PATH=/usr/bin:/bin:/home/fly1800/cpanfly-5.18/var/megalib/bin Start 2016-01-27T04:16:21 ActivePerl-1800 CPAN-2.10 Reading '/home/fly1800/cpanfly-5.18/var/cpan/Metadata' Database was generated on Wed, 27 Jan 2016 05:53:39 GMT Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz ok Bundle-BDFOY-20160101/ Bundle-BDFOY-20160101/Changes Bundle-BDFOY-20160101/INSTALL.SKIP Bundle-BDFOY-20160101/lib/ Bundle-BDFOY-20160101/LICENSE Bundle-BDFOY-20160101/Makefile.PL Bundle-BDFOY-20160101/MANIFEST Bundle-BDFOY-20160101/MANIFEST.SKIP Bundle-BDFOY-20160101/META.json Bundle-BDFOY-20160101/META.yml Bundle-BDFOY-20160101/README.pod Bundle-BDFOY-20160101/t/ Bundle-BDFOY-20160101/xt/ Bundle-BDFOY-20160101/xt/changes.t Bundle-BDFOY-20160101/t/load.t Bundle-BDFOY-20160101/t/pod.t Bundle-BDFOY-20160101/lib/Bundle/ Bundle-BDFOY-20160101/lib/Task/ Bundle-BDFOY-20160101/lib/Task/BDFOY.pm /bin/tar: Read 8192 bytes from - Bundle-BDFOY-20160101/lib/Bundle/BDFOY.pm Configuring B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite App::scriptdist 0 not found. Warning: prerequisite Distribution::Cooker 0 not found. Warning: prerequisite File::Fingerprint 0 not found. Warning: prerequisite HTTP::Cookies::Omniweb 0 not found. Warning: prerequisite HTTP::Cookies::Safari 0 not found. Warning: prerequisite HTTP::Cookies::iCab 0 not found. Warning: prerequisite Mac::OSVersion 0 not found. Warning: prerequisite Mac::iPhoto::Shell 0 not found. Warning: prerequisite Mac::iTerm::LaunchPad 0 not found. Warning: prerequisite MacOSX::Alias 0 not found. Warning: prerequisite MyCPAN::App::DPAN 0 not found. Warning: prerequisite MyCPAN::Indexer 0 not found. Warning: prerequisite Net::SSH::Perl::ProxiedIPC 0 not found. Warning: prerequisite Net::SSH::Perl::WithSocks 0 not found. Warning: prerequisite PPI::App::ppi_version::BDFOY 0 not found. Warning: prerequisite PeGS::PDF 0 not found. Warning: prerequisite PerlPowerTools 0 not found. Warning: prerequisite Pod::PseudoPod::PerlTricks 0 not found. Warning: prerequisite Pod::SpeakIt::MacSpeech 0 not found. Warning: prerequisite Psychic::Ninja 0 not found. Warning: prerequisite ReturnValue 0 not found. Warning: prerequisite Task::MasteringPerl 0 not found. Warning: prerequisite Test::WWW::Accessibility 0 not found. Warning: prerequisite Unicode::Support 0 not found. Warning: prerequisite Unicode::Tussle 0 not found. Warning: prerequisite WordPress::Grep 0 not found. Warning: prerequisite github_creator 0 not found. Warning: prerequisite perlbench 0 not found. Warning: prerequisite scriptdist 0 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Bundle::BDFOY Writing MYMETA.yml and MYMETA.json BDFOY/Bundle-BDFOY-20160101.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/Bundle-BDFOY-20160101.tar.gz ---- Unsatisfied dependencies detected during ---- ---- BDFOY/Bundle-BDFOY-20160101.tar.gz ---- PeGS::PDF [requires] Pod::PseudoPod::PerlTricks [requires] Net::SSH::Perl::WithSocks [requires] github_creator [requires] Net::SSH::Perl::ProxiedIPC [requires] HTTP::Cookies::Omniweb [requires] PPI::App::ppi_version::BDFOY [requires] Pod::SpeakIt::MacSpeech [requires] App::scriptdist [requires] MyCPAN::App::DPAN [requires] WordPress::Grep [requires] HTTP::Cookies::iCab [requires] Test::WWW::Accessibility [requires] Psychic::Ninja [requires] PerlPowerTools [requires] Mac::iTerm::LaunchPad [requires] perlbench [requires] Mac::OSVersion [requires] HTTP::Cookies::Safari [requires] MyCPAN::Indexer [requires] scriptdist [requires] Unicode::Support [requires] File::Fingerprint [requires] Task::MasteringPerl [requires] Mac::iPhoto::Shell [requires] ReturnValue [requires] Distribution::Cooker [requires] Unicode::Tussle [requires] MacOSX::Alias [requires] Running test for module 'PeGS::PDF' The module PeGS::PDF isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i PeGS::PDF'. Running test for module 'Pod::PseudoPod::PerlTricks' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Pod-PseudoPod-PerlTricks-0.012.tar.gz ok Pod-PseudoPod-PerlTricks-0.012/ Pod-PseudoPod-PerlTricks-0.012/Changes Pod-PseudoPod-PerlTricks-0.012/examples/ Pod-PseudoPod-PerlTricks-0.012/lib/ Pod-PseudoPod-PerlTricks-0.012/LICENSE Pod-PseudoPod-PerlTricks-0.012/Makefile.PL Pod-PseudoPod-PerlTricks-0.012/MANIFEST Pod-PseudoPod-PerlTricks-0.012/MANIFEST.SKIP Pod-PseudoPod-PerlTricks-0.012/META.json Pod-PseudoPod-PerlTricks-0.012/META.yml Pod-PseudoPod-PerlTricks-0.012/perltricks.html Pod-PseudoPod-PerlTricks-0.012/README.pod Pod-PseudoPod-PerlTricks-0.012/t/ Pod-PseudoPod-PerlTricks-0.012/test-corpus/ Pod-PseudoPod-PerlTricks-0.012/xt/ Pod-PseudoPod-PerlTricks-0.012/xt/changes.t Pod-PseudoPod-PerlTricks-0.012/test-corpus/test.html Pod-PseudoPod-PerlTricks-0.012/test-corpus/test.html.debug Pod-PseudoPod-PerlTricks-0.012/test-corpus/test.pod Pod-PseudoPod-PerlTricks-0.012/t/convert_pod.t Pod-PseudoPod-PerlTricks-0.012/t/lib/ Pod-PseudoPod-PerlTricks-0.012/t/load.t Pod-PseudoPod-PerlTricks-0.012/t/perltricks.t Pod-PseudoPod-PerlTricks-0.012/t/pod.t Pod-PseudoPod-PerlTricks-0.012/t/pod_coverage.t Pod-PseudoPod-PerlTricks-0.012/t/test_manifest Pod-PseudoPod-PerlTricks-0.012/t/lib/transform_file.pl Pod-PseudoPod-PerlTricks-0.012/lib/Pod/ Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/ Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/PerlTricks/ Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/PerlTricks.pm Pod-PseudoPod-PerlTricks-0.012/lib/Pod/PseudoPod/PerlTricks/HTML.pm /bin/tar: Read 9216 bytes from - Pod-PseudoPod-PerlTricks-0.012/examples/pod2perltricks Configuring B/BD/BDFOY/Pod-PseudoPod-PerlTricks-0.012.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Perl v5.20.0 required--this is only v5.18.0, stopped at (eval 12) line 1. Warning: No success on command[/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL] BDFOY/Pod-PseudoPod-PerlTricks-0.012.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- NOT OK Running test for module 'Net::SSH::Perl::WithSocks' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz ok Net-SSH-Perl-WithSocks-0.02/ Net-SSH-Perl-WithSocks-0.02/Changes Net-SSH-Perl-WithSocks-0.02/lib/ Net-SSH-Perl-WithSocks-0.02/LICENSE Net-SSH-Perl-WithSocks-0.02/Makefile.PL Net-SSH-Perl-WithSocks-0.02/MANIFEST Net-SSH-Perl-WithSocks-0.02/META.yml Net-SSH-Perl-WithSocks-0.02/MYMETA.yml Net-SSH-Perl-WithSocks-0.02/README Net-SSH-Perl-WithSocks-0.02/t/ Net-SSH-Perl-WithSocks-0.02/t/load.t Net-SSH-Perl-WithSocks-0.02/t/pod.t Net-SSH-Perl-WithSocks-0.02/t/pod_coverage.t Net-SSH-Perl-WithSocks-0.02/t/prereq.t Net-SSH-Perl-WithSocks-0.02/t/test_manifest Net-SSH-Perl-WithSocks-0.02/lib/Net/ Net-SSH-Perl-WithSocks-0.02/lib/Net/SSH/ Net-SSH-Perl-WithSocks-0.02/lib/Net/SSH/Perl/ Net-SSH-Perl-WithSocks-0.02/lib/Net/SSH/Perl/WithSocks.pm Configuring B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite Net::SSH::Perl 0 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Net::SSH::Perl::WithSocks Writing MYMETA.yml and MYMETA.json BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz ---- Unsatisfied dependencies detected during ---- ---- BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz ---- Net::SSH::Perl [requires] Running test for module 'Net::SSH::Perl' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz ok Net-SSH-Perl-1.42/ Net-SSH-Perl-1.42/t/ Net-SSH-Perl-1.42/t/05-cipher.t Net-SSH-Perl-1.42/t/00-signature.t Net-SSH-Perl-1.42/t/config Net-SSH-Perl-1.42/t/psshd Net-SSH-Perl-1.42/t/03-packet.t Net-SSH-Perl-1.42/t/test-common.pl Net-SSH-Perl-1.42/t/99-perlcritic.t Net-SSH-Perl-1.42/t/06-auth.t Net-SSH-Perl-1.42/t/04-config.t Net-SSH-Perl-1.42/t/99-pod.t Net-SSH-Perl-1.42/t/01-compile.t Net-SSH-Perl-1.42/t/99-yaml.t Net-SSH-Perl-1.42/t/99-spellcheck.t Net-SSH-Perl-1.42/t/06-circular.t Net-SSH-Perl-1.42/t/02-buffer.t Net-SSH-Perl-1.42/.perlcriticrc Net-SSH-Perl-1.42/lib/ Net-SSH-Perl-1.42/lib/Net/ Net-SSH-Perl-1.42/lib/Net/SSH/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/AuthMgr.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Buffer.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Agent.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/SSH2.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Authfile.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Hosts.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/SSH1Misc.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/RSA.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/SSH1MP.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Win32.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/Term.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Util/SSH2MP.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Comp.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/DSA.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/RSA.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key/RSA1.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/RC4.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/CFB.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/CBC.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/DES.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/DES3.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/IDEA.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Cipher/Blowfish.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Constants.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/SSH1.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Channel.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/Rhosts.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/RSA.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/PublicKey.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/KeyboardInteractive.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/KeyboardInt.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/ChallengeResponse.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/Password.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth/Rhosts_RSA.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Comp/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Comp/Zlib.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle/SSH2.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Handle/SSH1.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Config.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Mac.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Subsystem/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Subsystem/Server.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Subsystem/Client.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/ Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/DH14.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/DH1.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Kex/DH.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Packet.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/ChannelMgr.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Auth.pm Net-SSH-Perl-1.42/lib/Net/SSH/Perl/Key.pm Net-SSH-Perl-1.42/MANIFEST.SKIP Net-SSH-Perl-1.42/Makefile.PL Net-SSH-Perl-1.42/LICENSE Net-SSH-Perl-1.42/META.yml Net-SSH-Perl-1.42/eg/ Net-SSH-Perl-1.42/eg/pscp Net-SSH-Perl-1.42/eg/cmd.pl Net-SSH-Perl-1.42/eg/remoteinteract.pl Net-SSH-Perl-1.42/eg/remoteinteract2.pl Net-SSH-Perl-1.42/eg/pssh-keygen Net-SSH-Perl-1.42/eg/pssh Net-SSH-Perl-1.42/Changes Net-SSH-Perl-1.42/MANIFEST Net-SSH-Perl-1.42/README Net-SSH-Perl-1.42/SIGNATURE Net-SSH-Perl-1.42/ToDo Configuring S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL This is Net::SSH::Perl. As of version 1.00, Net::SSH::Perl supports both the SSH1 and SSH2 protocols natively. The two protocols have different module prerequisitives, so you need to decide which protocol(s) you plan to use. If you use one or the other, only those modules for your chosen protocol will be installed; if you choose both, all of the supporting modules will be installed. Please choose the protocols you'd like to use from the following list ("Both" is the default). [1] SSH1 [2] SSH2 [3] Both SSH1 and SSH2 Which protocol(s) do you plan to use? [3] 3 Some of the Net::SSH::Perl ciphers depend on a Crypt:: module from CPAN. You may already have the necessary modules installed, in which case you don't need to bother with this step. Otherwise you'll need to install at least one cipher to use Net::SSH::Perl. Please choose at least one from the following list (Crypt::IDEA is the default). [1] IDEA [2] DES [3] DES3 [4] Blowfish [5] RC4 Enter your choices, separated by spaces: [1] 1 Warning: prerequisite Crypt::DH 0.01 not found. Checking for optional modules Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Net::SSH::Perl Writing MYMETA.yml and MYMETA.json SCHWIGON/Net-SSH-Perl-1.42.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz ---- Unsatisfied dependencies detected during ---- ---- SCHWIGON/Net-SSH-Perl-1.42.tar.gz ---- Crypt::DH [requires] Running test for module 'Crypt::DH' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/M/MI/MITHALDU/Crypt-DH-0.07.tar.gz ok ./ ./Crypt-DH-0.07/ ./Crypt-DH-0.07/Changes ./Crypt-DH-0.07/inc/ ./Crypt-DH-0.07/inc/Devel/ ./Crypt-DH-0.07/inc/Devel/CheckLib.pm ./Crypt-DH-0.07/inc/Module/ ./Crypt-DH-0.07/inc/Module/AutoInstall.pm ./Crypt-DH-0.07/inc/Module/Install/ ./Crypt-DH-0.07/inc/Module/Install/AutoInstall.pm ./Crypt-DH-0.07/inc/Module/Install/Base.pm ./Crypt-DH-0.07/inc/Module/Install/Can.pm ./Crypt-DH-0.07/inc/Module/Install/CheckLib.pm ./Crypt-DH-0.07/inc/Module/Install/Fetch.pm ./Crypt-DH-0.07/inc/Module/Install/GithubMeta.pm ./Crypt-DH-0.07/inc/Module/Install/Include.pm ./Crypt-DH-0.07/inc/Module/Install/Makefile.pm ./Crypt-DH-0.07/inc/Module/Install/Metadata.pm ./Crypt-DH-0.07/inc/Module/Install/ReadmeFromPod.pm ./Crypt-DH-0.07/inc/Module/Install/Win32.pm ./Crypt-DH-0.07/inc/Module/Install/WriteAll.pm ./Crypt-DH-0.07/inc/Module/Install.pm ./Crypt-DH-0.07/inc/Test/ ./Crypt-DH-0.07/inc/Test/More.pm ./Crypt-DH-0.07/lib/ ./Crypt-DH-0.07/lib/Crypt/ ./Crypt-DH-0.07/lib/Crypt/DH.pm ./Crypt-DH-0.07/Makefile.PL ./Crypt-DH-0.07/MANIFEST ./Crypt-DH-0.07/META.yml ./Crypt-DH-0.07/README ./Crypt-DH-0.07/t/ ./Crypt-DH-0.07/t/00-compile.t ./Crypt-DH-0.07/t/01-dh.t ./Crypt-DH-0.07/ToDo Configuring M/MI/MITHALDU/Crypt-DH-0.07.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL *** Module::AutoInstall version 1.06 *** Checking for Perl dependencies... *** Since we're running under CPAN, I'll just let it take care of the dependency's installation later. [Core Features] - Test::More ...loaded. (0.98 >= 0.47) - Math::BigInt::GMP ...missing. (would need 1.24) - Math::BigInt ...loaded. (1.999715 >= 1.60) *** Module::AutoInstall configuration finished. Warning: prerequisite Math::BigInt::GMP 1.24 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Crypt::DH Writing MYMETA.yml and MYMETA.json MITHALDU/Crypt-DH-0.07.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for M/MI/MITHALDU/Crypt-DH-0.07.tar.gz ---- Unsatisfied dependencies detected during ---- ---- MITHALDU/Crypt-DH-0.07.tar.gz ---- Math::BigInt::GMP [requires] Running test for module 'Math::BigInt::GMP' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/P/PJ/PJACKLAM/Math-BigInt-GMP-1.49.tar.gz ok Math-BigInt-GMP-1.49/ Math-BigInt-GMP-1.49/BUGS Math-BigInt-GMP-1.49/build/ Math-BigInt-GMP-1.49/build/leak.pl Math-BigInt-GMP-1.49/build/leaktest Math-BigInt-GMP-1.49/build/README Math-BigInt-GMP-1.49/CHANGES Math-BigInt-GMP-1.49/CREDITS Math-BigInt-GMP-1.49/GMP.xs Math-BigInt-GMP-1.49/inc/ Math-BigInt-GMP-1.49/inc/Devel/ Math-BigInt-GMP-1.49/inc/Devel/CheckLib.pm Math-BigInt-GMP-1.49/INSTALL Math-BigInt-GMP-1.49/lib/ Math-BigInt-GMP-1.49/lib/Math/ Math-BigInt-GMP-1.49/lib/Math/BigInt/ Math-BigInt-GMP-1.49/lib/Math/BigInt/GMP.pm Math-BigInt-GMP-1.49/LICENSE Math-BigInt-GMP-1.49/Makefile.PL Math-BigInt-GMP-1.49/MANIFEST Math-BigInt-GMP-1.49/MANIFEST.SKIP Math-BigInt-GMP-1.49/META.json Math-BigInt-GMP-1.49/META.yml Math-BigInt-GMP-1.49/README Math-BigInt-GMP-1.49/SIGNATURE Math-BigInt-GMP-1.49/t/ Math-BigInt-GMP-1.49/t/00sig.t Math-BigInt-GMP-1.49/t/01load.t Math-BigInt-GMP-1.49/t/02pod.t Math-BigInt-GMP-1.49/t/03podcov.t Math-BigInt-GMP-1.49/t/bigfltpm.inc Math-BigInt-GMP-1.49/t/bigfltpm.t Math-BigInt-GMP-1.49/t/bigintg.t Math-BigInt-GMP-1.49/t/bigintpm.inc Math-BigInt-GMP-1.49/t/bigintpm.t Math-BigInt-GMP-1.49/t/biglog.t Math-BigInt-GMP-1.49/t/bigroot.t Math-BigInt-GMP-1.49/t/mbi-from-big-scalar.t Math-BigInt-GMP-1.49/t/storable.t Math-BigInt-GMP-1.49/t/threads.t Math-BigInt-GMP-1.49/TODO Math-BigInt-GMP-1.49/typemap Configuring P/PJ/PJACKLAM/Math-BigInt-GMP-1.49.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Math::BigInt::GMP Writing MYMETA.yml and MYMETA.json PJACKLAM/Math-BigInt-GMP-1.49.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for P/PJ/PJACKLAM/Math-BigInt-GMP-1.49.tar.gz >>> make cp lib/Math/BigInt/GMP.pm blib/lib/Math/BigInt/GMP.pm Running Mkbootstrap for Math::BigInt::GMP () chmod 644 "GMP.bs" "/home/fly1800/ap1800-297235/bin/perl-static" "/home/fly1800/cpanfly-5.18/var/megalib/ExtUtils/xsubpp" -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" -typemap "typemap" GMP.xs > GMP.xsc && mv GMP.xsc GMP.c gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"1.49\" -DXS_VERSION=\"1.49\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" GMP.c rm -f blib/arch/auto/Math/BigInt/GMP/GMP.so LD_RUN_PATH="/usr/lib" gcc -shared -O2 -fstack-protector GMP.o -o blib/arch/auto/Math/BigInt/GMP/GMP.so \ -lgmp \ chmod 755 blib/arch/auto/Math/BigInt/GMP/GMP.so "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::Command::MM -e 'cp_nonempty' -- GMP.bs blib/arch/auto/Math/BigInt/GMP/GMP.bs 644 Manifying 1 pod document PJACKLAM/Math-BigInt-GMP-1.49.tar.gz make -- OK Running make test >>> make test TEST_VERBOSE=1 Running Mkbootstrap for Math::BigInt::GMP () chmod 644 "GMP.bs" PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/00sig.t ................ skipped: Set the environment variable TEST_SIGNATURE to enable this test. # # Testing with Perl 5.018000, /home/fly1800/ap1800-297235/bin/perl-static # # Version Module # ------- ------ # 1.49 Math::BigInt::GMP # 1.999715 Math::BigInt # t/01load.t ............... 1..2 ok 1 - use Math::BigInt::GMP; ok 2 - use Math::BigInt; ok t/02pod.t ................ 1..1 ok 1 - POD test for blib/lib/Math/BigInt/GMP.pm ok t/03podcov.t ............. 1..1 ok 1 - All modules are covered ok t/bigfltpm.t ............. 1..2414 ok 1 - Math::BigFloat->config()->{class} ok 2 - Math::BigFloat->config()->{with} ok 3 - $c = Math::BigFloat -> new("123.3"); $y = $c -> bsub("123") ok 4 - 0.008 / 3 = 0.0027 ok 5 # skip skipping test which is not for this backend ok 6 - Math::BigFloat->config()->{lib} ok 7 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y); ok 8 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y); ok 9 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y); ok 10 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("12"); Math::BigFloat::bgcd($x, $y); ok 11 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y); ok 12 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y); ok 13 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y); ok 14 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y); ok 15 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y); ok 16 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); Math::BigFloat::bgcd($x, $y); ok 17 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y); ok 18 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y); ok 19 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y); ok 20 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); Math::BigFloat::bgcd($x, $y); ok 21 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y); ok 22 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y); ok 23 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y); ok 24 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y); ok 25 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y); ok 26 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::bgcd($x, $y); ok 27 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y); ok 28 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y); ok 29 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y); ok 30 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y); ok 31 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y); ok 32 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::bgcd($x, $y); ok 33 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y); ok 34 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); Math::BigFloat::bgcd($x, $y); ok 35 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); Math::BigFloat::bgcd($x, $y); ok 36 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); Math::BigFloat::bgcd($x, $y); ok 37 - $x = Math::BigFloat->new("+3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y); ok 38 - $x = Math::BigFloat->new("+3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y); ok 39 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y); ok 40 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("+2"); Math::BigFloat::bgcd($x, $y); ok 41 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-2"); Math::BigFloat::bgcd($x, $y); ok 42 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-2"); Math::BigFloat::bgcd($x, $y); ok 43 - $x = Math::BigFloat->new("-144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y); ok 44 - $x = Math::BigFloat->new("-144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y); ok 45 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y); ok 46 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("-60"); Math::BigFloat::bgcd($x, $y); ok 47 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("60"); Math::BigFloat::bgcd($x, $y); ok 48 - $x = Math::BigFloat->new("144"); $y = Math::BigFloat->new("60"); Math::BigFloat::bgcd($x, $y); ok 49 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("625"); Math::BigFloat::bgcd($x, $y); ok 50 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("625"); Math::BigFloat::bgcd($x, $y); ok 51 - $x = Math::BigFloat->new("4096"); $y = Math::BigFloat->new("81"); Math::BigFloat::bgcd($x, $y); ok 52 - $x = Math::BigFloat->new("4096"); $y = Math::BigFloat->new("81"); Math::BigFloat::bgcd($x, $y); ok 53 - $x = Math::BigFloat->new("1034"); $y = Math::BigFloat->new("804"); Math::BigFloat::bgcd($x, $y); ok 54 - $x = Math::BigFloat->new("1034"); $y = Math::BigFloat->new("804"); Math::BigFloat::bgcd($x, $y); ok 55 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("56"); Math::BigFloat::bgcd($x, $y, $z); ok 56 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("56"); Math::BigFloat::bgcd($x, $y, $z); ok 57 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("54"); Math::BigFloat::bgcd($x, $y, $z); ok 58 - $x = Math::BigFloat->new("27"); $y = Math::BigFloat->new("90"); $z = Math::BigFloat->new("54"); Math::BigFloat::bgcd($x, $y, $z); ok 59 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y); ok 60 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y); ok 61 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y); ok 62 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y); ok 63 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y); ok 64 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); Math::BigFloat::blcm($x, $y); ok 65 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y); ok 66 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y); ok 67 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y); ok 68 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); Math::BigFloat::blcm($x, $y); ok 69 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::blcm($x, $y); ok 70 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); Math::BigFloat::blcm($x, $y); ok 71 - $x = Math::BigFloat->new("+27"); $y = Math::BigFloat->new("+90"); Math::BigFloat::blcm($x, $y); ok 72 - $x = Math::BigFloat->new("+27"); $y = Math::BigFloat->new("+90"); Math::BigFloat::blcm($x, $y); ok 73 - $x = Math::BigFloat->new("+1034"); $y = Math::BigFloat->new("+804"); Math::BigFloat::blcm($x, $y); ok 74 - $x = Math::BigFloat->new("+1034"); $y = Math::BigFloat->new("+804"); Math::BigFloat::blcm($x, $y); ok 75 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("10"); $x->bcos($y); ok 76 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("10"); $x->bcos($y); ok 77 - $x = Math::BigFloat->new("2.4"); $y = Math::BigFloat->new("12"); $x->bcos($y); ok 78 - $x = Math::BigFloat->new("2.4"); $y = Math::BigFloat->new("12"); $x->bcos($y); ok 79 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bcos($y); ok 80 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bcos($y); ok 81 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bcos($y); ok 82 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bcos($y); ok 83 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bcos($y); ok 84 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bcos($y); ok 85 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("12"); $x->bcos($y); ok 86 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("12"); $x->bcos($y); ok 87 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bsin($y); ok 88 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $x->bsin($y); ok 89 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bsin($y); ok 90 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->bsin($y); ok 91 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bsin($y); ok 92 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("20"); $x->bsin($y); ok 93 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("12"); $x->bsin($y); ok 94 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("12"); $x->bsin($y); ok 95 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("13"); $x->bsin($y); ok 96 - $x = Math::BigFloat->new("1.2"); $y = Math::BigFloat->new("13"); $x->bsin($y); ok 97 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->bsin($y); ok 98 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->bsin($y); ok 99 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("12"); $x->bsin($y); ok 100 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("12"); $x->bsin($y); ok 101 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("10"); $x->batan($y); ok 102 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("10"); $x->batan($y); ok 103 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 104 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 105 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 106 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 107 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 108 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 109 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->batan($y); ok 110 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("10"); $x->batan($y); ok 111 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 112 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 113 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->batan($y); ok 114 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("13"); $x->batan($y); ok 115 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 116 - $x = Math::BigFloat->new("0.2"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 117 - $x = Math::BigFloat->new("0.5"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 118 - $x = Math::BigFloat->new("0.5"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 119 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 120 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 121 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 122 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 123 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 124 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 125 - $x = Math::BigFloat->new("2.0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 126 - $x = Math::BigFloat->new("2.0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 127 - $x = Math::BigFloat->new("2.5"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 128 - $x = Math::BigFloat->new("2.5"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 129 - $x = Math::BigFloat->new("3.0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 130 - $x = Math::BigFloat->new("3.0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 131 - $x = Math::BigFloat->new("6.0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 132 - $x = Math::BigFloat->new("6.0"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 133 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 134 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 135 - $x = Math::BigFloat->new("24"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 136 - $x = Math::BigFloat->new("24"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 137 - $x = Math::BigFloat->new("48"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 138 - $x = Math::BigFloat->new("48"); $y = Math::BigFloat->new("14"); $x->batan($y); ok 139 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z); ok 140 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z); ok 141 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z); ok 142 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z); ok 143 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z); ok 144 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $z = Math::BigFloat->new("10"); $x->batan2($y, $z); ok 145 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 146 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 147 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 148 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 149 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 150 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 151 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 152 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 153 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 154 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 155 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 156 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 157 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 158 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 159 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 160 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 161 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 162 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 163 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 164 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 165 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 166 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 167 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 168 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 169 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 170 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 171 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 172 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 173 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 174 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 175 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 176 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 177 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 178 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 179 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 180 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 181 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 182 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 183 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 184 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 185 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 186 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 187 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 188 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 189 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 190 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 191 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 192 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 193 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 194 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 195 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("13"); $x->batan2($y, $z); ok 196 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("13"); $x->batan2($y, $z); ok 197 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 198 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 199 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 200 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 201 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 202 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 203 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("11"); $x->batan2($y, $z); ok 204 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("11"); $x->batan2($y, $z); ok 205 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z); ok 206 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z); ok 207 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z); ok 208 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("77"); $x->batan2($y, $z); ok 209 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 210 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 211 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 212 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("5"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 213 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 214 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 215 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 216 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("8"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 217 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("24"); $x->batan2($y, $z); ok 218 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $z = Math::BigFloat->new("24"); $x->batan2($y, $z); ok 219 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 220 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 221 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 222 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("1"); $z = Math::BigFloat->new("14"); $x->batan2($y, $z); ok 223 - $x = Math::BigFloat->new("150"); Math::BigFloat->bpi($x); ok 224 - $x = Math::BigFloat->new("150"); Math::BigFloat->bpi($x); ok 225 - $x = Math::BigFloat->new("77"); Math::BigFloat->bpi($x); ok 226 - $x = Math::BigFloat->new("77"); Math::BigFloat->bpi($x); ok 227 - $x = Math::BigFloat->new("+0"); Math::BigFloat->bpi($x); ok 228 - $x = Math::BigFloat->new("+0"); Math::BigFloat->bpi($x); ok 229 - $x = Math::BigFloat->new("11"); Math::BigFloat->bpi($x); ok 230 - $x = Math::BigFloat->new("11"); Math::BigFloat->bpi($x); ok 231 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("10"); $x->bnok($y); ok 232 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("10"); $x->bnok($y); ok 233 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $x->bnok($y); ok 234 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("NaN"); $x->bnok($y); ok 235 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x->bnok($y); ok 236 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x->bnok($y); ok 237 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x->bnok($y); ok 238 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x->bnok($y); ok 239 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x->bnok($y); ok 240 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x->bnok($y); ok 241 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x->bnok($y); ok 242 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x->bnok($y); ok 243 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("3"); $x->bnok($y); ok 244 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("3"); $x->bnok($y); ok 245 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-2"); $x->bnok($y); ok 246 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-2"); $x->bnok($y); ok 247 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("3"); $x->bnok($y); ok 248 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("3"); $x->bnok($y); ok 249 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("6"); $x->bnok($y); ok 250 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("6"); $x->bnok($y); ok 251 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("90"); $x->bnok($y); ok 252 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("90"); $x->bnok($y); ok 253 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("95"); $x->bnok($y); ok 254 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("95"); $x->bnok($y); ok 255 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $x->bnok($y); ok 256 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0"); $x->bnok($y); ok 257 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("0"); $x->bnok($y); ok 258 - $x = Math::BigFloat->new("7"); $y = Math::BigFloat->new("0"); $x->bnok($y); ok 259 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x->bnok($y); ok 260 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x->bnok($y); ok 261 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 262 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 263 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 264 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 265 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 266 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 267 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(-1); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 268 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(-1); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 269 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(0); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 270 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(0); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 271 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 272 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 273 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 274 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 275 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 276 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(1); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 277 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(2); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 278 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new(2); $Math::BigFloat::div_scale = 40; $x->blog($y); ok 279 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 280 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 281 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 282 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 283 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 20; $x->blog(); ok 284 - $x = Math::BigFloat->new("2.718281828"); $Math::BigFloat::div_scale = 20; $x->blog(); ok 285 - $x = Math::BigFloat->new("123"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 286 - $x = Math::BigFloat->new("123"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 287 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 288 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 289 - $x = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 290 - $x = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 291 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 292 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 293 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 294 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 295 - $x = Math::BigFloat->new("3.1415"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 296 - $x = Math::BigFloat->new("3.1415"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 297 - $x = Math::BigFloat->new("12345"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 298 - $x = Math::BigFloat->new("12345"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 299 - $x = Math::BigFloat->new("0.001"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 300 - $x = Math::BigFloat->new("0.001"); $Math::BigFloat::div_scale = 15; $x->blog(); ok 301 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new(10); $Math::BigFloat::div_scale = 15; $x->blog($y); ok 302 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new(10); $Math::BigFloat::div_scale = 15; $x->blog($y); ok 303 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new(100); $Math::BigFloat::div_scale = 15; $x->blog($y); ok 304 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new(100); $Math::BigFloat::div_scale = 15; $x->blog($y); ok 305 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 306 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->blog(); ok 307 - $x = Math::BigFloat->new("NaNbrsft"); $y = Math::BigFloat->new("2"); $x >> $y; ok 308 - $x = Math::BigFloat->new("NaNbrsft"); $y = Math::BigFloat->new("2"); $x >> $y; ok 309 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $x >> $y; ok 310 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("2"); $x >> $y; ok 311 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x >> $y; ok 312 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x >> $y; ok 313 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x >> $y; ok 314 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x >> $y; ok 315 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("1"); $x >> $y; ok 316 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("1"); $x >> $y; ok 317 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("1"); $x >> $y; ok 318 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("1"); $x >> $y; ok 319 - $x = Math::BigFloat->new("32"); $y = Math::BigFloat->new("3"); $x >> $y; ok 320 - $x = Math::BigFloat->new("32"); $y = Math::BigFloat->new("3"); $x >> $y; ok 321 - $x = Math::BigFloat->new("NaNblsft"); $y = Math::BigFloat->new("0"); $x << $y; ok 322 - $x = Math::BigFloat->new("NaNblsft"); $y = Math::BigFloat->new("0"); $x << $y; ok 323 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x << $y; ok 324 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x << $y; ok 325 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x << $y; ok 326 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x << $y; ok 327 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("3"); $x << $y; ok 328 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("3"); $x << $y; ok 329 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x << $y; ok 330 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x << $y; ok 331 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("5"); $x << $y; ok 332 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("5"); $x << $y; ok 333 - $x = Math::BigFloat->new("1"); $x; ok 334 - $x = Math::BigFloat->new("1"); $x; ok 335 - $x = Math::BigFloat->new("-0"); $x; ok 336 - $x = Math::BigFloat->new("-0"); $x; ok 337 - $x = Math::BigFloat->new("bnormNaN"); $x; ok 338 - $x = Math::BigFloat->new("bnormNaN"); $x; ok 339 - $x = Math::BigFloat->new("+inf"); $x; ok 340 - $x = Math::BigFloat->new("+inf"); $x; ok 341 - $x = Math::BigFloat->new("-inf"); $x; ok 342 - $x = Math::BigFloat->new("-inf"); $x; ok 343 - $x = Math::BigFloat->new("123"); $x; ok 344 - $x = Math::BigFloat->new("123"); $x; ok 345 - $x = Math::BigFloat->new("-123.4567"); $x; ok 346 - $x = Math::BigFloat->new("-123.4567"); $x; ok 347 - $x = Math::BigFloat->new("1__2"); $x; ok 348 - $x = Math::BigFloat->new("1__2"); $x; ok 349 - $x = Math::BigFloat->new("1E1__2"); $x; ok 350 - $x = Math::BigFloat->new("1E1__2"); $x; ok 351 - $x = Math::BigFloat->new("11__2E2"); $x; ok 352 - $x = Math::BigFloat->new("11__2E2"); $x; ok 353 - $x = Math::BigFloat->new(".2E-3."); $x; ok 354 - $x = Math::BigFloat->new(".2E-3."); $x; ok 355 - $x = Math::BigFloat->new("1e3e4"); $x; ok 356 - $x = Math::BigFloat->new("1e3e4"); $x; ok 357 - $x = Math::BigFloat->new(".2E2"); $x; ok 358 - $x = Math::BigFloat->new(".2E2"); $x; ok 359 - $x = Math::BigFloat->new("1.E3"); $x; ok 360 - $x = Math::BigFloat->new("1.E3"); $x; ok 361 - $x = Math::BigFloat->new("0e0"); $x; ok 362 - $x = Math::BigFloat->new("0e0"); $x; ok 363 - $x = Math::BigFloat->new("+0e0"); $x; ok 364 - $x = Math::BigFloat->new("+0e0"); $x; ok 365 - $x = Math::BigFloat->new("+0e+0"); $x; ok 366 - $x = Math::BigFloat->new("+0e+0"); $x; ok 367 - $x = Math::BigFloat->new("-0e+0"); $x; ok 368 - $x = Math::BigFloat->new("-0e+0"); $x; ok 369 - $x = Math::BigFloat->new("0e-0"); $x; ok 370 - $x = Math::BigFloat->new("0e-0"); $x; ok 371 - $x = Math::BigFloat->new("-0e-0"); $x; ok 372 - $x = Math::BigFloat->new("-0e-0"); $x; ok 373 - $x = Math::BigFloat->new("+0e-0"); $x; ok 374 - $x = Math::BigFloat->new("+0e-0"); $x; ok 375 - $x = Math::BigFloat->new("000"); $x; ok 376 - $x = Math::BigFloat->new("000"); $x; ok 377 - $x = Math::BigFloat->new("00e2"); $x; ok 378 - $x = Math::BigFloat->new("00e2"); $x; ok 379 - $x = Math::BigFloat->new("00e02"); $x; ok 380 - $x = Math::BigFloat->new("00e02"); $x; ok 381 - $x = Math::BigFloat->new("000e002"); $x; ok 382 - $x = Math::BigFloat->new("000e002"); $x; ok 383 - $x = Math::BigFloat->new("000e1230"); $x; ok 384 - $x = Math::BigFloat->new("000e1230"); $x; ok 385 - $x = Math::BigFloat->new("00e-3"); $x; ok 386 - $x = Math::BigFloat->new("00e-3"); $x; ok 387 - $x = Math::BigFloat->new("00e+3"); $x; ok 388 - $x = Math::BigFloat->new("00e+3"); $x; ok 389 - $x = Math::BigFloat->new("00e-03"); $x; ok 390 - $x = Math::BigFloat->new("00e-03"); $x; ok 391 - $x = Math::BigFloat->new("00e+03"); $x; ok 392 - $x = Math::BigFloat->new("00e+03"); $x; ok 393 - $x = Math::BigFloat->new("-000"); $x; ok 394 - $x = Math::BigFloat->new("-000"); $x; ok 395 - $x = Math::BigFloat->new("-00e2"); $x; ok 396 - $x = Math::BigFloat->new("-00e2"); $x; ok 397 - $x = Math::BigFloat->new("-00e02"); $x; ok 398 - $x = Math::BigFloat->new("-00e02"); $x; ok 399 - $x = Math::BigFloat->new("-000e002"); $x; ok 400 - $x = Math::BigFloat->new("-000e002"); $x; ok 401 - $x = Math::BigFloat->new("-000e1230"); $x; ok 402 - $x = Math::BigFloat->new("-000e1230"); $x; ok 403 - $x = Math::BigFloat->new("-00e-3"); $x; ok 404 - $x = Math::BigFloat->new("-00e-3"); $x; ok 405 - $x = Math::BigFloat->new("-00e+3"); $x; ok 406 - $x = Math::BigFloat->new("-00e+3"); $x; ok 407 - $x = Math::BigFloat->new("-00e-03"); $x; ok 408 - $x = Math::BigFloat->new("-00e-03"); $x; ok 409 - $x = Math::BigFloat->new("-00e+03"); $x; ok 410 - $x = Math::BigFloat->new("-00e+03"); $x; ok 411 - $x = Math::BigFloat->new("0"); $x->as_number(); ok 412 - $x = Math::BigFloat->new("1"); $x->as_number(); ok 413 - $x = Math::BigFloat->new("1.2"); $x->as_number(); ok 414 - $x = Math::BigFloat->new("2.345"); $x->as_number(); ok 415 - $x = Math::BigFloat->new("-2"); $x->as_number(); ok 416 - $x = Math::BigFloat->new("-123.456"); $x->as_number(); ok 417 - $x = Math::BigFloat->new("-200"); $x->as_number(); ok 418 - $x = Math::BigFloat->new("-inf"); $x->as_number(); ok 419 - $x = Math::BigFloat->new("inf"); $x->as_number(); ok 420 - $x = Math::BigFloat->new("NaN"); $x->as_number(); ok 421 - $x = Math::BigFloat->new("71243225429896467497217836789578596379"); $x->as_number(); ok 422 - $x = Math::BigFloat->new("0.000641"); $x->as_number(); ok 423 - $x = Math::BigFloat->new("0.0006412"); $x->as_number(); ok 424 - $x = Math::BigFloat->new("0.00064123"); $x->as_number(); ok 425 - $x = Math::BigFloat->new("0.000641234"); $x->as_number(); ok 426 - $x = Math::BigFloat->new("0.0006412345"); $x->as_number(); ok 427 - $x = Math::BigFloat->new("0.00064123456"); $x->as_number(); ok 428 - $x = Math::BigFloat->new("0.000641234567"); $x->as_number(); ok 429 - $x = Math::BigFloat->new("0.0006412345678"); $x->as_number(); ok 430 - $x = Math::BigFloat->new("0.00064123456789"); $x->as_number(); ok 431 - $x = Math::BigFloat->new("0.1"); $x->as_number(); ok 432 - $x = Math::BigFloat->new("0.01"); $x->as_number(); ok 433 - $x = Math::BigFloat->new("0.001"); $x->as_number(); ok 434 - $x = Math::BigFloat->new("0.0001"); $x->as_number(); ok 435 - $x = Math::BigFloat->new("0.00001"); $x->as_number(); ok 436 - $x = Math::BigFloat->new("0.000001"); $x->as_number(); ok 437 - $x = Math::BigFloat->new("0.0000001"); $x->as_number(); ok 438 - $x = Math::BigFloat->new("0.00000001"); $x->as_number(); ok 439 - $x = Math::BigFloat->new("0.000000001"); $x->as_number(); ok 440 - $x = Math::BigFloat->new("0.0000000001"); $x->as_number(); ok 441 - $x = Math::BigFloat->new("0.00000000001"); $x->as_number(); ok 442 - $x = Math::BigFloat->new("0.12345"); $x->as_number(); ok 443 - $x = Math::BigFloat->new("0.123456"); $x->as_number(); ok 444 - $x = Math::BigFloat->new("0.1234567"); $x->as_number(); ok 445 - $x = Math::BigFloat->new("0.12345678"); $x->as_number(); ok 446 - $x = Math::BigFloat->new("0.123456789"); $x->as_number(); ok 447 - $x = Math::BigFloat->new("1"); $x->binf("+"); ok 448 - $x = Math::BigFloat->new("1"); $x->binf("+"); ok 449 - $x = Math::BigFloat->new("2"); $x->binf("-"); ok 450 - $x = Math::BigFloat->new("2"); $x->binf("-"); ok 451 - $x = Math::BigFloat->new("3"); $x->binf("abc"); ok 452 - $x = Math::BigFloat->new("3"); $x->binf("abc"); ok 453 - $x = Math::BigFloat->new("+inf"); $x->as_hex(); ok 454 - $x = Math::BigFloat->new("-inf"); $x->as_hex(); ok 455 - $x = Math::BigFloat->new("hexNaN"); $x->as_hex(); ok 456 - $x = Math::BigFloat->new("0"); $x->as_hex(); ok 457 - $x = Math::BigFloat->new("5"); $x->as_hex(); ok 458 - $x = Math::BigFloat->new("-5"); $x->as_hex(); ok 459 - $x = Math::BigFloat->new("+inf"); $x->as_bin(); ok 460 - $x = Math::BigFloat->new("-inf"); $x->as_bin(); ok 461 - $x = Math::BigFloat->new("hexNaN"); $x->as_bin(); ok 462 - $x = Math::BigFloat->new("0"); $x->as_bin(); ok 463 - $x = Math::BigFloat->new("5"); $x->as_bin(); ok 464 - $x = Math::BigFloat->new("-5"); $x->as_bin(); ok 465 - $x = Math::BigFloat->new("0"); $x->numify(); ok 466 - $x = Math::BigFloat->new("+1"); $x->numify(); ok 467 - $x = Math::BigFloat->new("1234"); $x->numify(); ok 468 - $x = Math::BigFloat->new("-5"); $x->numify(); ok 469 - $x = Math::BigFloat->new("100"); $x->numify(); ok 470 - $x = Math::BigFloat->new("-100"); $x->numify(); ok 471 - $x = Math::BigFloat->new("abc"); $x->bnan(); ok 472 - $x = Math::BigFloat->new("abc"); $x->bnan(); ok 473 - $x = Math::BigFloat->new("2"); $x->bnan(); ok 474 - $x = Math::BigFloat->new("2"); $x->bnan(); ok 475 - $x = Math::BigFloat->new("-2"); $x->bnan(); ok 476 - $x = Math::BigFloat->new("-2"); $x->bnan(); ok 477 - $x = Math::BigFloat->new("0"); $x->bnan(); ok 478 - $x = Math::BigFloat->new("0"); $x->bnan(); ok 479 - $x = Math::BigFloat->new("2"); $x->bone("+"); ok 480 - $x = Math::BigFloat->new("2"); $x->bone("+"); ok 481 - $x = Math::BigFloat->new("-2"); $x->bone("-"); ok 482 - $x = Math::BigFloat->new("-2"); $x->bone("-"); ok 