac.pm
BioPerl-1.6.923/Bio/MolEvol
BioPerl-1.6.923/Bio/MolEvol/CodonModel.pm
BioPerl-1.6.923/Bio/Nexml
BioPerl-1.6.923/Bio/Nexml/Factory.pm
BioPerl-1.6.923/Bio/Ontology
BioPerl-1.6.923/Bio/Ontology/DocumentRegistry.pm
BioPerl-1.6.923/Bio/Ontology/GOterm.pm
BioPerl-1.6.923/Bio/Ontology/InterProTerm.pm
BioPerl-1.6.923/Bio/Ontology/OBOEngine.pm
BioPerl-1.6.923/Bio/Ontology/OBOterm.pm
BioPerl-1.6.923/Bio/Ontology/Ontology.pm
BioPerl-1.6.923/Bio/Ontology/OntologyEngineI.pm
BioPerl-1.6.923/Bio/Ontology/OntologyI.pm
BioPerl-1.6.923/Bio/Ontology/OntologyStore.pm
BioPerl-1.6.923/Bio/Ontology/Path.pm
BioPerl-1.6.923/Bio/Ontology/PathI.pm
BioPerl-1.6.923/Bio/Ontology/Relationship.pm
BioPerl-1.6.923/Bio/Ontology/RelationshipFactory.pm
BioPerl-1.6.923/Bio/Ontology/RelationshipI.pm
BioPerl-1.6.923/Bio/Ontology/RelationshipType.pm
BioPerl-1.6.923/Bio/Ontology/SimpleOntologyEngine.pm
BioPerl-1.6.923/Bio/Ontology/Term.pm
BioPerl-1.6.923/Bio/Ontology/TermFactory.pm
BioPerl-1.6.923/Bio/Ontology/TermI.pm
BioPerl-1.6.923/Bio/Ontology/SimpleGOEngine
BioPerl-1.6.923/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
BioPerl-1.6.923/Bio/OntologyIO
BioPerl-1.6.923/Bio/OntologyIO/dagflat.pm
BioPerl-1.6.923/Bio/OntologyIO/goflat.pm
BioPerl-1.6.923/Bio/OntologyIO/InterProParser.pm
BioPerl-1.6.923/Bio/OntologyIO/obo.pm
BioPerl-1.6.923/Bio/OntologyIO/simplehierarchy.pm
BioPerl-1.6.923/Bio/OntologyIO/soflat.pm
BioPerl-1.6.923/Bio/OntologyIO/Handlers
BioPerl-1.6.923/Bio/OntologyIO/Handlers/BaseSAXHandler.pm
BioPerl-1.6.923/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
BioPerl-1.6.923/Bio/OntologyIO/Handlers/InterProHandler.pm
BioPerl-1.6.923/Bio/Phenotype
BioPerl-1.6.923/Bio/Phenotype/Correlate.pm
BioPerl-1.6.923/Bio/Phenotype/Measure.pm
BioPerl-1.6.923/Bio/Phenotype/Phenotype.pm
BioPerl-1.6.923/Bio/Phenotype/PhenotypeI.pm
BioPerl-1.6.923/Bio/Phenotype/MeSH
BioPerl-1.6.923/Bio/Phenotype/MeSH/Term.pm
BioPerl-1.6.923/Bio/Phenotype/MeSH/Twig.pm
BioPerl-1.6.923/Bio/Phenotype/OMIM
BioPerl-1.6.923/Bio/Phenotype/OMIM/MiniMIMentry.pm
BioPerl-1.6.923/Bio/Phenotype/OMIM/OMIMentry.pm
BioPerl-1.6.923/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm
BioPerl-1.6.923/Bio/Phenotype/OMIM/OMIMparser.pm
BioPerl-1.6.923/Bio/PhyloNetwork
BioPerl-1.6.923/Bio/PhyloNetwork/Factory.pm
BioPerl-1.6.923/Bio/PhyloNetwork/FactoryX.pm
BioPerl-1.6.923/Bio/PhyloNetwork/GraphViz.pm
BioPerl-1.6.923/Bio/PhyloNetwork/muVector.pm
BioPerl-1.6.923/Bio/PhyloNetwork/RandomFactory.pm
BioPerl-1.6.923/Bio/PhyloNetwork/TreeFactory.pm
BioPerl-1.6.923/Bio/PhyloNetwork/TreeFactoryMulti.pm
BioPerl-1.6.923/Bio/PhyloNetwork/TreeFactoryX.pm
BioPerl-1.6.923/Bio/PopGen
BioPerl-1.6.923/Bio/PopGen/Genotype.pm
BioPerl-1.6.923/Bio/PopGen/GenotypeI.pm
BioPerl-1.6.923/Bio/PopGen/HtSNP.pm
BioPerl-1.6.923/Bio/PopGen/Individual.pm
BioPerl-1.6.923/Bio/PopGen/IndividualI.pm
BioPerl-1.6.923/Bio/PopGen/IO.pm
BioPerl-1.6.923/Bio/PopGen/Marker.pm
BioPerl-1.6.923/Bio/PopGen/MarkerI.pm
BioPerl-1.6.923/Bio/PopGen/PopStats.pm
BioPerl-1.6.923/Bio/PopGen/Population.pm
BioPerl-1.6.923/Bio/PopGen/PopulationI.pm
BioPerl-1.6.923/Bio/PopGen/Statistics.pm
BioPerl-1.6.923/Bio/PopGen/TagHaplotype.pm
BioPerl-1.6.923/Bio/PopGen/Utilities.pm
BioPerl-1.6.923/Bio/PopGen/IO
BioPerl-1.6.923/Bio/PopGen/IO/csv.pm
BioPerl-1.6.923/Bio/PopGen/IO/hapmap.pm
BioPerl-1.6.923/Bio/PopGen/IO/phase.pm
BioPerl-1.6.923/Bio/PopGen/IO/prettybase.pm
BioPerl-1.6.923/Bio/PopGen/Simulation
BioPerl-1.6.923/Bio/PopGen/Simulation/Coalescent.pm
BioPerl-1.6.923/Bio/PopGen/Simulation/GeneticDrift.pm
BioPerl-1.6.923/Bio/Restriction
BioPerl-1.6.923/Bio/Restriction/Analysis.pm
BioPerl-1.6.923/Bio/Restriction/Enzyme.pm
BioPerl-1.6.923/Bio/Restriction/EnzymeCollection.pm
BioPerl-1.6.923/Bio/Restriction/EnzymeI.pm
BioPerl-1.6.923/Bio/Restriction/IO.pm
BioPerl-1.6.923/Bio/Restriction/Enzyme
BioPerl-1.6.923/Bio/Restriction/Enzyme/MultiCut.pm
BioPerl-1.6.923/Bio/Restriction/Enzyme/MultiSite.pm
BioPerl-1.6.923/Bio/Restriction/IO
BioPerl-1.6.923/Bio/Restriction/IO/bairoch.pm
BioPerl-1.6.923/Bio/Restriction/IO/base.pm
BioPerl-1.6.923/Bio/Restriction/IO/itype2.pm
BioPerl-1.6.923/Bio/Restriction/IO/prototype.pm
BioPerl-1.6.923/Bio/Restriction/IO/withrefm.pm
BioPerl-1.6.923/Bio/Root
BioPerl-1.6.923/Bio/Root/Build.pm
BioPerl-1.6.923/Bio/Root/Exception.pm
BioPerl-1.6.923/Bio/Root/HTTPget.pm
BioPerl-1.6.923/Bio/Root/IO.pm
BioPerl-1.6.923/Bio/Root/Root.pm
BioPerl-1.6.923/Bio/Root/RootI.pm
BioPerl-1.6.923/Bio/Root/Storable.pm
BioPerl-1.6.923/Bio/Root/Test.pm
BioPerl-1.6.923/Bio/Root/Utilities.pm
BioPerl-1.6.923/Bio/Root/Version.pm
BioPerl-1.6.923/Bio/Search
BioPerl-1.6.923/Bio/Search/BlastStatistics.pm
BioPerl-1.6.923/Bio/Search/BlastUtils.pm
BioPerl-1.6.923/Bio/Search/DatabaseI.pm
BioPerl-1.6.923/Bio/Search/GenericDatabase.pm
BioPerl-1.6.923/Bio/Search/GenericStatistics.pm
BioPerl-1.6.923/Bio/Search/Processor.pm
BioPerl-1.6.923/Bio/Search/SearchUtils.pm
BioPerl-1.6.923/Bio/Search/StatisticsI.pm
BioPerl-1.6.923/Bio/Search/Hit
BioPerl-1.6.923/Bio/Search/Hit/BlastHit.pm
BioPerl-1.6.923/Bio/Search/Hit/BlastPullHit.pm
BioPerl-1.6.923/Bio/Search/Hit/Fasta.pm
BioPerl-1.6.923/Bio/Search/Hit/GenericHit.pm
BioPerl-1.6.923/Bio/Search/Hit/HitFactory.pm
BioPerl-1.6.923/Bio/Search/Hit/HitI.pm
BioPerl-1.6.923/Bio/Search/Hit/hmmer3Hit.pm
BioPerl-1.6.923/Bio/Search/Hit/HMMERHit.pm
BioPerl-1.6.923/Bio/Search/Hit/HmmpfamHit.pm
BioPerl-1.6.923/Bio/Search/Hit/ModelHit.pm
BioPerl-1.6.923/Bio/Search/Hit/PsiBlastHit.pm
BioPerl-1.6.923/Bio/Search/Hit/PullHitI.pm
BioPerl-1.6.923/Bio/Search/HSP
BioPerl-1.6.923/Bio/Search/HSP/BlastHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/BlastPullHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/FastaHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/GenericHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/HMMERHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/HmmpfamHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/HSPFactory.pm
BioPerl-1.6.923/Bio/Search/HSP/HSPI.pm
BioPerl-1.6.923/Bio/Search/HSP/ModelHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/PsiBlastHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/PSLHSP.pm
BioPerl-1.6.923/Bio/Search/HSP/PullHSPI.pm
BioPerl-1.6.923/Bio/Search/HSP/WABAHSP.pm
BioPerl-1.6.923/Bio/Search/Iteration
BioPerl-1.6.923/Bio/Search/Iteration/GenericIteration.pm
BioPerl-1.6.923/Bio/Search/Iteration/IterationI.pm
BioPerl-1.6.923/Bio/Search/Result
BioPerl-1.6.923/Bio/Search/Result/BlastPullResult.pm
BioPerl-1.6.923/Bio/Search/Result/BlastResult.pm
BioPerl-1.6.923/Bio/Search/Result/CrossMatchResult.pm
BioPerl-1.6.923/Bio/Search/Result/GenericResult.pm
BioPerl-1.6.923/Bio/Search/Result/hmmer3Result.pm
BioPerl-1.6.923/Bio/Search/Result/HMMERResult.pm
BioPerl-1.6.923/Bio/Search/Result/HmmpfamResult.pm
BioPerl-1.6.923/Bio/Search/Result/PullResultI.pm
BioPerl-1.6.923/Bio/Search/Result/ResultFactory.pm
BioPerl-1.6.923/Bio/Search/Result/ResultI.pm
BioPerl-1.6.923/Bio/Search/Result/WABAResult.pm
BioPerl-1.6.923/Bio/Search/Tiling
BioPerl-1.6.923/Bio/Search/Tiling/MapTileUtils.pm
BioPerl-1.6.923/Bio/Search/Tiling/MapTiling.pm
BioPerl-1.6.923/Bio/Search/Tiling/TilingI.pm
BioPerl-1.6.923/Bio/SearchIO
BioPerl-1.6.923/Bio/SearchIO/axt.pm
BioPerl-1.6.923/Bio/SearchIO/blast.pm
BioPerl-1.6.923/Bio/SearchIO/blast_pull.pm
BioPerl-1.6.923/Bio/SearchIO/blasttable.pm
BioPerl-1.6.923/Bio/SearchIO/blastxml.pm
BioPerl-1.6.923/Bio/SearchIO/cross_match.pm
BioPerl-1.6.923/Bio/SearchIO/erpin.pm
BioPerl-1.6.923/Bio/SearchIO/EventHandlerI.pm
BioPerl-1.6.923/Bio/SearchIO/exonerate.pm
BioPerl-1.6.923/Bio/SearchIO/fasta.pm
BioPerl-1.6.923/Bio/SearchIO/FastHitEventBuilder.pm
BioPerl-1.6.923/Bio/SearchIO/gmap_f9.pm
BioPerl-1.6.923/Bio/SearchIO/hmmer.pm
BioPerl-1.6.923/Bio/SearchIO/hmmer2.pm
BioPerl-1.6.923/Bio/SearchIO/hmmer3.pm
BioPerl-1.6.923/Bio/SearchIO/hmmer_pull.pm
BioPerl-1.6.923/Bio/SearchIO/infernal.pm
BioPerl-1.6.923/Bio/SearchIO/IteratedSearchResultEventBuilder.pm
BioPerl-1.6.923/Bio/SearchIO/megablast.pm
BioPerl-1.6.923/Bio/SearchIO/psl.pm
BioPerl-1.6.923/Bio/SearchIO/rnamotif.pm
BioPerl-1.6.923/Bio/SearchIO/SearchResultEventBuilder.pm
BioPerl-1.6.923/Bio/SearchIO/SearchWriterI.pm
BioPerl-1.6.923/Bio/SearchIO/sim4.pm
BioPerl-1.6.923/Bio/SearchIO/waba.pm
BioPerl-1.6.923/Bio/SearchIO/wise.pm
BioPerl-1.6.923/Bio/SearchIO/Writer
BioPerl-1.6.923/Bio/SearchIO/Writer/BSMLResultWriter.pm
BioPerl-1.6.923/Bio/SearchIO/Writer/GbrowseGFF.pm
BioPerl-1.6.923/Bio/SearchIO/Writer/HitTableWriter.pm
BioPerl-1.6.923/Bio/SearchIO/Writer/HSPTableWriter.pm
BioPerl-1.6.923/Bio/SearchIO/Writer/HTMLResultWriter.pm
BioPerl-1.6.923/Bio/SearchIO/Writer/ResultTableWriter.pm
BioPerl-1.6.923/Bio/SearchIO/Writer/TextResultWriter.pm
BioPerl-1.6.923/Bio/SearchIO/XML
BioPerl-1.6.923/Bio/SearchIO/XML/BlastHandler.pm
BioPerl-1.6.923/Bio/SearchIO/XML/PsiBlastHandler.pm
BioPerl-1.6.923/Bio/Seq
BioPerl-1.6.923/Bio/Seq/BaseSeqProcessor.pm
BioPerl-1.6.923/Bio/Seq/EncodedSeq.pm
BioPerl-1.6.923/Bio/Seq/LargeLocatableSeq.pm
BioPerl-1.6.923/Bio/Seq/LargePrimarySeq.pm
BioPerl-1.6.923/Bio/Seq/LargeSeq.pm
BioPerl-1.6.923/Bio/Seq/LargeSeqI.pm
BioPerl-1.6.923/Bio/Seq/Meta.pm
BioPerl-1.6.923/Bio/Seq/MetaI.pm
BioPerl-1.6.923/Bio/Seq/PrimaryQual.pm
BioPerl-1.6.923/Bio/Seq/PrimedSeq.pm
BioPerl-1.6.923/Bio/Seq/QualI.pm
BioPerl-1.6.923/Bio/Seq/Quality.pm
BioPerl-1.6.923/Bio/Seq/RichSeq.pm
BioPerl-1.6.923/Bio/Seq/RichSeqI.pm
BioPerl-1.6.923/Bio/Seq/SeqBuilder.pm
BioPerl-1.6.923/Bio/Seq/SeqFactory.pm
BioPerl-1.6.923/Bio/Seq/SeqFastaSpeedFactory.pm
BioPerl-1.6.923/Bio/Seq/SequenceTrace.pm
BioPerl-1.6.923/Bio/Seq/SeqWithQuality.pm
BioPerl-1.6.923/Bio/Seq/SimulatedRead.pm
BioPerl-1.6.923/Bio/Seq/TraceI.pm
BioPerl-1.6.923/Bio/Seq/Meta
BioPerl-1.6.923/Bio/Seq/Meta/Array.pm
BioPerl-1.6.923/Bio/SeqEvolution
BioPerl-1.6.923/Bio/SeqEvolution/DNAPoint.pm
BioPerl-1.6.923/Bio/SeqEvolution/EvolutionI.pm
BioPerl-1.6.923/Bio/SeqEvolution/Factory.pm
BioPerl-1.6.923/Bio/SeqFeature
BioPerl-1.6.923/Bio/SeqFeature/Amplicon.pm
BioPerl-1.6.923/Bio/SeqFeature/AnnotationAdaptor.pm
BioPerl-1.6.923/Bio/SeqFeature/Collection.pm
BioPerl-1.6.923/Bio/SeqFeature/CollectionI.pm
BioPerl-1.6.923/Bio/SeqFeature/Computation.pm
BioPerl-1.6.923/Bio/SeqFeature/FeaturePair.pm
BioPerl-1.6.923/Bio/SeqFeature/Generic.pm
BioPerl-1.6.923/Bio/SeqFeature/Lite.pm
BioPerl-1.6.923/Bio/SeqFeature/PositionProxy.pm
BioPerl-1.6.923/Bio/SeqFeature/Primer.pm
BioPerl-1.6.923/Bio/SeqFeature/Similarity.pm
BioPerl-1.6.923/Bio/SeqFeature/SimilarityPair.pm
BioPerl-1.6.923/Bio/SeqFeature/SubSeq.pm
BioPerl-1.6.923/Bio/SeqFeature/TypedSeqFeatureI.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene
BioPerl-1.6.923/Bio/SeqFeature/Gene/Exon.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/ExonI.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/GeneStructure.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/GeneStructureI.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/Intron.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/NC_Feature.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/Poly_A_site.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/Promoter.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/Transcript.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/TranscriptI.pm
BioPerl-1.6.923/Bio/SeqFeature/Gene/UTR.pm
BioPerl-1.6.923/Bio/SeqFeature/SiRNA
BioPerl-1.6.923/Bio/SeqFeature/SiRNA/Oligo.pm
BioPerl-1.6.923/Bio/SeqFeature/SiRNA/Pair.pm
BioPerl-1.6.923/Bio/SeqFeature/Tools
BioPerl-1.6.923/Bio/SeqFeature/Tools/FeatureNamer.pm
BioPerl-1.6.923/Bio/SeqFeature/Tools/IDHandler.pm
BioPerl-1.6.923/Bio/SeqFeature/Tools/TypeMapper.pm
BioPerl-1.6.923/Bio/SeqFeature/Tools/Unflattener.pm
BioPerl-1.6.923/Bio/SeqIO
BioPerl-1.6.923/Bio/SeqIO/abi.pm
BioPerl-1.6.923/Bio/SeqIO/ace.pm
BioPerl-1.6.923/Bio/SeqIO/agave.pm
BioPerl-1.6.923/Bio/SeqIO/alf.pm
BioPerl-1.6.923/Bio/SeqIO/asciitree.pm
BioPerl-1.6.923/Bio/SeqIO/bsml.pm
BioPerl-1.6.923/Bio/SeqIO/bsml_sax.pm
BioPerl-1.6.923/Bio/SeqIO/chadoxml.pm
BioPerl-1.6.923/Bio/SeqIO/chaos.pm
BioPerl-1.6.923/Bio/SeqIO/chaosxml.pm
BioPerl-1.6.923/Bio/SeqIO/ctf.pm
BioPerl-1.6.923/Bio/SeqIO/embl.pm
BioPerl-1.6.923/Bio/SeqIO/embldriver.pm
BioPerl-1.6.923/Bio/SeqIO/entrezgene.pm
BioPerl-1.6.923/Bio/SeqIO/excel.pm
BioPerl-1.6.923/Bio/SeqIO/exp.pm
BioPerl-1.6.923/Bio/SeqIO/fasta.pm
BioPerl-1.6.923/Bio/SeqIO/fastq.pm
BioPerl-1.6.923/Bio/SeqIO/flybase_chadoxml.pm
BioPerl-1.6.923/Bio/SeqIO/FTHelper.pm
BioPerl-1.6.923/Bio/SeqIO/game.pm
BioPerl-1.6.923/Bio/SeqIO/gbdriver.pm
BioPerl-1.6.923/Bio/SeqIO/gbxml.pm
BioPerl-1.6.923/Bio/SeqIO/gcg.pm
BioPerl-1.6.923/Bio/SeqIO/genbank.pm
BioPerl-1.6.923/Bio/SeqIO/interpro.pm
BioPerl-1.6.923/Bio/SeqIO/kegg.pm
BioPerl-1.6.923/Bio/SeqIO/largefasta.pm
BioPerl-1.6.923/Bio/SeqIO/lasergene.pm
BioPerl-1.6.923/Bio/SeqIO/locuslink.pm
BioPerl-1.6.923/Bio/SeqIO/mbsout.pm
BioPerl-1.6.923/Bio/SeqIO/metafasta.pm
BioPerl-1.6.923/Bio/SeqIO/msout.pm
BioPerl-1.6.923/Bio/SeqIO/MultiFile.pm
BioPerl-1.6.923/Bio/SeqIO/nexml.pm
BioPerl-1.6.923/Bio/SeqIO/phd.pm
BioPerl-1.6.923/Bio/SeqIO/pir.pm
BioPerl-1.6.923/Bio/SeqIO/pln.pm
BioPerl-1.6.923/Bio/SeqIO/qual.pm
BioPerl-1.6.923/Bio/SeqIO/raw.pm
BioPerl-1.6.923/Bio/SeqIO/scf.pm
BioPerl-1.6.923/Bio/SeqIO/seqxml.pm
BioPerl-1.6.923/Bio/SeqIO/strider.pm
BioPerl-1.6.923/Bio/SeqIO/swiss.pm
BioPerl-1.6.923/Bio/SeqIO/swissdriver.pm
BioPerl-1.6.923/Bio/SeqIO/tab.pm
BioPerl-1.6.923/Bio/SeqIO/table.pm
BioPerl-1.6.923/Bio/SeqIO/tigr.pm
BioPerl-1.6.923/Bio/SeqIO/tigrxml.pm
BioPerl-1.6.923/Bio/SeqIO/tinyseq.pm
BioPerl-1.6.923/Bio/SeqIO/ztr.pm
BioPerl-1.6.923/Bio/SeqIO/game
BioPerl-1.6.923/Bio/SeqIO/game/featHandler.pm
BioPerl-1.6.923/Bio/SeqIO/game/gameHandler.pm
BioPerl-1.6.923/Bio/SeqIO/game/gameSubs.pm
BioPerl-1.6.923/Bio/SeqIO/game/gameWriter.pm
BioPerl-1.6.923/Bio/SeqIO/game/seqHandler.pm
BioPerl-1.6.923/Bio/SeqIO/Handler
BioPerl-1.6.923/Bio/SeqIO/Handler/GenericRichSeqHandler.pm
BioPerl-1.6.923/Bio/SeqIO/tinyseq
BioPerl-1.6.923/Bio/SeqIO/tinyseq/tinyseqHandler.pm
BioPerl-1.6.923/Bio/Structure
BioPerl-1.6.923/Bio/Structure/Atom.pm
BioPerl-1.6.923/Bio/Structure/Chain.pm
BioPerl-1.6.923/Bio/Structure/Entry.pm
BioPerl-1.6.923/Bio/Structure/IO.pm
BioPerl-1.6.923/Bio/Structure/Model.pm
BioPerl-1.6.923/Bio/Structure/Residue.pm
BioPerl-1.6.923/Bio/Structure/StructureI.pm
BioPerl-1.6.923/Bio/Structure/IO
BioPerl-1.6.923/Bio/Structure/IO/pdb.pm
BioPerl-1.6.923/Bio/Structure/SecStr
BioPerl-1.6.923/Bio/Structure/SecStr/DSSP
BioPerl-1.6.923/Bio/Structure/SecStr/DSSP/Res.pm
BioPerl-1.6.923/Bio/Structure/SecStr/STRIDE
BioPerl-1.6.923/Bio/Structure/SecStr/STRIDE/Res.pm
BioPerl-1.6.923/Bio/Symbol
BioPerl-1.6.923/Bio/Symbol/Alphabet.pm
BioPerl-1.6.923/Bio/Symbol/AlphabetI.pm
BioPerl-1.6.923/Bio/Symbol/DNAAlphabet.pm
BioPerl-1.6.923/Bio/Symbol/ProteinAlphabet.pm
BioPerl-1.6.923/Bio/Symbol/README.Symbol
BioPerl-1.6.923/Bio/Symbol/Symbol.pm
BioPerl-1.6.923/Bio/Symbol/SymbolI.pm
BioPerl-1.6.923/Bio/Taxonomy
BioPerl-1.6.923/Bio/Taxonomy/FactoryI.pm
BioPerl-1.6.923/Bio/Taxonomy/Node.pm
BioPerl-1.6.923/Bio/Taxonomy/Taxon.pm
BioPerl-1.6.923/Bio/Taxonomy/Tree.pm
BioPerl-1.6.923/Bio/Tools
BioPerl-1.6.923/Bio/Tools/AlignFactory.pm
BioPerl-1.6.923/Bio/Tools/AmpliconSearch.pm
BioPerl-1.6.923/Bio/Tools/AnalysisResult.pm
BioPerl-1.6.923/Bio/Tools/Blat.pm
BioPerl-1.6.923/Bio/Tools/CodonTable.pm
BioPerl-1.6.923/Bio/Tools/Coil.pm
BioPerl-1.6.923/Bio/Tools/dpAlign.pm
BioPerl-1.6.923/Bio/Tools/ECnumber.pm
BioPerl-1.6.923/Bio/Tools/EPCR.pm
BioPerl-1.6.923/Bio/Tools/Eponine.pm
BioPerl-1.6.923/Bio/Tools/ERPIN.pm
BioPerl-1.6.923/Bio/Tools/Est2Genome.pm
BioPerl-1.6.923/Bio/Tools/ESTScan.pm
BioPerl-1.6.923/Bio/Tools/Fgenesh.pm
BioPerl-1.6.923/Bio/Tools/FootPrinter.pm
BioPerl-1.6.923/Bio/Tools/Gel.pm
BioPerl-1.6.923/Bio/Tools/Geneid.pm
BioPerl-1.6.923/Bio/Tools/Genemark.pm
BioPerl-1.6.923/Bio/Tools/Genewise.pm
BioPerl-1.6.923/Bio/Tools/Genomewise.pm
BioPerl-1.6.923/Bio/Tools/Genscan.pm
BioPerl-1.6.923/Bio/Tools/GFF.pm
BioPerl-1.6.923/Bio/Tools/Glimmer.pm
BioPerl-1.6.923/Bio/Tools/Grail.pm
BioPerl-1.6.923/Bio/Tools/GuessSeqFormat.pm
BioPerl-1.6.923/Bio/Tools/Hmmpfam.pm
BioPerl-1.6.923/Bio/Tools/Infernal.pm
BioPerl-1.6.923/Bio/Tools/ipcress.pm
BioPerl-1.6.923/Bio/Tools/isPcr.pm
BioPerl-1.6.923/Bio/Tools/IUPAC.pm
BioPerl-1.6.923/Bio/Tools/Lucy.pm
BioPerl-1.6.923/Bio/Tools/Match.pm
BioPerl-1.6.923/Bio/Tools/MZEF.pm
BioPerl-1.6.923/Bio/Tools/OddCodes.pm
BioPerl-1.6.923/Bio/Tools/pICalculator.pm
BioPerl-1.6.923/Bio/Tools/Primer3.pm
BioPerl-1.6.923/Bio/Tools/Prints.pm
BioPerl-1.6.923/Bio/Tools/Profile.pm
BioPerl-1.6.923/Bio/Tools/Promoterwise.pm
BioPerl-1.6.923/Bio/Tools/PrositeScan.pm
BioPerl-1.6.923/Bio/Tools/Protparam.pm
BioPerl-1.6.923/Bio/Tools/Pseudowise.pm
BioPerl-1.6.923/Bio/Tools/pSW.pm
BioPerl-1.6.923/Bio/Tools/QRNA.pm
BioPerl-1.6.923/Bio/Tools/RandomDistFunctions.pm
BioPerl-1.6.923/Bio/Tools/RepeatMasker.pm
BioPerl-1.6.923/Bio/Tools/RNAMotif.pm
BioPerl-1.6.923/Bio/Tools/Seg.pm
BioPerl-1.6.923/Bio/Tools/SeqPattern.pm
BioPerl-1.6.923/Bio/Tools/SeqStats.pm
BioPerl-1.6.923/Bio/Tools/SeqWords.pm
BioPerl-1.6.923/Bio/Tools/Sigcleave.pm
BioPerl-1.6.923/Bio/Tools/Signalp.pm
BioPerl-1.6.923/Bio/Tools/SiRNA.pm
BioPerl-1.6.923/Bio/Tools/TandemRepeatsFinder.pm
BioPerl-1.6.923/Bio/Tools/TargetP.pm
BioPerl-1.6.923/Bio/Tools/Tmhmm.pm
BioPerl-1.6.923/Bio/Tools/tRNAscanSE.pm
BioPerl-1.6.923/Bio/Tools/Alignment
BioPerl-1.6.923/Bio/Tools/Alignment/Consed.pm
BioPerl-1.6.923/Bio/Tools/Alignment/Trim.pm
BioPerl-1.6.923/Bio/Tools/Analysis
BioPerl-1.6.923/Bio/Tools/Analysis/SimpleAnalysisBase.pm
BioPerl-1.6.923/Bio/Tools/Analysis/DNA
BioPerl-1.6.923/Bio/Tools/Analysis/DNA/ESEfinder.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Domcut.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/ELM.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/GOR4.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/HNN.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Mitoprot.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/NetPhos.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Scansite.pm
BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Sopma.pm
BioPerl-1.6.923/Bio/Tools/EMBOSS
BioPerl-1.6.923/Bio/Tools/EMBOSS/Palindrome.pm
BioPerl-1.6.923/Bio/Tools/HMMER
BioPerl-1.6.923/Bio/Tools/HMMER/Domain.pm
BioPerl-1.6.923/Bio/Tools/HMMER/Results.pm
BioPerl-1.6.923/Bio/Tools/HMMER/Set.pm
BioPerl-1.6.923/Bio/Tools/Phylo
BioPerl-1.6.923/Bio/Tools/Phylo/Gerp.pm
BioPerl-1.6.923/Bio/Tools/Phylo/Gumby.pm
BioPerl-1.6.923/Bio/Tools/Phylo/Molphy.pm
BioPerl-1.6.923/Bio/Tools/Phylo/PAML.pm
BioPerl-1.6.923/Bio/Tools/Phylo/Molphy
BioPerl-1.6.923/Bio/Tools/Phylo/Molphy/Result.pm
BioPerl-1.6.923/Bio/Tools/Phylo/PAML
BioPerl-1.6.923/Bio/Tools/Phylo/PAML/Codeml.pm
BioPerl-1.6.923/Bio/Tools/Phylo/PAML/ModelResult.pm
BioPerl-1.6.923/Bio/Tools/Phylo/PAML/Result.pm
BioPerl-1.6.923/Bio/Tools/Phylo/Phylip
BioPerl-1.6.923/Bio/Tools/Phylo/Phylip/ProtDist.pm
BioPerl-1.6.923/Bio/Tools/Prediction
BioPerl-1.6.923/Bio/Tools/Prediction/Exon.pm
BioPerl-1.6.923/Bio/Tools/Prediction/Gene.pm
BioPerl-1.6.923/Bio/Tools/Primer
BioPerl-1.6.923/Bio/Tools/Primer/AssessorI.pm
BioPerl-1.6.923/Bio/Tools/Primer/Feature.pm
BioPerl-1.6.923/Bio/Tools/Primer/Pair.pm
BioPerl-1.6.923/Bio/Tools/Primer/Assessor
BioPerl-1.6.923/Bio/Tools/Primer/Assessor/Base.pm
BioPerl-1.6.923/Bio/Tools/Run
BioPerl-1.6.923/Bio/Tools/Run/GenericParameters.pm
BioPerl-1.6.923/Bio/Tools/Run/hmmer3.pm
BioPerl-1.6.923/Bio/Tools/Run/ParametersI.pm
BioPerl-1.6.923/Bio/Tools/Run/README
BioPerl-1.6.923/Bio/Tools/Run/RemoteBlast.pm
BioPerl-1.6.923/Bio/Tools/Run/StandAloneBlast.pm
BioPerl-1.6.923/Bio/Tools/Run/StandAloneNCBIBlast.pm
BioPerl-1.6.923/Bio/Tools/Run/StandAloneWUBlast.pm
BioPerl-1.6.923/Bio/Tools/Run/WrapperBase.pm
BioPerl-1.6.923/Bio/Tools/Run/WrapperBase
BioPerl-1.6.923/Bio/Tools/Run/WrapperBase/CommandExts.pm
BioPerl-1.6.923/Bio/Tools/SeqPattern
BioPerl-1.6.923/Bio/Tools/SeqPattern/Backtranslate.pm
BioPerl-1.6.923/Bio/Tools/Signalp
BioPerl-1.6.923/Bio/Tools/Signalp/ExtendedSignalp.pm
BioPerl-1.6.923/Bio/Tools/Sim4
BioPerl-1.6.923/Bio/Tools/Sim4/Exon.pm
BioPerl-1.6.923/Bio/Tools/Sim4/Results.pm
BioPerl-1.6.923/Bio/Tools/SiRNA
BioPerl-1.6.923/Bio/Tools/SiRNA/Ruleset
BioPerl-1.6.923/Bio/Tools/SiRNA/Ruleset/saigo.pm
BioPerl-1.6.923/Bio/Tools/SiRNA/Ruleset/tuschl.pm
BioPerl-1.6.923/Bio/Tools/Spidey
BioPerl-1.6.923/Bio/Tools/Spidey/Exon.pm
BioPerl-1.6.923/Bio/Tools/Spidey/Results.pm
BioPerl-1.6.923/Bio/Tree
BioPerl-1.6.923/Bio/Tree/AlleleNode.pm
BioPerl-1.6.923/Bio/Tree/AnnotatableNode.pm
BioPerl-1.6.923/Bio/Tree/Compatible.pm
BioPerl-1.6.923/Bio/Tree/DistanceFactory.pm
BioPerl-1.6.923/Bio/Tree/Node.pm
BioPerl-1.6.923/Bio/Tree/NodeI.pm
BioPerl-1.6.923/Bio/Tree/NodeNHX.pm
BioPerl-1.6.923/Bio/Tree/RandomFactory.pm
BioPerl-1.6.923/Bio/Tree/Statistics.pm
BioPerl-1.6.923/Bio/Tree/Tree.pm
BioPerl-1.6.923/Bio/Tree/TreeFunctionsI.pm
BioPerl-1.6.923/Bio/Tree/TreeI.pm
BioPerl-1.6.923/Bio/Tree/Draw
BioPerl-1.6.923/Bio/Tree/Draw/Cladogram.pm
BioPerl-1.6.923/Bio/TreeIO
BioPerl-1.6.923/Bio/TreeIO/cluster.pm
BioPerl-1.6.923/Bio/TreeIO/lintree.pm
BioPerl-1.6.923/Bio/TreeIO/newick.pm
BioPerl-1.6.923/Bio/TreeIO/NewickParser.pm
BioPerl-1.6.923/Bio/TreeIO/nexml.pm
BioPerl-1.6.923/Bio/TreeIO/nexus.pm
BioPerl-1.6.923/Bio/TreeIO/nhx.pm
BioPerl-1.6.923/Bio/TreeIO/pag.pm
BioPerl-1.6.923/Bio/TreeIO/phyloxml.pm
BioPerl-1.6.923/Bio/TreeIO/svggraph.pm
BioPerl-1.6.923/Bio/TreeIO/tabtree.pm
BioPerl-1.6.923/Bio/TreeIO/TreeEventBuilder.pm
BioPerl-1.6.923/Bio/Variation
BioPerl-1.6.923/Bio/Variation/AAChange.pm
BioPerl-1.6.923/Bio/Variation/AAReverseMutate.pm
BioPerl-1.6.923/Bio/Variation/Allele.pm
BioPerl-1.6.923/Bio/Variation/DNAMutation.pm
BioPerl-1.6.923/Bio/Variation/IO.pm
BioPerl-1.6.923/Bio/Variation/README
BioPerl-1.6.923/Bio/Variation/RNAChange.pm
BioPerl-1.6.923/Bio/Variation/SeqDiff.pm
BioPerl-1.6.923/Bio/Variation/SNP.pm
BioPerl-1.6.923/Bio/Variation/VariantI.pm
BioPerl-1.6.923/Bio/Variation/IO
BioPerl-1.6.923/Bio/Variation/IO/flat.pm
BioPerl-1.6.923/Bio/Variation/IO/xml.pm
BioPerl-1.6.923/doc
BioPerl-1.6.923/doc/makedoc.PL
BioPerl-1.6.923/doc/README
BioPerl-1.6.923/doc/Deobfuscator
BioPerl-1.6.923/doc/Deobfuscator/Build.PL
BioPerl-1.6.923/doc/Deobfuscator/Changes
BioPerl-1.6.923/doc/Deobfuscator/excluded_modules.txt
BioPerl-1.6.923/doc/Deobfuscator/LICENSE
BioPerl-1.6.923/doc/Deobfuscator/Makefile.PL
BioPerl-1.6.923/doc/Deobfuscator/MANIFEST
BioPerl-1.6.923/doc/Deobfuscator/META.yml
BioPerl-1.6.923/doc/Deobfuscator/README
BioPerl-1.6.923/doc/Deobfuscator/bin
BioPerl-1.6.923/doc/Deobfuscator/bin/deob_index.pl
BioPerl-1.6.923/doc/Deobfuscator/bin/run-deobfuscator-update.pl
BioPerl-1.6.923/doc/Deobfuscator/cgi-bin
BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_detail.cgi
BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_flowchart.png
BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_help.html
BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_interface.cgi
BioPerl-1.6.923/doc/Deobfuscator/lib
BioPerl-1.6.923/doc/Deobfuscator/lib/Deobfuscator.pm
BioPerl-1.6.923/doc/Deobfuscator/t
BioPerl-1.6.923/doc/Deobfuscator/t/00.load.t
BioPerl-1.6.923/doc/Deobfuscator/t/pod.t
BioPerl-1.6.923/examples
BioPerl-1.6.923/examples/bioperl.pl
BioPerl-1.6.923/examples/generate_random_seq.pl
BioPerl-1.6.923/examples/longorf.pl
BioPerl-1.6.923/examples/make_primers.pl
BioPerl-1.6.923/examples/rev_and_trans.pl
BioPerl-1.6.923/examples/revcom_dir.pl
BioPerl-1.6.923/examples/subsequence.cgi
BioPerl-1.6.923/examples/align
BioPerl-1.6.923/examples/align/align_on_codons.pl
BioPerl-1.6.923/examples/align/aligntutorial.pl
BioPerl-1.6.923/examples/align/clustalw.pl
BioPerl-1.6.923/examples/align/FastAlign.pl
BioPerl-1.6.923/examples/align/simplealign.pl
BioPerl-1.6.923/examples/Bio-DB-GFF
BioPerl-1.6.923/examples/Bio-DB-GFF/load_ucsc.pl
BioPerl-1.6.923/examples/cluster
BioPerl-1.6.923/examples/cluster/dbsnp.pl
BioPerl-1.6.923/examples/contributed
BioPerl-1.6.923/examples/contributed/nmrpdb_parse.pl
BioPerl-1.6.923/examples/contributed/prosite2perl.pl
BioPerl-1.6.923/examples/contributed/rebase2list.pl
BioPerl-1.6.923/examples/db
BioPerl-1.6.923/examples/db/dbfetch
BioPerl-1.6.923/examples/db/est_tissue_query.pl
BioPerl-1.6.923/examples/db/gb2features.pl
BioPerl-1.6.923/examples/db/get_seqs.pl
BioPerl-1.6.923/examples/db/getGenBank.pl
BioPerl-1.6.923/examples/db/rfetch.pl
BioPerl-1.6.923/examples/db/use_registry.pl
BioPerl-1.6.923/examples/liveseq
BioPerl-1.6.923/examples/liveseq/change_gene.pl
BioPerl-1.6.923/examples/popgen
BioPerl-1.6.923/examples/popgen/parse_calc_stats.pl
BioPerl-1.6.923/examples/quality
BioPerl-1.6.923/examples/quality/svgtrace.pl
BioPerl-1.6.923/examples/root
BioPerl-1.6.923/examples/root/exceptions1.pl
BioPerl-1.6.923/examples/root/exceptions2.pl
BioPerl-1.6.923/examples/root/exceptions3.pl
BioPerl-1.6.923/examples/root/exceptions4.pl
BioPerl-1.6.923/examples/root/README
BioPerl-1.6.923/examples/root/lib
BioPerl-1.6.923/examples/root/lib/TestInterface.pm
BioPerl-1.6.923/examples/root/lib/TestObject.pm
BioPerl-1.6.923/examples/searchio
BioPerl-1.6.923/examples/searchio/blast_example.pl
BioPerl-1.6.923/examples/searchio/custom_writer.pl
BioPerl-1.6.923/examples/searchio/hitwriter.pl
BioPerl-1.6.923/examples/searchio/hspwriter.pl
BioPerl-1.6.923/examples/searchio/htmlwriter.pl
BioPerl-1.6.923/examples/searchio/psiblast_features.pl
BioPerl-1.6.923/examples/searchio/psiblast_iterations.pl
BioPerl-1.6.923/examples/searchio/rawwriter.pl
BioPerl-1.6.923/examples/searchio/resultwriter.pl
BioPerl-1.6.923/examples/searchio/waba2gff.pl
BioPerl-1.6.923/examples/searchio/waba2gff3.pl
BioPerl-1.6.923/examples/sirna
BioPerl-1.6.923/examples/sirna/rnai_finder.cgi
BioPerl-1.6.923/examples/sirna/TAG
BioPerl-1.6.923/examples/structure
BioPerl-1.6.923/examples/structure/structure-io.pl
BioPerl-1.6.923/examples/tk
BioPerl-1.6.923/examples/tk/gsequence.pl
BioPerl-1.6.923/examples/tk/hitdisplay.pl
BioPerl-1.6.923/examples/tools
BioPerl-1.6.923/examples/tools/extract_genes.pl
BioPerl-1.6.923/examples/tools/gb_to_gff.pl
BioPerl-1.6.923/examples/tools/gff2ps.pl
BioPerl-1.6.923/examples/tools/parse_codeml.pl
BioPerl-1.6.923/examples/tools/psw.pl
BioPerl-1.6.923/examples/tools/reverse-translate.pl
BioPerl-1.6.923/examples/tools/run_genscan.pl
BioPerl-1.6.923/examples/tools/run_primer3.pl
BioPerl-1.6.923/examples/tools/seq_pattern.pl
BioPerl-1.6.923/examples/tools/standaloneblast.pl
BioPerl-1.6.923/examples/tree
BioPerl-1.6.923/examples/tree/paup2phylip.pl
BioPerl-1.6.923/ide
BioPerl-1.6.923/ide/bioperl.komodo
BioPerl-1.6.923/ide/bioperl-mode
BioPerl-1.6.923/ide/bioperl-mode/README
BioPerl-1.6.923/ide/bioperl-mode/dist
BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar
BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5
BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode.tar
BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode.tar.md5
BioPerl-1.6.923/ide/bioperl-mode/dist/Changes
BioPerl-1.6.923/ide/bioperl-mode/dist/package-me
BioPerl-1.6.923/ide/bioperl-mode/dist/SKIP
BioPerl-1.6.923/ide/bioperl-mode/etc
BioPerl-1.6.923/ide/bioperl-mode/etc/images
BioPerl-1.6.923/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm
BioPerl-1.6.923/ide/bioperl-mode/etc/images/bpmode-tool.xpm
BioPerl-1.6.923/ide/bioperl-mode/site-lisp
BioPerl-1.6.923/ide/bioperl-mode/site-lisp/bioperl-init.el
BioPerl-1.6.923/ide/bioperl-mode/site-lisp/bioperl-mode.el
BioPerl-1.6.923/ide/bioperl-mode/site-lisp/bioperl-skel.el
BioPerl-1.6.923/ide/bioperl-mode/site-lisp/pod.el
BioPerl-1.6.923/maintenance
BioPerl-1.6.923/maintenance/authors.pl
BioPerl-1.6.923/maintenance/check_NAME.pl
BioPerl-1.6.923/maintenance/check_URLs.pl
BioPerl-1.6.923/maintenance/cvs2cl_by_file.pl
BioPerl-1.6.923/maintenance/dependencies.pl
BioPerl-1.6.923/maintenance/deprecated.pl
BioPerl-1.6.923/maintenance/find_mod_deps.pl
BioPerl-1.6.923/maintenance/module_usage.pl
BioPerl-1.6.923/maintenance/modules.pl
BioPerl-1.6.923/maintenance/ncbi_blast_switches.pl
BioPerl-1.6.923/maintenance/perltidy.conf
BioPerl-1.6.923/maintenance/pod.pl
BioPerl-1.6.923/maintenance/README
BioPerl-1.6.923/maintenance/symlink_script.pl
BioPerl-1.6.923/maintenance/version.pl
BioPerl-1.6.923/maintenance/big_split
BioPerl-1.6.923/maintenance/big_split/file_classification.csv
BioPerl-1.6.923/maintenance/big_split/rbuels_notes.txt
BioPerl-1.6.923/models
BioPerl-1.6.923/models/biblio.dia
BioPerl-1.6.923/models/bio_liveseq_variation.dia
BioPerl-1.6.923/models/bio_map.dia
BioPerl-1.6.923/models/bio_restriction.dia
BioPerl-1.6.923/models/bioperl.dia
BioPerl-1.6.923/models/coordinatemapper.dia
BioPerl-1.6.923/models/map_proposal.txt
BioPerl-1.6.923/models/maps_and_markers.dia
BioPerl-1.6.923/models/popgen.dia
BioPerl-1.6.923/models/population_proposal.txt
BioPerl-1.6.923/models/README
BioPerl-1.6.923/scripts
BioPerl-1.6.923/scripts/README
BioPerl-1.6.923/scripts/Bio-DB-GFF
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_bulk_load_gff.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_fast_load_gff.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_genbank2gff.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_genbank2gff3.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_generate_histogram.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_load_gff.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_meta_gff.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_process_gadfly.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_process_sgd.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_process_wormbase.pl
BioPerl-1.6.923/scripts/Bio-DB-GFF/README
BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store
BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl
BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl
BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl
BioPerl-1.6.923/scripts/das
BioPerl-1.6.923/scripts/das/bp_das_server.pl
BioPerl-1.6.923/scripts/das/README
BioPerl-1.6.923/scripts/das/TAG
BioPerl-1.6.923/scripts/DB
BioPerl-1.6.923/scripts/DB/bp_biofetch_genbank_proxy.pl
BioPerl-1.6.923/scripts/DB/bp_bioflat_index.pl
BioPerl-1.6.923/scripts/DB/bp_biogetseq.pl
BioPerl-1.6.923/scripts/DB/bp_flanks.pl
BioPerl-1.6.923/scripts/DB/TAG
BioPerl-1.6.923/scripts/DB-HIV
BioPerl-1.6.923/scripts/DB-HIV/bp_hivq.pl
BioPerl-1.6.923/scripts/index
BioPerl-1.6.923/scripts/index/bp_fetch.pl
BioPerl-1.6.923/scripts/index/bp_index.pl
BioPerl-1.6.923/scripts/index/bp_seqret.pl
BioPerl-1.6.923/scripts/index/TAG
BioPerl-1.6.923/scripts/popgen
BioPerl-1.6.923/scripts/popgen/bp_composite_LD.pl
BioPerl-1.6.923/scripts/popgen/bp_heterogeneity_test.pl
BioPerl-1.6.923/scripts/searchio
BioPerl-1.6.923/scripts/searchio/bp_fastam9_to_table.pl
BioPerl-1.6.923/scripts/searchio/bp_filter_search.pl
BioPerl-1.6.923/scripts/searchio/bp_hmmer_to_table.pl
BioPerl-1.6.923/scripts/searchio/bp_parse_hmmsearch.pl
BioPerl-1.6.923/scripts/searchio/bp_search2table.pl
BioPerl-1.6.923/scripts/searchio/README
BioPerl-1.6.923/scripts/searchio/TAG
BioPerl-1.6.923/scripts/seq
BioPerl-1.6.923/scripts/seq/bp_extract_feature_seq.pl
BioPerl-1.6.923/scripts/seq/bp_make_mrna_protein.pl
BioPerl-1.6.923/scripts/seq/bp_seqconvert.pl
BioPerl-1.6.923/scripts/seq/bp_seqcut.pl
BioPerl-1.6.923/scripts/seq/bp_seqpart.pl
BioPerl-1.6.923/scripts/seq/bp_seqretsplit.pl
BioPerl-1.6.923/scripts/seq/bp_split_seq.pl
BioPerl-1.6.923/scripts/seq/bp_translate_seq.pl
BioPerl-1.6.923/scripts/seq/bp_unflatten_seq.pl
BioPerl-1.6.923/scripts/seq/TAG
BioPerl-1.6.923/scripts/seqstats
BioPerl-1.6.923/scripts/seqstats/bp_aacomp.pl
BioPerl-1.6.923/scripts/seqstats/bp_chaos_plot.pl
BioPerl-1.6.923/scripts/seqstats/bp_gccalc.pl
BioPerl-1.6.923/scripts/seqstats/bp_oligo_count.pl
BioPerl-1.6.923/scripts/seqstats/TAG
BioPerl-1.6.923/scripts/taxa
BioPerl-1.6.923/scripts/taxa/bp_classify_hits_kingdom.pl
BioPerl-1.6.923/scripts/taxa/bp_local_taxonomydb_query.pl
BioPerl-1.6.923/scripts/taxa/bp_query_entrez_taxa.pl
BioPerl-1.6.923/scripts/taxa/bp_taxid4species.pl
BioPerl-1.6.923/scripts/taxa/bp_taxonomy2tree.pl
BioPerl-1.6.923/scripts/taxa/TAG
BioPerl-1.6.923/scripts/tree
BioPerl-1.6.923/scripts/tree/bp_blast2tree.pl
BioPerl-1.6.923/scripts/tree/bp_nexus2nh.pl
BioPerl-1.6.923/scripts/tree/bp_tree2pag.pl
BioPerl-1.6.923/scripts/tree/TAG
BioPerl-1.6.923/scripts/utilities
BioPerl-1.6.923/scripts/utilities/bp_dbsplit.pl
BioPerl-1.6.923/scripts/utilities/bp_download_query_genbank.pl
BioPerl-1.6.923/scripts/utilities/bp_mask_by_search.pl
BioPerl-1.6.923/scripts/utilities/bp_mrtrans.pl
BioPerl-1.6.923/scripts/utilities/bp_mutate.pl
BioPerl-1.6.923/scripts/utilities/bp_netinstall.pl
BioPerl-1.6.923/scripts/utilities/bp_nrdb.pl
BioPerl-1.6.923/scripts/utilities/bp_pairwise_kaks.pl
BioPerl-1.6.923/scripts/utilities/bp_remote_blast.pl
BioPerl-1.6.923/scripts/utilities/bp_revtrans-motif.pl
BioPerl-1.6.923/scripts/utilities/bp_search2alnblocks.pl
BioPerl-1.6.923/scripts/utilities/bp_search2BSML.pl
BioPerl-1.6.923/scripts/utilities/bp_search2gff.pl
BioPerl-1.6.923/scripts/utilities/bp_search2tribe.pl
BioPerl-1.6.923/scripts/utilities/bp_seq_length.pl
BioPerl-1.6.923/scripts/utilities/bp_sreformat.pl
BioPerl-1.6.923/scripts/utilities/README
BioPerl-1.6.923/scripts/utilities/TAG
BioPerl-1.6.923/t
BioPerl-1.6.923/t/Alphabet.t
BioPerl-1.6.923/t/nexml.t
BioPerl-1.6.923/t/Perl.t
BioPerl-1.6.923/t/PodSyntax.t
BioPerl-1.6.923/t/SearchDist.t
BioPerl-1.6.923/t/SeqEvolution.t
BioPerl-1.6.923/t/Species.t
BioPerl-1.6.923/t/Symbol.t
BioPerl-1.6.923/t/TaxonTree.t
BioPerl-1.6.923/t/Align
BioPerl-1.6.923/t/Align/AlignStats.t
BioPerl-1.6.923/t/Align/AlignUtil.t
BioPerl-1.6.923/t/Align/Graphics.t
BioPerl-1.6.923/t/Align/SimpleAlign.t
BioPerl-1.6.923/t/Align/TreeBuild.t
BioPerl-1.6.923/t/Align/Utilities.t
BioPerl-1.6.923/t/AlignIO
BioPerl-1.6.923/t/AlignIO/AlignIO.t
BioPerl-1.6.923/t/AlignIO/arp.t
BioPerl-1.6.923/t/AlignIO/bl2seq.t
BioPerl-1.6.923/t/AlignIO/clustalw.t
BioPerl-1.6.923/t/AlignIO/emboss.t
BioPerl-1.6.923/t/AlignIO/fasta.t
BioPerl-1.6.923/t/AlignIO/largemultifasta.t
BioPerl-1.6.923/t/AlignIO/maf.t
BioPerl-1.6.923/t/AlignIO/mase.t
BioPerl-1.6.923/t/AlignIO/mega.t
BioPerl-1.6.923/t/AlignIO/meme.t
BioPerl-1.6.923/t/AlignIO/metafasta.t
BioPerl-1.6.923/t/AlignIO/msf.t
BioPerl-1.6.923/t/AlignIO/nexml.t
BioPerl-1.6.923/t/AlignIO/nexus.t
BioPerl-1.6.923/t/AlignIO/pfam.t
BioPerl-1.6.923/t/AlignIO/phylip.t
BioPerl-1.6.923/t/AlignIO/po.t
BioPerl-1.6.923/t/AlignIO/prodom.t
BioPerl-1.6.923/t/AlignIO/psi.t
BioPerl-1.6.923/t/AlignIO/selex.t
BioPerl-1.6.923/t/AlignIO/stockholm.t
BioPerl-1.6.923/t/AlignIO/xmfa.t
BioPerl-1.6.923/t/Annotation
BioPerl-1.6.923/t/Annotation/Annotation.t
BioPerl-1.6.923/t/Annotation/AnnotationAdaptor.t
BioPerl-1.6.923/t/Assembly
BioPerl-1.6.923/t/Assembly/ContigSpectrum.t
BioPerl-1.6.923/t/Assembly/core.t
BioPerl-1.6.923/t/Assembly/IO
BioPerl-1.6.923/t/Assembly/IO/bowtie.t
BioPerl-1.6.923/t/Assembly/IO/sam.t
BioPerl-1.6.923/t/Cluster
BioPerl-1.6.923/t/Cluster/UniGene.t
BioPerl-1.6.923/t/ClusterIO
BioPerl-1.6.923/t/ClusterIO/ClusterIO.t
BioPerl-1.6.923/t/ClusterIO/SequenceFamily.t
BioPerl-1.6.923/t/ClusterIO/unigene.t
BioPerl-1.6.923/t/Coordinate
BioPerl-1.6.923/t/Coordinate/CoordinateBoundaryTest.t
BioPerl-1.6.923/t/Coordinate/CoordinateGraph.t
BioPerl-1.6.923/t/Coordinate/CoordinateMapper.t
BioPerl-1.6.923/t/Coordinate/GeneCoordinateMapper.t
BioPerl-1.6.923/t/data
BioPerl-1.6.923/t/data/01_basic.xml
BioPerl-1.6.923/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml
BioPerl-1.6.923/t/data/02_dogfish_no_taxrefs.xml
BioPerl-1.6.923/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml
BioPerl-1.6.923/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml
BioPerl-1.6.923/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml
BioPerl-1.6.923/t/data/02_mackerel_no_taxrefs.xml
BioPerl-1.6.923/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml
BioPerl-1.6.923/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml
BioPerl-1.6.923/t/data/03_bootstraps.xml
BioPerl-1.6.923/t/data/03_bootstraps_in_tag.xml
BioPerl-1.6.923/t/data/04_labeled_ancestors.xml
BioPerl-1.6.923/t/data/05_ancestral_states.xml
BioPerl-1.6.923/t/data/13-pilE-F.scf
BioPerl-1.6.923/t/data/1A11.pdb
BioPerl-1.6.923/t/data/1A3I.pdb
BioPerl-1.6.923/t/data/1BPT.pdb
BioPerl-1.6.923/t/data/1ZZ19XR301R-Alignment.tblastn
BioPerl-1.6.923/t/data/2008.blasttable
BioPerl-1.6.923/t/data/27-contig_Newbler.ace
BioPerl-1.6.923/t/data/503384.MEGABLAST.0
BioPerl-1.6.923/t/data/503384.MEGABLAST.2
BioPerl-1.6.923/t/data/5X_1895.FASTXY
BioPerl-1.6.923/t/data/8HVP.pdb
BioPerl-1.6.923/t/data/a_thaliana.blastn
BioPerl-1.6.923/t/data/AAC12660.fa
BioPerl-1.6.923/t/data/aaml.mlc
BioPerl-1.6.923/t/data/aaml_pairwise.mlc
BioPerl-1.6.923/t/data/AB077698.gb
BioPerl-1.6.923/t/data/acefile.ace.1
BioPerl-1.6.923/t/data/acefile.singlets
BioPerl-1.6.923/t/data/adh.mb_tree.nexus
BioPerl-1.6.923/t/data/AE003528_ecoli.bls
BioPerl-1.6.923/t/data/AE003644_Adh-genomic.gb
BioPerl-1.6.923/t/data/AF032047.gbk
BioPerl-1.6.923/t/data/AF165282.gb
BioPerl-1.6.923/t/data/AF305198.gb
BioPerl-1.6.923/t/data/AHCYL1.kegg
BioPerl-1.6.923/t/data/alleles.fas
BioPerl-1.6.923/t/data/alnfile.fasta
BioPerl-1.6.923/t/data/amino.fa
BioPerl-1.6.923/t/data/AnnIX-v003.gbk
BioPerl-1.6.923/t/data/ar.embl
BioPerl-1.6.923/t/data/assembly_with_singlets.ace
BioPerl-1.6.923/t/data/ATF14F8.gbk
BioPerl-1.6.923/t/data/atp1.matrix
BioPerl-1.6.923/t/data/ay007676.gb
BioPerl-1.6.923/t/data/AY095303S1.gbk
BioPerl-1.6.923/t/data/ay116458.gb
BioPerl-1.6.923/t/data/ay149291.gb
BioPerl-1.6.923/t/data/AY763288.gb
BioPerl-1.6.923/t/data/BAB68554.gb
BioPerl-1.6.923/t/data/badfasta.fa
BioPerl-1.6.923/t/data/barns-combined.nex
BioPerl-1.6.923/t/data/baseml.pairwise
BioPerl-1.6.923/t/data/baseml.usertree
BioPerl-1.6.923/t/data/basic-bush.nex
BioPerl-1.6.923/t/data/basic-ladder.nex
BioPerl-1.6.923/t/data/BC000007.gbk
BioPerl-1.6.923/t/data/BEL16-LTR_AG.embl
BioPerl-1.6.923/t/data/biofpc.cor
BioPerl-1.6.923/t/data/biofpc.fpc
BioPerl-1.6.923/t/data/biorecipe.nhx
BioPerl-1.6.923/t/data/Bird_Ovomucoids.nex
BioPerl-1.6.923/t/data/BK000016-tpa.gbk
BioPerl-1.6.923/t/data/bl2seq.blastn
BioPerl-1.6.923/t/data/bl2seq.blastn.rev
BioPerl-1.6.923/t/data/bl2seq.blastx.out
BioPerl-1.6.923/t/data/bl2seq.bug940.out
BioPerl-1.6.923/t/data/bl2seq.out
BioPerl-1.6.923/t/data/bl2seq.tblastn.out
BioPerl-1.6.923/t/data/bl2seq.tblastx.out
BioPerl-1.6.923/t/data/blast.report
BioPerl-1.6.923/t/data/blast_no_hit_desc.txt
BioPerl-1.6.923/t/data/blast_plus.blastp
BioPerl-1.6.923/t/data/blastp2215.blast
BioPerl-1.6.923/t/data/blat.psLayout3
BioPerl-1.6.923/t/data/BLOSUM50
BioPerl-1.6.923/t/data/blosum62.bla
BioPerl-1.6.923/t/data/BN000066-tpa.embl
BioPerl-1.6.923/t/data/bootstrap.tre
BioPerl-1.6.923/t/data/BOSS_DROME.FASTP_v35_04
BioPerl-1.6.923/t/data/branchSite.mlc
BioPerl-1.6.923/t/data/brassica_ATH.WUBLASTN
BioPerl-1.6.923/t/data/bug1986.blast2
BioPerl-1.6.923/t/data/bug1986.blastp
BioPerl-1.6.923/t/data/bug2120.phd
BioPerl-1.6.923/t/data/bug2246.blast
BioPerl-1.6.923/t/data/bug2391.megablast
BioPerl-1.6.923/t/data/bug2399.tblastn
BioPerl-1.6.923/t/data/bug2453.maf
BioPerl-1.6.923/t/data/bug2473.fasta
BioPerl-1.6.923/t/data/bug2862.pmr
BioPerl-1.6.923/t/data/bug2869.tree
BioPerl-1.6.923/t/data/bug2901.fa
BioPerl-1.6.923/t/data/bug2937.fasta
BioPerl-1.6.923/t/data/bug2942.blastx
BioPerl-1.6.923/t/data/bug2982.embl
BioPerl-1.6.923/t/data/bug2982.gb
BioPerl-1.6.923/t/data/bug3021.gmap
BioPerl-1.6.923/t/data/bug3086.embl
BioPerl-1.6.923/t/data/bug3331.mlc
BioPerl-1.6.923/t/data/c200-vs-yeast.BLASTN
BioPerl-1.6.923/t/data/c200-vs-yeast.BLASTN.m8
BioPerl-1.6.923/t/data/calm.swiss
BioPerl-1.6.923/t/data/catalase-webblast.BLASTP
BioPerl-1.6.923/t/data/cds-266.fas
BioPerl-1.6.923/t/data/cds_sample.embl
BioPerl-1.6.923/t/data/CG11099.fasaln
BioPerl-1.6.923/t/data/CG2865.fasaln
BioPerl-1.6.923/t/data/chad100.scf
BioPerl-1.6.923/t/data/char-interleave.nex
BioPerl-1.6.923/t/data/char-matrix-spaces.nex
BioPerl-1.6.923/t/data/characters+trees.nexml.xml
BioPerl-1.6.923/t/data/characters.nexml.old.xml
BioPerl-1.6.923/t/data/codeml.mlc
BioPerl-1.6.923/t/data/codeml315.mlc
BioPerl-1.6.923/t/data/codeml4.mlc
BioPerl-1.6.923/t/data/codeml43.mlc
BioPerl-1.6.923/t/data/codeml43_nssites.mlc
BioPerl-1.6.923/t/data/codeml45.mlc
BioPerl-1.6.923/t/data/codeml45b.mlc
BioPerl-1.6.923/t/data/codeml_nan.mlc
BioPerl-1.6.923/t/data/codeml_nssites.mlc
BioPerl-1.6.923/t/data/compLD_missingtest.prettybase
BioPerl-1.6.923/t/data/compLD_test.prettybase
BioPerl-1.6.923/t/data/component.ontology.test
BioPerl-1.6.923/t/data/component.ontology.test2
BioPerl-1.6.923/t/data/contig-by-hand.wublastp
BioPerl-1.6.923/t/data/contigspectrumtest.tigr
BioPerl-1.6.923/t/data/crab.dat.cn
BioPerl-1.6.923/t/data/crab.nj
BioPerl-1.6.923/t/data/crab.njb
BioPerl-1.6.923/t/data/crypto.sim4-0
BioPerl-1.6.923/t/data/crypto.sim4-3
BioPerl-1.6.923/t/data/crypto.sim4-4
BioPerl-1.6.923/t/data/ctgdemo.fpc
BioPerl-1.6.923/t/data/cys1_dicdi.water
BioPerl-1.6.923/t/data/cysprot.fa
BioPerl-1.6.923/t/data/cysprot.msf
BioPerl-1.6.923/t/data/cysprot.needle
BioPerl-1.6.923/t/data/cysprot.tblastn
BioPerl-1.6.923/t/data/cysprot.water
BioPerl-1.6.923/t/data/cysprot1.fa
BioPerl-1.6.923/t/data/cysprot1.FASTA
BioPerl-1.6.923/t/data/cysprot1a.fa
BioPerl-1.6.923/t/data/cysprot1a.msf
BioPerl-1.6.923/t/data/cysprot1b.fa
BioPerl-1.6.923/t/data/cysprot1b.hmmsearch
BioPerl-1.6.923/t/data/cysprot1b.msf
BioPerl-1.6.923/t/data/cysprot1b.newick
BioPerl-1.6.923/t/data/cysprot_vs_gadfly.FASTA
BioPerl-1.6.923/t/data/D10483.gbk
BioPerl-1.6.923/t/data/D12555.gbk
BioPerl-1.6.923/t/data/dcr1_sp.WUBLASTP
BioPerl-1.6.923/t/data/dmel_2Lchunk.gb
BioPerl-1.6.923/t/data/dna1.fa
BioPerl-1.6.923/t/data/dna2.fa
BioPerl-1.6.923/t/data/dnaE-bsub-prot.fa
BioPerl-1.6.923/t/data/dnaE-bsub.fa
BioPerl-1.6.923/t/data/dnaEbsub_ecoli.wublastx
BioPerl-1.6.923/t/data/dnaEbsub_ecoli.wutblastn
BioPerl-1.6.923/t/data/dnaEbsub_ecoli.wutblastx
BioPerl-1.6.923/t/data/DQ018368.gb
BioPerl-1.6.923/t/data/dq519393.gb
BioPerl-1.6.923/t/data/ECAPAH02.embl
BioPerl-1.6.923/t/data/echofilter.wublastn
BioPerl-1.6.923/t/data/ecoli-trna-qrna.out
BioPerl-1.6.923/t/data/ecoli_domains.rps.xml
BioPerl-1.6.923/t/data/ecoli_domains.rpsblast
BioPerl-1.6.923/t/data/ecolitst.bls
BioPerl-1.6.923/t/data/ecolitst.fa
BioPerl-1.6.923/t/data/ecolitst.noseqs.wublastp
BioPerl-1.6.923/t/data/ecolitst.wublastp
BioPerl-1.6.923/t/data/EG352462.gbxml
BioPerl-1.6.923/t/data/empty.bl2seq
BioPerl-1.6.923/t/data/ENr111.mfa.example.elems
BioPerl-1.6.923/t/data/entrezgene.dat
BioPerl-1.6.923/t/data/ex1.nucl.nhx
BioPerl-1.6.923/t/data/example.hap
BioPerl-1.6.923/t/data/example.phase
BioPerl-1.6.923/t/data/example.vcf
BioPerl-1.6.923/t/data/exonerate.output.dontwork
BioPerl-1.6.923/t/data/exonerate.output.negativescore.works
BioPerl-1.6.923/t/data/exonerate.output.works
BioPerl-1.6.923/t/data/exonerate.whitespace_before_query.works
BioPerl-1.6.923/t/data/expected.blast.out
BioPerl-1.6.923/t/data/exsignalp.out
BioPerl-1.6.923/t/data/factor7.embl
BioPerl-1.6.923/t/data/Fang_2003.xml
BioPerl-1.6.923/t/data/fgenesh.out
BioPerl-1.6.923/t/data/footprinter.out
BioPerl-1.6.923/t/data/forward_primer.fa
BioPerl-1.6.923/t/data/forward_reverse_primers.fa
BioPerl-1.6.923/t/data/frac_problems.blast
BioPerl-1.6.923/t/data/frac_problems2.blast
BioPerl-1.6.923/t/data/frac_problems3.blast
BioPerl-1.6.923/t/data/geneid_1.0.out
BioPerl-1.6.923/t/data/genemark-fragment.out
BioPerl-1.6.923/t/data/genemark.out
BioPerl-1.6.923/t/data/genewise.out