483 - $x = Math::BigFloat->new("-2"); $x->bone("+"); ok 484 - $x = Math::BigFloat->new("-2"); $x->bone("+"); ok 485 - $x = Math::BigFloat->new("2"); $x->bone("-"); ok 486 - $x = Math::BigFloat->new("2"); $x->bone("-"); ok 487 - $x = Math::BigFloat->new("0"); $x->bone(""); ok 488 - $x = Math::BigFloat->new("0"); $x->bone(""); ok 489 - $x = Math::BigFloat->new("-2"); $x->bone(""); ok 490 - $x = Math::BigFloat->new("-2"); $x->bone(""); ok 491 - $x = Math::BigFloat->new("abc"); $x->bone(""); ok 492 - $x = Math::BigFloat->new("abc"); $x->bone(""); ok 493 - $x = Math::BigFloat->new("2"); $x->bone("abc"); ok 494 - $x = Math::BigFloat->new("2"); $x->bone("abc"); ok 495 - $x = Math::BigFloat->new("+inf"); $x->bsstr(); ok 496 - $x = Math::BigFloat->new("-inf"); $x->bsstr(); ok 497 - $x = Math::BigFloat->new("abcfsstr"); $x->bsstr(); ok 498 - $x = Math::BigFloat->new("-abcfsstr"); $x->bsstr(); ok 499 - $x = Math::BigFloat->new("1234.567"); $x->bsstr(); ok 500 - $x = Math::BigFloat->new("123"); $x->bsstr(); ok 501 - $x = Math::BigFloat->new("-5"); $x->bsstr(); ok 502 - $x = Math::BigFloat->new("-100"); $x->bsstr(); ok 503 - $x = Math::BigFloat->new("+inf"); $x->accuracy(); $x->precision(); $x->bstr(); ok 504 - $x = Math::BigFloat->new("-inf"); $x->accuracy(); $x->precision(); $x->bstr(); ok 505 - $x = Math::BigFloat->new("abcfstr"); $x->accuracy(); $x->precision(); $x->bstr(); ok 506 - $x = Math::BigFloat->new("1234.567"); $x->accuracy(9); $x->precision(); $x->bstr(); ok 507 - $x = Math::BigFloat->new("1234.567"); $x->accuracy(); $x->precision(-6); $x->bstr(); ok 508 - $x = Math::BigFloat->new("12345"); $x->accuracy(5); $x->precision(); $x->bstr(); ok 509 - $x = Math::BigFloat->new("0.001234"); $x->accuracy(6); $x->precision(); $x->bstr(); ok 510 - $x = Math::BigFloat->new("0.001234"); $x->accuracy(); $x->precision(-8); $x->bstr(); ok 511 - $x = Math::BigFloat->new("0"); $x->accuracy(4); $x->precision(); $x->bstr(); ok 512 - $x = Math::BigFloat->new("0"); $x->accuracy(); $x->precision(-4); $x->bstr(); ok 513 - $x = Math::BigFloat->new("inf"); $x; ok 514 - $x = Math::BigFloat->new("inf"); $x; ok 515 - $x = Math::BigFloat->new("+inf"); $x; ok 516 - $x = Math::BigFloat->new("+inf"); $x; ok 517 - $x = Math::BigFloat->new("-inf"); $x; ok 518 - $x = Math::BigFloat->new("-inf"); $x; ok 519 - $x = Math::BigFloat->new("+infinity"); $x; ok 520 - $x = Math::BigFloat->new("+infinity"); $x; ok 521 - $x = Math::BigFloat->new("+-inf"); $x; ok 522 - $x = Math::BigFloat->new("+-inf"); $x; ok 523 - $x = Math::BigFloat->new("abc"); $x; ok 524 - $x = Math::BigFloat->new("abc"); $x; ok 525 - $x = Math::BigFloat->new(" 1 a"); $x; ok 526 - $x = Math::BigFloat->new(" 1 a"); $x; ok 527 - $x = Math::BigFloat->new("1bcd2"); $x; ok 528 - $x = Math::BigFloat->new("1bcd2"); $x; ok 529 - $x = Math::BigFloat->new("11111b"); $x; ok 530 - $x = Math::BigFloat->new("11111b"); $x; ok 531 - $x = Math::BigFloat->new("+1z"); $x; ok 532 - $x = Math::BigFloat->new("+1z"); $x; ok 533 - $x = Math::BigFloat->new("-1z"); $x; ok 534 - $x = Math::BigFloat->new("-1z"); $x; ok 535 - $x = Math::BigFloat->new("0e999"); $x; ok 536 - $x = Math::BigFloat->new("0e999"); $x; ok 537 - $x = Math::BigFloat->new("0e-999"); $x; ok 538 - $x = Math::BigFloat->new("0e-999"); $x; ok 539 - $x = Math::BigFloat->new("-0e999"); $x; ok 540 - $x = Math::BigFloat->new("-0e999"); $x; ok 541 - $x = Math::BigFloat->new("-0e-999"); $x; ok 542 - $x = Math::BigFloat->new("-0e-999"); $x; ok 543 - $x = Math::BigFloat->new("0"); $x; ok 544 - $x = Math::BigFloat->new("0"); $x; ok 545 - $x = Math::BigFloat->new("+0"); $x; ok 546 - $x = Math::BigFloat->new("+0"); $x; ok 547 - $x = Math::BigFloat->new("+00"); $x; ok 548 - $x = Math::BigFloat->new("+00"); $x; ok 549 - $x = Math::BigFloat->new("+0_0_0"); $x; ok 550 - $x = Math::BigFloat->new("+0_0_0"); $x; ok 551 - $x = Math::BigFloat->new("000000_0000000_00000"); $x; ok 552 - $x = Math::BigFloat->new("000000_0000000_00000"); $x; ok 553 - $x = Math::BigFloat->new("-0"); $x; ok 554 - $x = Math::BigFloat->new("-0"); $x; ok 555 - $x = Math::BigFloat->new("-0000"); $x; ok 556 - $x = Math::BigFloat->new("-0000"); $x; ok 557 - $x = Math::BigFloat->new("+1"); $x; ok 558 - $x = Math::BigFloat->new("+1"); $x; ok 559 - $x = Math::BigFloat->new("+01"); $x; ok 560 - $x = Math::BigFloat->new("+01"); $x; ok 561 - $x = Math::BigFloat->new("+001"); $x; ok 562 - $x = Math::BigFloat->new("+001"); $x; ok 563 - $x = Math::BigFloat->new("+00000100000"); $x; ok 564 - $x = Math::BigFloat->new("+00000100000"); $x; ok 565 - $x = Math::BigFloat->new("123456789"); $x; ok 566 - $x = Math::BigFloat->new("123456789"); $x; ok 567 - $x = Math::BigFloat->new("-1"); $x; ok 568 - $x = Math::BigFloat->new("-1"); $x; ok 569 - $x = Math::BigFloat->new("-01"); $x; ok 570 - $x = Math::BigFloat->new("-01"); $x; ok 571 - $x = Math::BigFloat->new("-001"); $x; ok 572 - $x = Math::BigFloat->new("-001"); $x; ok 573 - $x = Math::BigFloat->new("-123456789"); $x; ok 574 - $x = Math::BigFloat->new("-123456789"); $x; ok 575 - $x = Math::BigFloat->new("-00000100000"); $x; ok 576 - $x = Math::BigFloat->new("-00000100000"); $x; ok 577 - $x = Math::BigFloat->new("123.456a"); $x; ok 578 - $x = Math::BigFloat->new("123.456a"); $x; ok 579 - $x = Math::BigFloat->new("123.456"); $x; ok 580 - $x = Math::BigFloat->new("123.456"); $x; ok 581 - $x = Math::BigFloat->new("0.01"); $x; ok 582 - $x = Math::BigFloat->new("0.01"); $x; ok 583 - $x = Math::BigFloat->new(".002"); $x; ok 584 - $x = Math::BigFloat->new(".002"); $x; ok 585 - $x = Math::BigFloat->new("+.2"); $x; ok 586 - $x = Math::BigFloat->new("+.2"); $x; ok 587 - $x = Math::BigFloat->new("-0.0003"); $x; ok 588 - $x = Math::BigFloat->new("-0.0003"); $x; ok 589 - $x = Math::BigFloat->new("-.0000000004"); $x; ok 590 - $x = Math::BigFloat->new("-.0000000004"); $x; ok 591 - $x = Math::BigFloat->new("123456E2"); $x; ok 592 - $x = Math::BigFloat->new("123456E2"); $x; ok 593 - $x = Math::BigFloat->new("123456E-2"); $x; ok 594 - $x = Math::BigFloat->new("123456E-2"); $x; ok 595 - $x = Math::BigFloat->new("-123456E2"); $x; ok 596 - $x = Math::BigFloat->new("-123456E2"); $x; ok 597 - $x = Math::BigFloat->new("-123456E-2"); $x; ok 598 - $x = Math::BigFloat->new("-123456E-2"); $x; ok 599 - $x = Math::BigFloat->new("1e1"); $x; ok 600 - $x = Math::BigFloat->new("1e1"); $x; ok 601 - $x = Math::BigFloat->new("2e-11"); $x; ok 602 - $x = Math::BigFloat->new("2e-11"); $x; ok 603 - $x = Math::BigFloat->new(" .02e-1"); $x; ok 604 - $x = Math::BigFloat->new(" .02e-1"); $x; ok 605 - $x = Math::BigFloat->new(" 000001"); $x; ok 606 - $x = Math::BigFloat->new(" 000001"); $x; ok 607 - $x = Math::BigFloat->new(" -00001"); $x; ok 608 - $x = Math::BigFloat->new(" -00001"); $x; ok 609 - $x = Math::BigFloat->new(" -1"); $x; ok 610 - $x = Math::BigFloat->new(" -1"); $x; ok 611 - $x = Math::BigFloat->new(" 000.01"); $x; ok 612 - $x = Math::BigFloat->new(" 000.01"); $x; ok 613 - $x = Math::BigFloat->new(" -000.0023"); $x; ok 614 - $x = Math::BigFloat->new(" -000.0023"); $x; ok 615 - $x = Math::BigFloat->new(" 1.1e1"); $x; ok 616 - $x = Math::BigFloat->new(" 1.1e1"); $x; ok 617 - $x = Math::BigFloat->new("-3e111"); $x; ok 618 - $x = Math::BigFloat->new("-3e111"); $x; ok 619 - $x = Math::BigFloat->new("-4e-1111"); $x; ok 620 - $x = Math::BigFloat->new("-4e-1111"); $x; ok 621 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x ** $y; ok 622 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("1"); $x ** $y; ok 623 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 624 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 625 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-1"); $x ** $y; ok 626 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-1"); $x ** $y; ok 627 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 628 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 629 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-21"); $x ** $y; ok 630 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-21"); $x ** $y; ok 631 - $x = Math::BigFloat->new("-21"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 632 - $x = Math::BigFloat->new("-21"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 633 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("21"); $x ** $y; ok 634 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("21"); $x ** $y; ok 635 - $x = Math::BigFloat->new("21"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 636 - $x = Math::BigFloat->new("21"); $y = Math::BigFloat->new("NaN"); $x ** $y; ok 637 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x ** $y; ok 638 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x ** $y; ok 639 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x ** $y; ok 640 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x ** $y; ok 641 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("9"); $x ** $y; ok 642 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("9"); $x ** $y; ok 643 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-2"); $x ** $y; ok 644 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-2"); $x ** $y; ok 645 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $x ** $y; ok 646 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $x ** $y; ok 647 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x ** $y; ok 648 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x ** $y; ok 649 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x ** $y; ok 650 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x ** $y; ok 651 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $x ** $y; ok 652 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $x ** $y; ok 653 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("3"); $x ** $y; ok 654 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("3"); $x ** $y; ok 655 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $x ** $y; ok 656 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $x ** $y; ok 657 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-2"); $x ** $y; ok 658 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-2"); $x ** $y; ok 659 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-3"); $x ** $y; ok 660 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("-3"); $x ** $y; ok 661 - $x = Math::BigFloat->new("128"); $y = Math::BigFloat->new("-2"); $x ** $y; ok 662 - $x = Math::BigFloat->new("128"); $y = Math::BigFloat->new("-2"); $x ** $y; ok 663 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("123.456"); $x ** $y; ok 664 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("123.456"); $x ** $y; ok 665 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("abc"); $x ** $y; ok 666 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("abc"); $x ** $y; ok 667 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.45"); $x ** $y; ok 668 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.45"); $x ** $y; ok 669 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.45"); $x ** $y; ok 670 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.45"); $x ** $y; ok 671 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y; ok 672 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y; ok 673 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y; ok 674 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.45"); $x ** $y; ok 675 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $x ** $y; ok 676 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $x ** $y; ok 677 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x ** $y; ok 678 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x ** $y; ok 679 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("4"); $x ** $y; ok 680 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("4"); $x ** $y; ok 681 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("5"); $x ** $y; ok 682 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("5"); $x ** $y; ok 683 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("2"); $x ** $y; ok 684 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("2"); $x ** $y; ok 685 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("3"); $x ** $y; ok 686 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("3"); $x ** $y; ok 687 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $x ** $y; ok 688 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $x ** $y; ok 689 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("5"); $x ** $y; ok 690 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("5"); $x ** $y; ok 691 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0.5"); $x ** $y; ok 692 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("0.5"); $x ** $y; ok 693 - $x = Math::BigFloat->new("bnegNaN"); $x->bneg(); ok 694 - $x = Math::BigFloat->new("bnegNaN"); $x->bneg(); ok 695 - $x = Math::BigFloat->new("+inf"); $x->bneg(); ok 696 - $x = Math::BigFloat->new("+inf"); $x->bneg(); ok 697 - $x = Math::BigFloat->new("-inf"); $x->bneg(); ok 698 - $x = Math::BigFloat->new("-inf"); $x->bneg(); ok 699 - $x = Math::BigFloat->new("+0"); $x->bneg(); ok 700 - $x = Math::BigFloat->new("+0"); $x->bneg(); ok 701 - $x = Math::BigFloat->new("+1"); $x->bneg(); ok 702 - $x = Math::BigFloat->new("+1"); $x->bneg(); ok 703 - $x = Math::BigFloat->new("-1"); $x->bneg(); ok 704 - $x = Math::BigFloat->new("-1"); $x->bneg(); ok 705 - $x = Math::BigFloat->new("+123456789"); $x->bneg(); ok 706 - $x = Math::BigFloat->new("+123456789"); $x->bneg(); ok 707 - $x = Math::BigFloat->new("-123456789"); $x->bneg(); ok 708 - $x = Math::BigFloat->new("-123456789"); $x->bneg(); ok 709 - $x = Math::BigFloat->new("+123.456789"); $x->bneg(); ok 710 - $x = Math::BigFloat->new("+123.456789"); $x->bneg(); ok 711 - $x = Math::BigFloat->new("-123456.789"); $x->bneg(); ok 712 - $x = Math::BigFloat->new("-123456.789"); $x->bneg(); ok 713 - $x = Math::BigFloat->new("babsNaN"); $x->babs(); ok 714 - $x = Math::BigFloat->new("babsNaN"); $x->babs(); ok 715 - $x = Math::BigFloat->new("+inf"); $x->babs(); ok 716 - $x = Math::BigFloat->new("+inf"); $x->babs(); ok 717 - $x = Math::BigFloat->new("-inf"); $x->babs(); ok 718 - $x = Math::BigFloat->new("-inf"); $x->babs(); ok 719 - $x = Math::BigFloat->new("+0"); $x->babs(); ok 720 - $x = Math::BigFloat->new("+0"); $x->babs(); ok 721 - $x = Math::BigFloat->new("+1"); $x->babs(); ok 722 - $x = Math::BigFloat->new("+1"); $x->babs(); ok 723 - $x = Math::BigFloat->new("-1"); $x->babs(); ok 724 - $x = Math::BigFloat->new("-1"); $x->babs(); ok 725 - $x = Math::BigFloat->new("+123456789"); $x->babs(); ok 726 - $x = Math::BigFloat->new("+123456789"); $x->babs(); ok 727 - $x = Math::BigFloat->new("-123456789"); $x->babs(); ok 728 - $x = Math::BigFloat->new("-123456789"); $x->babs(); ok 729 - $x = Math::BigFloat->new("+123.456789"); $x->babs(); ok 730 - $x = Math::BigFloat->new("+123.456789"); $x->babs(); ok 731 - $x = Math::BigFloat->new("-123456.789"); $x->babs(); ok 732 - $x = Math::BigFloat->new("-123456.789"); $x->babs(); ok 733 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 734 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 735 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 736 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 737 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 738 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 739 - $x = Math::BigFloat->new("NaNfround"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 740 - $x = Math::BigFloat->new("NaNfround"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 741 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 742 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 743 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 744 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 745 - $x = Math::BigFloat->new("+10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 746 - $x = Math::BigFloat->new("+10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 747 - $x = Math::BigFloat->new("-10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 748 - $x = Math::BigFloat->new("-10123456789.123"); $Math::BigFloat::round_mode = "trunc"; $x->bround(5); ok 749 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9); ok 750 - $x = Math::BigFloat->new("+10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9); ok 751 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9); ok 752 - $x = Math::BigFloat->new("-10123456789"); $Math::BigFloat::round_mode = "trunc"; $x->bround(9); ok 753 - $x = Math::BigFloat->new("+101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6); ok 754 - $x = Math::BigFloat->new("+101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6); ok 755 - $x = Math::BigFloat->new("-101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6); ok 756 - $x = Math::BigFloat->new("-101234500"); $Math::BigFloat::round_mode = "trunc"; $x->bround(6); ok 757 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 758 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 759 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 760 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 761 - $x = Math::BigFloat->new("+20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 762 - $x = Math::BigFloat->new("+20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 763 - $x = Math::BigFloat->new("-20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 764 - $x = Math::BigFloat->new("-20123456789.123"); $Math::BigFloat::round_mode = "zero"; $x->bround(5); ok 765 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9); ok 766 - $x = Math::BigFloat->new("+20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9); ok 767 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9); ok 768 - $x = Math::BigFloat->new("-20123456789"); $Math::BigFloat::round_mode = "zero"; $x->bround(9); ok 769 - $x = Math::BigFloat->new("+201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6); ok 770 - $x = Math::BigFloat->new("+201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6); ok 771 - $x = Math::BigFloat->new("-201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6); ok 772 - $x = Math::BigFloat->new("-201234500"); $Math::BigFloat::round_mode = "zero"; $x->bround(6); ok 773 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 774 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 775 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 776 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 777 - $x = Math::BigFloat->new("+30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 778 - $x = Math::BigFloat->new("+30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 779 - $x = Math::BigFloat->new("-30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 780 - $x = Math::BigFloat->new("-30123456789.123"); $Math::BigFloat::round_mode = "+inf"; $x->bround(5); ok 781 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9); ok 782 - $x = Math::BigFloat->new("+30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9); ok 783 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9); ok 784 - $x = Math::BigFloat->new("-30123456789"); $Math::BigFloat::round_mode = "+inf"; $x->bround(9); ok 785 - $x = Math::BigFloat->new("+301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6); ok 786 - $x = Math::BigFloat->new("+301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6); ok 787 - $x = Math::BigFloat->new("-301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6); ok 788 - $x = Math::BigFloat->new("-301234500"); $Math::BigFloat::round_mode = "+inf"; $x->bround(6); ok 789 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 790 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 791 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 792 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 793 - $x = Math::BigFloat->new("+40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 794 - $x = Math::BigFloat->new("+40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 795 - $x = Math::BigFloat->new("-40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 796 - $x = Math::BigFloat->new("-40123456789.123"); $Math::BigFloat::round_mode = "-inf"; $x->bround(5); ok 797 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9); ok 798 - $x = Math::BigFloat->new("+40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9); ok 799 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9); ok 800 - $x = Math::BigFloat->new("-40123456789"); $Math::BigFloat::round_mode = "-inf"; $x->bround(9); ok 801 - $x = Math::BigFloat->new("+401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6); ok 802 - $x = Math::BigFloat->new("+401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6); ok 803 - $x = Math::BigFloat->new("-401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6); ok 804 - $x = Math::BigFloat->new("-401234500"); $Math::BigFloat::round_mode = "-inf"; $x->bround(6); ok 805 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 806 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 807 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 808 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 809 - $x = Math::BigFloat->new("+50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 810 - $x = Math::BigFloat->new("+50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 811 - $x = Math::BigFloat->new("-50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 812 - $x = Math::BigFloat->new("-50123456789.123"); $Math::BigFloat::round_mode = "odd"; $x->bround(5); ok 813 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9); ok 814 - $x = Math::BigFloat->new("+50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9); ok 815 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9); ok 816 - $x = Math::BigFloat->new("-50123456789"); $Math::BigFloat::round_mode = "odd"; $x->bround(9); ok 817 - $x = Math::BigFloat->new("+501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6); ok 818 - $x = Math::BigFloat->new("+501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6); ok 819 - $x = Math::BigFloat->new("-501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6); ok 820 - $x = Math::BigFloat->new("-501234500"); $Math::BigFloat::round_mode = "odd"; $x->bround(6); ok 821 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 822 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 823 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 824 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 825 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9); ok 826 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9); ok 827 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9); ok 828 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "even"; $x->bround(9); ok 829 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6); ok 830 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6); ok 831 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6); ok 832 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "even"; $x->bround(6); ok 833 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 834 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 835 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 836 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "even"; $x->bround(5); ok 837 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 838 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 839 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 840 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 841 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 842 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 843 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 844 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 845 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9); ok 846 - $x = Math::BigFloat->new("+60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9); ok 847 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9); ok 848 - $x = Math::BigFloat->new("-60123456789"); $Math::BigFloat::round_mode = "common"; $x->bround(9); ok 849 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 850 - $x = Math::BigFloat->new("+601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 851 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 852 - $x = Math::BigFloat->new("-601234500"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 853 - $x = Math::BigFloat->new("+601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 854 - $x = Math::BigFloat->new("+601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 855 - $x = Math::BigFloat->new("-601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 856 - $x = Math::BigFloat->new("-601234400"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 857 - $x = Math::BigFloat->new("+601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 858 - $x = Math::BigFloat->new("+601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 859 - $x = Math::BigFloat->new("-601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 860 - $x = Math::BigFloat->new("-601234600"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 861 - $x = Math::BigFloat->new("+601234300"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 862 - $x = Math::BigFloat->new("+601234300"); $Math::BigFloat::round_mode = "common"; $x->bround(6); ok 863 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 864 - $x = Math::BigFloat->new("+60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 865 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 866 - $x = Math::BigFloat->new("-60123456789.0123"); $Math::BigFloat::round_mode = "common"; $x->bround(5); ok 867 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 868 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 869 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 870 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 871 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 872 - $x = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 873 - $x = Math::BigFloat->new("NaNffround"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 874 - $x = Math::BigFloat->new("NaNffround"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(5); ok 875 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 876 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 877 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 878 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 879 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 880 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 881 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 882 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 883 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 884 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 885 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 886 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 887 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 888 - $x = Math::BigFloat->new("+1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 889 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 890 - $x = Math::BigFloat->new("+1.234"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 891 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 892 - $x = Math::BigFloat->new("+1.2345"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 893 - $x = Math::BigFloat->new("-1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 894 - $x = Math::BigFloat->new("-1.23"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 895 - $x = Math::BigFloat->new("+1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 896 - $x = Math::BigFloat->new("+1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 897 - $x = Math::BigFloat->new("-1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 898 - $x = Math::BigFloat->new("-1.27"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 899 - $x = Math::BigFloat->new("+1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 900 - $x = Math::BigFloat->new("+1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 901 - $x = Math::BigFloat->new("-1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 902 - $x = Math::BigFloat->new("-1.25"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 903 - $x = Math::BigFloat->new("+1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 904 - $x = Math::BigFloat->new("+1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 905 - $x = Math::BigFloat->new("-1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 906 - $x = Math::BigFloat->new("-1.35"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 907 - $x = Math::BigFloat->new("-0.0061234567890"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 908 - $x = Math::BigFloat->new("-0.0061234567890"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 909 - $x = Math::BigFloat->new("-0.0061"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 910 - $x = Math::BigFloat->new("-0.0061"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 911 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 912 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 913 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 914 - $x = Math::BigFloat->new("-0.00612"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 915 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 916 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-1); ok 917 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 918 - $x = Math::BigFloat->new("-0.006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 919 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 920 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-2); ok 921 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 922 - $x = Math::BigFloat->new("-0.0006"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 923 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-3); ok 924 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-4); ok 925 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(-5); ok 926 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 927 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 928 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 929 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 930 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 931 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 932 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 933 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "trunc"; $x->bfround(0); ok 934 - $x = Math::BigFloat->new("+2.23"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 935 - $x = Math::BigFloat->new("-2.23"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 936 - $x = Math::BigFloat->new("+2.27"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 937 - $x = Math::BigFloat->new("-2.27"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 938 - $x = Math::BigFloat->new("+2.25"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 939 - $x = Math::BigFloat->new("-2.25"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 940 - $x = Math::BigFloat->new("+2.35"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 941 - $x = Math::BigFloat->new("-2.35"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 942 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 943 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-1); ok 944 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-2); ok 945 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-3); ok 946 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-4); ok 947 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "zero"; $x->bfround(-5); ok 948 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 949 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 950 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 951 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 952 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 953 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 954 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 955 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "zero"; $x->bfround(0); ok 956 - $x = Math::BigFloat->new("+3.23"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 957 - $x = Math::BigFloat->new("-3.23"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 958 - $x = Math::BigFloat->new("+3.27"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 959 - $x = Math::BigFloat->new("-3.27"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 960 - $x = Math::BigFloat->new("+3.25"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 961 - $x = Math::BigFloat->new("-3.25"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 962 - $x = Math::BigFloat->new("+3.35"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 963 - $x = Math::BigFloat->new("-3.35"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 964 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 965 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-1); ok 966 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-2); ok 967 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-3); ok 968 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-4); ok 969 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(-5); ok 970 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 971 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 972 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 973 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 974 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 975 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 976 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 977 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "+inf"; $x->bfround(0); ok 978 - $x = Math::BigFloat->new("+4.23"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 979 - $x = Math::BigFloat->new("-4.23"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 980 - $x = Math::BigFloat->new("+4.27"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 981 - $x = Math::BigFloat->new("-4.27"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 982 - $x = Math::BigFloat->new("+4.25"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 983 - $x = Math::BigFloat->new("-4.25"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 984 - $x = Math::BigFloat->new("+4.35"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 985 - $x = Math::BigFloat->new("-4.35"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 986 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 987 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-1); ok 988 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-2); ok 989 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-3); ok 990 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-4); ok 991 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(-5); ok 992 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 993 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 994 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 995 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 996 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 997 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 998 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 999 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "-inf"; $x->bfround(0); ok 1000 - $x = Math::BigFloat->new("+5.23"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1001 - $x = Math::BigFloat->new("-5.23"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1002 - $x = Math::BigFloat->new("+5.27"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1003 - $x = Math::BigFloat->new("-5.27"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1004 - $x = Math::BigFloat->new("+5.25"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1005 - $x = Math::BigFloat->new("-5.25"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1006 - $x = Math::BigFloat->new("+5.35"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1007 - $x = Math::BigFloat->new("-5.35"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1008 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1009 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-1); ok 1010 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-2); ok 1011 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-3); ok 1012 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-4); ok 1013 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "odd"; $x->bfround(-5); ok 1014 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1015 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1016 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1017 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1018 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1019 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1020 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1021 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "odd"; $x->bfround(0); ok 1022 - $x = Math::BigFloat->new("+6.23"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1023 - $x = Math::BigFloat->new("-6.23"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1024 - $x = Math::BigFloat->new("+6.27"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1025 - $x = Math::BigFloat->new("-6.27"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1026 - $x = Math::BigFloat->new("+6.25"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1027 - $x = Math::BigFloat->new("-6.25"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1028 - $x = Math::BigFloat->new("+6.35"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1029 - $x = Math::BigFloat->new("-6.35"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1030 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1031 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-1); ok 1032 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-2); ok 1033 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-3); ok 1034 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-4); ok 1035 - $x = Math::BigFloat->new("-0.0065"); $Math::BigFloat::round_mode = "even"; $x->bfround(-5); ok 1036 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1037 - $x = Math::BigFloat->new("0.05"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1038 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1039 - $x = Math::BigFloat->new("0.5"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1040 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1041 - $x = Math::BigFloat->new("0.51"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1042 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1043 - $x = Math::BigFloat->new("0.41"); $Math::BigFloat::round_mode = "even"; $x->bfround(0); ok 1044 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-3); ok 1045 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-3); ok 1046 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-4); ok 1047 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-4); ok 1048 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-5); ok 1049 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-5); ok 1050 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-6); ok 1051 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-6); ok 1052 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-7); ok 1053 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-7); ok 1054 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-8); ok 1055 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-8); ok 1056 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-9); ok 1057 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-9); ok 1058 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-12); ok 1059 - $x = Math::BigFloat->new("0.01234567"); $Math::BigFloat::round_mode = "even"; $x->bfround(-12); ok 1060 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("bcmpNaN"); $x->bcmp($y); ok 1061 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("+0"); $x->bcmp($y); ok 1062 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("bcmpNaN"); $x->bcmp($y); ok 1063 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x->bcmp($y); ok 1064 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x->bcmp($y); ok 1065 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x->bcmp($y); ok 1066 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x->bcmp($y); ok 1067 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x->bcmp($y); ok 1068 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x->bcmp($y); ok 1069 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x->bcmp($y); ok 1070 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x->bcmp($y); ok 1071 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x->bcmp($y); ok 1072 - $x = Math::BigFloat->new("-1.1"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1073 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1.1"); $x->bcmp($y); ok 1074 - $x = Math::BigFloat->new("+1.1"); $y = Math::BigFloat->new("+0"); $x->bcmp($y); ok 1075 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1.1"); $x->bcmp($y); ok 1076 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+123"); $x->bcmp($y); ok 1077 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+12"); $x->bcmp($y); ok 1078 - $x = Math::BigFloat->new("+12"); $y = Math::BigFloat->new("+123"); $x->bcmp($y); ok 1079 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-123"); $x->bcmp($y); ok 1080 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-12"); $x->bcmp($y); ok 1081 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("-123"); $x->bcmp($y); ok 1082 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+124"); $x->bcmp($y); ok 1083 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+123"); $x->bcmp($y); ok 1084 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-124"); $x->bcmp($y); ok 1085 - $x = Math::BigFloat->new("-124"); $y = Math::BigFloat->new("-123"); $x->bcmp($y); ok 1086 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.01"); $x->bcmp($y); ok 1087 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y); ok 1088 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001"); $x->bcmp($y); ok 1089 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.1"); $x->bcmp($y); ok 1090 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1091 - $x = Math::BigFloat->new("0.00001"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1092 - $x = Math::BigFloat->new("-0.0001"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1093 - $x = Math::BigFloat->new("-0.1"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1094 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001234"); $x->bcmp($y); ok 1095 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001234"); $x->bcmp($y); ok 1096 - $x = Math::BigFloat->new("0.0001234"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1097 - $x = Math::BigFloat->new("-0.0001234"); $y = Math::BigFloat->new("0"); $x->bcmp($y); ok 1098 - $x = Math::BigFloat->new("0.0001"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y); ok 1099 - $x = Math::BigFloat->new("0.0005"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y); ok 1100 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y); ok 1101 - $x = Math::BigFloat->new("0.001"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y); ok 1102 - $x = Math::BigFloat->new("0.000001"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y); ok 1103 - $x = Math::BigFloat->new("0.00000123"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y); ok 1104 - $x = Math::BigFloat->new("0.00512"); $y = Math::BigFloat->new("0.0001"); $x->bcmp($y); ok 1105 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.000112"); $x->bcmp($y); ok 1106 - $x = Math::BigFloat->new("0.00123"); $y = Math::BigFloat->new("0.0005"); $x->bcmp($y); ok 1107 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("2"); $x->bcmp($y); ok 1108 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.5"); $x->bcmp($y); ok 1109 - $x = Math::BigFloat->new("1.54321"); $y = Math::BigFloat->new("234"); $x->bcmp($y); ok 1110 - $x = Math::BigFloat->new("234"); $y = Math::BigFloat->new("1.54321"); $x->bcmp($y); ok 1111 - $x = Math::BigFloat->new("1e1234567890987654321"); $y = Math::BigFloat->new("1e1234567890987654320"); $x->bcmp($y); ok 1112 - $x = Math::BigFloat->new("1e-1234567890987654321"); $y = Math::BigFloat->new("1e-1234567890987654320"); $x->bcmp($y); ok 1113 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5432112345"); $x->bcmp($y); ok 1114 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("5432112345"); $x->bcmp($y); ok 1115 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5432112345"); $x->bcmp($y); ok 1116 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-5432112345"); $x->bcmp($y); ok 1117 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("54321.12345"); $x->bcmp($y); ok 1118 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("54321.12345"); $x->bcmp($y); ok 1119 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bcmp($y); ok 1120 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bcmp($y); ok 1121 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x->bcmp($y); ok 1122 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x->bcmp($y); ok 1123 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x->bcmp($y); ok 1124 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x->bcmp($y); ok 1125 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaN"); $x->bcmp($y); ok 1126 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $x->bcmp($y); ok 1127 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaN"); $x->bcmp($y); ok 1128 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("-inf"); $x->bcmp($y); ok 1129 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("bcmpNaN"); $x->bacmp($y); ok 1130 - $x = Math::BigFloat->new("bcmpNaN"); $y = Math::BigFloat->new("+0"); $x->bacmp($y); ok 1131 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("bcmpNaN"); $x->bacmp($y); ok 1132 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x->bacmp($y); ok 1133 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x->bacmp($y); ok 1134 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x->bacmp($y); ok 1135 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x->bacmp($y); ok 1136 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x->bacmp($y); ok 1137 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x->bacmp($y); ok 1138 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x->bacmp($y); ok 1139 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x->bacmp($y); ok 1140 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x->bacmp($y); ok 1141 - $x = Math::BigFloat->new("-1.1"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1142 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1.1"); $x->bacmp($y); ok 1143 - $x = Math::BigFloat->new("+1.1"); $y = Math::BigFloat->new("+0"); $x->bacmp($y); ok 1144 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1.1"); $x->bacmp($y); ok 1145 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+123"); $x->bacmp($y); ok 1146 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+12"); $x->bacmp($y); ok 1147 - $x = Math::BigFloat->new("+12"); $y = Math::BigFloat->new("+123"); $x->bacmp($y); ok 1148 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-123"); $x->bacmp($y); ok 1149 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-12"); $x->bacmp($y); ok 1150 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("-123"); $x->bacmp($y); ok 1151 - $x = Math::BigFloat->new("+123"); $y = Math::BigFloat->new("+124"); $x->bacmp($y); ok 1152 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+123"); $x->bacmp($y); ok 1153 - $x = Math::BigFloat->new("-123"); $y = Math::BigFloat->new("-124"); $x->bacmp($y); ok 1154 - $x = Math::BigFloat->new("-124"); $y = Math::BigFloat->new("-123"); $x->bacmp($y); ok 1155 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.01"); $x->bacmp($y); ok 1156 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y); ok 1157 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001"); $x->bacmp($y); ok 1158 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.1"); $x->bacmp($y); ok 1159 - $x = Math::BigFloat->new("0.1"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1160 - $x = Math::BigFloat->new("0.00001"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1161 - $x = Math::BigFloat->new("-0.0001"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1162 - $x = Math::BigFloat->new("-0.1"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1163 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0.0001234"); $x->bacmp($y); ok 1164 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-0.0001234"); $x->bacmp($y); ok 1165 - $x = Math::BigFloat->new("0.0001234"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1166 - $x = Math::BigFloat->new("-0.0001234"); $y = Math::BigFloat->new("0"); $x->bacmp($y); ok 1167 - $x = Math::BigFloat->new("0.0001"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y); ok 1168 - $x = Math::BigFloat->new("0.0005"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y); ok 1169 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y); ok 1170 - $x = Math::BigFloat->new("0.001"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y); ok 1171 - $x = Math::BigFloat->new("0.000001"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y); ok 1172 - $x = Math::BigFloat->new("0.00000123"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y); ok 1173 - $x = Math::BigFloat->new("0.00512"); $y = Math::BigFloat->new("0.0001"); $x->bacmp($y); ok 1174 - $x = Math::BigFloat->new("0.005"); $y = Math::BigFloat->new("0.000112"); $x->bacmp($y); ok 1175 - $x = Math::BigFloat->new("0.00123"); $y = Math::BigFloat->new("0.0005"); $x->bacmp($y); ok 1176 - $x = Math::BigFloat->new("1.5"); $y = Math::BigFloat->new("2"); $x->bacmp($y); ok 1177 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.5"); $x->bacmp($y); ok 1178 - $x = Math::BigFloat->new("1.54321"); $y = Math::BigFloat->new("234"); $x->bacmp($y); ok 1179 - $x = Math::BigFloat->new("234"); $y = Math::BigFloat->new("1.54321"); $x->bacmp($y); ok 1180 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5432112345"); $x->bacmp($y); ok 1181 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("5432112345"); $x->bacmp($y); ok 1182 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5432112345"); $x->bacmp($y); ok 1183 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-5432112345"); $x->bacmp($y); ok 1184 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("54321.12345"); $x->bacmp($y); ok 1185 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("54321.12345"); $x->bacmp($y); ok 1186 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bacmp($y); ok 1187 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-54321.12345"); $x->bacmp($y); ok 1188 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x->bacmp($y); ok 1189 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y); ok 1190 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y); ok 1191 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x->bacmp($y); ok 1192 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("inf"); $x->bacmp($y); ok 1193 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("inf"); $x->bacmp($y); ok 1194 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y); ok 1195 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y); ok 1196 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("bacmpNaN"); $x->bacmp($y); ok 1197 - $x = Math::BigFloat->new("bacmpNaN"); $y = Math::BigFloat->new("inf"); $x->bacmp($y); ok 1198 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("bacmpNaN"); $x->bacmp($y); ok 1199 - $x = Math::BigFloat->new("bacmpNaN"); $y = Math::BigFloat->new("-inf"); $x->bacmp($y); ok 1200 - $x = Math::BigFloat->new("bdecNaN"); --$x; ok 1201 - $x = Math::BigFloat->new("bdecNaN"); --$x; ok 1202 - $x = Math::BigFloat->new("+inf"); --$x; ok 1203 - $x = Math::BigFloat->new("+inf"); --$x; ok 1204 - $x = Math::BigFloat->new("-inf"); --$x; ok 1205 - $x = Math::BigFloat->new("-inf"); --$x; ok 1206 - $x = Math::BigFloat->new("+0"); --$x; ok 1207 - $x = Math::BigFloat->new("+0"); --$x; ok 1208 - $x = Math::BigFloat->new("+1"); --$x; ok 1209 - $x = Math::BigFloat->new("+1"); --$x; ok 1210 - $x = Math::BigFloat->new("-1"); --$x; ok 1211 - $x = Math::BigFloat->new("-1"); --$x; ok 1212 - $x = Math::BigFloat->new("1.23"); --$x; ok 1213 - $x = Math::BigFloat->new("1.23"); --$x; ok 1214 - $x = Math::BigFloat->new("-1.23"); --$x; ok 1215 - $x = Math::BigFloat->new("-1.23"); --$x; ok 1216 - $x = Math::BigFloat->new("100"); --$x; ok 1217 - $x = Math::BigFloat->new("100"); --$x; ok 1218 - $x = Math::BigFloat->new("101"); --$x; ok 1219 - $x = Math::BigFloat->new("101"); --$x; ok 1220 - $x = Math::BigFloat->new("-100"); --$x; ok 1221 - $x = Math::BigFloat->new("-100"); --$x; ok 1222 - $x = Math::BigFloat->new("-99"); --$x; ok 1223 - $x = Math::BigFloat->new("-99"); --$x; ok 1224 - $x = Math::BigFloat->new("-98"); --$x; ok 1225 - $x = Math::BigFloat->new("-98"); --$x; ok 1226 - $x = Math::BigFloat->new("99"); --$x; ok 1227 - $x = Math::BigFloat->new("99"); --$x; ok 1228 - $x = Math::BigFloat->new("bincNaN"); ++$x; ok 1229 - $x = Math::BigFloat->new("bincNaN"); ++$x; ok 1230 - $x = Math::BigFloat->new("+inf"); ++$x; ok 1231 - $x = Math::BigFloat->new("+inf"); ++$x; ok 1232 - $x = Math::BigFloat->new("-inf"); ++$x; ok 1233 - $x = Math::BigFloat->new("-inf"); ++$x; ok 1234 - $x = Math::BigFloat->new("+0"); ++$x; ok 1235 - $x = Math::BigFloat->new("+0"); ++$x; ok 1236 - $x = Math::BigFloat->new("+1"); ++$x; ok 1237 - $x = Math::BigFloat->new("+1"); ++$x; ok 1238 - $x = Math::BigFloat->new("-1"); ++$x; ok 1239 - $x = Math::BigFloat->new("-1"); ++$x; ok 1240 - $x = Math::BigFloat->new("1.23"); ++$x; ok 1241 - $x = Math::BigFloat->new("1.23"); ++$x; ok 1242 - $x = Math::BigFloat->new("-1.23"); ++$x; ok 1243 - $x = Math::BigFloat->new("-1.23"); ++$x; ok 1244 - $x = Math::BigFloat->new("100"); ++$x; ok 1245 - $x = Math::BigFloat->new("100"); ++$x; ok 1246 - $x = Math::BigFloat->new("-100"); ++$x; ok 1247 - $x = Math::BigFloat->new("-100"); ++$x; ok 1248 - $x = Math::BigFloat->new("-99"); ++$x; ok 1249 - $x = Math::BigFloat->new("-99"); ++$x; ok 1250 - $x = Math::BigFloat->new("-101"); ++$x; ok 1251 - $x = Math::BigFloat->new("-101"); ++$x; ok 1252 - $x = Math::BigFloat->new("99"); ++$x; ok 1253 - $x = Math::BigFloat->new("99"); ++$x; ok 1254 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x + $y; ok 1255 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x + $y; ok 1256 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1257 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1258 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x + $y; ok 1259 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x + $y; ok 1260 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x + $y; ok 1261 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x + $y; ok 1262 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1263 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1264 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1265 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1266 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x + $y; ok 1267 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x + $y; ok 1268 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1269 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1270 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1271 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x + $y; ok 1272 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y; ok 1273 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y; ok 1274 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y; ok 1275 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x + $y; ok 1276 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1277 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1278 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1279 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1280 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1281 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1282 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1283 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1284 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1285 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x + $y; ok 1286 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1287 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1288 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1289 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1290 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1291 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1292 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1293 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1294 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1295 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1296 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1297 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1298 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1299 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1300 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1301 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1302 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1303 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1304 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1305 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1306 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1307 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1308 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1309 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1310 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1311 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1312 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1313 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1314 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1315 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x + $y; ok 1316 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1317 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1318 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1319 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1320 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1321 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1322 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1323 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1324 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1325 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1326 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1327 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1328 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1329 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1330 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1331 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1332 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1333 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1334 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1335 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x + $y; ok 1336 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y; ok 1337 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y; ok 1338 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y; ok 1339 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x + $y; ok 1340 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y; ok 1341 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y; ok 1342 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y; ok 1343 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x + $y; ok 1344 - $x = Math::BigFloat->new("0.001234"); $y = Math::BigFloat->new("0.0001234"); $x + $y; ok 1345 - $x = Math::BigFloat->new("0.001234"); $y = Math::BigFloat->new("0.0001234"); $x + $y; ok 1346 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x - $y; ok 1347 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x - $y; ok 1348 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1349 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1350 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x - $y; ok 1351 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x - $y; ok 1352 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x - $y; ok 1353 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x - $y; ok 1354 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1355 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1356 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1357 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1358 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x - $y; ok 1359 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x - $y; ok 1360 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1361 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1362 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1363 - $x = Math::BigFloat->new("baddNaN"); $y = Math::BigFloat->new("+inf"); $x - $y; ok 1364 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y; ok 1365 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y; ok 1366 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y; ok 1367 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("baddNaN"); $x - $y; ok 1368 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1369 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1370 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1371 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1372 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1373 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1374 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1375 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1376 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1377 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x - $y; ok 1378 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1379 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1380 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1381 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1382 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1383 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1384 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1385 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1386 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1387 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1388 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1389 - $x = Math::BigFloat->new("+99"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1390 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1391 - $x = Math::BigFloat->new("+999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1392 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1393 - $x = Math::BigFloat->new("+9999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1394 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1395 - $x = Math::BigFloat->new("+99999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1396 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1397 - $x = Math::BigFloat->new("+999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1398 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1399 - $x = Math::BigFloat->new("+9999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1400 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1401 - $x = Math::BigFloat->new("+99999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1402 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1403 - $x = Math::BigFloat->new("+999999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1404 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1405 - $x = Math::BigFloat->new("+9999999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1406 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1407 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+1"); $x - $y; ok 1408 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1409 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1410 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1411 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1412 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1413 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1414 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1415 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1416 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1417 - $x = Math::BigFloat->new("+100000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1418 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1419 - $x = Math::BigFloat->new("+1000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1420 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1421 - $x = Math::BigFloat->new("+10000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1422 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1423 - $x = Math::BigFloat->new("+100000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1424 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1425 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1426 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1427 - $x = Math::BigFloat->new("+10000000000"); $y = Math::BigFloat->new("-1"); $x - $y; ok 1428 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y; ok 1429 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y; ok 1430 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y; ok 1431 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("+987654321"); $x - $y; ok 1432 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y; ok 1433 - $x = Math::BigFloat->new("-123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y; ok 1434 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y; ok 1435 - $x = Math::BigFloat->new("+123456789"); $y = Math::BigFloat->new("-987654321"); $x - $y; ok 1436 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1437 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1438 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1439 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1440 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1441 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1442 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("abc"); $x->bmuladd($y, $z); ok 1443 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("abc"); $x->bmuladd($y, $z); ok 1444 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1445 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1446 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1447 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1448 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1449 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1450 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1451 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1452 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1453 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1454 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1455 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1456 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1457 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("+inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1458 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1459 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1460 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1461 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1462 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1463 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1464 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1465 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1466 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1467 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1468 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1469 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1470 - $x = Math::BigFloat->new("123456789123456789"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1471 - $x = Math::BigFloat->new("123456789123456789"); $y = Math::BigFloat->new("0"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1472 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("123456789123456789"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1473 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("123456789123456789"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1474 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1475 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1476 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1477 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1478 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1479 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1480 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1481 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1482 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1483 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1484 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1485 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1486 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1487 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1488 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1489 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1490 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1491 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1492 - $x = Math::BigFloat->new("111"); $y = Math::BigFloat->new("111"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1493 - $x = Math::BigFloat->new("111"); $y = Math::BigFloat->new("111"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1494 - $x = Math::BigFloat->new("10101"); $y = Math::BigFloat->new("10101"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1495 - $x = Math::BigFloat->new("10101"); $y = Math::BigFloat->new("10101"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1496 - $x = Math::BigFloat->new("1001001"); $y = Math::BigFloat->new("1001001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1497 - $x = Math::BigFloat->new("1001001"); $y = Math::BigFloat->new("1001001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1498 - $x = Math::BigFloat->new("100010001"); $y = Math::BigFloat->new("100010001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1499 - $x = Math::BigFloat->new("100010001"); $y = Math::BigFloat->new("100010001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1500 - $x = Math::BigFloat->new("10000100001"); $y = Math::BigFloat->new("10000100001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1501 - $x = Math::BigFloat->new("10000100001"); $y = Math::BigFloat->new("10000100001"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1502 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1503 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1504 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1505 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1506 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1507 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1508 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1509 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1510 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1511 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1512 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1513 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1514 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1515 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1516 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1517 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1518 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1519 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("0"); $x->bmuladd($y, $z); ok 1520 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1521 - $x = Math::BigFloat->new("11111111111"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1522 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1523 - $x = Math::BigFloat->new("22222222222"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1524 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1525 - $x = Math::BigFloat->new("33333333333"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1526 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1527 - $x = Math::BigFloat->new("44444444444"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1528 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1529 - $x = Math::BigFloat->new("55555555555"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1530 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1531 - $x = Math::BigFloat->new("66666666666"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1532 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1533 - $x = Math::BigFloat->new("77777777777"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1534 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1535 - $x = Math::BigFloat->new("88888888888"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1536 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1537 - $x = Math::BigFloat->new("99999999999"); $y = Math::BigFloat->new("9"); $z = Math::BigFloat->new("1"); $x->bmuladd($y, $z); ok 1538 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1539 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1540 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1541 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1542 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1543 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1544 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1545 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("-5"); $x->bmuladd($y, $z); ok 1546 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z); ok 1547 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z); ok 1548 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z); ok 1549 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-4"); $z = Math::BigFloat->new("5"); $x->bmuladd($y, $z); ok 1550 - $x = Math::BigFloat->new("9999999999999999999"); $y = Math::BigFloat->new("10000000000000000000"); $z = Math::BigFloat->new("1234567890"); $x->bmuladd($y, $z); ok 1551 - $x = Math::BigFloat->new("9999999999999999999"); $y = Math::BigFloat->new("10000000000000000000"); $z = Math::BigFloat->new("1234567890"); $x->bmuladd($y, $z); ok 1552 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("5.7"); $z = Math::BigFloat->new("8.9"); $x->bmuladd($y, $z); ok 1553 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("5.7"); $z = Math::BigFloat->new("8.9"); $x->bmuladd($y, $z); ok 1554 - $x = Math::BigFloat->new("-3.2"); $y = Math::BigFloat->new("5.197"); $z = Math::BigFloat->new("6.05"); $x->bmuladd($y, $z); ok 1555 - $x = Math::BigFloat->new("-3.2"); $y = Math::BigFloat->new("5.197"); $z = Math::BigFloat->new("6.05"); $x->bmuladd($y, $z); ok 1556 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("8"); $x->bmodpow($y, $z); ok 1557 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("8"); $x->bmodpow($y, $z); ok 1558 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z); ok 1559 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z); ok 1560 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z); ok 1561 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("4"); $z = Math::BigFloat->new("7"); $x->bmodpow($y, $z); ok 1562 - $x = Math::BigFloat->new("77777"); $y = Math::BigFloat->new("777"); $z = Math::BigFloat->new("123456789"); $x->bmodpow($y, $z); ok 1563 - $x = Math::BigFloat->new("77777"); $y = Math::BigFloat->new("777"); $z = Math::BigFloat->new("123456789"); $x->bmodpow($y, $z); ok 1564 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("6.2"); $z = Math::BigFloat->new("5.2"); $x->bmodpow($y, $z); ok 1565 - $x = Math::BigFloat->new("3.2"); $y = Math::BigFloat->new("6.2"); $z = Math::BigFloat->new("5.2"); $x->bmodpow($y, $z); ok 1566 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x * $y; ok 1567 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x * $y; ok 1568 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1569 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1570 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x * $y; ok 1571 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("abc"); $x * $y; ok 1572 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y; ok 1573 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y; ok 1574 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y; ok 1575 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaNmul"); $x * $y; ok 1576 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1577 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1578 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1579 - $x = Math::BigFloat->new("NaNmul"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1580 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1581 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1582 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1583 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1584 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1585 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1586 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1587 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1588 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.34"); $x * $y; ok 1589 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("123.34"); $x * $y; ok 1590 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.34"); $x * $y; ok 1591 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("-123.34"); $x * $y; ok 1592 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.34"); $x * $y; ok 1593 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("123.34"); $x * $y; ok 1594 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.34"); $x * $y; ok 1595 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-123.34"); $x * $y; ok 1596 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1597 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1598 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1599 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("+inf"); $x * $y; ok 1600 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1601 - $x = Math::BigFloat->new("123.34"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1602 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1603 - $x = Math::BigFloat->new("-123.34"); $y = Math::BigFloat->new("-inf"); $x * $y; ok 1604 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1605 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1606 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x * $y; ok 1607 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $x * $y; ok 1608 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1609 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1610 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x * $y; ok 1611 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $x * $y; ok 1612 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1613 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1614 - $x = Math::BigFloat->new("+123456789123456789"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1615 - $x = Math::BigFloat->new("+123456789123456789"); $y = Math::BigFloat->new("+0"); $x * $y; ok 1616 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+123456789123456789"); $x * $y; ok 1617 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+123456789123456789"); $x * $y; ok 1618 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x * $y; ok 1619 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x * $y; ok 1620 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x * $y; ok 1621 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $x * $y; ok 1622 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x * $y; ok 1623 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $x * $y; ok 1624 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x * $y; ok 1625 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $x * $y; ok 1626 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $x * $y; ok 1627 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+3"); $x * $y; ok 1628 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $x * $y; ok 1629 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("+3"); $x * $y; ok 1630 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $x * $y; ok 1631 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("-3"); $x * $y; ok 1632 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x * $y; ok 1633 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x * $y; ok 1634 - $x = Math::BigFloat->new("+111"); $y = Math::BigFloat->new("+111"); $x * $y; ok 1635 - $x = Math::BigFloat->new("+111"); $y = Math::BigFloat->new("+111"); $x * $y; ok 1636 - $x = Math::BigFloat->new("+10101"); $y = Math::BigFloat->new("+10101"); $x * $y; ok 1637 - $x = Math::BigFloat->new("+10101"); $y = Math::BigFloat->new("+10101"); $x * $y; ok 1638 - $x = Math::BigFloat->new("+1001001"); $y = Math::BigFloat->new("+1001001"); $x * $y; ok 1639 - $x = Math::BigFloat->new("+1001001"); $y = Math::BigFloat->new("+1001001"); $x * $y; ok 1640 - $x = Math::BigFloat->new("+100010001"); $y = Math::BigFloat->new("+100010001"); $x * $y; ok 1641 - $x = Math::BigFloat->new("+100010001"); $y = Math::BigFloat->new("+100010001"); $x * $y; ok 1642 - $x = Math::BigFloat->new("+10000100001"); $y = Math::BigFloat->new("+10000100001"); $x * $y; ok 1643 - $x = Math::BigFloat->new("+10000100001"); $y = Math::BigFloat->new("+10000100001"); $x * $y; ok 1644 - $x = Math::BigFloat->new("+11111111111"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1645 - $x = Math::BigFloat->new("+11111111111"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1646 - $x = Math::BigFloat->new("+22222222222"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1647 - $x = Math::BigFloat->new("+22222222222"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1648 - $x = Math::BigFloat->new("+33333333333"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1649 - $x = Math::BigFloat->new("+33333333333"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1650 - $x = Math::BigFloat->new("+44444444444"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1651 - $x = Math::BigFloat->new("+44444444444"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1652 - $x = Math::BigFloat->new("+55555555555"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1653 - $x = Math::BigFloat->new("+55555555555"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1654 - $x = Math::BigFloat->new("+66666666666"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1655 - $x = Math::BigFloat->new("+66666666666"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1656 - $x = Math::BigFloat->new("+77777777777"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1657 - $x = Math::BigFloat->new("+77777777777"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1658 - $x = Math::BigFloat->new("+88888888888"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1659 - $x = Math::BigFloat->new("+88888888888"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1660 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1661 - $x = Math::BigFloat->new("+99999999999"); $y = Math::BigFloat->new("+9"); $x * $y; ok 1662 - $x = Math::BigFloat->new("6"); $y = Math::BigFloat->new("120"); $x * $y; ok 1663 - $x = Math::BigFloat->new("6"); $y = Math::BigFloat->new("120"); $x * $y; ok 1664 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("10000"); $x * $y; ok 1665 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("10000"); $x * $y; ok 1666 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1667 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1668 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("4"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1669 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("5"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1670 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1671 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1672 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1673 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("1"); $Math::BigFloat::round_mode = "even"; join(",", $x->bdiv($y)); ok 1674 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1675 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1676 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1677 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1678 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1679 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1680 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1681 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1682 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1683 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("abc"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1684 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1685 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1686 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1687 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1688 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1689 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1690 - $x = Math::BigFloat->new("+3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1691 - $x = Math::BigFloat->new("+3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1692 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1693 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1694 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1695 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1696 - $x = Math::BigFloat->new("-3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1697 - $x = Math::BigFloat->new("-3214"); $y = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1698 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1699 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1700 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1701 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1702 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1703 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1704 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1705 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1706 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+2"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1707 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("+2"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1708 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1709 - $x = Math::BigFloat->new("+2"); $y = Math::BigFloat->new("+1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1710 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1711 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1712 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1713 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1714 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("+5"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1715 - $x = Math::BigFloat->new("+10"); $y = Math::BigFloat->new("+5"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1716 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("+4"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1717 - $x = Math::BigFloat->new("+100"); $y = Math::BigFloat->new("+4"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1718 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("+8"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1719 - $x = Math::BigFloat->new("+1000"); $y = Math::BigFloat->new("+8"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1720 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("+16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1721 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("+16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1722 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1723 - $x = Math::BigFloat->new("+10000"); $y = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1724 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1725 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1726 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+99"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1727 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+99"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1728 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1729 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1730 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1731 - $x = Math::BigFloat->new("+999999999999"); $y = Math::BigFloat->new("+9999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1732 - $x = Math::BigFloat->new("+999999999999999"); $y = Math::BigFloat->new("+99999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1733 - $x = Math::BigFloat->new("+999999999999999"); $y = Math::BigFloat->new("+99999"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1734 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1735 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1736 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1737 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1738 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1739 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1740 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1741 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1742 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1743 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1744 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1745 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1746 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1747 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1748 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1749 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1750 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1751 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1752 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1753 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1754 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1755 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1756 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1757 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1758 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1759 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1760 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("25.024996000799840031993601279744051189762"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1761 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("25.024996000799840031993601279744051189762"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1762 - $x = Math::BigFloat->new("123456"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1763 - $x = Math::BigFloat->new("123456"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $Math::BigFloat::round_mode = "even"; $x / $y; ok 1764 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1765 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1766 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1767 - $x = Math::BigFloat->new("+2000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1768 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1769 - $x = Math::BigFloat->new("+3000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1770 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1771 - $x = Math::BigFloat->new("+4000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1772 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1773 - $x = Math::BigFloat->new("+5000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1774 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1775 - $x = Math::BigFloat->new("+6000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1776 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1777 - $x = Math::BigFloat->new("+7000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1778 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1779 - $x = Math::BigFloat->new("+8000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1780 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1781 - $x = Math::BigFloat->new("+9000000000"); $y = Math::BigFloat->new("+9"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1782 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1783 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1784 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1785 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1786 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1787 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1000"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1788 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10000"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1789 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("10000"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1790 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("504"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1791 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("504"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1792 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.987654321"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1793 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1.987654321"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1794 - $x = Math::BigFloat->new("123456789.123456789123456789123456789"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1795 - $x = Math::BigFloat->new("123456789.123456789123456789123456789"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1796 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1797 - $x = Math::BigFloat->new("+35500000"); $y = Math::BigFloat->new("+113"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1798 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1799 - $x = Math::BigFloat->new("+71000000"); $y = Math::BigFloat->new("+226"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1800 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1801 - $x = Math::BigFloat->new("+106500000"); $y = Math::BigFloat->new("+339"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1802 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1803 - $x = Math::BigFloat->new("+1000000000"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 20; $x / $y; ok 1804 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 1; $x / $y; ok 1805 - $x = Math::BigFloat->new("+124"); $y = Math::BigFloat->new("+3"); $Math::BigFloat::div_scale = 1; $x / $y; ok 1806 - $x = Math::BigFloat->new("123456789.1234"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 1; $x / $y; ok 1807 - $x = Math::BigFloat->new("123456789.1234"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 1; $x / $y; ok 1808 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("4"); $x % $y; ok 1809 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("4"); $x % $y; ok 1810 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("5"); $x % $y; ok 1811 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("5"); $x % $y; ok 1812 - $x = Math::BigFloat->new("+9000"); $y = Math::BigFloat->new("56"); $x % $y; ok 1813 - $x = Math::BigFloat->new("+9000"); $y = Math::BigFloat->new("56"); $x % $y; ok 1814 - $x = Math::BigFloat->new("+56"); $y = Math::BigFloat->new("9000"); $x % $y; ok 1815 - $x = Math::BigFloat->new("+56"); $y = Math::BigFloat->new("9000"); $x % $y; ok 1816 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1817 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1818 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1819 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1820 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1821 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1822 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1823 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1824 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1825 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1826 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1827 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1828 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("5"); $x % $y; ok 1829 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("5"); $x % $y; ok 1830 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5"); $x % $y; ok 1831 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("5"); $x % $y; ok 1832 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1833 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1834 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1835 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1836 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("5"); $x % $y; ok 1837 - $x = Math::BigFloat->new("5"); $y = Math::BigFloat->new("5"); $x % $y; ok 1838 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1839 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1840 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1841 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1842 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1843 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1844 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1845 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("inf"); $x % $y; ok 1846 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1847 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("-inf"); $x % $y; ok 1848 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("0"); $x % $y; ok 1849 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("0"); $x % $y; ok 1850 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("0"); $x % $y; ok 1851 - $x = Math::BigFloat->new("inf"); $y = Math::BigFloat->new("0"); $x % $y; ok 1852 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $x % $y; ok 1853 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("0"); $x % $y; ok 1854 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("0"); $x % $y; ok 1855 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("0"); $x % $y; ok 1856 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x % $y; ok 1857 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("0"); $x % $y; ok 1858 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x % $y; ok 1859 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("abc"); $x % $y; ok 1860 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("1"); $x % $y; ok 1861 - $x = Math::BigFloat->new("abc"); $y = Math::BigFloat->new("1"); $x % $y; ok 1862 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("abc"); $x % $y; ok 1863 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("abc"); $x % $y; ok 1864 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x % $y; ok 1865 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("1"); $x % $y; ok 1866 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("0"); $x % $y; ok 1867 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("0"); $x % $y; ok 1868 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1869 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1870 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $x % $y; ok 1871 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $x % $y; ok 1872 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1873 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1874 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1875 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1876 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1877 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1878 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1879 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1880 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x % $y; ok 1881 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("2"); $x % $y; ok 1882 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x % $y; ok 1883 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("1"); $x % $y; ok 1884 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1885 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1886 - $x = Math::BigFloat->new("2000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1887 - $x = Math::BigFloat->new("2000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1888 - $x = Math::BigFloat->new("3000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1889 - $x = Math::BigFloat->new("3000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1890 - $x = Math::BigFloat->new("4000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1891 - $x = Math::BigFloat->new("4000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1892 - $x = Math::BigFloat->new("5000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1893 - $x = Math::BigFloat->new("5000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1894 - $x = Math::BigFloat->new("6000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1895 - $x = Math::BigFloat->new("6000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1896 - $x = Math::BigFloat->new("7000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1897 - $x = Math::BigFloat->new("7000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1898 - $x = Math::BigFloat->new("8000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1899 - $x = Math::BigFloat->new("8000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1900 - $x = Math::BigFloat->new("9000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1901 - $x = Math::BigFloat->new("9000000000"); $y = Math::BigFloat->new("9"); $x % $y; ok 1902 - $x = Math::BigFloat->new("35500000"); $y = Math::BigFloat->new("113"); $x % $y; ok 1903 - $x = Math::BigFloat->new("35500000"); $y = Math::BigFloat->new("113"); $x % $y; ok 1904 - $x = Math::BigFloat->new("71000000"); $y = Math::BigFloat->new("226"); $x % $y; ok 1905 - $x = Math::BigFloat->new("71000000"); $y = Math::BigFloat->new("226"); $x % $y; ok 1906 - $x = Math::BigFloat->new("106500000"); $y = Math::BigFloat->new("339"); $x % $y; ok 1907 - $x = Math::BigFloat->new("106500000"); $y = Math::BigFloat->new("339"); $x % $y; ok 1908 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("3"); $x % $y; ok 1909 - $x = Math::BigFloat->new("1000000000"); $y = Math::BigFloat->new("3"); $x % $y; ok 1910 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("5"); $x % $y; ok 1911 - $x = Math::BigFloat->new("10"); $y = Math::BigFloat->new("5"); $x % $y; ok 1912 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("4"); $x % $y; ok 1913 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("4"); $x % $y; ok 1914 - $x = Math::BigFloat->new("1000"); $y = Math::BigFloat->new("8"); $x % $y; ok 1915 - $x = Math::BigFloat->new("1000"); $y = Math::BigFloat->new("8"); $x % $y; ok 1916 - $x = Math::BigFloat->new("10000"); $y = Math::BigFloat->new("16"); $x % $y; ok 1917 - $x = Math::BigFloat->new("10000"); $y = Math::BigFloat->new("16"); $x % $y; ok 1918 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9"); $x % $y; ok 1919 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9"); $x % $y; ok 1920 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("99"); $x % $y; ok 1921 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("99"); $x % $y; ok 1922 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("999"); $x % $y; ok 1923 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("999"); $x % $y; ok 1924 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9999"); $x % $y; ok 1925 - $x = Math::BigFloat->new("999999999999"); $y = Math::BigFloat->new("9999"); $x % $y; ok 1926 - $x = Math::BigFloat->new("999999999999999"); $y = Math::BigFloat->new("99999"); $x % $y; ok 1927 - $x = Math::BigFloat->new("999999999999999"); $y = Math::BigFloat->new("99999"); $x % $y; ok 1928 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("+5"); $x % $y; ok 1929 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("+5"); $x % $y; ok 1930 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1931 - $x = Math::BigFloat->new("+9"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1932 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1933 - $x = Math::BigFloat->new("-9"); $y = Math::BigFloat->new("-5"); $x % $y; ok 1934 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("3"); $x % $y; ok 1935 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("3"); $x % $y; ok 1936 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x % $y; ok 1937 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("3"); $x % $y; ok 1938 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x % $y; ok 1939 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("3"); $x % $y; ok 1940 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x % $y; ok 1941 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("3"); $x % $y; ok 1942 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1943 - $x = Math::BigFloat->new("-5"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1944 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1945 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1946 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1947 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1948 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1949 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("-3"); $x % $y; ok 1950 - $x = Math::BigFloat->new("4095"); $y = Math::BigFloat->new("4095"); $x % $y; ok 1951 - $x = Math::BigFloat->new("4095"); $y = Math::BigFloat->new("4095"); $x % $y; ok 1952 - $x = Math::BigFloat->new("100041000510123"); $y = Math::BigFloat->new("3"); $x % $y; ok 1953 - $x = Math::BigFloat->new("100041000510123"); $y = Math::BigFloat->new("3"); $x % $y; ok 1954 - $x = Math::BigFloat->new("152403346"); $y = Math::BigFloat->new("12345"); $x % $y; ok 1955 - $x = Math::BigFloat->new("152403346"); $y = Math::BigFloat->new("12345"); $x % $y; ok 1956 - $x = Math::BigFloat->new("87654321"); $y = Math::BigFloat->new("87654321"); $x % $y; ok 1957 - $x = Math::BigFloat->new("87654321"); $y = Math::BigFloat->new("87654321"); $x % $y; ok 1958 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("2.5"); $x % $y; ok 1959 - $x = Math::BigFloat->new("123"); $y = Math::BigFloat->new("2.5"); $x % $y; ok 1960 - $x = Math::BigFloat->new("1230"); $y = Math::BigFloat->new("2.5"); $x % $y; ok 1961 - $x = Math::BigFloat->new("1230"); $y = Math::BigFloat->new("2.5"); $x % $y; ok 1962 - $x = Math::BigFloat->new("123.4"); $y = Math::BigFloat->new("2.5"); $x % $y; ok 1963 - $x = Math::BigFloat->new("123.4"); $y = Math::BigFloat->new("2.5"); $x % $y; ok 1964 - $x = Math::BigFloat->new("123e1"); $y = Math::BigFloat->new("25"); $x % $y; ok 1965 - $x = Math::BigFloat->new("123e1"); $y = Math::BigFloat->new("25"); $x % $y; ok 1966 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1967 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1968 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1969 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("1"); $x % $y; ok 1970 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1971 - $x = Math::BigFloat->new("-2.1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1972 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1973 - $x = Math::BigFloat->new("2.1"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1974 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("1"); $x % $y; ok 1975 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("1"); $x % $y; ok 1976 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("1"); $x % $y; ok 1977 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("1"); $x % $y; ok 1978 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1979 - $x = Math::BigFloat->new("-3"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1980 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1981 - $x = Math::BigFloat->new("3"); $y = Math::BigFloat->new("-1"); $x % $y; ok 1982 - $x = Math::BigFloat->new("Nanfac"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1983 - $x = Math::BigFloat->new("Nanfac"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1984 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1985 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1986 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1987 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1988 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1989 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1990 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1991 - $x = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1992 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1993 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1994 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1995 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1996 - $x = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1997 - $x = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1998 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 1999 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2000 - $x = Math::BigFloat->new("5"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2001 - $x = Math::BigFloat->new("5"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2002 - $x = Math::BigFloat->new("6"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2003 - $x = Math::BigFloat->new("6"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2004 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2005 - $x = Math::BigFloat->new("10"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2006 - $x = Math::BigFloat->new("11"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2007 - $x = Math::BigFloat->new("11"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2008 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2009 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bfac(); ok 2010 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2011 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2012 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2013 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2014 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2015 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2016 - $x = Math::BigFloat->new("-123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2017 - $x = Math::BigFloat->new("-123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2018 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2019 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2020 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2021 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2022 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2023 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2024 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2025 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2026 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2027 - $x = Math::BigFloat->new("4"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2028 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2029 - $x = Math::BigFloat->new("9"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2030 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2031 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2032 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2033 - $x = Math::BigFloat->new("100"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2034 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2035 - $x = Math::BigFloat->new("123.456"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2036 - $x = Math::BigFloat->new("15241.38393"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2037 - $x = Math::BigFloat->new("15241.38393"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2038 - $x = Math::BigFloat->new("1.44"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2039 - $x = Math::BigFloat->new("1.44"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2040 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2041 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2042 - $x = Math::BigFloat->new("0.49"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2043 - $x = Math::BigFloat->new("0.49"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2044 - $x = Math::BigFloat->new("0.0049"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2045 - $x = Math::BigFloat->new("0.0049"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2046 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2047 - $x = Math::BigFloat->new("1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2048 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2049 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2050 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2051 - $x = Math::BigFloat->new("0"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2052 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2053 - $x = Math::BigFloat->new("-inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2054 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2055 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("NaN"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2056 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2057 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2058 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2059 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2060 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2061 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2062 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2063 - $x = Math::BigFloat->new("NaN"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2064 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2065 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2066 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2067 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("inf"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2068 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2069 - $x = Math::BigFloat->new("+0"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2070 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2071 - $x = Math::BigFloat->new("+1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2072 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2073 - $x = Math::BigFloat->new("-1"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2074 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2075 - $x = Math::BigFloat->new("-2"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2076 - $x = Math::BigFloat->new("-123.45"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2077 - $x = Math::BigFloat->new("-123.45"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2078 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2079 - $x = Math::BigFloat->new("+inf"); $y = Math::BigFloat->new("0"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2080 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2081 - $x = Math::BigFloat->new("12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2082 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2083 - $x = Math::BigFloat->new("-12"); $y = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2084 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2085 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2086 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2087 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2088 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2089 - $x = Math::BigFloat->new("8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2090 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2091 - $x = Math::BigFloat->new("-8"); $y = Math::BigFloat->new("3"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2092 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2093 - $x = Math::BigFloat->new("16"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2094 - $x = Math::BigFloat->new("81"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2095 - $x = Math::BigFloat->new("81"); $y = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->broot($y); ok 2096 - $x = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2097 - $x = Math::BigFloat->new("+0"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2098 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2099 - $x = Math::BigFloat->new("-1"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2100 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2101 - $x = Math::BigFloat->new("-2"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2102 - $x = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2103 - $x = Math::BigFloat->new("-16"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2104 - $x = Math::BigFloat->new("-123.45"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2105 - $x = Math::BigFloat->new("-123.45"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2106 - $x = Math::BigFloat->new("nanbsqrt"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2107 - $x = Math::BigFloat->new("nanbsqrt"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2108 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2109 - $x = Math::BigFloat->new("+inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2110 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2111 - $x = Math::BigFloat->new("-inf"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2112 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2113 - $x = Math::BigFloat->new("1"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2114 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2115 - $x = Math::BigFloat->new("2"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2116 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2117 - $x = Math::BigFloat->new("4"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2118 - $x = Math::BigFloat->new("9"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2119 - $x = Math::BigFloat->new("9"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2120 - $x = Math::BigFloat->new("16"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2121 - $x = Math::BigFloat->new("16"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2122 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2123 - $x = Math::BigFloat->new("100"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2124 - $x = Math::BigFloat->new("123.456"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2125 - $x = Math::BigFloat->new("123.456"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2126 - $x = Math::BigFloat->new("15241.38393"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2127 - $x = Math::BigFloat->new("15241.38393"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2128 - $x = Math::BigFloat->new("1.44"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2129 - $x = Math::BigFloat->new("1.44"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2130 - $x = Math::BigFloat->new("1.44E10"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2131 - $x = Math::BigFloat->new("1.44E10"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2132 - $x = Math::BigFloat->new("2e10"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2133 - $x = Math::BigFloat->new("2e10"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2134 - $x = Math::BigFloat->new("144e20"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2135 - $x = Math::BigFloat->new("144e20"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2136 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2137 - $x = Math::BigFloat->new("12"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2138 - $x = Math::BigFloat->new("0.49"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2139 - $x = Math::BigFloat->new("0.49"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2140 - $x = Math::BigFloat->new("0.0049"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2141 - $x = Math::BigFloat->new("0.0049"); $Math::BigFloat::div_scale = 40; $x->bsqrt(); ok 2142 - $x = Math::BigFloat->new("123"); $x->is_nan(); ok 2143 - $x = Math::BigFloat->new("abc"); $x->is_nan(); ok 2144 - $x = Math::BigFloat->new("NaN"); $x->is_nan(); ok 2145 - $x = Math::BigFloat->new("-123"); $x->is_nan(); ok 2146 - $x = Math::BigFloat->new("+inf"); $x->is_inf(""); ok 2147 - $x = Math::BigFloat->new("-inf"); $x->is_inf(""); ok 2148 - $x = Math::BigFloat->new("abc"); $x->is_inf(""); ok 2149 - $x = Math::BigFloat->new("1"); $x->is_inf(""); ok 2150 - $x = Math::BigFloat->new("NaN"); $x->is_inf(""); ok 2151 - $x = Math::BigFloat->new("-1"); $x->is_inf(""); ok 2152 - $x = Math::BigFloat->new("+inf"); $x->is_inf("-"); ok 2153 - $x = Math::BigFloat->new("+inf"); $x->is_inf("+"); ok 2154 - $x = Math::BigFloat->new("-inf"); $x->is_inf("-"); ok 2155 - $x = Math::BigFloat->new("-inf"); $x->is_inf("+"); ok 2156 - $x = Math::BigFloat->new("-inf"); $x->is_inf("-inf"); ok 2157 - $x = Math::BigFloat->new("-inf"); $x->is_inf("+inf"); ok 2158 - $x = Math::BigFloat->new("+inf"); $x->is_inf("-inf"); ok 2159 - $x = Math::BigFloat->new("+inf"); $x->is_inf("+inf"); ok 2160 - $x = Math::BigFloat->new("+iNfInItY"); $x->is_inf(""); ok 2161 - $x = Math::BigFloat->new("-InFiNiTy"); $x->is_inf(""); ok 2162 - $x = Math::BigFloat->new("abc"); $x->is_odd(); ok 2163 - $x = Math::BigFloat->new("0"); $x->is_odd(); ok 2164 - $x = Math::BigFloat->new("-1"); $x->is_odd(); ok 2165 - $x = Math::BigFloat->new("-3"); $x->is_odd(); ok 2166 - $x = Math::BigFloat->new("1"); $x->is_odd(); ok 2167 - $x = Math::BigFloat->new("3"); $x->is_odd(); ok 2168 - $x = Math::BigFloat->new("1000001"); $x->is_odd(); ok 2169 - $x = Math::BigFloat->new("1000002"); $x->is_odd(); ok 2170 - $x = Math::BigFloat->new("+inf"); $x->is_odd(); ok 2171 - $x = Math::BigFloat->new("-inf"); $x->is_odd(); ok 2172 - $x = Math::BigFloat->new("123.45"); $x->is_odd(); ok 2173 - $x = Math::BigFloat->new("-123.45"); $x->is_odd(); ok 2174 - $x = Math::BigFloat->new("2"); $x->is_odd(); ok 2175 - $x = Math::BigFloat->new("NaNis_int"); $x->is_int(); ok 2176 - $x = Math::BigFloat->new("0"); $x->is_int(); ok 2177 - $x = Math::BigFloat->new("1"); $x->is_int(); ok 2178 - $x = Math::BigFloat->new("2"); $x->is_int(); ok 2179 - $x = Math::BigFloat->new("-2"); $x->is_int(); ok 2180 - $x = Math::BigFloat->new("-1"); $x->is_int(); ok 2181 - $x = Math::BigFloat->new("-inf"); $x->is_int(); ok 2182 - $x = Math::BigFloat->new("+inf"); $x->is_int(); ok 2183 - $x = Math::BigFloat->new("123.4567"); $x->is_int(); ok 2184 - $x = Math::BigFloat->new("-0.1"); $x->is_int(); ok 2185 - $x = Math::BigFloat->new("-0.002"); $x->is_int(); ok 2186 - $x = Math::BigFloat->new("abc"); $x->is_even(); ok 2187 - $x = Math::BigFloat->new("0"); $x->is_even(); ok 2188 - $x = Math::BigFloat->new("-1"); $x->is_even(); ok 2189 - $x = Math::BigFloat->new("-3"); $x->is_even(); ok 2190 - $x = Math::BigFloat->new("1"); $x->is_even(); ok 2191 - $x = Math::BigFloat->new("3"); $x->is_even(); ok 2192 - $x = Math::BigFloat->new("1000001"); $x->is_even(); ok 2193 - $x = Math::BigFloat->new("1000002"); $x->is_even(); ok 2194 - $x = Math::BigFloat->new("2"); $x->is_even(); ok 2195 - $x = Math::BigFloat->new("+inf"); $x->is_even(); ok 2196 - $x = Math::BigFloat->new("-inf"); $x->is_even(); ok 2197 - $x = Math::BigFloat->new("123.456"); $x->is_even(); ok 2198 - $x = Math::BigFloat->new("-123.456"); $x->is_even(); ok 2199 - $x = Math::BigFloat->new("0.01"); $x->is_even(); ok 2200 - $x = Math::BigFloat->new("-0.01"); $x->is_even(); ok 2201 - $x = Math::BigFloat->new("120"); $x->is_even(); ok 2202 - $x = Math::BigFloat->new("1200"); $x->is_even(); ok 2203 - $x = Math::BigFloat->new("-1200"); $x->is_even(); ok 2204 - $x = Math::BigFloat->new("0"); $x->is_positive(); ok 2205 - $x = Math::BigFloat->new("1"); $x->is_positive(); ok 2206 - $x = Math::BigFloat->new("-1"); $x->is_positive(); ok 2207 - $x = Math::BigFloat->new("-123"); $x->is_positive(); ok 2208 - $x = Math::BigFloat->new("NaN"); $x->is_positive(); ok 2209 - $x = Math::BigFloat->new("-inf"); $x->is_positive(); ok 2210 - $x = Math::BigFloat->new("+inf"); $x->is_positive(); ok 2211 - $x = Math::BigFloat->new("0"); $x->is_negative(); ok 2212 - $x = Math::BigFloat->new("1"); $x->is_negative(); ok 2213 - $x = Math::BigFloat->new("-1"); $x->is_negative(); ok 2214 - $x = Math::BigFloat->new("-123"); $x->is_negative(); ok 2215 - $x = Math::BigFloat->new("NaN"); $x->is_negative(); ok 2216 - $x = Math::BigFloat->new("-inf"); $x->is_negative(); ok 2217 - $x = Math::BigFloat->new("+inf"); $x->is_negative(); ok 2218 - $x = Math::BigFloat->new("0"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2219 - $x = Math::BigFloat->new("1"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2220 - $x = Math::BigFloat->new("123"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2221 - $x = Math::BigFloat->new("-123"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2222 - $x = Math::BigFloat->new("-1200"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2223 - $x = Math::BigFloat->new("NaNparts"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2224 - $x = Math::BigFloat->new("+inf"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2225 - $x = Math::BigFloat->new("-inf"); ($a, $b) = $x->parts(); $a = $a->bstr(); $b = $b->bstr(); "$a $b"; ok 2226 - $x = Math::BigFloat->new("0"); $x->exponent()->bstr(); ok 2227 - $x = Math::BigFloat->new("1"); $x->exponent()->bstr(); ok 2228 - $x = Math::BigFloat->new("123"); $x->exponent()->bstr(); ok 2229 - $x = Math::BigFloat->new("-123"); $x->exponent()->bstr(); ok 2230 - $x = Math::BigFloat->new("-1200"); $x->exponent()->bstr(); ok 2231 - $x = Math::BigFloat->new("+inf"); $x->exponent()->bstr(); ok 2232 - $x = Math::BigFloat->new("-inf"); $x->exponent()->bstr(); ok 2233 - $x = Math::BigFloat->new("NaNexponent"); $x->exponent()->bstr(); ok 2234 - $x = Math::BigFloat->new("0"); $x->mantissa()->bstr(); ok 2235 - $x = Math::BigFloat->new("1"); $x->mantissa()->bstr(); ok 2236 - $x = Math::BigFloat->new("123"); $x->mantissa()->bstr(); ok 2237 - $x = Math::BigFloat->new("-123"); $x->mantissa()->bstr(); ok 2238 - $x = Math::BigFloat->new("-1200"); $x->mantissa()->bstr(); ok 2239 - $x = Math::BigFloat->new("+inf"); $x->mantissa()->bstr(); ok 2240 - $x = Math::BigFloat->new("-inf"); $x->mantissa()->bstr(); ok 2241 - $x = Math::BigFloat->new("NaNmantissa"); $x->mantissa()->bstr(); ok 2242 - $x = Math::BigFloat->new("123"); $x->length(); ok 2243 - $x = Math::BigFloat->new("-123"); $x->length(); ok 2244 - $x = Math::BigFloat->new("0"); $x->length(); ok 2245 - $x = Math::BigFloat->new("1"); $x->length(); ok 2246 - $x = Math::BigFloat->new("12345678901234567890"); $x->length(); ok 2247 - $x = Math::BigFloat->new("NaNzero"); $x->is_zero(); ok 2248 - $x = Math::BigFloat->new("+inf"); $x->is_zero(); ok 2249 - $x = Math::BigFloat->new("-inf"); $x->is_zero(); ok 2250 - $x = Math::BigFloat->new("0"); $x->is_zero(); ok 2251 - $x = Math::BigFloat->new("-1"); $x->is_zero(); ok 2252 - $x = Math::BigFloat->new("1"); $x->is_zero(); ok 2253 - $x = Math::BigFloat->new("NaNone"); $x->is_one(); ok 2254 - $x = Math::BigFloat->new("+inf"); $x->is_one(); ok 2255 - $x = Math::BigFloat->new("-inf"); $x->is_one(); ok 2256 - $x = Math::BigFloat->new("0"); $x->is_one(); ok 2257 - $x = Math::BigFloat->new("2"); $x->is_one(); ok 2258 - $x = Math::BigFloat->new("1"); $x->is_one(); ok 2259 - $x = Math::BigFloat->new("-1"); $x->is_one(); ok 2260 - $x = Math::BigFloat->new("-2"); $x->is_one(); ok 2261 - $x = Math::BigFloat->new("0"); $x->bfloor(); ok 2262 - $x = Math::BigFloat->new("0"); $x->bfloor(); ok 2263 - $x = Math::BigFloat->new("abc"); $x->bfloor(); ok 2264 - $x = Math::BigFloat->new("abc"); $x->bfloor(); ok 2265 - $x = Math::BigFloat->new("+inf"); $x->bfloor(); ok 2266 - $x = Math::BigFloat->new("+inf"); $x->bfloor(); ok 2267 - $x = Math::BigFloat->new("-inf"); $x->bfloor(); ok 2268 - $x = Math::BigFloat->new("-inf"); $x->bfloor(); ok 2269 - $x = Math::BigFloat->new("1"); $x->bfloor(); ok 2270 - $x = Math::BigFloat->new("1"); $x->bfloor(); ok 2271 - $x = Math::BigFloat->new("-51"); $x->bfloor(); ok 2272 - $x = Math::BigFloat->new("-51"); $x->bfloor(); ok 2273 - $x = Math::BigFloat->new("-51.2"); $x->bfloor(); ok 2274 - $x = Math::BigFloat->new("-51.2"); $x->bfloor(); ok 2275 - $x = Math::BigFloat->new("12.2"); $x->bfloor(); ok 2276 - $x = Math::BigFloat->new("12.2"); $x->bfloor(); ok 2277 - $x = Math::BigFloat->new("0.12345"); $x->bfloor(); ok 2278 - $x = Math::BigFloat->new("0.12345"); $x->bfloor(); ok 2279 - $x = Math::BigFloat->new("0.123456"); $x->bfloor(); ok 2280 - $x = Math::BigFloat->new("0.123456"); $x->bfloor(); ok 2281 - $x = Math::BigFloat->new("0.1234567"); $x->bfloor(); ok 2282 - $x = Math::BigFloat->new("0.1234567"); $x->bfloor(); ok 2283 - $x = Math::BigFloat->new("0.12345678"); $x->bfloor(); ok 2284 - $x = Math::BigFloat->new("0.12345678"); $x->bfloor(); ok 2285 - $x = Math::BigFloat->new("0.123456789"); $x->bfloor(); ok 2286 - $x = Math::BigFloat->new("0.123456789"); $x->bfloor(); ok 2287 - $x = Math::BigFloat->new("0"); $x->bceil(); ok 2288 - $x = Math::BigFloat->new("0"); $x->bceil(); ok 2289 - $x = Math::BigFloat->new("abc"); $x->bceil(); ok 2290 - $x = Math::BigFloat->new("abc"); $x->bceil(); ok 2291 - $x = Math::BigFloat->new("+inf"); $x->bceil(); ok 2292 - $x = Math::BigFloat->new("+inf"); $x->bceil(); ok 2293 - $x = Math::BigFloat->new("-inf"); $x->bceil(); ok 2294 - $x = Math::BigFloat->new("-inf"); $x->bceil(); ok 2295 - $x = Math::BigFloat->new("1"); $x->bceil(); ok 2296 - $x = Math::BigFloat->new("1"); $x->bceil(); ok 2297 - $x = Math::BigFloat->new("-51"); $x->bceil(); ok 2298 - $x = Math::BigFloat->new("-51"); $x->bceil(); ok 2299 - $x = Math::BigFloat->new("-51.2"); $x->bceil(); ok 2300 - $x = Math::BigFloat->new("-51.2"); $x->bceil(); ok 2301 - $x = Math::BigFloat->new("12.2"); $x->bceil(); ok 2302 - $x = Math::BigFloat->new("12.2"); $x->bceil(); ok 2303 - $x = Math::BigFloat->new("-0.4"); $x->bceil(); ok 2304 - $x = Math::BigFloat->new("-0.4"); $x->bceil(); ok 2305 - $x = Math::BigFloat->new("0"); $x->bint(); ok 2306 - $x = Math::BigFloat->new("0"); $x->bint(); ok 2307 - $x = Math::BigFloat->new("NaN"); $x->bint(); ok 2308 - $x = Math::BigFloat->new("NaN"); $x->bint(); ok 2309 - $x = Math::BigFloat->new("+inf"); $x->bint(); ok 2310 - $x = Math::BigFloat->new("+inf"); $x->bint(); ok 2311 - $x = Math::BigFloat->new("-inf"); $x->bint(); ok 2312 - $x = Math::BigFloat->new("-inf"); $x->bint(); ok 2313 - $x = Math::BigFloat->new("1"); $x->bint(); ok 2314 - $x = Math::BigFloat->new("1"); $x->bint(); ok 2315 - $x = Math::BigFloat->new("-51"); $x->bint(); ok 2316 - $x = Math::BigFloat->new("-51"); $x->bint(); ok 2317 - $x = Math::BigFloat->new("-51.2"); $x->bint(); ok 2318 - $x = Math::BigFloat->new("-51.2"); $x->bint(); ok 2319 - $x = Math::BigFloat->new("12.2"); $x->bint(); ok 2320 - $x = Math::BigFloat->new("12.2"); $x->bint(); ok 2321 - $x = Math::BigFloat->new("-0.4"); $x->bint(); ok 2322 - $x = Math::BigFloat->new("-0.4"); $x->bint(); ok 2323 - $x = Math::BigFloat->new("-1"); $x = log($x); ok 2324 - $x = Math::BigFloat->new("-1"); $x = log($x); ok 2325 - $x = Math::BigFloat->new("0"); $x = log($x); ok 2326 - $x = Math::BigFloat->new("0"); $x = log($x); ok 2327 - $x = Math::BigFloat->new("1"); $x = log($x); ok 2328 - $x = Math::BigFloat->new("1"); $x = log($x); ok 2329 - $x = Math::BigFloat->new("2"); $x = log($x); ok 2330 - $x = Math::BigFloat->new("2"); $x = log($x); ok 2331 - $x = Math::BigFloat->new("3"); $x = log($x); ok 2332 - $x = Math::BigFloat->new("3"); $x = log($x); ok 2333 - $x = Math::BigFloat->new("123456789"); $x = log($x); ok 2334 - $x = Math::BigFloat->new("123456789"); $x = log($x); ok 2335 - $x = Math::BigFloat->new("1234567890987654321"); $x = log($x); ok 2336 - $x = Math::BigFloat->new("1234567890987654321"); $x = log($x); ok 2337 - $x = Math::BigFloat->new("-inf"); $x = log($x); ok 2338 - $x = Math::BigFloat->new("-inf"); $x = log($x); ok 2339 - $x = Math::BigFloat->new("inf"); $x = log($x); ok 2340 - $x = Math::BigFloat->new("inf"); $x = log($x); ok 2341 - $x = Math::BigFloat->new("NaN"); $x = log($x); ok 2342 - $x = Math::BigFloat->new("NaN"); $x = log($x); ok 2343 - $x = Math::BigInt->new(1200); $y = $CLASS->new($x); \# check $y ok 2344 - $x = Math::BigInt->new(1200); $y = $CLASS->new($x); \# check $x ok 2345 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->bsstr() ok 2346 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->exponent() ok 2347 - Math::BigFloat->new("1e1234567890123456789012345678901234567890") > 0 ok 2348 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->bsub("1e1234567890123456789012345678901234567890") ok 2349 - Math::BigFloat->new("1e1234567890123456789012345678901234567890")->bmul(2)->bsstr() ok 2350 - Math::BigFloat->new("1234567890123456789012345678901234567890e2")->mantissa() ok 2351 - $x = Math::BigFloat->new(2); $x->bzero(); $x->{_a} ok 2352 - $x = Math::BigFloat->new(2); $x->bzero(); $x->{_p} ok 2353 - $x = Math::BigFloat->new(2); $x->binf(); $x->{_a} ok 2354 - $x = Math::BigFloat->new(2); $x->binf(); $x->{_p} ok 2355 - $x = Math::BigFloat->new(2); $x->bone(); $x->{_a} ok 2356 - $x = Math::BigFloat->new(2); $x->bone(); $x->{_p} ok 2357 - $x = Math::BigFloat->new(2); $x->bnan(); $x->{_a} ok 2358 - $x = Math::BigFloat->new(2); $x->bnan(); $x->{_p} ok 2359 - Math::BigFloat->bzero() ok 2360 - Math::BigFloat->bone() ok 2361 - Math::BigFloat->bone("+") ok 2362 - Math::BigFloat->bone("-") ok 2363 - Math::BigFloat->bnan() ok 2364 - Math::BigFloat->binf() ok 2365 - Math::BigFloat->binf("+") ok 2366 - Math::BigFloat->binf("-") ok 2367 - Math::BigFloat->binf("-inf") ok 2368 - $x = Math::BigFloat->new("0.008"); $y = Math::BigFloat->new(2); $x->bdiv(3, $y); ok 2369 - Math::BigFloat->new("12345e67")->numify() ok 2370 - Math::BigFloat->new("1e-9999")->numify() ok 2371 - Math::BigFloat->new("1e9999")->numify() ok 2372 - numify of +Inf ok 2373 - numify of -Inf ok 2374 - numify of NaN ok 2375 - $x = Math::BigFloat->new(12); Math::BigFloat->precision(-2); $x->bsqrt(); ok 2376 - Math::BigFloat->precision(undef); $x = Math::BigFloat->new(12); Math::BigFloat->precision(0); $x->bsqrt(); ok 2377 - Math::BigFloat->precision(-3); $x = Math::BigFloat->new(12); $x->bsqrt(); ok 2378 - A and P set => NaN ok 2379 - supplied arg overrides set global ok 2380 - @args = Math::BigFloat::objectify(2, Math::BigFloat, 4, 5); join(" ", @args); ok 2381 - Math::BigFloat->new(-1)->is_one() ok 2382 - Math::BigFloat->new(-1)->is_one("-") ok 2383 - Math::BigFloat->new(1)->bdiv("0.5")->bsstr() ok 2384 - $x = Math::BigFloat->new(3); $x -= $x; ok 2385 - $x = Math::BigFloat->new(-3); $x -= $x; ok 2386 - $x = Math::BigFloat->new(3); $x += $x; ok 2387 - $x = Math::BigFloat->new(-3); $x += $x; ok 2388 - $x = Math::BigFloat->new("NaN"); $x -= $x; ok 2389 - $x = Math::BigFloat->new("inf"); $x -= $x; ok 2390 - $x = Math::BigFloat->new("-inf"); $x -= $x; ok 2391 - $x = Math::BigFloat->new("NaN"); $x += $x; ok 2392 - $x = Math::BigFloat->new("inf"); $x += $x; ok 2393 - $x = Math::BigFloat->new("-inf"); $x += $x; ok 2394 - $x = Math::BigFloat->new("3.14"); $x -= $x; ok 2395 - $x = Math::BigFloat->new("-3.14"); $x -= $x; ok 2396 - 6.28 = Math::BigFloat->new("3.14"); 6.28 += 6.28; ok 2397 - -6.28 = Math::BigFloat->new("-3.14"); -6.28 += -6.28; ok 2398 - 9.8596 = Math::BigFloat->new("3.14"); 9.8596 *= 9.8596; ok 2399 - 9.8596 = Math::BigFloat->new("-3.14"); 9.8596 *= 9.8596; ok 2400 - 1 = Math::BigFloat->new("3.14"); 1 /= 1; ok 2401 - 1 = Math::BigFloat->new("-3.14"); 1 /= 1; ok 2402 - 0 = Math::BigFloat->new("3.14"); 0 %= 0; ok 2403 - 0 = Math::BigFloat->new("-3.14"); 0 %= 0; ok 2404 - $x = Math::BigFloat->new(0); $y = Math::BigFloat->new("0.1"); $x ** $y ok 2405 - 1 = Math::BigFloat->new(".222222222222222222222222222222222222222222"); 1->bceil(); ok 2406 - value of ((2**148)+1)/17 ok 2407 - number of digits in ((2**148)+1)/17 ok 2408 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y ok 2409 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y; $x ok 2410 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y; $x >>= $y ok 2411 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18"); $x <<= $y; $x >>= $y; $x ok 2412 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18.2"); $x <<= $y; $x->copy()->bfround(-9); ok 2413 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18.2"); $x <<= $y; $x->copy()->bfround(-9); $x >>= $y ok 2414 - $x = Math::BigFloat->new("2"); $y = Math::BigFloat->new("18.2"); $x <<= $y; $x->copy()->bfround(-9); $x >>= $y; $x ok t/bigintg.t .............. 1..356 # Running under perl version 5.018000 for linux # Current time local: Wed Jan 27 04:16:32 2016 # Current time GMT: Wed Jan 27 12:16:32 2016 # Using Test.pm version 1.26 ok 1 ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok t/bigintpm.t ............. 1..3730 ok 1 - Math::BigInt->from_hex("0xcafe") ok 2 - Math::BigInt->from_hex("0xcafebabedead") ok 3 - Math::BigInt->from_bin("0b1001") ok 4 - Math::BigInt->from_bin("0b1001100110011001100110011001"); ok 5 - Math::BigInt->from_oct("0775"); ok 6 - Math::BigInt->from_oct("07777777777777711111111222222222"); ok 7 - Math::BigInt->config()->{lib} ok 8 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("-345"); $x .= $y; ok 9 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x += $y; ok 10 - is a valid object ok 11 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $x += $y; ok 12 - is a valid object ok 13 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x -= $y; ok 14 - is a valid object ok 15 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $x -= $y; ok 16 - is a valid object ok 17 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x *= $y; ok 18 - is a valid object ok 19 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("5"); $x *= $y; ok 20 - is a valid object ok 21 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("3"); $x %= $y; ok 22 - is a valid object ok 23 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("9"); $x %= $y; ok 24 - is a valid object ok 25 - $x = Math::BigInt->new("-629"); $y = Math::BigInt->new("5033"); $x %= $y; ok 26 - is a valid object ok 27 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("3"); $x /= $y; ok 28 - is a valid object ok 29 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("2"); $x /= $y; ok 30 - is a valid object ok 31 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x |= $y; ok 32 - is a valid object ok 33 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("7"); $x &= $y; ok 34 - is a valid object ok 35 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("7"); $x ^= $y; ok 36 - is a valid object ok 37 - $x = Math::BigInt->new("NaNlog"); $y = Math::BigInt->new("2"); $x->blog($y); ok 38 - is a valid object ok 39 - $x = Math::BigInt->new("122"); $y = Math::BigInt->new("NaNlog"); $x->blog($y); ok 40 - is a valid object ok 41 - $x = Math::BigInt->new("NaNlog1"); $y = Math::BigInt->new("NaNlog"); $x->blog($y); ok 42 - is a valid object ok 43 - $x = Math::BigInt->new("122"); $y = Math::BigInt->new("inf"); $x->blog($y); ok 44 - is a valid object ok 45 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("122"); $x->blog($y); ok 46 - is a valid object ok 47 - $x = Math::BigInt->new("122"); $y = Math::BigInt->new("-inf"); $x->blog($y); ok 48 - is a valid object ok 49 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("122"); $x->blog($y); ok 50 - is a valid object ok 51 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->blog($y); ok 52 - is a valid object ok 53 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $x->blog($y); ok 54 - is a valid object ok 55 - $x = Math::BigInt->new("-21"); $y = Math::BigInt->new("4"); $x->blog($y); ok 56 - is a valid object ok 57 - $x = Math::BigInt->new("21"); $y = Math::BigInt->new("-21"); $x->blog($y); ok 58 - is a valid object ok 59 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x->blog($y); ok 60 - is a valid object ok 61 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x->blog($y); ok 62 - is a valid object ok 63 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->blog($y); ok 64 - is a valid object ok 65 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->blog($y); ok 66 - is a valid object ok 67 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x->blog($y); ok 68 - is a valid object ok 69 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-inf"); $x->blog($y); ok 70 - is a valid object ok 71 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x->blog($y); ok 72 - is a valid object ok 73 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x->blog($y); ok 74 - is a valid object ok 75 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->blog($y); ok 76 - is a valid object ok 77 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $x->blog($y); ok 78 - is a valid object ok 79 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("inf"); $x->blog($y); ok 80 - is a valid object ok 81 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x->blog($y); ok 82 - is a valid object ok 83 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-1"); $x->blog($y); ok 84 - is a valid object ok 85 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); $x->blog($y); ok 86 - is a valid object ok 87 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("1"); $x->blog($y); ok 88 - is a valid object ok 89 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("4"); $x->blog($y); ok 90 - is a valid object ok 91 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); $x->blog($y); ok 92 - is a valid object ok 93 - $x = Math::BigInt->new("1024"); $y = Math::BigInt->new("2"); $x->blog($y); ok 94 - is a valid object ok 95 - $x = Math::BigInt->new("81"); $y = Math::BigInt->new("3"); $x->blog($y); ok 96 - is a valid object ok 97 - $x = Math::BigInt->new("82"); $y = Math::BigInt->new("3"); $x->blog($y); ok 98 - is a valid object ok 99 - $x = Math::BigInt->new("80"); $y = Math::BigInt->new("3"); $x->blog($y); ok 100 - is a valid object ok 101 - $x = Math::BigInt->new("4096"); $y = Math::BigInt->new("2"); $x->blog($y); ok 102 - is a valid object ok 103 - $x = Math::BigInt->new("15625"); $y = Math::BigInt->new("5"); $x->blog($y); ok 104 - is a valid object ok 105 - $x = Math::BigInt->new("15626"); $y = Math::BigInt->new("5"); $x->blog($y); ok 106 - is a valid object ok 107 - $x = Math::BigInt->new("15624"); $y = Math::BigInt->new("5"); $x->blog($y); ok 108 - is a valid object ok 109 - $x = Math::BigInt->new("1000"); $y = Math::BigInt->new("10"); $x->blog($y); ok 110 - is a valid object ok 111 - $x = Math::BigInt->new("10000"); $y = Math::BigInt->new("10"); $x->blog($y); ok 112 - is a valid object ok 113 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("10"); $x->blog($y); ok 114 - is a valid object ok 115 - $x = Math::BigInt->new("1000000"); $y = Math::BigInt->new("10"); $x->blog($y); ok 116 - is a valid object ok 117 - $x = Math::BigInt->new("10000000"); $y = Math::BigInt->new("10"); $x->blog($y); ok 118 - is a valid object ok 119 - $x = Math::BigInt->new("100000000"); $y = Math::BigInt->new("10"); $x->blog($y); ok 120 - is a valid object ok 121 - $x = Math::BigInt->new("8916100448256"); $y = Math::BigInt->new("12"); $x->blog($y); ok 122 - is a valid object ok 123 - $x = Math::BigInt->new("8916100448257"); $y = Math::BigInt->new("12"); $x->blog($y); ok 124 - is a valid object ok 125 - $x = Math::BigInt->new("8916100448255"); $y = Math::BigInt->new("12"); $x->blog($y); ok 126 - is a valid object ok 127 - $x = Math::BigInt->new("2251799813685248"); $y = Math::BigInt->new("8"); $x->blog($y); ok 128 - is a valid object ok 129 - $x = Math::BigInt->new("72057594037927936"); $y = Math::BigInt->new("2"); $x->blog($y); ok 130 - is a valid object ok 131 - $x = Math::BigInt->new("144115188075855872"); $y = Math::BigInt->new("2"); $x->blog($y); ok 132 - is a valid object ok 133 - $x = Math::BigInt->new("288230376151711744"); $y = Math::BigInt->new("2"); $x->blog($y); ok 134 - is a valid object ok 135 - $x = Math::BigInt->new("576460752303423488"); $y = Math::BigInt->new("2"); $x->blog($y); ok 136 - is a valid object ok 137 - $x = Math::BigInt->new("1329227995784915872903807060280344576"); $y = Math::BigInt->new("2"); $x->blog($y); ok 138 - is a valid object ok 139 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $x->blog($y); ok 140 - is a valid object ok 141 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $x->blog($y); ok 142 - is a valid object ok 143 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->blog($y); ok 144 - is a valid object ok 145 - $x = Math::BigInt->new("0"); $x->is_negative() || 0; ok 146 - $x = Math::BigInt->new("-1"); $x->is_negative() || 0; ok 147 - $x = Math::BigInt->new("1"); $x->is_negative() || 0; ok 148 - $x = Math::BigInt->new("+inf"); $x->is_negative() || 0; ok 149 - $x = Math::BigInt->new("-inf"); $x->is_negative() || 0; ok 150 - $x = Math::BigInt->new("NaNneg"); $x->is_negative() || 0; ok 151 - $x = Math::BigInt->new("0"); $x->is_positive() || 0; ok 152 - $x = Math::BigInt->new("-1"); $x->is_positive() || 0; ok 153 - $x = Math::BigInt->new("1"); $x->is_positive() || 0; ok 154 - $x = Math::BigInt->new("+inf"); $x->is_positive() || 0; ok 155 - $x = Math::BigInt->new("-inf"); $x->is_positive() || 0; ok 156 - $x = Math::BigInt->new("NaNneg"); $x->is_positive() || 0; ok 157 - $x = Math::BigInt->new("-inf"); $x->is_int() || 0; ok 158 - $x = Math::BigInt->new("+inf"); $x->is_int() || 0; ok 159 - $x = Math::BigInt->new("NaNis_int"); $x->is_int() || 0; ok 160 - $x = Math::BigInt->new("1"); $x->is_int() || 0; ok 161 - $x = Math::BigInt->new("0"); $x->is_int() || 0; ok 162 - $x = Math::BigInt->new("123e12"); $x->is_int() || 0; ok 163 - $x = Math::BigInt->new("abc"); $x->is_odd() || 0; ok 164 - $x = Math::BigInt->new("0"); $x->is_odd() || 0; ok 165 - $x = Math::BigInt->new("1"); $x->is_odd() || 0; ok 166 - $x = Math::BigInt->new("3"); $x->is_odd() || 0; ok 167 - $x = Math::BigInt->new("-1"); $x->is_odd() || 0; ok 168 - $x = Math::BigInt->new("-3"); $x->is_odd() || 0; ok 169 - $x = Math::BigInt->new("10000001"); $x->is_odd() || 0; ok 170 - $x = Math::BigInt->new("10000002"); $x->is_odd() || 0; ok 171 - $x = Math::BigInt->new("2"); $x->is_odd() || 0; ok 172 - $x = Math::BigInt->new("120"); $x->is_odd() || 0; ok 173 - $x = Math::BigInt->new("121"); $x->is_odd() || 0; ok 174 - $x = Math::BigInt->new("abc"); $x->is_even() || 0; ok 175 - $x = Math::BigInt->new("0"); $x->is_even() || 0; ok 176 - $x = Math::BigInt->new("1"); $x->is_even() || 0; ok 177 - $x = Math::BigInt->new("3"); $x->is_even() || 0; ok 178 - $x = Math::BigInt->new("-1"); $x->is_even() || 0; ok 179 - $x = Math::BigInt->new("-3"); $x->is_even() || 0; ok 180 - $x = Math::BigInt->new("10000001"); $x->is_even() || 0; ok 181 - $x = Math::BigInt->new("10000002"); $x->is_even() || 0; ok 182 - $x = Math::BigInt->new("2"); $x->is_even() || 0; ok 183 - $x = Math::BigInt->new("120"); $x->is_even() || 0; ok 184 - $x = Math::BigInt->new("121"); $x->is_even() || 0; ok 185 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-0"); $x->bacmp($y); ok 186 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $x->bacmp($y); ok 187 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x->bacmp($y); ok 188 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x->bacmp($y); ok 189 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+2"); $x->bacmp($y); ok 190 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-1"); $x->bacmp($y); ok 191 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("+987654321"); $x->bacmp($y); ok 192 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x->bacmp($y); ok 193 - $x = Math::BigInt->new("+987654321"); $y = Math::BigInt->new("+123456789"); $x->bacmp($y); ok 194 - $x = Math::BigInt->new("-987654321"); $y = Math::BigInt->new("+123456789"); $x->bacmp($y); ok 195 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("+4567889"); $x->bacmp($y); ok 196 - $x = Math::BigInt->new("acmpNaN"); $y = Math::BigInt->new("123"); $x->bacmp($y); ok 197 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("acmpNaN"); $x->bacmp($y); ok 198 - $x = Math::BigInt->new("acmpNaN"); $y = Math::BigInt->new("acmpNaN"); $x->bacmp($y); ok 199 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x->bacmp($y); ok 200 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->bacmp($y); ok 201 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x->bacmp($y); ok 202 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x->bacmp($y); ok 203 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("123"); $x->bacmp($y); ok 204 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("123"); $x->bacmp($y); ok 205 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-123"); $x->bacmp($y); ok 206 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-123"); $x->bacmp($y); ok 207 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-inf"); $x->bacmp($y); ok 208 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("inf"); $x->bacmp($y); ok 209 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-inf"); $x->bacmp($y); ok 210 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("inf"); $x->bacmp($y); ok 211 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaN"); $x->bacmp($y); ok 212 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->bacmp($y); ok 213 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x->bacmp($y); ok 214 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("-inf"); $x->bacmp($y); ok 215 - $x = Math::BigInt->bnorm("0e999"); ok 216 - is a valid object ok 217 - $x = Math::BigInt->bnorm("0e-999"); ok 218 - is a valid object ok 219 - $x = Math::BigInt->bnorm("-0e999"); ok 220 - is a valid object ok 221 - $x = Math::BigInt->bnorm("-0e-999"); ok 222 - is a valid object ok 223 - $x = Math::BigInt->bnorm("123"); ok 224 - is a valid object ok 225 - $x = Math::BigInt->bnorm("123.000"); ok 226 - is a valid object ok 227 - $x = Math::BigInt->bnorm("123e0"); ok 228 - is a valid object ok 229 - $x = Math::BigInt->bnorm("123e+0"); ok 230 - is a valid object ok 231 - $x = Math::BigInt->bnorm("123e-0"); ok 232 - is a valid object ok 233 - $x = Math::BigInt->bnorm("123.000e0"); ok 234 - is a valid object ok 235 - $x = Math::BigInt->bnorm("123.000e+0"); ok 236 - is a valid object ok 237 - $x = Math::BigInt->bnorm("123.000e-0"); ok 238 - is a valid object ok 239 - $x = Math::BigInt->bnorm("0babc"); ok 240 - is a valid object ok 241 - $x = Math::BigInt->bnorm("0b123"); ok 242 - is a valid object ok 243 - $x = Math::BigInt->bnorm("0b0"); ok 244 - is a valid object ok 245 - $x = Math::BigInt->bnorm("-0b0"); ok 246 - is a valid object ok 247 - $x = Math::BigInt->bnorm("-0b1"); ok 248 - is a valid object ok 249 - $x = Math::BigInt->bnorm("0b0001"); ok 250 - is a valid object ok 251 - $x = Math::BigInt->bnorm("0b001"); ok 252 - is a valid object ok 253 - $x = Math::BigInt->bnorm("0b011"); ok 254 - is a valid object ok 255 - $x = Math::BigInt->bnorm("0b101"); ok 256 - is a valid object ok 257 - $x = Math::BigInt->bnorm("0b1001"); ok 258 - is a valid object ok 259 - $x = Math::BigInt->bnorm("0b10001"); ok 260 - is a valid object ok 261 - $x = Math::BigInt->bnorm("0b100001"); ok 262 - is a valid object ok 263 - $x = Math::BigInt->bnorm("0b1000001"); ok 264 - is a valid object ok 265 - $x = Math::BigInt->bnorm("0b10000001"); ok 266 - is a valid object ok 267 - $x = Math::BigInt->bnorm("0b100000001"); ok 268 - is a valid object ok 269 - $x = Math::BigInt->bnorm("0b1000000001"); ok 270 - is a valid object ok 271 - $x = Math::BigInt->bnorm("0b10000000001"); ok 272 - is a valid object ok 273 - $x = Math::BigInt->bnorm("0b100000000001"); ok 274 - is a valid object ok 275 - $x = Math::BigInt->bnorm("0b1000000000001"); ok 276 - is a valid object ok 277 - $x = Math::BigInt->bnorm("0b10000000000001"); ok 278 - is a valid object ok 279 - $x = Math::BigInt->bnorm("0b100000000000001"); ok 280 - is a valid object ok 281 - $x = Math::BigInt->bnorm("0b1000000000000001"); ok 282 - is a valid object ok 283 - $x = Math::BigInt->bnorm("0b10000000000000001"); ok 284 - is a valid object ok 285 - $x = Math::BigInt->bnorm("0b100000000000000001"); ok 286 - is a valid object ok 287 - $x = Math::BigInt->bnorm("0b1000000000000000001"); ok 288 - is a valid object ok 289 - $x = Math::BigInt->bnorm("0b10000000000000000001"); ok 290 - is a valid object ok 291 - $x = Math::BigInt->bnorm("0b100000000000000000001"); ok 292 - is