BioPerl-1.6.923/t/data/genewise_output.paracel_btk
BioPerl-1.6.923/t/data/genomewise.out
BioPerl-1.6.923/t/data/genomic-seq.epcr
BioPerl-1.6.923/t/data/genomic-seq.fasta
BioPerl-1.6.923/t/data/genomic-seq.genscan
BioPerl-1.6.923/t/data/genomic-seq.mzef
BioPerl-1.6.923/t/data/Genscan.FastA
BioPerl-1.6.923/t/data/gf-s71.needle
BioPerl-1.6.923/t/data/Glimmer2.out
BioPerl-1.6.923/t/data/glimmer3-fragment.detail
BioPerl-1.6.923/t/data/glimmer3-fragment.predict
BioPerl-1.6.923/t/data/Glimmer3.detail
BioPerl-1.6.923/t/data/Glimmer3.predict
BioPerl-1.6.923/t/data/GlimmerHMM.out
BioPerl-1.6.923/t/data/GlimmerM.out
BioPerl-1.6.923/t/data/gmap_f9-multiple_results.txt
BioPerl-1.6.923/t/data/gmap_f9-reverse-strand.txt
BioPerl-1.6.923/t/data/gmap_f9.txt
BioPerl-1.6.923/t/data/GO.defs.test
BioPerl-1.6.923/t/data/GO.defs.test2
BioPerl-1.6.923/t/data/headerless.psl
BioPerl-1.6.923/t/data/hemoglobinA.meg
BioPerl-1.6.923/t/data/hg16_chroms.gff
BioPerl-1.6.923/t/data/hmmpfam.out
BioPerl-1.6.923/t/data/hmmpfam_cs.out
BioPerl-1.6.923/t/data/hmmpfam_fake.out
BioPerl-1.6.923/t/data/hmmpfam_HSPdashline.txt
BioPerl-1.6.923/t/data/hmmpfam_multiresult.out
BioPerl-1.6.923/t/data/hmmscan.out
BioPerl-1.6.923/t/data/hmmscan_multi_domain.out
BioPerl-1.6.923/t/data/hmmscan_sec_struct.out
BioPerl-1.6.923/t/data/hmmsearch.out
BioPerl-1.6.923/t/data/hmmsearch3.out
BioPerl-1.6.923/t/data/hs_est.est2genome
BioPerl-1.6.923/t/data/hs_fugu.newick
BioPerl-1.6.923/t/data/hs_owlmonkey.aln
BioPerl-1.6.923/t/data/hs_owlmonkey.fas
BioPerl-1.6.923/t/data/hs_owlmonkey.fasta
BioPerl-1.6.923/t/data/hsinsulin.blastcl3.blastn
BioPerl-1.6.923/t/data/HUMBETGLOA.fa
BioPerl-1.6.923/t/data/HUMBETGLOA.FASTA
BioPerl-1.6.923/t/data/HUMBETGLOA.gff
BioPerl-1.6.923/t/data/HUMBETGLOA.grail
BioPerl-1.6.923/t/data/HUMBETGLOA.grailexp
BioPerl-1.6.923/t/data/HUMBETGLOA.mzef
BioPerl-1.6.923/t/data/HUMBETGLOA.tblastx
BioPerl-1.6.923/t/data/humor.maf
BioPerl-1.6.923/t/data/humts1.pal
BioPerl-1.6.923/t/data/hybrid2.gff3
BioPerl-1.6.923/t/data/in.fasta
BioPerl-1.6.923/t/data/insulin.water
BioPerl-1.6.923/t/data/interpro.xml
BioPerl-1.6.923/t/data/interpro_ebi.xml
BioPerl-1.6.923/t/data/interpro_relationship.xml
BioPerl-1.6.923/t/data/interpro_sample.xml
BioPerl-1.6.923/t/data/interpro_short.xml
BioPerl-1.6.923/t/data/intrablock-comment.nex
BioPerl-1.6.923/t/data/Kingdoms_DNA.nex
BioPerl-1.6.923/t/data/L77119.hmmer
BioPerl-1.6.923/t/data/little.largemultifasta
BioPerl-1.6.923/t/data/LittleChrY.dbsnp.xml
BioPerl-1.6.923/t/data/LOAD_Ccd1.dnd
BioPerl-1.6.923/t/data/long-names.nex
BioPerl-1.6.923/t/data/longnames.aln
BioPerl-1.6.923/t/data/longnames.dnd
BioPerl-1.6.923/t/data/lucy.info
BioPerl-1.6.923/t/data/lucy.qual
BioPerl-1.6.923/t/data/lucy.seq
BioPerl-1.6.923/t/data/lucy.stderr
BioPerl-1.6.923/t/data/lysozyme6.protml
BioPerl-1.6.923/t/data/lysozyme6.simple.protml
BioPerl-1.6.923/t/data/M0.mlc
BioPerl-1.6.923/t/data/M12730.gb
BioPerl-1.6.923/t/data/mapmaker.out
BioPerl-1.6.923/t/data/mapmaker.txt
BioPerl-1.6.923/t/data/mast.dat
BioPerl-1.6.923/t/data/masta.dat
BioPerl-1.6.923/t/data/match.output
BioPerl-1.6.923/t/data/Mcjanrna_rdbII.gbk
BioPerl-1.6.923/t/data/megablast_output.paracel_btk
BioPerl-1.6.923/t/data/meme.dat
BioPerl-1.6.923/t/data/mini-AE001405.gb
BioPerl-1.6.923/t/data/mini-align.aln
BioPerl-1.6.923/t/data/mixedmast.dat
BioPerl-1.6.923/t/data/MmCT
BioPerl-1.6.923/t/data/mpath.ontology.test
BioPerl-1.6.923/t/data/MSGEFTUA.gb
BioPerl-1.6.923/t/data/multi.blast.m8
BioPerl-1.6.923/t/data/multi.blast.m9
BioPerl-1.6.923/t/data/multi.phd
BioPerl-1.6.923/t/data/multi_1.fa
BioPerl-1.6.923/t/data/multi_2.fa
BioPerl-1.6.923/t/data/multi_blast.bls
BioPerl-1.6.923/t/data/multifa.seq
BioPerl-1.6.923/t/data/multifa.seq.qual
BioPerl-1.6.923/t/data/multiline-intrablock-comment.nex
BioPerl-1.6.923/t/data/multiresult_blastn+.bls
BioPerl-1.6.923/t/data/multiseq.bls
BioPerl-1.6.923/t/data/multiseq_tags.phd
BioPerl-1.6.923/t/data/mus.bls.xml
BioPerl-1.6.923/t/data/mutations.dat
BioPerl-1.6.923/t/data/mutations.old.dat
BioPerl-1.6.923/t/data/mutations.old.xml
BioPerl-1.6.923/t/data/mutations.xml
BioPerl-1.6.923/t/data/myco_sites.gff
BioPerl-1.6.923/t/data/NC_000007-ribosomal-slippage.gb
BioPerl-1.6.923/t/data/NC_001284.gbk
BioPerl-1.6.923/t/data/NC_002058_multDBLINK_bug3375.gb
BioPerl-1.6.923/t/data/NC_006346.gb
BioPerl-1.6.923/t/data/NC_006511-short.gbk
BioPerl-1.6.923/t/data/NC_008536.gb
BioPerl-1.6.923/t/data/nei_gojobori_test.aln
BioPerl-1.6.923/t/data/neighbor.dist
BioPerl-1.6.923/t/data/new_blastn.txt
BioPerl-1.6.923/t/data/newblast.xml
BioPerl-1.6.923/t/data/nhmmer-3.1.out
BioPerl-1.6.923/t/data/nhx-bacteria.nhx
BioPerl-1.6.923/t/data/NM_002254.gb
BioPerl-1.6.923/t/data/no-genes.genscan
BioPerl-1.6.923/t/data/no_cds_example.gb
BioPerl-1.6.923/t/data/no_FH.embl
BioPerl-1.6.923/t/data/no_hsps.blastp
BioPerl-1.6.923/t/data/no_semicolon.newick
BioPerl-1.6.923/t/data/noninterleaved.phy
BioPerl-1.6.923/t/data/NT_021877.gbk
BioPerl-1.6.923/t/data/nucmatrix.txt
BioPerl-1.6.923/t/data/O_sat.wgs
BioPerl-1.6.923/t/data/omim_genemap_test
BioPerl-1.6.923/t/data/omim_genemap_test_nolinebreak
BioPerl-1.6.923/t/data/omim_text_test
BioPerl-1.6.923/t/data/P33897
BioPerl-1.6.923/t/data/P35527.gb
BioPerl-1.6.923/t/data/P39765.gb
BioPerl-1.6.923/t/data/PAM250
BioPerl-1.6.923/t/data/pep-266.aln
BioPerl-1.6.923/t/data/pfam_tests.stk
BioPerl-1.6.923/t/data/pfamOutput-bug3376.out
BioPerl-1.6.923/t/data/phi.out
BioPerl-1.6.923/t/data/phipsi.out
BioPerl-1.6.923/t/data/phylipdist-36.out
BioPerl-1.6.923/t/data/phylipdist.out
BioPerl-1.6.923/t/data/phyloxml_examples.xml
BioPerl-1.6.923/t/data/pictogram.fa
BioPerl-1.6.923/t/data/plague_yeast.bls.xml
BioPerl-1.6.923/t/data/polymorphism.dat
BioPerl-1.6.923/t/data/polymorphism.old.xml
BioPerl-1.6.923/t/data/polymorphism.xml
BioPerl-1.6.923/t/data/popgen_saureus.dat
BioPerl-1.6.923/t/data/popgen_saureus.multidat
BioPerl-1.6.923/t/data/popstats.prettybase
BioPerl-1.6.923/t/data/pre_rel9.swiss
BioPerl-1.6.923/t/data/Primate_mtDNA.nex
BioPerl-1.6.923/t/data/primedseq.fa
BioPerl-1.6.923/t/data/primer3_infile.txt
BioPerl-1.6.923/t/data/primer3_outfile.txt
BioPerl-1.6.923/t/data/primer3_output.txt
BioPerl-1.6.923/t/data/prints.out
BioPerl-1.6.923/t/data/promoterwise.out
BioPerl-1.6.923/t/data/protpars.phy
BioPerl-1.6.923/t/data/protpars_longid.phy
BioPerl-1.6.923/t/data/pseudowise.out
BioPerl-1.6.923/t/data/psi_xml.dat
BioPerl-1.6.923/t/data/psiblast.xml
BioPerl-1.6.923/t/data/psiblastreport.out
BioPerl-1.6.923/t/data/purine_v081.infernal
BioPerl-1.6.923/t/data/puzzle.tre
BioPerl-1.6.923/t/data/PX1CG.gb
BioPerl-1.6.923/t/data/Q8GBD3.swiss
BioPerl-1.6.923/t/data/qrna-relloc.out
BioPerl-1.6.923/t/data/qualfile.qual
BioPerl-1.6.923/t/data/quoted-strings1.nex
BioPerl-1.6.923/t/data/quoted-strings2.nex
BioPerl-1.6.923/t/data/Rab1.chaos-xml
BioPerl-1.6.923/t/data/radical-whitespace.nex
BioPerl-1.6.923/t/data/radical-whitespace_02.nex
BioPerl-1.6.923/t/data/rebase.itype2
BioPerl-1.6.923/t/data/rebase.withrefm
BioPerl-1.6.923/t/data/reference_ace.ace
BioPerl-1.6.923/t/data/regulation_test.obo
BioPerl-1.6.923/t/data/rel9.swiss
BioPerl-1.6.923/t/data/repeatmasker.fa.out
BioPerl-1.6.923/t/data/revcomp_mrna.gb
BioPerl-1.6.923/t/data/rfam_tests.stk
BioPerl-1.6.923/t/data/ribosome-slippage.gb
BioPerl-1.6.923/t/data/roa1.dat
BioPerl-1.6.923/t/data/roa1.gbxml
BioPerl-1.6.923/t/data/roa1.genbank
BioPerl-1.6.923/t/data/roa1.swiss
BioPerl-1.6.923/t/data/roa1_v2.dat
BioPerl-1.6.923/t/data/rpsblast.bls
BioPerl-1.6.923/t/data/rpsblast_no_hits.bls
BioPerl-1.6.923/t/data/sample_dataset.tigr
BioPerl-1.6.923/t/data/sbay_c127.fas
BioPerl-1.6.923/t/data/sbay_c545-yeast.BLASTZ.PSL
BioPerl-1.6.923/t/data/seg.out
BioPerl-1.6.923/t/data/semicolon.newick
BioPerl-1.6.923/t/data/seqdatabase.ini
BioPerl-1.6.923/t/data/seqfile.pir
BioPerl-1.6.923/t/data/seqs.fas
BioPerl-1.6.923/t/data/sequencefamily.dat
BioPerl-1.6.923/t/data/seqxml.xml
BioPerl-1.6.923/t/data/short.blx
BioPerl-1.6.923/t/data/signalp.hmm.short
BioPerl-1.6.923/t/data/signalp.hmm.summary
BioPerl-1.6.923/t/data/signalp.negative.out
BioPerl-1.6.923/t/data/signalp.nn.short
BioPerl-1.6.923/t/data/signalp.nn.summary
BioPerl-1.6.923/t/data/signalp.positive.out
BioPerl-1.6.923/t/data/signalp.short
BioPerl-1.6.923/t/data/signalp.summary
BioPerl-1.6.923/t/data/sim4.for.for
BioPerl-1.6.923/t/data/sim4.for.rev
BioPerl-1.6.923/t/data/sim4.rev
BioPerl-1.6.923/t/data/singleNSsite.mlc
BioPerl-1.6.923/t/data/singlescore.gbk
BioPerl-1.6.923/t/data/singlet_w_CT.ace
BioPerl-1.6.923/t/data/so.obo
BioPerl-1.6.923/t/data/sofa.ontology
BioPerl-1.6.923/t/data/sp_subset.obo
BioPerl-1.6.923/t/data/spaced_fasta.fa
BioPerl-1.6.923/t/data/spaces.nex
BioPerl-1.6.923/t/data/SPAN_Family4nl.nex
BioPerl-1.6.923/t/data/SPAN_Family7n.nex
BioPerl-1.6.923/t/data/SPAN_Family8a.nex
BioPerl-1.6.923/t/data/sparsealn.needle
BioPerl-1.6.923/t/data/spidey.noalignment
BioPerl-1.6.923/t/data/spidey.test1
BioPerl-1.6.923/t/data/sprintf.rnamotif
BioPerl-1.6.923/t/data/ssp160.embl.1
BioPerl-1.6.923/t/data/sv40_small.xml
BioPerl-1.6.923/t/data/swiss.dat
BioPerl-1.6.923/t/data/swisspfam.data
BioPerl-1.6.923/t/data/SwissProt.dat
BioPerl-1.6.923/t/data/T7.aln
BioPerl-1.6.923/t/data/tab1part.mif
BioPerl-1.6.923/t/data/tab2part.mif
BioPerl-1.6.923/t/data/tab3part.mif
BioPerl-1.6.923/t/data/tandem_repeats_finder.dat
BioPerl-1.6.923/t/data/tandem_repeats_finder.noresults
BioPerl-1.6.923/t/data/tandem_repeats_finder_no_desc.dat
BioPerl-1.6.923/t/data/targetp.out
BioPerl-1.6.923/t/data/tblastn.out
BioPerl-1.6.923/t/data/test 2.txt
BioPerl-1.6.923/t/data/test-3.0-1.meme
BioPerl-1.6.923/t/data/test-3.0-2.meme
BioPerl-1.6.923/t/data/test-4.9.meme
BioPerl-1.6.923/t/data/test.abi
BioPerl-1.6.923/t/data/test.ace
BioPerl-1.6.923/t/data/test.bam
BioPerl-1.6.923/t/data/test.bowtie
BioPerl-1.6.923/t/data/test.cns.fastq
BioPerl-1.6.923/t/data/test.ctf
BioPerl-1.6.923/t/data/test.embl
BioPerl-1.6.923/t/data/test.embl2sq
BioPerl-1.6.923/t/data/test.exp
BioPerl-1.6.923/t/data/test.fasta
BioPerl-1.6.923/t/data/test.fastq
BioPerl-1.6.923/t/data/test.game
BioPerl-1.6.923/t/data/test.gcg
BioPerl-1.6.923/t/data/test.gcgblast
BioPerl-1.6.923/t/data/test.gcgfasta
BioPerl-1.6.923/t/data/test.genbank
BioPerl-1.6.923/t/data/test.genbank.noseq
BioPerl-1.6.923/t/data/test.infernal
BioPerl-1.6.923/t/data/test.interpro
BioPerl-1.6.923/t/data/test.interpro-go.xml
BioPerl-1.6.923/t/data/test.lasergene
BioPerl-1.6.923/t/data/test.locuslink
BioPerl-1.6.923/t/data/test.maq
BioPerl-1.6.923/t/data/test.mase
BioPerl-1.6.923/t/data/test.metafasta
BioPerl-1.6.923/t/data/test.nh
BioPerl-1.6.923/t/data/test.nhx
BioPerl-1.6.923/t/data/test.pfam
BioPerl-1.6.923/t/data/test.phd
BioPerl-1.6.923/t/data/test.pir
BioPerl-1.6.923/t/data/test.pln
BioPerl-1.6.923/t/data/test.raw
BioPerl-1.6.923/t/data/test.ref.fas
BioPerl-1.6.923/t/data/test.swiss
BioPerl-1.6.923/t/data/test.tab
BioPerl-1.6.923/t/data/test.tigrxml
BioPerl-1.6.923/t/data/test.tseq
BioPerl-1.6.923/t/data/test.tsv
BioPerl-1.6.923/t/data/test.txt
BioPerl-1.6.923/t/data/test.waba
BioPerl-1.6.923/t/data/test.xls
BioPerl-1.6.923/t/data/test.ztr
BioPerl-1.6.923/t/data/test1.blasttab3
BioPerl-1.6.923/t/data/test1.wublastp
BioPerl-1.6.923/t/data/test2.infernal
BioPerl-1.6.923/t/data/test2.raw
BioPerl-1.6.923/t/data/test_badlf.gcg
BioPerl-1.6.923/t/data/test_clear_range.fastq
BioPerl-1.6.923/t/data/test_data.axt
BioPerl-1.6.923/t/data/test_singlets.cns.fastq
BioPerl-1.6.923/t/data/test_singlets.maq
BioPerl-1.6.923/t/data/testaln.aln
BioPerl-1.6.923/t/data/testaln.arp
BioPerl-1.6.923/t/data/testaln.fasta
BioPerl-1.6.923/t/data/testaln.fastq
BioPerl-1.6.923/t/data/testaln.list
BioPerl-1.6.923/t/data/testaln.mase
BioPerl-1.6.923/t/data/testaln.metafasta
BioPerl-1.6.923/t/data/testaln.msf
BioPerl-1.6.923/t/data/testaln.nexus
BioPerl-1.6.923/t/data/testaln.pfam
BioPerl-1.6.923/t/data/testaln.phylip
BioPerl-1.6.923/t/data/testaln.po
BioPerl-1.6.923/t/data/testaln.prodom
BioPerl-1.6.923/t/data/testaln.psi
BioPerl-1.6.923/t/data/testaln.selex
BioPerl-1.6.923/t/data/testaln.stockholm
BioPerl-1.6.923/t/data/testaln.xmfa
BioPerl-1.6.923/t/data/testaln2.arp
BioPerl-1.6.923/t/data/testaln2.fasta
BioPerl-1.6.923/t/data/testdat.exonerate
BioPerl-1.6.923/t/data/testdata.crossmatch
BioPerl-1.6.923/t/data/testdbaccnums.out
BioPerl-1.6.923/t/data/testfile.erpin
BioPerl-1.6.923/t/data/testfuzzy.genbank
BioPerl-1.6.923/t/data/tiny.stk
BioPerl-1.6.923/t/data/tmhmm.out
BioPerl-1.6.923/t/data/tmp.fst
BioPerl-1.6.923/t/data/tol-2010-02-18.nhx
BioPerl-1.6.923/t/data/traits.tab
BioPerl-1.6.923/t/data/traittree.nexus
BioPerl-1.6.923/t/data/transfac.dat
BioPerl-1.6.923/t/data/tree_nonewline.nexus
BioPerl-1.6.923/t/data/Treebase-chlamy-dna.nex
BioPerl-1.6.923/t/data/trees.nexml.old.xml
BioPerl-1.6.923/t/data/tricky.wublast
BioPerl-1.6.923/t/data/trna.strict.rnamotif
BioPerl-1.6.923/t/data/U58726.gb
BioPerl-1.6.923/t/data/U71225.gb
BioPerl-1.6.923/t/data/U71225.gb.unix
BioPerl-1.6.923/t/data/U71225.gb.win
BioPerl-1.6.923/t/data/U83300.bsml
BioPerl-1.6.923/t/data/UnaSmithHIV-both.nex
BioPerl-1.6.923/t/data/unigene.data
BioPerl-1.6.923/t/data/urease.tre.nexus
BioPerl-1.6.923/t/data/version2.scf
BioPerl-1.6.923/t/data/version3.scf
BioPerl-1.6.923/t/data/wellcome_tol.nhx
BioPerl-1.6.923/t/data/withrefm.906
BioPerl-1.6.923/t/data/worm_fam_2785.cdna
BioPerl-1.6.923/t/data/X98338_Adh-mRNA.gb
BioPerl-1.6.923/t/data/yeast.tRNAscanSE
BioPerl-1.6.923/t/data/yn00.mlc
BioPerl-1.6.923/t/data/yn00_45.mlc
BioPerl-1.6.923/t/data/YP_007988852.gp
BioPerl-1.6.923/t/data/ZABJ4EA7014.CH878695.1.blast.txt
BioPerl-1.6.923/t/data/bad_dbfa
BioPerl-1.6.923/t/data/bad_dbfa/bug3172.fa
BioPerl-1.6.923/t/data/bad_dbfa/shotdb.fa
BioPerl-1.6.923/t/data/biodbgff
BioPerl-1.6.923/t/data/biodbgff/test.gff
BioPerl-1.6.923/t/data/biodbgff/test.gff3
BioPerl-1.6.923/t/data/codeml_lysozyme
BioPerl-1.6.923/t/data/codeml_lysozyme/2NG.dN
BioPerl-1.6.923/t/data/codeml_lysozyme/2NG.dS
BioPerl-1.6.923/t/data/codeml_lysozyme/2NG.tt
BioPerl-1.6.923/t/data/codeml_lysozyme/4fold.nuc
BioPerl-1.6.923/t/data/codeml_lysozyme/lnf
BioPerl-1.6.923/t/data/codeml_lysozyme/lysozymeSmall.ctl
BioPerl-1.6.923/t/data/codeml_lysozyme/lysozymeSmall.trees
BioPerl-1.6.923/t/data/codeml_lysozyme/lysozymeSmall.txt
BioPerl-1.6.923/t/data/codeml_lysozyme/mlc
BioPerl-1.6.923/t/data/codeml_lysozyme/rst
BioPerl-1.6.923/t/data/codeml_lysozyme/rst1
BioPerl-1.6.923/t/data/codeml_lysozyme/rub
BioPerl-1.6.923/t/data/consed_project
BioPerl-1.6.923/t/data/consed_project/edit_dir
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.contigs
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.log
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.log
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.problems
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.qual
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.view
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.newtags
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.phrap.out
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.screen.out
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project_to_alu.cross
BioPerl-1.6.923/t/data/consed_project/edit_dir/test_projectNewChromats.fof
BioPerl-1.6.923/t/data/consed_project/phd_dir
BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4922R.phd.1
BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4924F.phd.1
BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4924R.phd.1
BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4947F.phd.1
BioPerl-1.6.923/t/data/dbfa
BioPerl-1.6.923/t/data/dbfa/1.fa
BioPerl-1.6.923/t/data/dbfa/2.fa
BioPerl-1.6.923/t/data/dbfa/3.fa
BioPerl-1.6.923/t/data/dbfa/4.fa
BioPerl-1.6.923/t/data/dbfa/5.fa
BioPerl-1.6.923/t/data/dbfa/6.fa
BioPerl-1.6.923/t/data/dbfa/7.fa
BioPerl-1.6.923/t/data/dbfa/mixed_alphabet.fasta
BioPerl-1.6.923/t/data/dbqual
BioPerl-1.6.923/t/data/dbqual/1.qual
BioPerl-1.6.923/t/data/dbqual/2.qual
BioPerl-1.6.923/t/data/dbqual/3.qual
BioPerl-1.6.923/t/data/fastq
BioPerl-1.6.923/t/data/fastq/bug2335.fastq
BioPerl-1.6.923/t/data/fastq/error_diff_ids.fastq
BioPerl-1.6.923/t/data/fastq/error_double_qual.fastq
BioPerl-1.6.923/t/data/fastq/error_double_seq.fastq
BioPerl-1.6.923/t/data/fastq/error_long_qual.fastq
BioPerl-1.6.923/t/data/fastq/error_no_qual.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_del.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_escape.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_null.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_space.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_tab.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_unit_sep.fastq
BioPerl-1.6.923/t/data/fastq/error_qual_vtab.fastq
BioPerl-1.6.923/t/data/fastq/error_short_qual.fastq
BioPerl-1.6.923/t/data/fastq/error_spaces.fastq
BioPerl-1.6.923/t/data/fastq/error_tabs.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_at_plus.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_at_qual.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_at_seq.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_in_plus.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_in_qual.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_in_seq.fastq
BioPerl-1.6.923/t/data/fastq/error_trunc_in_title.fastq
BioPerl-1.6.923/t/data/fastq/evil_wrapping.fastq
BioPerl-1.6.923/t/data/fastq/example.fasta
BioPerl-1.6.923/t/data/fastq/example.fastq
BioPerl-1.6.923/t/data/fastq/example.qual
BioPerl-1.6.923/t/data/fastq/illumina_faked.fastq
BioPerl-1.6.923/t/data/fastq/sanger_93.fastq
BioPerl-1.6.923/t/data/fastq/sanger_faked.fastq
BioPerl-1.6.923/t/data/fastq/solexa_example.fastq
BioPerl-1.6.923/t/data/fastq/solexa_faked.fastq
BioPerl-1.6.923/t/data/fastq/test1_sanger.fastq
BioPerl-1.6.923/t/data/fastq/test2_solexa.fastq
BioPerl-1.6.923/t/data/fastq/test3_illumina.fastq
BioPerl-1.6.923/t/data/fastq/tricky.fastq
BioPerl-1.6.923/t/data/fastq/wrapping_issues.fastq
BioPerl-1.6.923/t/data/fastq/zero_qual.fastq
BioPerl-1.6.923/t/data/map_hem
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM12.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM12.fa.revcom
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM12.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM13.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM13.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM14.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM14.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM2.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM2.fa.revcom
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM2.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM3.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM3.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM4.fa
BioPerl-1.6.923/t/data/map_hem/HEM1-HEM4.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM1.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM1.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM12-HEM13.fa
BioPerl-1.6.923/t/data/map_hem/HEM12-HEM13.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM12-HEM14.fa
BioPerl-1.6.923/t/data/map_hem/HEM12-HEM14.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM12-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM12-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM12.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM12.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM13-HEM14.fa
BioPerl-1.6.923/t/data/map_hem/HEM13-HEM14.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM13-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM13-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM13.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM13.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM14-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM14-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM14.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM14.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM15.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM15.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM12.fa
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM12.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM13.fa
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM13.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM14.fa
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM14.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM3.fa
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM3.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM4.fa
BioPerl-1.6.923/t/data/map_hem/HEM2-HEM4.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM2.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM2.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM12.fa
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM12.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM13.fa
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM13.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM14.fa
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM14.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM4.fa
BioPerl-1.6.923/t/data/map_hem/HEM3-HEM4.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM3.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM3.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM12.fa
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM12.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM13.fa
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM13.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM14.fa
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM14.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM15.fa
BioPerl-1.6.923/t/data/map_hem/HEM4-HEM15.meme.txt
BioPerl-1.6.923/t/data/map_hem/HEM4.ups.fa_
BioPerl-1.6.923/t/data/map_hem/HEM4.ups.fa_.revcom
BioPerl-1.6.923/t/data/map_hem/yeast.nc.1.freq
BioPerl-1.6.923/t/data/mbsout
BioPerl-1.6.923/t/data/mbsout/mbsout_infile1
BioPerl-1.6.923/t/data/mbsout/mbsout_infile2
BioPerl-1.6.923/t/data/mbsout/mbsout_infile3
BioPerl-1.6.923/t/data/msout
BioPerl-1.6.923/t/data/msout/bad_msout_infile1
BioPerl-1.6.923/t/data/msout/bad_msout_infile2
BioPerl-1.6.923/t/data/msout/msout_infile1
BioPerl-1.6.923/t/data/msout/msout_infile2
BioPerl-1.6.923/t/data/msout/msout_infile3
BioPerl-1.6.923/t/data/msout/msout_infile4
BioPerl-1.6.923/t/data/nexml
BioPerl-1.6.923/t/data/nexml/characters.nexml.8.xml
BioPerl-1.6.923/t/data/nexml/characters.nexml.xml
BioPerl-1.6.923/t/data/nexml/trees.nexml.8.xml
BioPerl-1.6.923/t/data/nexml/trees.nexml.xml
BioPerl-1.6.923/t/data/registry
BioPerl-1.6.923/t/data/registry/bdb
BioPerl-1.6.923/t/data/registry/bdb/seqdatabase.ini
BioPerl-1.6.923/t/data/registry/flat
BioPerl-1.6.923/t/data/registry/flat/seqdatabase.ini
BioPerl-1.6.923/t/data/seqfeaturedb
BioPerl-1.6.923/t/data/seqfeaturedb/test.gff3
BioPerl-1.6.923/t/data/taxdump
BioPerl-1.6.923/t/data/taxdump/names.dmp
BioPerl-1.6.923/t/data/taxdump/nodes.dmp
BioPerl-1.6.923/t/data/taxonomy
BioPerl-1.6.923/t/data/taxonomy/greengenes_taxonomy_16S_candiv_gg_2011_1.txt
BioPerl-1.6.923/t/data/taxonomy/silva_SSURef_108_tax_silva_trunc.fasta
BioPerl-1.6.923/t/data/transfac_pro
BioPerl-1.6.923/t/data/transfac_pro/factor.dat
BioPerl-1.6.923/t/data/transfac_pro/fragment.dat
BioPerl-1.6.923/t/data/transfac_pro/gene.dat
BioPerl-1.6.923/t/data/transfac_pro/matrix.dat
BioPerl-1.6.923/t/data/transfac_pro/readme.txt
BioPerl-1.6.923/t/data/transfac_pro/reference.dat
BioPerl-1.6.923/t/data/transfac_pro/site.dat
BioPerl-1.6.923/t/Draw
BioPerl-1.6.923/t/Draw/Pictogram.t
BioPerl-1.6.923/t/lib
BioPerl-1.6.923/t/lib/Error.pm
BioPerl-1.6.923/t/LiveSeq
BioPerl-1.6.923/t/LiveSeq/Chain.t
BioPerl-1.6.923/t/LiveSeq/LiveSeq.t
BioPerl-1.6.923/t/LiveSeq/Mutation.t
BioPerl-1.6.923/t/LiveSeq/Mutator.t
BioPerl-1.6.923/t/LocalDB
BioPerl-1.6.923/t/LocalDB/BioDBGFF.t
BioPerl-1.6.923/t/LocalDB/Fasta.t
BioPerl-1.6.923/t/LocalDB/Flat.t
BioPerl-1.6.923/t/LocalDB/Qual.t
BioPerl-1.6.923/t/LocalDB/Registry.t
BioPerl-1.6.923/t/LocalDB/SeqFeature.t
BioPerl-1.6.923/t/LocalDB/transfac_pro.t
BioPerl-1.6.923/t/LocalDB/Index
BioPerl-1.6.923/t/LocalDB/Index/Blast.t
BioPerl-1.6.923/t/LocalDB/Index/BlastTable.t
BioPerl-1.6.923/t/LocalDB/Index/Index.t
BioPerl-1.6.923/t/LocalDB/Taxonomy
BioPerl-1.6.923/t/LocalDB/Taxonomy/greengenes.t
BioPerl-1.6.923/t/LocalDB/Taxonomy/silva.t
BioPerl-1.6.923/t/Map
BioPerl-1.6.923/t/Map/Cyto.t
BioPerl-1.6.923/t/Map/Linkage.t
BioPerl-1.6.923/t/Map/Map.t
BioPerl-1.6.923/t/Map/MapIO.t
BioPerl-1.6.923/t/Map/MicrosatelliteMarker.t
BioPerl-1.6.923/t/Map/Physical.t
BioPerl-1.6.923/t/Matrix
BioPerl-1.6.923/t/Matrix/InstanceSite.t
BioPerl-1.6.923/t/Matrix/Matrix.t
BioPerl-1.6.923/t/Matrix/ProtMatrix.t
BioPerl-1.6.923/t/Matrix/ProtPsm.t
BioPerl-1.6.923/t/Matrix/SiteMatrix.t
BioPerl-1.6.923/t/Matrix/IO
BioPerl-1.6.923/t/Matrix/IO/masta.t
BioPerl-1.6.923/t/Matrix/IO/psm.t
BioPerl-1.6.923/t/Ontology
BioPerl-1.6.923/t/Ontology/GOterm.t
BioPerl-1.6.923/t/Ontology/GraphAdaptor.t
BioPerl-1.6.923/t/Ontology/Ontology.t
BioPerl-1.6.923/t/Ontology/OntologyEngine.t
BioPerl-1.6.923/t/Ontology/OntologyStore.t
BioPerl-1.6.923/t/Ontology/Relationship.t
BioPerl-1.6.923/t/Ontology/RelationshipType.t
BioPerl-1.6.923/t/Ontology/Term.t
BioPerl-1.6.923/t/Ontology/IO
BioPerl-1.6.923/t/Ontology/IO/go.t
BioPerl-1.6.923/t/Ontology/IO/interpro.t
BioPerl-1.6.923/t/Ontology/IO/obo.t
BioPerl-1.6.923/t/Phenotype
BioPerl-1.6.923/t/Phenotype/Correlate.t
BioPerl-1.6.923/t/Phenotype/Measure.t
BioPerl-1.6.923/t/Phenotype/MeSH.t
BioPerl-1.6.923/t/Phenotype/MiniMIMentry.t
BioPerl-1.6.923/t/Phenotype/OMIMentry.t
BioPerl-1.6.923/t/Phenotype/OMIMentryAllelicVariant.t
BioPerl-1.6.923/t/Phenotype/OMIMparser.t
BioPerl-1.6.923/t/Phenotype/Phenotype.t
BioPerl-1.6.923/t/PopGen
BioPerl-1.6.923/t/PopGen/Coalescent.t
BioPerl-1.6.923/t/PopGen/HtSNP.t
BioPerl-1.6.923/t/PopGen/MK.t
BioPerl-1.6.923/t/PopGen/PopGen.t
BioPerl-1.6.923/t/PopGen/PopGenSims.t
BioPerl-1.6.923/t/PopGen/TagHaplotype.t
BioPerl-1.6.923/t/RemoteDB
BioPerl-1.6.923/t/RemoteDB/BioFetch.t
BioPerl-1.6.923/t/RemoteDB/CUTG.t
BioPerl-1.6.923/t/RemoteDB/EMBL.t
BioPerl-1.6.923/t/RemoteDB/EntrezGene.t
BioPerl-1.6.923/t/RemoteDB/GenBank.t
BioPerl-1.6.923/t/RemoteDB/GenPept.t
BioPerl-1.6.923/t/RemoteDB/MeSH.t
BioPerl-1.6.923/t/RemoteDB/RefSeq.t
BioPerl-1.6.923/t/RemoteDB/SeqHound.t
BioPerl-1.6.923/t/RemoteDB/SeqRead_fail.t
BioPerl-1.6.923/t/RemoteDB/SeqVersion.t
BioPerl-1.6.923/t/RemoteDB/SwissProt.t
BioPerl-1.6.923/t/RemoteDB/Taxonomy.t
BioPerl-1.6.923/t/RemoteDB/HIV
BioPerl-1.6.923/t/RemoteDB/HIV/HIV.t
BioPerl-1.6.923/t/RemoteDB/HIV/HIVAnnotProcessor.t
BioPerl-1.6.923/t/RemoteDB/HIV/HIVQuery.t
BioPerl-1.6.923/t/RemoteDB/HIV/HIVQueryHelper.t
BioPerl-1.6.923/t/RemoteDB/Query
BioPerl-1.6.923/t/RemoteDB/Query/GenBank.t
BioPerl-1.6.923/t/Restriction
BioPerl-1.6.923/t/Restriction/Analysis-refac.t
BioPerl-1.6.923/t/Restriction/Analysis.t
BioPerl-1.6.923/t/Restriction/Gel.t
BioPerl-1.6.923/t/Restriction/IO.t
BioPerl-1.6.923/t/Root
BioPerl-1.6.923/t/Root/Exception.t
BioPerl-1.6.923/t/Root/HTTPget.t
BioPerl-1.6.923/t/Root/RootI.t
BioPerl-1.6.923/t/Root/RootIO.t
BioPerl-1.6.923/t/Root/Storable.t
BioPerl-1.6.923/t/Root/Tempfile.t
BioPerl-1.6.923/t/Root/Utilities.t
BioPerl-1.6.923/t/SearchIO
BioPerl-1.6.923/t/SearchIO/axt.t
BioPerl-1.6.923/t/SearchIO/blast.t
BioPerl-1.6.923/t/SearchIO/blast_pull.t
BioPerl-1.6.923/t/SearchIO/blasttable.t
BioPerl-1.6.923/t/SearchIO/blastxml.t
BioPerl-1.6.923/t/SearchIO/CigarString.t
BioPerl-1.6.923/t/SearchIO/cross_match.t
BioPerl-1.6.923/t/SearchIO/erpin.t
BioPerl-1.6.923/t/SearchIO/exonerate.t
BioPerl-1.6.923/t/SearchIO/fasta.t
BioPerl-1.6.923/t/SearchIO/gmap_f9.t
BioPerl-1.6.923/t/SearchIO/hmmer.t
BioPerl-1.6.923/t/SearchIO/hmmer_pull.t
BioPerl-1.6.923/t/SearchIO/infernal.t
BioPerl-1.6.923/t/SearchIO/megablast.t
BioPerl-1.6.923/t/SearchIO/psl.t
BioPerl-1.6.923/t/SearchIO/rnamotif.t
BioPerl-1.6.923/t/SearchIO/SearchIO.t
BioPerl-1.6.923/t/SearchIO/sim4.t
BioPerl-1.6.923/t/SearchIO/SimilarityPair.t
BioPerl-1.6.923/t/SearchIO/Tiling.t
BioPerl-1.6.923/t/SearchIO/waba.t
BioPerl-1.6.923/t/SearchIO/wise.t
BioPerl-1.6.923/t/SearchIO/Writer
BioPerl-1.6.923/t/SearchIO/Writer/GbrowseGFF.t
BioPerl-1.6.923/t/SearchIO/Writer/HitTableWriter.t
BioPerl-1.6.923/t/SearchIO/Writer/HSPTableWriter.t
BioPerl-1.6.923/t/SearchIO/Writer/HTMLWriter.t
BioPerl-1.6.923/t/SearchIO/Writer/TextWriter.t
BioPerl-1.6.923/t/Seq
BioPerl-1.6.923/t/Seq/DBLink.t
BioPerl-1.6.923/t/Seq/EncodedSeq.t
BioPerl-1.6.923/t/Seq/LargeLocatableSeq.t
BioPerl-1.6.923/t/Seq/LargePSeq.t
BioPerl-1.6.923/t/Seq/LocatableSeq.t
BioPerl-1.6.923/t/Seq/MetaSeq.t
BioPerl-1.6.923/t/Seq/PrimaryQual.t
BioPerl-1.6.923/t/Seq/PrimarySeq.t
BioPerl-1.6.923/t/Seq/PrimedSeq.t
BioPerl-1.6.923/t/Seq/Quality.t
BioPerl-1.6.923/t/Seq/Seq.t
BioPerl-1.6.923/t/Seq/SimulatedRead.t
BioPerl-1.6.923/t/Seq/WithQuality.t
BioPerl-1.6.923/t/SeqFeature
BioPerl-1.6.923/t/SeqFeature/Amplicon.t
BioPerl-1.6.923/t/SeqFeature/Clone.t
BioPerl-1.6.923/t/SeqFeature/Collection.t
BioPerl-1.6.923/t/SeqFeature/Computation.t
BioPerl-1.6.923/t/SeqFeature/FeaturePair.t
BioPerl-1.6.923/t/SeqFeature/Gene.t
BioPerl-1.6.923/t/SeqFeature/Generic.t
BioPerl-1.6.923/t/SeqFeature/Location.t
BioPerl-1.6.923/t/SeqFeature/LocationFactory.t
BioPerl-1.6.923/t/SeqFeature/Primer.t
BioPerl-1.6.923/t/SeqFeature/Range.t
BioPerl-1.6.923/t/SeqFeature/RangeI.t
BioPerl-1.6.923/t/SeqFeature/SeqAnalysisParser.t
BioPerl-1.6.923/t/SeqFeature/SubSeq.t
BioPerl-1.6.923/t/SeqFeature/Unflattener.t
BioPerl-1.6.923/t/SeqFeature/Unflattener2.t
BioPerl-1.6.923/t/SeqIO
BioPerl-1.6.923/t/SeqIO/abi.t
BioPerl-1.6.923/t/SeqIO/ace.t
BioPerl-1.6.923/t/SeqIO/agave.t
BioPerl-1.6.923/t/SeqIO/alf.t
BioPerl-1.6.923/t/SeqIO/asciitree.t
BioPerl-1.6.923/t/SeqIO/bsml.t
BioPerl-1.6.923/t/SeqIO/bsml_sax.t
BioPerl-1.6.923/t/SeqIO/chadoxml.t
BioPerl-1.6.923/t/SeqIO/chaos.t
BioPerl-1.6.923/t/SeqIO/chaosxml.t
BioPerl-1.6.923/t/SeqIO/ctf.t
BioPerl-1.6.923/t/SeqIO/embl.t
BioPerl-1.6.923/t/SeqIO/entrezgene.t
BioPerl-1.6.923/t/SeqIO/excel.t
BioPerl-1.6.923/t/SeqIO/exp.t
BioPerl-1.6.923/t/SeqIO/fasta.t
BioPerl-1.6.923/t/SeqIO/fastq.t
BioPerl-1.6.923/t/SeqIO/flybase_chadoxml.t
BioPerl-1.6.923/t/SeqIO/game.t
BioPerl-1.6.923/t/SeqIO/gbxml.t
BioPerl-1.6.923/t/SeqIO/gcg.t
BioPerl-1.6.923/t/SeqIO/genbank.t
BioPerl-1.6.923/t/SeqIO/Handler.t
BioPerl-1.6.923/t/SeqIO/interpro.t
BioPerl-1.6.923/t/SeqIO/kegg.t
BioPerl-1.6.923/t/SeqIO/largefasta.t
BioPerl-1.6.923/t/SeqIO/lasergene.t
BioPerl-1.6.923/t/SeqIO/locuslink.t
BioPerl-1.6.923/t/SeqIO/mbsout.t
BioPerl-1.6.923/t/SeqIO/metafasta.t
BioPerl-1.6.923/t/SeqIO/msout.t
BioPerl-1.6.923/t/SeqIO/MultiFile.t
BioPerl-1.6.923/t/SeqIO/Multiple_fasta.t
BioPerl-1.6.923/t/SeqIO/nexml.t
BioPerl-1.6.923/t/SeqIO/phd.t
BioPerl-1.6.923/t/SeqIO/pir.t
BioPerl-1.6.923/t/SeqIO/pln.t
BioPerl-1.6.923/t/SeqIO/qual.t
BioPerl-1.6.923/t/SeqIO/raw.t
BioPerl-1.6.923/t/SeqIO/scf.t
BioPerl-1.6.923/t/SeqIO/SeqBuilder.t
BioPerl-1.6.923/t/SeqIO/SeqIO.t
BioPerl-1.6.923/t/SeqIO/seqxml.t
BioPerl-1.6.923/t/SeqIO/Splicedseq.t
BioPerl-1.6.923/t/SeqIO/strider.t
BioPerl-1.6.923/t/SeqIO/swiss.t
BioPerl-1.6.923/t/SeqIO/tab.t
BioPerl-1.6.923/t/SeqIO/table.t
BioPerl-1.6.923/t/SeqIO/tigr.t
BioPerl-1.6.923/t/SeqIO/tigrxml.t
BioPerl-1.6.923/t/SeqIO/tinyseq.t
BioPerl-1.6.923/t/SeqIO/ztr.t
BioPerl-1.6.923/t/SeqTools
BioPerl-1.6.923/t/SeqTools/Backtranslate.t
BioPerl-1.6.923/t/SeqTools/CodonTable.t
BioPerl-1.6.923/t/SeqTools/ECnumber.t
BioPerl-1.6.923/t/SeqTools/GuessSeqFormat.t
BioPerl-1.6.923/t/SeqTools/OddCodes.t
BioPerl-1.6.923/t/SeqTools/SeqPattern.t
BioPerl-1.6.923/t/SeqTools/SeqStats.t
BioPerl-1.6.923/t/SeqTools/SeqUtils.t
BioPerl-1.6.923/t/SeqTools/SeqWords.t
BioPerl-1.6.923/t/Structure
BioPerl-1.6.923/t/Structure/IO.t
BioPerl-1.6.923/t/Structure/Structure.t
BioPerl-1.6.923/t/Tools
BioPerl-1.6.923/t/Tools/AmpliconSearch.t
BioPerl-1.6.923/t/Tools/ePCR.t
BioPerl-1.6.923/t/Tools/Est2Genome.t
BioPerl-1.6.923/t/Tools/FootPrinter.t
BioPerl-1.6.923/t/Tools/Geneid.t
BioPerl-1.6.923/t/Tools/Genewise.t
BioPerl-1.6.923/t/Tools/Genomewise.t
BioPerl-1.6.923/t/Tools/Genpred.t
BioPerl-1.6.923/t/Tools/GFF.t
BioPerl-1.6.923/t/Tools/GuessSeqFormat.t
BioPerl-1.6.923/t/Tools/Hmmer.t
BioPerl-1.6.923/t/Tools/IUPAC.t
BioPerl-1.6.923/t/Tools/Lucy.t
BioPerl-1.6.923/t/Tools/Match.t
BioPerl-1.6.923/t/Tools/pICalculator.t
BioPerl-1.6.923/t/Tools/Primer3.t
BioPerl-1.6.923/t/Tools/Promoterwise.t
BioPerl-1.6.923/t/Tools/Pseudowise.t
BioPerl-1.6.923/t/Tools/QRNA.t
BioPerl-1.6.923/t/Tools/RandDistFunctions.t
BioPerl-1.6.923/t/Tools/RepeatMasker.t
BioPerl-1.6.923/t/Tools/rnamotif.t
BioPerl-1.6.923/t/Tools/Seg.t
BioPerl-1.6.923/t/Tools/Sigcleave.t
BioPerl-1.6.923/t/Tools/Signalp.t
BioPerl-1.6.923/t/Tools/Sim4.t
BioPerl-1.6.923/t/Tools/SiRNA.t
BioPerl-1.6.923/t/Tools/TandemRepeatsFinder.t
BioPerl-1.6.923/t/Tools/TargetP.t
BioPerl-1.6.923/t/Tools/Tmhmm.t
BioPerl-1.6.923/t/Tools/tRNAscanSE.t
BioPerl-1.6.923/t/Tools/Alignment
BioPerl-1.6.923/t/Tools/Alignment/Consed.t
BioPerl-1.6.923/t/Tools/Analysis
BioPerl-1.6.923/t/Tools/Analysis/DNA
BioPerl-1.6.923/t/Tools/Analysis/DNA/ESEfinder.t
BioPerl-1.6.923/t/Tools/Analysis/Protein
BioPerl-1.6.923/t/Tools/Analysis/Protein/Domcut.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/ELM.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/GOR4.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/HNN.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/Mitoprot.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/NetPhos.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/Scansite.t
BioPerl-1.6.923/t/Tools/Analysis/Protein/Sopma.t
BioPerl-1.6.923/t/Tools/EMBOSS
BioPerl-1.6.923/t/Tools/EMBOSS/Palindrome.t
BioPerl-1.6.923/t/Tools/Phylo
BioPerl-1.6.923/t/Tools/Phylo/Gerp.t
BioPerl-1.6.923/t/Tools/Phylo/Molphy.t
BioPerl-1.6.923/t/Tools/Phylo/PAML.t
BioPerl-1.6.923/t/Tools/Phylo/Phylip
BioPerl-1.6.923/t/Tools/Phylo/Phylip/ProtDist.t
BioPerl-1.6.923/t/Tools/Run
BioPerl-1.6.923/t/Tools/Run/Dummy.pm
BioPerl-1.6.923/t/Tools/Run/RemoteBlast.t
BioPerl-1.6.923/t/Tools/Run/RemoteBlast_rpsblast.t
BioPerl-1.6.923/t/Tools/Run/StandAloneBlast.t
BioPerl-1.6.923/t/Tools/Run/WBCommandExts.t
BioPerl-1.6.923/t/Tools/Run/WrapperBase.t
BioPerl-1.6.923/t/Tools/Run/Dummy
BioPerl-1.6.923/t/Tools/Run/Dummy/Config.pm
BioPerl-1.6.923/t/Tools/Signalp
BioPerl-1.6.923/t/Tools/Signalp/ExtendedSignalp.t
BioPerl-1.6.923/t/Tools/Spidey
BioPerl-1.6.923/t/Tools/Spidey/Spidey.t
BioPerl-1.6.923/t/Tree
BioPerl-1.6.923/t/Tree/Compatible.t
BioPerl-1.6.923/t/Tree/Node.t
BioPerl-1.6.923/t/Tree/RandomTreeFactory.t
BioPerl-1.6.923/t/Tree/Tree.t
BioPerl-1.6.923/t/Tree/TreeIO.t
BioPerl-1.6.923/t/Tree/TreeStatistics.t
BioPerl-1.6.923/t/Tree/PhyloNetwork
BioPerl-1.6.923/t/Tree/PhyloNetwork/Factory.t
BioPerl-1.6.923/t/Tree/PhyloNetwork/GraphViz.t
BioPerl-1.6.923/t/Tree/PhyloNetwork/MuVector.t
BioPerl-1.6.923/t/Tree/PhyloNetwork/PhyloNetwork.t
BioPerl-1.6.923/t/Tree/PhyloNetwork/RandomFactory.t
BioPerl-1.6.923/t/Tree/PhyloNetwork/TreeFactory.t
BioPerl-1.6.923/t/Tree/TreeIO
BioPerl-1.6.923/t/Tree/TreeIO/lintree.t
BioPerl-1.6.923/t/Tree/TreeIO/newick.t
BioPerl-1.6.923/t/Tree/TreeIO/nexml.t
BioPerl-1.6.923/t/Tree/TreeIO/nexus.t
BioPerl-1.6.923/t/Tree/TreeIO/nhx.t
BioPerl-1.6.923/t/Tree/TreeIO/phyloxml.t
BioPerl-1.6.923/t/Tree/TreeIO/svggraph.t
BioPerl-1.6.923/t/Tree/TreeIO/tabtree.t
BioPerl-1.6.923/t/Variation
BioPerl-1.6.923/t/Variation/AAChange.t
BioPerl-1.6.923/t/Variation/AAReverseMutate.t
BioPerl-1.6.923/t/Variation/Allele.t
BioPerl-1.6.923/t/Variation/DNAMutation.t
BioPerl-1.6.923/t/Variation/RNAChange.t
BioPerl-1.6.923/t/Variation/SeqDiff.t
BioPerl-1.6.923/t/Variation/SNP.t
BioPerl-1.6.923/t/Variation/Variation_IO.t
/bin/tar: Read 3072 bytes from -
BioPerl-1.6.923/travis_scripts
BioPerl-1.6.923/travis_scripts/dependency_installs
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare'
Configuring C/CJ/CJFIELDS/BioPerl-1.6.923.tar.gz with Build.PL
>>> /home/fly1800/ap1800-297235/bin/perl-static Build.PL
could not find ParserDetails.ini in /home/fly1800/cpanfly-5.18/var/megalib/XML/SAX
Checking prerequisites...
recommends:
* GraphViz is not installed
Checking optional features...
EntrezGene............disabled
requires:
! Bio::ASN1::EntrezGene is not installed
ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions
of the modules indicated above before proceeding with this installation
Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests
Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts
Do you want to run tests that require connection to servers across the internet
(likely to cause some failures)? y/n [n] - will not run internet-requiring tests
Created MYMETA.yml and MYMETA.json
Creating new 'Build' script for 'BioPerl' version '1.006923'
CJFIELDS/BioPerl-1.6.923.tar.gz
/home/fly1800/ap1800-297235/bin/perl-static Build.PL -- OK
Running Build for C/CJ/CJFIELDS/BioPerl-1.6.923.tar.gz
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make'
>>> ./Build
Building BioPerl
CJFIELDS/BioPerl-1.6.923.tar.gz
./Build -- OK
Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test'
Running Build test
>>> ./Build test verbose=1
t/Align/AlignStats.t ...................
1..45
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::AlignIO;
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 38 - An object of class 'Bio::Matrix::PhylipDist' isa 'Bio::Matrix::PhylipDist'
ok 39
ok 40
ok 41
ok 42 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 43
ok 44 - Warn if seqs don't overlap
ok 45
ok
t/Align/AlignUtil.t ....................
1..47
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqIO;
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok
t/Align/Graphics.t .....................
1..41
ok 1 - use Bio::Align::Graphics;
ok 2 - require Bio::Align::Graphics;
ok 3 - Bio::Align::Graphics->can(...)
ok 4 - input is defined
ok 5 - AlignIO object is defined
ok 6 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO'
ok 7 - alignment is there and defined
ok 8 - all starts are present
ok 9 - all ends are present
ok 10 - all colors are present
ok 11 - first end is further than first start
ok 12 - second end is further than second start
ok 13 - third end is further than third start
ok 14 - domain labels are present
ok 15 - domain starts are present
ok 16 - domain ends are present
ok 17 - domain colors are present
ok 18 - label - first end is further than first start
ok 19 - label - second end is further than second start
ok 20 - label - third end is further than third start
ok 21 - first label start is within domain range
ok 22 - second label start is within domain range
ok 23 - third label start is within domain range
ok 24 - first label end is within domain range
ok 25 - second label end is within domain range
ok 26 - third label end is within domain range
ok 27 - individual labels work
ok 28 - An object of class 'Bio::Align::Graphics' isa 'Bio::Align::Graphics'
ok 29 - new object is defined
ok 30 - pad_bottom is right
ok 31 - default pad_top is right
ok 32 - start point loaded
ok 33 - end point loaded
ok 34 - color of domain loaded
ok 35 - domain labels loaded
ok 36 - label starts loaded
ok 37 - label ends loaded
ok 38 - label colors loaded
ok 39 - labels loaded
ok 40 - output file is png
ok 41 - wrapping length is not zero
ok
t/Align/SimpleAlign.t ..................
1..206
ok 1 - use Bio::SimpleAlign;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Location::Simple;
ok 5 - use Bio::Location::Split;
ok 6 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO'
ok 7 - pfam input test
ok 8 - match_line
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10 - num_sequences
ok 11 - num_sequences
ok 12 - select_noncont
ok 13 - select_noncont
ok 14 - num_sequences
ok 15 - select_noncont
ok 16 - select_noncont
ok 17 - select_noncont_by_name
ok 18 - select_noncont_by_name
ok 19 - select_noncont_by_name
ok 20 - select_noncont_by_name
ok 21 - each_seq
ok 22 - get_nse
ok 23 - id
ok 24 - num_gaps
ok 25 - each_alphabetically
ok 26 - column_from_residue_number
ok 27 - display_name get/set
ok 28 - display_name get
ok 29 - consensus_string
ok 30 - consensus_string
ok 31 - consensus_string
ok 32
ok 33 - each_seq_with_id
ok 34 - is_flush
ok 35 - id get/set
ok 36 - length
ok 37 - num_residues
ok 38 - num_sequences
ok 39 - overall_percentage_identity
ok 40 - overall_percentage_identity (align)
ok 41 - overall_percentage_identity (short)
ok 42 - overall_percentage_identity (long)
ok 43 - average_percentage_identity
ok 44
ok 45 - set_displayname_count
ok 46
ok 47 - set_displayname_flat
ok 48
ok 49 - set_displayname_normal
ok 50
ok 51
ok 52 - uppercase, map_chars
ok 53 - match_line
ok 54 - remove_seqs
ok 55 - remove_seqs
ok 56 - add_seq
ok 57 - add_seq
ok 58 - get_seq_by_pos
ok 59 - get_seq_by_pos
ok 60
ok 61
ok 62
ok 63 - purge
ok 64 - purge
ok 65 - IO::String consensus_iupac
ok 66 - IO::String write_aln normal
ok 67 - IO::String write_aln slice
ok 68 - IO::String write_aln slice
ok 69 - IO::String write_aln slice
ok 70 - IO::String write_aln slice
ok 71 - IO::String write_aln slice
ok 72
ok 73 - remove_columns by position
ok 74 - remove_columns by position (wrong order)
ok 75 - cigar_line
ok 76 - cigar_line
ok 77 - cigar_line
ok 78 - cigar_line
ok 79 - sort_alphabetically - before
ok 80
ok 81 - sort_alphabetically - after
ok 82 - remove_gaps
ok 83 - remove_gaps all_gaps_only
ok 84 - set_new_reference
ok 85 - set_new_reference
ok 86 - uniq_seq
ok 87 - bug 2099
ok 88 - bug 2099
ok 89 - bug 2793
ok 90 - bug 2793
ok 91 - bug 2793
ok 92 - bug 2793
ok 93 - Bad sequence, bad!
ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI'
ok 95 - added 3 seqs
ok 96 - first 2 features added
ok 97 - 3rd feature added
ok 98
ok 99 - slice 1 len
ok 100 - correct masked seq
ok 101 - correct masked seq
ok 102 - correct masked seq
ok 103
ok 104 - slice 2 len
ok 105 - correct masked seq
ok 106 - correct masked seq
ok 107 - correct masked seq
ok 108
ok 109 - slice 3 len
ok 110 - correct masked seq
ok 111 - correct masked seq
ok 112 - correct masked seq
ok 113
ok 114 - slice 4 len
ok 115 - correct masked seq
ok 116 - correct masked seq
ok 117 - correct masked seq
ok 118 - initial display id ok
ok 119 - safe display id ok
ok 120 - restored display id ok
ok 121 - sort by list ok
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128 - BIC:GGATCCATT[C/C]CTACT
ok 129 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT
ok 130 - BIC:G[G/C]ATCCATT[C/G]CTACT
ok 131 - BIC:GGATCCATT[C/G]CTACT
ok 132 - BIC:GGATCCATT[C/G]CTAC[T/A]
ok 133 - BIC:GGATCCATT[C/G]CTA[C/G][T/A]
ok 134 - BIC:GGATCCATT[C/G]CTACT
ok 135 - BIC:GGATCCATT{C.C}CTACT
ok 136 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT
ok 137 - BIC:G{G.C}ATCCATT{C.G}CTACT
ok 138 - BIC:GGATCCATT{C.G}CTACT
ok 139 - BIC:GGATCCATT{C.G}CTAC{T.A}
ok 140 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A}
ok 141 - BIC:GGATCCATT{C.G}CTACT
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 200 - consensus string looks ok
ok 201 - conservation length
ok 202 - conservation scores
ok 203 - looks like correct unmasked alignment (from clustalw)
ok 204 - looks like correct masked alignment (from clustalw)
ok 205
ok 206 - align after looks ok
ok
t/Align/TreeBuild.t ....................
1..13
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::Align::Utilities;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Tree::DistanceFactory;
ok 6 - use Bio::TreeIO;
ok 7 - 'SimpleAlign object parsed out' isa 'Bio::SimpleAlign'