a valid object ok 293 - $x = Math::BigInt->bnorm("0b1000000000000000000001"); ok 294 - is a valid object ok 295 - $x = Math::BigInt->bnorm("0b10000000000000000000001"); ok 296 - is a valid object ok 297 - $x = Math::BigInt->bnorm("0b100000000000000000000001"); ok 298 - is a valid object ok 299 - $x = Math::BigInt->bnorm("0b1000000000000000000000001"); ok 300 - is a valid object ok 301 - $x = Math::BigInt->bnorm("0b10000000000000000000000001"); ok 302 - is a valid object ok 303 - $x = Math::BigInt->bnorm("0b100000000000000000000000001"); ok 304 - is a valid object ok 305 - $x = Math::BigInt->bnorm("0b1000000000000000000000000001"); ok 306 - is a valid object ok 307 - $x = Math::BigInt->bnorm("0b10000000000000000000000000001"); ok 308 - is a valid object ok 309 - $x = Math::BigInt->bnorm("0b100000000000000000000000000001"); ok 310 - is a valid object ok 311 - $x = Math::BigInt->bnorm("0b1000000000000000000000000000001"); ok 312 - is a valid object ok 313 - $x = Math::BigInt->bnorm("0b10000000000000000000000000000001"); ok 314 - is a valid object ok 315 - $x = Math::BigInt->bnorm("0b100000000000000000000000000000001"); ok 316 - is a valid object ok 317 - $x = Math::BigInt->bnorm("0b1000000000000000000000000000000001"); ok 318 - is a valid object ok 319 - $x = Math::BigInt->bnorm("0b10000000000000000000000000000000001"); ok 320 - is a valid object ok 321 - $x = Math::BigInt->bnorm("0b__101"); ok 322 - is a valid object ok 323 - $x = Math::BigInt->bnorm("0b1_0_1"); ok 324 - is a valid object ok 325 - $x = Math::BigInt->bnorm("0b0_0_0_1"); ok 326 - is a valid object ok 327 - $x = Math::BigInt->bnorm("-0x0"); ok 328 - is a valid object ok 329 - $x = Math::BigInt->bnorm("0xabcdefgh"); ok 330 - is a valid object ok 331 - $x = Math::BigInt->bnorm("0x1234"); ok 332 - is a valid object ok 333 - $x = Math::BigInt->bnorm("0xabcdef"); ok 334 - is a valid object ok 335 - $x = Math::BigInt->bnorm("-0xABCDEF"); ok 336 - is a valid object ok 337 - $x = Math::BigInt->bnorm("-0x1234"); ok 338 - is a valid object ok 339 - $x = Math::BigInt->bnorm("0x12345678"); ok 340 - is a valid object ok 341 - $x = Math::BigInt->bnorm("0x1_2_3_4_56_78"); ok 342 - is a valid object ok 343 - $x = Math::BigInt->bnorm("0xa_b_c_d_e_f"); ok 344 - is a valid object ok 345 - $x = Math::BigInt->bnorm("0x__123"); ok 346 - is a valid object ok 347 - $x = Math::BigInt->bnorm("0x9"); ok 348 - is a valid object ok 349 - $x = Math::BigInt->bnorm("0x11"); ok 350 - is a valid object ok 351 - $x = Math::BigInt->bnorm("0x21"); ok 352 - is a valid object ok 353 - $x = Math::BigInt->bnorm("0x41"); ok 354 - is a valid object ok 355 - $x = Math::BigInt->bnorm("0x81"); ok 356 - is a valid object ok 357 - $x = Math::BigInt->bnorm("0x101"); ok 358 - is a valid object ok 359 - $x = Math::BigInt->bnorm("0x201"); ok 360 - is a valid object ok 361 - $x = Math::BigInt->bnorm("0x401"); ok 362 - is a valid object ok 363 - $x = Math::BigInt->bnorm("0x801"); ok 364 - is a valid object ok 365 - $x = Math::BigInt->bnorm("0x1001"); ok 366 - is a valid object ok 367 - $x = Math::BigInt->bnorm("0x2001"); ok 368 - is a valid object ok 369 - $x = Math::BigInt->bnorm("0x4001"); ok 370 - is a valid object ok 371 - $x = Math::BigInt->bnorm("0x8001"); ok 372 - is a valid object ok 373 - $x = Math::BigInt->bnorm("0x10001"); ok 374 - is a valid object ok 375 - $x = Math::BigInt->bnorm("0x20001"); ok 376 - is a valid object ok 377 - $x = Math::BigInt->bnorm("0x40001"); ok 378 - is a valid object ok 379 - $x = Math::BigInt->bnorm("0x80001"); ok 380 - is a valid object ok 381 - $x = Math::BigInt->bnorm("0x100001"); ok 382 - is a valid object ok 383 - $x = Math::BigInt->bnorm("0x200001"); ok 384 - is a valid object ok 385 - $x = Math::BigInt->bnorm("0x400001"); ok 386 - is a valid object ok 387 - $x = Math::BigInt->bnorm("0x800001"); ok 388 - is a valid object ok 389 - $x = Math::BigInt->bnorm("0x1000001"); ok 390 - is a valid object ok 391 - $x = Math::BigInt->bnorm("0x2000001"); ok 392 - is a valid object ok 393 - $x = Math::BigInt->bnorm("0x4000001"); ok 394 - is a valid object ok 395 - $x = Math::BigInt->bnorm("0x8000001"); ok 396 - is a valid object ok 397 - $x = Math::BigInt->bnorm("0x10000001"); ok 398 - is a valid object ok 399 - $x = Math::BigInt->bnorm("0x20000001"); ok 400 - is a valid object ok 401 - $x = Math::BigInt->bnorm("0x40000001"); ok 402 - is a valid object ok 403 - $x = Math::BigInt->bnorm("0x80000001"); ok 404 - is a valid object ok 405 - $x = Math::BigInt->bnorm("0x100000001"); ok 406 - is a valid object ok 407 - $x = Math::BigInt->bnorm("0x200000001"); ok 408 - is a valid object ok 409 - $x = Math::BigInt->bnorm("0x400000001"); ok 410 - is a valid object ok 411 - $x = Math::BigInt->bnorm("0x800000001"); ok 412 - is a valid object ok 413 - $x = Math::BigInt->bnorm("0x2dd59e18a125dbed30a6ab1d93e9c855569f44f75806f0645dc9a2e98b808c3"); ok 414 - is a valid object ok 415 - $x = Math::BigInt->bnorm("inf"); ok 416 - is a valid object ok 417 - $x = Math::BigInt->bnorm("+inf"); ok 418 - is a valid object ok 419 - $x = Math::BigInt->bnorm("-inf"); ok 420 - is a valid object ok 421 - $x = Math::BigInt->bnorm("0inf"); ok 422 - is a valid object ok 423 - $x = Math::BigInt->bnorm(""); ok 424 - is a valid object ok 425 - $x = Math::BigInt->bnorm("abc"); ok 426 - is a valid object ok 427 - $x = Math::BigInt->bnorm(" 1 a"); ok 428 - is a valid object ok 429 - $x = Math::BigInt->bnorm("1bcd2"); ok 430 - is a valid object ok 431 - $x = Math::BigInt->bnorm("11111b"); ok 432 - is a valid object ok 433 - $x = Math::BigInt->bnorm("+1z"); ok 434 - is a valid object ok 435 - $x = Math::BigInt->bnorm("-1z"); ok 436 - is a valid object ok 437 - $x = Math::BigInt->bnorm("_123"); ok 438 - is a valid object ok 439 - $x = Math::BigInt->bnorm("_123_"); ok 440 - is a valid object ok 441 - $x = Math::BigInt->bnorm("123_"); ok 442 - is a valid object ok 443 - $x = Math::BigInt->bnorm("1__23"); ok 444 - is a valid object ok 445 - $x = Math::BigInt->bnorm("1E1__2"); ok 446 - is a valid object ok 447 - $x = Math::BigInt->bnorm("1_E12"); ok 448 - is a valid object ok 449 - $x = Math::BigInt->bnorm("1E_12"); ok 450 - is a valid object ok 451 - $x = Math::BigInt->bnorm("1_E_12"); ok 452 - is a valid object ok 453 - $x = Math::BigInt->bnorm("+_1E12"); ok 454 - is a valid object ok 455 - $x = Math::BigInt->bnorm("+0_1E2"); ok 456 - is a valid object ok 457 - $x = Math::BigInt->bnorm("+0_0_1E2"); ok 458 - is a valid object ok 459 - $x = Math::BigInt->bnorm("-0_0_1E2"); ok 460 - is a valid object ok 461 - $x = Math::BigInt->bnorm("-0_0_1E+0_0_2"); ok 462 - is a valid object ok 463 - $x = Math::BigInt->bnorm("E1"); ok 464 - is a valid object ok 465 - $x = Math::BigInt->bnorm("E23"); ok 466 - is a valid object ok 467 - $x = Math::BigInt->bnorm("1.23E1"); ok 468 - is a valid object ok 469 - $x = Math::BigInt->bnorm("1.23E-1"); ok 470 - is a valid object ok 471 - $x = Math::BigInt->bnorm("1e2e3"); ok 472 - is a valid object ok 473 - $x = Math::BigInt->bnorm("1e2r"); ok 474 - is a valid object ok 475 - $x = Math::BigInt->bnorm("1e2.0"); ok 476 - is a valid object ok 477 - $x = Math::BigInt->bnorm("1.2.2"); ok 478 - is a valid object ok 479 - $x = Math::BigInt->bnorm("1.2.3e1"); ok 480 - is a valid object ok 481 - $x = Math::BigInt->bnorm("-1.2.3"); ok 482 - is a valid object ok 483 - $x = Math::BigInt->bnorm("-1.2.3e-4"); ok 484 - is a valid object ok 485 - $x = Math::BigInt->bnorm("1.2e3.4"); ok 486 - is a valid object ok 487 - $x = Math::BigInt->bnorm("1.2e-3.4"); ok 488 - is a valid object ok 489 - $x = Math::BigInt->bnorm("1.2.3.4"); ok 490 - is a valid object ok 491 - $x = Math::BigInt->bnorm("1.2.t"); ok 492 - is a valid object ok 493 - $x = Math::BigInt->bnorm("1..2"); ok 494 - is a valid object ok 495 - $x = Math::BigInt->bnorm("1..2e1"); ok 496 - is a valid object ok 497 - $x = Math::BigInt->bnorm("1..2e1..1"); ok 498 - is a valid object ok 499 - $x = Math::BigInt->bnorm("12e1..1"); ok 500 - is a valid object ok 501 - $x = Math::BigInt->bnorm("..2"); ok 502 - is a valid object ok 503 - $x = Math::BigInt->bnorm(".-2"); ok 504 - is a valid object ok 505 - $x = Math::BigInt->bnorm("012"); ok 506 - is a valid object ok 507 - $x = Math::BigInt->bnorm("0123"); ok 508 - is a valid object ok 509 - $x = Math::BigInt->bnorm("01234"); ok 510 - is a valid object ok 511 - $x = Math::BigInt->bnorm("012345"); ok 512 - is a valid object ok 513 - $x = Math::BigInt->bnorm("0123456"); ok 514 - is a valid object ok 515 - $x = Math::BigInt->bnorm("01234567"); ok 516 - is a valid object ok 517 - $x = Math::BigInt->bnorm("012345678"); ok 518 - is a valid object ok 519 - $x = Math::BigInt->bnorm("0123456789"); ok 520 - is a valid object ok 521 - $x = Math::BigInt->bnorm("01234567891"); ok 522 - is a valid object ok 523 - $x = Math::BigInt->bnorm("012345678912"); ok 524 - is a valid object ok 525 - $x = Math::BigInt->bnorm("0123456789123"); ok 526 - is a valid object ok 527 - $x = Math::BigInt->bnorm("01234567891234"); ok 528 - is a valid object ok 529 - $x = Math::BigInt->bnorm("0e0"); ok 530 - is a valid object ok 531 - $x = Math::BigInt->bnorm("+0e0"); ok 532 - is a valid object ok 533 - $x = Math::BigInt->bnorm("+0e+0"); ok 534 - is a valid object ok 535 - $x = Math::BigInt->bnorm("-0e+0"); ok 536 - is a valid object ok 537 - $x = Math::BigInt->bnorm("0e-0"); ok 538 - is a valid object ok 539 - $x = Math::BigInt->bnorm("-0e-0"); ok 540 - is a valid object ok 541 - $x = Math::BigInt->bnorm("+0e-0"); ok 542 - is a valid object ok 543 - $x = Math::BigInt->bnorm("000"); ok 544 - is a valid object ok 545 - $x = Math::BigInt->bnorm("00e2"); ok 546 - is a valid object ok 547 - $x = Math::BigInt->bnorm("00e02"); ok 548 - is a valid object ok 549 - $x = Math::BigInt->bnorm("000e002"); ok 550 - is a valid object ok 551 - $x = Math::BigInt->bnorm("000e1230"); ok 552 - is a valid object ok 553 - $x = Math::BigInt->bnorm("00e-3"); ok 554 - is a valid object ok 555 - $x = Math::BigInt->bnorm("00e+3"); ok 556 - is a valid object ok 557 - $x = Math::BigInt->bnorm("00e-03"); ok 558 - is a valid object ok 559 - $x = Math::BigInt->bnorm("00e+03"); ok 560 - is a valid object ok 561 - $x = Math::BigInt->bnorm("-000"); ok 562 - is a valid object ok 563 - $x = Math::BigInt->bnorm("-00e2"); ok 564 - is a valid object ok 565 - $x = Math::BigInt->bnorm("-00e02"); ok 566 - is a valid object ok 567 - $x = Math::BigInt->bnorm("-000e002"); ok 568 - is a valid object ok 569 - $x = Math::BigInt->bnorm("-000e1230"); ok 570 - is a valid object ok 571 - $x = Math::BigInt->bnorm("-00e-3"); ok 572 - is a valid object ok 573 - $x = Math::BigInt->bnorm("-00e+3"); ok 574 - is a valid object ok 575 - $x = Math::BigInt->bnorm("-00e-03"); ok 576 - is a valid object ok 577 - $x = Math::BigInt->bnorm("-00e+03"); ok 578 - is a valid object ok 579 - $x = Math::BigInt->bnorm("0"); ok 580 - is a valid object ok 581 - $x = Math::BigInt->bnorm("+0"); ok 582 - is a valid object ok 583 - $x = Math::BigInt->bnorm("+00"); ok 584 - is a valid object ok 585 - $x = Math::BigInt->bnorm("+000"); ok 586 - is a valid object ok 587 - $x = Math::BigInt->bnorm("000000000000000000"); ok 588 - is a valid object ok 589 - $x = Math::BigInt->bnorm("-0"); ok 590 - is a valid object ok 591 - $x = Math::BigInt->bnorm("-0000"); ok 592 - is a valid object ok 593 - $x = Math::BigInt->bnorm("+1"); ok 594 - is a valid object ok 595 - $x = Math::BigInt->bnorm("+01"); ok 596 - is a valid object ok 597 - $x = Math::BigInt->bnorm("+001"); ok 598 - is a valid object ok 599 - $x = Math::BigInt->bnorm("+00000100000"); ok 600 - is a valid object ok 601 - $x = Math::BigInt->bnorm("123456789"); ok 602 - is a valid object ok 603 - $x = Math::BigInt->bnorm("-1"); ok 604 - is a valid object ok 605 - $x = Math::BigInt->bnorm("-01"); ok 606 - is a valid object ok 607 - $x = Math::BigInt->bnorm("-001"); ok 608 - is a valid object ok 609 - $x = Math::BigInt->bnorm("-123456789"); ok 610 - is a valid object ok 611 - $x = Math::BigInt->bnorm("-00000100000"); ok 612 - is a valid object ok 613 - $x = Math::BigInt->bnorm("1_2_3"); ok 614 - is a valid object ok 615 - $x = Math::BigInt->bnorm("10000000000E-1_0"); ok 616 - is a valid object ok 617 - $x = Math::BigInt->bnorm("1E2"); ok 618 - is a valid object ok 619 - $x = Math::BigInt->bnorm("1E1"); ok 620 - is a valid object ok 621 - $x = Math::BigInt->bnorm("1E0"); ok 622 - is a valid object ok 623 - $x = Math::BigInt->bnorm("1.23E2"); ok 624 - is a valid object ok 625 - $x = Math::BigInt->bnorm("100E-1"); ok 626 - is a valid object ok 627 - $x = Math::BigInt->bnorm("1.E3"); ok 628 - is a valid object ok 629 - $x = Math::BigInt->bnorm("1.01E2"); ok 630 - is a valid object ok 631 - $x = Math::BigInt->bnorm("1010E-1"); ok 632 - is a valid object ok 633 - $x = Math::BigInt->bnorm("-1010E0"); ok 634 - is a valid object ok 635 - $x = Math::BigInt->bnorm("-1010E1"); ok 636 - is a valid object ok 637 - $x = Math::BigInt->bnorm("1234.00"); ok 638 - is a valid object ok 639 - $x = Math::BigInt->bnorm("-1010E-2"); ok 640 - is a valid object ok 641 - $x = Math::BigInt->bnorm("-1.01E+1"); ok 642 - is a valid object ok 643 - $x = Math::BigInt->bnorm("-1.01E-1"); ok 644 - is a valid object ok 645 - $x = Math::BigInt->bnorm("1E-999999"); ok 646 - is a valid object ok 647 - $x = Math::BigInt->bnorm("0.5"); ok 648 - is a valid object ok 649 - $x = Math::BigInt->new("1"); $x->bnan(); ok 650 - is a valid object ok 651 - $x = Math::BigInt->new("2"); $x->bnan(); ok 652 - is a valid object ok 653 - $x = Math::BigInt->new("abc"); $x->bnan(); ok 654 - is a valid object ok 655 - $x = Math::BigInt->new("2"); $x->bone("+"); ok 656 - is a valid object ok 657 - $x = Math::BigInt->new("2"); $x->bone("-"); ok 658 - is a valid object ok 659 - $x = Math::BigInt->new("boneNaN"); $x->bone("-"); ok 660 - is a valid object ok 661 - $x = Math::BigInt->new("boneNaN"); $x->bone("+"); ok 662 - is a valid object ok 663 - $x = Math::BigInt->new("2"); $x->bone("abc"); ok 664 - is a valid object ok 665 - $x = Math::BigInt->new("3"); $x->bone(""); ok 666 - is a valid object ok 667 - $x = Math::BigInt->new("1"); $x->binf("+"); ok 668 - is a valid object ok 669 - $x = Math::BigInt->new("2"); $x->binf("-"); ok 670 - is a valid object ok 671 - $x = Math::BigInt->new("3"); $x->binf("abc"); ok 672 - is a valid object ok 673 - $x = Math::BigInt->new("123"); $x->is_nan() || 0; ok 674 - $x = Math::BigInt->new("abc"); $x->is_nan() || 0; ok 675 - $x = Math::BigInt->new("NaN"); $x->is_nan() || 0; ok 676 - $x = Math::BigInt->new("-123"); $x->is_nan() || 0; ok 677 - $x = Math::BigInt->new("+inf"); $x->is_inf(""); ok 678 - $x = Math::BigInt->new("-inf"); $x->is_inf(""); ok 679 - $x = Math::BigInt->new("abc"); $x->is_inf(""); ok 680 - $x = Math::BigInt->new("1"); $x->is_inf(""); ok 681 - $x = Math::BigInt->new("NaN"); $x->is_inf(""); ok 682 - $x = Math::BigInt->new("-1"); $x->is_inf(""); ok 683 - $x = Math::BigInt->new("+inf"); $x->is_inf("-"); ok 684 - $x = Math::BigInt->new("+inf"); $x->is_inf("+"); ok 685 - $x = Math::BigInt->new("-inf"); $x->is_inf("-"); ok 686 - $x = Math::BigInt->new("-inf"); $x->is_inf("+"); ok 687 - $x = Math::BigInt->new("-inf"); $x->is_inf("-inf"); ok 688 - $x = Math::BigInt->new("-inf"); $x->is_inf("+inf"); ok 689 - $x = Math::BigInt->new("+inf"); $x->is_inf("-inf"); ok 690 - $x = Math::BigInt->new("+inf"); $x->is_inf("+inf"); ok 691 - $x = Math::BigInt->new("+iNfInItY"); $x->is_inf(""); ok 692 - $x = Math::BigInt->new("-InFiNiTy"); $x->is_inf(""); ok 693 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x << $y; ok 694 - is a valid object ok 695 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+2"); $x << $y; ok 696 - is a valid object ok 697 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+32"); $x << $y; ok 698 - is a valid object ok 699 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+48"); $x << $y; ok 700 - is a valid object ok 701 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("-2"); $x << $y; ok 702 - is a valid object ok 703 - $x = Math::BigInt->new("+12345"); $y = Math::BigInt->new("4"); $x->blsft($y, 10); ok 704 - is a valid object ok 705 - $x = Math::BigInt->new("-1234"); $y = Math::BigInt->new("0"); $x->blsft($y, 10); ok 706 - is a valid object ok 707 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("0"); $x->blsft($y, 10); ok 708 - is a valid object ok 709 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("2"); $x->blsft($y, 10); ok 710 - is a valid object ok 711 - $x = Math::BigInt->new("+12"); $y = Math::BigInt->new("2"); $x->blsft($y, 10); ok 712 - is a valid object ok 713 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("-3"); $x->blsft($y, 10); ok 714 - is a valid object ok 715 - $x = Math::BigInt->new("1234567890123"); $y = Math::BigInt->new("12"); $x->blsft($y, 10); ok 716 - is a valid object ok 717 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("1"); $x->blsft($y, 2); ok 718 - is a valid object ok 719 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("1"); $x->blsft($y, 2); ok 720 - is a valid object ok 721 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $x->blsft($y, 2); ok 722 - is a valid object ok 723 - $x = Math::BigInt->new("-102533203"); $y = Math::BigInt->new("1"); $x->blsft($y, 2); ok 724 - is a valid object ok 725 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x >> $y; ok 726 - is a valid object ok 727 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x >> $y; ok 728 - is a valid object ok 729 - $x = Math::BigInt->new("+4294967296"); $y = Math::BigInt->new("+32"); $x >> $y; ok 730 - is a valid object ok 731 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("+48"); $x >> $y; ok 732 - is a valid object ok 733 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-2"); $x >> $y; ok 734 - is a valid object ok 735 - $x = Math::BigInt->new("-1234"); $y = Math::BigInt->new("0"); $x->brsft($y, 10); ok 736 - is a valid object ok 737 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("0"); $x->brsft($y, 10); ok 738 - is a valid object ok 739 - $x = Math::BigInt->new("+200"); $y = Math::BigInt->new("2"); $x->brsft($y, 10); ok 740 - is a valid object ok 741 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("3"); $x->brsft($y, 10); ok 742 - is a valid object ok 743 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("2"); $x->brsft($y, 10); ok 744 - is a valid object ok 745 - $x = Math::BigInt->new("+1234"); $y = Math::BigInt->new("-3"); $x->brsft($y, 10); ok 746 - is a valid object ok 747 - $x = Math::BigInt->new("310000"); $y = Math::BigInt->new("4"); $x->brsft($y, 10); ok 748 - is a valid object ok 749 - $x = Math::BigInt->new("12300000"); $y = Math::BigInt->new("5"); $x->brsft($y, 10); ok 750 - is a valid object ok 751 - $x = Math::BigInt->new("1230000000000"); $y = Math::BigInt->new("10"); $x->brsft($y, 10); ok 752 - is a valid object ok 753 - $x = Math::BigInt->new("09876123456789067890"); $y = Math::BigInt->new("12"); $x->brsft($y, 10); ok 754 - is a valid object ok 755 - $x = Math::BigInt->new("1234561234567890123"); $y = Math::BigInt->new("13"); $x->brsft($y, 10); ok 756 - is a valid object ok 757 - $x = Math::BigInt->new("820265627"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 758 - is a valid object ok 759 - $x = Math::BigInt->new("-15"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 760 - is a valid object ok 761 - $x = Math::BigInt->new("-14"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 762 - is a valid object ok 763 - $x = Math::BigInt->new("-13"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 764 - is a valid object ok 765 - $x = Math::BigInt->new("-12"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 766 - is a valid object ok 767 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 768 - is a valid object ok 769 - $x = Math::BigInt->new("-10"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 770 - is a valid object ok 771 - $x = Math::BigInt->new("-9"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 772 - is a valid object ok 773 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 774 - is a valid object ok 775 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 776 - is a valid object ok 777 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 778 - is a valid object ok 779 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 780 - is a valid object ok 781 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 782 - is a valid object ok 783 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 784 - is a valid object ok 785 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 786 - is a valid object ok 787 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 788 - is a valid object ok 789 - $x = Math::BigInt->new("-1640531254"); $y = Math::BigInt->new("2"); $x->brsft($y, 2); ok 790 - is a valid object ok 791 - $x = Math::BigInt->new("-1640531254"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 792 - is a valid object ok 793 - $x = Math::BigInt->new("-820265627"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 794 - is a valid object ok 795 - $x = Math::BigInt->new("-205066405"); $y = Math::BigInt->new("1"); $x->brsft($y, 2); ok 796 - is a valid object ok 797 - $x = Math::BigInt->new("+inf"); $x->bsstr(); ok 798 - $x = Math::BigInt->new("-inf"); $x->bsstr(); ok 799 - $x = Math::BigInt->new("1e+34"); $x->bsstr(); ok 800 - $x = Math::BigInt->new("123.456E3"); $x->bsstr(); ok 801 - $x = Math::BigInt->new("100"); $x->bsstr(); ok 802 - $x = Math::BigInt->new("bsstrabc"); $x->bsstr(); ok 803 - $x = Math::BigInt->new("-5"); $x->bsstr(); ok 804 - $x = Math::BigInt->new("-100"); $x->bsstr(); ok 805 - $x = Math::BigInt->new("5"); $x->numify(); ok 806 - $x = Math::BigInt->new("-5"); $x->numify(); ok 807 - $x = Math::BigInt->new("100"); $x->numify(); ok 808 - $x = Math::BigInt->new("-100"); $x->numify(); ok 809 - $x = Math::BigInt->new("bnegNaN"); $x->bneg(); ok 810 - is a valid object ok 811 - $x = Math::BigInt->new("+inf"); $x->bneg(); ok 812 - is a valid object ok 813 - $x = Math::BigInt->new("-inf"); $x->bneg(); ok 814 - is a valid object ok 815 - $x = Math::BigInt->new("abd"); $x->bneg(); ok 816 - is a valid object ok 817 - $x = Math::BigInt->new("0"); $x->bneg(); ok 818 - is a valid object ok 819 - $x = Math::BigInt->new("1"); $x->bneg(); ok 820 - is a valid object ok 821 - $x = Math::BigInt->new("-1"); $x->bneg(); ok 822 - is a valid object ok 823 - $x = Math::BigInt->new("+123456789"); $x->bneg(); ok 824 - is a valid object ok 825 - $x = Math::BigInt->new("-123456789"); $x->bneg(); ok 826 - is a valid object ok 827 - $x = Math::BigInt->new("babsNaN"); $x->babs(); ok 828 - is a valid object ok 829 - $x = Math::BigInt->new("+inf"); $x->babs(); ok 830 - is a valid object ok 831 - $x = Math::BigInt->new("-inf"); $x->babs(); ok 832 - is a valid object ok 833 - $x = Math::BigInt->new("0"); $x->babs(); ok 834 - is a valid object ok 835 - $x = Math::BigInt->new("1"); $x->babs(); ok 836 - is a valid object ok 837 - $x = Math::BigInt->new("-1"); $x->babs(); ok 838 - is a valid object ok 839 - $x = Math::BigInt->new("+123456789"); $x->babs(); ok 840 - is a valid object ok 841 - $x = Math::BigInt->new("-123456789"); $x->babs(); ok 842 - is a valid object ok 843 - $x = Math::BigInt->new("NaN"); $x->bsgn(); ok 844 - is a valid object ok 845 - $x = Math::BigInt->new("+inf"); $x->bsgn(); ok 846 - is a valid object ok 847 - $x = Math::BigInt->new("-inf"); $x->bsgn(); ok 848 - is a valid object ok 849 - $x = Math::BigInt->new("0"); $x->bsgn(); ok 850 - is a valid object ok 851 - $x = Math::BigInt->new("+123456789"); $x->bsgn(); ok 852 - is a valid object ok 853 - $x = Math::BigInt->new("-123456789"); $x->bsgn(); ok 854 - is a valid object ok 855 - $x = Math::BigInt->new("bcmpNaN"); $y = Math::BigInt->new("bcmpNaN"); $x->bcmp($y); ok 856 - $x = Math::BigInt->new("bcmpNaN"); $y = Math::BigInt->new("0"); $x->bcmp($y); ok 857 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("bcmpNaN"); $x->bcmp($y); ok 858 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->bcmp($y); ok 859 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x->bcmp($y); ok 860 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x->bcmp($y); ok 861 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x->bcmp($y); ok 862 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->bcmp($y); ok 863 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->bcmp($y); ok 864 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x->bcmp($y); ok 865 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x->bcmp($y); ok 866 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->bcmp($y); ok 867 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("123"); $x->bcmp($y); ok 868 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("12"); $x->bcmp($y); ok 869 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("123"); $x->bcmp($y); ok 870 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-123"); $x->bcmp($y); ok 871 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-12"); $x->bcmp($y); ok 872 - $x = Math::BigInt->new("-12"); $y = Math::BigInt->new("-123"); $x->bcmp($y); ok 873 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("124"); $x->bcmp($y); ok 874 - $x = Math::BigInt->new("124"); $y = Math::BigInt->new("123"); $x->bcmp($y); ok 875 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("-124"); $x->bcmp($y); ok 876 - $x = Math::BigInt->new("-124"); $y = Math::BigInt->new("-123"); $x->bcmp($y); ok 877 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("5"); $x->bcmp($y); ok 878 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("987654321"); $x->bcmp($y); ok 879 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x->bcmp($y); ok 880 - $x = Math::BigInt->new("-987654321"); $y = Math::BigInt->new("123456789"); $x->bcmp($y); ok 881 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5432112345"); $x->bcmp($y); ok 882 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("5432112345"); $x->bcmp($y); ok 883 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5432112345"); $x->bcmp($y); ok 884 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-5432112345"); $x->bcmp($y); ok 885 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x->bcmp($y); ok 886 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->bcmp($y); ok 887 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x->bcmp($y); ok 888 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x->bcmp($y); ok 889 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x->bcmp($y); ok 890 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x->bcmp($y); ok 891 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x->bcmp($y); ok 892 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x->bcmp($y); ok 893 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaN"); $x->bcmp($y); ok 894 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->bcmp($y); ok 895 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x->bcmp($y); ok 896 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("-inf"); $x->bcmp($y); ok 897 - $x = Math::BigInt->new("abc"); $x->binc(); ok 898 - is a valid object ok 899 - $x = Math::BigInt->new("+inf"); $x->binc(); ok 900 - is a valid object ok 901 - $x = Math::BigInt->new("-inf"); $x->binc(); ok 902 - is a valid object ok 903 - $x = Math::BigInt->new("+0"); $x->binc(); ok 904 - is a valid object ok 905 - $x = Math::BigInt->new("+1"); $x->binc(); ok 906 - is a valid object ok 907 - $x = Math::BigInt->new("-1"); $x->binc(); ok 908 - is a valid object ok 909 - $x = Math::BigInt->new("abc"); $x->bdec(); ok 910 - is a valid object ok 911 - $x = Math::BigInt->new("+inf"); $x->bdec(); ok 912 - is a valid object ok 913 - $x = Math::BigInt->new("-inf"); $x->bdec(); ok 914 - is a valid object ok 915 - $x = Math::BigInt->new("+0"); $x->bdec(); ok 916 - is a valid object ok 917 - $x = Math::BigInt->new("+1"); $x->bdec(); ok 918 - is a valid object ok 919 - $x = Math::BigInt->new("-1"); $x->bdec(); ok 920 - is a valid object ok 921 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x + $y; ok 922 - is a valid object ok 923 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x + $y; ok 924 - is a valid object ok 925 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $x + $y; ok 926 - is a valid object ok 927 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x + $y; ok 928 - is a valid object ok 929 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x + $y; ok 930 - is a valid object ok 931 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x + $y; ok 932 - is a valid object ok 933 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x + $y; ok 934 - is a valid object ok 935 - $x = Math::BigInt->new("baddNaN"); $y = Math::BigInt->new("+inf"); $x + $y; ok 936 - is a valid object ok 937 - $x = Math::BigInt->new("baddNaN"); $y = Math::BigInt->new("+inf"); $x + $y; ok 938 - is a valid object ok 939 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("baddNaN"); $x + $y; ok 940 - is a valid object ok 941 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("baddNaN"); $x + $y; ok 942 - is a valid object ok 943 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x + $y; ok 944 - is a valid object ok 945 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x + $y; ok 946 - is a valid object ok 947 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x + $y; ok 948 - is a valid object ok 949 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x + $y; ok 950 - is a valid object ok 951 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x + $y; ok 952 - is a valid object ok 953 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x + $y; ok 954 - is a valid object ok 955 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x + $y; ok 956 - is a valid object ok 957 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x + $y; ok 958 - is a valid object ok 959 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x + $y; ok 960 - is a valid object ok 961 - $x = Math::BigInt->new("+9"); $y = Math::BigInt->new("+1"); $x + $y; ok 962 - is a valid object ok 963 - $x = Math::BigInt->new("+99"); $y = Math::BigInt->new("+1"); $x + $y; ok 964 - is a valid object ok 965 - $x = Math::BigInt->new("+999"); $y = Math::BigInt->new("+1"); $x + $y; ok 966 - is a valid object ok 967 - $x = Math::BigInt->new("+9999"); $y = Math::BigInt->new("+1"); $x + $y; ok 968 - is a valid object ok 969 - $x = Math::BigInt->new("+99999"); $y = Math::BigInt->new("+1"); $x + $y; ok 970 - is a valid object ok 971 - $x = Math::BigInt->new("+999999"); $y = Math::BigInt->new("+1"); $x + $y; ok 972 - is a valid object ok 973 - $x = Math::BigInt->new("+9999999"); $y = Math::BigInt->new("+1"); $x + $y; ok 974 - is a valid object ok 975 - $x = Math::BigInt->new("+99999999"); $y = Math::BigInt->new("+1"); $x + $y; ok 976 - is a valid object ok 977 - $x = Math::BigInt->new("+999999999"); $y = Math::BigInt->new("+1"); $x + $y; ok 978 - is a valid object ok 979 - $x = Math::BigInt->new("+9999999999"); $y = Math::BigInt->new("+1"); $x + $y; ok 980 - is a valid object ok 981 - $x = Math::BigInt->new("+99999999999"); $y = Math::BigInt->new("+1"); $x + $y; ok 982 - is a valid object ok 983 - $x = Math::BigInt->new("+10"); $y = Math::BigInt->new("-1"); $x + $y; ok 984 - is a valid object ok 985 - $x = Math::BigInt->new("+100"); $y = Math::BigInt->new("-1"); $x + $y; ok 986 - is a valid object ok 987 - $x = Math::BigInt->new("+1000"); $y = Math::BigInt->new("-1"); $x + $y; ok 988 - is a valid object ok 989 - $x = Math::BigInt->new("+10000"); $y = Math::BigInt->new("-1"); $x + $y; ok 990 - is a valid object ok 991 - $x = Math::BigInt->new("+100000"); $y = Math::BigInt->new("-1"); $x + $y; ok 992 - is a valid object ok 993 - $x = Math::BigInt->new("+1000000"); $y = Math::BigInt->new("-1"); $x + $y; ok 994 - is a valid object ok 995 - $x = Math::BigInt->new("+10000000"); $y = Math::BigInt->new("-1"); $x + $y; ok 996 - is a valid object ok 997 - $x = Math::BigInt->new("+100000000"); $y = Math::BigInt->new("-1"); $x + $y; ok 998 - is a valid object ok 999 - $x = Math::BigInt->new("+1000000000"); $y = Math::BigInt->new("-1"); $x + $y; ok 1000 - is a valid object ok 1001 - $x = Math::BigInt->new("+10000000000"); $y = Math::BigInt->new("-1"); $x + $y; ok 1002 - is a valid object ok 1003 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("987654321"); $x + $y; ok 1004 - is a valid object ok 1005 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("987654321"); $x + $y; ok 1006 - is a valid object ok 1007 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("-987654321"); $x + $y; ok 1008 - is a valid object ok 1009 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x + $y; ok 1010 - is a valid object ok 1011 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10001"); $x + $y; ok 1012 - is a valid object ok 1013 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("100001"); $x + $y; ok 1014 - is a valid object ok 1015 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1000001"); $x + $y; ok 1016 - is a valid object ok 1017 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10000001"); $x + $y; ok 1018 - is a valid object ok 1019 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("100000001"); $x + $y; ok 1020 - is a valid object ok 1021 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1000000001"); $x + $y; ok 1022 - is a valid object ok 1023 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10000000001"); $x + $y; ok 1024 - is a valid object ok 1025 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("100000000001"); $x + $y; ok 1026 - is a valid object ok 1027 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1000000000001"); $x + $y; ok 1028 - is a valid object ok 1029 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("10000000000001"); $x + $y; ok 1030 - is a valid object ok 1031 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10001"); $x + $y; ok 1032 - is a valid object ok 1033 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-100001"); $x + $y; ok 1034 - is a valid object ok 1035 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1000001"); $x + $y; ok 1036 - is a valid object ok 1037 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10000001"); $x + $y; ok 1038 - is a valid object ok 1039 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-100000001"); $x + $y; ok 1040 - is a valid object ok 1041 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1000000001"); $x + $y; ok 1042 - is a valid object ok 1043 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10000000001"); $x + $y; ok 1044 - is a valid object ok 1045 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-100000000001"); $x + $y; ok 1046 - is a valid object ok 1047 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1000000000001"); $x + $y; ok 1048 - is a valid object ok 1049 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-10000000000001"); $x + $y; ok 1050 - is a valid object ok 1051 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x - $y; ok 1052 - is a valid object ok 1053 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); $x - $y; ok 1054 - is a valid object ok 1055 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $x - $y; ok 1056 - is a valid object ok 1057 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x - $y; ok 1058 - is a valid object ok 1059 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x - $y; ok 1060 - is a valid object ok 1061 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x - $y; ok 1062 - is a valid object ok 1063 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x - $y; ok 1064 - is a valid object ok 1065 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); $x - $y; ok 1066 - is a valid object ok 1067 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); $x - $y; ok 1068 - is a valid object ok 1069 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $x - $y; ok 1070 - is a valid object ok 1071 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); $x - $y; ok 1072 - is a valid object ok 1073 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+0"); $x - $y; ok 1074 - is a valid object ok 1075 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-1"); $x - $y; ok 1076 - is a valid object ok 1077 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x - $y; ok 1078 - is a valid object ok 1079 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x - $y; ok 1080 - is a valid object ok 1081 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x - $y; ok 1082 - is a valid object ok 1083 - $x = Math::BigInt->new("+9"); $y = Math::BigInt->new("+1"); $x - $y; ok 1084 - is a valid object ok 1085 - $x = Math::BigInt->new("+99"); $y = Math::BigInt->new("+1"); $x - $y; ok 1086 - is a valid object ok 1087 - $x = Math::BigInt->new("+999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1088 - is a valid object ok 1089 - $x = Math::BigInt->new("+9999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1090 - is a valid object ok 1091 - $x = Math::BigInt->new("+99999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1092 - is a valid object ok 1093 - $x = Math::BigInt->new("+999999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1094 - is a valid object ok 1095 - $x = Math::BigInt->new("+9999999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1096 - is a valid object ok 1097 - $x = Math::BigInt->new("+99999999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1098 - is a valid object ok 1099 - $x = Math::BigInt->new("+999999999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1100 - is a valid object ok 1101 - $x = Math::BigInt->new("+9999999999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1102 - is a valid object ok 1103 - $x = Math::BigInt->new("+99999999999"); $y = Math::BigInt->new("+1"); $x - $y; ok 1104 - is a valid object ok 1105 - $x = Math::BigInt->new("+10"); $y = Math::BigInt->new("-1"); $x - $y; ok 1106 - is a valid object ok 1107 - $x = Math::BigInt->new("+100"); $y = Math::BigInt->new("-1"); $x - $y; ok 1108 - is a valid object ok 1109 - $x = Math::BigInt->new("+1000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1110 - is a valid object ok 1111 - $x = Math::BigInt->new("+10000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1112 - is a valid object ok 1113 - $x = Math::BigInt->new("+100000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1114 - is a valid object ok 1115 - $x = Math::BigInt->new("+1000000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1116 - is a valid object ok 1117 - $x = Math::BigInt->new("+10000000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1118 - is a valid object ok 1119 - $x = Math::BigInt->new("+100000000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1120 - is a valid object ok 1121 - $x = Math::BigInt->new("+1000000000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1122 - is a valid object ok 1123 - $x = Math::BigInt->new("+10000000000"); $y = Math::BigInt->new("-1"); $x - $y; ok 1124 - is a valid object ok 1125 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("+987654321"); $x - $y; ok 1126 - is a valid object ok 1127 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("+987654321"); $x - $y; ok 1128 - is a valid object ok 1129 - $x = Math::BigInt->new("-123456789"); $y = Math::BigInt->new("-987654321"); $x - $y; ok 1130 - is a valid object ok 1131 - $x = Math::BigInt->new("+123456789"); $y = Math::BigInt->new("-987654321"); $x - $y; ok 1132 - is a valid object ok 1133 - $x = Math::BigInt->new("10001"); $y = Math::BigInt->new("1"); $x - $y; ok 1134 - is a valid object ok 1135 - $x = Math::BigInt->new("100001"); $y = Math::BigInt->new("1"); $x - $y; ok 1136 - is a valid object ok 1137 - $x = Math::BigInt->new("1000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1138 - is a valid object ok 1139 - $x = Math::BigInt->new("10000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1140 - is a valid object ok 1141 - $x = Math::BigInt->new("100000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1142 - is a valid object ok 1143 - $x = Math::BigInt->new("1000000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1144 - is a valid object ok 1145 - $x = Math::BigInt->new("10000000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1146 - is a valid object ok 1147 - $x = Math::BigInt->new("100000000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1148 - is a valid object ok 1149 - $x = Math::BigInt->new("1000000000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1150 - is a valid object ok 1151 - $x = Math::BigInt->new("10000000000001"); $y = Math::BigInt->new("1"); $x - $y; ok 1152 - is a valid object ok 1153 - $x = Math::BigInt->new("10001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1154 - is a valid object ok 1155 - $x = Math::BigInt->new("100001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1156 - is a valid object ok 1157 - $x = Math::BigInt->new("1000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1158 - is a valid object ok 1159 - $x = Math::BigInt->new("10000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1160 - is a valid object ok 1161 - $x = Math::BigInt->new("100000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1162 - is a valid object ok 1163 - $x = Math::BigInt->new("1000000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1164 - is a valid object ok 1165 - $x = Math::BigInt->new("10000000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1166 - is a valid object ok 1167 - $x = Math::BigInt->new("100000000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1168 - is a valid object ok 1169 - $x = Math::BigInt->new("1000000000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1170 - is a valid object ok 1171 - $x = Math::BigInt->new("10000000000001"); $y = Math::BigInt->new("-1"); $x - $y; ok 1172 - is a valid object ok 1173 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1174 - is a valid object ok 1175 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1176 - is a valid object ok 1177 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1178 - is a valid object ok 1179 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("abc"); $x->bmuladd($y, $z); ok 1180 - is a valid object ok 1181 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("+inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1182 - is a valid object ok 1183 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("-inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1184 - is a valid object ok 1185 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaNmul"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1186 - is a valid object ok 1187 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaNmul"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1188 - is a valid object ok 1189 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1190 - is a valid object ok 1191 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1192 - is a valid object ok 1193 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1194 - is a valid object ok 1195 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1196 - is a valid object ok 1197 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1198 - is a valid object ok 1199 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1200 - is a valid object ok 1201 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1202 - is a valid object ok 1203 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1204 - is a valid object ok 1205 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1206 - is a valid object ok 1207 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1208 - is a valid object ok 1209 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("123456789123456789"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1210 - is a valid object ok 1211 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1212 - is a valid object ok 1213 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1214 - is a valid object ok 1215 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1216 - is a valid object ok 1217 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1218 - is a valid object ok 1219 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1220 - is a valid object ok 1221 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1222 - is a valid object ok 1223 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("+3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1224 - is a valid object ok 1225 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1226 - is a valid object ok 1227 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1228 - is a valid object ok 1229 - $x = Math::BigInt->new("111"); $y = Math::BigInt->new("111"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1230 - is a valid object ok 1231 - $x = Math::BigInt->new("10101"); $y = Math::BigInt->new("10101"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1232 - is a valid object ok 1233 - $x = Math::BigInt->new("1001001"); $y = Math::BigInt->new("1001001"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1234 - is a valid object ok 1235 - $x = Math::BigInt->new("100010001"); $y = Math::BigInt->new("100010001"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1236 - is a valid object ok 1237 - $x = Math::BigInt->new("10000100001"); $y = Math::BigInt->new("10000100001"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1238 - is a valid object ok 1239 - $x = Math::BigInt->new("11111111111"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1240 - is a valid object ok 1241 - $x = Math::BigInt->new("22222222222"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1242 - is a valid object ok 1243 - $x = Math::BigInt->new("33333333333"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1244 - is a valid object ok 1245 - $x = Math::BigInt->new("44444444444"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1246 - is a valid object ok 1247 - $x = Math::BigInt->new("55555555555"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1248 - is a valid object ok 1249 - $x = Math::BigInt->new("66666666666"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1250 - is a valid object ok 1251 - $x = Math::BigInt->new("77777777777"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1252 - is a valid object ok 1253 - $x = Math::BigInt->new("88888888888"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1254 - is a valid object ok 1255 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("0"); $x->bmuladd($y, $z); ok 1256 - is a valid object ok 1257 - $x = Math::BigInt->new("11111111111"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1258 - is a valid object ok 1259 - $x = Math::BigInt->new("22222222222"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1260 - is a valid object ok 1261 - $x = Math::BigInt->new("33333333333"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1262 - is a valid object ok 1263 - $x = Math::BigInt->new("44444444444"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1264 - is a valid object ok 1265 - $x = Math::BigInt->new("55555555555"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1266 - is a valid object ok 1267 - $x = Math::BigInt->new("66666666666"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1268 - is a valid object ok 1269 - $x = Math::BigInt->new("77777777777"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1270 - is a valid object ok 1271 - $x = Math::BigInt->new("88888888888"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1272 - is a valid object ok 1273 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("9"); $z = Math::BigInt->new("1"); $x->bmuladd($y, $z); ok 1274 - is a valid object ok 1275 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("-4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z); ok 1276 - is a valid object ok 1277 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z); ok 1278 - is a valid object ok 1279 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z); ok 1280 - is a valid object ok 1281 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("-5"); $x->bmuladd($y, $z); ok 1282 - is a valid object ok 1283 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("5"); $x->bmuladd($y, $z); ok 1284 - is a valid object ok 1285 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-4"); $z = Math::BigInt->new("5"); $x->bmuladd($y, $z); ok 1286 - is a valid object ok 1287 - $x = Math::BigInt->new("9999999999999999999"); $y = Math::BigInt->new("10000000000000000000"); $z = Math::BigInt->new("1234567890"); $x->bmuladd($y, $z); ok 1288 - is a valid object ok 1289 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("12345678901234567890"); $x->bmuladd($y, $z); ok 1290 - is a valid object ok 1291 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x * $y; ok 1292 - is a valid object ok 1293 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); $x * $y; ok 1294 - is a valid object ok 1295 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); $x * $y; ok 1296 - is a valid object ok 1297 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("+inf"); $x * $y; ok 1298 - is a valid object ok 1299 - $x = Math::BigInt->new("NaNmul"); $y = Math::BigInt->new("-inf"); $x * $y; ok 1300 - is a valid object ok 1301 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaNmul"); $x * $y; ok 1302 - is a valid object ok 1303 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaNmul"); $x * $y; ok 1304 - is a valid object ok 1305 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("+inf"); $x * $y; ok 1306 - is a valid object ok 1307 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-inf"); $x * $y; ok 1308 - is a valid object ok 1309 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x * $y; ok 1310 - is a valid object ok 1311 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x * $y; ok 1312 - is a valid object ok 1313 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); $x * $y; ok 1314 - is a valid object ok 1315 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); $x * $y; ok 1316 - is a valid object ok 1317 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); $x * $y; ok 1318 - is a valid object ok 1319 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("-1"); $x * $y; ok 1320 - is a valid object ok 1321 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+0"); $x * $y; ok 1322 - is a valid object ok 1323 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("0"); $x * $y; ok 1324 - is a valid object ok 1325 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("123456789123456789"); $x * $y; ok 1326 - is a valid object ok 1327 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x * $y; ok 1328 - is a valid object ok 1329 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("+1"); $x * $y; ok 1330 - is a valid object ok 1331 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("-1"); $x * $y; ok 1332 - is a valid object ok 1333 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); $x * $y; ok 1334 - is a valid object ok 1335 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+3"); $x * $y; ok 1336 - is a valid object ok 1337 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("+3"); $x * $y; ok 1338 - is a valid object ok 1339 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("-3"); $x * $y; ok 1340 - is a valid object ok 1341 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x * $y; ok 1342 - is a valid object ok 1343 - $x = Math::BigInt->new("111"); $y = Math::BigInt->new("111"); $x * $y; ok 1344 - is a valid object ok 1345 - $x = Math::BigInt->new("10101"); $y = Math::BigInt->new("10101"); $x * $y; ok 1346 - is a valid object ok 1347 - $x = Math::BigInt->new("1001001"); $y = Math::BigInt->new("1001001"); $x * $y; ok 1348 - is a valid object ok 1349 - $x = Math::BigInt->new("100010001"); $y = Math::BigInt->new("100010001"); $x * $y; ok 1350 - is a valid object ok 1351 - $x = Math::BigInt->new("10000100001"); $y = Math::BigInt->new("10000100001"); $x * $y; ok 1352 - is a valid object ok 1353 - $x = Math::BigInt->new("11111111111"); $y = Math::BigInt->new("9"); $x * $y; ok 1354 - is a valid object ok 1355 - $x = Math::BigInt->new("22222222222"); $y = Math::BigInt->new("9"); $x * $y; ok 1356 - is a valid object ok 1357 - $x = Math::BigInt->new("33333333333"); $y = Math::BigInt->new("9"); $x * $y; ok 1358 - is a valid object ok 1359 - $x = Math::BigInt->new("44444444444"); $y = Math::BigInt->new("9"); $x * $y; ok 1360 - is a valid object ok 1361 - $x = Math::BigInt->new("55555555555"); $y = Math::BigInt->new("9"); $x * $y; ok 1362 - is a valid object ok 1363 - $x = Math::BigInt->new("66666666666"); $y = Math::BigInt->new("9"); $x * $y; ok 1364 - is a valid object ok 1365 - $x = Math::BigInt->new("77777777777"); $y = Math::BigInt->new("9"); $x * $y; ok 1366 - is a valid object ok 1367 - $x = Math::BigInt->new("88888888888"); $y = Math::BigInt->new("9"); $x * $y; ok 1368 - is a valid object ok 1369 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("9"); $x * $y; ok 1370 - is a valid object ok 1371 - $x = Math::BigInt->new("+25"); $y = Math::BigInt->new("+25"); $x * $y; ok 1372 - is a valid object ok 1373 - $x = Math::BigInt->new("+12345"); $y = Math::BigInt->new("+12345"); $x * $y; ok 1374 - is a valid object ok 1375 - $x = Math::BigInt->new("+99999"); $y = Math::BigInt->new("+11111"); $x * $y; ok 1376 - is a valid object ok 1377 - $x = Math::BigInt->new("9999"); $y = Math::BigInt->new("10000"); $x * $y; ok 1378 - is a valid object ok 1379 - $x = Math::BigInt->new("99999"); $y = Math::BigInt->new("100000"); $x * $y; ok 1380 - is a valid object ok 1381 - $x = Math::BigInt->new("999999"); $y = Math::BigInt->new("1000000"); $x * $y; ok 1382 - is a valid object ok 1383 - $x = Math::BigInt->new("9999999"); $y = Math::BigInt->new("10000000"); $x * $y; ok 1384 - is a valid object ok 1385 - $x = Math::BigInt->new("99999999"); $y = Math::BigInt->new("100000000"); $x * $y; ok 1386 - is a valid object ok 1387 - $x = Math::BigInt->new("999999999"); $y = Math::BigInt->new("1000000000"); $x * $y; ok 1388 - is a valid object ok 1389 - $x = Math::BigInt->new("9999999999"); $y = Math::BigInt->new("10000000000"); $x * $y; ok 1390 - is a valid object ok 1391 - $x = Math::BigInt->new("99999999999"); $y = Math::BigInt->new("100000000000"); $x * $y; ok 1392 - is a valid object ok 1393 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("1000000000000"); $x * $y; ok 1394 - is a valid object ok 1395 - $x = Math::BigInt->new("9999999999999"); $y = Math::BigInt->new("10000000000000"); $x * $y; ok 1396 - is a valid object ok 1397 - $x = Math::BigInt->new("99999999999999"); $y = Math::BigInt->new("100000000000000"); $x * $y; ok 1398 - is a valid object ok 1399 - $x = Math::BigInt->new("999999999999999"); $y = Math::BigInt->new("1000000000000000"); $x * $y; ok 1400 - is a valid object ok 1401 - $x = Math::BigInt->new("9999999999999999"); $y = Math::BigInt->new("10000000000000000"); $x * $y; ok 1402 - is a valid object ok 1403 - $x = Math::BigInt->new("99999999999999999"); $y = Math::BigInt->new("100000000000000000"); $x * $y; ok 1404 - is a valid object ok 1405 - $x = Math::BigInt->new("999999999999999999"); $y = Math::BigInt->new("1000000000000000000"); $x * $y; ok 1406 - is a valid object ok 1407 - $x = Math::BigInt->new("9999999999999999999"); $y = Math::BigInt->new("10000000000000000000"); $x * $y; ok 1408 - is a valid object ok 1409 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("20"); join (",", $x->bdiv($y)); ok 1410 - $x = Math::BigInt->new("4095"); $y = Math::BigInt->new("4095"); join (",", $x->bdiv($y)); ok 1411 - $x = Math::BigInt->new("-4095"); $y = Math::BigInt->new("-4095"); join (",", $x->bdiv($y)); ok 1412 - $x = Math::BigInt->new("4095"); $y = Math::BigInt->new("-4095"); join (",", $x->bdiv($y)); ok 1413 - $x = Math::BigInt->new("-4095"); $y = Math::BigInt->new("4095"); join (",", $x->bdiv($y)); ok 1414 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("2"); join (",", $x->bdiv($y)); ok 1415 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y)); ok 1416 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("4"); join (",", $x->bdiv($y)); ok 1417 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("8"); join (",", $x->bdiv($y)); ok 1418 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("8"); join (",", $x->bdiv($y)); ok 1419 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("2"); join (",", $x->bdiv($y)); ok 1420 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("-2"); join (",", $x->bdiv($y)); ok 1421 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("2"); join (",", $x->bdiv($y)); ok 1422 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y)); ok 1423 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y)); ok 1424 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y)); ok 1425 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y)); ok 1426 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y)); ok 1427 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y)); ok 1428 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y)); ok 1429 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y)); ok 1430 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-5"); join (",", $x->bdiv($y)); ok 1431 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5"); join (",", $x->bdiv($y)); ok 1432 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); join (",", $x->bdiv($y)); ok 1433 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-5"); join (",", $x->bdiv($y)); ok 1434 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y)); ok 1435 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y)); ok 1436 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); join (",", $x->bdiv($y)); ok 1437 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); join (",", $x->bdiv($y)); ok 1438 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y)); ok 1439 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y)); ok 1440 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y)); ok 1441 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y)); ok 1442 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); join (",", $x->bdiv($y)); ok 1443 - $x = Math::BigInt->new("1234567812345678"); $y = Math::BigInt->new("123456712345678"); join (",", $x->bdiv($y)); ok 1444 - $x = Math::BigInt->new("12345671234567"); $y = Math::BigInt->new("1234561234567"); join (",", $x->bdiv($y)); ok 1445 - $x = Math::BigInt->new("123456123456"); $y = Math::BigInt->new("12345123456"); join (",", $x->bdiv($y)); ok 1446 - $x = Math::BigInt->new("1234512345"); $y = Math::BigInt->new("123412345"); join (",", $x->bdiv($y)); ok 1447 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("1234567890"); join (",", $x->bdiv($y)); ok 1448 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("1234567890"); join (",", $x->bdiv($y)); ok 1449 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("9876543210"); join (",", $x->bdiv($y)); ok 1450 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("9876543210"); join (",", $x->bdiv($y)); ok 1451 - $x = Math::BigInt->new("96969696969696969696969696969678787878626262626262626262626262"); $y = Math::BigInt->new("484848484848484848484848486666666666666689898989898989898989"); join (",", $x->bdiv($y)); ok 1452 - $x = Math::BigInt->new("1267650600228229401496703205375"); $y = Math::BigInt->new("1267650600228229401496703205376"); join (",", $x->bdiv($y)); ok 1453 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("999999999999999999999999999999999"); join (",", $x->bdiv($y)); ok 1454 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("888888888888888888888888888888888"); join (",", $x->bdiv($y)); ok 1455 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("777777777777777777777777777777777"); join (",", $x->bdiv($y)); ok 1456 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("666666666666666666666666666666666"); join (",", $x->bdiv($y)); ok 1457 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("555555555555555555555555555555555"); join (",", $x->bdiv($y)); ok 1458 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("444444444444444444444444444444444"); join (",", $x->bdiv($y)); ok 1459 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("333333333333333333333333333333333"); join (",", $x->bdiv($y)); ok 1460 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("222222222222222222222222222222222"); join (",", $x->bdiv($y)); ok 1461 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("111111111111111111111111111111111"); join (",", $x->bdiv($y)); ok 1462 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_3333333_3333333_3333333"); join (",", $x->bdiv($y)); ok 1463 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1464 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3000000_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1465 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("2000000_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1466 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000000_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1467 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100000_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1468 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10000_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1469 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1470 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1471 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1472 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1_0000000_0000000_0000000"); join (",", $x->bdiv($y)); ok 1473 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x / $y; ok 1474 - is a valid object ok 1475 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("1"); $x / $y; ok 1476 - is a valid object ok 1477 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("abc"); $x / $y; ok 1478 - is a valid object ok 1479 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x / $y; ok 1480 - is a valid object ok 1481 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x / $y; ok 1482 - is a valid object ok 1483 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x / $y; ok 1484 - is a valid object ok 1485 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x / $y; ok 1486 - is a valid object ok 1487 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); $x / $y; ok 1488 - is a valid object ok 1489 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("inf"); $x / $y; ok 1490 - is a valid object ok 1491 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x / $y; ok 1492 - is a valid object ok 1493 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $x / $y; ok 1494 - is a valid object ok 1495 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); $x / $y; ok 1496 - is a valid object ok 1497 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-5"); $x / $y; ok 1498 - is a valid object ok 1499 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5"); $x / $y; ok 1500 - is a valid object ok 1501 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); $x / $y; ok 1502 - is a valid object ok 1503 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-5"); $x / $y; ok 1504 - is a valid object ok 1505 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); $x / $y; ok 1506 - is a valid object ok 1507 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x / $y; ok 1508 - is a valid object ok 1509 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); $x / $y; ok 1510 - is a valid object ok 1511 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x / $y; ok 1512 - is a valid object ok 1513 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("0"); $x / $y; ok 1514 - is a valid object ok 1515 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); $x / $y; ok 1516 - is a valid object ok 1517 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("0"); $x / $y; ok 1518 - is a valid object ok 1519 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); $x / $y; ok 1520 - is a valid object ok 1521 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x / $y; ok 1522 - is a valid object ok 1523 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("2"); $x / $y; ok 1524 - is a valid object ok 1525 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("-2"); $x / $y; ok 1526 - is a valid object ok 1527 - $x = Math::BigInt->new("-11"); $y = Math::BigInt->new("2"); $x / $y; ok 1528 - is a valid object ok 1529 - $x = Math::BigInt->new("11"); $y = Math::BigInt->new("-2"); $x / $y; ok 1530 - is a valid object ok 1531 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x / $y; ok 1532 - is a valid object ok 1533 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x / $y; ok 1534 - is a valid object ok 1535 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x / $y; ok 1536 - is a valid object ok 1537 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x / $y; ok 1538 - is a valid object ok 1539 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x / $y; ok 1540 - is a valid object ok 1541 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x / $y; ok 1542 - is a valid object ok 1543 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x / $y; ok 1544 - is a valid object ok 1545 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x / $y; ok 1546 - is a valid object ok 1547 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("26"); $x / $y; ok 1548 - is a valid object ok 1549 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1550 - is a valid object ok 1551 - $x = Math::BigInt->new("2000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1552 - is a valid object ok 1553 - $x = Math::BigInt->new("3000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1554 - is a valid object ok 1555 - $x = Math::BigInt->new("4000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1556 - is a valid object ok 1557 - $x = Math::BigInt->new("5000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1558 - is a valid object ok 1559 - $x = Math::BigInt->new("6000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1560 - is a valid object ok 1561 - $x = Math::BigInt->new("7000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1562 - is a valid object ok 1563 - $x = Math::BigInt->new("8000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1564 - is a valid object ok 1565 - $x = Math::BigInt->new("9000000000"); $y = Math::BigInt->new("9"); $x / $y; ok 1566 - is a valid object ok 1567 - $x = Math::BigInt->new("35500000"); $y = Math::BigInt->new("113"); $x / $y; ok 1568 - is a valid object ok 1569 - $x = Math::BigInt->new("71000000"); $y = Math::BigInt->new("226"); $x / $y; ok 1570 - is a valid object ok 1571 - $x = Math::BigInt->new("106500000"); $y = Math::BigInt->new("339"); $x / $y; ok 1572 - is a valid object ok 1573 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("3"); $x / $y; ok 1574 - is a valid object ok 1575 - $x = Math::BigInt->new("+10"); $y = Math::BigInt->new("+5"); $x / $y; ok 1576 - is a valid object ok 1577 - $x = Math::BigInt->new("+100"); $y = Math::BigInt->new("+4"); $x / $y; ok 1578 - is a valid object ok 1579 - $x = Math::BigInt->new("+1000"); $y = Math::BigInt->new("+8"); $x / $y; ok 1580 - is a valid object ok 1581 - $x = Math::BigInt->new("+10000"); $y = Math::BigInt->new("+16"); $x / $y; ok 1582 - is a valid object ok 1583 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9"); $x / $y; ok 1584 - is a valid object ok 1585 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("99"); $x / $y; ok 1586 - is a valid object ok 1587 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("999"); $x / $y; ok 1588 - is a valid object ok 1589 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9999"); $x / $y; ok 1590 - is a valid object ok 1591 - $x = Math::BigInt->new("999999999999999"); $y = Math::BigInt->new("99999"); $x / $y; ok 1592 - is a valid object ok 1593 - $x = Math::BigInt->new("+1111088889"); $y = Math::BigInt->new("99999"); $x / $y; ok 1594 - is a valid object ok 1595 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-3"); $x / $y; ok 1596 - is a valid object ok 1597 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("3"); $x / $y; ok 1598 - is a valid object ok 1599 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $x / $y; ok 1600 - is a valid object ok 1601 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-3"); $x / $y; ok 1602 - is a valid object ok 1603 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x / $y; ok 1604 - is a valid object ok 1605 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-3"); $x / $y; ok 1606 - is a valid object ok 1607 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x / $y; ok 1608 - is a valid object ok 1609 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x / $y; ok 1610 - is a valid object ok 1611 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("3"); $x / $y; ok 1612 - is a valid object ok 1613 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("3"); $x / $y; ok 1614 - is a valid object ok 1615 - $x = Math::BigInt->new("14"); $y = Math::BigInt->new("-3"); $x / $y; ok 1616 - is a valid object ok 1617 - $x = Math::BigInt->new("-14"); $y = Math::BigInt->new("3"); $x / $y; ok 1618 - is a valid object ok 1619 - $x = Math::BigInt->new("-14"); $y = Math::BigInt->new("-3"); $x / $y; ok 1620 - is a valid object ok 1621 - $x = Math::BigInt->new("14"); $y = Math::BigInt->new("3"); $x / $y; ok 1622 - is a valid object ok 1623 - $x = Math::BigInt->new("10000000000000000000000000000000000000000000000000000000000000000000000000000000000"); $y = Math::BigInt->new("10000000375084540248994272022843165711074"); $x / $y; ok 1624 - is a valid object ok 1625 - $x = Math::BigInt->new("1234567812345678"); $y = Math::BigInt->new("123456712345678"); $x / $y; ok 1626 - is a valid object ok 1627 - $x = Math::BigInt->new("12345671234567"); $y = Math::BigInt->new("1234561234567"); $x / $y; ok 1628 - is a valid object ok 1629 - $x = Math::BigInt->new("123456123456"); $y = Math::BigInt->new("12345123456"); $x / $y; ok 1630 - is a valid object ok 1631 - $x = Math::BigInt->new("1234512345"); $y = Math::BigInt->new("123412345"); $x / $y; ok 1632 - is a valid object ok 1633 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("1234567890"); $x / $y; ok 1634 - is a valid object ok 1635 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("1234567890"); $x / $y; ok 1636 - is a valid object ok 1637 - $x = Math::BigInt->new("1234567890999999999"); $y = Math::BigInt->new("9876543210"); $x / $y; ok 1638 - is a valid object ok 1639 - $x = Math::BigInt->new("1234567890000000000"); $y = Math::BigInt->new("9876543210"); $x / $y; ok 1640 - is a valid object ok 1641 - $x = Math::BigInt->new("96969696969696969696969696969678787878626262626262626262626262"); $y = Math::BigInt->new("484848484848484848484848486666666666666689898989898989898989"); $x / $y; ok 1642 - is a valid object ok 1643 - $x = Math::BigInt->new("84696969696969696956565656566184292929292929292847474747436308080808080808086765396464646464646465"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y; ok 1644 - is a valid object ok 1645 - $x = Math::BigInt->new("84696969696969696943434343434871161616161616161452525252486813131313131313143230042929292929292930"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y; ok 1646 - is a valid object ok 1647 - $x = Math::BigInt->new("84696969696969696969696969697497424242424242424242424242385803030303030303030300750000000000000000"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y; ok 1648 - is a valid object ok 1649 - $x = Math::BigInt->new("84696969696969696930303030303558030303030303030057575757537318181818181818199694689393939393939395"); $y = Math::BigInt->new("13131313131313131313131313131394949494949494949494949494943535353535353535353535"); $x / $y; ok 1650 - is a valid object ok 1651 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("999999999999999999999999999999999"); $x / $y; ok 1652 - is a valid object ok 1653 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("888888888888888888888888888888888"); $x / $y; ok 1654 - is a valid object ok 1655 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("777777777777777777777777777777777"); $x / $y; ok 1656 - is a valid object ok 1657 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("666666666666666666666666666666666"); $x / $y; ok 1658 - is a valid object ok 1659 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("555555555555555555555555555555555"); $x / $y; ok 1660 - is a valid object ok 1661 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("444444444444444444444444444444444"); $x / $y; ok 1662 - is a valid object ok 1663 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("333333333333333333333333333333333"); $x / $y; ok 1664 - is a valid object ok 1665 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("222222222222222222222222222222222"); $x / $y; ok 1666 - is a valid object ok 1667 - $x = Math::BigInt->new("999999999999999999999999999999999"); $y = Math::BigInt->new("111111111111111111111111111111111"); $x / $y; ok 1668 - is a valid object ok 1669 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_3333333_3333333_3333333"); $x / $y; ok 1670 - is a valid object ok 1671 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3333333_0000000_0000000_0000000"); $x / $y; ok 1672 - is a valid object ok 1673 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("3000000_0000000_0000000_0000000"); $x / $y; ok 1674 - is a valid object ok 1675 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("2000000_0000000_0000000_0000000"); $x / $y; ok 1676 - is a valid object ok 1677 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000000_0000000_0000000_0000000"); $x / $y; ok 1678 - is a valid object ok 1679 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100000_0000000_0000000_0000000"); $x / $y; ok 1680 - is a valid object ok 1681 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10000_0000000_0000000_0000000"); $x / $y; ok 1682 - is a valid object ok 1683 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1000_0000000_0000000_0000000"); $x / $y; ok 1684 - is a valid object ok 1685 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("100_0000000_0000000_0000000"); $x / $y; ok 1686 - is a valid object ok 1687 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("10_0000000_0000000_0000000"); $x / $y; ok 1688 - is a valid object ok 1689 - $x = Math::BigInt->new("9999999_9999999_9999999_9999999"); $y = Math::BigInt->new("1_0000000_0000000_0000000"); $x / $y; ok 1690 - is a valid object ok 1691 - $x = Math::BigInt->new("949418181818187070707070707070707070"); $y = Math::BigInt->new("181818181853535353535353535353535353"); $x / $y; ok 1692 - is a valid object ok 1693 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x->bmodinv($y); ok 1694 - is a valid object ok 1695 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("5"); $x->bmodinv($y); ok 1696 - is a valid object ok 1697 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("abc"); $x->bmodinv($y); ok 1698 - is a valid object ok 1699 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->bmodinv($y); ok 1700 - is a valid object ok 1701 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("5"); $x->bmodinv($y); ok 1702 - is a valid object ok 1703 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-5"); $x->bmodinv($y); ok 1704 - is a valid object ok 1705 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("5"); $x->bmodinv($y); ok 1706 - is a valid object ok 1707 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("5033"); $x->bmodinv($y); ok 1708 - is a valid object ok 1709 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("13"); $x->bmodinv($y); ok 1710 - is a valid object ok 1711 - $x = Math::BigInt->new("-1234567891"); $y = Math::BigInt->new("13"); $x->bmodinv($y); ok 1712 - is a valid object ok 1713 - $x = Math::BigInt->new("324958749843759385732954874325984357439658735983745"); $y = Math::BigInt->new("2348249874968739"); $x->bmodinv($y); ok 1714 - is a valid object ok 1715 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1716 - is a valid object ok 1717 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1718 - is a valid object ok 1719 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1720 - is a valid object ok 1721 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1722 - is a valid object ok 1723 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1724 - is a valid object ok 1725 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1726 - is a valid object ok 1727 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $x->bmodinv($y); ok 1728 - is a valid object ok 1729 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1730 - is a valid object ok 1731 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1732 - is a valid object ok 1733 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1734 - is a valid object ok 1735 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1736 - is a valid object ok 1737 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1738 - is a valid object ok 1739 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1740 - is a valid object ok 1741 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $x->bmodinv($y); ok 1742 - is a valid object ok 1743 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1744 - is a valid object ok 1745 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1746 - is a valid object ok 1747 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1748 - is a valid object ok 1749 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1750 - is a valid object ok 1751 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1752 - is a valid object ok 1753 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1754 - is a valid object ok 1755 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $x->bmodinv($y); ok 1756 - is a valid object ok 1757 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $x->bmodinv($y); ok 1758 - is a valid object ok 1759 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x->bmodinv($y); ok 1760 - is a valid object ok 1761 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); $x->bmodinv($y); ok 1762 - is a valid object ok 1763 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); $x->bmodinv($y); ok 1764 - is a valid object ok 1765 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z); ok 1766 - is a valid object ok 1767 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z); ok 1768 - is a valid object ok 1769 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z); ok 1770 - is a valid object ok 1771 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z); ok 1772 - is a valid object ok 1773 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("abc"); $x->bmodpow($y, $z); ok 1774 - is a valid object ok 1775 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("abc"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z); ok 1776 - is a valid object ok 1777 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z); ok 1778 - is a valid object ok 1779 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("0"); $x->bmodpow($y, $z); ok 1780 - is a valid object ok 1781 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("2"); $x->bmodpow($y, $z); ok 1782 - is a valid object ok 1783 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("2"); $x->bmodpow($y, $z); ok 1784 - is a valid object ok 1785 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("5"); $x->bmodpow($y, $z); ok 1786 - is a valid object ok 1787 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1788 - is a valid object ok 1789 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1790 - is a valid object ok 1791 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1792 - is a valid object ok 1793 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1794 - is a valid object ok 1795 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1796 - is a valid object ok 1797 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1798 - is a valid object ok 1799 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1800 - is a valid object ok 1801 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1802 - is a valid object ok 1803 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1804 - is a valid object ok 1805 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1806 - is a valid object ok 1807 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1808 - is a valid object ok 1809 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1810 - is a valid object ok 1811 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1812 - is a valid object ok 1813 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1814 - is a valid object ok 1815 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1816 - is a valid object ok 1817 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1818 - is a valid object ok 1819 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1820 - is a valid object ok 1821 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1822 - is a valid object ok 1823 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1824 - is a valid object ok 1825 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1826 - is a valid object ok 1827 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1828 - is a valid object ok 1829 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1830 - is a valid object ok 1831 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1832 - is a valid object ok 1833 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1834 - is a valid object ok 1835 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1836 - is a valid object ok 1837 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1838 - is a valid object ok 1839 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1840 - is a valid object ok 1841 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1842 - is a valid object ok 1843 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1844 - is a valid object ok 1845 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1846 - is a valid object ok 1847 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1848 - is a valid object ok 1849 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1850 - is a valid object ok 1851 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1852 - is a valid object ok 1853 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1854 - is a valid object ok 1855 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1856 - is a valid object ok 1857 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1858 - is a valid object ok 1859 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1860 - is a valid object ok 1861 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1862 - is a valid object ok 1863 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1864 - is a valid object ok 1865 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1866 - is a valid object ok 1867 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1868 - is a valid object ok 1869 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1870 - is a valid object ok 1871 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1872 - is a valid object ok 1873 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1874 - is a valid object ok 1875 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1876 - is a valid object ok 1877 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1878 - is a valid object ok 1879 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1880 - is a valid object ok 1881 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1882 - is a valid object ok 1883 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 1884 - is a valid object ok 1885 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1886 - is a valid object ok 1887 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1888 - is a valid object ok 1889 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1890 - is a valid object ok 1891 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1892 - is a valid object ok 1893 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1894 - is a valid object ok 1895 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1896 - is a valid object ok 1897 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1898 - is a valid object ok 1899 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1900 - is a valid object ok 1901 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1902 - is a valid object ok 1903 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1904 - is a valid object ok 1905 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1906 - is a valid object ok 1907 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1908 - is a valid object ok 1909 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1910 - is a valid object ok 1911 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1912 - is a valid object ok 1913 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1914 - is a valid object ok 1915 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1916 - is a valid object ok 1917 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1918 - is a valid object ok 1919 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1920 - is a valid object ok 1921 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1922 - is a valid object ok 1923 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1924 - is a valid object ok 1925 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1926 - is a valid object ok 1927 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1928 - is a valid object ok 1929 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1930 - is a valid object ok 1931 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1932 - is a valid object ok 1933 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1934 - is a valid object ok 1935 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1936 - is a valid object ok 1937 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1938 - is a valid object ok 1939 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1940 - is a valid object ok 1941 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1942 - is a valid object ok 1943 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1944 - is a valid object ok 1945 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1946 - is a valid object ok 1947 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1948 - is a valid object ok 1949 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1950 - is a valid object ok 1951 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1952 - is a valid object ok 1953 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1954 - is a valid object ok 1955 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1956 - is a valid object ok 1957 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1958 - is a valid object ok 1959 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1960 - is a valid object ok 1961 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1962 - is a valid object ok 1963 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1964 - is a valid object ok 1965 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1966 - is a valid object ok 1967 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1968 - is a valid object ok 1969 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1970 - is a valid object ok 1971 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1972 - is a valid object ok 1973 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1974 - is a valid object ok 1975 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1976 - is a valid object ok 1977 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1978 - is a valid object ok 1979 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1980 - is a valid object ok 1981 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("3"); $x->bmodpow($y, $z); ok 1982 - is a valid object ok 1983 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1984 - is a valid object ok 1985 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1986 - is a valid object ok 1987 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1988 - is a valid object ok 1989 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1990 - is a valid object ok 1991 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1992 - is a valid object ok 1993 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1994 - is a valid object ok 1995 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1996 - is a valid object ok 1997 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 1998 - is a valid object ok 1999 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2000 - is a valid object ok 2001 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2002 - is a valid object ok 2003 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2004 - is a valid object ok 2005 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2006 - is a valid object ok 2007 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2008 - is a valid object ok 2009 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2010 - is a valid object ok 2011 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2012 - is a valid object ok 2013 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2014 - is a valid object ok 2015 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2016 - is a valid object ok 2017 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2018 - is a valid object ok 2019 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2020 - is a valid object ok 2021 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2022 - is a valid object ok 2023 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("0"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2024 - is a valid object ok 2025 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2026 - is a valid object ok 2027 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2028 - is a valid object ok 2029 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2030 - is a valid object ok 2031 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2032 - is a valid object ok 2033 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2034 - is a valid object ok 2035 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2036 - is a valid object ok 2037 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2038 - is a valid object ok 2039 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2040 - is a valid object ok 2041 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2042 - is a valid object ok 2043 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2044 - is a valid object ok 2045 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2046 - is a valid object ok 2047 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2048 - is a valid object ok 2049 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2050 - is a valid object ok 2051 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2052 - is a valid object ok 2053 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2054 - is a valid object ok 2055 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2056 - is a valid object ok 2057 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2058 - is a valid object ok 2059 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2060 - is a valid object ok 2061 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2062 - is a valid object ok 2063 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2064 - is a valid object ok 2065 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2066 - is a valid object ok 2067 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2068 - is a valid object ok 2069 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2070 - is a valid object ok 2071 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2072 - is a valid object ok 2073 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2074 - is a valid object ok 2075 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2076 - is a valid object ok 2077 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2078 - is a valid object ok 2079 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("4"); $z = Math::BigInt->new("4"); $x->bmodpow($y, $z); ok 2080 - is a valid object ok 2081 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("16"); $x->bmodpow($y, $z); ok 2082 - is a valid object ok 2083 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("-1"); $z = Math::BigInt->new("5033"); $x->bmodpow($y, $z); ok 2084 - is a valid object ok 2085 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("7"); $z = Math::BigInt->new("5032"); $x->bmodpow($y, $z); ok 2086 - is a valid object ok 2087 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("8"); $z = Math::BigInt->new("-5"); $x->bmodpow($y, $z); ok 2088 - is a valid object ok 2089 - $x = Math::BigInt->new("1e50"); $y = Math::BigInt->new("1"); $z = Math::BigInt->new("1"); $x->bmodpow($y, $z); ok 2090 - is a valid object ok 2091 - $x = Math::BigInt->new("98436739867439843769485798542749827593285729587325"); $y = Math::BigInt->new("43698764986460981048259837659386739857456983759328457"); $z = Math::BigInt->new("6943857329857295827698367"); $x->bmodpow($y, $z); ok 2092 - is a valid object ok 2093 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $z = Math::BigInt->new("13"); $x->bmodpow($y, $z); ok 2094 - is a valid object ok 2095 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $z = Math::BigInt->new("13"); $x->bmodpow($y, $z); ok 2096 - is a valid object ok 2097 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x % $y; ok 2098 - is a valid object ok 2099 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x % $y; ok 2100 - is a valid object ok 2101 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("inf"); $x % $y; ok 2102 - is a valid object ok 2103 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("-inf"); $x % $y; ok 2104 - is a valid object ok 2105 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("inf"); $x % $y; ok 2106 - is a valid object ok 2107 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-inf"); $x % $y; ok 2108 - is a valid object ok 2109 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("5"); $x % $y; ok 2110 - is a valid object ok 2111 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("5"); $x % $y; ok 2112 - is a valid object ok 2113 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-5"); $x % $y; ok 2114 - is a valid object ok 2115 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-5"); $x % $y; ok 2116 - is a valid object ok 2117 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("5"); $x % $y; ok 2118 - is a valid object ok 2119 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-5"); $x % $y; ok 2120 - is a valid object ok 2121 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); $x % $y; ok 2122 - is a valid object ok 2123 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x % $y; ok 2124 - is a valid object ok 2125 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); $x % $y; ok 2126 - is a valid object ok 2127 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x % $y; ok 2128 - is a valid object ok 2129 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("0"); $x % $y; ok 2130 - is a valid object ok 2131 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("0"); $x % $y; ok 2132 - is a valid object ok 2133 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); $x % $y; ok 2134 - is a valid object ok 2135 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("0"); $x % $y; ok 2136 - is a valid object ok 2137 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x % $y; ok 2138 - is a valid object ok 2139 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x % $y; ok 2140 - is a valid object ok 2141 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("1"); $x % $y; ok 2142 - is a valid object ok 2143 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("abc"); $x % $y; ok 2144 - is a valid object ok 2145 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x % $y; ok 2146 - is a valid object ok 2147 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x % $y; ok 2148 - is a valid object ok 2149 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x % $y; ok 2150 - is a valid object ok 2151 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x % $y; ok 2152 - is a valid object ok 2153 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x % $y; ok 2154 - is a valid object ok 2155 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x % $y; ok 2156 - is a valid object ok 2157 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x % $y; ok 2158 - is a valid object ok 2159 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x % $y; ok 2160 - is a valid object ok 2161 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x % $y; ok 2162 - is a valid object ok 2163 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x % $y; ok 2164 - is a valid object ok 2165 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2166 - is a valid object ok 2167 - $x = Math::BigInt->new("2000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2168 - is a valid object ok 2169 - $x = Math::BigInt->new("3000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2170 - is a valid object ok 2171 - $x = Math::BigInt->new("4000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2172 - is a valid object ok 2173 - $x = Math::BigInt->new("5000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2174 - is a valid object ok 2175 - $x = Math::BigInt->new("6000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2176 - is a valid object ok 2177 - $x = Math::BigInt->new("7000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2178 - is a valid object ok 2179 - $x = Math::BigInt->new("8000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2180 - is a valid object ok 2181 - $x = Math::BigInt->new("9000000000"); $y = Math::BigInt->new("9"); $x % $y; ok 2182 - is a valid object ok 2183 - $x = Math::BigInt->new("35500000"); $y = Math::BigInt->new("113"); $x % $y; ok 2184 - is a valid object ok 2185 - $x = Math::BigInt->new("71000000"); $y = Math::BigInt->new("226"); $x % $y; ok 2186 - is a valid object ok 2187 - $x = Math::BigInt->new("106500000"); $y = Math::BigInt->new("339"); $x % $y; ok 2188 - is a valid object ok 2189 - $x = Math::BigInt->new("1000000000"); $y = Math::BigInt->new("3"); $x % $y; ok 2190 - is a valid object ok 2191 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("5"); $x % $y; ok 2192 - is a valid object ok 2193 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("4"); $x % $y; ok 2194 - is a valid object ok 2195 - $x = Math::BigInt->new("1000"); $y = Math::BigInt->new("8"); $x % $y; ok 2196 - is a valid object ok 2197 - $x = Math::BigInt->new("10000"); $y = Math::BigInt->new("16"); $x % $y; ok 2198 - is a valid object ok 2199 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9"); $x % $y; ok 2200 - is a valid object ok 2201 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("99"); $x % $y; ok 2202 - is a valid object ok 2203 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("999"); $x % $y; ok 2204 - is a valid object ok 2205 - $x = Math::BigInt->new("999999999999"); $y = Math::BigInt->new("9999"); $x % $y; ok 2206 - is a valid object ok 2207 - $x = Math::BigInt->new("999999999999999"); $y = Math::BigInt->new("99999"); $x % $y; ok 2208 - is a valid object ok 2209 - $x = Math::BigInt->new("-9"); $y = Math::BigInt->new("+5"); $x % $y; ok 2210 - is a valid object ok 2211 - $x = Math::BigInt->new("+9"); $y = Math::BigInt->new("-5"); $x % $y; ok 2212 - is a valid object ok 2213 - $x = Math::BigInt->new("-9"); $y = Math::BigInt->new("-5"); $x % $y; ok 2214 - is a valid object ok 2215 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("3"); $x % $y; ok 2216 - is a valid object ok 2217 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x % $y; ok 2218 - is a valid object ok 2219 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("3"); $x % $y; ok 2220 - is a valid object ok 2221 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x % $y; ok 2222 - is a valid object ok 2223 - $x = Math::BigInt->new("-5"); $y = Math::BigInt->new("-3"); $x % $y; ok 2224 - is a valid object ok 2225 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x % $y; ok 2226 - is a valid object ok 2227 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-3"); $x % $y; ok 2228 - is a valid object ok 2229 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-3"); $x % $y; ok 2230 - is a valid object ok 2231 - $x = Math::BigInt->new("4095"); $y = Math::BigInt->new("4095"); $x % $y; ok 2232 - is a valid object ok 2233 - $x = Math::BigInt->new("100041000510123"); $y = Math::BigInt->new("3"); $x % $y; ok 2234 - is a valid object ok 2235 - $x = Math::BigInt->new("152403346"); $y = Math::BigInt->new("12345"); $x % $y; ok 2236 - is a valid object ok 2237 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("5"); $x % $y; ok 2238 - is a valid object ok 2239 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("9"); $x % $y; ok 2240 - is a valid object ok 2241 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("9"); $x % $y; ok 2242 - is a valid object ok 2243 - $x = Math::BigInt->new("12345678"); $y = Math::BigInt->new("9"); $x % $y; ok 2244 - is a valid object ok 2245 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("9"); $x % $y; ok 2246 - is a valid object ok 2247 - $x = Math::BigInt->new("123456789123"); $y = Math::BigInt->new("9"); $x % $y; ok 2248 - is a valid object ok 2249 - $x = Math::BigInt->new("12345678912345"); $y = Math::BigInt->new("9"); $x % $y; ok 2250 - is a valid object ok 2251 - $x = Math::BigInt->new("1234567891234567"); $y = Math::BigInt->new("9"); $x % $y; ok 2252 - is a valid object ok 2253 