ok 8 - 'Protein distance matrix retrieved' isa 'Bio::Matrix::MatrixI'
ok 9 - 'Tree object gotten back' isa 'Bio::Tree::TreeI'
ok 10 - NJ calculated Branch length
ok 11 - NJ calculated Branch length
ok 12 - Make sure two nodes are sister
ok 13 - 10 replicates formulated
ok
t/Align/Utilities.t ....................
1..13
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::SimpleAlign;
ok 3 - use Bio::PrimarySeq;
ok 4 - use Bio::LocatableSeq;
ok 5 - use Bio::AlignIO;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok
t/AlignIO/AlignIO.t ....................
1..29
ok 1 - use Bio::AlignIO;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI'
ok 3 - input filehandle method test : prodom
ok 4 - input filehandle method test : mase
ok 5 - input filehandle method test : po
ok 6 - input filehandle method test : stockholm
ok 7 - input filehandle method test : pfam
ok 8 - input filehandle method test : selex
ok 9 - input filehandle method test : nexus
ok 10 - input filehandle method test : psi
ok 11 - input filehandle method test : clustalw
ok 12 - input filehandle method test : metafasta
ok 13 - input filehandle method test : arp
ok 14 - input filehandle method test : xmfa
ok 15 - input filehandle method test : msf
ok 16 - input filehandle method test : phylip
ok 17 - input filehandle method test : fasta
ok 18 - filehandle output test : po
ok 19 - filehandle output test : stockholm
ok 20 - filehandle output test : pfam
ok 21 - filehandle output test : selex
ok 22 - filehandle output test : nexus
ok 23 - filehandle output test : psi
ok 24 - filehandle output test : clustalw
ok 25 - filehandle output test : metafasta
ok 26 - filehandle output test : xmfa
ok 27 - filehandle output test : msf
ok 28 - filehandle output test : phylip
ok 29 - filehandle output test : fasta
ok
t/AlignIO/arp.t ........................
1..48
ok 1 - use Bio::AlignIO::arp;
ok 2 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4 - ARP get_nse()
ok 5
ok 6 - ARP num_sequences()
ok 7 - ARP id()
ok 8 - ARP description()
ok 9 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 10 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO'
ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 17 - ARP get_nse()
ok 18 - ARP num_sequences()
ok 19 - ARP id()
ok 20 - ARP description()
ok 21 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 22 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 23
ok 24
ok 25
ok 26
ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 28 - ARP get_nse()
ok 29 - ARP num_sequences()
ok 30 - ARP id()
ok 31 - ARP description()
ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 33 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 34
ok 35
ok 36
ok 37
ok 38 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 39 - ARP get_nse()
ok 40 - ARP num_sequences()
ok 41 - ARP id()
ok 42 - ARP description()
ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 44 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 45
ok 46
ok 47
ok 48
ok
t/AlignIO/bl2seq.t .....................
1..7
ok 1 - use Bio::AlignIO::bl2seq;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - BLAST bl2seq format test
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7
ok
t/AlignIO/clustalw.t ...................
1..6
ok 1 - use Bio::AlignIO::clustalw;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - clustalw consensus_string test
ok 4 - clustalw (.aln) output test
ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 6 - clustalw (.aln) input test
ok
t/AlignIO/emboss.t .....................
1..37
ok 1 - use Bio::AlignIO::emboss;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 15
ok 16
ok 17
ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 19
ok 20
ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/AlignIO/fasta.t ......................
1..10
ok 1 - use Bio::AlignIO::fasta;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - fasta input test
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for end
ok 7 - fasta input test for description
ok 8 - fasta output test
ok 9 - filehandle input test
ok 10 - filehandle output test
ok
t/AlignIO/largemultifasta.t ............
1..7
ok 1 - use Bio::AlignIO::largemultifasta;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - fasta input test
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for description
ok 7 - fasta output test
ok
t/AlignIO/maf.t ........................
1..11
ok 1 - use Bio::AlignIO::maf;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - maf input test
ok 4
ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 6 - maf input test
ok 7
ok 8 - maf input test
ok 9
ok 10 - maf input test
ok 11
ok
t/AlignIO/mase.t .......................
1..3
ok 1 - use Bio::AlignIO::mase;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - mase input test
ok
t/AlignIO/mega.t .......................
1..6
ok 1 - use Bio::AlignIO::mega;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3
ok 4
ok 5
ok 6 - mega output test
ok
t/AlignIO/meme.t .......................
1..20
ok 1 - use Bio::AlignIO::meme;
ok 2 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5
ok 6
ok 7
ok 8 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO'
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO'
ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 17
ok 18
ok 19
ok 20
ok
t/AlignIO/metafasta.t ..................
1..4
ok 1 - use Bio::AlignIO::metafasta;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - consensus_string on metafasta
ok 4 - symbol_chars() using metafasta
ok
t/AlignIO/msf.t ........................
1..4
ok 1 - use Bio::AlignIO::msf;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - msf input test
ok 4 - msf output test
ok
# WARNING: NeXML parsing for NeXML v0.9 is currently very experimental support
t/AlignIO/nexml.t ......................
1..125
ok 1 - use Bio::AlignIO::nexml;
ok 2 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 3 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 4 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 5 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 6 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 7 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 8 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 9 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 10 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 11 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 12 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 13 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 14 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 15 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 16 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 17 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 18 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 19 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 20 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 21 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 22 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 23 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 24 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 25 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 26 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 27 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 28 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 29 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 30 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 31 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 32 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 33 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 34 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 35 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 36 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 37 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 38 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 39 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 40 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 41 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 42 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 43 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 44 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 45 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 46 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 47 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 48 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 49 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 50 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 51 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 52 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 53 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 54 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 55 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 56 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 57 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 58 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 59 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 60 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 61 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 62 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 63 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 64 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 65 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 66 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 67 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 68 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 69 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 70 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 71 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 72 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 73 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 74 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 75 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 76 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 77 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 78 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 79 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 80 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 81 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 82 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 83 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 84 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 85 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 86 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 87 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 88 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 89 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 90 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 91 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 92 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 93 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 94 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 95 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 96 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 97 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 98 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 99 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 100 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 101 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 102 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 103 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 104 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 105 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 106 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 107 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 108 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 109 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 110 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 111 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 112 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 113 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 114 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 115 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 116 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 117 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 118 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 119 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 120 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 121 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 122 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 123 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 124 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 125 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok
t/AlignIO/nexus.t ......................
1..43
ok 1 - use Bio::AlignIO::nexus;
ok 2 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5 - nexus output test
ok 6 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 11 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 12 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 14 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 15 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 16 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 18 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 20 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 22 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 23 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 24 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 25 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 26 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 28 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 30 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 32 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 33 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 34 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 35 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 36 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 38 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 40 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 41 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 42 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO'
ok 43 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok
t/AlignIO/pfam.t .......................
1..5
ok 1 - use Bio::AlignIO::pfam;
ok 2 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5 - pfam output test
ok
t/AlignIO/phylip.t .....................
1..17
ok 1 - use Bio::AlignIO::phylip;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3
ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10
ok 11 - phylip output test
ok 12
ok 13
ok 14
not ok 15 # TODO problems with default strand, length?
# Failed (TODO) test at t/AlignIO/phylip.t line 81.
# got: undef
# expected: '0'
not ok 16 # TODO problems with default strand, length?
# Failed (TODO) test at t/AlignIO/phylip.t line 82.
# got: '50'
# expected: '47'
ok 17 - newline between header and sequences is parsed correctly
ok
t/AlignIO/po.t .........................
1..11
ok 1 - use Bio::AlignIO::po;
ok 2 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO'
ok 6 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 7 - po output test
ok 8 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO'
ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 10
ok 11
ok
t/AlignIO/prodom.t .....................
1..3
ok 1 - use Bio::AlignIO::prodom;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - prodom input test
ok
t/AlignIO/psi.t ........................
1..5
ok 1 - use Bio::AlignIO::psi;
ok 2 - An object of class 'Bio::AlignIO::psi' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5
ok
t/AlignIO/selex.t ......................
1..4
ok 1 - use Bio::AlignIO::selex;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - selex format test
ok 4 - selex output test
ok
t/AlignIO/stockholm.t ..................
1..87
ok 1 - use Bio::AlignIO::stockholm;
ok 2 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO'
ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 10 - Stockholm annotation
ok 11 - Stockholm annotation
ok 12 - stockholm output test
ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20 - 'Stockholm annotation' isa 'Bio::Annotation::Reference'
ok 21 - Stockholm annotation
ok 22 - Stockholm annotation
ok 23 - Stockholm annotation
ok 24 - Stockholm annotation
ok 25 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI'
ok 26 - Rfam meta data
ok 27 - Rfam meta data
ok 28
ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI'
ok 36 - Rfam meta data
ok 37 - Rfam meta data
ok 38 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO'
ok 39
ok 40 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 41
ok 42
ok 43
ok 44
ok 45 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 46 - Pfam annotation
ok 47
ok 48 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 49
ok 50
ok 51
ok 52
ok 53 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI'
ok 60 - Pfam aln meta data
ok 61 - Pfam aln meta data
ok 62 - Pfam aln meta data
ok 63 - Pfam aln meta data
ok 64 - Pfam aln meta data
ok 65 - Pfam aln meta data
ok 66 - Pfam seq meta data
ok 67 - Pfam seq meta data
ok 68 - Pfam seq meta data
ok 69 - Pfam seq meta data
ok 70
ok 71 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI'
ok 72 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta'
ok 73 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI'
ok 74 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::DBLink'
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok
t/AlignIO/xmfa.t .......................
1..30
ok 1 - use Bio::AlignIO::xmfa;
ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 3 - xmfa input test
ok 4 - xmfa input test for start
ok 5 - xmfa input test for end
ok 6 - xmfa strand test
ok 7 - xmfa input test for id
ok 8 - xmfa input test for id
ok 9 - xmfa input test
ok 10 - xmfa input test for start
ok 11 - xmfa input test for end
ok 12 - xmfa strand test
ok 13 - xmfa input test for id
ok 14 - xmfa input test for id
ok 15 - xmfa input test
ok 16 - xmfa input test for start
ok 17 - xmfa input test for end
ok 18 - xmfa strand test
ok 19 - xmfa input test for id
ok 20 - xmfa input test for id
ok 21 - xmfa alignment score
ok 22 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 23 - xmfa input test
ok 24 - xmfa strand
ok 25 - xmfa input test for description
ok 26 - xmfa input test for id
ok 27 - xmfa input test for end
ok 28 - xmfa input test for end
ok 29 - xmfa alignment score
ok 30 - xmfa output test
ok
t/Alphabet.t ...........................
1..100
ok 1 - use Bio::Symbol::Alphabet;
ok 2 - use Bio::Symbol::Symbol;
ok 3 - use Bio::Symbol::DNAAlphabet;
ok 4 - use Bio::Symbol::ProteinAlphabet;
ok 5 - An object of class 'Bio::Symbol::Alphabet' isa 'Bio::Symbol::Alphabet'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - An object of class 'Bio::Symbol::DNAAlphabet' isa 'Bio::Symbol::AlphabetI'
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - An object of class 'Bio::Symbol::ProteinAlphabet' isa 'Bio::Symbol::AlphabetI'
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok
t/Annotation/Annotation.t ..............
1..152
ok 1 - use Bio::Annotation::Collection;
ok 2 - use Bio::Annotation::DBLink;
ok 3 - use Bio::Annotation::Comment;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6 - use Bio::Annotation::Target;
ok 7 - use Bio::Annotation::AnnotationFactory;
ok 8 - use Bio::Annotation::StructuredValue;
ok 9 - use Bio::Annotation::TagTree;
ok 10 - use Bio::Annotation::Tree;
ok 11 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::AnnotationI'
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::AnnotationI'
ok 19
ok 20
ok 21
ok 22 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 23
ok 24
ok 25 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI'
ok 26
ok 27 - An object of class 'Bio::Annotation::Reference' isa 'Bio::AnnotationI'
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::AnnotationI'
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 66
ok 67
ok 68
ok 69
ok 70 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::Annotation::StructuredValue'
ok 71
ok 72
ok 73
ok 74
ok 75 - use Bio::Annotation::OntologyTerm;
ok 76 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::Term'
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82 - 'isa SeqFeatureI' isa 'Bio::SeqFeatureI'
ok 83 - 'isa AnnotatableI' isa 'Bio::AnnotatableI'
ok 84 - 'isa SeqFeatureI' isa 'Bio::SeqFeatureI'
ok 85 - 'isa AnnotatableI' isa 'Bio::AnnotatableI'
ok 86 - An object of class 'Bio::Annotation::AnnotationFactory' isa 'Bio::Factory::ObjectFactoryI'
ok 87 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue'
ok 88
ok 89 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Annotation::OntologyTerm'
ok 90 - Bio::Annotation::Comment
ok 91 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 92
ok 93 - Bio::Annotation::Comment
ok 94 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 95 - Bio::Annotation::Comment
ok 96 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment'
ok 97
ok 98 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::Target'
ok 99
ok 100
ok 101 - An object of class 'Bio::Annotation::Tree' isa 'Bio::AnnotationI'
ok 102 - tree_id()
ok 103 - tagname()
ok 104
ok 105 - add tree to AlignI
ok 106 - get seq from node id
ok 107
ok 108 - An object of class 'Bio::Annotation::Tree' isa 'Bio::Annotation::Tree'
ok 109 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 110 - default itext
ok 111 - roundtrip
ok 112 - itext
ok 113 - spxr
ok 114 - indent
ok 115 - xml
ok 116 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 117
ok 118 - child changes
ok 119 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 120
ok 121 - child changes
ok 122 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 123
ok 124 - child changes
ok 125 - child changes in parent node
ok 126 - no tags
ok 127 - before Stag node
ok 128 - after Stag node
ok 129 - both stag nodes
ok 130 - different instances
ok 131 - before TagTree
ok 132 - after TagTree
ok 133 - both stag nodes
ok 134 - different instances
ok 135 - before TagTree
ok 136 - after TagTree
ok 137 - stag nodes
ok 138 - same instance
ok 139 - before TagTree
ok 140 - after TagTree
ok 141 - stag nodes
ok 142 - different instance
ok 143 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI'
ok 144 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 145 - child changes
ok 146 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 147 - child changes
ok 148 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI'
ok 149 - child changes
ok 150
ok 151
ok 152 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::Annotation::TagTree'
ok
t/Annotation/AnnotationAdaptor.t .......
1..23
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::SeqFeature::AnnotationAdaptor;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
t/Assembly/ContigSpectrum.t ............
1..239
ok 1 - use Bio::Assembly::IO;
ok 2 - use Bio::Assembly::Tools::ContigSpectrum;
ok 3 - An object of class 'Bio::Assembly::IO::tigr' isa 'Bio::Assembly::IO'
ok 4 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold'
ok 5 - get/set methods
ok 6 - An object of class 'Bio::Assembly::Tools::ContigSpectrum' isa 'Bio::Assembly::Tools::ContigSpectrum'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - simple spectrum
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48 - contig spectrum score
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57 - mixed contig spectrum
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70 - dissolved contig spectrum
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131 - cross-contig spectrum
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139 - cross-contig spectrum
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151 - cross-contig spectrum
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160 - contig spectrum sum
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - average contig spectrum
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189 - drop assembly
ok 190
ok 191 - An object of class 'Bio::Assembly::IO::ace' isa 'Bio::Assembly::IO'
ok 192 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold'
ok 193 - large contig spectrum
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206 - 74.7485808732225
ok 207 - 74.7485808732225
ok 208 - large cross-contig spectrum
ok 209
ok 210 - 88.7692307692308
ok 211 - 88.7692307692308
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222 - one contig at a time
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok
t/Assembly/IO/bowtie.t ................. skipped: The optional module Bio::DB::Sam (or dependencies thereof) was not installed
t/Assembly/IO/sam.t .................... skipped: The optional module Bio::DB::Sam (or dependencies thereof) was not installed
t/Assembly/core.t ......................
1..890
ok 1 - use Bio::Seq;
ok 2 - use Bio::LocatableSeq;
ok 3 - use Bio::Seq::Quality;
ok 4 - use Bio::Assembly::IO;
ok 5 - use Bio::Assembly::Singlet;
ok 6 - singlet from Bio::PrimarySeq
ok 7 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 8 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Singlet'
ok 9
ok 10
ok 11 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 - singlet from Bio::Seq::Quality
ok 25
ok 26
ok 27 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::QualI'
ok 28
ok 29 - singlet from LocatableSeq
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38 - singlet from LocatableSeq with set coordinates
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48 - consed
ok 49
ok 50
ok 51
ok 52
ok 53 - An object of class 'Bio::Assembly::IO::phrap' isa 'Bio::Assembly::IO'
ok 54 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 55 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 56 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 57 - An object of class 'Bio::Assembly::IO::phrap' isa 'Bio::Assembly::IO'
not ok 58 # TODO phrap parser doesn't include the sequence string in the sequence objects.
# Failed (TODO) test at t/Assembly/core.t line 126.
ok 59
ok 60 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold'
ok 61
ok 62
ok 63 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 64 - no annotations in Annotation collection?
ok 65
ok 66
ok 67 - get_nof_singlets
ok 68 - get_contig_seq_ids
ok 69 - get_contig_ids
ok 70 - get_singlet_ids
ok 71 - 'the contig is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 72 - 'the singlet is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 73 - 'the singlet is a Bio::Assembly::Singlet' isa 'Bio::Assembly::Singlet'
ok 74 - get_contig_seq_ids
ok 75
ok 76
ok 77
ok 78 - get_contig_ids
ok 79
ok 80
ok 81 - get_singlet_ids
ok 82
ok 83
ok 84
ok 85 - get_all_seq_ids
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92 - contig features
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - get_nof_singlets
ok 100 - get_contig_seq_ids
ok 101 - get_contig_ids
ok 102 - get_singlet_ids
ok 103 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 104 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 105 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 106 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 107 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 108 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 109 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 110 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 111 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 112 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 113 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 114 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 115 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 116 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 117 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 118 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 119 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 120 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 121 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 122 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 123 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 124 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 125 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 126 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 127 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 128 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 129 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 130 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 131 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 132 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 133 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 134 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 135 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 136 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 137 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 138 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 139
ok 140 - 'the contig is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146 - get_nof_singlets
ok 147 - 'the singlet is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 148 - 'the singlet is a Bio::Assembly::Singlet' isa 'Bio::Assembly::Singlet'
ok 149 - get_contig_seq_ids
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157 - get_contig_ids
ok 158
ok 159
ok 160
ok 161
ok 162 - get_singlet_ids
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197 - get_all_seq_ids
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239 - 454 ACE variant coordinates check
ok 240
ok 241 - 454 ACE variant consensus check
ok 242
ok 243
ok 244
ok 245
ok 246 - writing in the ACE format
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 253 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 254 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 255 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 256 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 257 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 258 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 259 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 260 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 261 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 262 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 263 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 264 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 265 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 266 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold'
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 275 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 276
ok 277
ok 278
ok 279 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI'
ok 280 - no annotations in Annotation collection?
ok 281 - writing in the TIGR format
ok 282 - init maq IO object
ok 283 - get maq assy
ok 284 - got all contigs
ok 285 - read test file as text
ok 286 - recorded all maq reads
ok 287 - no singlets
ok 288
ok 289 - An object of class 'Bio::Assembly::IO::maq' isa 'Bio::Assembly::IO'
ok 290 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 291 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 292 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 293 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 294 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 295 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 296 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 297 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 298 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 299 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 300 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 301
ok 302 - get maq assy
ok 303 - An object of class 'Bio::Assembly::IO::maq' isa 'Bio::Assembly::IO'
ok 304 - get_contig_seq_ids
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517
ok 518
ok 519
ok 520
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551
ok 552 - get_contig_ids
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561
ok 562
ok 563
ok 564
ok 565
ok 566
ok 567
ok 568
ok 569
ok 570
ok 571
ok 572
ok 573
ok 574
ok 575
ok 576
ok 577
ok 578
ok 579
ok 580
ok 581
ok 582
ok 583
ok 584
ok 585
ok 586
ok 587
ok 588
ok 589
ok 590
ok 591 - get_singlet_ids
ok 592
ok 593
ok 594
ok 595
ok 596
ok 597 - get_all_seq_ids
ok 598
ok 599
ok 600
ok 601
ok 602
ok 603
ok 604
ok 605
ok 606
ok 607
ok 608
ok 609
ok 610
ok 611
ok 612
ok 613
ok 614
ok 615
ok 616
ok 617
ok 618
ok 619
ok 620
ok 621
ok 622
ok 623
ok 624
ok 625
ok 626
ok 627
ok 628
ok 629
ok 630
ok 631
ok 632
ok 633
ok 634
ok 635
ok 636
ok 637
ok 638
ok 639
ok 640
ok 641
ok 642
ok 643
ok 644
ok 645
ok 646
ok 647
ok 648
ok 649
ok 650
ok 651
ok 652
ok 653
ok 654
ok 655
ok 656
ok 657
ok 658
ok 659
ok 660
ok 661
ok 662
ok 663
ok 664
ok 665
ok 666
ok 667
ok 668
ok 669
ok 670
ok 671
ok 672
ok 673
ok 674
ok 675
ok 676
ok 677
ok 678
ok 679
ok 680
ok 681
ok 682
ok 683
ok 684
ok 685
ok 686
ok 687
ok 688
ok 689
ok 690
ok 691
ok 692
ok 693
ok 694
ok 695
ok 696
ok 697
ok 698
ok 699
ok 700
ok 701
ok 702
ok 703
ok 704
ok 705
ok 706
ok 707
ok 708
ok 709
ok 710
ok 711
ok 712
ok 713
ok 714
ok 715
ok 716
ok 717
ok 718
ok 719
ok 720
ok 721
ok 722
ok 723
ok 724
ok 725
ok 726
ok 727
ok 728
ok 729
ok 730
ok 731
ok 732
ok 733
ok 734
ok 735
ok 736
ok 737
ok 738
ok 739
ok 740
ok 741
ok 742
ok 743
ok 744
ok 745
ok 746
ok 747
ok 748
ok 749
ok 750
ok 751
ok 752
ok 753
ok 754
ok 755
ok 756
ok 757
ok 758
ok 759
ok 760
ok 761
ok 762
ok 763
ok 764
ok 765
ok 766
ok 767
ok 768
ok 769
ok 770
ok 771
ok 772
ok 773
ok 774
ok 775
ok 776
ok 777
ok 778
ok 779
ok 780
ok 781
ok 782
ok 783
ok 784
ok 785
ok 786
ok 787
ok 788
ok 789
ok 790
ok 791
ok 792
ok 793
ok 794
ok 795
ok 796
ok 797
ok 798
ok 799
ok 800
ok 801
ok 802
ok 803
ok 804
ok 805
ok 806
ok 807
ok 808
ok 809
ok 810
ok 811
ok 812
ok 813
ok 814
ok 815
ok 816
ok 817
ok 818
ok 819
ok 820
ok 821
ok 822
ok 823
ok 824
ok 825
ok 826
ok 827
ok 828
ok 829
ok 830
ok 831
ok 832
ok 833
ok 834
ok 835
ok 836
ok 837
ok 838
ok 839
ok 840
ok 841
ok 842
ok 843
ok 844
ok 845
ok 846
ok 847
ok 848
ok 849
ok 850 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 851 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 852 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 853 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 854 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 855 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 856 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 857 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 858 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 859 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 860 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 861 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 862 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 863 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 864 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 865 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 866 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 867 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 868 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 869 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 870 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 871 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 872 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 873 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 874 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 875 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 876 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 877 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig'
ok 878 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 879 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 880 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 881 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 882 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 883 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 884 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 885 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 886 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 887 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 888 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 889 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok 890 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig'
ok
t/Cluster/UniGene.t ....................
1..2
ok 1 - use Bio::Cluster::UniGene;
ok 2 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::AnnotatableI'
ok
t/ClusterIO/ClusterIO.t ................
1..12
ok 1 - use Bio::ClusterIO;
ok 2 - use Bio::Cluster::ClusterFactory;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI'
ok 12 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI'
ok
t/ClusterIO/SequenceFamily.t ...........
1..17
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Cluster::SequenceFamily;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok
t/ClusterIO/unigene.t ..................
1..73
ok 1 - use Bio::ClusterIO;
ok 2 - new Bio::ClusterIO object defined
ok 3
ok 4 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI'
ok 5 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::ClusterI'
ok 6 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::IdentifiableI'
ok 7 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::DescribableI'
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 49
ok 50
ok 51 - annotation object defined
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI'
ok 67
ok 68 - next cluster
ok 69
ok 70
ok 71
ok 72
ok 73
ok
t/Coordinate/CoordinateBoundaryTest.t ..
1..174
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3
ok 4 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 5
ok 6 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 7
ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 9
ok 10 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair'
ok 11
ok 12 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair'
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 33
ok 34 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 35
ok 36 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 51
ok 52 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 53
ok 54 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 69
ok 70 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 71
ok 72 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 89
ok 90 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 91
ok 92 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 109
ok 110 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 111
ok 112 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 113
ok 114 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair'
ok 115
ok 116 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair'
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 133
ok 134 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 143
ok 144 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 153
ok 154 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 165
ok 166 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok
t/Coordinate/CoordinateGraph.t .........
1..7
ok 1 - use Bio::Coordinate::Graph;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok
t/Coordinate/CoordinateMapper.t ........
1..175
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3 - use Bio::Coordinate::Result::Match;
ok 4 - use Bio::Coordinate::Result::Gap;
ok 5 - use Bio::Coordinate::Chain;
ok 6 - use Bio::Coordinate::Collection;
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result'
ok 15 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Location::SplitLocationI'
ok 16
ok 17
ok 18
ok 19 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::LocationI'
ok 20 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match'
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::Coordinate::Result::Gap'
ok 38 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::LocationI'
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match'
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138 - Match: |314696| Test: 314696|
ok 139
ok 140
ok 141
ok 142 - Match: |341| Test: 341|
ok 143
ok 144
ok 145
ok 146 - Match: |315843| Test: 315843|
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152 - Match: |627011| Test: 627011|
ok 153
ok 154
ok 155
ok 156 - Match: |chr1| Test: chr1|
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok
t/Coordinate/GeneCoordinateMapper.t ....
1..116
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3 - use Bio::Coordinate::ExtrapolatingPair;
ok 4 - use Bio::Coordinate::GeneMapper;
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple'
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple'
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok
t/Draw/Pictogram.t .....................
1..6
ok 1 - use Bio::Draw::Pictogram;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::Matrix::PSM::IO;
ok 4 - An object of class 'Bio::Draw::Pictogram' isa 'Bio::Draw::Pictogram'
ok 5
ok 6
ok
t/LiveSeq/Chain.t ......................
1..45
ok 1 - use Bio::LiveSeq::Chain;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok
t/LiveSeq/LiveSeq.t ....................
1..48
ok 1 - use Bio::LiveSeq::IO::BioPerl;
ok 2
ok 3
ok 4 - Bio::LiveSeq::Gene
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok
t/LiveSeq/Mutation.t ...................
1..19
ok 1 - use Bio::LiveSeq::Mutation;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/LiveSeq/Mutator.t ....................
1..24
ok 1 - use Bio::LiveSeq::Mutator;
ok 2 - use Bio::LiveSeq::IO::BioPerl;
ok 3 - use Bio::Variation::IO;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
You are loading a Bio::DB::GFF database with GFF3 formatted data.
While this will likely work fine, the Bio::DB::GFF schema does not
always faithfully capture the complexity represented in GFF3 files.
Unless you have a specific reason for using Bio::DB::GFF, we suggest
that you use a Bio::DB::SeqFeature::Store database and its corresponding
loader, bp_seqfeature_load.pl.
t/LocalDB/BioDBGFF.t ...................
1..275
ok 1 - use Bio::DB::GFF;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 102 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132 # skip delete_groups() not implemented by this adaptor
ok 133 # skip delete_groups() not implemented by this adaptor
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 239 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246 # skip preferred groups are not supported by gff3
ok 247 # skip preferred groups are not supported by gff3
ok 248 # skip preferred groups are not supported by gff3
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269 # skip delete_groups() not implemented by this adaptor
ok 270 # skip delete_groups() not implemented by this adaptor
ok 271
ok 272
ok 273
ok 274
ok 275
ok
t/LocalDB/Fasta.t ......................
1..107
ok 1 - Index a directory
ok 2
ok 3 - An object of class 'Bio::DB::Fasta' isa 'Bio::DB::Fasta'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 29 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - bug 3126
ok 38
ok 39
ok 40 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 41 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 42
ok 43
ok 44
ok 45 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta'
ok 46 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 47
ok 48
ok 49 - use Class::Unload;
ok 50 - Re-open an existing index
ok 51
ok 52 - Tied hash access
ok 53
ok 54
ok 55
ok 56
ok 57 - Writing with SeqIO
ok 58
ok 59
ok 60 - Index a single file
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream'
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88 - Make single ID
ok 89
ok 90
ok 91 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 92 - Make multiple IDs, bug \#3389
ok 93
ok 94
ok 95 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI'
ok 96 - Index a set of files
ok 97
ok 98
ok 99
ok 100
ok 101 - threw Regexp ((?^:FASTA header doesn't match))
ok 102 - threw Regexp ((?^:Blank lines can only precede header lines))
ok 103
ok 104 - length is correct in sequences past spaces
ok 105
ok 106 - subseq is correct
ok 107 - subseq is correct
ok
t/LocalDB/Flat.t .......................
1..25
ok 1 - use Bio::DB::Flat;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok
t/LocalDB/Index/Blast.t ................
1..26
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::Blast;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok
t/LocalDB/Index/BlastTable.t ...........
1..27
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::BlastTable;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/LocalDB/Index/Index.t ................
1..69
ok 1 - use Bio::Index::Fasta;
ok 2 - use Bio::Index::Qual;
ok 3 - use Bio::Index::SwissPfam;
ok 4 - use Bio::Index::EMBL;
ok 5 - use Bio::Index::GenBank;
ok 6 - use Bio::Index::Stockholm;
ok 7 - use Bio::Index::Swissprot;
ok 8 - use Bio::DB::InMemoryCache;
ok 9 - use Bio::DB::InMemoryCache;
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 19
ok 20
ok 21
ok 22 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - An object of class 'Bio::Index::Stockholm' isa 'Bio::Index::Stockholm'
ok 68
ok 69 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok
t/LocalDB/Qual.t .......................
1..56
ok 1 - use Bio::Root::IO;
ok 2 - use File::Copy;
ok 3
ok 4
ok 5 - An object of class 'Bio::DB::Qual' isa 'Bio::DB::Qual'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual'
ok 23 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI'
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual'
ok 38 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI'
ok 39
ok 40
ok 41
ok 42 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual'
ok 43 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual'
ok 44
ok 45
ok 46
ok 47
ok 48 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream'
ok 49
ok 50 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual'
ok 51
ok 52 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual'
ok 53
ok 54
ok 55
ok 56
ok
t/LocalDB/Registry.t ...................
1..14
ok 1 - use Bio::DB::Registry;
ok 2 - use Bio::DB::Flat;
ok 3
ok 4
ok 5
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok
t/LocalDB/SeqFeature.t .................
1..116
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::DB::SeqFeature::Store;
ok 3 - use Bio::DB::SeqFeature::Store::GFF3Loader;
ok 4 - use Bio::Root::IO;
ok 5 - use Bio::DB::Fasta;
ok 6 - use File::Copy;
ok 7
ok 8
ok 9
ok 10 - adding a feature
ok 11
ok 12
ok 13
ok 14 - adding a feature with no primary_id
ok 15
ok 16 - searching for a feature that shouldnt exist
ok 17 - simple type
ok 18 - base type with colon
ok 19 - base type alone
ok 20 - queried types are not interpolated
ok 21
ok 22
ok 23 - An object of class 'Bio::DB::GFF::Typename' isa 'Bio::DB::GFF::Typename'
ok 24 - feature deletion
ok 25
ok 26
ok 27 - adding subfeatures
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - feature names should be case insensitive
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64 - base type
ok 65 - base:source type
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73 - An object of class 'Bio::Location::Split' isa 'Bio::Location::Split'
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102 - keyword search; 1 term
ok 103 - keyword search; 2 terms
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors
ok 112 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors
ok 113 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors
ok 114 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors
ok 115 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors
ok 116 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors
ok
t/LocalDB/Taxonomy/greengenes.t ........
1..38
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
ok 4 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::greengenes'
ok 5 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::list'
ok 6 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok
t/LocalDB/Taxonomy/silva.t .............
1..42
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
ok 4 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::silva'
ok 5 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::list'
ok 6 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok
t/LocalDB/transfac_pro.t ...............
1..115
ok 1 - use Bio::Matrix::PSM::IO;
ok 2 - use Bio::DB::TFBS;
ok 3 - use Bio::DB::Taxonomy;
ok 4
ok 5
ok 6
ok 7
ok 8 - An object of class 'Bio::Annotation::Reference' isa 'Bio::Annotation::Reference'
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39 - An object of class 'Bio::Seq' isa 'Bio::Seq'
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57 - An object of class 'Bio::Matrix::PSM::SiteMatrix' isa 'Bio::Matrix::PSM::SiteMatrix'
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107 - An object of class 'Bio::Map::TranscriptionFactor' isa 'Bio::Map::TranscriptionFactor'
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok
t/Map/Cyto.t ...........................
1..110
ok 1 - use Bio::Map::CytoMap;
ok 2 - use Bio::Map::CytoPosition;
ok 3 - use Bio::Map::CytoMarker;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::Map::CytoPosition' isa 'Bio::Map::CytoPosition'
ok 15
ok 16
ok 17
ok 18 - An object of class 'Bio::Range' isa 'Bio::Range'
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok
t/Map/Linkage.t ........................
1..18
ok 1 - use Bio::Map::LinkagePosition;
ok 2 - use Bio::Map::Microsatellite;
ok 3 - use Bio::Map::LinkageMap;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/Map/Map.t ............................
1..267
ok 1 - use Bio::Map::SimpleMap;
ok 2 - use Bio::Map::Marker;
ok 3 - use Bio::Map::Position;
ok 4 - use Bio::Map::Relative;
ok 5 - use Bio::Map::Mappable;
ok 6
ok 7
ok 8
ok 9
ok 10 - Length is 0
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151 - use Bio::Map::Gene;
ok 152 - use Bio::Map::GeneMap;
ok 153 - use Bio::Map::TranscriptionFactor;
ok 154 - use Bio::Map::GeneRelative;
ok 155 - use Bio::Map::GenePosition;
ok 156 - use Bio::Map::Prediction;
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok
t/Map/MapIO.t ..........................
1..51
ok 1 - use Bio::MapIO;
ok 2
ok 3 - An object of class 'Bio::Map::SimpleMap' isa 'Bio::Map::MapI'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok
t/Map/MicrosatelliteMarker.t ...........
1..8
ok 1 - use Bio::Map::SimpleMap;
ok 2 - use Bio::Map::Position;
ok 3 - use Bio::Map::Microsatellite;
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Map/Physical.t .......................
1..40
ok 1 - use Bio::Map::Physical;
ok 2 - use Bio::MapIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - code holds and returns a string, definition requires a boolean
ok 13 - code holds and returns a string, definition requires a boolean
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
not ok 40 # TODO Possible hash randomization-related bug, sum of contig pos values sometimes fails with off-by-one
# Failed (TODO) test at t/Map/Physical.t line 101.
# got: '1248'
# expected: '1249'
ok
t/Matrix/IO/masta.t ....................
1..16
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/Matrix/IO/psm.t ......................
1..63
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok
t/Matrix/InstanceSite.t ................
1..6
ok 1 - use Bio::Matrix::PSM::InstanceSite;
ok 2
ok 3
ok 4
ok 5
ok 6
ok
t/Matrix/Matrix.t ......................
1..77
ok 1 - use Bio::Matrix::Generic;
ok 2 - use Bio::Matrix::IO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring'
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring'
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok
t/Matrix/ProtMatrix.t ..................
1..14
ok 1 - use Bio::Matrix::PSM::ProtMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Matrix/ProtPsm.t .....................
1..14
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5 # skip TODO: Module incomplete
ok 6 # skip TODO: Module incomplete
ok 7 # skip TODO: Module incomplete
ok 8 # skip TODO: Module incomplete
ok 9 # skip TODO: Module incomplete
ok 10 # skip TODO: Module incomplete
ok 11 # skip TODO: Module incomplete
ok 12 # skip TODO: Module incomplete
ok 13 # skip TODO: Module incomplete
ok 14 # skip TODO: Module incomplete
ok
t/Matrix/SiteMatrix.t ..................
1..14
ok 1 - use Bio::Matrix::PSM::SiteMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Ontology/GOterm.t ....................
1..62
ok 1 - use Bio::Ontology::GOterm;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok
t/Ontology/GraphAdaptor.t ..............
1..28
ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok
t/Ontology/IO/go.t .....................
1..102
ok 1 - use Bio::OntologyIO;
ok 2
ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::OntologyI'
ok 4
ok 5 - An object of class 'Bio::Ontology::OBOEngine' isa 'Bio::Ontology::OntologyEngineI'
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/Ontology/IO/interpro.t ...............
1..69
ok 1 - use Bio::OntologyIO;
ok 2 - An object of class 'Bio::OntologyIO::InterProParser' isa 'Bio::OntologyIO::InterProParser'
ok 3
ok 4 - get_dbxrefs on leaf terms is non-empty
ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty
ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty
ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty
ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty
ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty
ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty
ok 11 - get_members on leaf terms is non-empty
ok 12 - class_list on leaf terms is non-empty
ok 13 - get_examples on leaf terms is non-empty
ok 14 - get_external_documents on leaf terms is non-empty
ok 15 - get_references on leaf terms is non-empty
ok 16 - protein_count on leaf terms is non-empty
ok 17 - to_string looks reasonable
ok 18 - There are 8 root InterPro terms
ok 19 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 20 - term Kringle in ontology InterPro
ok 21 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 22 - term Repeat in ontology InterPro
ok 23 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 24 - term Conserved Site in ontology InterPro
ok 25 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 26 - term Active Site in ontology InterPro
ok 27 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 28 - term Integrins alpha chain in ontology InterPro
ok 29 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 30 - term post-translational modification in ontology InterPro
ok 31 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 32 - term Region in ontology InterPro
ok 33 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 34 - term Binding Site in ontology InterPro
ok 35 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 36 - term Helix-turn-helix, AraC type in ontology InterPro
ok 37 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 38 - term Cdc20/Fizzy in ontology InterPro
ok 39 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 40 - term Active Site in ontology InterPro
ok 41 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 42 - term Binding Site in ontology InterPro
ok 43 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 44 - term Conserved Site in ontology InterPro
ok 45 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 46 - term Domain in ontology InterPro
ok 47 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 48 - term Family in ontology InterPro
ok 49 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 50 - term Region in ontology InterPro
ok 51 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 52 - term Repeat in ontology InterPro
ok 53 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 54 - term post-translational modification in ontology InterPro
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 - Kringle term has one parent
ok 62 - Kringle term has one ancestor
ok 63 - Integrins alpha chain term has one parent
ok 64 - Integrins alpha chain term has one ancestor
ok 65 - Helix-turn-helix, AraC type term has one parent
ok 66 - Helix-turn-helix, AraC type term has one ancestor
ok 67 - Cdc20/Fizzy term has one parent
ok 68 - Cdc20/Fizzy term has one ancestor
ok 69 - secondary accession map has 2 keys
ok
t/Ontology/IO/obo.t ....................
1..92
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - 'got a ontology IO handler' isa 'Bio::OntologyIO'
ok 47 - 'got ontology parser2' isa 'Bio::Ontology::Ontology'
ok 48 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine'
ok 49 - 'got ontology parser2' isa 'Bio::Ontology::Ontology'
ok 50 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine'
ok 51 - 'got ontology parser2' isa 'Bio::Ontology::Ontology'
ok 52 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine'
ok 53 - Gene ontology
ok 54 - biological process
ok 55 - molecular function
ok 56 - Got root
ok 57 - Got root
ok 58 - Got regulates
# from gene_ontology
ok 59 - Got
# positively regulates from gene_ontology
ok 60 - Got
# regulates from biological_process
ok 61 - Got
# positively regulates from biological_process
ok 62 - Got predicates for gene_ontology
ok 63 - Got predicates for biological_process
ok 64 - Got regulates predicate
ok 65 - Got positively regulates predicate
ok 66 - Got relationships for biological_process
ok 67 - Got relationships for molecular_function
ok 68 - Got is a relationship from
# molecular_function
ok 69 - 'Got term object' isa 'Bio::Ontology::Term'
ok 70 - Got term id
ok 71 - Got term name
ok 72 - 'Got regulated object' isa 'Bio::Ontology::Term'
ok 73 - Got regulated term1 id
ok 74 - 'Got term1 object' isa 'Bio::Ontology::Term'
ok 75 - Got back the child
ok 76 - 'Got term object' isa 'Bio::Ontology::Term'
ok 77 - Got term id
ok 78 - Got term name
ok 79 - 'Got regulated object' isa 'Bio::Ontology::Term'
ok 80 - Got regulated term1 id
ok 81 - Got identical regulation
ok 82 - 'Got term1 object' isa 'Bio::Ontology::Term'
ok 83 - Got back the child
ok 84 - 'got a ontology IO handler' isa 'Bio::OntologyIO'
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok
t/Ontology/Ontology.t ..................
1..55
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53 - Interpro XML file interpro.xml can be parsed
ok 54 - Interpro XML file interpro_sample.xml can be parsed
ok 55 - Interpro XML file interpro_relationship.xml can be parsed
ok
t/Ontology/OntologyEngine.t ............
1..31
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::Relationship;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - use Bio::Ontology::SimpleOntologyEngine;
ok 5 - use Bio::Ontology::Ontology;
ok 6 - An object of class 'Bio::Ontology::SimpleOntologyEngine' isa 'Bio::Ontology::OntologyEngineI'
ok 7
ok 8 - adding a relationship with an undef object term fails
ok 9 - adding a relationship with an undef object term fails
ok 10 - adding a relationship with an undef subject term fails
ok 11 - adding a relationship with an undef subject term fails
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/Ontology/OntologyStore.t ............. skipped: Network tests have not been requested
t/Ontology/Relationship.t ..............
1..12
ok 1 - use Bio::Ontology::Relationship;
ok 2 - use Bio::Ontology::GOterm;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType'
ok 5 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 6 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 7 - An object of class 'Bio::Ontology::Relationship' isa 'Bio::Ontology::Relationship'
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/Ontology/RelationshipType.t ..........
1..23
ok 1 - use Bio::Ontology::RelationshipType;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType'
ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::TermI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
t/Ontology/Term.t ......................
1..54
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::TermFactory;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI'
ok 45
ok 46 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::TermI'
ok 47 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm'
ok 48
ok 49
ok 50 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Ontology::TermI'
ok 51 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::AnnotationI'
ok 52
ok 53
ok 54
ok
t/Perl.t ...............................
1..31
ok 1 - use Bio::Perl;
ok 2
ok 3 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 4
ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI'
ok 6
ok 7 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 8 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 9
ok 10
ok 11 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 12
ok 13 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 14
ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 16
ok 17
ok 18
ok 19
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok
t/Phenotype/Correlate.t ................
1..17
ok 1 - use Bio::Phenotype::Correlate;
ok 2 - use Bio::Species;
ok 3 - An object of class 'Bio::Phenotype::Correlate' isa 'Bio::Phenotype::Correlate'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok
t/Phenotype/MeSH.t .....................
1..24
ok 1 - use Bio::Phenotype::MeSH::Term;
ok 2 - use Bio::Phenotype::MeSH::Twig;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/Phenotype/Measure.t ..................
1..21
ok 1 - use Bio::Phenotype::Measure;
ok 2 - An object of class 'Bio::Phenotype::Measure' isa 'Bio::Phenotype::Measure'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok
t/Phenotype/MiniMIMentry.t .............
1..15
ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry;
ok 2 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/Phenotype/OMIMentry.t ................
1..153
ok 1 - use Bio::Phenotype::OMIM::OMIMentry;
ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry;
ok 3 - use Bio::Species;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Map::CytoPosition;
ok 6 - use Bio::Phenotype::Correlate;
ok 7 - use Bio::Phenotype::Measure;
ok 8 - use Bio::Annotation::DBLink;
ok 9 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79 - operator overloading in AnnotationI is deprecated
ok 80 - operator overloading in AnnotationI is deprecated
ok 81
ok 82
ok 83 - operator overloading in AnnotationI is deprecated
ok 84 - operator overloading in AnnotationI is deprecated
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136 - operator overloading in AnnotationI is deprecated
ok 137 - operator overloading in AnnotationI is deprecated
ok 138
ok 139
ok 140 - operator overloading in AnnotationI is deprecated
ok 141 - operator overloading in AnnotationI is deprecated
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok
t/Phenotype/OMIMentryAllelicVariant.t ..
1..27
ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant;
ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' isa 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/Phenotype/OMIMparser.t ...............
1..175
ok 1 - use Bio::Phenotype::OMIM::OMIMparser;
ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMparser' isa 'Bio::Phenotype::OMIM::OMIMparser'
ok 3 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry'
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry'
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry'
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry'
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - missing linebreak caught
ok
t/Phenotype/Phenotype.t ................
1..116
ok 1 - use Bio::Phenotype::Phenotype;
ok 2 - use Bio::Species;
ok 3 - use Bio::Annotation::Reference;
ok 4 - use Bio::Map::CytoPosition;
ok 5 - use Bio::Phenotype::Correlate;
ok 6 - use Bio::Phenotype::Measure;
ok 7 - use Bio::Annotation::DBLink;
ok 8 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::PhenotypeI'
ok 9 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::Phenotype'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - operator overloading in AnnotationI is deprecated
ok 43 - operator overloading in AnnotationI is deprecated
ok 44
ok 45
ok 46 - operator overloading in AnnotationI is deprecated
ok 47 - operator overloading in AnnotationI is deprecated
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - operator overloading in AnnotationI is deprecated
ok 100 - operator overloading in AnnotationI is deprecated
ok 101
ok 102
ok 103 - operator overloading in AnnotationI is deprecated
ok 104 - operator overloading in AnnotationI is deprecated
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok
t/PodSyntax.t ..........................
1..953
ok 1 - POD test for Bio/NexmlIO.pm
ok 2 - POD test for Bio/AnalysisParserI.pm
ok 3 - POD test for Bio/AlignIO.pm
ok 4 - POD test for Bio/IdCollectionI.pm
ok 5 - POD test for Bio/ClusterI.pm
ok 6 - POD test for Bio/AnalysisI.pm
ok 7 - POD test for Bio/FeatureHolderI.pm
ok 8 - POD test for Bio/AnalysisResultI.pm
ok 9 - POD test for Bio/LocatableSeq.pm
ok 10 - POD test for Bio/PrimarySeq.pm
ok 11 - POD test for Bio/SeqUtils.pm
ok 12 - POD test for Bio/SimpleAlign.pm
ok 13 - POD test for Bio/AnnotationCollectionI.pm
ok 14 - POD test for Bio/PrimarySeqI.pm
ok 15 - POD test for Bio/DBLinkContainerI.pm
ok 16 - POD test for Bio/LocationI.pm
ok 17 - POD test for Bio/OntologyIO.pm
ok 18 - POD test for Bio/SearchIO.pm
ok 19 - POD test for Bio/WebAgent.pm
ok 20 - POD test for Bio/Taxon.pm
ok 21 - POD test for Bio/SeqI.pm
ok 22 - POD test for Bio/Seq.pm
ok 23 - POD test for Bio/SeqFeatureI.pm
ok 24 - POD test for Bio/IdentifiableI.pm
ok 25 - POD test for Bio/Range.pm
ok 26 - POD test for Bio/TreeIO.pm
ok 27 - POD test for Bio/PhyloNetwork.pm
ok 28 - POD test for Bio/DescribableI.pm
ok 29 - POD test for Bio/SeqAnalysisParserI.pm
ok 30 - POD test for Bio/MapIO.pm
ok 31 - POD test for Bio/PullParserI.pm
ok 32 - POD test for Bio/RangeI.pm
ok 33 - POD test for Bio/DasI.pm
ok 34 - POD test for Bio/AnnotationI.pm
ok 35 - POD test for Bio/ParameterBaseI.pm
ok 36 - POD test for Bio/SimpleAnalysisI.pm
ok 37 - POD test for Bio/HandlerBaseI.pm
ok 38 - POD test for Bio/AnnotatableI.pm
ok 39 - POD test for Bio/SearchDist.pm
ok 40 - POD test for Bio/Perl.pm
ok 41 - POD test for Bio/Taxonomy.pm
ok 42 - POD test for Bio/UpdateableSeqI.pm
ok 43 - POD test for Bio/SeqIO.pm
ok 44 - POD test for Bio/ClusterIO.pm
ok 45 - POD test for Bio/Species.pm
ok 46 - POD test for Bio/Taxonomy/Taxon.pm
ok 47 - POD test for Bio/Taxonomy/Node.pm
ok 48 - POD test for Bio/Taxonomy/Tree.pm
ok 49 - POD test for Bio/Taxonomy/FactoryI.pm
ok 50 - POD test for Bio/Das/SegmentI.pm
ok 51 - POD test for Bio/Das/FeatureTypeI.pm
ok 52 - POD test for Bio/SeqEvolution/DNAPoint.pm
ok 53 - POD test for Bio/SeqEvolution/Factory.pm
ok 54 - POD test for Bio/SeqEvolution/EvolutionI.pm
ok 55 - POD test for Bio/ClusterIO/dbsnp.pm
ok 56 - POD test for Bio/ClusterIO/unigene.pm
ok 57 - POD test for Bio/Annotation/TypeManager.pm
ok 58 - POD test for Bio/Annotation/StructuredValue.pm
ok 59 - POD test for Bio/Annotation/DBLink.pm
ok 60 - POD test for Bio/Annotation/Reference.pm
ok 61 - POD test for Bio/Annotation/OntologyTerm.pm
ok 62 - POD test for Bio/Annotation/SimpleValue.pm
ok 63 - POD test for Bio/Annotation/Target.pm
ok 64 - POD test for Bio/Annotation/AnnotationFactory.pm
ok 65 - POD test for Bio/Annotation/Relation.pm
ok 66 - POD test for Bio/Annotation/Tree.pm
ok 67 - POD test for Bio/Annotation/Collection.pm
ok 68 - POD test for Bio/Annotation/Comment.pm
ok 69 - POD test for Bio/Annotation/TagTree.pm
ok 70 - POD test for Bio/Seq/RichSeq.pm
ok 71 - POD test for Bio/Seq/Quality.pm
ok 72 - POD test for Bio/Seq/MetaI.pm
ok 73 - POD test for Bio/Seq/SeqBuilder.pm
ok 74 - POD test for Bio/Seq/BaseSeqProcessor.pm
ok 75 - POD test for Bio/Seq/EncodedSeq.pm
ok 76 - POD test for Bio/Seq/QualI.pm
ok 77 - POD test for Bio/Seq/PrimedSeq.pm
ok 78 - POD test for Bio/Seq/PrimaryQual.pm
ok 79 - POD test for Bio/Seq/SeqFactory.pm
ok 80 - POD test for Bio/Seq/LargeSeqI.pm
ok 81 - POD test for Bio/Seq/LargeSeq.pm
ok 82 - POD test for Bio/Seq/LargeLocatableSeq.pm
ok 83 - POD test for Bio/Seq/LargePrimarySeq.pm
ok 84 - POD test for Bio/Seq/TraceI.pm
ok 85 - POD test for Bio/Seq/SeqWithQuality.pm
ok 86 - POD test for Bio/Seq/SimulatedRead.pm
ok 87 - POD test for Bio/Seq/RichSeqI.pm
ok 88 - POD test for Bio/Seq/SequenceTrace.pm
ok 89 - POD test for Bio/Seq/SeqFastaSpeedFactory.pm
ok 90 - POD test for Bio/Seq/Meta.pm
ok 91 - POD test for Bio/Seq/Meta/Array.pm
ok 92 - POD test for Bio/Index/Abstract.pm
ok 93 - POD test for Bio/Index/Qual.pm
ok 94 - POD test for Bio/Index/GenBank.pm
ok 95 - POD test for Bio/Index/Blast.pm
ok 96 - POD test for Bio/Index/AbstractSeq.pm
ok 97 - POD test for Bio/Index/Fasta.pm
ok 98 - POD test for Bio/Index/EMBL.pm
ok 99 - POD test for Bio/Index/Stockholm.pm
ok 100 - POD test for Bio/Index/Hmmer.pm
ok 101 - POD test for Bio/Index/BlastTable.pm
ok 102 - POD test for Bio/Index/SwissPfam.pm
ok 103 - POD test for Bio/Index/Fastq.pm
ok 104 - POD test for Bio/Index/Swissprot.pm
ok 105 - POD test for Bio/Nexml/Factory.pm
ok 106 - POD test for Bio/Ontology/DocumentRegistry.pm
ok 107 - POD test for Bio/Ontology/RelationshipFactory.pm
ok 108 - POD test for Bio/Ontology/OntologyI.pm
ok 109 - POD test for Bio/Ontology/RelationshipType.pm
ok 110 - POD test for Bio/Ontology/TermFactory.pm
ok 111 - POD test for Bio/Ontology/InterProTerm.pm
ok 112 - POD test for Bio/Ontology/OntologyStore.pm
ok 113 - POD test for Bio/Ontology/PathI.pm
ok 114 - POD test for Bio/Ontology/TermI.pm
ok 115 - POD test for Bio/Ontology/OntologyEngineI.pm
ok 116 - POD test for Bio/Ontology/RelationshipI.pm
ok 117 - POD test for Bio/Ontology/Term.pm
ok 118 - POD test for Bio/Ontology/OBOEngine.pm
ok 119 - POD test for Bio/Ontology/Ontology.pm
ok 120 - POD test for Bio/Ontology/Relationship.pm
ok 121 - POD test for Bio/Ontology/GOterm.pm
ok 122 - POD test for Bio/Ontology/SimpleOntologyEngine.pm
ok 123 - POD test for Bio/Ontology/OBOterm.pm
ok 124 - POD test for Bio/Ontology/Path.pm
ok 125 - POD test for Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
ok 126 - POD test for Bio/MapIO/fpc.pm
ok 127 - POD test for Bio/MapIO/mapmaker.pm
ok 128 - POD test for Bio/TreeIO/phyloxml.pm
ok 129 - POD test for Bio/TreeIO/pag.pm
ok 130 - POD test for Bio/TreeIO/nexml.pm
ok 131 - POD test for Bio/TreeIO/cluster.pm
ok 132 - POD test for Bio/TreeIO/tabtree.pm
ok 133 - POD test for Bio/TreeIO/lintree.pm
ok 134 - POD test for Bio/TreeIO/newick.pm
ok 135 - POD test for Bio/TreeIO/NewickParser.pm
ok 136 - POD test for Bio/TreeIO/TreeEventBuilder.pm
ok 137 - POD test for Bio/TreeIO/nexus.pm
ok 138 - POD test for Bio/TreeIO/svggraph.pm
ok 139 - POD test for Bio/TreeIO/nhx.pm
ok 140 - POD test for Bio/MolEvol/CodonModel.pm
ok 141 - POD test for Bio/LiveSeq/Exon.pm
ok 142 - POD test for Bio/LiveSeq/Repeat_Region.pm
ok 143 - POD test for Bio/LiveSeq/AARange.pm
ok 144 - POD test for Bio/LiveSeq/Mutator.pm
ok 145 - POD test for Bio/LiveSeq/Intron.pm
ok 146 - POD test for Bio/LiveSeq/DNA.pm
ok 147 - POD test for Bio/LiveSeq/ChainI.pm
ok 148 - POD test for Bio/LiveSeq/Transcript.pm
ok 149 - POD test for Bio/LiveSeq/Gene.pm
ok 150 - POD test for Bio/LiveSeq/SeqI.pm
ok 151 - POD test for Bio/LiveSeq/Chain.pm
ok 152 - POD test for Bio/LiveSeq/Range.pm
ok 153 - POD test for Bio/LiveSeq/Mutation.pm
ok 154 - POD test for Bio/LiveSeq/Repeat_Unit.pm
ok 155 - POD test for Bio/LiveSeq/Translation.pm
ok 156 - POD test for Bio/LiveSeq/Prim_Transcript.pm
ok 157 - POD test for Bio/LiveSeq/IO/Loader.pm
ok 158 - POD test for Bio/LiveSeq/IO/BioPerl.pm
ok 159 - POD test for Bio/CodonUsage/IO.pm
ok 160 - POD test for Bio/CodonUsage/Table.pm
ok 161 - POD test for Bio/Draw/Pictogram.pm
ok 162 - POD test for Bio/Symbol/ProteinAlphabet.pm
ok 163 - POD test for Bio/Symbol/DNAAlphabet.pm
ok 164 - POD test for Bio/Symbol/SymbolI.pm
ok 165 - POD test for Bio/Symbol/AlphabetI.pm
ok 166 - POD test for Bio/Symbol/Symbol.pm
ok 167 - POD test for Bio/Symbol/Alphabet.pm
ok 168 - POD test for Bio/Tools/GuessSeqFormat.pm
ok 169 - POD test for Bio/Tools/Profile.pm
ok 170 - POD test for Bio/Tools/ipcress.pm
ok 171 - POD test for Bio/Tools/AmpliconSearch.pm
ok 172 - POD test for Bio/Tools/Coil.pm
ok 173 - POD test for Bio/Tools/Fgenesh.pm
ok 174 - POD test for Bio/Tools/ECnumber.pm
ok 175 - POD test for Bio/Tools/CodonTable.pm
ok 176 - POD test for Bio/Tools/pICalculator.pm
ok 177 - POD test for Bio/Tools/EPCR.pm
ok 178 - POD test for Bio/Tools/Pseudowise.pm
ok 179 - POD test for Bio/Tools/Eponine.pm
ok 180 - POD test for Bio/Tools/Genscan.pm
ok 181 - POD test for Bio/Tools/Tmhmm.pm
ok 182 - POD test for Bio/Tools/SeqWords.pm
ok 183 - POD test for Bio/Tools/tRNAscanSE.pm
ok 184 - POD test for Bio/Tools/AlignFactory.pm
ok 185 - POD test for Bio/Tools/Grail.pm
ok 186 - POD test for Bio/Tools/ERPIN.pm
ok 187 - POD test for Bio/Tools/RepeatMasker.pm
ok 188 - POD test for Bio/Tools/Gel.pm
ok 189 - POD test for Bio/Tools/isPcr.pm
ok 190 - POD test for Bio/Tools/PrositeScan.pm
ok 191 - POD test for Bio/Tools/Blat.pm
ok 192 - POD test for Bio/Tools/IUPAC.pm
ok 193 - POD test for Bio/Tools/Seg.pm
ok 194 - POD test for Bio/Tools/Genemark.pm
ok 195 - POD test for Bio/Tools/Geneid.pm
ok 196 - POD test for Bio/Tools/Protparam.pm
ok 197 - POD test for Bio/Tools/Lucy.pm
ok 198 - POD test for Bio/Tools/pSW.pm
ok 199 - POD test for Bio/Tools/Match.pm
ok 200 - POD test for Bio/Tools/Prints.pm
ok 201 - POD test for Bio/Tools/Glimmer.pm
ok 202 - POD test for Bio/Tools/AnalysisResult.pm
ok 203 - POD test for Bio/Tools/Signalp.pm
ok 204 - POD test for Bio/Tools/Promoterwise.pm
ok 205 - POD test for Bio/Tools/TandemRepeatsFinder.pm
ok 206 - POD test for Bio/Tools/RandomDistFunctions.pm
ok 207 - POD test for Bio/Tools/QRNA.pm
ok 208 - POD test for Bio/Tools/Genomewise.pm
ok 209 - POD test for Bio/Tools/OddCodes.pm
ok 210 - POD test for Bio/Tools/Sigcleave.pm
ok 211 - POD test for Bio/Tools/Primer3.pm
ok 212 - POD test for Bio/Tools/GFF.pm
ok 213 - POD test for Bio/Tools/ESTScan.pm
ok 214 - POD test for Bio/Tools/SeqStats.pm
ok 215 - POD test for Bio/Tools/TargetP.pm
ok 216 - POD test for Bio/Tools/SiRNA.pm
ok 217 - POD test for Bio/Tools/Infernal.pm
ok 218 - POD test for Bio/Tools/Genewise.pm
ok 219 - POD test for Bio/Tools/Est2Genome.pm
ok 220 - POD test for Bio/Tools/MZEF.pm
ok 221 - POD test for Bio/Tools/FootPrinter.pm
ok 222 - POD test for Bio/Tools/SeqPattern.pm
ok 223 - POD test for Bio/Tools/dpAlign.pm
ok 224 - POD test for Bio/Tools/Hmmpfam.pm
ok 225 - POD test for Bio/Tools/RNAMotif.pm
ok 226 - POD test for Bio/Tools/Signalp/ExtendedSignalp.pm
ok 227 - POD test for Bio/Tools/Primer/Feature.pm
ok 228 - POD test for Bio/Tools/Primer/AssessorI.pm
ok 229 - POD test for Bio/Tools/Primer/Pair.pm
ok 230 - POD test for Bio/Tools/Primer/Assessor/Base.pm
ok 231 - POD test for Bio/Tools/SiRNA/Ruleset/saigo.pm
ok 232 - POD test for Bio/Tools/SiRNA/Ruleset/tuschl.pm
ok 233 - POD test for Bio/Tools/Spidey/Exon.pm
ok 234 - POD test for Bio/Tools/Spidey/Results.pm
ok 235 - POD test for Bio/Tools/Analysis/SimpleAnalysisBase.pm
ok 236 - POD test for Bio/Tools/Analysis/Protein/Sopma.pm
ok 237 - POD test for Bio/Tools/Analysis/Protein/ELM.pm
ok 238 - POD test for Bio/Tools/Analysis/Protein/NetPhos.pm
ok 239 - POD test for Bio/Tools/Analysis/Protein/Scansite.pm
ok 240 - POD test for Bio/Tools/Analysis/Protein/Domcut.pm
ok 241 - POD test for Bio/Tools/Analysis/Protein/GOR4.pm
ok 242 - POD test for Bio/Tools/Analysis/Protein/HNN.pm
ok 243 - POD test for Bio/Tools/Analysis/Protein/Mitoprot.pm
ok 244 - POD test for Bio/Tools/Analysis/DNA/ESEfinder.pm
ok 245 - POD test for Bio/Tools/Phylo/Gerp.pm
ok 246 - POD test for Bio/Tools/Phylo/PAML.pm
ok 247 - POD test for Bio/Tools/Phylo/Gumby.pm
ok 248 - POD test for Bio/Tools/Phylo/Molphy.pm
ok 249 - POD test for Bio/Tools/Phylo/Molphy/Result.pm
ok 250 - POD test for Bio/Tools/Phylo/PAML/Codeml.pm
ok 251 - POD test for Bio/Tools/Phylo/PAML/Result.pm
ok 252 - POD test for Bio/Tools/Phylo/PAML/ModelResult.pm
ok 253 - POD test for Bio/Tools/Phylo/Phylip/ProtDist.pm
ok 254 - POD test for Bio/Tools/Prediction/Exon.pm
ok 255 - POD test for Bio/Tools/Prediction/Gene.pm
ok 256 - POD test for Bio/Tools/EMBOSS/Palindrome.pm
ok 257 - POD test for Bio/Tools/SeqPattern/Backtranslate.pm
ok 258 - POD test for Bio/Tools/Alignment/Trim.pm
ok 259 - POD test for Bio/Tools/Alignment/Consed.pm
ok 260 - POD test for Bio/Tools/HMMER/Results.pm
ok 261 - POD test for Bio/Tools/HMMER/Domain.pm
ok 262 - POD test for Bio/Tools/HMMER/Set.pm
ok 263 - POD test for Bio/Tools/Run/WrapperBase.pm
ok 264 - POD test for Bio/Tools/Run/GenericParameters.pm
ok 265 - POD test for Bio/Tools/Run/StandAloneWUBlast.pm
ok 266 - POD test for Bio/Tools/Run/StandAloneBlast.pm
ok 267 - POD test for Bio/Tools/Run/ParametersI.pm
ok 268 - POD test for Bio/Tools/Run/hmmer3.pm (no pod)
ok 269 - POD test for Bio/Tools/Run/RemoteBlast.pm
ok 270 - POD test for Bio/Tools/Run/StandAloneNCBIBlast.pm
ok 271 - POD test for Bio/Tools/Run/WrapperBase/CommandExts.pm
ok 272 - POD test for Bio/Tools/Sim4/Exon.pm
ok 273 - POD test for Bio/Tools/Sim4/Results.pm
ok 274 - POD test for Bio/Tree/TreeFunctionsI.pm
ok 275 - POD test for Bio/Tree/AnnotatableNode.pm
ok 276 - POD test for Bio/Tree/Statistics.pm
ok 277 - POD test for Bio/Tree/Compatible.pm
ok 278 - POD test for Bio/Tree/Node.pm
ok 279 - POD test for Bio/Tree/NodeNHX.pm
ok 280 - POD test for Bio/Tree/AlleleNode.pm
ok 281 - POD test for Bio/Tree/TreeI.pm
ok 282 - POD test for Bio/Tree/Tree.pm
ok 283 - POD test for Bio/Tree/NodeI.pm
ok 284 - POD test for Bio/Tree/DistanceFactory.pm
ok 285 - POD test for Bio/Tree/RandomFactory.pm
ok 286 - POD test for Bio/Tree/Draw/Cladogram.pm
ok 287 - POD test for Bio/Factory/TreeFactoryI.pm
ok 288 - POD test for Bio/Factory/ObjectFactoryI.pm
ok 289 - POD test for Bio/Factory/AnalysisI.pm
ok 290 - POD test for Bio/Factory/MapFactoryI.pm
ok 291 - POD test for Bio/Factory/SequenceProcessorI.pm
ok 292 - POD test for Bio/Factory/ObjectFactory.pm
ok 293 - POD test for Bio/Factory/SeqAnalysisParserFactoryI.pm
ok 294 - POD test for Bio/Factory/SeqAnalysisParserFactory.pm
ok 295 - POD test for Bio/Factory/LocationFactoryI.pm
ok 296 - POD test for Bio/Factory/SequenceFactoryI.pm
ok 297 - POD test for Bio/Factory/FTLocationFactory.pm
ok 298 - POD test for Bio/Factory/ObjectBuilderI.pm
ok 299 - POD test for Bio/Factory/SequenceStreamI.pm
ok 300 - POD test for Bio/Factory/DriverFactory.pm
ok 301 - POD test for Bio/Factory/ApplicationFactoryI.pm
ok 302 - POD test for Bio/Assembly/Contig.pm
ok 303 - POD test for Bio/Assembly/ContigAnalysis.pm
ok 304 - POD test for Bio/Assembly/IO.pm
ok 305 - POD test for Bio/Assembly/Singlet.pm
ok 306 - POD test for Bio/Assembly/Scaffold.pm
ok 307 - POD test for Bio/Assembly/ScaffoldI.pm
ok 308 - POD test for Bio/Assembly/Tools/ContigSpectrum.pm
ok 309 - POD test for Bio/Assembly/IO/tigr.pm
ok 310 - POD test for Bio/Assembly/IO/phrap.pm
ok 311 - POD test for Bio/Assembly/IO/bowtie.pm
ok 312 - POD test for Bio/Assembly/IO/maq.pm
ok 313 - POD test for Bio/Assembly/IO/sam.pm
ok 314 - POD test for Bio/Assembly/IO/ace.pm
ok 315 - POD test for Bio/Structure/StructureI.pm
ok 316 - POD test for Bio/Structure/Entry.pm
ok 317 - POD test for Bio/Structure/Model.pm
ok 318 - POD test for Bio/Structure/IO.pm
ok 319 - POD test for Bio/Structure/Chain.pm
ok 320 - POD test for Bio/Structure/Residue.pm
ok 321 - POD test for Bio/Structure/Atom.pm
ok 322 - POD test for Bio/Structure/SecStr/STRIDE/Res.pm
ok 323 - POD test for Bio/Structure/SecStr/DSSP/Res.pm
ok 324 - POD test for Bio/Structure/IO/pdb.pm
ok 325 - POD test for Bio/Matrix/Mlagan.pm
ok 326 - POD test for Bio/Matrix/PhylipDist.pm
ok 327 - POD test for Bio/Matrix/IO.pm
ok 328 - POD test for Bio/Matrix/Scoring.pm
ok 329 - POD test for Bio/Matrix/MatrixI.pm
ok 330 - POD test for Bio/Matrix/Generic.pm
ok 331 - POD test for Bio/Matrix/IO/mlagan.pm
ok 332 - POD test for Bio/Matrix/IO/phylip.pm
ok 333 - POD test for Bio/Matrix/IO/scoring.pm
ok 334 - POD test for Bio/Matrix/PSM/PsmHeader.pm
ok 335 - POD test for Bio/Matrix/PSM/SiteMatrixI.pm
ok 336 - POD test for Bio/Matrix/PSM/Psm.pm
ok 337 - POD test for Bio/Matrix/PSM/InstanceSite.pm
ok 338 - POD test for Bio/Matrix/PSM/IO.pm
ok 339 - POD test for Bio/Matrix/PSM/PsmHeaderI.pm
ok 340 - POD test for Bio/Matrix/PSM/PsmI.pm
ok 341 - POD test for Bio/Matrix/PSM/ProtPsm.pm
ok 342 - POD test for Bio/Matrix/PSM/InstanceSiteI.pm
ok 343 - POD test for Bio/Matrix/PSM/SiteMatrix.pm
ok 344 - POD test for Bio/Matrix/PSM/ProtMatrix.pm
ok 345 - POD test for Bio/Matrix/PSM/IO/transfac.pm
ok 346 - POD test for Bio/Matrix/PSM/IO/masta.pm
ok 347 - POD test for Bio/Matrix/PSM/IO/psiblast.pm
ok 348 - POD test for Bio/Matrix/PSM/IO/mast.pm
ok 349 - POD test for Bio/Matrix/PSM/IO/meme.pm
ok 350 - POD test for Bio/Variation/RNAChange.pm
ok 351 - POD test for Bio/Variation/Allele.pm
ok 352 - POD test for Bio/Variation/DNAMutation.pm
ok 353 - POD test for Bio/Variation/SeqDiff.pm
ok 354 - POD test for Bio/Variation/IO.pm
ok 355 - POD test for Bio/Variation/VariantI.pm
ok 356 - POD test for Bio/Variation/AAReverseMutate.pm
ok 357 - POD test for Bio/Variation/SNP.pm
ok 358 - POD test for Bio/Variation/AAChange.pm
ok 359 - POD test for Bio/Variation/IO/xml.pm
ok 360 - POD test for Bio/Variation/IO/flat.pm
ok 361 - POD test for Bio/AlignIO/prodom.pm
ok 362 - POD test for Bio/AlignIO/proda.pm
ok 363 - POD test for Bio/AlignIO/emboss.pm
ok 364 - POD test for Bio/AlignIO/nexml.pm
ok 365 - POD test for Bio/AlignIO/selex.pm
ok 366 - POD test for Bio/AlignIO/arp.pm
ok 367 - POD test for Bio/AlignIO/xmfa.pm
ok 368 - POD test for Bio/AlignIO/stockholm.pm
ok 369 - POD test for Bio/AlignIO/msf.pm
ok 370 - POD test for Bio/AlignIO/psi.pm
ok 371 - POD test for Bio/AlignIO/fasta.pm
ok 372 - POD test for Bio/AlignIO/phylip.pm
ok 373 - POD test for Bio/AlignIO/metafasta.pm
ok 374 - POD test for Bio/AlignIO/bl2seq.pm
ok 375 - POD test for Bio/AlignIO/maf.pm
ok 376 - POD test for Bio/AlignIO/largemultifasta.pm
ok 377 - POD test for Bio/AlignIO/pfam.pm
ok 378 - POD test for Bio/AlignIO/meme.pm
ok 379 - POD test for Bio/AlignIO/nexus.pm
ok 380 - POD test for Bio/AlignIO/mase.pm
ok 381 - POD test for Bio/AlignIO/mega.pm
ok 382 - POD test for Bio/AlignIO/po.pm
ok 383 - POD test for Bio/AlignIO/clustalw.pm
ok 384 - POD test for Bio/AlignIO/Handler/GenericAlignHandler.pm
ok 385 - POD test for Bio/PhyloNetwork/TreeFactoryMulti.pm
ok 386 - POD test for Bio/PhyloNetwork/TreeFactoryX.pm
ok 387 - POD test for Bio/PhyloNetwork/Factory.pm
ok 388 - POD test for Bio/PhyloNetwork/muVector.pm
ok 389 - POD test for Bio/PhyloNetwork/TreeFactory.pm
ok 390 - POD test for Bio/PhyloNetwork/FactoryX.pm
ok 391 - POD test for Bio/PhyloNetwork/RandomFactory.pm
ok 392 - POD test for Bio/PhyloNetwork/GraphViz.pm
ok 393 - POD test for Bio/Coordinate/MapperI.pm
ok 394 - POD test for Bio/Coordinate/Graph.pm
ok 395 - POD test for Bio/Coordinate/Chain.pm
ok 396 - POD test for Bio/Coordinate/GeneMapper.pm
ok 397 - POD test for Bio/Coordinate/ResultI.pm
ok 398 - POD test for Bio/Coordinate/ExtrapolatingPair.pm
ok 399 - POD test for Bio/Coordinate/Collection.pm
ok 400 - POD test for Bio/Coordinate/Result.pm
ok 401 - POD test for Bio/Coordinate/Utils.pm
ok 402 - POD test for Bio/Coordinate/Pair.pm
ok 403 - POD test for Bio/Coordinate/Result/Match.pm
ok 404 - POD test for Bio/Coordinate/Result/Gap.pm
ok 405 - POD test for Bio/OntologyIO/simplehierarchy.pm
ok 406 - POD test for Bio/OntologyIO/soflat.pm
ok 407 - POD test for Bio/OntologyIO/goflat.pm
ok 408 - POD test for Bio/OntologyIO/dagflat.pm
ok 409 - POD test for Bio/OntologyIO/InterProParser.pm
ok 410 - POD test for Bio/OntologyIO/obo.pm
ok 411 - POD test for Bio/OntologyIO/Handlers/BaseSAXHandler.pm
ok 412 - POD test for Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
ok 413 - POD test for Bio/OntologyIO/Handlers/InterProHandler.pm
ok 414 - POD test for Bio/Align/Graphics.pm
ok 415 - POD test for Bio/Align/Utilities.pm
ok 416 - POD test for Bio/Align/ProteinStatistics.pm
ok 417 - POD test for Bio/Align/StatisticsI.pm
ok 418 - POD test for Bio/Align/PairwiseStatistics.pm
ok 419 - POD test for Bio/Align/DNAStatistics.pm
ok 420 - POD test for Bio/Align/AlignI.pm
ok 421 - POD test for Bio/Map/OrderedPosition.pm
ok 422 - POD test for Bio/Map/EntityI.pm
ok 423 - POD test for Bio/Map/MarkerI.pm
ok 424 - POD test for Bio/Map/TranscriptionFactor.pm
ok 425 - POD test for Bio/Map/Prediction.pm
ok 426 - POD test for Bio/Map/Contig.pm
ok 427 - POD test for Bio/Map/LinkageMap.pm
ok 428 - POD test for Bio/Map/PositionHandlerI.pm
ok 429 - POD test for Bio/Map/Physical.pm
ok 430 - POD test for Bio/Map/GenePosition.pm
ok 431 - POD test for Bio/Map/Gene.pm
ok 432 - POD test for Bio/Map/GeneMap.pm
ok 433 - POD test for Bio/Map/Mappable.pm
ok 434 - POD test for Bio/Map/OrderedPositionWithDistance.pm
ok 435 - POD test for Bio/Map/Relative.pm
ok 436 - POD test for Bio/Map/GeneRelative.pm
ok 437 - POD test for Bio/Map/MapI.pm
ok 438 - POD test for Bio/Map/CytoPosition.pm
ok 439 - POD test for Bio/Map/MappableI.pm
ok 440 - POD test for Bio/Map/PositionHandler.pm
ok 441 - POD test for Bio/Map/Clone.pm
ok 442 - POD test for Bio/Map/RelativeI.pm
ok 443 - POD test for Bio/Map/Position.pm
ok 444 - POD test for Bio/Map/PositionWithSequence.pm
ok 445 - POD test for Bio/Map/Marker.pm
ok 446 - POD test for Bio/Map/FPCMarker.pm
ok 447 - POD test for Bio/Map/LinkagePosition.pm
ok 448 - POD test for Bio/Map/Microsatellite.pm
ok 449 - POD test for Bio/Map/CytoMap.pm
ok 450 - POD test for Bio/Map/CytoMarker.pm
ok 451 - POD test for Bio/Map/SimpleMap.pm
ok 452 - POD test for Bio/Map/PositionI.pm
ok 453 - POD test for Bio/Location/Atomic.pm
ok 454 - POD test for Bio/Location/Simple.pm
ok 455 - POD test for Bio/Location/Fuzzy.pm
ok 456 - POD test for Bio/Location/CoordinatePolicyI.pm
ok 457 - POD test for Bio/Location/Split.pm
ok 458 - POD test for Bio/Location/SplitLocationI.pm
ok 459 - POD test for Bio/Location/AvWithinCoordPolicy.pm
ok 460 - POD test for Bio/Location/FuzzyLocationI.pm
ok 461 - POD test for Bio/Location/WidestCoordPolicy.pm
ok 462 - POD test for Bio/Location/NarrowestCoordPolicy.pm
ok 463 - POD test for Bio/Search/SearchUtils.pm
ok 464 - POD test for Bio/Search/BlastUtils.pm
ok 465 - POD test for Bio/Search/StatisticsI.pm
ok 466 - POD test for Bio/Search/GenericDatabase.pm
ok 467 - POD test for Bio/Search/DatabaseI.pm
ok 468 - POD test for Bio/Search/GenericStatistics.pm
ok 469 - POD test for Bio/Search/BlastStatistics.pm
ok 470 - POD test for Bio/Search/Processor.pm
ok 471 - POD test for Bio/Search/Hit/ModelHit.pm
ok 472 - POD test for Bio/Search/Hit/hmmer3Hit.pm
ok 473 - POD test for Bio/Search/Hit/PsiBlastHit.pm
ok 474 - POD test for Bio/Search/Hit/Fasta.pm
ok 475 - POD test for Bio/Search/Hit/PullHitI.pm
ok 476 - POD test for Bio/Search/Hit/GenericHit.pm
ok 477 - POD test for Bio/Search/Hit/HMMERHit.pm
ok 478 - POD test for Bio/Search/Hit/HitFactory.pm
ok 479 - POD test for Bio/Search/Hit/HitI.pm
ok 480 - POD test for Bio/Search/Hit/BlastHit.pm
ok 481 - POD test for Bio/Search/Hit/BlastPullHit.pm
ok 482 - POD test for Bio/Search/Hit/HmmpfamHit.pm
ok 483 - POD test for Bio/Search/Tiling/MapTileUtils.pm
ok 484 - POD test for Bio/Search/Tiling/TilingI.pm
ok 485 - POD test for Bio/Search/Tiling/MapTiling.pm
ok 486 - POD test for Bio/Search/Result/hmmer3Result.pm
ok 487 - POD test for Bio/Search/Result/HmmpfamResult.pm
ok 488 - POD test for Bio/Search/Result/PullResultI.pm
ok 489 - POD test for Bio/Search/Result/ResultFactory.pm
ok 490 - POD test for Bio/Search/Result/HMMERResult.pm
ok 491 - POD test for Bio/Search/Result/BlastResult.pm
ok 492 - POD test for Bio/Search/Result/WABAResult.pm
ok 493 - POD test for Bio/Search/Result/GenericResult.pm
ok 494 - POD test for Bio/Search/Result/ResultI.pm
ok 495 - POD test for Bio/Search/Result/BlastPullResult.pm
ok 496 - POD test for Bio/Search/Result/CrossMatchResult.pm
ok 497 - POD test for Bio/Search/Iteration/GenericIteration.pm
ok 498 - POD test for Bio/Search/Iteration/IterationI.pm
ok 499 - POD test for Bio/Search/HSP/BlastHSP.pm
ok 500 - POD test for Bio/Search/HSP/ModelHSP.pm
ok 501 - POD test for Bio/Search/HSP/HSPI.pm
ok 502 - POD test for Bio/Search/HSP/PSLHSP.pm
ok 503 - POD test for Bio/Search/HSP/HSPFactory.pm
ok 504 - POD test for Bio/Search/HSP/PsiBlastHSP.pm
ok 505 - POD test for Bio/Search/HSP/PullHSPI.pm
ok 506 - POD test for Bio/Search/HSP/HmmpfamHSP.pm
ok 507 - POD test for Bio/Search/HSP/GenericHSP.pm
ok 508 - POD test for Bio/Search/HSP/BlastPullHSP.pm
ok 509 - POD test for Bio/Search/HSP/FastaHSP.pm
ok 510 - POD test for Bio/Search/HSP/HMMERHSP.pm
ok 511 - POD test for Bio/Search/HSP/WABAHSP.pm
ok 512 - POD test for Bio/SeqFeature/Similarity.pm
ok 513 - POD test for Bio/SeqFeature/TypedSeqFeatureI.pm
ok 514 - POD test for Bio/SeqFeature/PositionProxy.pm
ok 515 - POD test for Bio/SeqFeature/SubSeq.pm
ok 516 - POD test for Bio/SeqFeature/SimilarityPair.pm
ok 517 - POD test for Bio/SeqFeature/CollectionI.pm
ok 518 - POD test for Bio/SeqFeature/Primer.pm
ok 519 - POD test for Bio/SeqFeature/AnnotationAdaptor.pm
ok 520 - POD test for Bio/SeqFeature/FeaturePair.pm
ok 521 - POD test for Bio/SeqFeature/Amplicon.pm
ok 522 - POD test for Bio/SeqFeature/Generic.pm
ok 523 - POD test for Bio/SeqFeature/Computation.pm
ok 524 - POD test for Bio/SeqFeature/Collection.pm
ok 525 - POD test for Bio/SeqFeature/Lite.pm
ok 526 - POD test for Bio/SeqFeature/SiRNA/Oligo.pm
ok 527 - POD test for Bio/SeqFeature/SiRNA/Pair.pm
ok 528 - POD test for Bio/SeqFeature/Tools/IDHandler.pm
ok 529 - POD test for Bio/SeqFeature/Tools/TypeMapper.pm
ok 530 - POD test for Bio/SeqFeature/Tools/Unflattener.pm
ok 531 - POD test for Bio/SeqFeature/Tools/FeatureNamer.pm
ok 532 - POD test for Bio/SeqFeature/Gene/Exon.pm
ok 533 - POD test for Bio/SeqFeature/Gene/GeneStructureI.pm
ok 534 - POD test for Bio/SeqFeature/Gene/UTR.pm
ok 535 - POD test for Bio/SeqFeature/Gene/Intron.pm
ok 536 - POD test for Bio/SeqFeature/Gene/Poly_A_site.pm
ok 537 - POD test for Bio/SeqFeature/Gene/GeneStructure.pm
ok 538 - POD test for Bio/SeqFeature/Gene/NC_Feature.pm
ok 539 - POD test for Bio/SeqFeature/Gene/Transcript.pm
ok 540 - POD test for Bio/SeqFeature/Gene/ExonI.pm
ok 541 - POD test for Bio/SeqFeature/Gene/TranscriptI.pm
ok 542 - POD test for Bio/SeqFeature/Gene/Promoter.pm
ok 543 - POD test for Bio/Event/EventHandlerI.pm
ok 544 - POD test for Bio/Event/EventGeneratorI.pm
ok 545 - POD test for Bio/SeqIO/locuslink.pm
ok 546 - POD test for Bio/SeqIO/tab.pm
ok 547 - POD test for Bio/SeqIO/tigr.pm
ok 548 - POD test for Bio/SeqIO/raw.pm
ok 549 - POD test for Bio/SeqIO/nexml.pm
ok 550 - POD test for Bio/SeqIO/MultiFile.pm
ok 551 - POD test for Bio/SeqIO/abi.pm
ok 552 - POD test for Bio/SeqIO/chaos.pm
ok 553 - POD test for Bio/SeqIO/entrezgene.pm
ok 554 - POD test for Bio/SeqIO/gbxml.pm
ok 555 - POD test for Bio/SeqIO/agave.pm
ok 556 - POD test for Bio/SeqIO/table.pm
ok 557 - POD test for Bio/SeqIO/bsml_sax.pm
ok 558 - POD test for Bio/SeqIO/swissdriver.pm
ok 559 - POD test for Bio/SeqIO/gcg.pm
ok 560 - POD test for Bio/SeqIO/ctf.pm
ok 561 - POD test for Bio/SeqIO/lasergene.pm
ok 562 - POD test for Bio/SeqIO/chaosxml.pm
ok 563 - POD test for Bio/SeqIO/fasta.pm
ok 564 - POD test for Bio/SeqIO/flybase_chadoxml.pm
ok 565 - POD test for Bio/SeqIO/phd.pm
ok 566 - POD test for Bio/SeqIO/alf.pm
ok 567 - POD test for Bio/SeqIO/metafasta.pm
ok 568 - POD test for Bio/SeqIO/embldriver.pm
ok 569 - POD test for Bio/SeqIO/qual.pm
ok 570 - POD test for Bio/SeqIO/chadoxml.pm
ok 571 - POD test for Bio/SeqIO/mbsout.pm
ok 572 - POD test for Bio/SeqIO/bsml.pm
ok 573 - POD test for Bio/SeqIO/kegg.pm
ok 574 - POD test for Bio/SeqIO/excel.pm
ok 575 - POD test for Bio/SeqIO/seqxml.pm
ok 576 - POD test for Bio/SeqIO/pir.pm
ok 577 - POD test for Bio/SeqIO/gbdriver.pm
ok 578 - POD test for Bio/SeqIO/ace.pm
ok 579 - POD test for Bio/SeqIO/interpro.pm
ok 580 - POD test for Bio/SeqIO/tigrxml.pm
ok 581 - POD test for Bio/SeqIO/genbank.pm
ok 582 - POD test for Bio/SeqIO/msout.pm
ok 583 - POD test for Bio/SeqIO/embl.pm
ok 584 - POD test for Bio/SeqIO/tinyseq.pm
ok 585 - POD test for Bio/SeqIO/ztr.pm
ok 586 - POD test for Bio/SeqIO/fastq.pm
ok 587 - POD test for Bio/SeqIO/game.pm
ok 588 - POD test for Bio/SeqIO/pln.pm
ok 589 - POD test for Bio/SeqIO/swiss.pm
ok 590 - POD test for Bio/SeqIO/asciitree.pm
ok 591 - POD test for Bio/SeqIO/scf.pm
ok 592 - POD test for Bio/SeqIO/exp.pm
ok 593 - POD test for Bio/SeqIO/largefasta.pm
ok 594 - POD test for Bio/SeqIO/FTHelper.pm
ok 595 - POD test for Bio/SeqIO/strider.pm
ok 596 - POD test for Bio/SeqIO/tinyseq/tinyseqHandler.pm
ok 597 - POD test for Bio/SeqIO/game/gameWriter.pm
ok 598 - POD test for Bio/SeqIO/game/featHandler.pm
ok 599 - POD test for Bio/SeqIO/game/gameHandler.pm
ok 600 - POD test for Bio/SeqIO/game/seqHandler.pm
ok 601 - POD test for Bio/SeqIO/game/gameSubs.pm
ok 602 - POD test for Bio/SeqIO/Handler/GenericRichSeqHandler.pm
ok 603 - POD test for Bio/Root/Exception.pm
ok 604 - POD test for Bio/Root/Test.pm
ok 605 - POD test for Bio/Root/Build.pm
ok 606 - POD test for Bio/Root/Root.pm
ok 607 - POD test for Bio/Root/Utilities.pm
ok 608 - POD test for Bio/Root/IO.pm
ok 609 - POD test for Bio/Root/RootI.pm
ok 610 - POD test for Bio/Root/Storable.pm
ok 611 - POD test for Bio/Root/Version.pm
ok 612 - POD test for Bio/Root/HTTPget.pm
ok 613 - POD test for Bio/DB/RefSeq.pm
ok 614 - POD test for Bio/DB/DBFetch.pm
ok 615 - POD test for Bio/DB/Ace.pm
ok 616 - POD test for Bio/DB/SeqHound.pm
ok 617 - POD test for Bio/DB/FileCache.pm
ok 618 - POD test for Bio/DB/Qual.pm
ok 619 - POD test for Bio/DB/NCBIHelper.pm
ok 620 - POD test for Bio/DB/SwissProt.pm
ok 621 - POD test for Bio/DB/GenBank.pm
ok 622 - POD test for Bio/DB/Expression.pm
ok 623 - POD test for Bio/DB/Universal.pm
ok 624 - POD test for Bio/DB/SeqVersion.pm
ok 625 - POD test for Bio/DB/GenericWebAgent.pm
ok 626 - POD test for Bio/DB/LocationI.pm
ok 627 - POD test for Bio/DB/IndexedBase.pm
ok 628 - POD test for Bio/DB/Fasta.pm
ok 629 - POD test for Bio/DB/SeqI.pm
ok 630 - POD test for Bio/DB/RandomAccessI.pm
ok 631 - POD test for Bio/DB/CUTG.pm
ok 632 - POD test for Bio/DB/EMBL.pm
ok 633 - POD test for Bio/DB/Failover.pm
ok 634 - POD test for Bio/DB/TFBS.pm
ok 635 - POD test for Bio/DB/GFF.pm
ok 636 - POD test for Bio/DB/InMemoryCache.pm
ok 637 - POD test for Bio/DB/SeqFeature.pm
ok 638 - POD test for Bio/DB/GenPept.pm
ok 639 - POD test for Bio/DB/ReferenceI.pm
ok 640 - POD test for Bio/DB/QueryI.pm
ok 641 - POD test for Bio/DB/WebDBSeqI.pm
ok 642 - POD test for Bio/DB/Taxonomy.pm
ok 643 - POD test for Bio/DB/EntrezGene.pm
ok 644 - POD test for Bio/DB/HIV.pm
ok 645 - POD test for Bio/DB/MeSH.pm
ok 646 - POD test for Bio/DB/UpdateableSeqI.pm
ok 647 - POD test for Bio/DB/BioFetch.pm
ok 648 - POD test for Bio/DB/Registry.pm
ok 649 - POD test for Bio/DB/Flat.pm
ok 650 - POD test for Bio/DB/Taxonomy/list.pm
ok 651 - POD test for Bio/DB/Taxonomy/greengenes.pm
ok 652 - POD test for Bio/DB/Taxonomy/silva.pm
ok 653 - POD test for Bio/DB/Taxonomy/flatfile.pm
ok 654 - POD test for Bio/DB/Taxonomy/entrez.pm
ok 655 - POD test for Bio/DB/HIV/HIVAnnotProcessor.pm
ok 656 - POD test for Bio/DB/HIV/HIVQueryHelper.pm
ok 657 - POD test for Bio/DB/SeqVersion/gi.pm
ok 658 - POD test for Bio/DB/TFBS/transfac_pro.pm
ok 659 - POD test for Bio/DB/GFF/Feature.pm
ok 660 - POD test for Bio/DB/GFF/Featname.pm
ok 661 - POD test for Bio/DB/GFF/Homol.pm
ok 662 - POD test for Bio/DB/GFF/RelSegment.pm
ok 663 - POD test for Bio/DB/GFF/Aggregator.pm
ok 664 - POD test for Bio/DB/GFF/Typename.pm
ok 665 - POD test for Bio/DB/GFF/Segment.pm
ok 666 - POD test for Bio/DB/GFF/Util/Rearrange.pm
ok 667 - POD test for Bio/DB/GFF/Util/Binning.pm
ok 668 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22.pm
ok 669 - POD test for Bio/DB/GFF/Aggregator/processed_transcript.pm
ok 670 - POD test for Bio/DB/GFF/Aggregator/clone.pm
ok 671 - POD test for Bio/DB/GFF/Aggregator/ucsc_refgene.pm
ok 672 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm
ok 673 - POD test for Bio/DB/GFF/Aggregator/coding.pm
ok 674 - POD test for Bio/DB/GFF/Aggregator/ucsc_ensgene.pm
ok 675 - POD test for Bio/DB/GFF/Aggregator/none.pm
ok 676 - POD test for Bio/DB/GFF/Aggregator/ucsc_unigene.pm
ok 677 - POD test for Bio/DB/GFF/Aggregator/transcript.pm
ok 678 - POD test for Bio/DB/GFF/Aggregator/ucsc_acembly.pm
ok 679 - POD test for Bio/DB/GFF/Aggregator/ucsc_genscan.pm
ok 680 - POD test for Bio/DB/GFF/Aggregator/ucsc_softberry.pm
ok 681 - POD test for Bio/DB/GFF/Aggregator/gene.pm
ok 682 - POD test for Bio/DB/GFF/Aggregator/ucsc_twinscan.pm
ok 683 - POD test for Bio/DB/GFF/Aggregator/so_transcript.pm
ok 684 - POD test for Bio/DB/GFF/Aggregator/alignment.pm
ok 685 - POD test for Bio/DB/GFF/Aggregator/orf.pm
ok 686 - POD test for Bio/DB/GFF/Aggregator/match.pm
ok 687 - POD test for Bio/DB/GFF/Adaptor/dbi.pm
ok 688 - POD test for Bio/DB/GFF/Adaptor/memory.pm
ok 689 - POD test for Bio/DB/GFF/Adaptor/berkeleydb.pm
ok 690 - POD test for Bio/DB/GFF/Adaptor/ace.pm
ok 691 - POD test for Bio/DB/GFF/Adaptor/biofetch.pm
ok 692 - POD test for Bio/DB/GFF/Adaptor/biofetch_oracle.pm
ok 693 - POD test for Bio/DB/GFF/Adaptor/dbi/oracle.pm
ok 694 - POD test for Bio/DB/GFF/Adaptor/dbi/pg.pm
ok 695 - POD test for Bio/DB/GFF/Adaptor/dbi/oracleace.pm
ok 696 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm
ok 697 - POD test for Bio/DB/GFF/Adaptor/dbi/iterator.pm
ok 698 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlace.pm
ok 699 - POD test for Bio/DB/GFF/Adaptor/dbi/mysql.pm
ok 700 - POD test for Bio/DB/GFF/Adaptor/dbi/pg_fts.pm
ok 701 - POD test for Bio/DB/GFF/Adaptor/dbi/caching_handle.pm
ok 702 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm
ok 703 - POD test for Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm
ok 704 - POD test for Bio/DB/GFF/Adaptor/memory/feature_serializer.pm
ok 705 - POD test for Bio/DB/GFF/Adaptor/memory/iterator.pm
ok 706 - POD test for Bio/DB/Expression/geo.pm
ok 707 - POD test for Bio/DB/Flat/BinarySearch.pm
ok 708 - POD test for Bio/DB/Flat/BDB.pm
ok 709 - POD test for Bio/DB/Flat/BDB/fasta.pm
ok 710 - POD test for Bio/DB/Flat/BDB/genbank.pm
ok 711 - POD test for Bio/DB/Flat/BDB/embl.pm
ok 712 - POD test for Bio/DB/Flat/BDB/swiss.pm
ok 713 - POD test for Bio/DB/SeqFeature/NormalizedTableFeatureI.pm
ok 714 - POD test for Bio/DB/SeqFeature/Store.pm
ok 715 - POD test for Bio/DB/SeqFeature/NormalizedFeature.pm
ok 716 - POD test for Bio/DB/SeqFeature/NormalizedFeatureI.pm
ok 717 - POD test for Bio/DB/SeqFeature/Segment.pm
ok 718 - POD test for Bio/DB/SeqFeature/Store/LoadHelper.pm
ok 719 - POD test for Bio/DB/SeqFeature/Store/GFF3Loader.pm
ok 720 - POD test for Bio/DB/SeqFeature/Store/GFF2Loader.pm
ok 721 - POD test for Bio/DB/SeqFeature/Store/Loader.pm
ok 722 - POD test for Bio/DB/SeqFeature/Store/memory.pm
ok 723 - POD test for Bio/DB/SeqFeature/Store/berkeleydb.pm
ok 724 - POD test for Bio/DB/SeqFeature/Store/berkeleydb3.pm
ok 725 - POD test for Bio/DB/SeqFeature/Store/FeatureFileLoader.pm
ok 726 - POD test for Bio/DB/SeqFeature/Store/bdb.pm
ok 727 - POD test for Bio/DB/SeqFeature/Store/DBI/Iterator.pm
ok 728 - POD test for Bio/DB/SeqFeature/Store/DBI/SQLite.pm
ok 729 - POD test for Bio/DB/SeqFeature/Store/DBI/mysql.pm
ok 730 - POD test for Bio/DB/SeqFeature/Store/DBI/Pg.pm
ok 731 - POD test for Bio/DB/Query/GenBank.pm
ok 732 - POD test for Bio/DB/Query/HIVQuery.pm
ok 733 - POD test for Bio/DB/Query/WebQuery.pm
ok 734 - POD test for Bio/SearchIO/hmmer.pm
ok 735 - POD test for Bio/SearchIO/EventHandlerI.pm
ok 736 - POD test for Bio/SearchIO/IteratedSearchResultEventBuilder.pm
ok 737 - POD test for Bio/SearchIO/blasttable.pm
ok 738 - POD test for Bio/SearchIO/blastxml.pm
ok 739 - POD test for Bio/SearchIO/psl.pm
ok 740 - POD test for Bio/SearchIO/hmmer_pull.pm
ok 741 - POD test for Bio/SearchIO/sim4.pm
ok 742 - POD test for Bio/SearchIO/blast.pm
ok 743 - POD test for Bio/SearchIO/fasta.pm
ok 744 - POD test for Bio/SearchIO/infernal.pm
ok 745 - POD test for Bio/SearchIO/gmap_f9.pm
ok 746 - POD test for Bio/SearchIO/axt.pm
ok 747 - POD test for Bio/SearchIO/rnamotif.pm
ok 748 - POD test for Bio/SearchIO/SearchResultEventBuilder.pm
ok 749 - POD test for Bio/SearchIO/waba.pm
ok 750 - POD test for Bio/SearchIO/exonerate.pm
ok 751 - POD test for Bio/SearchIO/erpin.pm
ok 752 - POD test for Bio/SearchIO/SearchWriterI.pm
ok 753 - POD test for Bio/SearchIO/hmmer2.pm
ok 754 - POD test for Bio/SearchIO/hmmer3.pm
ok 755 - POD test for Bio/SearchIO/FastHitEventBuilder.pm
ok 756 - POD test for Bio/SearchIO/wise.pm
ok 757 - POD test for Bio/SearchIO/megablast.pm
ok 758 - POD test for Bio/SearchIO/cross_match.pm
ok 759 - POD test for Bio/SearchIO/blast_pull.pm
ok 760 - POD test for Bio/SearchIO/Writer/TextResultWriter.pm
ok 761 - POD test for Bio/SearchIO/Writer/HitTableWriter.pm
ok 762 - POD test for Bio/SearchIO/Writer/HTMLResultWriter.pm
ok 763 - POD test for Bio/SearchIO/Writer/HSPTableWriter.pm
ok 764 - POD test for Bio/SearchIO/Writer/BSMLResultWriter.pm
ok 765 - POD test for Bio/SearchIO/Writer/GbrowseGFF.pm
ok 766 - POD test for Bio/SearchIO/Writer/ResultTableWriter.pm
ok 767 - POD test for Bio/SearchIO/XML/PsiBlastHandler.pm
ok 768 - POD test for Bio/SearchIO/XML/BlastHandler.pm
ok 769 - POD test for Bio/Phenotype/Measure.pm
ok 770 - POD test for Bio/Phenotype/PhenotypeI.pm
ok 771 - POD test for Bio/Phenotype/Phenotype.pm
ok 772 - POD test for Bio/Phenotype/Correlate.pm
ok 773 - POD test for Bio/Phenotype/OMIM/OMIMentry.pm
ok 774 - POD test for Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm
ok 775 - POD test for Bio/Phenotype/OMIM/OMIMparser.pm
ok 776 - POD test for Bio/Phenotype/OMIM/MiniMIMentry.pm
ok 777 - POD test for Bio/Phenotype/MeSH/Term.pm
ok 778 - POD test for Bio/Phenotype/MeSH/Twig.pm
ok 779 - POD test for Bio/Restriction/IO.pm
ok 780 - POD test for Bio/Restriction/EnzymeI.pm
ok 781 - POD test for Bio/Restriction/Enzyme.pm
ok 782 - POD test for Bio/Restriction/EnzymeCollection.pm
ok 783 - POD test for Bio/Restriction/Analysis.pm
ok 784 - POD test for Bio/Restriction/Enzyme/MultiCut.pm
ok 785 - POD test for Bio/Restriction/Enzyme/MultiSite.pm
ok 786 - POD test for Bio/Restriction/IO/base.pm
ok 787 - POD test for Bio/Restriction/IO/itype2.pm
ok 788 - POD test for Bio/Restriction/IO/withrefm.pm
ok 789 - POD test for Bio/Restriction/IO/prototype.pm
ok 790 - POD test for Bio/Restriction/IO/bairoch.pm
ok 791 - POD test for Bio/PopGen/MarkerI.pm
ok 792 - POD test for Bio/PopGen/PopulationI.pm
ok 793 - POD test for Bio/PopGen/IndividualI.pm
ok 794 - POD test for Bio/PopGen/Population.pm
ok 795 - POD test for Bio/PopGen/Genotype.pm
ok 796 - POD test for Bio/PopGen/PopStats.pm
ok 797 - POD test for Bio/PopGen/Utilities.pm
ok 798 - POD test for Bio/PopGen/Statistics.pm
ok 799 - POD test for Bio/PopGen/GenotypeI.pm
ok 800 - POD test for Bio/PopGen/IO.pm
ok 801 - POD test for Bio/PopGen/HtSNP.pm
ok 802 - POD test for Bio/PopGen/Marker.pm
ok 803 - POD test for Bio/PopGen/Individual.pm
ok 804 - POD test for Bio/PopGen/TagHaplotype.pm
ok 805 - POD test for Bio/PopGen/Simulation/Coalescent.pm
ok 806 - POD test for Bio/PopGen/Simulation/GeneticDrift.pm
ok 807 - POD test for Bio/PopGen/IO/prettybase.pm
ok 808 - POD test for Bio/PopGen/IO/phase.pm
ok 809 - POD test for Bio/PopGen/IO/hapmap.pm
ok 810 - POD test for Bio/PopGen/IO/csv.pm
ok 811 - POD test for Bio/Cluster/ClusterFactory.pm
ok 812 - POD test for Bio/Cluster/UniGene.pm
ok 813 - POD test for Bio/Cluster/SequenceFamily.pm
ok 814 - POD test for Bio/Cluster/FamilyI.pm
ok 815 - POD test for Bio/Cluster/UniGeneI.pm
ok 816 - POD test for scripts/seq/bp_seqconvert.pl
ok 817 - POD test for scripts/seq/bp_make_mrna_protein.pl
ok 818 - POD test for scripts/seq/bp_seqpart.pl
ok 819 - POD test for scripts/seq/bp_translate_seq.pl
ok 820 - POD test for scripts/seq/bp_seqretsplit.pl
ok 821 - POD test for scripts/seq/bp_extract_feature_seq.pl
ok 822 - POD test for scripts/seq/bp_seqcut.pl
ok 823 - POD test for scripts/seq/bp_split_seq.pl
ok 824 - POD test for scripts/seq/bp_unflatten_seq.pl
ok 825 - POD test for scripts/popgen/bp_composite_LD.pl
ok 826 - POD test for scripts/popgen/bp_heterogeneity_test.pl
ok 827 - POD test for scripts/index/bp_index.pl
ok 828 - POD test for scripts/index/bp_seqret.pl
ok 829 - POD test for scripts/index/bp_fetch.pl
ok 830 - POD test for scripts/Bio-DB-GFF/bp_fast_load_gff.pl
ok 831 - POD test for scripts/Bio-DB-GFF/bp_process_sgd.pl
ok 832 - POD test for scripts/Bio-DB-GFF/bp_process_wormbase.pl
ok 833 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff3.pl
ok 834 - POD test for scripts/Bio-DB-GFF/bp_bulk_load_gff.pl
ok 835 - POD test for scripts/Bio-DB-GFF/bp_meta_gff.pl
ok 836 - POD test for scripts/Bio-DB-GFF/bp_load_gff.pl
ok 837 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff.pl
ok 838 - POD test for scripts/Bio-DB-GFF/bp_generate_histogram.pl
ok 839 - POD test for scripts/Bio-DB-GFF/bp_process_gadfly.pl
ok 840 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl
ok 841 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl (no pod)
ok 842 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl (no pod)
ok 843 - POD test for scripts/taxa/bp_query_entrez_taxa.pl
ok 844 - POD test for scripts/taxa/bp_taxid4species.pl
ok 845 - POD test for scripts/taxa/bp_taxonomy2tree.pl
ok 846 - POD test for scripts/taxa/bp_classify_hits_kingdom.pl
ok 847 - POD test for scripts/taxa/bp_local_taxonomydb_query.pl
ok 848 - POD test for scripts/seqstats/bp_aacomp.pl
ok 849 - POD test for scripts/seqstats/bp_gccalc.pl
ok 850 - POD test for scripts/seqstats/bp_oligo_count.pl
ok 851 - POD test for scripts/seqstats/bp_chaos_plot.pl
ok 852 - POD test for scripts/searchio/bp_fastam9_to_table.pl
ok 853 - POD test for scripts/searchio/bp_filter_search.pl
ok 854 - POD test for scripts/searchio/bp_parse_hmmsearch.pl
ok 855 - POD test for scripts/searchio/bp_hmmer_to_table.pl
ok 856 - POD test for scripts/searchio/bp_search2table.pl
ok 857 - POD test for scripts/utilities/bp_pairwise_kaks.pl
ok 858 - POD test for scripts/utilities/bp_revtrans-motif.pl
ok 859 - POD test for scripts/utilities/bp_search2alnblocks.pl
ok 860 - POD test for scripts/utilities/bp_search2tribe.pl
ok 861 - POD test for scripts/utilities/bp_netinstall.pl
ok 862 - POD test for scripts/utilities/bp_sreformat.pl
ok 863 - POD test for scripts/utilities/bp_search2BSML.pl
ok 864 - POD test for scripts/utilities/bp_download_query_genbank.pl
ok 865 - POD test for scripts/utilities/bp_remote_blast.pl
ok 866 - POD test for scripts/utilities/bp_nrdb.pl
ok 867 - POD test for scripts/utilities/bp_mask_by_search.pl
ok 868 - POD test for scripts/utilities/bp_search2gff.pl
ok 869 - POD test for scripts/utilities/bp_seq_length.pl
ok 870 - POD test for scripts/utilities/bp_dbsplit.pl
ok 871 - POD test for scripts/utilities/bp_mutate.pl
ok 872 - POD test for scripts/utilities/bp_mrtrans.pl
ok 873 - POD test for scripts/das/bp_das_server.pl (no pod)
ok 874 - POD test for scripts/DB-HIV/bp_hivq.pl
ok 875 - POD test for scripts/tree/bp_blast2tree.pl
ok 876 - POD test for scripts/tree/bp_tree2pag.pl
ok 877 - POD test for scripts/tree/bp_nexus2nh.pl
ok 878 - POD test for scripts/DB/bp_bioflat_index.pl
ok 879 - POD test for scripts/DB/bp_biofetch_genbank_proxy.pl
ok 880 - POD test for scripts/DB/bp_flanks.pl
ok 881 - POD test for scripts/DB/bp_biogetseq.pl
ok 882 - POD test for examples/bioperl.pl (no pod)
ok 883 - POD test for examples/make_primers.pl (no pod)
ok 884 - POD test for examples/generate_random_seq.pl (no pod)
ok 885 - POD test for examples/revcom_dir.pl (no pod)
ok 886 - POD test for examples/rev_and_trans.pl (no pod)
ok 887 - POD test for examples/longorf.pl
ok 888 - POD test for examples/subsequence.cgi (no pod)
ok 889 - POD test for examples/quality/svgtrace.pl (no pod)
ok 890 - POD test for examples/cluster/dbsnp.pl (no pod)
ok 891 - POD test for examples/sirna/rnai_finder.cgi
ok 892 - POD test for examples/db/use_registry.pl (no pod)
ok 893 - POD test for examples/db/dbfetch
ok 894 - POD test for examples/db/rfetch.pl (no pod)
ok 895 - POD test for examples/db/est_tissue_query.pl (no pod)
ok 896 - POD test for examples/db/get_seqs.pl (no pod)
ok 897 - POD test for examples/db/gb2features.pl (no pod)
ok 898 - POD test for examples/db/getGenBank.pl (no pod)
ok 899 - POD test for examples/contributed/rebase2list.pl (no pod)
ok 900 - POD test for examples/contributed/nmrpdb_parse.pl (no pod)
ok 901 - POD test for examples/contributed/prosite2perl.pl (no pod)
ok 902 - POD test for examples/tk/hitdisplay.pl (no pod)
ok 903 - POD test for examples/tk/gsequence.pl (no pod)
ok 904 - POD test for examples/popgen/parse_calc_stats.pl (no pod)
ok 905 - POD test for examples/tools/psw.pl (no pod)
ok 906 - POD test for examples/tools/run_genscan.pl (no pod)
ok 907 - POD test for examples/tools/reverse-translate.pl
ok 908 - POD test for examples/tools/gff2ps.pl
ok 909 - POD test for examples/tools/gb_to_gff.pl (no pod)
ok 910 - POD test for examples/tools/seq_pattern.pl (no pod)
ok 911 - POD test for examples/tools/run_primer3.pl
ok 912 - POD test for examples/tools/standaloneblast.pl (no pod)
ok 913 - POD test for examples/tools/parse_codeml.pl (no pod)
ok 914 - POD test for examples/tools/extract_genes.pl
ok 915 - POD test for examples/Bio-DB-GFF/load_ucsc.pl (no pod)
ok 916 - POD test for examples/root/exceptions3.pl (no pod)
ok 917 - POD test for examples/root/exceptions4.pl (no pod)
ok 918 - POD test for examples/root/exceptions2.pl (no pod)
ok 919 - POD test for examples/root/exceptions1.pl (no pod)
ok 920 - POD test for examples/root/lib/TestObject.pm
ok 921 - POD test for examples/root/lib/TestInterface.pm
ok 922 - POD test for examples/liveseq/change_gene.pl (no pod)
ok 923 - POD test for examples/searchio/psiblast_iterations.pl (no pod)
ok 924 - POD test for examples/searchio/resultwriter.pl (no pod)
ok 925 - POD test for examples/searchio/psiblast_features.pl (no pod)
ok 926 - POD test for examples/searchio/htmlwriter.pl (no pod)
ok 927 - POD test for examples/searchio/waba2gff.pl (no pod)
ok 928 - POD test for examples/searchio/waba2gff3.pl
ok 929 - POD test for examples/searchio/hspwriter.pl (no pod)
ok 930 - POD test for examples/searchio/hitwriter.pl (no pod)
ok 931 - POD test for examples/searchio/rawwriter.pl (no pod)
ok 932 - POD test for examples/searchio/custom_writer.pl (no pod)
ok 933 - POD test for examples/searchio/blast_example.pl (no pod)
ok 934 - POD test for examples/structure/structure-io.pl (no pod)
ok 935 - POD test for examples/align/FastAlign.pl
ok 936 - POD test for examples/align/aligntutorial.pl (no pod)
ok 937 - POD test for examples/align/simplealign.pl (no pod)
ok 938 - POD test for examples/align/align_on_codons.pl (no pod)
ok 939 - POD test for examples/align/clustalw.pl (no pod)
ok 940 - POD test for examples/tree/paup2phylip.pl (no pod)
ok 941 - POD test for maintenance/modules.pl
ok 942 - POD test for maintenance/module_usage.pl (no pod)
ok 943 - POD test for maintenance/version.pl
ok 944 - POD test for maintenance/dependencies.pl
ok 945 - POD test for maintenance/check_URLs.pl
ok 946 - POD test for maintenance/check_NAME.pl
ok 947 - POD test for maintenance/pod.pl
ok 948 - POD test for maintenance/deprecated.pl
ok 949 - POD test for maintenance/symlink_script.pl
ok 950 - POD test for maintenance/ncbi_blast_switches.pl (no pod)
ok 951 - POD test for maintenance/cvs2cl_by_file.pl
ok 952 - POD test for maintenance/authors.pl
ok 953 - POD test for maintenance/find_mod_deps.pl
ok
t/PopGen/Coalescent.t ..................
1..13
ok 1 - use Bio::PopGen::Simulation::Coalescent;
ok 2 - use Bio::PopGen::Statistics;
ok 3 - use Bio::TreeIO;
ok 4
ok 5
ok 6 - pi
ok 7 - theta
ok 8 - tajimaD
ok 9 - all the mutations should be polymorphic (by definition)
ok 10 - fu and li D
ok 11 - fu and li D*
ok 12 - fu and li F
ok 13 - fu and li F
ok
t/PopGen/HtSNP.t .......................
1..8
ok 1 - use Bio::PopGen::HtSNP;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/PopGen/MK.t ..........................
1..46
ok 1 - use Bio::AlignIO;
ok 2 - use Bio::PopGen::Statistics;
ok 3 - use Bio::PopGen::Utilities;
ok 4 - An object of class 'Bio::PopGen::Statistics' isa 'Bio::PopGen::Statistics'
ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 6 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population'
ok 7 - Marker Names
ok 8 - Number of Inds
ok 9 - number of ingroup sequences
ok 10 - number of outgroup1 sequences
ok 11 - number of outgroup2 sequences
ok 12 - NSpoly
ok 13 - NSfixed
ok 14 - Spoly
ok 15 - Sfixed
ok 16 - McDonald Kreitman
ok 17 - NSpoly
ok 18 - NSfixed
ok 19 - Spoly
ok 20 - Sfixed
ok 21 - McDonald Kreitman
ok 22 - NSpoly
ok 23 - NSfixed
ok 24 - Spoly
ok 25 - Sfixed
ok 26 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok 27 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population'
ok 28 - Marker Names
ok 29 - Number of Inds
ok 30 - number of ingroup sequences
ok 31 - number of outgroup1 sequences
ok 32 - number of outgroup2 sequences
ok 33 - NSpoly
ok 34 - NSfixed
ok 35 - Spoly
ok 36 - Sfixed
ok 37 - McDonald Kreitman
ok 38 - NSpoly
ok 39 - NSfixed
ok 40 - Spoly
ok 41 - Sfixed
ok 42 - McDonald Kreitman
ok 43 - NSpoly
ok 44 - NSfixed
ok 45 - Spoly
ok 46 - Sfixed
ok
t/PopGen/PopGen.t ......................
1..105
ok 1 - use IO::String;
ok 2 - use Bio::PopGen::Individual;
ok 3 - use Bio::PopGen::Genotype;
ok 4 - use Bio::PopGen::Population;
ok 5 - use Bio::PopGen::IO;
ok 6 - use Bio::PopGen::PopStats;
ok 7 - use Bio::AlignIO;
ok 8 - use Bio::PopGen::Statistics;
ok 9 - use Bio::PopGen::Utilities;
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40 - mrsa,mssa aflp1
ok 41 - all pops, aflp1
ok 42 - mrsa,envpop aflp1,aflp2
ok 43
ok 44
ok 45
ok 46 - mssa,mrsa all_bands
ok 47 - env,mssa mkr1
ok 48 - env,mssa,mrsa all bands
ok 49 - env,mssa,mrsa mkr2
ok 50 - mrsa,nc all_bands
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104 - Pi on 3-allele data
ok 105 - Theta on 3-allele data
ok
t/PopGen/PopGenSims.t ..................
1..23
ok 1 - use Bio::PopGen::Simulation::GeneticDrift;
ok 2 - Allele freqs should sum to 1
ok 3 - Allele freqs should sum to 1
ok 4 - Allele freqs should sum to 1
ok 5 - Allele freqs should sum to 1
ok 6 - Allele freqs should sum to 1
ok 7 - Allele freqs should sum to 1
ok 8 - Allele freqs should sum to 1
ok 9 - Allele freqs should sum to 1
ok 10 - Allele freqs should sum to 1
ok 11 - Allele freqs should sum to 1
ok 12
ok 13 - All frequencies should be <= 1
ok 14 - Allele freqs should sum to 1
ok 15 - Allele freqs should sum to 1
ok 16 - Allele freqs should sum to 1
ok 17 - Allele freqs should sum to 1
ok 18 - Allele freqs should sum to 1
ok 19 - Allele freqs should sum to 1
ok 20 - Allele freqs should sum to 1
ok 21 - Allele freqs should sum to 1
ok 22 - Allele freqs should sum to 1
ok 23 - Allele freqs should sum to 1
ok
t/PopGen/TagHaplotype.t ................
1..3
ok 1 - use Bio::PopGen::TagHaplotype;
ok 2
ok 3
ok
t/RemoteDB/BioFetch.t .................. skipped: Network tests have not been requested
t/RemoteDB/CUTG.t ......................
1..37
ok 1 - use Bio::DB::CUTG;
ok 2 - use Bio::CodonUsage::Table;
ok 3 - use Bio::CodonUsage::IO;
ok 4 - use Bio::SeqIO;
ok 5 - use Bio::Tools::SeqStats;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok
t/RemoteDB/EMBL.t ...................... skipped: Network tests have not been requested
t/RemoteDB/EntrezGene.t ................ skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed
t/RemoteDB/GenBank.t ................... skipped: Network tests have not been requested
t/RemoteDB/GenPept.t ................... skipped: Network tests have not been requested
t/RemoteDB/HIV/HIV.t ...................
1..30
ok 1 - use Bio::DB::HIV;
ok 2 - use Bio::DB::WebDBSeqI;
ok 3 - use Bio::DB::HIV::HIVAnnotProcessor;
ok 4 - An object of class 'Bio::DB::HIV' isa 'Bio::DB::HIV'
ok 5 - An object of class 'Bio::DB::HIV' isa 'Bio::Root::Root'
ok 6 - Bio::DB::HIV->can(...)
ok 7 - Bio::DB::HIV->can(...)
ok 8 - Bio::DB::HIV->can(...)
ok 9 - lanl_base set in default object
ok 10 - map_db set in default object
ok 11 - make_search_if set in default object
ok 12 - search_ set in default object
ok 13 - url_base_address set in default object
ok 14 - default sequence request format (fasta)
ok 15 - sorry till implemented
ok 16 - sorry till implemented
ok 17 - HIVQuery type exception check
ok 18 # skip Network tests have not been requested
ok 19 # skip Network tests have not been requested
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok
t/RemoteDB/HIV/HIVAnnotProcessor.t .....
1..11
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::DB::HIV::HIVAnnotProcessor;
ok 4 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::DB::HIV::HIVAnnotProcessor'
ok 5 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::Root::Root'
ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...)
ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query')
ok 8 - bad type set exception
ok 9 - attach stream
ok 10 - write exception
ok 11 - access stream
ok
t/RemoteDB/HIV/HIVQuery.t ..............
1..41
ok 1 - use Bio::DB::Query::HIVQuery;
ok 2 - use Bio::DB::HIV;
ok 3 - use Bio::Annotation::Collection;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::Reference;
ok 6 - use Bio::DB::HIV::HIVQueryHelper;
ok 7 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::DB::Query::HIVQuery'
ok 8 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::Root::Root'
ok 9 - Bio::DB::Query::HIVQuery->can(...)
ok 10 - Bio::DB::Query::HIVQuery->can(...)
ok 11 - Bio::DB::Query::HIVQuery->can(...)
ok 12 - _map_db_uri set in default object
ok 13 - _make_search_if_uri set in default object
ok 14 - _search_uri set in default object
ok 15 - _schema_file set in default object
ok 16 - _run_option set in default object
ok 17 - annotations container available
ok 18 - query syntax check 1
ok 19 - query syntax check 2
ok 20 - query syntax check 3
ok 21 - query parser check
ok 22 - multiquery parse check
ok 23 - use HTML::Parser;
ok 24 - help html to file
ok 25 - help html parsed
ok 26 - bad field exception check
ok 27 - bad match data exception check
ok 28 - empty field not ok exception check
ok 29 - uninitialized schema exception check
ok 30 - query not run (level 1) warning check
ok 31 - query not run (level 2) warning check
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok 38 # skip Network tests have not been requested
ok 39 # skip Network tests have not been requested
ok 40 # skip Network tests have not been requested
ok 41 # skip Network tests have not been requested
ok
t/RemoteDB/HIV/HIVQueryHelper.t ........
1..40
ok 1 - use Bio::DB::HIV::HIVQueryHelper;
ok 2 - An object of class 'HIVSchema' isa 'HIVSchema'
ok 3 - An object of class 'QRY' isa 'QRY'
ok 4 - An object of class 'R' isa 'R'
ok 5 - An object of class 'Q' isa 'Q'
ok 6 - schema load
ok 7 - HIVSchema->can(...)
ok 8 - fields complete
ok 9 - tables complete
ok 10 - aliases complete
ok 11
ok 12 - test field syntax ok
ok 13 - test field syntax ok
ok 14 - test alias by field name
ok 15 - correct primary key for SequenceEntry
ok 16 - correct number of foreign keys for AUthor
ok 17 - correct foreign table for au_pub_id
ok 18 - correct annotation key hash
ok 19 - QRY->can(...)
ok 20 - R->can(...)
ok 21 - Q->can(...)
ok 22 - null QRY
ok 23 - null R (request object)
ok 24 - null Q (atomic query object)
ok 25 - R obj create and init (1)
ok 26 - R obj create and init (2)
ok 27 - R::In
ok 28 - !R::In
ok 29 - R::Eq
ok 30 - QRY obj create and init (1)
ok 31 - QRY obj create and init (2)
ok 32 - QRY obj create and init (3)
ok 33 - QRY overload |
ok 34 - QRY overload &
ok 35 - QRY nontrivial &
ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]}
ok 37 - make: 2 queries returned
ok 38 - {annotation fields} parsed correctly
ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]}
ok 40 - above query is null
ok
t/RemoteDB/MeSH.t ...................... skipped: Network tests have not been requested
t/RemoteDB/Query/GenBank.t ............. skipped: Network tests have not been requested
t/RemoteDB/RefSeq.t ....................
1..16
ok 1 - use Bio::DB::RefSeq;
ok 2 - use Bio::DB::GenBank;
ok 3 - use Bio::DB::EMBL;
ok 4
ok 5
ok 6
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok 15 # skip Network tests have not been requested
ok 16 # skip Network tests have not been requested
ok
t/RemoteDB/SeqHound.t .................. skipped: Network tests have not been requested
t/RemoteDB/SeqRead_fail.t .............. skipped: Network tests have not been requested
t/RemoteDB/SeqVersion.t ................
ok 1 - use Bio::DB::SeqVersion;
ok 2
ok 3 # skip Network tests have not been requested
ok 4 # skip Network tests have not been requested
ok 5 # skip Network tests have not been requested
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
1..10
ok
t/RemoteDB/SwissProt.t ................. skipped: Network tests have not been requested
t/RemoteDB/Taxonomy.t ..................
1..191
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
ok 4 - An object of class 'Bio::DB::Taxonomy::entrez' isa 'Bio::DB::Taxonomy::entrez'
ok 5 - An object of class 'Bio::DB::Taxonomy::entrez' isa 'Bio::DB::Taxonomy'
ok 6
ok 7 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy::flatfile'
ok 8 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy'
ok 9
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok 15 # skip Network tests have not been requested
ok 16 # skip Network tests have not been requested
ok 17 # skip Network tests have not been requested
ok 18 # skip Network tests have not been requested
ok 19 # skip Network tests have not been requested
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok 38 # skip Network tests have not been requested
ok 39 # skip Network tests have not been requested
ok 40 # skip Network tests have not been requested
ok 41 # skip Network tests have not been requested
ok 42 # skip Network tests have not been requested
ok 43 # skip Network tests have not been requested
ok 44 # skip Network tests have not been requested
ok 45 # skip Network tests have not been requested
ok 46 # skip Network tests have not been requested
ok 47 # skip Network tests have not been requested
ok 48 # skip Network tests have not been requested
ok 49 # skip Network tests have not been requested
ok 50 # skip Network tests have not been requested
ok 51 # skip Network tests have not been requested
ok 52 # skip Network tests have not been requested
ok 53 # skip Network tests have not been requested
ok 54 # skip Network tests have not been requested
ok 55 # skip Network tests have not been requested
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - Bio::DB::Taxonomy::flatfile: common names
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy::list'
ok 101 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy'
ok 102
ok 103
ok 104
ok 105
ok 106 - Ranks
ok 107
ok 108
ok 109 - Ranks
ok 110
ok 111 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI'
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128 # skip Network tests have not been requested
ok 129 # skip Network tests have not been requested
ok 130 # skip Network tests have not been requested
ok 131 # skip Network tests have not been requested
ok 132 # skip Network tests have not been requested
ok 133 # skip Network tests have not been requested
ok 134 # skip Network tests have not been requested
ok 135 # skip Network tests have not been requested
ok 136 # skip Network tests have not been requested
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148 # skip Network tests have not been requested
ok 149 - List context
ok 150 - 'Scalar context' isa 'SCALAR'
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158 - DB with ambiguous names
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok
t/Restriction/Analysis-refac.t .........
1..91
ok 1 - use Bio::Restriction::IO;
ok 2 - use Bio::Restriction::Analysis;
ok 3 - use Bio::Restriction::EnzymeCollection;
ok 4 - use Bio::Restriction::Enzyme;
ok 5 - read withrefm file
ok 6 - parse withrefm file
ok 7 - HindIII: nonambiguous intrasite cutter
ok 8 - AarI: nonambiguous extrasite cutter
ok 9 - AasI: ambiguous intrasite cutter
ok 10 - BceSI: ambiguous extrasite cutter
ok 11 - AjuI: cutter with central recog site
ok 12 - TaqII: multi-extrasite cutter
ok 13
ok 14 - HindIII plus
ok 15 - HindIII minus
ok 16 - AasI plus
ok 17 - AasI minus
ok 18 - AarI plus
ok 19 - AarI minus
ok 20 - BceSI plus
ok 21 - BceSI minus
ok 22 - AjuI plus
ok 23 - AjuI minus
ok 24 - TaqII plus
ok 25 - TaqII minus
ok 26 - build real B:R::Analysis object
ok 27 - 13 fragments
ok 28 - circularize
ok 29 - recut
ok 30 - circ: AasI
# site at origin
ok 31 - circ: still 13 fragments (cut site at origin)
ok 32 - use Bio::Restriction::IO;
ok 33 - use Bio::Restriction::Analysis;
ok 34 - read withrefm file
ok 35 - parse withrefm file
ok 36 - Collection initiated
ok 37 - AbeI: found ok into collection
ok 38 - AccBSI: found ok into collection
ok 39 - AciI: found ok into collection
ok 40 - Asp26HI: found ok into collection
ok 41 - BmgBI: found ok into collection
ok 42 - AbeI plus
ok 43 - AbeI minus
ok 44 - AbeI fragment
ok 45 - AbeI positions
ok 46 - AbeI Overhang
ok 47 - AbeI name
ok 48 - AbeI site
ok 49 - AbeI revcom_site
ok 50 - AbeI cut
ok 51 - AbeI complementary_cut
ok 52 - AccBSI plus
ok 53 - AccBSI minus
ok 54 - AccBSI fragment
ok 55 - AccBSI positions
ok 56 - AccBSI Overhang
ok 57 - AccBSI name
ok 58 - AccBSI site
ok 59 - AccBSI revcom_site
ok 60 - AccBSI cut
ok 61 - AccBSI complementary_cut
ok 62 - AciI plus
ok 63 - AciI minus
ok 64 - AciI fragment
ok 65 - AciI positions
ok 66 - AciI Overhang
ok 67 - AciI name
ok 68 - AciI site
ok 69 - AciI revcom_site
ok 70 - AciI cut
ok 71 - AciI complementary_cut
ok 72 - Asp26HI plus
ok 73 - Asp26HI minus
ok 74 - Asp26HI fragment
ok 75 - Asp26HI positions
ok 76 - Asp26HI Overhang
ok 77 - Asp26HI name
ok 78 - Asp26HI site
ok 79 - Asp26HI revcom_site
ok 80 - Asp26HI cut
ok 81 - Asp26HI complementary_cut
ok 82 - BmgBI plus
ok 83 - BmgBI minus
ok 84 - BmgBI fragment
ok 85 - BmgBI positions
ok 86 - BmgBI Overhang
ok 87 - BmgBI name
ok 88 - BmgBI site
ok 89 - BmgBI revcom_site
ok 90 - BmgBI cut
ok 91 - BmgBI complementary_cut
ok
t/Restriction/Analysis.t ...............
1..182
ok 1 - use Bio::Restriction::Enzyme;
ok 2 - use Bio::Restriction::Enzyme::MultiCut;
ok 3 - use Bio::Restriction::Enzyme::MultiSite;
ok 4 - use Bio::Restriction::EnzymeCollection;
ok 5 - use Bio::Restriction::Analysis;
ok 6 - use Bio::SeqIO;
ok 7
ok 8 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::EnzymeI'
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - bug 2179
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI'
ok 77 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI'
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI'
ok 88 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI'
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme'
ok 100
ok 101
ok 102 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme'
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118 - number of unique cutters
ok 119 - number of RsaI fragments
ok 120 - number of maximum cutters
ok 121 - number of zero cutters
ok 122 - number of cutters
ok 123 - number of 3x cutters
ok 124 - 4 MseI fragments
ok 125 - 3 MseI cut sites
ok 126 - expected 2 PspEI fragments
ok 127
ok 128
ok 129 - expected 2 sizes for PspEI
ok 130
ok 131 - expected 2 sizes for PspEI
ok 132
ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut
ok 134
ok 135
ok 136 - number of RsaI fragments
ok 137 - 3 circular MseI fragments
ok 138 - 3 circular MseI cut sites
ok 139 - number for AciI a non-palindromic enzyme
ok 140 - 1 fragment for MwoI as it cuts across the circ point
ok 141
ok 142
ok 143
ok 144
ok 145 - 7 fragments in the multiple digest
ok 146 - 7 positions in the multiple digest
ok 147 - 7 sizes in the multiple digest
ok 148
ok 149 - expected 9 cuts for HindI
ok 150 - expect 9 fragment maps for HindI
ok 151 - sequence for GT
ok 152 - start at 40
ok 153 - end at 41
ok 154 - sequence for GGATTAAAAAAAGAGT
ok 155 - start at 42
ok 156 - end at 57
ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT
ok 158 - start at 58
ok 159 - end at 92
ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA
ok 161 - start at 93
ok 162 - end at 123
ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA
ok 164 - start at 124
ok 165 - end at 155
ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA
ok 167 - start at 156
ok 168 - end at 181
ok 169 - sequence for CAACATCCATGAAACGCATTAGCA
ok 170 - start at 182
ok 171 - end at 205
ok 172 - sequence for CCA
ok 173 - start at 206
ok 174 - end at 208
ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT
ok 176 - start at 209
ok 177 - end at 39
ok 178
ok 179 - bug 2139
ok 180 - number of HindIII fragments
ok 181 - number of EcoRI fragments
ok 182 - number of RsaI fragments
ok
t/Restriction/Gel.t ....................
1..9
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Restriction::Analysis;
ok 3 - use Bio::Tools::Gel;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok
t/Restriction/IO.t .....................
1..18
ok 1 - use Bio::Restriction::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT!
# Failed (TODO) test at t/Restriction/IO.t line 31.
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 # skip Network tests have not been requested
ok 17 # skip Network tests have not been requested
ok 18 # skip Network tests have not been requested
ok
t/Root/Exception.t .....................
1..8
ok 1 - use TestObject;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Root/HTTPget.t ....................... skipped: Network tests have not been requested
t/Root/RootI.t .........................
1..63
ok 1 - use Bio::Root::Root;
ok 2 - use Bio::Seq;
ok 3
ok 4 - An object of class 'Bio::Root::Root' isa 'Bio::Root::RootI'
ok 5 - threw Regexp ((?^:Testing throw))
ok 6 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented))
ok 7 - threw Regexp ((?^:EXCEPTION ))
ok 8 - threw Regexp ((?^:Testing throw))
ok 9
ok 10 - threw Regexp ((?^:Testing throw))
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - simple
ok 17 - simple
ok 18 - warns for versions below current version 1.006923
ok 19 - warns for versions below current version 1.006923
ok 20 - throws for versions above 1.006923
ok 21 - throws for versions above 1.006923
ok 22 - throws for versions equal to 1.006923
ok 23 - simple
ok 24 - simple
ok 25 - warns for versions below current version 1.006923
ok 26 - warns for versions below current version 1.006923
ok 27 - throws for versions above 1.006923
ok 28 - throws for versions above 1.006923
ok 29 - arg callable since method was created
ok 30 - mal-formed arg callable since method was created with good name
ok 31 - Bio::Foo2->can('t3')
ok 32 - Methods don't pollute original Bio::Root::Root namespace
ok 33 - Bio::Foo2->can('test_4')
ok 34 - Methods don't pollute original Bio::Root::Root namespace
ok 35 - Bio::Foo3->can('t5')
ok 36 - arg not in method list not created
ok 37 - Bio::Foo3->can('t5')
ok 38 - Methods don't pollute original Bio::Root::Root namespace
ok 39 - verbose was set correctly
ok 40 - synonym was set correctly
ok 41 - real method of synonym was set correctly
ok 42 - mal-formed arg correctly resolved to created method
ok 43 - synonym of set method was set correctly
ok 44 - Bio::Foo4->can('t7')
ok 45 - Methods don't pollute original Bio::Root::Root namespace
ok 46 - Bio::Foo4->can('test7')
ok 47 - Methods don't pollute original Bio::Root::Root namespace
ok 48 - Bio::Foo4->can('test_8')
ok 49 - Methods don't pollute original Bio::Root::Root namespace
ok 50 - Bio::Foo4->can('t8')
ok 51 - Methods don't pollute original Bio::Root::Root namespace
ok 52 - clone
ok 53 - clone
ok 54 - clone
ok 55 - clone changed, original didn't
ok 56 - parameters passed to clone() modify object
ok 57 - original is not modified
ok 58 - must use proper versioning scheme
ok 59 - warns for versions >= 1.006923
ok 60 - warns for versions >= 1.006923
ok 61 - throws for versions >= 1.006923
ok 62 - throws for versions >= 1.006923
ok 63 - No warnings/exceptions below 1.006923
ok
t/Root/RootIO.t ........................
1..77
ok 1 - use Bio::Root::IO;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::Assembly::IO;
ok 4
ok 5 - throw()
ok 6 - throw() verbose(-1)
ok 7 - warn()
ok 8 - throw() verbose(1)
ok 9 - stack_trace()
ok 10 - set verbosity to 1
ok 11
ok 12
ok 13 - executable file
ok 14 - non-executable file
ok 15 - executable dir
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21 - filename, read
ok 22
ok 23
ok 24 - filename, write
ok 25
ok 26
ok 27
ok 28
ok 29 - handle, read
ok 30
ok 31
ok 32 - handle, write
ok 33 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 34 - is a write handle
ok 35 - no warnings in ->close call
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - _print
ok 45
ok 46 - _insert at middle of file
ok 47
ok 48
ok 49
ok 50
ok 51 - _insert in empty file
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63 - Bio::Root::IO->new can handle a Path::Class object
ok 64 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 65 # skip Network tests have not been requested
ok 66 # skip Network tests have not been requested
ok 67 - default -string method
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok
t/Root/Storable.t ......................
1..35
ok 1 - use Bio::Root::Storable;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok
t/Root/Tempfile.t ......................
1..18
ok 1 - use Bio::Root::IO;
ok 2
ok 3 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO'
ok 4
ok 5
ok 6 - auto UNLINK => 1
ok 7
ok 8
ok 9 - tempfile deleted
ok 10
ok 11 - UNLINK => 0
ok 12
ok 13
ok 14
ok 15 - tempfile suffix
ok 16
ok 17 - tempfile() in scalar context
ok 18
ok
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip.
---------------------------------------------------
t/Root/Utilities.t .....................
1..56
ok 1 - use Bio::Root::Utilities;
ok 2 - An object of class 'Bio::Root::Utilities' isa 'Bio::Root::Utilities'
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - file_date()
ok 38 - unix (\n or 012 or ^J)
ok 39 - date format
ok 40 - date format
ok 41 - date format
ok 42 - date format
ok 43 - date format
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok
t/SearchDist.t ......................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed
t/SearchIO/CigarString.t ...............
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/SearchIO.t ..................
1..19
ok 1 - use Bio::SearchIO;
ok 2 - fasta for f.ssearch
ok 3 - blast for filename.blast
ok 4 - blastxml for f.blastxml
ok 5 - blastxml for f.xml
ok 6 - blast for fast.bls
ok 7 - fasta for f.psearch
ok 8 - exonerate for f.exonerate
ok 9 - blast for f.blx
ok 10 - fasta for f.osearch
ok 11 - blast for filename.bls
ok 12 - exonerate for f.exon
ok 13 - fasta for f.fa
ok 14 - fasta for f.fasta
ok 15 - fasta for f.SSEARCH.m9
ok 16 - fasta for f.fx
ok 17 - fasta for f.m9
ok 18 - blast for f.tblx
ok 19 - fasta for f.fy
ok
t/SearchIO/SimilarityPair.t ............
1..12
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SeqIO;
ok 3
ok 4 - An object of class 'Bio::Seq' isa 'Bio::SeqI'
ok 5
ok 6 - An object of class 'Bio::SearchIO::blast' isa 'Bio::SearchIO'
ok 7
ok 8 - An object of class 'Bio::Search::Hit::BlastHit' isa 'Bio::Search::Hit::HitI'
ok 9
ok 10 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI'
ok 11
ok 12
ok
t/SearchIO/Tiling.t ....................
1..1141
ok 1 - use Bio::Search::Tiling::MapTiling;
ok 2 - use Bio::Search::Tiling::MapTileUtils;
ok 3 - use Bio::SearchIO;
ok 4 - use Bio::Search::Hit::BlastHit;
ok 5 - use File::Spec;
ok 6 - parse data file
ok 7 - got test hit
ok 8 - create tiling
ok 9 - An object of class 'Bio::Search::Tiling::MapTiling' isa 'Bio::Search::Tiling::TilingI'
ok 10 - implements 'next_tiling'
ok 11 - implements 'rewind_tilings'
ok 12 - implements 'identities'
ok 13 - implements 'conserved'
ok 14 - implements 'length'
ok 15 - identities regression test
ok 16 - conserved regression test
ok 17 - tiling iterator regression test(1)
ok 18 - tiling iterator regression test(2)
ok 19 - tiling iterator regression test(3, rewind)
ok 20 - ecolitst.wublastp
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - dnaEbsub_ecoli.wublastx
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36 - tricky.wublast
ok 37 - tricky.wublast(1)
ok 38 - tricky.wublast(2)
ok 39 - tricky.wublast(3)
ok 40 - tricky.wublast(4)
ok 41 - ecolitst.bls
ok 42 - tile ecolitst.bls hit 1 \#hsps 1
ok 43 - q id: est (0.98293) = fast (0.98293)
ok 44 - q cn: est (0.98293) = fast (0.98293)
ok 45 - h id: est (0.98293) = fast (0.98293)
ok 46 - h cn: est (0.98293) = fast (0.98293)
ok 47 - tile ecolitst.bls hit 2 \#hsps 1
ok 48 - q id: est (0.30074) = fast (0.30074)
ok 49 - q cn: est (0.49876) = fast (0.49876)
ok 50 - h id: est (0.30759) = fast (0.30759)
ok 51 - h cn: est (0.51013) = fast (0.51013)
ok 52 - tile ecolitst.bls hit 3 \#hsps 1
ok 53 - q id: est (0.31004) = fast (0.31004)
ok 54 - q cn: est (0.49782) = fast (0.49782)
ok 55 - h id: est (0.32054) = fast (0.32054)
ok 56 - h cn: est (0.51467) = fast (0.51467)
ok 57 - tile ecolitst.bls hit 4 \#hsps 1
ok 58 - q id: est (0.30435) = fast (0.30435)
ok 59 - q cn: est (0.47826) = fast (0.47826)
ok 60 - h id: est (0.29787) = fast (0.29787)
ok 61 - h cn: est (0.46809) = fast (0.46809)
ok 62 - tricky.wublast
ok 63 - tile tricky.wublast hit 1 \#hsps 7
ok 64 - q id: exact (0.22153) ~ est (0.22153)
ok 65 - q id: exact (0.22153) <= max (0.22153)
ok 66 - q cn: exact (0.42760) ~ est (0.42760)
ok 67 - q cn: exact (0.42760) <= max (0.42760)
ok 68 - h id: exact (0.22704) ~ est (0.22704)
ok 69 - h id: exact (0.22704) <= max (0.22704)
ok 70 - h cn: exact (0.43335) ~ est (0.43335)
ok 71 - h cn: exact (0.43335) <= max (0.43335)
ok 72 - a_thaliana.blastn
ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1
ok 74 - q id: est (0.96667) = fast (0.96667)
ok 75 - q cn: est (0.96667) = fast (0.96667)
ok 76 - h id: est (0.98305) = fast (0.98305)
ok 77 - h cn: est (0.98305) = fast (0.98305)
ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1
ok 79 - q id: est (0.96667) = fast (0.96667)
ok 80 - q cn: est (0.96667) = fast (0.96667)
ok 81 - h id: est (0.98305) = fast (0.98305)
ok 82 - h cn: est (0.98305) = fast (0.98305)
ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1
ok 84 - q id: est (1.00000) = fast (1.00000)
ok 85 - q cn: est (1.00000) = fast (1.00000)
ok 86 - h id: est (1.00000) = fast (1.00000)
ok 87 - h cn: est (1.00000) = fast (1.00000)
ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1
ok 89 - q id: est (1.00000) = fast (1.00000)
ok 90 - q cn: est (1.00000) = fast (1.00000)
ok 91 - h id: est (1.00000) = fast (1.00000)
ok 92 - h cn: est (1.00000) = fast (1.00000)
ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1
ok 94 - q id: est (0.92308) = fast (0.92308)
ok 95 - q cn: est (0.92308) = fast (0.92308)
ok 96 - h id: est (0.92308) = fast (0.92308)
ok 97 - h cn: est (0.92308) = fast (0.92308)
ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1
ok 99 - q id: est (1.00000) = fast (1.00000)
ok 100 - q cn: est (1.00000) = fast (1.00000)
ok 101 - h id: est (1.00000) = fast (1.00000)
ok 102 - h cn: est (1.00000) = fast (1.00000)
ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1
ok 104 - q id: est (1.00000) = fast (1.00000)
ok 105 - q cn: est (1.00000) = fast (1.00000)
ok 106 - h id: est (1.00000) = fast (1.00000)
ok 107 - h cn: est (1.00000) = fast (1.00000)
ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1
ok 109 - q id: est (1.00000) = fast (1.00000)
ok 110 - q cn: est (1.00000) = fast (1.00000)
ok 111 - h id: est (1.00000) = fast (1.00000)
ok 112 - h cn: est (1.00000) = fast (1.00000)
ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1
ok 114 - q id: est (1.00000) = fast (1.00000)
ok 115 - q cn: est (1.00000) = fast (1.00000)
ok 116 - h id: est (1.00000) = fast (1.00000)
ok 117 - h cn: est (1.00000) = fast (1.00000)
ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1
ok 119 - q id: est (1.00000) = fast (1.00000)
ok 120 - q cn: est (1.00000) = fast (1.00000)
ok 121 - h id: est (1.00000) = fast (1.00000)
ok 122 - h cn: est (1.00000) = fast (1.00000)
ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1
ok 124 - q id: est (1.00000) = fast (1.00000)
ok 125 - q cn: est (1.00000) = fast (1.00000)
ok 126 - h id: est (1.00000) = fast (1.00000)
ok 127 - h cn: est (1.00000) = fast (1.00000)
ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1
ok 129 - q id: est (1.00000) = fast (1.00000)
ok 130 - q cn: est (1.00000) = fast (1.00000)
ok 131 - h id: est (1.00000) = fast (1.00000)
ok 132 - h cn: est (1.00000) = fast (1.00000)
ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1
ok 134 - q id: est (1.00000) = fast (1.00000)
ok 135 - q cn: est (1.00000) = fast (1.00000)
ok 136 - h id: est (1.00000) = fast (1.00000)
ok 137 - h cn: est (1.00000) = fast (1.00000)
ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1
ok 139 - q id: est (1.00000) = fast (1.00000)
ok 140 - q cn: est (1.00000) = fast (1.00000)
ok 141 - h id: est (1.00000) = fast (1.00000)
ok 142 - h cn: est (1.00000) = fast (1.00000)
ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1
ok 144 - q id: est (1.00000) = fast (1.00000)
ok 145 - q cn: est (1.00000) = fast (1.00000)
ok 146 - h id: est (1.00000) = fast (1.00000)
ok 147 - h cn: est (1.00000) = fast (1.00000)
ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1
ok 149 - q id: est (1.00000) = fast (1.00000)
ok 150 - q cn: est (1.00000) = fast (1.00000)
ok 151 - h id: est (1.00000) = fast (1.00000)
ok 152 - h cn: est (1.00000) = fast (1.00000)
ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1
ok 154 - q id: est (1.00000) = fast (1.00000)
ok 155 - q cn: est (1.00000) = fast (1.00000)
ok 156 - h id: est (1.00000) = fast (1.00000)
ok 157 - h cn: est (1.00000) = fast (1.00000)
ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1
ok 159 - q id: est (1.00000) = fast (1.00000)
ok 160 - q cn: est (1.00000) = fast (1.00000)
ok 161 - h id: est (1.00000) = fast (1.00000)
ok 162 - h cn: est (1.00000) = fast (1.00000)
ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1
ok 164 - q id: est (1.00000) = fast (1.00000)
ok 165 - q cn: est (1.00000) = fast (1.00000)
ok 166 - h id: est (1.00000) = fast (1.00000)
ok 167 - h cn: est (1.00000) = fast (1.00000)
ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1
ok 169 - q id: est (0.95238) = fast (0.95238)
ok 170 - q cn: est (0.95238) = fast (0.95238)
ok 171 - h id: est (0.95238) = fast (0.95238)
ok 172 - h cn: est (0.95238) = fast (0.95238)
ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1
ok 174 - q id: est (1.00000) = fast (1.00000)
ok 175 - q cn: est (1.00000) = fast (1.00000)
ok 176 - h id: est (1.00000) = fast (1.00000)
ok 177 - h cn: est (1.00000) = fast (1.00000)
ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1
ok 179 - q id: est (0.95238) = fast (0.95238)
ok 180 - q cn: est (0.95238) = fast (0.95238)
ok 181 - h id: est (0.95238) = fast (0.95238)
ok 182 - h cn: est (0.95238) = fast (0.95238)
ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1
ok 184 - q id: est (1.00000) = fast (1.00000)
ok 185 - q cn: est (1.00000) = fast (1.00000)
ok 186 - h id: est (1.00000) = fast (1.00000)
ok 187 - h cn: est (1.00000) = fast (1.00000)
ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1
ok 189 - q id: est (0.95238) = fast (0.95238)
ok 190 - q cn: est (0.95238) = fast (0.95238)
ok 191 - h id: est (0.95238) = fast (0.95238)
ok 192 - h cn: est (0.95238) = fast (0.95238)
ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1
ok 194 - q id: est (1.00000) = fast (1.00000)
ok 195 - q cn: est (1.00000) = fast (1.00000)
ok 196 - h id: est (1.00000) = fast (1.00000)
ok 197 - h cn: est (1.00000) = fast (1.00000)
ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1
ok 199 - q id: est (1.00000) = fast (1.00000)
ok 200 - q cn: est (1.00000) = fast (1.00000)
ok 201 - h id: est (1.00000) = fast (1.00000)
ok 202 - h cn: est (1.00000) = fast (1.00000)
ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1
ok 204 - q id: est (1.00000) = fast (1.00000)
ok 205 - q cn: est (1.00000) = fast (1.00000)
ok 206 - h id: est (1.00000) = fast (1.00000)
ok 207 - h cn: est (1.00000) = fast (1.00000)
ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1
ok 209 - q id: est (1.00000) = fast (1.00000)
ok 210 - q cn: est (1.00000) = fast (1.00000)
ok 211 - h id: est (1.00000) = fast (1.00000)
ok 212 - h cn: est (1.00000) = fast (1.00000)
ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1
ok 214 - q id: est (1.00000) = fast (1.00000)
ok 215 - q cn: est (1.00000) = fast (1.00000)
ok 216 - h id: est (1.00000) = fast (1.00000)
ok 217 - h cn: est (1.00000) = fast (1.00000)
ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1
ok 219 - q id: est (1.00000) = fast (1.00000)
ok 220 - q cn: est (1.00000) = fast (1.00000)
ok 221 - h id: est (1.00000) = fast (1.00000)
ok 222 - h cn: est (1.00000) = fast (1.00000)
ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1
ok 224 - q id: est (1.00000) = fast (1.00000)
ok 225 - q cn: est (1.00000) = fast (1.00000)
ok 226 - h id: est (1.00000) = fast (1.00000)
ok 227 - h cn: est (1.00000) = fast (1.00000)
ok 228 - brassica_ATH.WUBLASTN
ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3
ok 230 - q id: exact (0.82465) ~ est (0.82343)
ok 231 - q id: exact (0.82465) <= max (0.83333)
ok 232 - q cn: exact (0.85590) ~ est (0.85312)
ok 233 - q cn: exact (0.85590) <= max (0.86458)
ok 234 - h id: exact (0.83920) ~ est (0.83920)
ok 235 - h id: exact (0.83920) <= max (0.83920)
ok 236 - h cn: exact (0.86935) ~ est (0.86935)
ok 237 - h cn: exact (0.86935) <= max (0.86935)
ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2
ok 239 - q id: exact (0.82486) ~ est (0.82486)
ok 240 - q id: exact (0.82486) <= max (0.82486)
ok 241 - q cn: exact (0.85122) ~ est (0.85122)
ok 242 - q cn: exact (0.85122) <= max (0.85122)
ok 243 - h id: exact (0.82955) ~ est (0.82955)
ok 244 - h id: exact (0.82955) <= max (0.82955)
ok 245 - h cn: exact (0.85606) ~ est (0.85606)
ok 246 - h cn: exact (0.85606) <= max (0.85606)
ok 247 - no_hsps.blastp
ok 248 - tile no_hsps.blastp hit 1 \#hsps 0
ok 249 - tile no_hsps.blastp hit 2 \#hsps 0
ok 250 - tile no_hsps.blastp hit 3 \#hsps 0
ok 251 - tile no_hsps.blastp hit 4 \#hsps 0
ok 252 - tile no_hsps.blastp hit 5 \#hsps 0
ok 253 - tile no_hsps.blastp hit 6 \#hsps 0
ok 254 - tile no_hsps.blastp hit 7 \#hsps 0
ok 255 - tile no_hsps.blastp hit 8 \#hsps 0
ok 256 - tile no_hsps.blastp hit 9 \#hsps 0
ok 257 - tile no_hsps.blastp hit 10 \#hsps 0
ok 258 - tile no_hsps.blastp hit 11 \#hsps 0
ok 259 - tile no_hsps.blastp hit 12 \#hsps 0
ok 260 - tile no_hsps.blastp hit 13 \#hsps 0
ok 261 - tile no_hsps.blastp hit 14 \#hsps 0
ok 262 - tile no_hsps.blastp hit 15 \#hsps 0
ok 263 - tile no_hsps.blastp hit 16 \#hsps 0
ok 264 - tile no_hsps.blastp hit 17 \#hsps 0
ok 265 - tile no_hsps.blastp hit 18 \#hsps 0
ok 266 - tile no_hsps.blastp hit 19 \#hsps 0
ok 267 - tile no_hsps.blastp hit 20 \#hsps 0
ok 268 - tile no_hsps.blastp hit 21 \#hsps 0
ok 269 - tile no_hsps.blastp hit 22 \#hsps 0
ok 270 - tile no_hsps.blastp hit 23 \#hsps 0
ok 271 - tile no_hsps.blastp hit 24 \#hsps 0
ok 272 - tile no_hsps.blastp hit 25 \#hsps 0
ok 273 - tile no_hsps.blastp hit 26 \#hsps 0
ok 274 - tile no_hsps.blastp hit 27 \#hsps 0
ok 275 - tile no_hsps.blastp hit 28 \#hsps 0
ok 276 - tile no_hsps.blastp hit 29 \#hsps 0
ok 277 - tile no_hsps.blastp hit 30 \#hsps 0
ok 278 - tile no_hsps.blastp hit 31 \#hsps 0
ok 279 - tile no_hsps.blastp hit 32 \#hsps 0
ok 280 - tile no_hsps.blastp hit 33 \#hsps 0
ok 281 - tile no_hsps.blastp hit 34 \#hsps 0
ok 282 - tile no_hsps.blastp hit 35 \#hsps 0
ok 283 - tile no_hsps.blastp hit 36 \#hsps 0
ok 284 - tile no_hsps.blastp hit 37 \#hsps 0
ok 285 - tile no_hsps.blastp hit 38 \#hsps 0
ok 286 - tile no_hsps.blastp hit 39 \#hsps 0
ok 287 - tile no_hsps.blastp hit 40 \#hsps 0
ok 288 - tile no_hsps.blastp hit 41 \#hsps 0
ok 289 - tile no_hsps.blastp hit 42 \#hsps 0
ok 290 - tile no_hsps.blastp hit 43 \#hsps 0
ok 291 - tile no_hsps.blastp hit 44 \#hsps 0
ok 292 - tile no_hsps.blastp hit 45 \#hsps 0
ok 293 - tile no_hsps.blastp hit 46 \#hsps 0
ok 294 - tile no_hsps.blastp hit 47 \#hsps 0
ok 295 - tile no_hsps.blastp hit 48 \#hsps 0
ok 296 - tile no_hsps.blastp hit 49 \#hsps 0
ok 297 - tile no_hsps.blastp hit 50 \#hsps 0
ok 298 - tile no_hsps.blastp hit 51 \#hsps 0
ok 299 - tile no_hsps.blastp hit 52 \#hsps 0
ok 300 - tile no_hsps.blastp hit 53 \#hsps 0
ok 301 - tile no_hsps.blastp hit 54 \#hsps 0
ok 302 - tile no_hsps.blastp hit 55 \#hsps 0
ok 303 - tile no_hsps.blastp hit 56 \#hsps 0
ok 304 - tile no_hsps.blastp hit 57 \#hsps 0
ok 305 - tile no_hsps.blastp hit 58 \#hsps 0
ok 306 - tile no_hsps.blastp hit 59 \#hsps 0
ok 307 - tile no_hsps.blastp hit 60 \#hsps 0
ok 308 - tile no_hsps.blastp hit 61 \#hsps 0
ok 309 - tile no_hsps.blastp hit 62 \#hsps 0
ok 310 - tile no_hsps.blastp hit 63 \#hsps 0
ok 311 - tile no_hsps.blastp hit 64 \#hsps 0
ok 312 - tile no_hsps.blastp hit 65 \#hsps 0
ok 313 - tile no_hsps.blastp hit 66 \#hsps 0
ok 314 - tile no_hsps.blastp hit 67 \#hsps 0
ok 315 - tile no_hsps.blastp hit 68 \#hsps 0
ok 316 - tile no_hsps.blastp hit 69 \#hsps 0
ok 317 - tile no_hsps.blastp hit 70 \#hsps 0
ok 318 - tile no_hsps.blastp hit 71 \#hsps 0
ok 319 - tile no_hsps.blastp hit 72 \#hsps 0
ok 320 - tile no_hsps.blastp hit 73 \#hsps 0
ok 321 - tile no_hsps.blastp hit 74 \#hsps 0
ok 322 - tile no_hsps.blastp hit 75 \#hsps 0
ok 323 - tile no_hsps.blastp hit 76 \#hsps 0
ok 324 - tile no_hsps.blastp hit 77 \#hsps 0
ok 325 - tile no_hsps.blastp hit 78 \#hsps 0
ok 326 - tile no_hsps.blastp hit 79 \#hsps 0
ok 327 - tile no_hsps.blastp hit 80 \#hsps 0
ok 328 - tile no_hsps.blastp hit 81 \#hsps 0
ok 329 - tile no_hsps.blastp hit 82 \#hsps 0
ok 330 - tile no_hsps.blastp hit 83 \#hsps 0
ok 331 - tile no_hsps.blastp hit 84 \#hsps 0
ok 332 - tile no_hsps.blastp hit 85 \#hsps 0
ok 333 - tile no_hsps.blastp hit 86 \#hsps 0
ok 334 - tile no_hsps.blastp hit 87 \#hsps 0
ok 335 - tile no_hsps.blastp hit 88 \#hsps 0
ok 336 - tile no_hsps.blastp hit 89 \#hsps 0
ok 337 - tile no_hsps.blastp hit 90 \#hsps 0
ok 338 - tile no_hsps.blastp hit 91 \#hsps 0
ok 339 - tile no_hsps.blastp hit 92 \#hsps 0
ok 340 - tile no_hsps.blastp hit 93 \#hsps 0
ok 341 - tile no_hsps.blastp hit 94 \#hsps 0
ok 342 - tile no_hsps.blastp hit 95 \#hsps 0
ok 343 - tile no_hsps.blastp hit 96 \#hsps 0
ok 344 - tile no_hsps.blastp hit 97 \#hsps 0
ok 345 - tile no_hsps.blastp hit 98 \#hsps 0
ok 346 - tile no_hsps.blastp hit 99 \#hsps 0
ok 347 - tile no_hsps.blastp hit 100 \#hsps 0
ok 348 - tile no_hsps.blastp hit 101 \#hsps 0
ok 349 - tile no_hsps.blastp hit 102 \#hsps 0
ok 350 - tile no_hsps.blastp hit 103 \#hsps 0
ok 351 - tile no_hsps.blastp hit 104 \#hsps 0
ok 352 - tile no_hsps.blastp hit 105 \#hsps 0
ok 353 - tile no_hsps.blastp hit 106 \#hsps 0
ok 354 - tile no_hsps.blastp hit 107 \#hsps 0
ok 355 - tile no_hsps.blastp hit 108 \#hsps 0
ok 356 - tile no_hsps.blastp hit 109 \#hsps 0
ok 357 - tile no_hsps.blastp hit 110 \#hsps 0
ok 358 - tile no_hsps.blastp hit 111 \#hsps 0
ok 359 - tile no_hsps.blastp hit 112 \#hsps 0
ok 360 - tile no_hsps.blastp hit 113 \#hsps 0
ok 361 - tile no_hsps.blastp hit 114 \#hsps 0
ok 362 - tile no_hsps.blastp hit 115 \#hsps 0
ok 363 - tile no_hsps.blastp hit 116 \#hsps 0
ok 364 - tile no_hsps.blastp hit 117 \#hsps 0
ok 365 - tile no_hsps.blastp hit 118 \#hsps 0
ok 366 - tile no_hsps.blastp hit 119 \#hsps 0
ok 367 - tile no_hsps.blastp hit 120 \#hsps 0
ok 368 - tile no_hsps.blastp hit 121 \#hsps 0
ok 369 - tile no_hsps.blastp hit 122 \#hsps 0
ok 370 - tile no_hsps.blastp hit 123 \#hsps 0
ok 371 - tile no_hsps.blastp hit 124 \#hsps 0
ok 372 - tile no_hsps.blastp hit 125 \#hsps 0
ok 373 - tile no_hsps.blastp hit 126 \#hsps 0
ok 374 - tile no_hsps.blastp hit 127 \#hsps 0
ok 375 - tile no_hsps.blastp hit 128 \#hsps 0
ok 376 - tile no_hsps.blastp hit 129 \#hsps 0
ok 377 - tile no_hsps.blastp hit 130 \#hsps 0
ok 378 - tile no_hsps.blastp hit 131 \#hsps 0
ok 379 - tile no_hsps.blastp hit 132 \#hsps 0
ok 380 - tile no_hsps.blastp hit 133 \#hsps 0
ok 381 - tile no_hsps.blastp hit 134 \#hsps 0
ok 382 - tile no_hsps.blastp hit 135 \#hsps 0
ok 383 - tile no_hsps.blastp hit 136 \#hsps 0
ok 384 - tile no_hsps.blastp hit 137 \#hsps 0
ok 385 - tile no_hsps.blastp hit 138 \#hsps 0
ok 386 - tile no_hsps.blastp hit 139 \#hsps 0
ok 387 - tile no_hsps.blastp hit 140 \#hsps 0
ok 388 - tile no_hsps.blastp hit 141 \#hsps 0
ok 389 - tile no_hsps.blastp hit 142 \#hsps 0
ok 390 - tile no_hsps.blastp hit 143 \#hsps 0
ok 391 - tile no_hsps.blastp hit 144 \#hsps 0
ok 392 - tile no_hsps.blastp hit 145 \#hsps 0
ok 393 - tile no_hsps.blastp hit 146 \#hsps 0
ok 394 - tile no_hsps.blastp hit 147 \#hsps 0
ok 395 - tile no_hsps.blastp hit 148 \#hsps 0
ok 396 - tile no_hsps.blastp hit 149 \#hsps 0
ok 397 - tile no_hsps.blastp hit 150 \#hsps 0
ok 398 - tile no_hsps.blastp hit 151 \#hsps 0
ok 399 - tile no_hsps.blastp hit 152 \#hsps 0
ok 400 - tile no_hsps.blastp hit 153 \#hsps 0
ok 401 - tile no_hsps.blastp hit 154 \#hsps 0
ok 402 - tile no_hsps.blastp hit 155 \#hsps 0
ok 403 - tile no_hsps.blastp hit 156 \#hsps 0
ok 404 - tile no_hsps.blastp hit 157 \#hsps 0
ok 405 - tile no_hsps.blastp hit 158 \#hsps 0
ok 406 - tile no_hsps.blastp hit 159 \#hsps 0
ok 407 - tile no_hsps.blastp hit 160 \#hsps 0
ok 408 - tile no_hsps.blastp hit 161 \#hsps 0
ok 409 - tile no_hsps.blastp hit 162 \#hsps 0
ok 410 - tile no_hsps.blastp hit 163 \#hsps 0
ok 411 - tile no_hsps.blastp hit 164 \#hsps 0
ok 412 - tile no_hsps.blastp hit 165 \#hsps 0
ok 413 - tile no_hsps.blastp hit 166 \#hsps 0
ok 414 - tile no_hsps.blastp hit 167 \#hsps 0
ok 415 - tile no_hsps.blastp hit 168 \#hsps 0
ok 416 - tile no_hsps.blastp hit 169 \#hsps 0
ok 417 - tile no_hsps.blastp hit 170 \#hsps 0
ok 418 - tile no_hsps.blastp hit 171 \#hsps 0
ok 419 - tile no_hsps.blastp hit 172 \#hsps 0
ok 420 - tile no_hsps.blastp hit 173 \#hsps 0
ok 421 - tile no_hsps.blastp hit 174 \#hsps 0
ok 422 - tile no_hsps.blastp hit 175 \#hsps 0
ok 423 - tile no_hsps.blastp hit 176 \#hsps 0
ok 424 - tile no_hsps.blastp hit 177 \#hsps 0
ok 425 - tile no_hsps.blastp hit 178 \#hsps 0
ok 426 - tile no_hsps.blastp hit 179 \#hsps 0
ok 427 - tile no_hsps.blastp hit 180 \#hsps 0
ok 428 - tile no_hsps.blastp hit 181 \#hsps 0
ok 429 - tile no_hsps.blastp hit 182 \#hsps 0
ok 430 - tile no_hsps.blastp hit 183 \#hsps 0
ok 431 - tile no_hsps.blastp hit 184 \#hsps 0
ok 432 - tile no_hsps.blastp hit 185 \#hsps 0
ok 433 - tile no_hsps.blastp hit 186 \#hsps 0
ok 434 - tile no_hsps.blastp hit 187 \#hsps 0
ok 435 - tile no_hsps.blastp hit 188 \#hsps 0
ok 436 - tile no_hsps.blastp hit 189 \#hsps 0
ok 437 - tile no_hsps.blastp hit 190 \#hsps 0
ok 438 - tile no_hsps.blastp hit 191 \#hsps 0
ok 439 - tile no_hsps.blastp hit 192 \#hsps 0
ok 440 - tile no_hsps.blastp hit 193 \#hsps 0
ok 441 - tile no_hsps.blastp hit 194 \#hsps 0
ok 442 - tile no_hsps.blastp hit 195 \#hsps 0
ok 443 - tile no_hsps.blastp hit 196 \#hsps 0
ok 444 - tile no_hsps.blastp hit 197 \#hsps 0
ok 445 - tile no_hsps.blastp hit 198 \#hsps 0
ok 446 - tile no_hsps.blastp hit 199 \#hsps 0
ok 447 - tile no_hsps.blastp hit 200 \#hsps 0
ok 448 - tile no_hsps.blastp hit 201 \#hsps 0
ok 449 - tile no_hsps.blastp hit 202 \#hsps 0
ok 450 - tile no_hsps.blastp hit 203 \#hsps 0
ok 451 - tile no_hsps.blastp hit 204 \#hsps 0
ok 452 - tile no_hsps.blastp hit 205 \#hsps 0
ok 453 - tile no_hsps.blastp hit 206 \#hsps 0
ok 454 - tile no_hsps.blastp hit 207 \#hsps 0
ok 455 - tile no_hsps.blastp hit 208 \#hsps 0
ok 456 - tile no_hsps.blastp hit 209 \#hsps 0
ok 457 - tile no_hsps.blastp hit 210 \#hsps 0
ok 458 - tile no_hsps.blastp hit 211 \#hsps 0
ok 459 - tile no_hsps.blastp hit 212 \#hsps 0
ok 460 - tile no_hsps.blastp hit 213 \#hsps 0
ok 461 - tile no_hsps.blastp hit 214 \#hsps 0
ok 462 - tile no_hsps.blastp hit 215 \#hsps 0
ok 463 - tile no_hsps.blastp hit 216 \#hsps 0
ok 464 - tile no_hsps.blastp hit 217 \#hsps 0
ok 465 - tile no_hsps.blastp hit 218 \#hsps 0
ok 466 - tile no_hsps.blastp hit 219 \#hsps 0
ok 467 - tile no_hsps.blastp hit 220 \#hsps 0
ok 468 - tile no_hsps.blastp hit 221 \#hsps 0
ok 469 - tile no_hsps.blastp hit 222 \#hsps 0
ok 470 - tile no_hsps.blastp hit 223 \#hsps 0
ok 471 - tile no_hsps.blastp hit 224 \#hsps 0
ok 472 - tile no_hsps.blastp hit 225 \#hsps 0
ok 473 - tile no_hsps.blastp hit 226 \#hsps 0
ok 474 - tile no_hsps.blastp hit 227 \#hsps 0
ok 475 - tile no_hsps.blastp hit 228 \#hsps 0
ok 476 - tile no_hsps.blastp hit 229 \#hsps 0
ok 477 - tile no_hsps.blastp hit 230 \#hsps 0
ok 478 - tile no_hsps.blastp hit 231 \#hsps 0
ok 479 - tile no_hsps.blastp hit 232 \#hsps 0
ok 480 - tile no_hsps.blastp hit 233 \#hsps 0
ok 481 - tile no_hsps.blastp hit 234 \#hsps 0
ok 482 - tile no_hsps.blastp hit 235 \#hsps 0
ok 483 - tile no_hsps.blastp hit 236 \#hsps 0
ok 484 - tile no_hsps.blastp hit 237 \#hsps 0
ok 485 - tile no_hsps.blastp hit 238 \#hsps 0
ok 486 - tile no_hsps.blastp hit 239 \#hsps 0
ok 487 - tile no_hsps.blastp hit 240 \#hsps 0
ok 488 - tile no_hsps.blastp hit 241 \#hsps 0
ok 489 - tile no_hsps.blastp hit 242 \#hsps 0
ok 490 - tile no_hsps.blastp hit 243 \#hsps 0
ok 491 - tile no_hsps.blastp hit 244 \#hsps 0
ok 492 - tile no_hsps.blastp hit 245 \#hsps 0
ok 493 - tile no_hsps.blastp hit 246 \#hsps 0
ok 494 - tile no_hsps.blastp hit 247 \#hsps 0
ok 495 - tile no_hsps.blastp hit 248 \#hsps 0
ok 496 - tile no_hsps.blastp hit 249 \#hsps 0
ok 497 - tile no_hsps.blastp hit 250 \#hsps 0
ok 498 - tile no_hsps.blastp hit 251 \#hsps 0
ok 499 - tile no_hsps.blastp hit 252 \#hsps 0
ok 500 - tile no_hsps.blastp hit 253 \#hsps 0
ok 501 - tile no_hsps.blastp hit 254 \#hsps 0
ok 502 - tile no_hsps.blastp hit 255 \#hsps 0
ok 503 - tile no_hsps.blastp hit 256 \#hsps 0
ok 504 - tile no_hsps.blastp hit 257 \#hsps 0
ok 505 - tile no_hsps.blastp hit 258 \#hsps 0
ok 506 - tile no_hsps.blastp hit 259 \#hsps 0
ok 507 - tile no_hsps.blastp hit 260 \#hsps 0
ok 508 - tile no_hsps.blastp hit 261 \#hsps 0
ok 509 - tile no_hsps.blastp hit 262 \#hsps 0
ok 510 - tile no_hsps.blastp hit 263 \#hsps 0
ok 511 - tile no_hsps.blastp hit 264 \#hsps 0
ok 512 - tile no_hsps.blastp hit 265 \#hsps 0
ok 513 - tile no_hsps.blastp hit 266 \#hsps 0
ok 514 - tile no_hsps.blastp hit 267 \#hsps 0
ok 515 - tile no_hsps.blastp hit 268 \#hsps 0
ok 516 - tile no_hsps.blastp hit 269 \#hsps 0
ok 517 - tile no_hsps.blastp hit 270 \#hsps 0
ok 518 - tile no_hsps.blastp hit 271 \#hsps 0
ok 519 - tile no_hsps.blastp hit 272 \#hsps 0
ok 520 - tile no_hsps.blastp hit 273 \#hsps 0
ok 521 - tile no_hsps.blastp hit 274 \#hsps 0
ok 522 - tile no_hsps.blastp hit 275 \#hsps 0
ok 523 - tile no_hsps.blastp hit 276 \#hsps 0
ok 524 - tile no_hsps.blastp hit 277 \#hsps 0
ok 525 - tile no_hsps.blastp hit 278 \#hsps 0
ok 526 - tile no_hsps.blastp hit 279 \#hsps 0
ok 527 - tile no_hsps.blastp hit 280 \#hsps 0
ok 528 - tile no_hsps.blastp hit 281 \#hsps 0
ok 529 - tile no_hsps.blastp hit 282 \#hsps 0
ok 530 - tile no_hsps.blastp hit 283 \#hsps 0
ok 531 - tile no_hsps.blastp hit 284 \#hsps 0
ok 532 - tile no_hsps.blastp hit 285 \#hsps 0
ok 533 - tile no_hsps.blastp hit 286 \#hsps 0
ok 534 - tile no_hsps.blastp hit 287 \#hsps 0
ok 535 - tile no_hsps.blastp hit 288 \#hsps 0
ok 536 - tile no_hsps.blastp hit 289 \#hsps 0
ok 537 - tile no_hsps.blastp hit 290 \#hsps 0
ok 538 - tile no_hsps.blastp hit 291 \#hsps 0
ok 539 - tile no_hsps.blastp hit 292 \#hsps 0
ok 540 - tile no_hsps.blastp hit 293 \#hsps 0
ok 541 - tile no_hsps.blastp hit 294 \#hsps 0
ok 542 - tile no_hsps.blastp hit 295 \#hsps 0
ok 543 - tile no_hsps.blastp hit 296 \#hsps 0
ok 544 - tile no_hsps.blastp hit 297 \#hsps 0
ok 545 - tile no_hsps.blastp hit 298 \#hsps 0
ok 546 - tile no_hsps.blastp hit 299 \#hsps 0
ok 547 - tile no_hsps.blastp hit 300 \#hsps 0
ok 548 - tile no_hsps.blastp hit 301 \#hsps 0
ok 549 - tile no_hsps.blastp hit 302 \#hsps 0
ok 550 - tile no_hsps.blastp hit 303 \#hsps 0
ok 551 - tile no_hsps.blastp hit 304 \#hsps 0
ok 552 - tile no_hsps.blastp hit 305 \#hsps 0
ok 553 - tile no_hsps.blastp hit 306 \#hsps 0
ok 554 - tile no_hsps.blastp hit 307 \#hsps 0
ok 555 - tile no_hsps.blastp hit 308 \#hsps 0
ok 556 - tile no_hsps.blastp hit 309 \#hsps 0
ok 557 - tile no_hsps.blastp hit 310 \#hsps 0
ok 558 - tile no_hsps.blastp hit 311 \#hsps 0
ok 559 - tile no_hsps.blastp hit 312 \#hsps 0
ok 560 - tile no_hsps.blastp hit 313 \#hsps 0
ok 561 - tile no_hsps.blastp hit 314 \#hsps 0
ok 562 - tile no_hsps.blastp hit 315 \#hsps 0
ok 563 - tile no_hsps.blastp hit 316 \#hsps 0
ok 564 - tile no_hsps.blastp hit 317 \#hsps 0
ok 565 - tile no_hsps.blastp hit 318 \#hsps 0
ok 566 - tile no_hsps.blastp hit 319 \#hsps 0
ok 567 - tile no_hsps.blastp hit 320 \#hsps 0
ok 568 - tile no_hsps.blastp hit 321 \#hsps 0
ok 569 - tile no_hsps.blastp hit 322 \#hsps 0
ok 570 - tile no_hsps.blastp hit 323 \#hsps 0
ok 571 - tile no_hsps.blastp hit 324 \#hsps 0
ok 572 - tile no_hsps.blastp hit 325 \#hsps 0
ok 573 - tile no_hsps.blastp hit 326 \#hsps 0
ok 574 - tile no_hsps.blastp hit 327 \#hsps 0
ok 575 - tile no_hsps.blastp hit 328 \#hsps 0
ok 576 - tile no_hsps.blastp hit 329 \#hsps 0
ok 577 - tile no_hsps.blastp hit 330 \#hsps 0
ok 578 - tile no_hsps.blastp hit 331 \#hsps 0
ok 579 - tile no_hsps.blastp hit 332 \#hsps 0
ok 580 - tile no_hsps.blastp hit 333 \#hsps 0
ok 581 - tile no_hsps.blastp hit 334 \#hsps 0
ok 582 - tile no_hsps.blastp hit 335 \#hsps 0
ok 583 - tile no_hsps.blastp hit 336 \#hsps 0
ok 584 - tile no_hsps.blastp hit 337 \#hsps 0
ok 585 - tile no_hsps.blastp hit 338 \#hsps 0
ok 586 - tile no_hsps.blastp hit 339 \#hsps 0
ok 587 - tile no_hsps.blastp hit 340 \#hsps 0
ok 588 - tile no_hsps.blastp hit 341 \#hsps 0
ok 589 - tile no_hsps.blastp hit 342 \#hsps 0
ok 590 - tile no_hsps.blastp hit 343 \#hsps 0
ok 591 - tile no_hsps.blastp hit 344 \#hsps 0
ok 592 - tile no_hsps.blastp hit 345 \#hsps 0
ok 593 - tile no_hsps.blastp hit 346 \#hsps 0
ok 594 - tile no_hsps.blastp hit 347 \#hsps 0
ok 595 - tile no_hsps.blastp hit 348 \#hsps 0
ok 596 - tile no_hsps.blastp hit 349 \#hsps 0
ok 597 - tile no_hsps.blastp hit 350 \#hsps 0
ok 598 - tile no_hsps.blastp hit 351 \#hsps 0
ok 599 - tile no_hsps.blastp hit 352 \#hsps 0
ok 600 - tile no_hsps.blastp hit 353 \#hsps 0
ok 601 - tile no_hsps.blastp hit 354 \#hsps 0
ok 602 - tile no_hsps.blastp hit 355 \#hsps 0
ok 603 - tile no_hsps.blastp hit 356 \#hsps 0
ok 604 - tile no_hsps.blastp hit 357 \#hsps 0
ok 605 - tile no_hsps.blastp hit 358 \#hsps 0
ok 606 - tile no_hsps.blastp hit 359 \#hsps 0
ok 607 - tile no_hsps.blastp hit 360 \#hsps 0
ok 608 - tile no_hsps.blastp hit 361 \#hsps 0
ok 609 - tile no_hsps.blastp hit 362 \#hsps 0
ok 610 - tile no_hsps.blastp hit 363 \#hsps 0
ok 611 - tile no_hsps.blastp hit 364 \#hsps 0
ok 612 - tile no_hsps.blastp hit 365 \#hsps 0
ok 613 - tile no_hsps.blastp hit 366 \#hsps 0
ok 614 - tile no_hsps.blastp hit 367 \#hsps 0
ok 615 - tile no_hsps.blastp hit 368 \#hsps 0
ok 616 - tile no_hsps.blastp hit 369 \#hsps 0
ok 617 - tile no_hsps.blastp hit 370 \#hsps 0
ok 618 - tile no_hsps.blastp hit 371 \#hsps 0
ok 619 - tile no_hsps.blastp hit 372 \#hsps 0
ok 620 - tile no_hsps.blastp hit 373 \#hsps 0
ok 621 - tile no_hsps.blastp hit 374 \#hsps 0
ok 622 - tile no_hsps.blastp hit 375 \#hsps 0
ok 623 - tile no_hsps.blastp hit 376 \#hsps 0
ok 624 - tile no_hsps.blastp hit 377 \#hsps 0
ok 625 - tile no_hsps.blastp hit 378 \#hsps 0
ok 626 - tile no_hsps.blastp hit 379 \#hsps 0
ok 627 - tile no_hsps.blastp hit 380 \#hsps 0
ok 628 - tile no_hsps.blastp hit 381 \#hsps 0
ok 629 - tile no_hsps.blastp hit 382 \#hsps 0
ok 630 - tile no_hsps.blastp hit 383 \#hsps 0
ok 631 - tile no_hsps.blastp hit 384 \#hsps 0
ok 632 - tile no_hsps.blastp hit 385 \#hsps 0
ok 633 - tile no_hsps.blastp hit 386 \#hsps 0
ok 634 - tile no_hsps.blastp hit 387 \#hsps 0
ok 635 - tile no_hsps.blastp hit 388 \#hsps 0
ok 636 - tile no_hsps.blastp hit 389 \#hsps 0
ok 637 - tile no_hsps.blastp hit 390 \#hsps 0
ok 638 - tile no_hsps.blastp hit 391 \#hsps 0
ok 639 - tile no_hsps.blastp hit 392 \#hsps 0
ok 640 - tile no_hsps.blastp hit 393 \#hsps 0
ok 641 - tile no_hsps.blastp hit 394 \#hsps 0
ok 642 - tile no_hsps.blastp hit 395 \#hsps 0
ok 643 - tile no_hsps.blastp hit 396 \#hsps 0
ok 644 - tile no_hsps.blastp hit 397 \#hsps 0
ok 645 - tile no_hsps.blastp hit 398 \#hsps 0
ok 646 - tile no_hsps.blastp hit 399 \#hsps 0
ok 647 - tile no_hsps.blastp hit 400 \#hsps 0
ok 648 - tile no_hsps.blastp hit 401 \#hsps 0
ok 649 - tile no_hsps.blastp hit 402 \#hsps 0
ok 650 - tile no_hsps.blastp hit 403 \#hsps 0
ok 651 - tile no_hsps.blastp hit 404 \#hsps 0
ok 652 - tile no_hsps.blastp hit 405 \#hsps 0
ok 653 - tile no_hsps.blastp hit 406 \#hsps 0
ok 654 - tile no_hsps.blastp hit 407 \#hsps 0
ok 655 - tile no_hsps.blastp hit 408 \#hsps 0
ok 656 - tile no_hsps.blastp hit 409 \#hsps 0
ok 657 - tile no_hsps.blastp hit 410 \#hsps 0
ok 658 - tile no_hsps.blastp hit 411 \#hsps 0
ok 659 - tile no_hsps.blastp hit 412 \#hsps 0
ok 660 - tile no_hsps.blastp hit 413 \#hsps 0
ok 661 - tile no_hsps.blastp hit 414 \#hsps 0
ok 662 - tile no_hsps.blastp hit 415 \#hsps 0
ok 663 - catalase-webblast.BLASTP
ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1
ok 665 - q id: est (1.00000) = fast (1.00000)
ok 666 - q cn: est (1.00000) = fast (1.00000)
ok 667 - h id: est (1.00000) = fast (1.00000)
ok 668 - h cn: est (1.00000) = fast (1.00000)
ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1
ok 670 - q id: est (0.80973) = fast (0.80973)
ok 671 - q cn: est (0.89006) = fast (0.89006)
ok 672 - h id: est (0.82543) = fast (0.82543)
ok 673 - h cn: est (0.90733) = fast (0.90733)
ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1
ok 675 - q id: est (0.71670) = fast (0.71670)
ok 676 - q cn: est (0.84144) = fast (0.84144)
ok 677 - h id: est (0.72747) = fast (0.72747)
ok 678 - h cn: est (0.85408) = fast (0.85408)
ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1
ok 680 - q id: est (0.58910) = fast (0.58910)
ok 681 - q cn: est (0.70860) = fast (0.70860)
ok 682 - h id: est (0.65654) = fast (0.65654)
ok 683 - h cn: est (0.78972) = fast (0.78972)
ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1
ok 685 - q id: est (0.49245) = fast (0.49245)
ok 686 - q cn: est (0.65257) = fast (0.65257)
ok 687 - h id: est (0.49544) = fast (0.49544)
ok 688 - h cn: est (0.65653) = fast (0.65653)
ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1
ok 690 - q id: est (0.44366) = fast (0.44366)
ok 691 - q cn: est (0.58920) = fast (0.58920)
ok 692 - h id: est (0.44787) = fast (0.44787)
ok 693 - h cn: est (0.59479) = fast (0.59479)
ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1
ok 695 - q id: est (0.42564) = fast (0.42564)
ok 696 - q cn: est (0.61282) = fast (0.61282)
ok 697 - h id: est (0.43229) = fast (0.43229)
ok 698 - h cn: est (0.62240) = fast (0.62240)
ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1
ok 700 - q id: est (0.48358) = fast (0.48358)
ok 701 - q cn: est (0.63881) = fast (0.63881)
ok 702 - h id: est (0.48943) = fast (0.48943)
ok 703 - h cn: est (0.64653) = fast (0.64653)
ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1
ok 705 - q id: est (0.42308) = fast (0.42308)
ok 706 - q cn: est (0.61282) = fast (0.61282)
ok 707 - h id: est (0.42969) = fast (0.42969)
ok 708 - h cn: est (0.62240) = fast (0.62240)
ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1
ok 710 - q id: est (0.39675) = fast (0.39675)
ok 711 - q cn: est (0.58933) = fast (0.58933)
ok 712 - h id: est (0.39767) = fast (0.39767)
ok 713 - h cn: est (0.59070) = fast (0.59070)
ok 714 - dcr1_sp.WUBLASTP
ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1
ok 716 - q id: est (1.00000) = fast (1.00000)
ok 717 - q cn: est (1.00000) = fast (1.00000)
ok 718 - h id: est (1.00000) = fast (1.00000)
ok 719 - h cn: est (1.00000) = fast (1.00000)
ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4
ok 721 - q id: exact (0.36876) ~ est (0.36973)
ok 722 - q id: exact (0.36876) <= max (0.37070)
ok 723 - q cn: exact (0.55022) ~ est (0.55041)
ok 724 - q cn: exact (0.55022) <= max (0.55105)
ok 725 - h id: exact (0.35111) ~ est (0.35111)
ok 726 - h id: exact (0.35111) <= max (0.35111)
ok 727 - h cn: exact (0.52305) ~ est (0.52305)
ok 728 - h cn: exact (0.52305) <= max (0.52305)
ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1
ok 730 - q id: est (0.38685) = fast (0.38685)
ok 731 - q cn: est (0.55397) = fast (0.55397)
ok 732 - h id: est (0.37613) = fast (0.37613)
ok 733 - h cn: est (0.53863) = fast (0.53863)
ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1
ok 735 - q id: est (0.38247) = fast (0.38247)
ok 736 - q cn: est (0.55068) = fast (0.55068)
ok 737 - h id: est (0.37306) = fast (0.37306)
ok 738 - h cn: est (0.53715) = fast (0.53715)
ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5
ok 740 - q id: exact (0.35010) ~ est (0.35010)
ok 741 - q id: exact (0.35010) <= max (0.35010)
ok 742 - q cn: exact (0.53183) ~ est (0.53183)
ok 743 - q cn: exact (0.53183) <= max (0.53183)
ok 744 - h id: exact (0.35082) ~ est (0.35082)
ok 745 - h id: exact (0.35082) <= max (0.35082)
ok 746 - h cn: exact (0.53292) ~ est (0.53292)
ok 747 - h cn: exact (0.53292) <= max (0.53292)
ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8
ok 749 - q id: exact (0.30547) ~ est (0.30659)
ok 750 - q id: exact (0.30547) <= max (0.30623)
ok 751 - q cn: exact (0.50076) ~ est (0.50205)
ok 752 - q cn: exact (0.50076) <= max (0.50076)
ok 753 - h id: exact (0.31390) ~ est (0.31179)
ok 754 - h id: exact (0.31390) <= max (0.31795)
ok 755 - h cn: exact (0.50531) ~ est (0.50557)
ok 756 - h cn: exact (0.50531) <= max (0.51091)
ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7
ok 758 - q id: exact (0.30136) ~ est (0.30184)
ok 759 - q id: exact (0.30136) <= max (0.30498)
ok 760 - q cn: exact (0.48688) ~ est (0.48742)
ok 761 - q cn: exact (0.48688) <= max (0.49140)
ok 762 - h id: exact (0.30944) ~ est (0.31034)
ok 763 - h id: exact (0.30944) <= max (0.30988)
ok 764 - h cn: exact (0.50178) ~ est (0.50277)
ok 765 - h cn: exact (0.50178) <= max (0.50223)
ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10
ok 767 - q id: exact (0.28918) ~ est (0.28961)
ok 768 - q id: exact (0.28918) <= max (0.28955)
ok 769 - q cn: exact (0.46418) ~ est (0.46247)
ok 770 - q cn: exact (0.46418) <= max (0.46866)
ok 771 - h id: exact (0.30166) ~ est (0.30299)
ok 772 - h id: exact (0.30166) <= max (0.30800)
ok 773 - h cn: exact (0.48179) ~ est (0.48439)
ok 774 - h cn: exact (0.48179) <= max (0.48535)
ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8
ok 776 - q id: exact (0.30289) ~ est (0.30238)
ok 777 - q id: exact (0.30289) <= max (0.30651)
ok 778 - q cn: exact (0.49955) ~ est (0.49787)
ok 779 - q cn: exact (0.49955) <= max (0.50362)
ok 780 - h id: exact (0.31395) ~ est (0.31347)
ok 781 - h id: exact (0.31395) <= max (0.31721)
ok 782 - h cn: exact (0.51535) ~ est (0.51578)
ok 783 - h cn: exact (0.51535) <= max (0.51814)
ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5
ok 785 - q id: exact (0.29334) ~ est (0.29534)
ok 786 - q id: exact (0.29334) <= max (0.29810)
ok 787 - q cn: exact (0.46617) ~ est (0.46719)
ok 788 - q cn: exact (0.46617) <= max (0.47040)
ok 789 - h id: exact (0.31176) ~ est (0.31176)
ok 790 - h id: exact (0.31176) <= max (0.31176)
ok 791 - h cn: exact (0.49299) ~ est (0.49299)
ok 792 - h cn: exact (0.49299) <= max (0.49299)
ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7
ok 794 - q id: exact (0.30456) ~ est (0.30514)
ok 795 - q id: exact (0.30456) <= max (0.30650)
ok 796 - q cn: exact (0.48739) ~ est (0.48879)
ok 797 - q cn: exact (0.48739) <= max (0.49370)
ok 798 - h id: exact (0.32062) ~ est (0.31987)
ok 799 - h id: exact (0.32062) <= max (0.32932)
ok 800 - h cn: exact (0.51071) ~ est (0.51306)
ok 801 - h cn: exact (0.51071) <= max (0.52410)
ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8
ok 803 - q id: exact (0.29615) ~ est (0.29879)
ok 804 - q id: exact (0.29615) <= max (0.30009)
ok 805 - q cn: exact (0.47419) ~ est (0.47394)
ok 806 - q cn: exact (0.47419) <= max (0.48119)
ok 807 - h id: exact (0.31611) ~ est (0.31482)
ok 808 - h id: exact (0.31611) <= max (0.32227)
ok 809 - h cn: exact (0.49779) ~ est (0.49788)
ok 810 - h cn: exact (0.49779) <= max (0.50616)
ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8
ok 812 - q id: exact (0.30390) ~ est (0.30440)
ok 813 - q id: exact (0.30390) <= max (0.30701)
ok 814 - q cn: exact (0.45874) ~ est (0.45993)
ok 815 - q cn: exact (0.45874) <= max (0.45963)
ok 816 - h id: exact (0.32282) ~ est (0.32324)
ok 817 - h id: exact (0.32282) <= max (0.32560)
ok 818 - h cn: exact (0.48052) ~ est (0.48136)
ok 819 - h cn: exact (0.48052) <= max (0.48330)
ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6
ok 821 - q id: exact (0.29769) ~ est (0.29851)
ok 822 - q id: exact (0.29769) <= max (0.29769)
ok 823 - q cn: exact (0.48480) ~ est (0.48628)
ok 824 - q cn: exact (0.48480) <= max (0.48637)
ok 825 - h id: exact (0.30704) ~ est (0.30810)
ok 826 - h id: exact (0.30704) <= max (0.30917)
ok 827 - h cn: exact (0.50107) ~ est (0.50292)
ok 828 - h cn: exact (0.50107) <= max (0.50320)
ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6
ok 830 - q id: exact (0.27854) ~ est (0.27854)
ok 831 - q id: exact (0.27854) <= max (0.27854)
ok 832 - q cn: exact (0.48174) ~ est (0.48174)
ok 833 - q cn: exact (0.48174) <= max (0.48174)
ok 834 - h id: exact (0.28514) ~ est (0.28623)
ok 835 - h id: exact (0.28514) <= max (0.28594)
ok 836 - h cn: exact (0.49197) ~ est (0.49154)
ok 837 - h cn: exact (0.49197) <= max (0.49237)
ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8
ok 839 - q id: exact (0.30362) ~ est (0.30824)
ok 840 - q id: exact (0.30362) <= max (0.30852)
ok 841 - q cn: exact (0.47111) ~ est (0.47587)
ok 842 - q cn: exact (0.47111) <= max (0.47405)
ok 843 - h id: exact (0.32347) ~ est (0.32392)
ok 844 - h id: exact (0.32347) <= max (0.32643)
ok 845 - h cn: exact (0.49310) ~ est (0.49360)
ok 846 - h cn: exact (0.49310) <= max (0.49606)
ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4
ok 848 - q id: exact (0.29174) ~ est (0.29174)
ok 849 - q id: exact (0.29174) <= max (0.29174)
ok 850 - q cn: exact (0.46230) ~ est (0.46230)
ok 851 - q cn: exact (0.46230) <= max (0.46230)
ok 852 - h id: exact (0.30204) ~ est (0.30204)
ok 853 - h id: exact (0.30204) <= max (0.30204)
ok 854 - h cn: exact (0.47862) ~ est (0.47862)
ok 855 - h cn: exact (0.47862) <= max (0.47862)
ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6
ok 857 - q id: exact (0.29064) ~ est (0.29089)
ok 858 - q id: exact (0.29064) <= max (0.29115)
ok 859 - q cn: exact (0.48765) ~ est (0.48670)
ok 860 - q cn: exact (0.48765) <= max (0.48868)
ok 861 - h id: exact (0.29848) ~ est (0.29887)
ok 862 - h id: exact (0.29848) <= max (0.29902)
ok 863 - h cn: exact (0.50108) ~ est (0.50116)
ok 864 - h cn: exact (0.50108) <= max (0.50163)
ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5
ok 866 - q id: exact (0.29510) ~ est (0.29505)
ok 867 - q id: exact (0.29510) <= max (0.29510)
ok 868 - q cn: exact (0.48982) ~ est (0.49039)
ok 869 - q cn: exact (0.48982) <= max (0.49029)
ok 870 - h id: exact (0.30019) ~ est (0.30019)
ok 871 - h id: exact (0.30019) <= max (0.30019)
ok 872 - h cn: exact (0.49906) ~ est (0.49906)
ok 873 - h cn: exact (0.49906) <= max (0.49906)
ok 874 - 503384.MEGABLAST.2
ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5
ok 876 - q id: exact (0.91435) ~ est (0.91435)
ok 877 - q id: exact (0.91435) <= max (0.91435)
ok 878 - q cn: exact (0.91435) ~ est (0.91435)
ok 879 - q cn: exact (0.91435) <= max (0.91435)
ok 880 - h id: exact (0.91157) ~ est (0.91157)
ok 881 - h id: exact (0.91157) <= max (0.91157)
ok 882 - h cn: exact (0.91157) ~ est (0.91157)
ok 883 - h cn: exact (0.91157) <= max (0.91157)
ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9
ok 885 - q id: exact (0.92895) ~ est (0.92895)
ok 886 - q id: exact (0.92895) <= max (0.92895)
ok 887 - q cn: exact (0.92895) ~ est (0.92895)
ok 888 - q cn: exact (0.92895) <= max (0.92895)
ok 889 - h id: exact (0.92854) ~ est (0.92854)
ok 890 - h id: exact (0.92854) <= max (0.92854)
ok 891 - h cn: exact (0.92854) ~ est (0.92854)
ok 892 - h cn: exact (0.92854) <= max (0.92854)
ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3
ok 894 - q id: exact (0.93516) ~ est (0.93516)
ok 895 - q id: exact (0.93516) <= max (0.93516)
ok 896 - q cn: exact (0.93516) ~ est (0.93516)
ok 897 - q cn: exact (0.93516) <= max (0.93516)
ok 898 - h id: exact (0.93651) ~ est (0.93651)
ok 899 - h id: exact (0.93651) <= max (0.93651)
ok 900 - h cn: exact (0.93651) ~ est (0.93651)
ok 901 - h cn: exact (0.93651) <= max (0.93651)
ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3
ok 903 - q id: exact (0.93064) ~ est (0.93064)
ok 904 - q id: exact (0.93064) <= max (0.93064)
ok 905 - q cn: exact (0.93064) ~ est (0.93064)
ok 906 - q cn: exact (0.93064) <= max (0.93064)
ok 907 - h id: exact (0.92885) ~ est (0.92885)
ok 908 - h id: exact (0.92885) <= max (0.92885)
ok 909 - h cn: exact (0.92885) ~ est (0.92885)
ok 910 - h cn: exact (0.92885) <= max (0.92885)
ok 911 - bl2seq.blastx.out
ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6
ok 913 - q id: exact (0.70536) ~ est (0.70495)
ok 914 - q id: exact (0.70536) <= max (0.94286)
ok 915 - q cn: exact (0.78810) ~ est (0.78803)
ok 916 - q cn: exact (0.78810) <= max (0.96429)
ok 917 - q id: est (0.35714) = fast (0.35714)
ok 918 - q cn: est (0.57143) = fast (0.57143)
ok 919 - q id: est (0.71429) = fast (0.71429)
ok 920 - q cn: est (1.00000) = fast (1.00000)
ok 921 - h id: exact (0.61923) ~ est (0.61955)
ok 922 - h id: exact (0.61923) <= max (0.64231)
ok 923 - h cn: exact (0.73077) ~ est (0.73077)
ok 924 - h cn: exact (0.73077) <= max (0.75000)
ok 925 - dnaEbsub_ecoli.wublastx
ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1
ok 927 - q id: est (0.36386) = fast (0.36386)
ok 928 - q cn: est (0.53735) = fast (0.53735)
ok 929 - h id: est (0.36562) = fast (0.36562)
ok 930 - h cn: est (0.53995) = fast (0.53995)
ok 931 - tblastn.out
ok 932 - tile tblastn.out hit 1 \#hsps 2
ok 933 - q id: exact (0.31250) ~ est (0.33325)
ok 934 - q id: exact (0.31250) <= max (0.33333)
ok 935 - q cn: exact (0.44792) ~ est (0.47055)
ok 936 - q cn: exact (0.44792) <= max (0.45833)
ok 937 - h id: exact (0.33333) ~ est (0.33333)
ok 938 - h id: exact (0.33333) <= max (0.33333)
ok 939 - h cn: exact (0.47059) ~ est (0.47059)
ok 940 - h cn: exact (0.47059) <= max (0.47059)
ok 941 - tile tblastn.out hit 2 \#hsps 2
ok 942 - q id: exact (0.68750) ~ est (0.68750)
ok 943 - q id: exact (0.68750) <= max (0.68750)
ok 944 - q cn: exact (0.81250) ~ est (0.81250)
ok 945 - q cn: exact (0.81250) <= max (0.81250)
ok 946 - h id: est (0.66667) = fast (0.66667)
ok 947 - h cn: est (0.77778) = fast (0.77778)
ok 948 - h id: est (0.71429) = fast (0.71429)
ok 949 - h cn: est (0.85714) = fast (0.85714)
ok 950 - dnaEbsub_ecoli.wutblastn
ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1
ok 952 - q id: est (0.36386) = fast (0.36386)
ok 953 - q cn: est (0.53735) = fast (0.53735)
ok 954 - h id: est (0.36562) = fast (0.36562)
ok 955 - h cn: est (0.53995) = fast (0.53995)
ok 956 - HUMBETGLOA.tblastx
ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1
ok 958 - q id: est (0.42308) = fast (0.42308)
ok 959 - q cn: est (0.61538) = fast (0.61538)
ok 960 - h id: est (0.42308) = fast (0.42308)
ok 961 - h cn: est (0.61538) = fast (0.61538)
ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1
ok 963 - q id: est (0.47059) = fast (0.47059)
ok 964 - q cn: est (0.76471) = fast (0.76471)
ok 965 - h id: est (0.47059) = fast (0.47059)
ok 966 - h cn: est (0.76471) = fast (0.76471)
ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1
ok 968 - q id: est (0.36000) = fast (0.36000)
ok 969 - q cn: est (0.56000) = fast (0.56000)
ok 970 - h id: est (0.36000) = fast (0.36000)
ok 971 - h cn: est (0.56000) = fast (0.56000)
ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1
ok 973 - q id: est (0.29268) = fast (0.29268)
ok 974 - q cn: est (0.58537) = fast (0.58537)
ok 975 - h id: est (0.29268) = fast (0.29268)
ok 976 - h cn: est (0.58537) = fast (0.58537)
ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1
ok 978 - q id: est (0.38889) = fast (0.38889)
ok 979 - q cn: est (0.55556) = fast (0.55556)
ok 980 - h id: est (0.38889) = fast (0.38889)
ok 981 - h cn: est (0.55556) = fast (0.55556)
ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1
ok 983 - q id: est (0.43590) = fast (0.43590)
ok 984 - q cn: est (0.51282) = fast (0.51282)
ok 985 - h id: est (0.43590) = fast (0.43590)
ok 986 - h cn: est (0.51282) = fast (0.51282)
ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1
ok 988 - q id: est (0.35714) = fast (0.35714)
ok 989 - q cn: est (0.42857) = fast (0.42857)
ok 990 - h id: est (0.35714) = fast (0.35714)
ok 991 - h cn: est (0.42857) = fast (0.42857)
ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1
ok 993 - q id: est (0.33333) = fast (0.33333)
ok 994 - q cn: est (0.66667) = fast (0.66667)
ok 995 - h id: est (0.33333) = fast (0.33333)
ok 996 - h cn: est (0.66667) = fast (0.66667)
ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2
ok 998 - q id: exact (0.40541) ~ est (0.40541)
ok 999 - q id: exact (0.40541) <= max (0.40541)
ok 1000 - q cn: exact (0.56757) ~ est (0.56757)
ok 1001 - q cn: exact (0.56757) <= max (0.56757)
ok 1002 - h id: est (0.42308) = fast (0.42308)
ok 1003 - h cn: est (0.53846) = fast (0.53846)
ok 1004 - h id: est (0.36364) = fast (0.36364)
ok 1005 - h cn: est (0.63636) = fast (0.63636)
ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1
ok 1007 - q id: est (0.29167) = fast (0.29167)
ok 1008 - q cn: est (0.39583) = fast (0.39583)
ok 1009 - h id: est (0.29167) = fast (0.29167)
ok 1010 - h cn: est (0.39583) = fast (0.39583)
ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1
ok 1012 - q id: est (0.60000) = fast (0.60000)
ok 1013 - q cn: est (0.65000) = fast (0.65000)
ok 1014 - h id: est (0.60000) = fast (0.60000)
ok 1015 - h cn: est (0.65000) = fast (0.65000)
ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1
ok 1017 - q id: est (0.50000) = fast (0.50000)
ok 1018 - q cn: est (0.68182) = fast (0.68182)
ok 1019 - h id: est (0.50000) = fast (0.50000)
ok 1020 - h cn: est (0.68182) = fast (0.68182)
ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1
ok 1022 - q id: est (0.29630) = fast (0.29630)
ok 1023 - q cn: est (0.48148) = fast (0.48148)
ok 1024 - h id: est (0.29630) = fast (0.29630)
ok 1025 - h cn: est (0.48148) = fast (0.48148)
ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1
ok 1027 - q id: est (0.47826) = fast (0.47826)
ok 1028 - q cn: est (0.52174) = fast (0.52174)
ok 1029 - h id: est (0.47826) = fast (0.47826)
ok 1030 - h cn: est (0.52174) = fast (0.52174)
ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1
ok 1032 - q id: est (0.47368) = fast (0.47368)
ok 1033 - q cn: est (0.63158) = fast (0.63158)
ok 1034 - h id: est (0.47368) = fast (0.47368)
ok 1035 - h cn: est (0.63158) = fast (0.63158)
ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1
ok 1037 - q id: est (0.44444) = fast (0.44444)
ok 1038 - q cn: est (0.55556) = fast (0.55556)
ok 1039 - h id: est (0.44444) = fast (0.44444)
ok 1040 - h cn: est (0.55556) = fast (0.55556)
ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1
ok 1042 - q id: est (0.47059) = fast (0.47059)
ok 1043 - q cn: est (0.70588) = fast (0.70588)
ok 1044 - h id: est (0.47059) = fast (0.47059)
ok 1045 - h cn: est (0.70588) = fast (0.70588)
ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1
ok 1047 - q id: est (0.38889) = fast (0.38889)
ok 1048 - q cn: est (0.66667) = fast (0.66667)
ok 1049 - h id: est (0.38889) = fast (0.38889)
ok 1050 - h cn: est (0.66667) = fast (0.66667)
ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1
ok 1052 - q id: est (0.27660) = fast (0.27660)
ok 1053 - q cn: est (0.48936) = fast (0.48936)
ok 1054 - h id: est (0.27660) = fast (0.27660)
ok 1055 - h cn: est (0.48936) = fast (0.48936)
ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1
ok 1057 - q id: est (0.40000) = fast (0.40000)
ok 1058 - q cn: est (0.60000) = fast (0.60000)
ok 1059 - h id: est (0.40000) = fast (0.40000)
ok 1060 - h cn: est (0.60000) = fast (0.60000)
ok 1061 - dnaEbsub_ecoli.wutblastx
ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12
ok 1063 - q id: est (0.37500) = fast (0.37500)
ok 1064 - q cn: est (0.62500) = fast (0.62500)
ok 1065 - q id: exact (0.44118) ~ est (0.44118)
ok 1066 - q id: exact (0.44118) <= max (0.44118)
ok 1067 - q cn: exact (0.54412) ~ est (0.54412)
ok 1068 - q cn: exact (0.54412) <= max (0.54412)
ok 1069 - q id: est (0.25352) = fast (0.25352)
ok 1070 - q cn: est (0.47887) = fast (0.47887)
ok 1071 - q id: exact (0.40224) ~ est (0.40912)
ok 1072 - q id: exact (0.40224) <= max (0.42628)
ok 1073 - q cn: exact (0.58494) ~ est (0.58968)
ok 1074 - q cn: exact (0.58494) <= max (0.62179)
ok 1075 - h id: exact (0.44118) ~ est (0.44118)
ok 1076 - h id: exact (0.44118) <= max (0.44118)
ok 1077 - h cn: exact (0.54412) ~ est (0.54412)
ok 1078 - h cn: exact (0.54412) <= max (0.54412)
ok 1079 - h id: est (0.25352) = fast (0.25352)
ok 1080 - h cn: est (0.47887) = fast (0.47887)
ok 1081 - h id: exact (0.39848) ~ est (0.40304)
ok 1082 - h id: exact (0.39848) <= max (0.40355)
ok 1083 - h cn: exact (0.58376) ~ est (0.58889)
ok 1084 - h cn: exact (0.58376) <= max (0.58883)
ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2
ok 1086 - q id: exact (0.41818) ~ est (0.41818)
ok 1087 - q id: exact (0.41818) <= max (0.41818)
ok 1088 - q cn: exact (0.52727) ~ est (0.52727)
ok 1089 - q cn: exact (0.52727) <= max (0.52727)
ok 1090 - h id: est (0.53333) = fast (0.53333)
ok 1091 - h cn: est (0.66667) = fast (0.66667)
ok 1092 - h id: est (0.37500) = fast (0.37500)
ok 1093 - h cn: est (0.47500) = fast (0.47500)
ok 1094 - bug2942: query m0: range correct
ok 1095 - bug2942: query m1: range correct
ok 1096 - bug2942: query m2: range correct
ok 1097 - bug2942: subject all : range correct
ok 1098 - get_tiled_alns
ok 1099 - got all alns
ok 1100
ok 1101 - aln and qfeat lengths correspond
ok 1102 - q length correct
ok 1103
ok 1104 - features on q and s correspond
ok 1105 - aln and hfeat lengths correspond
ok 1106 - s length correct
ok 1107
ok 1108 - aln and qfeat lengths correspond
ok 1109 - q length correct
ok 1110
ok 1111 - features on q and s correspond
ok 1112 - aln and hfeat lengths correspond
ok 1113 - s length correct
ok 1114
ok 1115 - aln and qfeat lengths correspond
ok 1116 - q length correct
ok 1117
ok 1118 - features on q and s correspond
ok 1119 - aln and hfeat lengths correspond
ok 1120 - s length correct
ok 1121
ok 1122 - aln and qfeat lengths correspond
ok 1123 - q length correct
ok 1124
ok 1125 - features on q and s correspond
ok 1126 - aln and hfeat lengths correspond
ok 1127 - s length correct
ok 1128
ok 1129 - aln and qfeat lengths correspond
ok 1130 - q length correct
ok 1131
ok 1132 - features on q and s correspond
ok 1133 - aln and hfeat lengths correspond
ok 1134 - s length correct
ok 1135
ok 1136 - aln and qfeat lengths correspond
ok 1137 - q length correct
ok 1138
ok 1139 - features on q and s correspond
ok 1140 - aln and hfeat lengths correspond
ok 1141 - s length correct
ok
t/SearchIO/Writer/GbrowseGFF.t .........
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/Writer/HSPTableWriter.t .....
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HSPTableWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/Writer/HTMLWriter.t .........
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/Writer/HitTableWriter.t .....
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HitTableWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/Writer/TextWriter.t .........
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::TextResultWriter;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6
ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 8
ok
t/SearchIO/axt.t .......................
1..19
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/SearchIO/blast.t .....................
1..1360
ok 1 - use Bio::SearchIO;
ok 2 - Bio::SearchIO->new can handle a Path::Class object
ok 3 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO'
ok 4 - Bio::SearchIO->new can handle a Path::Class object
ok 5 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO'
ok 6
ok 7 - database_name()
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
not ok 415 # TODO frac_identical & frac_conserved are still too wrong
# Failed (TODO) test at t/SearchIO/blast.t line 668.
# '0.852'
# >
# '0.9'
not ok 416 # TODO frac_identical & frac_conserved are still too wrong
# Failed (TODO) test at t/SearchIO/blast.t line 669.
# '1.599'
# <=
# '1'
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517
ok 518
ok 519
ok 520
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561
ok 562
ok 563
ok 564
ok 565
ok 566
ok 567
ok 568
ok 569
ok 570
ok 571
ok 572
ok 573
ok 574
ok 575
ok 576
ok 577
ok 578
ok 579
ok 580
ok 581
ok 582
ok 583
ok 584
ok 585
ok 586
ok 587
ok 588
ok 589
ok 590
ok 591
ok 592
ok 593
ok 594
ok 595
ok 596
ok 597 - Multiblast query test
ok 598
ok 599 - Multiblast query test
ok 600
ok 601 - Multiblast query test
ok 602
ok 603 - Multiblast query test
ok 604
ok 605
ok 606
ok 607
ok 608
ok 609
ok 610
ok 611
ok 612
ok 613
ok 614
ok 615
ok 616
ok 617
ok 618
ok 619
ok 620
ok 621
ok 622
ok 623
ok 624
ok 625
ok 626
ok 627
ok 628
ok 629
ok 630
ok 631
ok 632
ok 633
ok 634
ok 635
ok 636
ok 637
ok 638
ok 639
ok 640
ok 641
ok 642
ok 643
ok 644
ok 645
ok 646
ok 647
ok 648
ok 649
ok 650
ok 651
ok 652
ok 653
ok 654
ok 655
ok 656
ok 657
ok 658
ok 659
ok 660
ok 661
ok 662
ok 663
ok 664
ok 665
ok 666
ok 667
ok 668
ok 669
ok 670
ok 671
ok 672
ok 673
ok 674
ok 675
ok 676
ok 677
ok 678
ok 679
ok 680
ok 681
ok 682
ok 683
ok 684
ok 685
ok 686
ok 687
ok 688
ok 689
ok 690
ok 691
ok 692
ok 693
ok 694
ok 695
ok 696
ok 697
ok 698
ok 699
ok 700
ok 701
ok 702
ok 703
ok 704
ok 705
ok 706
ok 707
ok 708
ok 709
ok 710
ok 711
ok 712
ok 713
ok 714
ok 715
ok 716
ok 717
ok 718
ok 719
ok 720
ok 721
ok 722
ok 723
ok 724
ok 725
ok 726
ok 727
ok 728
ok 729
ok 730
ok 731
ok 732
ok 733
ok 734
ok 735
ok 736
ok 737
ok 738
ok 739
ok 740
ok 741
ok 742
ok 743
ok 744
ok 745
ok 746
ok 747
ok 748
ok 749
ok 750
ok 751
ok 752
ok 753
ok 754
ok 755
ok 756
ok 757
ok 758
ok 759
ok 760
ok 761
ok 762
ok 763
ok 764
ok 765
ok 766
ok 767
ok 768
ok 769
ok 770
ok 771
ok 772
ok 773
ok 774
ok 775
ok 776
ok 777
ok 778
ok 779
ok 780
ok 781
ok 782
ok 783
ok 784
ok 785
ok 786
ok 787
ok 788
ok 789
ok 790
ok 791
ok 792
ok 793
ok 794
ok 795
ok 796
ok 797
ok 798
ok 799
ok 800
ok 801
ok 802
ok 803
ok 804
ok 805
ok 806
ok 807
ok 808
ok 809
ok 810
ok 811
ok 812
ok 813
ok 814
ok 815
ok 816
ok 817
ok 818
ok 819
ok 820
ok 821
ok 822
ok 823
ok 824
ok 825
ok 826
ok 827
ok 828
ok 829
ok 830
ok 831
ok 832
ok 833
ok 834
ok 835
ok 836
ok 837
ok 838
ok 839
ok 840
ok 841
ok 842
ok 843
ok 844
ok 845
ok 846
ok 847
ok 848
ok 849
ok 850
ok 851
ok 852
ok 853
ok 854
ok 855
ok 856
ok 857
ok 858
ok 859
ok 860
ok 861
ok 862
ok 863
ok 864
ok 865
ok 866
ok 867
ok 868
ok 869
ok 870
ok 871
ok 872
ok 873
ok 874
ok 875
ok 876
ok 877
ok 878
ok 879
ok 880
ok 881
ok 882
ok 883
ok 884
ok 885 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 886
ok 887
ok 888
ok 889
ok 890
ok 891
ok 892
ok 893
ok 894
ok 895
ok 896
ok 897
ok 898
ok 899
ok 900
ok 901
ok 902
ok 903
ok 904
ok 905 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 906
ok 907
ok 908
ok 909
ok 910
ok 911
ok 912
ok 913
ok 914
ok 915
ok 916
ok 917
ok 918
ok 919
ok 920
ok 921
ok 922
ok 923
ok 924
ok 925
ok 926
ok 927
ok 928
ok 929 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 930
ok 931
ok 932
ok 933
ok 934
ok 935
ok 936
ok 937
ok 938
ok 939
ok 940
ok 941
ok 942
ok 943
ok 944
ok 945
ok 946
ok 947
ok 948
ok 949
ok 950
ok 951
ok 952
ok 953 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 954
ok 955
ok 956
ok 957
ok 958
ok 959
ok 960
ok 961
ok 962
ok 963
ok 964
ok 965
ok 966
ok 967
ok 968
ok 969
ok 970
ok 971
ok 972
ok 973
ok 974
ok 975
ok 976
ok 977
ok 978 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 979
ok 980
ok 981
ok 982
ok 983
ok 984
ok 985
ok 986
ok 987
ok 988
ok 989
ok 990
ok 991
ok 992
ok 993
ok 994
ok 995
ok 996
ok 997
ok 998
ok 999
ok 1000
ok 1001
ok 1002
ok 1003
ok 1004
ok 1005
ok 1006 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 1007
ok 1008
ok 1009
ok 1010
ok 1011
ok 1012
ok 1013
ok 1014
ok 1015
ok 1016
ok 1017
ok 1018
ok 1019
ok 1020
ok 1021
ok 1022
ok 1023
ok 1024
ok 1025
ok 1026
ok 1027
ok 1028
ok 1029
ok 1030
ok 1031
ok 1032
ok 1033
ok 1034
ok 1035 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 1036
ok 1037
ok 1038
ok 1039
ok 1040
ok 1041
ok 1042
ok 1043
ok 1044
ok 1045
ok 1046
ok 1047
ok 1048
ok 1049
ok 1050
ok 1051
ok 1052
ok 1053
ok 1054 - fasta for f.fasta
ok 1055 - fasta for f.ssearch
ok 1056 - fasta for f.fx
ok 1057 - exonerate for f.exonerate
ok 1058 - fasta for f.fy
ok 1059 - blast for filename.bls
ok 1060 - exonerate for f.exon
ok 1061 - blastxml for f.xml
ok 1062 - blast for f.tblx
ok 1063 - blast for filename.blast
ok 1064 - fasta for f.osearch
ok 1065 - fasta for f.m9
ok 1066 - fasta for f.SSEARCH.m9
ok 1067 - fasta for f.psearch
ok 1068 - blast for f.blx
ok 1069 - blastxml for f.blastxml
ok 1070 - blast for fast.bls
ok 1071 - fasta for f.fa
ok 1072
ok 1073
ok 1074
ok 1075
ok 1076
ok 1077
ok 1078
ok 1079
ok 1080
ok 1081
ok 1082
ok 1083
ok 1084
ok 1085
ok 1086
ok 1087 - full hit name
ok 1088 - hit accession
ok 1089
ok 1090
ok 1091 - query start
ok 1092 - query start
ok 1093
ok 1094
ok 1095
ok 1096
ok 1097
ok 1098
ok 1099
ok 1100
ok 1101
ok 1102
ok 1103
ok 1104
ok 1105
ok 1106
ok 1107
ok 1108
ok 1109
ok 1110
ok 1111
ok 1112
ok 1113
ok 1114
ok 1115
ok 1116
ok 1117
ok 1118
ok 1119
ok 1120
ok 1121
ok 1122
ok 1123
ok 1124
ok 1125
ok 1126
ok 1127
ok 1128
ok 1129
ok 1130
ok 1131
ok 1132
ok 1133
ok 1134
ok 1135
ok 1136
ok 1137
ok 1138
ok 1139
ok 1140
ok 1141
ok 1142
ok 1143
ok 1144
ok 1145
ok 1146
ok 1147
ok 1148
ok 1149
ok 1150
ok 1151
ok 1152
ok 1153
ok 1154
ok 1155
ok 1156
ok 1157
ok 1158
ok 1159
ok 1160
ok 1161
ok 1162
ok 1163
ok 1164
ok 1165
ok 1166
ok 1167
ok 1168
ok 1169
ok 1170
ok 1171
ok 1172
ok 1173
ok 1174
ok 1175
ok 1176
ok 1177
ok 1178
ok 1179
ok 1180
ok 1181
ok 1182
ok 1183
ok 1184
ok 1185
ok 1186
ok 1187
ok 1188
ok 1189
ok 1190
ok 1191
ok 1192
ok 1193
ok 1194
ok 1195
ok 1196
ok 1197
ok 1198
ok 1199
ok 1200
ok 1201
ok 1202
ok 1203
ok 1204
ok 1205
ok 1206
ok 1207
ok 1208
ok 1209
ok 1210
ok 1211
ok 1212
ok 1213
ok 1214
ok 1215
ok 1216
ok 1217
ok 1218
ok 1219
ok 1220
ok 1221
ok 1222
ok 1223
ok 1224
ok 1225
ok 1226
ok 1227
ok 1228
ok 1229
ok 1230
ok 1231
ok 1232
ok 1233
ok 1234
ok 1235
ok 1236
ok 1237
ok 1238
ok 1239
ok 1240
ok 1241
ok 1242
ok 1243
ok 1244
ok 1245
ok 1246
ok 1247
ok 1248
ok 1249
ok 1250
ok 1251
ok 1252
ok 1253
ok 1254
ok 1255
ok 1256
ok 1257
ok 1258
ok 1259
ok 1260
ok 1261
ok 1262
ok 1263
ok 1264
ok 1265
ok 1266
ok 1267
ok 1268
ok 1269
ok 1270
ok 1271
ok 1272
ok 1273
ok 1274
ok 1275
ok 1276
ok 1277
ok 1278
ok 1279
ok 1280
ok 1281
ok 1282
ok 1283
ok 1284
ok 1285
ok 1286
ok 1287
ok 1288
ok 1289
ok 1290
ok 1291
ok 1292
ok 1293
ok 1294
ok 1295
ok 1296
ok 1297
ok 1298
ok 1299
ok 1300
ok 1301
ok 1302
ok 1303
ok 1304
ok 1305
ok 1306
ok 1307
ok 1308
ok 1309
ok 1310
ok 1311
ok 1312
ok 1313
ok 1314
ok 1315
ok 1316
ok 1317
ok 1318
ok 1319
ok 1320
ok 1321
ok 1322
ok 1323
ok 1324
ok 1325
ok 1326
ok 1327
ok 1328
ok 1329
ok 1330
ok 1331
ok 1332
ok 1333
ok 1334
ok 1335
ok 1336
ok 1337
ok 1338
ok 1339
ok 1340
ok 1341
ok 1342
ok 1343
ok 1344
ok 1345
ok 1346
ok 1347
ok 1348
ok 1349
ok 1350
ok 1351
ok 1352
ok 1353
ok 1354
ok 1355 - testing Bug 3298
ok 1356 - testing Bug 3298
ok 1357 - testing Bug 3298
ok 1358 - testing Bug 3251
ok 1359 - testing Bug 3251
ok 1360 - testing Bug 3251
ok
t/SearchIO/blast_pull.t ................
1..289
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - database_name()
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
not ok 191 # TODO frac_identical failing!
# Failed (TODO) test at t/SearchIO/blast_pull.t line 260.
# got: '0.946'
# expected: '0.943'
ok 192
ok 193
ok 194
ok 195
ok 196 - Multiblast query test
ok 197 - Multiblast query test
ok 198 - Multiblast query test
ok 199 - Multiblast query test
ok 200
ok 201
ok 202
ok 203 - full hit name
ok 204 - hit accession
ok 205
ok 206 - query start
ok 207 - query start
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok
t/SearchIO/blasttable.t ................
1..166
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::Search::SearchUtils;
ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 4
ok 5
ok 6 - hit1_bits
ok 7 - hit1_name
ok 8 - hsp1_bits
ok 9 - hsp1_gaps
ok 10 - hsp1_he
ok 11 - hsp1_hs
ok 12 - hsp1_hstr
ok 13 - hsp1_qe
ok 14 - hsp1_qs
ok 15 - hsp1_qstr
ok 16 - hsp2_bits
ok 17 - hsp2_gaps
ok 18 - hsp2_he
ok 19 - hsp2_hs
ok 20 - hsp2_hstr
ok 21 - hsp2_qe
ok 22 - hsp2_qs
ok 23 - hsp2_qstr
ok 24 - hsp3_bits
ok 25 - hsp3_gaps
ok 26 - hsp3_he
ok 27 - hsp3_hs
ok 28 - hsp3_hstr
ok 29 - hsp3_qe
ok 30 - hsp3_qs
ok 31 - hsp3_qstr
ok 32 - hsp4_bits
ok 33 - hsp4_gaps
ok 34 - hsp4_he
ok 35 - hsp4_hs
ok 36 - hsp4_hstr
ok 37 - hsp4_qe
ok 38 - hsp4_qs
ok 39 - hsp4_qstr
ok 40 - hsp5_bits
ok 41 - hsp5_gaps
ok 42 - hsp5_he
ok 43 - hsp5_hs
ok 44 - hsp5_hstr
ok 45 - hsp5_qe
ok 46 - hsp5_qs
ok 47 - hsp5_qstr
ok 48 - hsp6_bits
ok 49 - hsp6_gaps
ok 50 - hsp6_he
ok 51 - hsp6_hs
ok 52 - hsp6_hstr
ok 53 - hsp6_qe
ok 54 - hsp6_qs
ok 55 - hsp6_qstr
ok 56 - hsp7_bits
ok 57 - hsp7_gaps
ok 58 - hsp7_he
ok 59 - hsp7_hs
ok 60 - hsp7_hstr
ok 61 - hsp7_qe
ok 62 - hsp7_qs
ok 63 - hsp7_qstr
ok 64 - hsp8_bits
ok 65 - hsp8_gaps
ok 66 - hsp8_he
ok 67 - hsp8_hs
ok 68 - hsp8_hstr
ok 69 - hsp8_qe
ok 70 - hsp8_qs
ok 71 - hsp8_qstr
ok 72 - query_name
ok 73 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI'
ok 74
ok 75
ok 76 - hit1_bits
ok 77 - hit1_name
ok 78 - hsp1_bits
ok 79 - hsp1_gaps
ok 80 - hsp1_he
ok 81 - hsp1_hs
ok 82 - hsp1_hstr
ok 83 - hsp1_qe
ok 84 - hsp1_qs
ok 85 - hsp1_qstr
ok 86 - hsp2_bits
ok 87 - hsp2_gaps
ok 88 - hsp2_he
ok 89 - hsp2_hs
ok 90 - hsp2_hstr
ok 91 - hsp2_qe
ok 92 - hsp2_qs
ok 93 - hsp2_qstr
ok 94 - hsp3_bits
ok 95 - hsp3_gaps
ok 96 - hsp3_he
ok 97 - hsp3_hs
ok 98 - hsp3_hstr
ok 99 - hsp3_qe
ok 100 - hsp3_qs
ok 101 - hsp3_qstr
ok 102 - hsp4_bits
ok 103 - hsp4_gaps
ok 104 - hsp4_he
ok 105 - hsp4_hs
ok 106 - hsp4_hstr
ok 107 - hsp4_qe
ok 108 - hsp4_qs
ok 109 - hsp4_qstr
ok 110 - hsp5_bits
ok 111 - hsp5_gaps
ok 112 - hsp5_he
ok 113 - hsp5_hs
ok 114 - hsp5_hstr
ok 115 - hsp5_qe
ok 116 - hsp5_qs
ok 117 - hsp5_qstr
ok 118 - hsp6_bits
ok 119 - hsp6_gaps
ok 120 - hsp6_he
ok 121 - hsp6_hs
ok 122 - hsp6_hstr
ok 123 - hsp6_qe
ok 124 - hsp6_qs
ok 125 - hsp6_qstr
ok 126 - hsp7_bits
ok 127 - hsp7_gaps
ok 128 - hsp7_he
ok 129 - hsp7_hs
ok 130 - hsp7_hstr
ok 131 - hsp7_qe
ok 132 - hsp7_qs
ok 133 - hsp7_qstr
ok 134 - hsp8_bits
ok 135 - hsp8_gaps
ok 136 - hsp8_he
ok 137 - hsp8_hs
ok 138 - hsp8_hstr
ok 139 - hsp8_qe
ok 140 - hsp8_qs
ok 141 - hsp8_qstr
ok 142 - query_name
ok 143
ok 144
ok 145
ok 146
ok 147 - hit score
ok 148 - hit raw_score
ok 149 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI'
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157 - fixed bug 3343 (percent identity)
ok 158 - side effect of fixing bug 3343 (number of gaps)
ok 159 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI'
ok 160
ok 161
ok 162
ok 163 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI'
ok 164
ok 165
ok 166
ok
t/SearchIO/blastxml.t ..................
1..391
ok 1 - use Bio::SearchIO;
ok 2
ok 3 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 4 - database_name()
ok 5 - query_name()
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - database_name()
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60 - query name on HSP
ok 61 - query desc on HSP
ok 62 - hitname
ok 63 - hitdesc
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI'
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168 - query name on HSP
ok 169 - query desc on HSP
ok 170 - hitname
ok 171 - hitdesc
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214 - query name on HSP
ok 215 - query desc on HSP
ok 216 - hitname
ok 217 - hitdesc
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok
t/SearchIO/cross_match.t ...............
1..15
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/SearchIO/erpin.t .....................
1..91
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 3 - Result ERPIN
ok 4 - Result ERPIN reference
ok 5 - Result ERPIN version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_name
ok 16 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 17 - Hit accession
ok 18 - Hit GI
ok 19 - Hit algorithm
ok 20 - Hit bits
ok 21 - Hit description
ok 22 - Hit length
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit overlap
ok 28 - Hit query_length
ok 29 - Hit rank
ok 30 - Hit raw_score
ok 31 - Hit score
ok 32
ok 33 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 34 - HSP algorithm
ok 35
ok 36 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 37 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 38 - HSP frame
ok 39 - HSP gaps
ok 40 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 41 - HSP hit_string
ok 42 - HSP homology_string
ok 43 - HSP hsp_group
ok 44 - HSP hsp_length
ok 45 - HSP length
ok 46 - HSP links
ok 47 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 48 - HSP query_string
ok 49 - HSP range
ok 50 - HSP rank
ok 51
ok 52 - HSP expect
ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58
ok 59
ok 60 - HSP strand
ok 61
ok 62
ok 63 - ERPIN get_aln warning
ok 64 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 65 - HSP algorithm
ok 66
ok 67 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 68 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 69 - HSP frame
ok 70 - HSP gaps
ok 71 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 72 - HSP hit_string
ok 73 - HSP homology_string
ok 74 - HSP query_string
ok 75 - HSP hsp_group
ok 76 - HSP hsp_length
ok 77 - HSP length
ok 78 - HSP links
ok 79 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 80 - HSP range
ok 81 - HSP rank
ok 82
ok 83 - HSP end
ok 84 - HSP expect
ok 85 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 86 - HSP seq_str
ok 87 - HSP start
ok 88 - HSP custom_score
ok 89
ok 90
ok 91 - HSP strand
ok
t/SearchIO/exonerate.t .................
1..52
ok 1 - use Bio::SearchIO;
ok 2
ok 3 # skip no query length available in default output
ok 4
ok 5 # skip no hit length available in default output
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 # skip no query length available in default output
ok 26
ok 27 # skip no hit length available in default output
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - query_name
ok 47
ok 48 - query_name
ok 49
ok 50 - query_name
ok 51
ok 52
ok
t/SearchIO/fasta.t .....................
1..299
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267 - TFASTXY
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286 - num_identical()
ok 287 - num_conserved()
ok 288 - bug 2937 and FASTA version 3.5
ok 289 - algorithm version
ok 290 - query name
ok 291 - query description
ok 292 - query length
ok 293 - algorithm
ok 294 - num_identical()
ok 295 - num_conserved()
ok 296 - hsp->strand(hit)
ok 297 - hsp->hit->strand
ok 298 - hsp->strand(query)
ok 299 - hsp->query->strand
ok
t/SearchIO/gmap_f9.t ...................
1..54
ok 1 - use Bio::SearchIO;
ok 2 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult'
ok 3 - Did we get the expected number of hits?
ok 4 - Did we get the expected algorithm?
ok 5 - Did we get the expected query_name?
ok 6 - 'Did we get a Hit?' isa 'Bio::Search::Hit::GenericHit'
ok 7 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI'
ok 8 - Check the name
ok 9 - Check the hit length
ok 10 - Check the number of hsps
ok 11 - Check the query length
ok 12 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI'
ok 13 - Check the algorithm
ok 14 - Count gaps in the query
ok 15 - Count gaps in the hit
ok 16 - Length of the query
ok 17 - Length of the hit
ok 18 - Query sequence
ok 19 - Hit sequence
ok 20 - Check query start
ok 21 - Check query end
ok 22 - Check query end
ok 23 - Check the homology string
ok 24 - Check seq_inds
ok 25 - Check hit start
ok 26 - Check hit end
ok 27 - Check hit end
ok 28 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult'
ok 29 - Did we get the expected number of hits?
ok 30 - Did we get the expected algorithm?
ok 31 - Did we get the expected query_name?
ok 32 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI'
ok 33 - Check the name
ok 34 - Check the hit length
ok 35 - Check the number of hsps
ok 36 - Check the query length
ok 37 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI'
ok 38 - Check the algorithm
ok 39 - Count gaps in the query
ok 40 - Count gaps in the hit
ok 41 - Length of the query
ok 42 - Length of the hit
ok 43 - Query sequence
ok 44 - Hit sequence
ok 45 - Check query start
ok 46 - Check query end
ok 47 - Check query end
ok 48 - Check the homology string
ok 49 - Check seq_inds
ok 50 - Check hit start
ok 51 - Check hit end
ok 52 - Check hit end
ok 53 - Can we loop over multiple results properly (expecting 58)?
ok 54 - simple query_name now caught, bug 3021
ok
t/SearchIO/hmmer.t .....................
1..327
ok 1 - use Bio::SearchIO;
ok 2 - Check for the correct result reference type
ok 3 - Check algorithm
ok 4 - Check algorithm version
ok 5 - Check hmm_name
ok 6 - Check sequence_file
ok 7 - Check query_name
ok 8 - Check query_description
ok 9 - Check num_hits
ok 10 - Check hit name
ok 11 - Check hit raw_score
ok 12 - Check hit significance
ok 13 - Check for the correct hit reference type
ok 14 - Check num_hsps
ok 15 - Check for hit hmmfrom value
ok 16 - Check for hit hmm to value
ok 17 - Check for query alifrom value
ok 18 - Check for query ali to value
ok 19 - Check for hsp score
ok 20 - Check for hsp c-Evalue
ok 21 - Check for query string
ok 22 - Check for number of gaps in query
ok 23 - Check for hit string
ok 24 - Check for homology string
ok 25 - Check if homology string and hit string have an equal lenght
ok 26 - Check if query string and homology string have an equal lenght
ok 27 - Check for hit hmmfrom value
ok 28 - Check for hit hmm to value
ok 29 - Check for query alifrom value
ok 30 - Check for query ali to value
ok 31 - Check for hsp score
ok 32 - Check for hsp c-Evalue
ok 33 - Check for query string
ok 34 - Check for number of gaps in query
ok 35 - Check for hit string
ok 36 - Check for homology string
ok 37 - Check if homology string and hit string have an equal lenght
ok 38 - Check if query string and homology string have an equal lenght
ok 39 - Check for the correct result reference type
ok 40 - Check algorithm
ok 41 - Check algorithm version
ok 42 - Check hmm_name
ok 43 - Check sequence_file
ok 44 - Check database_name
ok 45 - Check query_name
ok 46 - Check query_description
ok 47 - Check num_hits
ok 48 - Check hit name
ok 49 - Check for hit description
ok 50 - Check hit significance
ok 51 - Check hit raw_score
ok 52 - Check for hsp score
ok 53 - Check for hsp c-Evalue
ok 54 - Check for query alifrom value
ok 55 - Check for query ali to value
ok 56 - Check for hit hmmfrom value
ok 57 - Check for hit hmm to value
ok 58 - Check for query seq_id
ok 59 - Check for hit seq_id
ok 60 - Check for the correct result reference type
ok 61 - Check algorithm
ok 62 - Check algorithm version
ok 63 - Check hmm_name
ok 64 - Check sequence_file
ok 65 - Check query_name
ok 66 - Check query_description
ok 67 - Check num_hits
ok 68 - Check hit name
ok 69 - Check for hit description
ok 70 - Check hit significance
ok 71 - Check hit raw_score
ok 72 - Check for hsp score
ok 73 - Check for hsp evalue
ok 74 - Check for query alifrom value
ok 75 - Check for query ali to value
ok 76 - Check for hit hmmfrom value
ok 77 - Check for hit hmm to value
ok 78 - Check for query seq_id
ok 79 - Check for hit seq_id
ok 80 - Check for hiy string
ok 81 - Check for query string
ok 82 - Check for homology string
ok 83 - Check for nomatch indices in query
ok 84 - Check for nomatch indices in hit
ok 85 - Check for gap indices in query
ok 86 - Check for gap indices in hit
ok 87 - Check for the correct result reference type
ok 88 - Check algorithm
ok 89 - Check algorithm version
ok 90 - Check hmm_name
ok 91 - Check database_name
ok 92 - Check sequence_file
ok 93 - Check query_name
ok 94 - Check query_accession
ok 95 - Check query_description
ok 96 - Check num_hits
ok 97 - Check hit name
ok 98 - Check for hit description
ok 99 - Check hit significance
ok 100 - Check hit raw_score
ok 101 - Check for hsp score
ok 102 - Check for hsp evalue
ok 103 - Check for query alifrom value
ok 104 - Check for query ali to value
ok 105 - Check for hit hmmfrom value
ok 106 - Check for hit hmm to value
ok 107 - Check for query seq_id
ok 108 - Check for hit seq_id
ok 109 - Check for hiy string
ok 110 - Check for homology string
ok 111 - Check for query string
ok 112 - Check hit name
ok 113 - Check for hit description
ok 114 - Check hit significance
ok 115 - Check hit raw_score
ok 116 - Check for hsp seq_str
ok 117 - Check if correct searchio object is returned
ok 118 - Check for the correct result reference type
ok 119 - Check algorithm
ok 120 - Check algorithm version
ok 121 - Check hmm_name
ok 122 - Check sequence_file
ok 123 - Check query_name
ok 124 - Check query_length
ok 125 - Check query_description
ok 126 - Check num_hits
ok 127 - Check for the correct hit reference type
ok 128 - Check hit name
ok 129 - Check for hit description
ok 130 - Check hit raw_score
ok 131 - Check hit significance
ok 132 - Check num_hsps
ok 133 - Check for correct hsp reference type
ok 134 - Check for hit hmmfrom value
ok 135 - Check for hit hmm to value
ok 136 - Check for query alifrom value
ok 137 - Check for query ali to value
ok 138 - Check for hsp score
ok 139 - Check for hsp c-Evalue
ok 140 - Check for query string
ok 141 - Check for hit string
ok 142 - Check for homology string
ok 143 - Check for the correct result reference type
ok 144 - Check algorithm
ok 145 - Check algorithm version
ok 146 - Check hmm_name
ok 147 - Check sequence_file
ok 148 - Check query_name
ok 149 - Check query_length
ok 150 - Check query_description
ok 151 - Check num_hits
ok 152 - Check for the correct result reference type
ok 153 - Check algorithm
ok 154 - Check algorithm version
ok 155 - Check hmm_name
ok 156 - Check sequence_file
ok 157 - Check query_name
ok 158 - Check query_length
ok 159 - Check query_description
ok 160 - Check num_hits
ok 161 - Check for the correct hit reference type
ok 162 - Check hit name
ok 163 - Check for hit description
ok 164 - Check hit raw_score
ok 165 - Check hit significance
ok 166 - Check num_hsps
ok 167 - Check for correct hsp reference type
ok 168 - Check for hit envfrom value
ok 169 - Check for hit env to value
ok 170 - Check for query hmmfrom value
ok 171 - Check for query hmm to value
ok 172 - Check for hsp score
ok 173 - Check for hsp c-Evalue
ok 174 - Check for correct hsp reference type
ok 175 - Check for hit envfrom value
ok 176 - Check for hit env to value
ok 177 - Check for query hmmfrom value
ok 178 - Check for query hmm to value
ok 179 - Check for hsp score
ok 180 - Check for hsp c-Evalue
ok 181 - Check for correct hsp reference type
ok 182 - Check for hit envfrom value
ok 183 - Check for hit env to value
ok 184 - Check for query hmmfrom value
ok 185 - Check for query hmm to value
ok 186 - Check for hsp score
ok 187 - Check for hsp c-Evalue
ok 188 - Check for correct hsp reference type
ok 189 - Check for hit envfrom value
ok 190 - Check for hit env to value
ok 191 - Check for query hmmfrom value
ok 192 - Check for query hmm to value
ok 193 - Check for hsp score
ok 194 - Check for hsp c-Evalue
ok 195 - Check for correct hsp reference type
ok 196 - Check for hit envfrom value
ok 197 - Check for hit env to value
ok 198 - Check for query hmmfrom value
ok 199 - Check for query hmm to value
ok 200 - Check for hsp score
ok 201 - Check for hsp c-Evalue
ok 202 - Check for correct hsp reference type
ok 203 - Check for hit envfrom value
ok 204 - Check for hit env to value
ok 205 - Check for query hmmfrom value
ok 206 - Check for query hmm to value
ok 207 - Check for hsp score
ok 208 - Check for hsp c-Evalue
ok 209 - Check for the correct hit reference type
ok 210 - Check hit name
ok 211 - Check for hit description
ok 212 - Check hit raw_score
ok 213 - Check hit significance
ok 214 - Check num_hsps
ok 215 - Check for correct hsp reference type
ok 216 - Check for hit envfrom value
ok 217 - Check for hit env to value
ok 218 - Check for query hmmfrom value
ok 219 - Check for query hmm to value
ok 220 - Check for hsp score
ok 221 - Check for hsp c-Evalue
ok 222 - Check for correct hsp reference type
ok 223 - Check for hit envfrom value
ok 224 - Check for hit env to value
ok 225 - Check for query hmmfrom value
ok 226 - Check for query hmm to value
ok 227 - Check for hsp score
ok 228 - Check for hsp c-Evalue
ok 229 - Check for correct hsp reference type
ok 230 - Check for hit envfrom value
ok 231 - Check for hit env to value
ok 232 - Check for query hmmfrom value
ok 233 - Check for query hmm to value
ok 234 - Check for hsp score
ok 235 - Check for hsp c-Evalue
ok 236 - Check for the correct result reference type
ok 237 - Check algorithm
ok 238 - Check algorithm version
ok 239 - Check hmm_name
ok 240 - Check sequence_file
ok 241 - Check query_name
ok 242 - Check query_length
ok 243 - Check query_description
ok 244 - Check num_hits
ok 245 - Check for the correct hit reference type
ok 246 - Check hit name
ok 247 - Check for hit description
ok 248 - Check hit raw_score
ok 249 - Check hit significance
ok 250 - Check num_hsps
ok 251 - Check for correct hsp reference type
ok 252 - Check hit sequence
ok 253 - Check query sequence
ok 254 - Check for correct hsp reference type
ok 255 - Check hit sequence
ok 256 - Check query sequence
ok 257 - Check for the correct hit reference type
ok 258 - Check hit name
ok 259 - Check for hit description
ok 260 - Check hit raw_score
ok 261 - Check hit significance
ok 262 - Check num_hsps
ok 263 - Check for correct hsp reference type
ok 264 - Check hit sequence
ok 265 - Check query sequence
ok 266 - Check for correct hsp reference type
ok 267 - Check hit sequence
ok 268 - Check query sequence
ok 269 - Check for the correct hit reference type
ok 270 - Check hit name
ok 271 - Check for hit description
ok 272 - Check hit raw_score
ok 273 - Check hit significance
ok 274 - Check num_hsps
ok 275 - Check for correct hsp reference type
ok 276 - Check hit sequence
ok 277 - Check query sequence
ok 278 - Check for correct hsp reference type
ok 279 - Check hit sequence
ok 280 - Check query sequence
ok 281 - Check if loading hmmpfam output via the hmm2 parser directly works
ok 282 - Check for the correct result reference type
ok 283 - Check if loading hmmsearch2 output via the hmm2 parser directly works
ok 284 - Check for the correct result reference type
ok 285 - Check if loading hmmscan output via the hmm3 parser directly works
ok 286 - Check for the correct result reference type
ok 287 - Check if loading hmmsearch3 output via the hmm3 parser directly works
ok 288 - Check for the correct result reference type
ok 289 - Check if selecting the correct hmmpfam parser using -version works
ok 290 - Check for the correct result reference type
ok 291 - Check if selecting the correct hmmsearch2 parser using -version works
ok 292 - Check for the correct result reference type
ok 293 - Check if selecting the correct hmmscan parser using -version works
ok 294 - Check for the correct result reference type
ok 295 - Check if selecting the correct hmmsearch3 parser using -version works
ok 296 - Check for the correct result reference type
ok 297 - Check if reading from a pipe works
ok 298 - Check for the correct result reference type
ok 299 - Check num_hits
ok 300 - bug3376
ok 301 - bug3421 - Check if can correctly parse an HSP with line full of dashes
ok 302 - bug3302 - Check if can parse multiresult hmmer
ok 303 - Check nhmmer algorithm version
ok 304 - Check nhmmer hit name
ok 305 - Check nhmmer hit description
ok 306 - Check nhmmer hit significance
ok 307 - Check nhmmer hit score
ok 308 - Check nhmmer hsp score
ok 309 - Check nhmmer hsp score
ok 310 - Check nhmmer hsp hit start
ok 311 - Check nhmmer hsp hit end
ok 312 - Check nhmmer hsp query start
ok 313 - Check nhmmer hsp query end
ok 314 - Check nhmmer hsp hit strand
ok 315 - Check nhmmer hsp query strand
ok 316 - Check nhmmer hit name
ok 317 - Check nhmmer hit description
ok 318 - Check nhmmer hit significance
ok 319 - Check nhmmer hit score
ok 320 - Check nhmmer hsp score
ok 321 - Check nhmmer hsp score
ok 322 - Check nhmmer hsp query start
ok 323 - Check nhmmer hsp query end
ok 324 - Check nhmmer hsp hit start
ok 325 - Check nhmmer hsp hit end
ok 326 - Check nhmmer hsp hit strand
ok 327 - Check nhmmer hsp query strand
ok
t/SearchIO/hmmer_pull.t ................
1..290
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok
t/SearchIO/infernal.t ..................
1..412
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 3 - Result
ok 4 - Result reference
ok 5 - Result version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_length
ok 16 - Result query_name
ok 17 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 18 - Hit GI
ok 19 - Hit accession
ok 20 - Hit algorithm
ok 21 - Hit bits
ok 22 - Hit description
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit length_aln() not implemented
ok 28 - Hit num_unaligned_hit() not implemented
ok 29 - Hit num_unaligned_query() not implemented
ok 30 - Hit num_unaligned_sbjct() not implemented
ok 31 - Hit start not implemented
ok 32 - Hit end not implemented
ok 33 - Hit strand not implemented
ok 34 - Hit logical_length not implemented
ok 35 - Hit frac_aligned_hit not implemented
ok 36 - Hit frac_aligned_query not implemented
ok 37 - Hit frac_conserved not implemented
ok 38 - Hit frac_identical not implemented
ok 39 - Hit matches not implemented
ok 40 - Hit gaps not implemented
ok 41 - Hit frame not implemented
ok 42 - Hit range not implemented
ok 43 - Hit seq_inds not implemented
ok 44 - Hit length
ok 45 - Hit overlap
ok 46 - Hit query_length
ok 47 - Hit rank
ok 48 - Hit raw_score
ok 49 - Hit score
ok 50 - Hit p
ok 51
ok 52 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 53 - HSP algorithm
ok 54
ok 55 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 56 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 57
ok 58
ok 59 - HSP frame
ok 60 - HSP gaps
ok 61 - Hit length
ok 62 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 63 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 64 - HSP hit_string
ok 65 - HSP homology_string
ok 66 - HSP hsp_group
ok 67 - HSP hsp_length
ok 68 - HSP length
ok 69 - HSP links
ok 70 - HSP n
ok 71 - HSP pvalue
ok 72 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 73 - HSP query_string
ok 74 - HSP range
ok 75 - HSP rank
ok 76
ok 77 - HSP end
ok 78 - HSP expect
ok 79 - HSP seq_inds not implemented
ok 80 - HSP matches not implemented
ok 81 - HSP frac_conserved not implemented
ok 82 - HSP frac_identical not implemented
ok 83 - HSP num_conserved not implemented
ok 84 - HSP num_identical not implemented
ok 85 - HSP percent_identity not implemented
ok 86 - HSP cigar_string not implemented
ok 87 - HSP cigar_string not implemented
ok 88 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 89 - HSP seq_str
ok 90 - HSP start
ok 91 - HSP custom_score
ok 92 - HSP meta
ok 93 - HSP strand
ok 94 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 95 - HSP algorithm
ok 96
ok 97 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 98 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 99 - HSP frame
ok 100 - HSP gaps
ok 101 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 102 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 103 - HSP hit_string
ok 104 - HSP homology_string
ok 105 - HSP hsp_group
ok 106 - HSP hsp_length
ok 107 - HSP length
ok 108 - HSP links
ok 109 - HSP n
ok 110 - HSP pvalue
ok 111 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 112 - HSP query_string
ok 113 - HSP range
ok 114 - HSP rank
ok 115
ok 116 - HSP end
ok 117 - HSP expect
ok 118 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 119 - HSP seq_str
ok 120 - HSP start
ok 121 - HSP custom_score
ok 122 - HSP meta
ok 123 - HSP strand
ok 124 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 125 - Result CMSEARCH
ok 126 - Result CMSEARCH reference
ok 127 - Result CMSEARCH version
ok 128 - Result parameters
ok 129 - Result statistics
ok 130 - Result entries
ok 131 - Result letters
ok 132 - Result database_name
ok 133 - Result num_hits
ok 134 - Result program_reference
ok 135 - Result query_accession
ok 136 - Result query_description
ok 137 - Result query_length
ok 138 - Result query_name
ok 139 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 140 - Hit GI
ok 141 - Hit accession
ok 142 - Hit algorithm
ok 143 - Hit bits
ok 144 - Hit description
ok 145 - Hit locus
ok 146 - Hit n
ok 147 - Hit name
ok 148 - Hit num_hsps
ok 149 - No p values
ok 150 - Hit length
ok 151 - Hit overlap
ok 152 - Hit query_length
ok 153 - Hit rank
ok 154 - Hit raw_score
ok 155 - Hit score
ok 156
ok 157 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 158 - HSP algorithm
ok 159
ok 160 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 161 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 162
ok 163
ok 164 - HSP frame
ok 165 - HSP gaps
ok 166 - Hit length
ok 167 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 168 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 169 - HSP hit_string
ok 170 - HSP homology_string
ok 171 - HSP hsp_group
ok 172 - HSP hsp_length
ok 173 - HSP length
ok 174 - HSP links
ok 175 - HSP n
ok 176 - HSP pvalue
ok 177 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 178 - HSP query_string
ok 179 - HSP range
ok 180 - HSP rank
ok 181
ok 182 - HSP end
ok 183 - HSP expect
ok 184 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 185 - HSP seq_str
ok 186 - HSP start
ok 187 - HSP custom_score
ok 188 - HSP meta
ok 189 - HSP strand
ok 190 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 191 - HSP algorithm
ok 192
ok 193 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 194 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 195 - HSP frame
ok 196 - HSP gaps
ok 197 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 198 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 199 - HSP hit_string
ok 200 - HSP homology_string
ok 201 - HSP hsp_group
ok 202 - HSP hsp_length
ok 203 - HSP length
ok 204 - HSP links
ok 205 - HSP n
ok 206 - HSP pvalue
ok 207 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 208 - HSP query_string
ok 209 - HSP range
ok 210 - HSP rank
ok 211
ok 212 - HSP end
ok 213 - HSP expect
ok 214 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 215 - HSP seq_str
ok 216 - HSP start
ok 217 - HSP custom_score
ok 218 - HSP meta
ok 219 - HSP strand
ok 220 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 221 - Hit accession
ok 222 - Hit GI
ok 223 - Hit algorithm
ok 224 - Hit bits
ok 225 - Hit description
ok 226 - Hit length
ok 227 - Hit locus
ok 228 - Hit n
ok 229 - Hit name
ok 230 - Hit num_hsps
ok 231 - Hit overlap
ok 232 - Hit query_length
ok 233 - Hit rank
ok 234 - Hit raw_score
ok 235 - Hit score
ok 236
ok 237 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 238 - HSP algorithm
ok 239
ok 240 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 241 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 242 - HSP frame
ok 243 - HSP gaps
ok 244 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 245 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 246 - HSP hit_string
ok 247 - HSP homology_string
ok 248 - HSP hsp_group
ok 249 - HSP hsp_length
ok 250 - HSP length
ok 251 - HSP links
ok 252 - HSP n
ok 253 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 254 - HSP query_string
ok 255 - HSP range
ok 256 - HSP rank
ok 257
ok 258 - HSP end
ok 259 - HSP expect
ok 260 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 261 - HSP seq_str
ok 262 - HSP start
ok 263 - HSP custom_score
ok 264 - HSP meta
ok 265 - HSP strand
ok 266 - HSP meta gap bug
ok 267 - HSP meta
ok 268 - HSP meta
ok 269
ok 270
ok 271 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 272 - Result CMSEARCH
ok 273 - Result CMSEARCH reference
ok 274 - Result CMSEARCH version
ok 275 - Result parameters
ok 276 - Result statistics
ok 277 - Result entries
ok 278 - Result letters
ok 279 - Result database_name
ok 280 - Result num_hits
ok 281 - Result program_reference
ok 282 - Result query_accession
ok 283 - Result query_description
ok 284 - Result query_length
ok 285 - Result query_name
ok 286 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 287 - Hit GI
ok 288 - Hit accession
ok 289 - Hit algorithm
ok 290 - Hit bits
ok 291 - Hit description
ok 292 - Hit locus
ok 293 - Hit n
ok 294 - Hit name
ok 295 - Hit num_hsps
ok 296 - No p values
ok 297 - Hit length
ok 298 - Hit overlap
ok 299 - Hit query_length
ok 300 - Hit rank
ok 301 - Hit raw_score
ok 302 - Hit score
ok 303
ok 304 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 305 - HSP algorithm
ok 306
ok 307 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 308 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 309
ok 310
ok 311 - HSP frame
ok 312 - HSP gaps
ok 313 - Hit length
ok 314 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 315 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 316 - HSP hit_string
ok 317 - HSP homology_string
ok 318 - HSP hsp_group
ok 319 - HSP hsp_length
ok 320 - HSP length
ok 321 - HSP links
ok 322 - HSP n
ok 323 - HSP pvalue
ok 324 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 325 - HSP query_string
ok 326 - HSP range
ok 327 - HSP rank
ok 328
ok 329 - HSP end
ok 330 - HSP expect
ok 331 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 332 - HSP seq_str
ok 333 - HSP start
ok 334 - HSP custom_score
ok 335 - HSP meta
ok 336 - HSP strand
ok 337 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 338 - HSP algorithm
ok 339
ok 340 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 341 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 342 - HSP frame
ok 343 - HSP gaps
ok 344 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 345 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 346 - HSP hit_string
ok 347 - HSP homology_string
ok 348 - HSP hsp_group
ok 349 - HSP hsp_length
ok 350 - HSP length
ok 351 - HSP links
ok 352 - HSP n
ok 353 - HSP pvalue
ok 354 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 355 - HSP query_string
ok 356 - HSP range
ok 357 - HSP rank
ok 358
ok 359 - HSP end
ok 360 - HSP expect
ok 361 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 362 - HSP seq_str
ok 363 - HSP start
ok 364 - HSP custom_score
ok 365 - HSP meta
ok 366 - HSP strand
ok 367 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 368 - Hit accession
ok 369 - Hit GI
ok 370 - Hit algorithm
ok 371 - Hit bits
ok 372 - Hit description
ok 373 - Hit length
ok 374 - Hit locus
ok 375 - Hit n
ok 376 - Hit name
ok 377 - Hit num_hsps
ok 378 - Hit overlap
ok 379 - Hit query_length
ok 380 - Hit rank
ok 381 - Hit raw_score
ok 382 - Hit score
ok 383
ok 384 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 385 - HSP algorithm
ok 386
ok 387 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 388 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 389 - HSP frame
ok 390 - HSP gaps
ok 391 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI'
ok 392 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 393 - HSP hit_string
ok 394 - HSP homology_string
ok 395 - HSP hsp_group
ok 396 - HSP hsp_length
ok 397 - HSP length
ok 398 - HSP links
ok 399 - HSP n
ok 400 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 401 - HSP query_string
ok 402 - HSP range
ok 403 - HSP rank
ok 404
ok 405 - HSP end
ok 406 - HSP expect
ok 407 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 408 - HSP seq_str
ok 409 - HSP start
ok 410 - HSP custom_score
ok 411 - HSP meta
ok 412 - HSP strand
ok
t/SearchIO/megablast.t .................
1..31
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/SearchIO/psl.t .......................
1..53
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - next_hsp should be undef
ok 51 - next_hit should be undef
not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string
# Failed (TODO) test 'next_result should be undef'
# at t/SearchIO/psl.t line 97.
# got: ''
# expected: undef
ok 53
ok
t/SearchIO/rnamotif.t ..................
1..60
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI'
ok 3 - Result RNAMOTIF
ok 4 - Result RNAMOTIF reference
ok 5 - Result RNAMOTIF version
ok 6 - Result entries
ok 7 - Result letters
ok 8 - Result database_name
ok 9 - Result num_hits
ok 10 - Result program_reference
ok 11 - Result query_accession
ok 12 - Result query_description
ok 13 - Result query_length
ok 14 - Result query_name
ok 15 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI'
ok 16 - Hit accession
ok 17 - Hit GI
ok 18 - Hit algorithm
ok 19 - Hit description
ok 20 - Hit length
ok 21 - Hit locus
ok 22 - Hit n
ok 23 - Hit name
ok 24 - Hit num_hsps
ok 25 - Hit overlap
ok 26 - Hit rank
ok 27 - Hit raw_score
ok 28 - Hit score
ok 29
ok 30 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI'
ok 31 - HSP algorithm
ok 32
ok 33 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 34 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity'
ok 35 - HSP frame
ok 36 - HSP gaps
ok 37 - RNAMotif get_aln warning
ok 38 - 'HSP hit' isa 'Bio::SeqFeature::Similarity'
ok 39 - HSP hit_string
ok 40 - HSP homology_string
ok 41 - HSP hsp_group
ok 42 - HSP hsp_length
ok 43 - HSP length
ok 44 - HSP links
ok 45 - HSP n
ok 46 - 'HSP query' isa 'Bio::SeqFeature::Similarity'
ok 47 - HSP query_string
ok 48 - HSP range
ok 49 - HSP rank
ok 50
ok 51 - HSP end
ok 52 - HSP expect
ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq'
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58 - HSP strand
ok 59
ok 60
ok
t/SearchIO/sim4.t ......................
1..102
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/SearchIO/waba.t ......................
1..64
ok 1 - use Bio::SearchIO;
ok 2 - An object of class 'Bio::SearchIO::waba' isa 'Bio::SearchIO'
ok 3 - query_name
ok 4 - query database
ok 5 - database name
ok 6 - name
ok 7 - hsps
ok 8 - total length
ok 9 - start
ok 10 - end
ok 11 - strand
ok 12 - start
ok 13 - end
ok 14 - strand
ok 15 - query string
ok 16 - hit_string
ok 17 - hmmstate string
ok 18
ok 19
ok 20
ok 21 - total length
ok 22 - start
ok 23 - end
ok 24 - strand
ok 25 - start
ok 26 - end
ok 27 - strand
ok 28 - query string
ok 29 - hit_string
ok 30 - hmmstate string
ok 31
ok 32
ok 33
ok 34 - total length
ok 35 - start
ok 36 - end
ok 37 - strand
ok 38 - start
ok 39 - end
ok 40 - strand
ok 41 - query string
ok 42 - hit_string
ok 43 - hmmstate string
ok 44
ok 45
ok 46
ok 47 - query_name
ok 48 - query database
ok 49 - database name
ok 50 - name
ok 51 - hsps
ok 52 - total length
ok 53 - start
ok 54 - end
ok 55 - strand
ok 56 - start
ok 57 - end
ok 58 - strand
ok 59 - query string
ok 60 - hit_string
ok 61 - hmmstate string
ok 62
ok 63
ok 64
ok
t/SearchIO/wise.t ......................
1..20
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok
t/Seq/DBLink.t .........................
1..131
ok 1 - use Bio::SeqIO;
ok 2 - "swissprot:K1C9_HUMAN"
ok 3 - no double colon
ok 4 - no trailing colon
ok 5 - no double space
ok 6 - dblink value is splittable
ok 7 - "GenBank:Z29074.1"
ok 8 - no double colon
ok 9 - no trailing colon
ok 10 - no double space
ok 11 - dblink value is splittable
ok 12 - "GenPept:CAA82315.1"
ok 13 - no double colon
ok 14 - no trailing colon
ok 15 - no double space
ok 16 - dblink value is splittable
ok 17 - "GenBank:S69510.1"
ok 18 - no double colon
ok 19 - no trailing colon
ok 20 - no double space
ok 21 - dblink value is splittable
ok 22 - "GenPept:AAC60619.1"
ok 23 - no double colon
ok 24 - no trailing colon
ok 25 - no double space
ok 26 - dblink value is splittable
ok 27 - "GenBank:X75015.1"
ok 28 - no double colon
ok 29 - no trailing colon
ok 30 - no double space
ok 31 - dblink value is splittable
ok 32 - "GenPept:CAA52924.1"
ok 33 - no double colon
ok 34 - no trailing colon
ok 35 - no double space
ok 36 - dblink value is splittable
ok 37 - "GenBank:AB001594.1"
ok 38 - no double colon
ok 39 - no trailing colon
ok 40 - no double space
ok 41 - dblink value is splittable
ok 42 - "GenPept:BAA19418.1"
ok 43 - no double colon
ok 44 - no trailing colon
ok 45 - no double space
ok 46 - dblink value is splittable
ok 47 - "GenBank:I37984"
ok 48 - no double colon
ok 49 - no trailing colon
ok 50 - no double space
ok 51 - dblink value is splittable
ok 52 - "HSSP:P08670"
ok 53 - no double colon
ok 54 - no trailing colon
ok 55 - no double space
ok 56 - dblink value is splittable
ok 57 - "IntAct:P35527"
ok 58 - no double colon
ok 59 - no trailing colon
ok 60 - no double space
ok 61 - dblink value is splittable
ok 62 - "Ensembl:ENSG00000171403"
ok 63 - no double colon
ok 64 - no trailing colon
ok 65 - no double space
ok 66 - dblink value is splittable
ok 67 - "KEGG:hsa:3857"
ok 68 - no double colon
ok 69 - no trailing colon
ok 70 - no double space
ok 71 - dblink value is splittable
ok 72 - "HGNC:6447"
ok 73 - no double colon
ok 74 - no trailing colon
ok 75 - no double space
ok 76 - dblink value is splittable
ok 77 - "MIM:144200"
ok 78 - no double colon
ok 79 - no trailing colon
ok 80 - no double space
ok 81 - dblink value is splittable
ok 82 - "MIM:607606"
ok 83 - no double colon
ok 84 - no trailing colon
ok 85 - no double space
ok 86 - dblink value is splittable
ok 87 - "ArrayExpress:P35527"
ok 88 - no double colon
ok 89 - no trailing colon
ok 90 - no double space
ok 91 - dblink value is splittable
ok 92 - "GO:0005200"
ok 93 - no double colon
ok 94 - no trailing colon
ok 95 - no double space
ok 96 - dblink value is splittable
ok 97 - "GO:0008544"
ok 98 - no double colon
ok 99 - no trailing colon
ok 100 - no double space
ok 101 - dblink value is splittable
ok 102 - "InterPro:IPR011000"
ok 103 - no double colon
ok 104 - no trailing colon
ok 105 - no double space
ok 106 - dblink value is splittable
ok 107 - "InterPro:IPR001664"
ok 108 - no double colon
ok 109 - no trailing colon
ok 110 - no double space
ok 111 - dblink value is splittable
ok 112 - "InterPro:IPR002957"
ok 113 - no double colon
ok 114 - no trailing colon
ok 115 - no double space
ok 116 - dblink value is splittable
ok 117 - "Pfam:PF00038"
ok 118 - no double colon
ok 119 - no trailing colon
ok 120 - no double space
ok 121 - dblink value is splittable
ok 122 - "PRINTS:PR01248"
ok 123 - no double colon
ok 124 - no trailing colon
ok 125 - no double space
ok 126 - dblink value is splittable
ok 127 - "PROSITE:PS00226"
ok 128 - no double colon
ok 129 - no trailing colon
ok 130 - no double space
ok 131 - dblink value is splittable
ok
t/Seq/EncodedSeq.t .....................
1..37
ok 1 - use Bio::Seq::EncodedSeq;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 12
ok 13
ok 14 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/Seq/LargeLocatableSeq.t ..............
1..8
ok 1 - use Bio::Seq::LargeLocatableSeq;
ok 2
ok 3 - An object of class 'Bio::Seq::LargeLocatableSeq' isa 'Bio::Seq::LargeSeqI'
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Seq/LargePSeq.t ......................
1..30
ok 1 - use Bio::Seq::LargePrimarySeq;
ok 2 - use Bio::Seq::LargeSeq;
ok 3 - use Bio::Location::Simple;
ok 4 - use Bio::Location::Fuzzy;
ok 5 - use Bio::Location::Split;
ok 6 - use Bio::SeqIO;
ok 7
ok 8
ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 10 - Subseq is GGGGT
ok 11
ok 12
ok 13
ok 14 - trunc seq was GGGGTGAA
ok 15
ok 16
ok 17
ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 19
ok 20 - output via Bio::SeqIO::fasta
ok 21 - Subseq is GGGGT
ok 22 - trunc seq was GGGGTGAA
ok 23
ok 24
ok 25
ok 26 - Sequence is ATGGGGTGGGGT
ok 27 - Subseq is GGGGT
ok 28 - trunc seq was GGGGT
ok 29
ok 30
ok
t/Seq/LocatableSeq.t ...................
1..119
ok 1 - use Bio::LocatableSeq;
ok 2 - use Bio::AlignIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 13
ok 14
ok 15 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 16
ok 17
ok 18
ok 19
not ok 20 # TODO Need to fix columns before start of seq w/ start > 1
# Failed (TODO) test at t/Seq/LocatableSeq.t line 47.
# got: 'Bio::Location::Simple=HASH(0x990ea3c)'
# expected: undef
ok 21
ok 22 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO'
ok 23
ok 24
ok 25
ok 26
ok 27 - threw Regexp ((?^:.+))
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 51
ok 52
ok 53 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple'
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106 - * is counted in length
ok 107 - * is counted in length, but end is wrong
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues
# Failed (TODO) test at t/Seq/LocatableSeq.t line 307.
# got: '\-\.=~'
# expected: '-\?'
not ok 119 # TODO Bio::LocatableSeq global variables have scoping issues
# Failed (TODO) test at t/Seq/LocatableSeq.t line 309.
# got: '19'
# expected: anything else
ok
t/Seq/MetaSeq.t ........................
1..132
ok 1 - use Bio::Seq::Meta;
ok 2 - use Bio::Seq::Meta::Array;
ok 3 - use Bio::SeqIO;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Seq::Quality;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - aa-bb bb
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok
t/Seq/PrimaryQual.t ....................
1..70
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::Quality;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8 - A reference of type 'ARRAY' isa 'ARRAY'
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26 - threw Regexp ((?^:.+))
ok 27 - threw Regexp ((?^:.+))
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33 - threw Regexp ((?^:EX))
ok 34
ok 35
ok 36 - threw Regexp ((?^:EX))
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok
t/Seq/PrimarySeq.t .....................
1..287
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::Location::Split;
ok 5 - Bare object
ok 6 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::IdentifiableI'
ok 26 - An object of class 'Bio::PrimarySeq' isa 'Bio::DescribableI'
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51 - threw Regexp ((?^:.+))
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 59
ok 60 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 61
ok 62 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 63
ok 64 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76 - Translation: LVAST
ok 77 - Translation: MVAST
ok 78 - Translation: MVAST
ok 79 - Translation: MVAST*
ok 80 - Translation: M*
ok 81 - Translation: M
ok 82
ok 83 - Translation: MWP
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95 - Alphabet
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129 - Bug 2438
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138 - Bug \#2864
ok 139 - Terminator + inside sequence
ok 140
ok 141 - Length method
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161 - threw Regexp ((?^:.+))
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173 - threw Regexp ((?^:.+))
ok 174 - Validation
ok 175
ok 176
ok 177 - threw Regexp ((?^:.+))
ok 178
ok 179
ok 180 - _find_orfs 1
ok 181 - orfs are sorted by descending length
ok 182 - got correct -orf => "longest" seq
ok 183 - _find_orfs 1
ok 184 - orfs are sorted by descending length
ok 185 - got correct -orf => "longest" seq
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok
t/Seq/PrimedSeq.t ......................
1..65
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::PrimedSeq;
ok 3 - Priming the target with sequence objects
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 13
ok 14
ok 15 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26 - Priming the target with primer objects
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - Priming the target with located primer objects
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok
t/Seq/Quality.t ........................
1..85
ok 1 - use Bio::Seq::Quality;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bug 2845
ok 73
ok 74 - Bug 2845
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok
t/Seq/Seq.t ............................
1..73
ok 1 - use Bio::Seq;
ok 2 - use Bio::Seq::RichSeq;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Species;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7 - An object of class 'Bio::Seq' isa 'Bio::AnnotatableI'
ok 8
ok 9
ok 10
ok 11 - truncated sequence length
ok 12 - truncated sequence string
ok 13
ok 14
ok 15 - alphabet
ok 16 - id
ok 17 - accession number
ok 18 - subseq
ok 19 - An object of class 'Bio::Seq' isa 'Bio::IdentifiableI'
ok 20 - An object of class 'Bio::Seq' isa 'Bio::DescribableI'
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - translated sequence
ok 35 - translated sequence with explicit unambiguous codons
ok 36 - translated sequence with unknown unambiguous codons
ok 37 - translated sequence with unknown unambiguous codons, completed
ok 38 - translated sequence with unambiguous codons
ok 39 - translated sequence with unambiguous codons
ok 40 - translated sequence with unknown unambiguous codons, completed
ok 41 - translated sequence with unambiguous codons
ok 42 - translated sequence with unknown unambiguous codons, completed
ok 43 - translated sequence with stop
ok 44 - translated sequence
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65 - Bug \#2864
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok
t/Seq/SimulatedRead.t ..................
1..194
ok 1 - use Bio::Seq;
ok 2 - use Bio::Seq::Quality;
ok 3 - use Bio::PrimarySeq;
ok 4 - use Bio::LocatableSeq;
ok 5 - use Bio::Seq::SimulatedRead;
ok 6
ok 7 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::SimulatedRead'
ok 8 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::LocatableSeq'
ok 9 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::Quality'
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102 - redundant errors
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114 - errors()
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130 - track()
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137 - qual_levels()
ok 138
ok 139 - reference()
ok 140
ok 141 - mid()
ok 142
ok 143
ok 144
ok 145 - ACGT
ok 146
ok 147
ok 148
ok 149
ok 150 - TTTAAA
ok 151
ok 152
ok 153
ok 154
ok 155 - Bio::Seq::Quality
ok 156 - Bio::Seq
ok 157 - Bio::PrimarySeq
ok 158 - Bio::LocatableSeq
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok
t/Seq/WithQuality.t ....................
1..22
ok 1 - use Bio::Seq::SeqWithQuality;
ok 2 - use Bio::PrimarySeq;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual'
ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 21
ok 22
ok
t/SeqEvolution.t .......................
1..39
ok 1 - use Bio::SeqEvolution::Factory;
ok 2 - use Bio::PrimarySeq;
ok 3
ok 4 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint'
ok 5
ok 6 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint'
ok 7
ok 8 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint'
ok 9
ok 10
ok 11 - get rate()
ok 12 - get and set rate()
ok 13 - identity()
ok 14 - identity()
ok 15 - pam()
ok 16 - pam()
ok 17 - mutation_count()
ok 18 - mutation_count()
ok 19 - seq_type()
ok 20 - seq_type()
ok 21 - next_seq()
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - each_mutation()
ok 28
ok 29
ok 30 - get_alignment_identity()
ok 31
ok 32
ok 33 - get_mutation_counter()
ok 34 - get_sequence_counter()
ok 35 - reset_sequence_counter()
ok 36 - get_sequence_counter() == 0
ok 37
ok 38
ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign'
ok
t/SeqFeature/Amplicon.t ................
1..21
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::SeqFeature::Primer;
ok 3 - use Bio::SeqFeature::Amplicon;
ok 4 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon'
ok 5 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::SubSeq'
ok 6
ok 7
ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 16
ok 17
ok 18
ok 19
ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 21
ok
t/SeqFeature/Clone.t ...................
1..17
ok 1 - clone()
ok 2 - start() clone set
ok 3 - start() clone get
ok 4 - start() original unchanged
ok 5 - clone() with arguments
ok 6 - start() orig get
ok 7 - end() orig get
ok 8 - start() clone get
ok 9 - end() clone get
ok 10 - start() clone set
ok 11 - start() clone get
ok 12 - start() original unchanged
ok 13 - location() Bio::Location::Split
ok 14 - clone()
ok 15 - start() clone set
ok 16 - start() clone get
ok 17 - start() original unchanged
ok
t/SeqFeature/Collection.t ..............
1..24
ok 1 - use Bio::SeqFeature::Collection;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Tools::GFF;
ok 4 - use Bio::SeqIO;
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/SeqFeature/Computation.t .............
1..12
ok 1 - use Bio::SeqFeature::Computation;
ok 2
ok 3 - computation id
ok 4 - score value
ok 5
ok 6
ok 7
ok 8 - sft[0] is exon
ok 9
ok 10 - computation id
ok 11
ok 12 - score value
ok
t/SeqFeature/FeaturePair.t .............
1..19
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::SeqFeature::FeaturePair;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8 - feature1 of pair stored
ok 9 - feature2 of pair stored
ok 10 - feature start
ok 11 - feature end
ok 12 - primary tag
ok 13 - source tag
ok 14 - hstart
ok 15 - hend
ok 16 - hprimary tag
ok 17 - hsource tag
ok 18
ok 19 - inverted end
ok
t/SeqFeature/Gene.t ....................
1..28
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Gene::Transcript;
ok 3 - use Bio::SeqFeature::Gene::UTR;
ok 4 - use Bio::SeqFeature::Gene::Exon;
ok 5 - use Bio::SeqFeature::Gene::Poly_A_site;
ok 6 - use Bio::SeqFeature::Gene::GeneStructure;
ok 7 - use Bio::Location::Fuzzy;
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - mRNA spliced length
ok 28 - has 2 UTRs
ok
t/SeqFeature/Generic.t .................
1..362
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - Start of feature location
ok 10 - End of feature location
ok 11 - Primary tag
ok 12 - Source tag
ok 13 - Display name
ok 14 - Undef phase by default
ok 15 - Phase accessor returns
ok 16 - Phase is persistent
ok 17
ok 18
ok 19 - Set phase from constructor
ok 20
ok 21
ok 22 - Start of first seqfeature
ok 23 - End of first seqfeature
ok 24 - Strand of first seqfeature
ok 25
ok 26 - Sequence of first seqfeature
ok 27
ok 28
ok 29
ok 30 - Start of second seqfeature
ok 31 - End of second seqfeature
ok 32 - Strand of second seqfeature
ok 33
ok 34 - Sequence of second seqfeature
ok 35
ok 36
ok 37
ok 38 - sfeat start for EXPAND-ED feature (bug \#947)
ok 39 - sfeat end for EXPAND-ED feature (bug \#947)
ok 40
ok 41
ok 42 - Can create feature starting and ending at 0
ok 43
ok 44 - Can create feature starting and ending at 0
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 55
ok 56 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq'
ok 57
ok 58 # skip Network tests have not been requested
ok 59 # skip Network tests have not been requested
ok 60 # skip Network tests have not been requested
ok 61 # skip Network tests have not been requested
ok 62 # skip Network tests have not been requested
ok 63
ok 64 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 65
ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq'
ok 67
ok 68 # skip Network tests have not been requested
ok 69 # skip Network tests have not been requested
ok 70
ok 71 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO'
ok 72
ok 73
ok 74 - spliced_seq translation matches expected
ok 75
ok 76 - spliced_seq translation matches expected
ok 77
ok 78 - spliced_seq translation matches expected
ok 79
ok 80 - spliced_seq translation matches expected
ok 81
ok 82 - spliced_seq translation matches expected
ok 83
ok 84 - spliced_seq translation matches expected
ok 85
ok 86 - spliced_seq translation matches expected
ok 87
ok 88 - spliced_seq translation matches expected
ok 89
ok 90 - spliced_seq translation matches expected
ok 91
ok 92 - spliced_seq translation matches expected
ok 93
ok 94 - spliced_seq translation matches expected
ok 95
ok 96 - spliced_seq translation matches expected
ok 97
ok 98 - spliced_seq translation matches expected
ok 99
ok 100 - spliced_seq translation matches expected
ok 101
ok 102 - spliced_seq translation matches expected
ok 103
ok 104 - spliced_seq translation matches expected
ok 105
ok 106 - spliced_seq translation matches expected
ok 107
ok 108 - spliced_seq translation matches expected
ok 109
ok 110 - spliced_seq translation matches expected
ok 111
ok 112 - spliced_seq translation matches expected
ok 113
ok 114 - spliced_seq translation matches expected
ok 115
ok 116 - spliced_seq translation matches expected
ok 117
ok 118 - spliced_seq translation matches expected
ok 119
ok 120 - spliced_seq translation matches expected
ok 121
ok 122 - spliced_seq translation matches expected
ok 123
ok 124 - spliced_seq translation matches expected
ok 125
ok 126 - spliced_seq translation matches expected
ok 127
ok 128 - spliced_seq translation matches expected
ok 129
ok 130 - spliced_seq translation matches expected
ok 131
ok 132 - spliced_seq translation matches expected
ok 133
ok 134 - spliced_seq translation matches expected
ok 135
ok 136 - spliced_seq translation matches expected
ok 137
ok 138 - spliced_seq translation matches expected
ok 139
ok 140 - spliced_seq translation matches expected
ok 141
ok 142 - spliced_seq translation matches expected
ok 143
ok 144 - spliced_seq translation matches expected
ok 145
ok 146 - spliced_seq translation matches expected
ok 147
ok 148 - spliced_seq translation matches expected
ok 149
ok 150 - spliced_seq translation matches expected
ok 151
ok 152 - spliced_seq translation matches expected
ok 153
ok 154 - spliced_seq translation matches expected
ok 155
ok 156 - spliced_seq translation matches expected
ok 157
ok 158 - spliced_seq translation matches expected
ok 159
ok 160 - spliced_seq translation matches expected
ok 161
ok 162 - spliced_seq translation matches expected
ok 163
ok 164 - spliced_seq translation matches expected
ok 165
ok 166 - spliced_seq translation matches expected
ok 167
ok 168 - spliced_seq translation matches expected
ok 169
ok 170 - spliced_seq translation matches expected
ok 171
ok 172 - spliced_seq translation matches expected
ok 173
ok 174 - spliced_seq translation matches expected
ok 175
ok 176 - spliced_seq translation matches expected
ok 177
ok 178 - spliced_seq translation matches expected
ok 179
ok 180 - spliced_seq translation matches expected
ok 181
ok 182 - spliced_seq translation matches expected
ok 183
ok 184 - spliced_seq translation matches expected
ok 185
ok 186 - spliced_seq translation matches expected
ok 187
ok 188 - spliced_seq translation matches expected
ok 189
ok 190 - spliced_seq translation matches expected
ok 191
ok 192 - spliced_seq translation matches expected
ok 193
ok 194 - spliced_seq translation matches expected
ok 195
ok 196 - spliced_seq translation matches expected
ok 197
ok 198 - spliced_seq translation matches expected
ok 199
ok 200 - spliced_seq translation matches expected
ok 201
ok 202 - spliced_seq translation matches expected
ok 203
ok 204 - spliced_seq translation matches expected
ok 205
ok 206 - spliced_seq translation matches expected
ok 207
ok 208 - spliced_seq translation matches expected
ok 209
ok 210 - spliced_seq translation matches expected
ok 211
ok 212 - spliced_seq translation matches expected
ok 213
ok 214 - spliced_seq translation matches expected
ok 215
ok 216 - spliced_seq translation matches expected
ok 217
ok 218 - spliced_seq translation matches expected
ok 219
ok 220 - spliced_seq translation matches expected
ok 221
ok 222 - spliced_seq translation matches expected
ok 223
ok 224 - spliced_seq translation matches expected
ok 225
ok 226 - spliced_seq translation matches expected
ok 227
ok 228 - spliced_seq translation matches expected
ok 229
ok 230 - spliced_seq translation matches expected
ok 231
ok 232 - spliced_seq translation matches expected
ok 233
ok 234 - spliced_seq translation matches expected
ok 235
ok 236 - spliced_seq translation matches expected
ok 237
ok 238 - spliced_seq translation matches expected
ok 239
ok 240 - spliced_seq translation matches expected
ok 241
ok 242 - spliced_seq translation matches expected
ok 243
ok 244 - spliced_seq translation matches expected
ok 245
ok 246 - spliced_seq translation matches expected
ok 247
ok 248 - spliced_seq translation matches expected
ok 249
ok 250 - spliced_seq translation matches expected
ok 251
ok 252 - spliced_seq translation matches expected
ok 253
ok 254 - spliced_seq translation matches expected
ok 255
ok 256 - spliced_seq translation matches expected
ok 257
ok 258 - spliced_seq translation matches expected
ok 259
ok 260 - spliced_seq translation matches expected
ok 261
ok 262 - spliced_seq translation matches expected
ok 263
ok 264 - spliced_seq translation matches expected
ok 265
ok 266 - spliced_seq translation matches expected
ok 267
ok 268 - spliced_seq translation matches expected
ok 269
ok 270 - spliced_seq translation matches expected
ok 271
ok 272 - spliced_seq translation matches expected
ok 273
ok 274 - spliced_seq translation matches expected
ok 275
ok 276 - spliced_seq translation matches expected
ok 277
ok 278 - spliced_seq translation matches expected
ok 279
ok 280 - spliced_seq translation matches expected
ok 281
ok 282 - spliced_seq translation matches expected
ok 283
ok 284 - spliced_seq translation matches expected
ok 285
ok 286 - spliced_seq translation matches expected
ok 287
ok 288 - spliced_seq translation matches expected
ok 289
ok 290 - spliced_seq translation matches expected
ok 291
ok 292 - spliced_seq translation matches expected
ok 293
ok 294 - spliced_seq translation matches expected
ok 295
ok 296 - spliced_seq translation matches expected
ok 297
ok 298 - spliced_seq translation matches expected
ok 299
ok 300 - spliced_seq translation matches expected
ok 301
ok 302 - spliced_seq translation matches expected
ok 303
ok 304 - spliced_seq translation matches expected
ok 305
ok 306 - spliced_seq translation matches expected
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312 - phase check
ok 313
ok 314
ok 315 - phase check
ok 316
ok 317
ok 318 - phase check
ok 319
ok 320
ok 321 - phase check
ok 322
ok 323
ok 324 - phase check
ok 325
ok 326
ok 327
ok 328 - Tags found
ok 329 - get_tagset_values tag values found
ok 330 - get_tagset_values tag values for multiple tags found
ok 331 - get_tag_values tag values found
ok 332 - get_tag_values lives with tag
ok 333 - get_tagset_values no tag values found
ok 334 - get_tagset_values lives with no tag
ok 335 - get_tag_values throws with no tag
ok 336 - Phi-X174 genome is circular
ok 337
ok 338 - Only 3 split locations
ok 339 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 340
ok 341 - Feature string
ok 342 - First ten nucleotides
ok 343 - Strand
ok 344 - Start
ok 345 - End
ok 346 - Expected length
ok 347 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 348
ok 349 - Feature string
ok 350 - First ten nucleotides
ok 351 - Strand
ok 352 - Start
ok 353 - End
ok 354 - Expected length
ok 355 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI'
ok 356
ok 357 - Feature string
ok 358 - First ten nucleotides
ok 359 - Strand
ok 360 - Start
ok 361 - End
ok 362 - Expected length
ok
t/SeqFeature/Location.t ................
1..103
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Location::Split;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::SeqFeature::Generic;
ok 5 - use Bio::SeqFeature::SimilarityPair;
ok 6 - use Bio::SeqFeature::FeaturePair;
ok 7 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI'
ok 9 - Bio::Location::Simple tests
ok 10
ok 11
ok 12
ok 13
ok 14 - 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI'
ok 15 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::RangeI'
ok 16
ok 17
ok 18 - Bio::SeqFeature::FeaturePair tests
ok 19
ok 20
ok 21
ok 22 - Bio::SeqFeature::Generic tests
ok 23
ok 24 - Bio::Location::Fuzzy tests
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38 - Bio::Location::Split tests
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55 - Bugfix 1074
ok 56
ok 57
ok 58
ok 59 - Positive length
ok 60
ok 61 - seq_id() on Bio::Location::Split
ok 62
ok 63
ok 64 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 65 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI'
ok 66 - Bio::Location::Simple EXACT
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bio::Location::Simple IN-BETWEEN
ok 73
ok 74
ok 75
ok 76
ok 77 - Testing error handling
ok 78
ok 79
ok 80
ok 81 - use Bio::Location::WidestCoordPolicy;
ok 82 - use Bio::Location::NarrowestCoordPolicy;
ok 83 - use Bio::Location::AvWithinCoordPolicy;
ok 84 - Default coodinate policy
ok 85
ok 86
ok 87
ok 88 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy'
ok 89 - Narrowest coodinate policy
ok 90
ok 91
ok 92
ok 93 - An object of class 'Bio::Location::NarrowestCoordPolicy' isa 'Bio::Location::NarrowestCoordPolicy'
ok 94 - Average coodinate policy
ok 95
ok 96
ok 97
ok 98 - An object of class 'Bio::Location::AvWithinCoordPolicy' isa 'Bio::Location::AvWithinCoordPolicy'
ok 99 - Widest coodinate policy
ok 100
ok 101
ok 102
ok 103 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy'
ok
t/SeqFeature/LocationFactory.t .........
1..272
ok 1 - use Bio::Factory::FTLocationFactory;
ok 2 - An object of class 'Bio::Factory::FTLocationFactory' isa 'Bio::Factory::LocationFactoryI'
ok 3 - Bio::Location::Fuzzy
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - Location String: complement(34..(122.126))
ok 13
ok 14 - Bio::Location::Fuzzy
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23 - Location String: (102.110)
ok 24
ok 25 - Bio::Location::Fuzzy
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - Location String: (23.45)..600
ok 35
ok 36 - Bio::Location::Simple
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - Location String: 123^124
ok 46
ok 47 - Bio::Location::Fuzzy
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - Location String: 1..?
ok 57
ok 58 - Bio::Location::Fuzzy
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - Location String: ?22..?64
ok 68
ok 69 - Bio::Location::Fuzzy
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78 - Location String: ?..>393
ok 79
ok 80 - Bio::Location::Simple
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - Location String: J00194:100..202
ok 90
ok 91 - Bio::Location::Fuzzy
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100 - Location String: <345..500
ok 101
ok 102 - Bio::Location::Fuzzy
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111 - Location String: <1..?
ok 112
ok 113 - Bio::Location::Fuzzy
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122 - Location String: <1..888
ok 123
ok 124 - Bio::Location::Fuzzy
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133 - Location String: ?..?
ok 134
ok 135 - Bio::Location::Fuzzy
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144 - Location String: (122.133)..(204.221)
ok 145
ok 146 - Bio::Location::Split
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155 - Location String: complement(join(4918..5163,2691..4571))
ok 156
ok 157 - Bio::Location::Fuzzy
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166 - Location String: (122.133)..(204.221)
ok 167
ok 168 - Bio::Location::Fuzzy
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177 - Location String: 145^177
ok 178
ok 179 - Bio::Location::Fuzzy
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188 - Location String: 22..?64
ok 189
ok 190 - Bio::Location::Simple
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199 - Location String: J00194:100..202
ok 200
ok 201 - Bio::Location::Split
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599)
ok 211
ok 212 - Bio::Location::Fuzzy
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221 - Location String: ?2465..2774
ok 222
ok 223 - Bio::Location::Split
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232 - Location String: join(12..78,134..202)
ok 233
ok 234 - Bio::Location::Simple
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243 - Location String: 467
ok 244
ok 245 - Bio::Location::Simple
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254 - Location String: 340..565
ok 255
ok 256 - Bio::Location::Fuzzy
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265 - Location String: ?..536
ok 266
ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294)))
ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081)))
ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669)))
ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672)))
ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000)
ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19))
ok
t/SeqFeature/Primer.t ..................
1..47
ok 1 - use Bio::SeqFeature::Primer;
ok 2 - use Bio::PrimarySeq;
ok 3 - Implied primer sequence
ok 4 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 5 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::SubSeq'
ok 6
ok 7
ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 9
ok 10 - PrimarySeq primer
ok 11
ok 12
ok 13 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI'
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI'
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 42
ok 43
ok 44 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer'
ok 45 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 46
ok 47
ok
t/SeqFeature/Range.t ...................
1..49
ok 1 - use Bio::Range;
ok 2 - 'BioRange object' isa 'Bio::Range'
ok 3
ok 4 - 'BioRange object' isa 'Bio::Range'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - 'BioRange object' isa 'Bio::Range'
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - 'BioRange object' isa 'Bio::Range'
ok 26 - 'BioRange object' isa 'Bio::Range'
ok 27 - 'BioRange object' isa 'Bio::Range'
ok 28 - 1 & -1
ok 29 - 1 & 1 true
ok 30 - 1 & 0 true
ok 31 - 1 & -1 false
ok 32 - 1 & 1 true
ok 33 - 1 & 0 false
ok 34 - 1 & -1 false
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - 'Bio::Range object' isa 'Bio::Range'
ok 46
ok 47
ok 48
ok 49
ok
t/SeqFeature/RangeI.t ..................
1..45
ok 1 - use Bio::SeqFeature::Generic;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39 - subtract() of split features
ok 40 - 0 start
ok 41 - 0 end
ok 42 - 1 start
ok 43 - 1 end
ok 44 - 2 start
ok 45 - 2 end
ok
t/SeqFeature/SeqAnalysisParser.t .......
1..14
ok 1 - use Bio::Factory::SeqAnalysisParserFactory;
ok 2 - use Bio::SeqIO;
ok 3 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO'
ok 4 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 5 - An object of class 'Bio::Tools::Genscan' isa 'Bio::SeqAnalysisParserI'
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI'
ok 10 - An object of class 'Bio::Tools::MZEF' isa 'Bio::SeqAnalysisParserI'
ok 11
ok 12
ok 13 - An object of class 'Bio::Tools::EPCR' isa 'Bio::SeqAnalysisParserI'
ok 14
ok
t/SeqFeature/SubSeq.t ..................
1..37
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::SeqFeature::SubSeq;
ok 3 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::SubSeq'
ok 4 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::Generic'
ok 5
ok 6
ok 7
ok 8
ok 9 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 10
ok 11
ok 12
ok 13
ok 14 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 15
ok 16
ok 17
ok 18
ok 19 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 26
ok 27
ok 28
ok 29
ok 30 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 31
ok 32
ok 33
ok 34
ok 35 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq'
ok 36
ok 37
ok
Timeout (max run time is 300s)
/home/fly1800/ap1800-297235/bin/perl-static killed by signal 15.