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("9"); $x % $y; ok 2254 - is a valid object ok 2255 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("10"); $x % $y; ok 2256 - is a valid object ok 2257 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("10"); $x % $y; ok 2258 - is a valid object ok 2259 - $x = Math::BigInt->new("12345678"); $y = Math::BigInt->new("10"); $x % $y; ok 2260 - is a valid object ok 2261 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("10"); $x % $y; ok 2262 - is a valid object ok 2263 - $x = Math::BigInt->new("123456789123"); $y = Math::BigInt->new("10"); $x % $y; ok 2264 - is a valid object ok 2265 - $x = Math::BigInt->new("12345678912345"); $y = Math::BigInt->new("10"); $x % $y; ok 2266 - is a valid object ok 2267 - $x = Math::BigInt->new("1234567891234567"); $y = Math::BigInt->new("10"); $x % $y; ok 2268 - is a valid object ok 2269 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("10"); $x % $y; ok 2270 - is a valid object ok 2271 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("113"); $x % $y; ok 2272 - is a valid object ok 2273 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("113"); $x % $y; ok 2274 - is a valid object ok 2275 - $x = Math::BigInt->new("12345678"); $y = Math::BigInt->new("113"); $x % $y; ok 2276 - is a valid object ok 2277 - $x = Math::BigInt->new("1234567891"); $y = Math::BigInt->new("113"); $x % $y; ok 2278 - is a valid object ok 2279 - $x = Math::BigInt->new("123456789123"); $y = Math::BigInt->new("113"); $x % $y; ok 2280 - is a valid object ok 2281 - $x = Math::BigInt->new("12345678912345"); $y = Math::BigInt->new("113"); $x % $y; ok 2282 - is a valid object ok 2283 - $x = Math::BigInt->new("1234567891234567"); $y = Math::BigInt->new("113"); $x % $y; ok 2284 - is a valid object ok 2285 - $x = Math::BigInt->new("123456789123456789"); $y = Math::BigInt->new("113"); $x % $y; ok 2286 - is a valid object ok 2287 - $x = Math::BigInt->new("-629"); $y = Math::BigInt->new("5033"); $x % $y; ok 2288 - is a valid object ok 2289 - $x = Math::BigInt->new("111111111111111111111111111111"); $y = Math::BigInt->new("111111111111111111111111111111"); $x % $y; ok 2290 - is a valid object ok 2291 - $x = Math::BigInt->new("12345678901234567890"); $y = Math::BigInt->new("12345678901234567890"); $x % $y; ok 2292 - is a valid object ok 2293 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("12"); Math::BigInt::bgcd($x, $y); ok 2294 - is a valid object ok 2295 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("12"); Math::BigInt::bgcd($x, $y); ok 2296 - is a valid object ok 2297 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("inf"); Math::BigInt::bgcd($x, $y); ok 2298 - is a valid object ok 2299 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("-inf"); Math::BigInt::bgcd($x, $y); ok 2300 - is a valid object ok 2301 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("inf"); Math::BigInt::bgcd($x, $y); ok 2302 - is a valid object ok 2303 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); Math::BigInt::bgcd($x, $y); ok 2304 - is a valid object ok 2305 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); Math::BigInt::bgcd($x, $y); ok 2306 - is a valid object ok 2307 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); Math::BigInt::bgcd($x, $y); ok 2308 - is a valid object ok 2309 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); Math::BigInt::bgcd($x, $y); ok 2310 - is a valid object ok 2311 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); Math::BigInt::bgcd($x, $y); ok 2312 - is a valid object ok 2313 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); Math::BigInt::bgcd($x, $y); ok 2314 - is a valid object ok 2315 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); Math::BigInt::bgcd($x, $y); ok 2316 - is a valid object ok 2317 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); Math::BigInt::bgcd($x, $y); ok 2318 - is a valid object ok 2319 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+1"); Math::BigInt::bgcd($x, $y); ok 2320 - is a valid object ok 2321 - $x = Math::BigInt->new("+2"); $y = Math::BigInt->new("+3"); Math::BigInt::bgcd($x, $y); ok 2322 - is a valid object ok 2323 - $x = Math::BigInt->new("+3"); $y = Math::BigInt->new("+2"); Math::BigInt::bgcd($x, $y); ok 2324 - is a valid object ok 2325 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("+2"); Math::BigInt::bgcd($x, $y); ok 2326 - is a valid object ok 2327 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("-2"); Math::BigInt::bgcd($x, $y); ok 2328 - is a valid object ok 2329 - $x = Math::BigInt->new("-144"); $y = Math::BigInt->new("-60"); Math::BigInt::bgcd($x, $y); ok 2330 - is a valid object ok 2331 - $x = Math::BigInt->new("144"); $y = Math::BigInt->new("-60"); Math::BigInt::bgcd($x, $y); ok 2332 - is a valid object ok 2333 - $x = Math::BigInt->new("144"); $y = Math::BigInt->new("60"); Math::BigInt::bgcd($x, $y); ok 2334 - is a valid object ok 2335 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("625"); Math::BigInt::bgcd($x, $y); ok 2336 - is a valid object ok 2337 - $x = Math::BigInt->new("4096"); $y = Math::BigInt->new("81"); Math::BigInt::bgcd($x, $y); ok 2338 - is a valid object ok 2339 - $x = Math::BigInt->new("1034"); $y = Math::BigInt->new("804"); Math::BigInt::bgcd($x, $y); ok 2340 - is a valid object ok 2341 - $x = Math::BigInt->new("27"); $y = Math::BigInt->new("90"); $z = Math::BigInt->new("56"); Math::BigInt::bgcd($x, $y, $z); ok 2342 - is a valid object ok 2343 - $x = Math::BigInt->new("27"); $y = Math::BigInt->new("90"); $z = Math::BigInt->new("54"); Math::BigInt::bgcd($x, $y, $z); ok 2344 - is a valid object ok 2345 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); Math::BigInt::blcm($x, $y); ok 2346 - is a valid object ok 2347 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("+0"); Math::BigInt::blcm($x, $y); ok 2348 - is a valid object ok 2349 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("abc"); Math::BigInt::blcm($x, $y); ok 2350 - is a valid object ok 2351 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+0"); Math::BigInt::blcm($x, $y); ok 2352 - is a valid object ok 2353 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("+0"); Math::BigInt::blcm($x, $y); ok 2354 - is a valid object ok 2355 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("+1"); Math::BigInt::blcm($x, $y); ok 2356 - is a valid object ok 2357 - $x = Math::BigInt->new("+27"); $y = Math::BigInt->new("+90"); Math::BigInt::blcm($x, $y); ok 2358 - is a valid object ok 2359 - $x = Math::BigInt->new("+1034"); $y = Math::BigInt->new("+804"); Math::BigInt::blcm($x, $y); ok 2360 - is a valid object ok 2361 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x & $y; ok 2362 - is a valid object ok 2363 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x & $y; ok 2364 - is a valid object ok 2365 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("abc"); $x & $y; ok 2366 - is a valid object ok 2367 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x & $y; ok 2368 - is a valid object ok 2369 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("2"); $x & $y; ok 2370 - is a valid object ok 2371 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x & $y; ok 2372 - is a valid object ok 2373 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("0"); $x & $y; ok 2374 - is a valid object ok 2375 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("1"); $x & $y; ok 2376 - is a valid object ok 2377 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("+281474976710656"); $x & $y; ok 2378 - is a valid object ok 2379 - $x = Math::BigInt->new("281474976710656"); $y = Math::BigInt->new("-1"); $x & $y; ok 2380 - is a valid object ok 2381 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x & $y; ok 2382 - is a valid object ok 2383 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x & $y; ok 2384 - is a valid object ok 2385 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("-6"); $x & $y; ok 2386 - is a valid object ok 2387 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("-4"); $x & $y; ok 2388 - is a valid object ok 2389 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("4"); $x & $y; ok 2390 - is a valid object ok 2391 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("7"); $x & $y; ok 2392 - is a valid object ok 2393 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-3"); $x & $y; ok 2394 - is a valid object ok 2395 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-1"); $x & $y; ok 2396 - is a valid object ok 2397 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0xFFFF"); $x & $y; ok 2398 - is a valid object ok 2399 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0xFFFFFF"); $x & $y; ok 2400 - is a valid object ok 2401 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFF"); $x & $y; ok 2402 - is a valid object ok 2403 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x & $y; ok 2404 - is a valid object ok 2405 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x & $y; ok 2406 - is a valid object ok 2407 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0xF0F0"); $x & $y; ok 2408 - is a valid object ok 2409 - $x = Math::BigInt->new("0x0F0F"); $y = Math::BigInt->new("0x0F0F"); $x & $y; ok 2410 - is a valid object ok 2411 - $x = Math::BigInt->new("0xF0F0F0"); $y = Math::BigInt->new("0xF0F0F0"); $x & $y; ok 2412 - is a valid object ok 2413 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0x0F0F0F"); $x & $y; ok 2414 - is a valid object ok 2415 - $x = Math::BigInt->new("0xF0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0"); $x & $y; ok 2416 - is a valid object ok 2417 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F"); $x & $y; ok 2418 - is a valid object ok 2419 - $x = Math::BigInt->new("0xF0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x & $y; ok 2420 - is a valid object ok 2421 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F"); $x & $y; ok 2422 - is a valid object ok 2423 - $x = Math::BigInt->new("0xF0F0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x & $y; ok 2424 - is a valid object ok 2425 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F0F"); $x & $y; ok 2426 - is a valid object ok 2427 - $x = Math::BigInt->new("0x1F0F0F0F0F0F"); $y = Math::BigInt->new("0x3F0F0F0F0F0F"); $x & $y; ok 2428 - is a valid object ok 2429 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x | $y; ok 2430 - is a valid object ok 2431 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x | $y; ok 2432 - is a valid object ok 2433 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("abc"); $x | $y; ok 2434 - is a valid object ok 2435 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x | $y; ok 2436 - is a valid object ok 2437 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x | $y; ok 2438 - is a valid object ok 2439 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("0"); $x | $y; ok 2440 - is a valid object ok 2441 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("1"); $x | $y; ok 2442 - is a valid object ok 2443 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("281474976710656"); $x | $y; ok 2444 - is a valid object ok 2445 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x | $y; ok 2446 - is a valid object ok 2447 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x | $y; ok 2448 - is a valid object ok 2449 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("-6"); $x | $y; ok 2450 - is a valid object ok 2451 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("4"); $x | $y; ok 2452 - is a valid object ok 2453 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("7"); $x | $y; ok 2454 - is a valid object ok 2455 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("-1"); $x | $y; ok 2456 - is a valid object ok 2457 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-3"); $x | $y; ok 2458 - is a valid object ok 2459 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-4"); $x | $y; ok 2460 - is a valid object ok 2461 - $x = Math::BigInt->new("300"); $y = Math::BigInt->new("-76"); $x | $y; ok 2462 - is a valid object ok 2463 - $x = Math::BigInt->new("-76"); $y = Math::BigInt->new("300"); $x | $y; ok 2464 - is a valid object ok 2465 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0xFFFF"); $x | $y; ok 2466 - is a valid object ok 2467 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0xFFFFFF"); $x | $y; ok 2468 - is a valid object ok 2469 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFF"); $x | $y; ok 2470 - is a valid object ok 2471 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x | $y; ok 2472 - is a valid object ok 2473 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x | $y; ok 2474 - is a valid object ok 2475 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFF"); $x | $y; ok 2476 - is a valid object ok 2477 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFF"); $x | $y; ok 2478 - is a valid object ok 2479 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFF"); $x | $y; ok 2480 - is a valid object ok 2481 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x | $y; ok 2482 - is a valid object ok 2483 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x | $y; ok 2484 - is a valid object ok 2485 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0"); $x | $y; ok 2486 - is a valid object ok 2487 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0"); $x | $y; ok 2488 - is a valid object ok 2489 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0"); $x | $y; ok 2490 - is a valid object ok 2491 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x | $y; ok 2492 - is a valid object ok 2493 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x | $y; ok 2494 - is a valid object ok 2495 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0xF0F0"); $x | $y; ok 2496 - is a valid object ok 2497 - $x = Math::BigInt->new("0x0F0F"); $y = Math::BigInt->new("0x0F0F"); $x | $y; ok 2498 - is a valid object ok 2499 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0x0F0F"); $x | $y; ok 2500 - is a valid object ok 2501 - $x = Math::BigInt->new("0xF0F0F0"); $y = Math::BigInt->new("0xF0F0F0"); $x | $y; ok 2502 - is a valid object ok 2503 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0x0F0F0F"); $x | $y; ok 2504 - is a valid object ok 2505 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0xF0F0F0"); $x | $y; ok 2506 - is a valid object ok 2507 - $x = Math::BigInt->new("0xF0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0"); $x | $y; ok 2508 - is a valid object ok 2509 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F"); $x | $y; ok 2510 - is a valid object ok 2511 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0"); $x | $y; ok 2512 - is a valid object ok 2513 - $x = Math::BigInt->new("0xF0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x | $y; ok 2514 - is a valid object ok 2515 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F"); $x | $y; ok 2516 - is a valid object ok 2517 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x | $y; ok 2518 - is a valid object ok 2519 - $x = Math::BigInt->new("0xF0F0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x | $y; ok 2520 - is a valid object ok 2521 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F0F"); $x | $y; ok 2522 - is a valid object ok 2523 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x | $y; ok 2524 - is a valid object ok 2525 - $x = Math::BigInt->new("0x1F0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x | $y; ok 2526 - is a valid object ok 2527 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("abc"); $x ^ $y; ok 2528 - is a valid object ok 2529 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2530 - is a valid object ok 2531 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("abc"); $x ^ $y; ok 2532 - is a valid object ok 2533 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x ^ $y; ok 2534 - is a valid object ok 2535 - $x = Math::BigInt->new("+8"); $y = Math::BigInt->new("+2"); $x ^ $y; ok 2536 - is a valid object ok 2537 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2538 - is a valid object ok 2539 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("1"); $x ^ $y; ok 2540 - is a valid object ok 2541 - $x = Math::BigInt->new("+281474976710656"); $y = Math::BigInt->new("281474976710656"); $x ^ $y; ok 2542 - is a valid object ok 2543 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-3"); $x ^ $y; ok 2544 - is a valid object ok 2545 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x ^ $y; ok 2546 - is a valid object ok 2547 - $x = Math::BigInt->new("-6"); $y = Math::BigInt->new("-6"); $x ^ $y; ok 2548 - is a valid object ok 2549 - $x = Math::BigInt->new("-7"); $y = Math::BigInt->new("4"); $x ^ $y; ok 2550 - is a valid object ok 2551 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("7"); $x ^ $y; ok 2552 - is a valid object ok 2553 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("-7"); $x ^ $y; ok 2554 - is a valid object ok 2555 - $x = Math::BigInt->new("-4"); $y = Math::BigInt->new("-7"); $x ^ $y; ok 2556 - is a valid object ok 2557 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-3"); $x ^ $y; ok 2558 - is a valid object ok 2559 - $x = Math::BigInt->new("30"); $y = Math::BigInt->new("-4"); $x ^ $y; ok 2560 - is a valid object ok 2561 - $x = Math::BigInt->new("300"); $y = Math::BigInt->new("-76"); $x ^ $y; ok 2562 - is a valid object ok 2563 - $x = Math::BigInt->new("-76"); $y = Math::BigInt->new("300"); $x ^ $y; ok 2564 - is a valid object ok 2565 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0xFFFF"); $x ^ $y; ok 2566 - is a valid object ok 2567 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0xFFFFFF"); $x ^ $y; ok 2568 - is a valid object ok 2569 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFF"); $x ^ $y; ok 2570 - is a valid object ok 2571 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x ^ $y; ok 2572 - is a valid object ok 2573 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x ^ $y; ok 2574 - is a valid object ok 2575 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFF"); $x ^ $y; ok 2576 - is a valid object ok 2577 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFF"); $x ^ $y; ok 2578 - is a valid object ok 2579 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFF"); $x ^ $y; ok 2580 - is a valid object ok 2581 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFF"); $x ^ $y; ok 2582 - is a valid object ok 2583 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0xFFFFFFFFFFFF"); $x ^ $y; ok 2584 - is a valid object ok 2585 - $x = Math::BigInt->new("0xFFFF"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2586 - is a valid object ok 2587 - $x = Math::BigInt->new("0xFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2588 - is a valid object ok 2589 - $x = Math::BigInt->new("0xFFFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2590 - is a valid object ok 2591 - $x = Math::BigInt->new("0xFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2592 - is a valid object ok 2593 - $x = Math::BigInt->new("0xFFFFFFFFFFFF"); $y = Math::BigInt->new("0"); $x ^ $y; ok 2594 - is a valid object ok 2595 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0xF0F0"); $x ^ $y; ok 2596 - is a valid object ok 2597 - $x = Math::BigInt->new("0x0F0F"); $y = Math::BigInt->new("0x0F0F"); $x ^ $y; ok 2598 - is a valid object ok 2599 - $x = Math::BigInt->new("0xF0F0"); $y = Math::BigInt->new("0x0F0F"); $x ^ $y; ok 2600 - is a valid object ok 2601 - $x = Math::BigInt->new("0xF0F0F0"); $y = Math::BigInt->new("0xF0F0F0"); $x ^ $y; ok 2602 - is a valid object ok 2603 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0x0F0F0F"); $x ^ $y; ok 2604 - is a valid object ok 2605 - $x = Math::BigInt->new("0x0F0F0F"); $y = Math::BigInt->new("0xF0F0F0"); $x ^ $y; ok 2606 - is a valid object ok 2607 - $x = Math::BigInt->new("0xF0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0"); $x ^ $y; ok 2608 - is a valid object ok 2609 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F"); $x ^ $y; ok 2610 - is a valid object ok 2611 - $x = Math::BigInt->new("0x0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0"); $x ^ $y; ok 2612 - is a valid object ok 2613 - $x = Math::BigInt->new("0xF0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x ^ $y; ok 2614 - is a valid object ok 2615 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F"); $x ^ $y; ok 2616 - is a valid object ok 2617 - $x = Math::BigInt->new("0x0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0"); $x ^ $y; ok 2618 - is a valid object ok 2619 - $x = Math::BigInt->new("0xF0F0F0F0F0F0"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x ^ $y; ok 2620 - is a valid object ok 2621 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0x0F0F0F0F0F0F"); $x ^ $y; ok 2622 - is a valid object ok 2623 - $x = Math::BigInt->new("0x0F0F0F0F0F0F"); $y = Math::BigInt->new("0xF0F0F0F0F0F0"); $x ^ $y; ok 2624 - is a valid object ok 2625 - $x = Math::BigInt->new("abc"); $x->bnot(); ok 2626 - is a valid object ok 2627 - $x = Math::BigInt->new("+0"); $x->bnot(); ok 2628 - is a valid object ok 2629 - $x = Math::BigInt->new("+8"); $x->bnot(); ok 2630 - is a valid object ok 2631 - $x = Math::BigInt->new("+281474976710656"); $x->bnot(); ok 2632 - is a valid object ok 2633 - $x = Math::BigInt->new("-1"); $x->bnot(); ok 2634 - is a valid object ok 2635 - $x = Math::BigInt->new("-2"); $x->bnot(); ok 2636 - is a valid object ok 2637 - $x = Math::BigInt->new("-12"); $x->bnot(); ok 2638 - is a valid object ok 2639 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->digit($y); ok 2640 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("0"); $x->digit($y); ok 2641 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("1"); $x->digit($y); ok 2642 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("0"); $x->digit($y); ok 2643 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("1"); $x->digit($y); ok 2644 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("2"); $x->digit($y); ok 2645 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-1"); $x->digit($y); ok 2646 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-2"); $x->digit($y); ok 2647 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("-3"); $x->digit($y); ok 2648 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("0"); $x->digit($y); ok 2649 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("1"); $x->digit($y); ok 2650 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("2"); $x->digit($y); ok 2651 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("3"); $x->digit($y); ok 2652 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("4"); $x->digit($y); ok 2653 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("5"); $x->digit($y); ok 2654 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("-1"); $x->digit($y); ok 2655 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("-2"); $x->digit($y); ok 2656 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("-3"); $x->digit($y); ok 2657 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("-3"); $x->digit($y); ok 2658 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("0"); $x->digit($y); ok 2659 - $x = Math::BigInt->new("100000"); $y = Math::BigInt->new("1"); $x->digit($y); ok 2660 - $x = Math::BigInt->new("abc"); $x = $x->mantissa()->bstr(); ok 2661 - $x = Math::BigInt->new("1e4"); $x = $x->mantissa()->bstr(); ok 2662 - $x = Math::BigInt->new("2e0"); $x = $x->mantissa()->bstr(); ok 2663 - $x = Math::BigInt->new("123"); $x = $x->mantissa()->bstr(); ok 2664 - $x = Math::BigInt->new("-1"); $x = $x->mantissa()->bstr(); ok 2665 - $x = Math::BigInt->new("-2"); $x = $x->mantissa()->bstr(); ok 2666 - $x = Math::BigInt->new("+inf"); $x = $x->mantissa()->bstr(); ok 2667 - $x = Math::BigInt->new("-inf"); $x = $x->mantissa()->bstr(); ok 2668 - $x = Math::BigInt->new("abc"); $x = $x->exponent()->bstr(); ok 2669 - $x = Math::BigInt->new("1e4"); $x = $x->exponent()->bstr(); ok 2670 - $x = Math::BigInt->new("2e0"); $x = $x->exponent()->bstr(); ok 2671 - $x = Math::BigInt->new("123"); $x = $x->exponent()->bstr(); ok 2672 - $x = Math::BigInt->new("-1"); $x = $x->exponent()->bstr(); ok 2673 - $x = Math::BigInt->new("-2"); $x = $x->exponent()->bstr(); ok 2674 - $x = Math::BigInt->new("0"); $x = $x->exponent()->bstr(); ok 2675 - $x = Math::BigInt->new("+inf"); $x = $x->exponent()->bstr(); ok 2676 - $x = Math::BigInt->new("-inf"); $x = $x->exponent()->bstr(); ok 2677 - $x = Math::BigInt->new("abc"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2678 - $x = Math::BigInt->new("1e4"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2679 - $x = Math::BigInt->new("2e0"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2680 - $x = Math::BigInt->new("123"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2681 - $x = Math::BigInt->new("-1"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2682 - $x = Math::BigInt->new("-2"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2683 - $x = Math::BigInt->new("0"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2684 - $x = Math::BigInt->new("+inf"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2685 - $x = Math::BigInt->new("-inf"); ($m, $e) = $x->parts(); $m = $m->bstr(); $m = "NaN" if !defined $m; $e = $e->bstr(); $e = "NaN" if !defined $e; "$m,$e"; ok 2686 - $x = Math::BigInt->new("-1"); $x->bfac(); ok 2687 - is a valid object ok 2688 - $x = Math::BigInt->new("NaNfac"); $x->bfac(); ok 2689 - is a valid object ok 2690 - $x = Math::BigInt->new("+inf"); $x->bfac(); ok 2691 - is a valid object ok 2692 - $x = Math::BigInt->new("-inf"); $x->bfac(); ok 2693 - is a valid object ok 2694 - $x = Math::BigInt->new("0"); $x->bfac(); ok 2695 - is a valid object ok 2696 - $x = Math::BigInt->new("1"); $x->bfac(); ok 2697 - is a valid object ok 2698 - $x = Math::BigInt->new("2"); $x->bfac(); ok 2699 - is a valid object ok 2700 - $x = Math::BigInt->new("3"); $x->bfac(); ok 2701 - is a valid object ok 2702 - $x = Math::BigInt->new("4"); $x->bfac(); ok 2703 - is a valid object ok 2704 - $x = Math::BigInt->new("5"); $x->bfac(); ok 2705 - is a valid object ok 2706 - $x = Math::BigInt->new("6"); $x->bfac(); ok 2707 - is a valid object ok 2708 - $x = Math::BigInt->new("7"); $x->bfac(); ok 2709 - is a valid object ok 2710 - $x = Math::BigInt->new("8"); $x->bfac(); ok 2711 - is a valid object ok 2712 - $x = Math::BigInt->new("9"); $x->bfac(); ok 2713 - is a valid object ok 2714 - $x = Math::BigInt->new("10"); $x->bfac(); ok 2715 - is a valid object ok 2716 - $x = Math::BigInt->new("11"); $x->bfac(); ok 2717 - is a valid object ok 2718 - $x = Math::BigInt->new("12"); $x->bfac(); ok 2719 - is a valid object ok 2720 - $x = Math::BigInt->new("20"); $x->bfac(); ok 2721 - is a valid object ok 2722 - $x = Math::BigInt->new("22"); $x->bfac(); ok 2723 - is a valid object ok 2724 - $x = Math::BigInt->new("69"); $x->bfac(); ok 2725 - is a valid object ok 2726 - $x = Math::BigInt->new("abc"); $y = Math::BigInt->new("12"); $x ** $y; ok 2727 - is a valid object ok 2728 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("abc"); $x ** $y; ok 2729 - is a valid object ok 2730 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x ** $y; ok 2731 - is a valid object ok 2732 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x ** $y; ok 2733 - is a valid object ok 2734 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $x ** $y; ok 2735 - is a valid object ok 2736 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-1"); $x ** $y; ok 2737 - is a valid object ok 2738 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-2"); $x ** $y; ok 2739 - is a valid object ok 2740 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x ** $y; ok 2741 - is a valid object ok 2742 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x ** $y; ok 2743 - is a valid object ok 2744 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x ** $y; ok 2745 - is a valid object ok 2746 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("3"); $x ** $y; ok 2747 - is a valid object ok 2748 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-1"); $x ** $y; ok 2749 - is a valid object ok 2750 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $x ** $y; ok 2751 - is a valid object ok 2752 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-3"); $x ** $y; ok 2753 - is a valid object ok 2754 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $x ** $y; ok 2755 - is a valid object ok 2756 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x ** $y; ok 2757 - is a valid object ok 2758 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $x ** $y; ok 2759 - is a valid object ok 2760 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x ** $y; ok 2761 - is a valid object ok 2762 - $x = Math::BigInt->new("3"); $y = Math::BigInt->new("3"); $x ** $y; ok 2763 - is a valid object ok 2764 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $x ** $y; ok 2765 - is a valid object ok 2766 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x ** $y; ok 2767 - is a valid object ok 2768 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $x ** $y; ok 2769 - is a valid object ok 2770 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("5"); $x ** $y; ok 2771 - is a valid object ok 2772 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-1"); $x ** $y; ok 2773 - is a valid object ok 2774 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-1"); $x ** $y; ok 2775 - is a valid object ok 2776 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-2"); $x ** $y; ok 2777 - is a valid object ok 2778 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-2"); $x ** $y; ok 2779 - is a valid object ok 2780 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("1234500012"); $x ** $y; ok 2781 - is a valid object ok 2782 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("1234500012"); $x ** $y; ok 2783 - is a valid object ok 2784 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("1234500013"); $x ** $y; ok 2785 - is a valid object ok 2786 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("-12345000123"); $x ** $y; ok 2787 - is a valid object ok 2788 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-12345000123"); $x ** $y; ok 2789 - is a valid object ok 2790 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("2"); $x ** $y; ok 2791 - is a valid object ok 2792 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("0"); $x ** $y; ok 2793 - is a valid object ok 2794 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-1"); $x ** $y; ok 2795 - is a valid object ok 2796 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2797 - is a valid object ok 2798 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2799 - is a valid object ok 2800 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2801 - is a valid object ok 2802 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2803 - is a valid object ok 2804 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2805 - is a valid object ok 2806 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2807 - is a valid object ok 2808 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2809 - is a valid object ok 2810 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2811 - is a valid object ok 2812 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2813 - is a valid object ok 2814 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2815 - is a valid object ok 2816 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2817 - is a valid object ok 2818 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x ** $y; ok 2819 - is a valid object ok 2820 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("NaN"); $x ** $y; ok 2821 - is a valid object ok 2822 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2823 - is a valid object ok 2824 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("inf"); $x ** $y; ok 2825 - is a valid object ok 2826 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-inf"); $x ** $y; ok 2827 - is a valid object ok 2828 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x ** $y; ok 2829 - is a valid object ok 2830 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $x ** $y; ok 2831 - is a valid object ok 2832 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x ** $y; ok 2833 - is a valid object ok 2834 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $x ** $y; ok 2835 - is a valid object ok 2836 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("3"); $x ** $y; ok 2837 - is a valid object ok 2838 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("4"); $x ** $y; ok 2839 - is a valid object ok 2840 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("5"); $x ** $y; ok 2841 - is a valid object ok 2842 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-1"); $x ** $y; ok 2843 - is a valid object ok 2844 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-2"); $x ** $y; ok 2845 - is a valid object ok 2846 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-3"); $x ** $y; ok 2847 - is a valid object ok 2848 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-4"); $x ** $y; ok 2849 - is a valid object ok 2850 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("2"); $x ** $y; ok 2851 - is a valid object ok 2852 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("3"); $x ** $y; ok 2853 - is a valid object ok 2854 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("4"); $x ** $y; ok 2855 - is a valid object ok 2856 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("5"); $x ** $y; ok 2857 - is a valid object ok 2858 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("6"); $x ** $y; ok 2859 - is a valid object ok 2860 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("7"); $x ** $y; ok 2861 - is a valid object ok 2862 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("8"); $x ** $y; ok 2863 - is a valid object ok 2864 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("9"); $x ** $y; ok 2865 - is a valid object ok 2866 - $x = Math::BigInt->new("10"); $y = Math::BigInt->new("20"); $x ** $y; ok 2867 - is a valid object ok 2868 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("2"); $x ** $y; ok 2869 - is a valid object ok 2870 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $x ** $y; ok 2871 - is a valid object ok 2872 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("3"); $x ** $y; ok 2873 - is a valid object ok 2874 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("4"); $x ** $y; ok 2875 - is a valid object ok 2876 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("5"); $x ** $y; ok 2877 - is a valid object ok 2878 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("2"); $x ** $y; ok 2879 - is a valid object ok 2880 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("3"); $x ** $y; ok 2881 - is a valid object ok 2882 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("4"); $x ** $y; ok 2883 - is a valid object ok 2884 - $x = Math::BigInt->new("-3"); $y = Math::BigInt->new("5"); $x ** $y; ok 2885 - is a valid object ok 2886 - $x = Math::BigInt->new("100"); $x->length(); ok 2887 - $x = Math::BigInt->new("10"); $x->length(); ok 2888 - $x = Math::BigInt->new("1"); $x->length(); ok 2889 - $x = Math::BigInt->new("0"); $x->length(); ok 2890 - $x = Math::BigInt->new("12345"); $x->length(); ok 2891 - $x = Math::BigInt->new("10000000000000000"); $x->length(); ok 2892 - $x = Math::BigInt->new("-123"); $x->length(); ok 2893 - $x = Math::BigInt->new("215960156869840440586892398248"); $x->length(); ok 2894 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2895 - is a valid object ok 2896 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2897 - is a valid object ok 2898 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2899 - is a valid object ok 2900 - $x = Math::BigInt->new("-123"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2901 - is a valid object ok 2902 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2903 - is a valid object ok 2904 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2905 - is a valid object ok 2906 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2907 - is a valid object ok 2908 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2909 - is a valid object ok 2910 - $x = Math::BigInt->new("4"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2911 - is a valid object ok 2912 - $x = Math::BigInt->new("9"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2913 - is a valid object ok 2914 - $x = Math::BigInt->new("16"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2915 - is a valid object ok 2916 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2917 - is a valid object ok 2918 - $x = Math::BigInt->new("123"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2919 - is a valid object ok 2920 - $x = Math::BigInt->new("15241"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2921 - is a valid object ok 2922 - $x = Math::BigInt->new("144"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2923 - is a valid object ok 2924 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2925 - is a valid object ok 2926 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("NaN"); $x->broot($y); ok 2927 - is a valid object ok 2928 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("NaN"); $x->broot($y); ok 2929 - is a valid object ok 2930 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("NaN"); $x->broot($y); ok 2931 - is a valid object ok 2932 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("NaN"); $x->broot($y); ok 2933 - is a valid object ok 2934 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("NaN"); $x->broot($y); ok 2935 - is a valid object ok 2936 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2937 - is a valid object ok 2938 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("2"); $x->broot($y); ok 2939 - is a valid object ok 2940 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->broot($y); ok 2941 - is a valid object ok 2942 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("inf"); $x->broot($y); ok 2943 - is a valid object ok 2944 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("-inf"); $x->broot($y); ok 2945 - is a valid object ok 2946 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("inf"); $x->broot($y); ok 2947 - is a valid object ok 2948 - $x = Math::BigInt->new("+0"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2949 - is a valid object ok 2950 - $x = Math::BigInt->new("+1"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2951 - is a valid object ok 2952 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2953 - is a valid object ok 2954 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2955 - is a valid object ok 2956 - $x = Math::BigInt->new("-123.45"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2957 - is a valid object ok 2958 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("0"); $x->broot($y); ok 2959 - is a valid object ok 2960 - $x = Math::BigInt->new("12"); $y = Math::BigInt->new("1"); $x->broot($y); ok 2961 - is a valid object ok 2962 - $x = Math::BigInt->new("-12"); $y = Math::BigInt->new("1"); $x->broot($y); ok 2963 - is a valid object ok 2964 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("-1"); $x->broot($y); ok 2965 - is a valid object ok 2966 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("-1"); $x->broot($y); ok 2967 - is a valid object ok 2968 - $x = Math::BigInt->new("8"); $y = Math::BigInt->new("3"); $x->broot($y); ok 2969 - is a valid object ok 2970 - $x = Math::BigInt->new("-8"); $y = Math::BigInt->new("3"); $x->broot($y); ok 2971 - is a valid object ok 2972 - $x = Math::BigInt->new("16"); $y = Math::BigInt->new("4"); $x->broot($y); ok 2973 - is a valid object ok 2974 - $x = Math::BigInt->new("81"); $y = Math::BigInt->new("4"); $x->broot($y); ok 2975 - is a valid object ok 2976 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("4"); $x->broot($y); ok 2977 - is a valid object ok 2978 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("8"); $x->broot($y); ok 2979 - is a valid object ok 2980 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("16"); $x->broot($y); ok 2981 - is a valid object ok 2982 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("32"); $x->broot($y); ok 2983 - is a valid object ok 2984 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("64"); $x->broot($y); ok 2985 - is a valid object ok 2986 - $x = Math::BigInt->new("18446744073709551616"); $y = Math::BigInt->new("128"); $x->broot($y); ok 2987 - is a valid object ok 2988 - $x = Math::BigInt->new("84274086103068221283760416414557757"); $y = Math::BigInt->new("15"); $x->broot($y); ok 2989 - is a valid object ok 2990 - $x = Math::BigInt->new("145"); $x->bsqrt(); ok 2991 - is a valid object ok 2992 - $x = Math::BigInt->new("144"); $x->bsqrt(); ok 2993 - is a valid object ok 2994 - $x = Math::BigInt->new("143"); $x->bsqrt(); ok 2995 - is a valid object ok 2996 - $x = Math::BigInt->new("16"); $x->bsqrt(); ok 2997 - is a valid object ok 2998 - $x = Math::BigInt->new("170"); $x->bsqrt(); ok 2999 - is a valid object ok 3000 - $x = Math::BigInt->new("169"); $x->bsqrt(); ok 3001 - is a valid object ok 3002 - $x = Math::BigInt->new("168"); $x->bsqrt(); ok 3003 - is a valid object ok 3004 - $x = Math::BigInt->new("4"); $x->bsqrt(); ok 3005 - is a valid object ok 3006 - $x = Math::BigInt->new("3"); $x->bsqrt(); ok 3007 - is a valid object ok 3008 - $x = Math::BigInt->new("2"); $x->bsqrt(); ok 3009 - is a valid object ok 3010 - $x = Math::BigInt->new("9"); $x->bsqrt(); ok 3011 - is a valid object ok 3012 - $x = Math::BigInt->new("12"); $x->bsqrt(); ok 3013 - is a valid object ok 3014 - $x = Math::BigInt->new("256"); $x->bsqrt(); ok 3015 - is a valid object ok 3016 - $x = Math::BigInt->new("100000000"); $x->bsqrt(); ok 3017 - is a valid object ok 3018 - $x = Math::BigInt->new("4000000000000"); $x->bsqrt(); ok 3019 - is a valid object ok 3020 - $x = Math::BigInt->new("152399026"); $x->bsqrt(); ok 3021 - is a valid object ok 3022 - $x = Math::BigInt->new("152399025"); $x->bsqrt(); ok 3023 - is a valid object ok 3024 - $x = Math::BigInt->new("152399024"); $x->bsqrt(); ok 3025 - is a valid object ok 3026 - $x = Math::BigInt->new("18446744073709551616"); $x->bsqrt(); ok 3027 - is a valid object ok 3028 - $x = Math::BigInt->new("84274086103068221283760416414557757"); $x->bsqrt(); ok 3029 - is a valid object ok 3030 - $x = Math::BigInt->new("1"); $x->bsqrt(); ok 3031 - is a valid object ok 3032 - $x = Math::BigInt->new("0"); $x->bsqrt(); ok 3033 - is a valid object ok 3034 - $x = Math::BigInt->new("-2"); $x->bsqrt(); ok 3035 - is a valid object ok 3036 - $x = Math::BigInt->new("-123"); $x->bsqrt(); ok 3037 - is a valid object ok 3038 - $x = Math::BigInt->new("Nan"); $x->bsqrt(); ok 3039 - is a valid object ok 3040 - $x = Math::BigInt->new("+inf"); $x->bsqrt(); ok 3041 - is a valid object ok 3042 - $x = Math::BigInt->new("-inf"); $x->bsqrt(); ok 3043 - is a valid object ok 3044 - $x = Math::BigInt->new("NaN"); $x->bexp(); ok 3045 - is a valid object ok 3046 - $x = Math::BigInt->new("inf"); $x->bexp(); ok 3047 - is a valid object ok 3048 - $x = Math::BigInt->new("1"); $x->bexp(); ok 3049 - is a valid object ok 3050 - $x = Math::BigInt->new("2"); $x->bexp(); ok 3051 - is a valid object ok 3052 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("1"); $x->batan2($y); ok 3053 - is a valid object ok 3054 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("NaN"); $x->batan2($y); ok 3055 - is a valid object ok 3056 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("NaN"); $x->batan2($y); ok 3057 - is a valid object ok 3058 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("1"); $x->batan2($y); ok 3059 - is a valid object ok 3060 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("1"); $x->batan2($y); ok 3061 - is a valid object ok 3062 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("-inf"); $x->batan2($y); ok 3063 - is a valid object ok 3064 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("-inf"); $x->batan2($y); ok 3065 - is a valid object ok 3066 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-inf"); $x->batan2($y); ok 3067 - is a valid object ok 3068 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("inf"); $x->batan2($y); ok 3069 - is a valid object ok 3070 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("-inf"); $x->batan2($y); ok 3071 - is a valid object ok 3072 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("-inf"); $x->batan2($y); ok 3073 - is a valid object ok 3074 - $x = Math::BigInt->new("inf"); $y = Math::BigInt->new("+inf"); $x->batan2($y); ok 3075 - is a valid object ok 3076 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("+inf"); $x->batan2($y); ok 3077 - is a valid object ok 3078 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->batan2($y); ok 3079 - is a valid object ok 3080 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->batan2($y); ok 3081 - is a valid object ok 3082 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("0"); $x->batan2($y); ok 3083 - is a valid object ok 3084 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("1"); $x->batan2($y); ok 3085 - is a valid object ok 3086 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("2"); $x->batan2($y); ok 3087 - is a valid object ok 3088 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("0"); $x->batan2($y); ok 3089 - is a valid object ok 3090 - $x = Math::BigInt->new("5"); $y = Math::BigInt->new("0"); $x->batan2($y); ok 3091 - is a valid object ok 3092 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("0"); $x->batan2($y); ok 3093 - is a valid object ok 3094 - $x = Math::BigInt->new("-2"); $y = Math::BigInt->new("0"); $x->batan2($y); ok 3095 - is a valid object ok 3096 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $x->batan2($y); ok 3097 - is a valid object ok 3098 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("5"); $x->batan2($y); ok 3099 - is a valid object ok 3100 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("5"); $x->batan2($y); ok 3101 - is a valid object ok 3102 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("8"); $x->batan2($y); ok 3103 - is a valid object ok 3104 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("8"); $x->batan2($y); ok 3105 - is a valid object ok 3106 - $x = Math::BigInt->new("-1"); $y = Math::BigInt->new("1"); $x->batan2($y); ok 3107 - is a valid object ok 3108 - $x = Math::BigInt->new("77"); Math::BigInt->bpi($x); ok 3109 - is a valid object ok 3110 - $x = Math::BigInt->new("+0"); Math::BigInt->bpi($x); ok 3111 - is a valid object ok 3112 - $x = Math::BigInt->new("11"); Math::BigInt->bpi($x); ok 3113 - is a valid object ok 3114 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("10"); $x->bnok($y); ok 3115 - is a valid object ok 3116 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("NaN"); $x->bnok($y); ok 3117 - is a valid object ok 3118 - $x = Math::BigInt->new("NaN"); $y = Math::BigInt->new("1"); $x->bnok($y); ok 3119 - is a valid object ok 3120 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("NaN"); $x->bnok($y); ok 3121 - is a valid object ok 3122 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("1"); $x->bnok($y); ok 3123 - is a valid object ok 3124 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("2"); $x->bnok($y); ok 3125 - is a valid object ok 3126 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("3"); $x->bnok($y); ok 3127 - is a valid object ok 3128 - $x = Math::BigInt->new("1"); $y = Math::BigInt->new("-2"); $x->bnok($y); ok 3129 - is a valid object ok 3130 - $x = Math::BigInt->new("7"); $y = Math::BigInt->new("3"); $x->bnok($y); ok 3131 - is a valid object ok 3132 - $x = Math::BigInt->new("7"); $y = Math::BigInt->new("6"); $x->bnok($y); ok 3133 - is a valid object ok 3134 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("90"); $x->bnok($y); ok 3135 - is a valid object ok 3136 - $x = Math::BigInt->new("100"); $y = Math::BigInt->new("95"); $x->bnok($y); ok 3137 - is a valid object ok 3138 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("0"); $x->bnok($y); ok 3139 - is a valid object ok 3140 - $x = Math::BigInt->new("7"); $y = Math::BigInt->new("0"); $x->bnok($y); ok 3141 - is a valid object ok 3142 - $x = Math::BigInt->new("2"); $y = Math::BigInt->new("1"); $x->bnok($y); ok 3143 - is a valid object ok 3144 - $x = Math::BigInt->new("0"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3145 - is a valid object ok 3146 - $x = Math::BigInt->new("NaNbround"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3147 - is a valid object ok 3148 - $x = Math::BigInt->new("+inf"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3149 - is a valid object ok 3150 - $x = Math::BigInt->new("-inf"); $y = Math::BigInt->new("12"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3151 - is a valid object ok 3152 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("0"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3153 - is a valid object ok 3154 - $x = Math::BigInt->new("1234"); $y = Math::BigInt->new("2"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3155 - is a valid object ok 3156 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3157 - is a valid object ok 3158 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3159 - is a valid object ok 3160 - $x = Math::BigInt->new("123456"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3161 - is a valid object ok 3162 - $x = Math::BigInt->new("+10123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3163 - is a valid object ok 3164 - $x = Math::BigInt->new("-10123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3165 - is a valid object ok 3166 - $x = Math::BigInt->new("+10123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3167 - is a valid object ok 3168 - $x = Math::BigInt->new("-10123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3169 - is a valid object ok 3170 - $x = Math::BigInt->new("+101234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3171 - is a valid object ok 3172 - $x = Math::BigInt->new("-101234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("trunc"); $x->bround($y); ok 3173 - is a valid object ok 3174 - $x = Math::BigInt->new("+20123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3175 - is a valid object ok 3176 - $x = Math::BigInt->new("-20123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3177 - is a valid object ok 3178 - $x = Math::BigInt->new("+20123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3179 - is a valid object ok 3180 - $x = Math::BigInt->new("-20123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3181 - is a valid object ok 3182 - $x = Math::BigInt->new("+201234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3183 - is a valid object ok 3184 - $x = Math::BigInt->new("-201234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3185 - is a valid object ok 3186 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3187 - is a valid object ok 3188 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("zero"); $x->bround($y); ok 3189 - is a valid object ok 3190 - $x = Math::BigInt->new("+30123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3191 - is a valid object ok 3192 - $x = Math::BigInt->new("-30123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3193 - is a valid object ok 3194 - $x = Math::BigInt->new("+30123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3195 - is a valid object ok 3196 - $x = Math::BigInt->new("-30123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3197 - is a valid object ok 3198 - $x = Math::BigInt->new("+301234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3199 - is a valid object ok 3200 - $x = Math::BigInt->new("-301234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3201 - is a valid object ok 3202 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3203 - is a valid object ok 3204 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("+inf"); $x->bround($y); ok 3205 - is a valid object ok 3206 - $x = Math::BigInt->new("+40123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3207 - is a valid object ok 3208 - $x = Math::BigInt->new("-40123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3209 - is a valid object ok 3210 - $x = Math::BigInt->new("+40123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3211 - is a valid object ok 3212 - $x = Math::BigInt->new("-40123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3213 - is a valid object ok 3214 - $x = Math::BigInt->new("+401234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3215 - is a valid object ok 3216 - $x = Math::BigInt->new("+401234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3217 - is a valid object ok 3218 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3219 - is a valid object ok 3220 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("-inf"); $x->bround($y); ok 3221 - is a valid object ok 3222 - $x = Math::BigInt->new("+50123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3223 - is a valid object ok 3224 - $x = Math::BigInt->new("-50123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3225 - is a valid object ok 3226 - $x = Math::BigInt->new("+50123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3227 - is a valid object ok 3228 - $x = Math::BigInt->new("-50123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3229 - is a valid object ok 3230 - $x = Math::BigInt->new("+501234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3231 - is a valid object ok 3232 - $x = Math::BigInt->new("-501234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3233 - is a valid object ok 3234 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3235 - is a valid object ok 3236 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("odd"); $x->bround($y); ok 3237 - is a valid object ok 3238 - $x = Math::BigInt->new("+60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3239 - is a valid object ok 3240 - $x = Math::BigInt->new("-60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3241 - is a valid object ok 3242 - $x = Math::BigInt->new("+60123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3243 - is a valid object ok 3244 - $x = Math::BigInt->new("-60123456789"); $y = Math::BigInt->new("9"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3245 - is a valid object ok 3246 - $x = Math::BigInt->new("+601234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3247 - is a valid object ok 3248 - $x = Math::BigInt->new("-601234500"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3249 - is a valid object ok 3250 - $x = Math::BigInt->new("+1234567"); $y = Math::BigInt->new("7"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3251 - is a valid object ok 3252 - $x = Math::BigInt->new("+1234567"); $y = Math::BigInt->new("6"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3253 - is a valid object ok 3254 - $x = Math::BigInt->new("+12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3255 - is a valid object ok 3256 - $x = Math::BigInt->new("-12345000"); $y = Math::BigInt->new("4"); Math::BigInt->round_mode("even"); $x->bround($y); ok 3257 - is a valid object ok 3258 - $x = Math::BigInt->new("+60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3259 - is a valid object ok 3260 - $x = Math::BigInt->new("+60123199999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3261 - is a valid object ok 3262 - $x = Math::BigInt->new("+60123299999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3263 - is a valid object ok 3264 - $x = Math::BigInt->new("+60123399999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3265 - is a valid object ok 3266 - $x = Math::BigInt->new("+60123499999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3267 - is a valid object ok 3268 - $x = Math::BigInt->new("+60123500000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3269 - is a valid object ok 3270 - $x = Math::BigInt->new("+60123600000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3271 - is a valid object ok 3272 - $x = Math::BigInt->new("+60123700000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3273 - is a valid object ok 3274 - $x = Math::BigInt->new("+60123800000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3275 - is a valid object ok 3276 - $x = Math::BigInt->new("+60123900000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3277 - is a valid object ok 3278 - $x = Math::BigInt->new("-60123456789"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3279 - is a valid object ok 3280 - $x = Math::BigInt->new("-60123199999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3281 - is a valid object ok 3282 - $x = Math::BigInt->new("-60123299999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3283 - is a valid object ok 3284 - $x = Math::BigInt->new("-60123399999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3285 - is a valid object ok 3286 - $x = Math::BigInt->new("-60123499999"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3287 - is a valid object ok 3288 - $x = Math::BigInt->new("-60123500000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3289 - is a valid object ok 3290 - $x = Math::BigInt->new("-60123600000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3291 - is a valid object ok 3292 - $x = Math::BigInt->new("-60123700000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3293 - is a valid object ok 3294 - $x = Math::BigInt->new("-60123800000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3295 - is a valid object ok 3296 - $x = Math::BigInt->new("-60123900000"); $y = Math::BigInt->new("5"); Math::BigInt->round_mode("common"); $x->bround($y); ok 3297 - is a valid object ok 3298 - $x = Math::BigInt->new("0"); $x->is_zero() || 0; ok 3299 - $x = Math::BigInt->new("NaNzero"); $x->is_zero() || 0; ok 3300 - $x = Math::BigInt->new("+inf"); $x->is_zero() || 0; ok 3301 - $x = Math::BigInt->new("-inf"); $x->is_zero() || 0; ok 3302 - $x = Math::BigInt->new("123"); $x->is_zero() || 0; ok 3303 - $x = Math::BigInt->new("-1"); $x->is_zero() || 0; ok 3304 - $x = Math::BigInt->new("1"); $x->is_zero() || 0; ok 3305 - $x = Math::BigInt->new("0"); $x->is_one() || 0; ok 3306 - $x = Math::BigInt->new("NaNone"); $x->is_one() || 0; ok 3307 - $x = Math::BigInt->new("+inf"); $x->is_one() || 0; ok 3308 - $x = Math::BigInt->new("-inf"); $x->is_one() || 0; ok 3309 - $x = Math::BigInt->new("1"); $x->is_one() || 0; ok 3310 - $x = Math::BigInt->new("2"); $x->is_one() || 0; ok 3311 - $x = Math::BigInt->new("-1"); $x->is_one() || 0; ok 3312 - $x = Math::BigInt->new("-2"); $x->is_one() || 0; ok 3313 - $x = Math::BigInt->new("0"); $x->bfloor(); ok 3314 - is a valid object ok 3315 - $x = Math::BigInt->new("NaNfloor"); $x->bfloor(); ok 3316 - is a valid object ok 3317 - $x = Math::BigInt->new("+inf"); $x->bfloor(); ok 3318 - is a valid object ok 3319 - $x = Math::BigInt->new("-inf"); $x->bfloor(); ok 3320 - is a valid object ok 3321 - $x = Math::BigInt->new("-1"); $x->bfloor(); ok 3322 - is a valid object ok 3323 - $x = Math::BigInt->new("-2"); $x->bfloor(); ok 3324 - is a valid object ok 3325 - $x = Math::BigInt->new("2"); $x->bfloor(); ok 3326 - is a valid object ok 3327 - $x = Math::BigInt->new("3"); $x->bfloor(); ok 3328 - is a valid object ok 3329 - $x = Math::BigInt->new("abc"); $x->bfloor(); ok 3330 - is a valid object ok 3331 - $x = Math::BigInt->new("NaNceil"); $x->bceil(); ok 3332 - is a valid object ok 3333 - $x = Math::BigInt->new("+inf"); $x->bceil(); ok 3334 - is a valid object ok 3335 - $x = Math::BigInt->new("-inf"); $x->bceil(); ok 3336 - is a valid object ok 3337 - $x = Math::BigInt->new("0"); $x->bceil(); ok 3338 - is a valid object ok 3339 - $x = Math::BigInt->new("-1"); $x->bceil(); ok 3340 - is a valid object ok 3341 - $x = Math::BigInt->new("-2"); $x->bceil(); ok 3342 - is a valid object ok 3343 - $x = Math::BigInt->new("2"); $x->bceil(); ok 3344 - is a valid object ok 3345 - $x = Math::BigInt->new("3"); $x->bceil(); ok 3346 - is a valid object ok 3347 - $x = Math::BigInt->new("abc"); $x->bceil(); ok 3348 - is a valid object ok 3349 - $x = Math::BigInt->new("NaN"); $x->bint(); ok 3350 - is a valid object ok 3351 - $x = Math::BigInt->new("+inf"); $x->bint(); ok 3352 - is a valid object ok 3353 - $x = Math::BigInt->new("-inf"); $x->bint(); ok 3354 - is a valid object ok 3355 - $x = Math::BigInt->new("0"); $x->bint(); ok 3356 - is a valid object ok 3357 - $x = Math::BigInt->new("-1"); $x->bint(); ok 3358 - is a valid object ok 3359 - $x = Math::BigInt->new("-2"); $x->bint(); ok 3360 - is a valid object ok 3361 - $x = Math::BigInt->new("2"); $x->bint(); ok 3362 - is a valid object ok 3363 - $x = Math::BigInt->new("3"); $x->bint(); ok 3364 - is a valid object ok 3365 - $x = Math::BigInt->new("128"); $x->as_hex(); ok 3366 - $x = Math::BigInt->new("-128"); $x->as_hex(); ok 3367 - $x = Math::BigInt->new("0"); $x->as_hex(); ok 3368 - $x = Math::BigInt->new("-0"); $x->as_hex(); ok 3369 - $x = Math::BigInt->new("1"); $x->as_hex(); ok 3370 - $x = Math::BigInt->new("0x123456789123456789"); $x->as_hex(); ok 3371 - $x = Math::BigInt->new("+inf"); $x->as_hex(); ok 3372 - $x = Math::BigInt->new("-inf"); $x->as_hex(); ok 3373 - $x = Math::BigInt->new("NaNas_hex"); $x->as_hex(); ok 3374 - $x = Math::BigInt->new("128"); $x->as_bin(); ok 3375 - $x = Math::BigInt->new("-128"); $x->as_bin(); ok 3376 - $x = Math::BigInt->new("0"); $x->as_bin(); ok 3377 - $x = Math::BigInt->new("-0"); $x->as_bin(); ok 3378 - $x = Math::BigInt->new("1"); $x->as_bin(); ok 3379 - $x = Math::BigInt->new("0b1010111101010101010110110110110110101"); $x->as_bin(); ok 3380 - $x = Math::BigInt->new("0x123456789123456789"); $x->as_bin(); ok 3381 - $x = Math::BigInt->new("+inf"); $x->as_bin(); ok 3382 - $x = Math::BigInt->new("-inf"); $x->as_bin(); ok 3383 - $x = Math::BigInt->new("NaNas_bin"); $x->as_bin(); ok 3384 - $x = Math::BigInt->new("128"); $x->as_oct(); ok 3385 - $x = Math::BigInt->new("-128"); $x->as_oct(); ok 3386 - $x = Math::BigInt->new("0"); $x->as_oct(); ok 3387 - $x = Math::BigInt->new("-0"); $x->as_oct(); ok 3388 - $x = Math::BigInt->new("1"); $x->as_oct(); ok 3389 - $x = Math::BigInt->new("0b1010111101010101010110110110110110101"); $x->as_oct(); ok 3390 - $x = Math::BigInt->new("0x123456789123456789"); $x->as_oct(); ok 3391 - $x = Math::BigInt->new("+inf"); $x->as_oct(); ok 3392 - $x = Math::BigInt->new("-inf"); $x->as_oct(); ok 3393 - $x = Math::BigInt->new("NaNas_oct"); $x->as_oct(); ok 3394 - $x = Math::BigInt->new("-1"); $x = log($x); ok 3395 - is a valid object ok 3396 - $x = Math::BigInt->new("0"); $x = log($x); ok 3397 - is a valid object ok 3398 - $x = Math::BigInt->new("1"); $x = log($x); ok 3399 - is a valid object ok 3400 - $x = Math::BigInt->new("2"); $x = log($x); ok 3401 - is a valid object ok 3402 - $x = Math::BigInt->new("3"); $x = log($x); ok 3403 - is a valid object ok 3404 - $x = Math::BigInt->new("123456789"); $x = log($x); ok 3405 - is a valid object ok 3406 - $x = Math::BigInt->new("1234567890987654321"); $x = log($x); ok 3407 - is a valid object ok 3408 - $x = Math::BigInt->new("-inf"); $x = log($x); ok 3409 - is a valid object ok 3410 - $x = Math::BigInt->new("inf"); $x = log($x); ok 3411 - is a valid object ok 3412 - $x = Math::BigInt->new("NaN"); $x = log($x); ok 3413 - is a valid object ok 3414 - $x = Math::BigInt->new("4294967296"); $a = $x->bmul($x); ok 3415 - $x = Math::BigInt->new(10); $a = $x->bpow($x); ok 3416 - $z = $x & $y; $x ok 3417 - $z = $x & $y; $y ok 3418 - $z = $x & $y; $z ok 3419 - $z = $x | $y; $x ok 3420 - $z = $x | $y; $y ok 3421 - $z = $x | $y; $z ok 3422 - $z = $x | $y; $x ok 3423 - $z = $x | $y; $y ok 3424 - $z = $x | $y; $z ok 3425 - $z = $x ^ $y; $x ok 3426 - $z = $x ^ $y; $y ok 3427 - $z = $x ^ $y; $z ok 3428 - $y = -$x; $x ok 3429 - $y = abs($x); $x ok 3430 - $x->copy()->bmodpow($y, $z); $u ok 3431 - $x->copy()->bmodpow($y, $z); $y ok 3432 - $x->copy()->bmodpow($y, $z); $z ok 3433 - $y = -$x; $x ok 3434 - $y = -$x; $y ok 3435 - $y = $x->copy()->bneg(); $x ok 3436 - $y = $x->copy()->bneg(); $y ok 3437 - $x->bmul($y); $x ok 3438 - $x->bmul($y); $y ok 3439 - $x->badd($y); $x ok 3440 - $x->badd($y); $y ok 3441 - $x->bsub($y); $x ok 3442 - $x->bsub($y); $y ok 3443 - $x->bdiv($y); $x ok 3444 - $x->bdiv($y); $y ok 3445 - $x->bmod($y); $x ok 3446 - $x->bmod($y); $y ok 3447 - $x->bmul($y); $x ok 3448 - $x->bmul($y); $y ok 3449 - $x->badd($y); $x ok 3450 - $x->badd($y); $y ok 3451 - $x->bsub($y); $x ok 3452 - $x->bsub($y); $y ok 3453 - $x->bdiv($y); $x ok 3454 - $x->bdiv($y); $y ok 3455 - $x->bmod($y); $x ok 3456 - $x->bmod($y); $y ok 3457 - $x->bmul($y); $x ok 3458 - $x->bmul($y); $y ok 3459 - $x->badd($y); $x ok 3460 - $x->badd($y); $y ok 3461 - $x->bsub($y); $x ok 3462 - $x->bsub($y); $y ok 3463 - $x->bdiv($y); $x ok 3464 - $x->bdiv($y); $y ok 3465 - $x->bmod($y); $x ok 3466 - $x->bmod($y); $y ok 3467 - overloading cmp works ok 3468 - $x = Math::BigInt->new(10); $x = 2 ** $x; $x == 1024; ok 3469 - $x = Math::BigInt->new(10); $x = 2 * $x; $x == 20; ok 3470 - $x = Math::BigInt->new(10); $x = 2 + $x; $x == 12; ok 3471 - $x = Math::BigInt->new(10); $x = 2 - $x; $x == -8; ok 3472 - $x = Math::BigInt->new(10); $x = 20 / $x; $x == 2; ok 3473 - $x = Math::BigInt->new(3); $x = 20 % $x; $x == 2; ok 3474 - $x = Math::BigInt->new(7); $x = 20 & $x; $x == 4; ok 3475 - $x = Math::BigInt->new(7); $x = 0x20 | $x; $x == 0x27; ok 3476 - $x = Math::BigInt->new(7); $x = 0x20 ^ $x; $x == 0x27; ok 3477 - $x = Math::BigInt->badd(4, 5); $x == 9; ok 3478 - $x = Math::BigInt->new(1); $x is true ok 3479 - $x = Math::BigInt->new(0); !$x is false ok 3480 - objectify(2, 4, 5) gives Math::BigInt, 4, 5 ok 3481 - first arg matches /^Math::BigInt/ ok 3482 - second arg is 4 ok 3483 - third arg is 5 ok 3484 - objectify(0, 4, 5) gives Math::BigInt, 4, 5 ok 3485 - first arg matches /^Math::BigInt/ ok 3486 - second arg is 4 ok 3487 - third arg is 5 ok 3488 - objectify(2, 4, 5) gives Math::BigInt, 4, 5 ok 3489 - first arg matches /^Math::BigInt/ ok 3490 - second arg is 4 ok 3491 - third arg is 5 ok 3492 - objectify(2, 4, 5, 6, 7) gives Math::BigInt, 4, 5, 6, 7 ok 3493 - first arg matches /^Math::BigInt/ ok 3494 - second arg is 4 ok 3495 - second arg is a Math::BigInt object ok 3496 - third arg is 5 ok 3497 - third arg is a Math::BigInt object ok 3498 - fourth arg is 6 ok 3499 - fourth arg is a scalar ok 3500 - fifth arg is 7 ok 3501 - fifth arg is a scalar ok 3502 - objectify(2, Math::BigInt, 4, 5, 6, 7) gives Math::BigInt, 4, 5, 6, 7 ok 3503 - first arg is Math::BigInt ok 3504 - second arg is 4 ok 3505 - second arg is a Math::BigInt object ok 3506 - third arg is 5 ok 3507 - third arg is a Math::BigInt object ok 3508 - fourth arg is 6 ok 3509 - fourth arg is a scalar ok 3510 - fifth arg is 7 ok 3511 - fifth arg is a scalar ok 3512 - Math::BigInt->new(123)->badd(123) = 246 ok 3513 - Math::BigInt->badd(123, 321) = 444 ok 3514 - Math::BigInt->badd(123, Math::BigInt->new(321)) = 444 ok 3515 - Math::BigInt->new(123)->bsub(122) = 1 ok 3516 - Math::BigInt->bsub(321, 123) = 198 ok 3517 - Math::BigInt->bsub(321, Math::BigInt->new(123)) = 198 ok 3518 - Math::BigInt->new(123)->bmul(123) = 15129 ok 3519 - Math::BigInt->bmul(123, 123) = 15129 ok 3520 - Math::BigInt->bmul(123, Math::BigInt->new(123)) = 15129 ok 3521 - Math::BigInt->new(15129)->bdiv(123) = 123 ok 3522 - Math::BigInt->bdiv(15129, 123) = 123 ok 3523 - Math::BigInt->bdiv(15129, Math::BigInt->new(123)) = 123 ok 3524 - Math::BigInt->new(15131)->bmod(123) = 2 ok 3525 - Math::BigInt->bmod(15131, 123) = 2 ok 3526 - Math::BigInt->bmod(15131, Math::BigInt->new(123)) = 2 ok 3527 - Math::BigInt->new(2)->bpow(16) = 65536 ok 3528 - Math::BigInt->bpow(2, 16) = 65536 ok 3529 - Math::BigInt->bpow(2, Math::BigInt->new(16)) = 65536 ok 3530 - Math::BigInt->new(2**15)->brsft(1) = 2**14 ok 3531 - Math::BigInt->brsft(2**15, 1) = 2**14 ok 3532 - Math::BigInt->brsft(2**15, Math::BigInt->new(1)) = 2**14 ok 3533 - Math::BigInt->new(2**13)->blsft(1) = 2**14 ok 3534 - Math::BigInt->blsft(2**13, 1) = 2**14 ok 3535 - Math::BigInt->blsft(2**13, Math::BigInt->new(1)) = 2**14 ok 3536 - $x = Math::BigInt->new(1050000000000000); $x->bsstr() = "105e+13" ok 3537 - $x = Math::BigInt->new(1e+129); $x->bsstr() = "1e+129" ok 3538 - Math::BigInt->new("1") = 1 ok 3539 - Math::BigInt->new(" 1") = 1 ok 3540 - Math::BigInt->new("1 ") = 1 ok 3541 - Math::BigInt->new(" 1 ") = 1 ok 3542 - Math::BigInt->new("\n1") = 1 ok 3543 - Math::BigInt->new("1\n") = 1 ok 3544 - Math::BigInt->new("\n1\n") = 1 ok 3545 - Math::BigInt->new(" \n1\n") = 1 ok 3546 - Math::BigInt->new(" \n1 \n") = 1 ok 3547 - Math::BigInt->new(" \n1\n ") = 1 ok 3548 - Math::BigInt->new(" \n1\n1") = 'NaN' ok 3549 - Math::BigInt->new("1 \n1\n1") = 'NaN' ok 3550 - Math::BigInt->new("12") = 12 ok 3551 - Math::BigInt->new(" 12") = 12 ok 3552 - Math::BigInt->new("12 ") = 12 ok 3553 - Math::BigInt->new(" 12 ") = 12 ok 3554 - Math::BigInt->new("\n12") = 12 ok 3555 - Math::BigInt->new("12\n") = 12 ok 3556 - Math::BigInt->new("\n12\n") = 12 ok 3557 - Math::BigInt->new(" \n12\n") = 12 ok 3558 - Math::BigInt->new(" \n12 \n") = 12 ok 3559 - Math::BigInt->new(" \n12\n ") = 12 ok 3560 - Math::BigInt->new(" \n12\n1") = 'NaN' ok 3561 - Math::BigInt->new("1 \n12\n1") = 'NaN' ok 3562 - Math::BigInt->new("123") = 123 ok 3563 - Math::BigInt->new(" 123") = 123 ok 3564 - Math::BigInt->new("123 ") = 123 ok 3565 - Math::BigInt->new(" 123 ") = 123 ok 3566 - Math::BigInt->new("\n123") = 123 ok 3567 - Math::BigInt->new("123\n") = 123 ok 3568 - Math::BigInt->new("\n123\n") = 123 ok 3569 - Math::BigInt->new(" \n123\n") = 123 ok 3570 - Math::BigInt->new(" \n123 \n") = 123 ok 3571 - Math::BigInt->new(" \n123\n ") = 123 ok 3572 - Math::BigInt->new(" \n123\n1") = 'NaN' ok 3573 - Math::BigInt->new("1 \n123\n1") = 'NaN' ok 3574 - Math::BigInt->new("1234") = 1234 ok 3575 - Math::BigInt->new(" 1234") = 1234 ok 3576 - Math::BigInt->new("1234 ") = 1234 ok 3577 - Math::BigInt->new(" 1234 ") = 1234 ok 3578 - Math::BigInt->new("\n1234") = 1234 ok 3579 - Math::BigInt->new("1234\n") = 1234 ok 3580 - Math::BigInt->new("\n1234\n") = 1234 ok 3581 - Math::BigInt->new(" \n1234\n") = 1234 ok 3582 - Math::BigInt->new(" \n1234 \n") = 1234 ok 3583 - Math::BigInt->new(" \n1234\n ") = 1234 ok 3584 - Math::BigInt->new(" \n1234\n1") = 'NaN' ok 3585 - Math::BigInt->new("1 \n1234\n1") = 'NaN' ok 3586 - Math::BigInt->new("12345") = 12345 ok 3587 - Math::BigInt->new(" 12345") = 12345 ok 3588 - Math::BigInt->new("12345 ") = 12345 ok 3589 - Math::BigInt->new(" 12345 ") = 12345 ok 3590 - Math::BigInt->new("\n12345") = 12345 ok 3591 - Math::BigInt->new("12345\n") = 12345 ok 3592 - Math::BigInt->new("\n12345\n") = 12345 ok 3593 - Math::BigInt->new(" \n12345\n") = 12345 ok 3594 - Math::BigInt->new(" \n12345 \n") = 12345 ok 3595 - Math::BigInt->new(" \n12345\n ") = 12345 ok 3596 - Math::BigInt->new(" \n12345\n1") = 'NaN' ok 3597 - Math::BigInt->new("1 \n12345\n1") = 'NaN' ok 3598 - Math::BigInt->new("123456") = 123456 ok 3599 - Math::BigInt->new(" 123456") = 123456 ok 3600 - Math::BigInt->new("123456 ") = 123456 ok 3601 - Math::BigInt->new(" 123456 ") = 123456 ok 3602 - Math::BigInt->new("\n123456") = 123456 ok 3603 - Math::BigInt->new("123456\n") = 123456 ok 3604 - Math::BigInt->new("\n123456\n") = 123456 ok 3605 - Math::BigInt->new(" \n123456\n") = 123456 ok 3606 - Math::BigInt->new(" \n123456 \n") = 123456 ok 3607 - Math::BigInt->new(" \n123456\n ") = 123456 ok 3608 - Math::BigInt->new(" \n123456\n1") = 'NaN' ok 3609 - Math::BigInt->new("1 \n123456\n1") = 'NaN' ok 3610 - Math::BigInt->new("1234567") = 1234567 ok 3611 - Math::BigInt->new(" 1234567") = 1234567 ok 3612 - Math::BigInt->new("1234567 ") = 1234567 ok 3613 - Math::BigInt->new(" 1234567 ") = 1234567 ok 3614 - Math::BigInt->new("\n1234567") = 1234567 ok 3615 - Math::BigInt->new("1234567\n") = 1234567 ok 3616 - Math::BigInt->new("\n1234567\n") = 1234567 ok 3617 - Math::BigInt->new(" \n1234567\n") = 1234567 ok 3618 - Math::BigInt->new(" \n1234567 \n") = 1234567 ok 3619 - Math::BigInt->new(" \n1234567\n ") = 1234567 ok 3620 - Math::BigInt->new(" \n1234567\n1") = 'NaN' ok 3621 - Math::BigInt->new("1 \n1234567\n1") = 'NaN' ok 3622 - Math::BigInt->new("12345678") = 12345678 ok 3623 - Math::BigInt->new(" 12345678") = 12345678 ok 3624 - Math::BigInt->new("12345678 ") = 12345678 ok 3625 - Math::BigInt->new(" 12345678 ") = 12345678 ok 3626 - Math::BigInt->new("\n12345678") = 12345678 ok 3627 - Math::BigInt->new("12345678\n") = 12345678 ok 3628 - Math::BigInt->new("\n12345678\n") = 12345678 ok 3629 - Math::BigInt->new(" \n12345678\n") = 12345678 ok 3630 - Math::BigInt->new(" \n12345678 \n") = 12345678 ok 3631 - Math::BigInt->new(" \n12345678\n ") = 12345678 ok 3632 - Math::BigInt->new(" \n12345678\n1") = 'NaN' ok 3633 - Math::BigInt->new("1 \n12345678\n1") = 'NaN' ok 3634 - Math::BigInt->new("123456789") = 123456789 ok 3635 - Math::BigInt->new(" 123456789") = 123456789 ok 3636 - Math::BigInt->new("123456789 ") = 123456789 ok 3637 - Math::BigInt->new(" 123456789 ") = 123456789 ok 3638 - Math::BigInt->new("\n123456789") = 123456789 ok 3639 - Math::BigInt->new("123456789\n") = 123456789 ok 3640 - Math::BigInt->new("\n123456789\n") = 123456789 ok 3641 - Math::BigInt->new(" \n123456789\n") = 123456789 ok 3642 - Math::BigInt->new(" \n123456789 \n") = 123456789 ok 3643 - Math::BigInt->new(" \n123456789\n ") = 123456789 ok 3644 - Math::BigInt->new(" \n123456789\n1") = 'NaN' ok 3645 - Math::BigInt->new("1 \n123456789\n1") = 'NaN' ok 3646 - Math::BigInt->new("1234567890") = 1234567890 ok 3647 - Math::BigInt->new(" 1234567890") = 1234567890 ok 3648 - Math::BigInt->new("1234567890 ") = 1234567890 ok 3649 - Math::BigInt->new(" 1234567890 ") = 1234567890 ok 3650 - Math::BigInt->new("\n1234567890") = 1234567890 ok 3651 - Math::BigInt->new("1234567890\n") = 1234567890 ok 3652 - Math::BigInt->new("\n1234567890\n") = 1234567890 ok 3653 - Math::BigInt->new(" \n1234567890\n") = 1234567890 ok 3654 - Math::BigInt->new(" \n1234567890 \n") = 1234567890 ok 3655 - Math::BigInt->new(" \n1234567890\n ") = 1234567890 ok 3656 - Math::BigInt->new(" \n1234567890\n1") = 'NaN' ok 3657 - Math::BigInt->new("1 \n1234567890\n1") = 'NaN' ok 3658 - value of ((2^148)+1)/17 ok 3659 - number of digits in ((2^148)+1)/17 ok 3660 - value of 2^127-1 ok 3661 - number of digits in 2^127-1 ok 3662 - number of digits in fraction part of 2^127-1 ok 3663 - number of digits in 1_000_000_000_000 ok 3664 - number of digits in fraction part of 1_000_000_000_000 ok 3665 - 2 <<= 18 with Math::BigInt objects ok 3666 - 2 <<= 18 with Math::BigInt objects ok 3667 - 2 >>= 18 with Math::BigInt objects ok 3668 - 2 >>= 18 with Math::BigInt objects ok 3669 - $x = Math::Foo->new(5); $x = $x - 8; $x = 3 ok 3670 - $x is an object of class "Math::Foo" ok 3671 - $x = Math::Foo->new(5); $x = 8 - $x; $x = -3 ok 3672 - $x is an object of class "Math::Foo" ok 3673 - numify of +Inf ok 3674 - numify of -Inf ok 3675 - numify of NaN ok 3676 - Math::BigInt->new("+inf") = "inf" ok 3677 # skip no 64 bit integer support ok 3678 # skip no 64 bit integer support ok 3679 # skip no 64 bit integer support ok 3680 # skip no 64 bit integer support ok 3681 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3682 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3683 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3684 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3685 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3686 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3687 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3688 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3689 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3690 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3691 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3692 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3693 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3694 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3695 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3696 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3697 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3698 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3699 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3700 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3701 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3702 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3703 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3704 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3705 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3706 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3707 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3708 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3709 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3710 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3711 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3712 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3713 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3714 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3715 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3716 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3717 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3718 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3719 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3720 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3721 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3722 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3723 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3724 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3725 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3726 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3727 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3728 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3729 # skip skipping tests not intended for the backend Math::BigInt::GMP ok 3730 # skip skipping tests not intended for the backend Math::BigInt::GMP ok t/biglog.t ............... 1..71 ok 1 - GMP loaded ok 2 - blog(2) ok 3 - blog(288) ok 4 - blog(2000) ok 5 - bexp(1) ok 6 - bexp(2) ok 7 - bexp(3) ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - blog(100) ok 42 - 2 ** 32 ok 43 - 3 ** 32 ok 44 - 2 ** 65 ok 45 - blog(777**256, 12345678901234) ok 46 - blog(777**777, 777) ok 47 - 14.14213562 ok 48 - 4.472135955 ok 49 - 1.414213562 ok 50 - 0.4472135955 ok 51 - 0.1414213562 ok 52 - 0.7 ok 53 - 0.7000000000 ok 54 - 0.04472135955 ok 55 - 0.01414213562 ok 56 - 0.07 ok 57 - 0.07000000000 ok 58 - 0.001414213562 ok 59 - 0.1449137675 ok 60 - 1.095445115 ok 61 - 1.109053651 ok 62 - 3.507135583 ok 63 - 3.146426545 ok 64 - 3.141500000 ok 65 - 3.1415 ok 66 - 0.5169187652 ok 67 - bexp(1) ok 68 - bexp(2) ok 69 - bexp(12.5) ok 70 - bexp(100) ok 71 - bexp(12.5) to 91 digits ok t/bigroot.t .............. 1..9 ok 1 - GMP loaded ok 2 - Try: Math::BigFloat 2->bpow(120)->broot(8,undef) == 32768 ok 3 - Try: Math::BigInt 2->bpow(120)->broot(8,undef) == 32768 ok 4 - Try: Math::BigFloat 2->bpow(60)->broot(8,undef) == 181.0193359837561662466161566988413540569 ok 5 - Try: Math::BigInt 2->bpow(60)->broot(8,undef) == 181 ok 6 - Try: Math::BigFloat 2->bpow(60)->broot(9,undef) == 101.5936673259647663841091609134277286651 ok 7 - Try: Math::BigInt 2->bpow(60)->broot(9,undef) == 101 ok 8 - Try: Math::BigFloat 2->bpow(60)->broot(17,undef) == 11.54672461623965153271017217302844672562 ok 9 - Try: Math::BigInt 2->bpow(60)->broot(17,undef) == 11 ok t/mbi-from-big-scalar.t .. 1..12 ok 1 - new 9223372036854775805 ok 2 - new -9223372036854775805 ok 3 - new 9223372036854775806 ok 4 - new -9223372036854775806 ok 5 - new 9223372036854775807 ok 6 - new -9223372036854775807 ok 7 - new 9223372036854775808 ok 8 - new -9223372036854775808 ok 9 - new 18446744073709551614 ok 10 - new 18446744073709551615 ok 11 - 10 should be less than maxint ok 12 # skip The following test may hang or cause an exception if incorrect. Set AUTHOR_TESTING to a true value to run this test. ok t/storable.t ............. 1..1 ok 1 ok Thread creation failed: pthread_create returned 12 at t/threads.t line 24. Thread creation failed: pthread_create returned 12 at t/threads.t line 24. Thread creation failed: pthread_create returned 12 at t/threads.t line 24. Can't call method "join" on an undefined value at t/threads.t line 27. # Looks like your test exited with 12 before it could output anything. t/threads.t .............. 1..22 Dubious, test returned 12 (wstat 3072, 0xc00) Failed 22/22 subtests Test Summary Report ------------------- t/threads.t (Wstat: 3072 Tests: 0 Failed: 0) Non-zero exit status: 12 Parse errors: Bad plan. You planned 22 tests but ran 0. Files=12, Tests=6597, 6 wallclock secs ( 0.96 usr 0.10 sys + 4.77 cusr 0.22 csys = 6.05 CPU) Result: FAIL Failed 1/12 test programs. 0/6597 subtests failed. make: *** [test_dynamic] Error 12 PJACKLAM/Math-BigInt-GMP-1.49.tar.gz make test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports PJACKLAM/Math-BigInt-GMP-1.49.tar.gz MITHALDU/Crypt-DH-0.07.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Crypt-DH-0.07-JEt8dG MITHALDU/Crypt-DH-0.07.tar.gz Has already been prepared Running make for M/MI/MITHALDU/Crypt-DH-0.07.tar.gz Warning: Prerequisite 'Math::BigInt::GMP => 1.24' for 'MITHALDU/Crypt-DH-0.07.tar.gz' failed when processing 'PJACKLAM/Math-BigInt-GMP-1.49.tar.gz' with 'make_test => NO'. Continuing, but chances to succeed are limited. >>> make cp lib/Crypt/DH.pm blib/lib/Crypt/DH.pm Manifying 1 pod document MITHALDU/Crypt-DH-0.07.tar.gz make -- OK Running make test >>> make test TEST_VERBOSE=1 PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'inc', 'blib/lib', 'blib/arch')" t/00-compile.t t/01-dh.t t/00-compile.t .. 1..1 ok 1 - use Crypt::DH; ok t/01-dh.t ....... 1..21 ok 1 - any2bigint(scalar) returns a defined value ok 2 - any2bigint(scalar) returns a Math::BigInt ok 3 - any2bigint(scalar) returns the correct value ok 4 - any2bigint(Math::BigInt) returns a defined value ok 5 - any2bigint(Math::BigInt) returns a Math::BigInt ok 6 - any2bigint(Math::BigInt) returns the correct value ok 7 - any2bigint(Math::Pari) returns a defined value ok 8 - any2bigint(Math::Pari) returns a Math::BigInt ok 9 - any2bigint(Math::Pari) returns the correct value ok 10 - Key generation did not modify g ok 11 - Key generation did not modify p ok 12 - Shared secrets match ok 13 - Key generation did not modify g ok 14 - Key generation did not modify p ok 15 - Shared secrets match ok 16 - Key generation did not modify g ok 17 - Key generation did not modify p ok 18 - Shared secrets match ok 19 - Key generation did not modify g ok 20 - Key generation did not modify p ok 21 - Shared secrets match ok All tests successful. Files=2, Tests=22, 6 wallclock secs ( 0.02 usr 0.01 sys + 5.56 cusr 0.03 csys = 5.62 CPU) Result: PASS MITHALDU/Crypt-DH-0.07.tar.gz Tests succeeded but one dependency not OK (Math::BigInt::GMP) MITHALDU/Crypt-DH-0.07.tar.gz [dependencies] -- NA SCHWIGON/Net-SSH-Perl-1.42.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-1.42-_2k1Go SCHWIGON/Net-SSH-Perl-1.42.tar.gz Has already been prepared Running make for S/SC/SCHWIGON/Net-SSH-Perl-1.42.tar.gz Warning: Prerequisite 'Crypt::DH => 0.01' for 'SCHWIGON/Net-SSH-Perl-1.42.tar.gz' failed when processing 'MITHALDU/Crypt-DH-0.07.tar.gz' with 'make_test => NO one dependency not OK (Math::BigInt::GMP)'. Continuing, but chances to succeed are limited. >>> make cp lib/Net/SSH/Perl/SSH2.pm blib/lib/Net/SSH/Perl/SSH2.pm cp lib/Net/SSH/Perl/Cipher.pm blib/lib/Net/SSH/Perl/Cipher.pm cp lib/Net/SSH/Perl/Kex/DH1.pm blib/lib/Net/SSH/Perl/Kex/DH1.pm cp lib/Net/SSH/Perl/Subsystem/Server.pm blib/lib/Net/SSH/Perl/Subsystem/Server.pm cp lib/Net/SSH/Perl/Util/SSH1MP.pm blib/lib/Net/SSH/Perl/Util/SSH1MP.pm cp lib/Net/SSH/Perl/Subsystem/Client.pm blib/lib/Net/SSH/Perl/Subsystem/Client.pm cp lib/Net/SSH/Perl/Cipher/DES.pm blib/lib/Net/SSH/Perl/Cipher/DES.pm cp lib/Net/SSH/Perl/Util/SSH2MP.pm blib/lib/Net/SSH/Perl/Util/SSH2MP.pm cp lib/Net/SSH/Perl/Cipher/CFB.pm blib/lib/Net/SSH/Perl/Cipher/CFB.pm cp lib/Net/SSH/Perl/ChannelMgr.pm blib/lib/Net/SSH/Perl/ChannelMgr.pm cp lib/Net/SSH/Perl/AuthMgr.pm blib/lib/Net/SSH/Perl/AuthMgr.pm cp lib/Net/SSH/Perl/Auth/RSA.pm blib/lib/Net/SSH/Perl/Auth/RSA.pm cp lib/Net/SSH/Perl/Kex/DH.pm blib/lib/Net/SSH/Perl/Kex/DH.pm cp lib/Net/SSH/Perl/Comp/Zlib.pm blib/lib/Net/SSH/Perl/Comp/Zlib.pm cp lib/Net/SSH/Perl/Auth/Rhosts_RSA.pm blib/lib/Net/SSH/Perl/Auth/Rhosts_RSA.pm cp lib/Net/SSH/Perl/Buffer.pm blib/lib/Net/SSH/Perl/Buffer.pm cp lib/Net/SSH/Perl/Channel.pm blib/lib/Net/SSH/Perl/Channel.pm cp lib/Net/SSH/Perl.pm blib/lib/Net/SSH/Perl.pm cp lib/Net/SSH/Perl/Auth/PublicKey.pm blib/lib/Net/SSH/Perl/Auth/PublicKey.pm cp lib/Net/SSH/Perl/Util.pm blib/lib/Net/SSH/Perl/Util.pm cp lib/Net/SSH/Perl/Auth/Password.pm blib/lib/Net/SSH/Perl/Auth/Password.pm cp lib/Net/SSH/Perl/Util/Term.pm blib/lib/Net/SSH/Perl/Util/Term.pm cp lib/Net/SSH/Perl/Kex.pm blib/lib/Net/SSH/Perl/Kex.pm cp lib/Net/SSH/Perl/Cipher/RC4.pm blib/lib/Net/SSH/Perl/Cipher/RC4.pm cp lib/Net/SSH/Perl/Comp.pm blib/lib/Net/SSH/Perl/Comp.pm cp lib/Net/SSH/Perl/Agent.pm blib/lib/Net/SSH/Perl/Agent.pm cp lib/Net/SSH/Perl/Auth.pm blib/lib/Net/SSH/Perl/Auth.pm cp lib/Net/SSH/Perl/Util/Hosts.pm blib/lib/Net/SSH/Perl/Util/Hosts.pm cp lib/Net/SSH/Perl/Packet.pm blib/lib/Net/SSH/Perl/Packet.pm cp lib/Net/SSH/Perl/Auth/KeyboardInt.pm blib/lib/Net/SSH/Perl/Auth/KeyboardInt.pm cp lib/Net/SSH/Perl/Handle/SSH1.pm blib/lib/Net/SSH/Perl/Handle/SSH1.pm cp lib/Net/SSH/Perl/Config.pm blib/lib/Net/SSH/Perl/Config.pm cp lib/Net/SSH/Perl/Cipher/Blowfish.pm blib/lib/Net/SSH/Perl/Cipher/Blowfish.pm cp lib/Net/SSH/Perl/Kex/DH14.pm blib/lib/Net/SSH/Perl/Kex/DH14.pm cp lib/Net/SSH/Perl/Mac.pm blib/lib/Net/SSH/Perl/Mac.pm cp lib/Net/SSH/Perl/Key/RSA1.pm blib/lib/Net/SSH/Perl/Key/RSA1.pm cp lib/Net/SSH/Perl/Util/Win32.pm blib/lib/Net/SSH/Perl/Util/Win32.pm cp lib/Net/SSH/Perl/Util/Authfile.pm blib/lib/Net/SSH/Perl/Util/Authfile.pm cp lib/Net/SSH/Perl/Key/DSA.pm blib/lib/Net/SSH/Perl/Key/DSA.pm cp lib/Net/SSH/Perl/SSH1.pm blib/lib/Net/SSH/Perl/SSH1.pm cp lib/Net/SSH/Perl/Auth/Rhosts.pm blib/lib/Net/SSH/Perl/Auth/Rhosts.pm cp lib/Net/SSH/Perl/Auth/ChallengeResponse.pm blib/lib/Net/SSH/Perl/Auth/ChallengeResponse.pm cp lib/Net/SSH/Perl/Cipher/DES3.pm blib/lib/Net/SSH/Perl/Cipher/DES3.pm cp lib/Net/SSH/Perl/Cipher/IDEA.pm blib/lib/Net/SSH/Perl/Cipher/IDEA.pm cp lib/Net/SSH/Perl/Util/SSH1Misc.pm blib/lib/Net/SSH/Perl/Util/SSH1Misc.pm cp lib/Net/SSH/Perl/Constants.pm blib/lib/Net/SSH/Perl/Constants.pm cp lib/Net/SSH/Perl/Handle/SSH2.pm blib/lib/Net/SSH/Perl/Handle/SSH2.pm cp lib/Net/SSH/Perl/Key/RSA.pm blib/lib/Net/SSH/Perl/Key/RSA.pm cp lib/Net/SSH/Perl/Key.pm blib/lib/Net/SSH/Perl/Key.pm cp lib/Net/SSH/Perl/Auth/KeyboardInteractive.pm blib/lib/Net/SSH/Perl/Auth/KeyboardInteractive.pm cp lib/Net/SSH/Perl/Util/RSA.pm blib/lib/Net/SSH/Perl/Util/RSA.pm cp lib/Net/SSH/Perl/Cipher/CBC.pm blib/lib/Net/SSH/Perl/Cipher/CBC.pm cp lib/Net/SSH/Perl/Handle.pm blib/lib/Net/SSH/Perl/Handle.pm Manifying 41 pod documents SCHWIGON/Net-SSH-Perl-1.42.tar.gz make -- OK Running make test >>> make test TEST_VERBOSE=1 PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/00-signature.t ... skipped: Set the environment variable TEST_SIGNATURE to enable this test t/01-compile.t ..... 1..1 ok 1 - use Net::SSH::Perl; ok t/02-buffer.t ...... 1..19 ok 1 - make a buffer ok 2 - buffer length is 7 ok 3 - get_str returns "foo" ok 4 - offset is 7 ok 5 - get_str returns 0 ok 6 - get_int32 returns 999,99,999 ok 7 - get_int8 returns 2 ok 8 - get_char returns "a" ok 9 - get_mp_int returns very large number ok 10 - offset is 0 after empty() ok 11 - length is 0 after empty() ok 12 - bytes is "" after empty() ok 13 - length is 6 after append ok 14 - bytes is "foobar" after append ok 15 - length is 0 after empty() again ok 16 - dump returns "" ok 17 - get_int16 returns 129 ok 18 - dump returns "00 81" ok 19 - dump(1) returns "81" ok t/03-packet.t ...... 1..10 ok 1 - created a packet ok 2 - read a packet back ok 3 - packet type is SSH_CMSG_USER ok 4 - get_str returns "foo" ok 5 - sending success and expecting a failure message croaks ok 6 - check failure message ok 7 - read fails after disconnect ok 8 - error message on read after disconnect ok 9 - packet type is SSH_SMSG_FAILURE ok 10 - second packet type is SSH_CMSG_EOF ok t/04-config.t ...... 1..25 ok 1 - created config object ok 2 - port is 10000 ok 3 - port was set to 5000 ok 4 - got identity_files config ok 5 - got two entries ok 6 - first entry is "identity" ok 7 - second entry is "identity2" ok 8 - cipher is IDEA after merge ok 9 - create a new config with an overridden option ok 10 - port is 22 ok 11 - auth_rhosts is false ok 12 - host is "dummy" ok 13 - port is 5000 ok 14 - interactive is true ok 15 - make a new SSH object ok 16 - object has config ok 17 - port for object is 10000 ok 18 - hostname is foo.bar.com ok 19 - host key in object is foo.bar.com ok 20 - port is 22 after override in SSH constructor ok 21 - port is 22 after override via "options" ok 22 - auth_rhosts is false ok 23 - interactive is true ok 24 - user is "bar" ok 25 - user is "bar" after ->login ok t/05-cipher.t ...... 1..60 ok 1 - First argument was true from line 49 ok 2 - Second argument was true from line 49 ok 3 - Values matched from line 49 ok 4 - Values matched from line 49 ok 5 - First argument was true from line 54 ok 6 - Second argument was true from line 54 ok 7 - Values matched from line 54 ok 8 - Values matched from line 54 ok 9 - First argument was true from line 59 ok 10 - Second argument was true from line 59 ok 11 - Values matched from line 59 ok 12 - Values matched from line 59 ok 13 - First argument was true from line 49 ok 14 - Second argument was true from line 49 ok 15 - Values matched from line 49 ok 16 - Values matched from line 49 ok 17 - First argument was true from line 54 ok 18 - Second argument was true from line 54 ok 19 - Values matched from line 54 ok 20 - Values matched from line 54 ok 21 - First argument was true from line 59 ok 22 - Second argument was true from line 59 ok 23 - Values matched from line 59 ok 24 - Values matched from line 59 ok 25 - First argument was true from line 49 ok 26 - Second argument was true from line 49 ok 27 - Values matched from line 49 ok 28 - Values matched from line 49 ok 29 - First argument was true from line 54 ok 30 - Second argument was true from line 54 ok 31 - Values matched from line 54 ok 32 - Values matched from line 54 ok 33 - First argument was true from line 59 ok 34 - Second argument was true from line 59 ok 35 - Values matched from line 59 ok 36 - Values matched from line 59 ok 37 - First argument was true from line 49 ok 38 - Second argument was true from line 49 ok 39 - Values matched from line 49 ok 40 - Values matched from line 49 ok 41 - First argument was true from line 54 ok 42 - Second argument was true from line 54 ok 43 - Values matched from line 54 ok 44 - Values matched from line 54 ok 45 - First argument was true from line 59 ok 46 - Second argument was true from line 59 ok 47 - Values matched from line 59 ok 48 - Values matched from line 59 ok 49 - First argument was true from line 49 ok 50 - Second argument was true from line 49 ok 51 - Values matched from line 49 ok 52 - Values matched from line 49 ok 53 - First argument was true from line 54 ok 54 - Second argument was true from line 54 ok 55 - Values matched from line 54 ok 56 - Values matched from line 54 ok 57 - First argument was true from line 59 ok 58 - Second argument was true from line 59 ok 59 - Values matched from line 59 ok 60 - Values matched from line 59 ok t/06-auth.t ........ skipped: Test not enabled yet t/06-circular.t .... 1..1 # Running under perl version 5.018000 for linux # Current time local: Wed Jan 27 04:16:44 2016 # Current time GMT: Wed Jan 27 12:16:44 2016 # Using Test.pm version 1.26 ok 1 ok t/99-perlcritic.t .. skipped: Set the environment variable TEST_CRITIC to enable this test t/99-pod.t ......... skipped: Test not ready yet. t/99-spellcheck.t .. skipped: Set the environment variable TEST_SPELL to enable this test t/99-yaml.t ........ skipped: Set the environment variable TEST_AUTHOR to enable this test All tests successful. Files=12, Tests=116, 1 wallclock secs ( 0.06 usr 0.02 sys + 0.77 cusr 0.07 csys = 0.92 CPU) Result: PASS SCHWIGON/Net-SSH-Perl-1.42.tar.gz Tests succeeded but one dependency not OK (Crypt::DH) SCHWIGON/Net-SSH-Perl-1.42.tar.gz [dependencies] -- NA BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-WithSocks-0.02-LdPRtD BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz Has already been prepared Running make for B/BD/BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz Warning: Prerequisite 'Net::SSH::Perl => 0' for 'BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz' failed when processing 'SCHWIGON/Net-SSH-Perl-1.42.tar.gz' with 'make_test => NO one dependency not OK (Crypt::DH)'. Continuing, but chances to succeed are limited. >>> make cp lib/Net/SSH/Perl/WithSocks.pm blib/lib/Net/SSH/Perl/WithSocks.pm Manifying 1 pod document BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz make -- OK Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 test file [00-scratch.t] does not exist! Skipping! at -e line 1. test file [01-sanity.t] does not exist! Skipping! at -e line 1. Test::Manifest::test_harness found [t/load.t t/pod.t t/pod_coverage.t t/prereq.t] t/load.t .......... 1..1 ok 1 - use Net::SSH::Perl::WithSocks; ok t/pod.t ........... 1..1 ok 1 - POD test for blib/lib/Net/SSH/Perl/WithSocks.pm ok t/pod_coverage.t .. 1..1 ok 1 - Pod coverage on Net::SSH::Perl::WithSocks ok t/prereq.t ........ 1..1 ok 1 - Prereq test ok All tests successful. Files=4, Tests=4, 4 wallclock secs ( 0.03 usr 0.01 sys + 4.34 cusr 0.09 csys = 4.47 CPU) Result: PASS BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz Tests succeeded but one dependency not OK (Net::SSH::Perl) BDFOY/Net-SSH-Perl-WithSocks-0.02.tar.gz [dependencies] -- NA Running test for module 'github_creator' The module github_creator isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i github_creator'. Running test for module 'Net::SSH::Perl::ProxiedIPC' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz ok Net-SSH-Perl-ProxiedIPC-0.02/ Net-SSH-Perl-ProxiedIPC-0.02/Changes Net-SSH-Perl-ProxiedIPC-0.02/lib/ Net-SSH-Perl-ProxiedIPC-0.02/Makefile.PL Net-SSH-Perl-ProxiedIPC-0.02/MANIFEST Net-SSH-Perl-ProxiedIPC-0.02/MANIFEST.SKIP Net-SSH-Perl-ProxiedIPC-0.02/META.yml Net-SSH-Perl-ProxiedIPC-0.02/MYMETA.yml Net-SSH-Perl-ProxiedIPC-0.02/README Net-SSH-Perl-ProxiedIPC-0.02/t/ Net-SSH-Perl-ProxiedIPC-0.02/t/load.t Net-SSH-Perl-ProxiedIPC-0.02/t/pod.t Net-SSH-Perl-ProxiedIPC-0.02/t/pod_coverage.t Net-SSH-Perl-ProxiedIPC-0.02/t/prereq.t Net-SSH-Perl-ProxiedIPC-0.02/t/scratch.t Net-SSH-Perl-ProxiedIPC-0.02/t/test_manifest Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/ Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/SSH/ Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/SSH/Perl/ Net-SSH-Perl-ProxiedIPC-0.02/lib/Net/SSH/Perl/ProxiedIPC.pm /bin/tar: Read 3584 bytes from - Configuring B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite Net::SSH::Perl 0 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Net::SSH::Perl::ProxiedIPC Writing MYMETA.yml and MYMETA.json BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz ---- Unsatisfied dependencies detected during ---- ---- BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz ---- Net::SSH::Perl [requires] Running test for module 'Net::SSH::Perl' SCHWIGON/Net-SSH-Perl-1.42.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-1.42-_2k1Go SCHWIGON/Net-SSH-Perl-1.42.tar.gz Has already been prepared SCHWIGON/Net-SSH-Perl-1.42.tar.gz Has already been made SCHWIGON/Net-SSH-Perl-1.42.tar.gz Has already been tested within this command BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-ProxiedIPC-0.02-4vVAw4 BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz Has already been prepared Running make for B/BD/BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz Warning: Prerequisite 'Net::SSH::Perl => 0' for 'BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz' failed when processing 'SCHWIGON/Net-SSH-Perl-1.42.tar.gz' with 'make_test => NO one dependency not OK (Crypt::DH)'. Continuing, but chances to succeed are limited. >>> make cp lib/Net/SSH/Perl/ProxiedIPC.pm blib/lib/Net/SSH/Perl/ProxiedIPC.pm Manifying 1 pod document BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz make -- OK Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/load.t t/pod.t t/pod_coverage.t t/prereq.t t/scratch.t] t/load.t .......... 1..1 ok 1 - use Net::SSH::Perl::ProxiedIPC; ok t/pod.t ........... 1..1 ok 1 - POD test for blib/lib/Net/SSH/Perl/ProxiedIPC.pm ok t/pod_coverage.t .. 1..1 ok 1 - Pod coverage on Net::SSH::Perl::ProxiedIPC ok t/prereq.t ........ 1..1 ok 1 - Prereq test ok Can't locate Net/SSH/Perl.pm in @INC (you may need to install the Net::SSH::Perl module) (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-ProxiedIPC-0.02-4vVAw4/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/Net-SSH-Perl-ProxiedIPC-0.02-4vVAw4/blib/arch /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .) at t/scratch.t line 6. BEGIN failed--compilation aborted at t/scratch.t line 6. t/scratch.t ....... Dubious, test returned 2 (wstat 512, 0x200) No subtests run Test Summary Report ------------------- t/scratch.t (Wstat: 512 Tests: 0 Failed: 0) Non-zero exit status: 2 Parse errors: No plan found in TAP output Files=5, Tests=4, 4 wallclock secs ( 0.03 usr 0.02 sys + 4.40 cusr 0.13 csys = 4.58 CPU) Result: FAIL Failed 1/5 test programs. 0/4 subtests failed. make: *** [test_dynamic] Error 2 BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz one dependency not OK (Net::SSH::Perl); additionally test harness failed make test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports BDFOY/Net-SSH-Perl-ProxiedIPC-0.02.tar.gz Running test for module 'HTTP::Cookies::Omniweb' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz ok HTTP-Cookies-Omniweb-1.13/ HTTP-Cookies-Omniweb-1.13/Changes HTTP-Cookies-Omniweb-1.13/examples/ HTTP-Cookies-Omniweb-1.13/lib/ HTTP-Cookies-Omniweb-1.13/LICENSE HTTP-Cookies-Omniweb-1.13/Makefile.PL HTTP-Cookies-Omniweb-1.13/MANIFEST HTTP-Cookies-Omniweb-1.13/META.yml HTTP-Cookies-Omniweb-1.13/README HTTP-Cookies-Omniweb-1.13/t/ HTTP-Cookies-Omniweb-1.13/t/compile.t HTTP-Cookies-Omniweb-1.13/t/Cookies.xml HTTP-Cookies-Omniweb-1.13/t/load.t HTTP-Cookies-Omniweb-1.13/t/pod.t HTTP-Cookies-Omniweb-1.13/t/pod_coverage.t HTTP-Cookies-Omniweb-1.13/t/prereq.t HTTP-Cookies-Omniweb-1.13/t/save.t HTTP-Cookies-Omniweb-1.13/t/test_manifest HTTP-Cookies-Omniweb-1.13/lib/HTTP/ HTTP-Cookies-Omniweb-1.13/lib/HTTP/Cookies/ HTTP-Cookies-Omniweb-1.13/lib/HTTP/Cookies/Omniweb.pm /bin/tar: Read 5120 bytes from - HTTP-Cookies-Omniweb-1.13/examples/README Configuring B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for HTTP::Cookies::Omniweb Writing MYMETA.yml and MYMETA.json BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz >>> make cp lib/HTTP/Cookies/Omniweb.pm blib/lib/HTTP/Cookies/Omniweb.pm Manifying 1 pod document BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz make -- OK Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/compile.t t/pod.t t/pod_coverage.t t/load.t t/save.t] t/compile.t ....... 1..1 ok 1 - use HTTP::Cookies::Omniweb; ok t/pod.t ........... 1..1 ok 1 - POD test for blib/lib/HTTP/Cookies/Omniweb.pm ok t/pod_coverage.t .. 1..1 ok 1 - Pod coverage on HTTP::Cookies::Omniweb ok t/load.t .......... 1..5 ok 1 - An object of class 'HTTP::Cookies::Omniweb' isa 'HTTP::Cookies::Omniweb' ok 2 - Count of domains ok 3 - .ebay.com has 1 cookies ok 4 - .usatoday.com has 3 cookies ok 5 - Cookie has right value ok t/save.t .......... 1..2 ok 1 - An object of class 'HTTP::Cookies::Omniweb' isa 'HTTP::Cookies::Omniweb' ok 2 - Saved file is same as original ok All tests successful. Files=5, Tests=10, 1 wallclock secs ( 0.03 usr 0.02 sys + 0.33 cusr 0.04 csys = 0.42 CPU) Result: PASS BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz make test TEST_VERBOSE=1 -- OK brian d foy <bdfoy@cpan.org> Cookie storage and management for Omniweb >>> (cd /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J && tar cvf - HTTP-Cookies-Omniweb-1.13.ppd blib) | gzip -c >/home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY/HTTP-Cookies-Omniweb-1.13.tar.gz HTTP-Cookies-Omniweb-1.13.ppd blib/ blib/man3/ blib/man3/HTTP::Cookies::Omniweb.3 blib/lib/ blib/lib/HTTP/ blib/lib/HTTP/Cookies/ blib/lib/HTTP/Cookies/Omniweb.pm >>> mv /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/HTTP-Cookies-Omniweb-1.13.ppd /home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY Running test for module 'PPI::App::ppi_version::BDFOY' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz ok PPI-App-ppi_version-BDFOY-0.14/ PPI-App-ppi_version-BDFOY-0.14/Changes PPI-App-ppi_version-BDFOY-0.14/corpus/ PPI-App-ppi_version-BDFOY-0.14/lib/ PPI-App-ppi_version-BDFOY-0.14/LICENSE PPI-App-ppi_version-BDFOY-0.14/Makefile.PL PPI-App-ppi_version-BDFOY-0.14/MANIFEST PPI-App-ppi_version-BDFOY-0.14/MANIFEST.SKIP PPI-App-ppi_version-BDFOY-0.14/META.json PPI-App-ppi_version-BDFOY-0.14/META.yml PPI-App-ppi_version-BDFOY-0.14/README PPI-App-ppi_version-BDFOY-0.14/script/ PPI-App-ppi_version-BDFOY-0.14/t/ PPI-App-ppi_version-BDFOY-0.14/t/get_version.t PPI-App-ppi_version-BDFOY-0.14/t/load.t PPI-App-ppi_version-BDFOY-0.14/t/pod.t PPI-App-ppi_version-BDFOY-0.14/t/pod_coverage.t PPI-App-ppi_version-BDFOY-0.14/t/test_manifest PPI-App-ppi_version-BDFOY-0.14/script/ppi_version PPI-App-ppi_version-BDFOY-0.14/lib/PPI/ PPI-App-ppi_version-BDFOY-0.14/lib/PPI/App/ PPI-App-ppi_version-BDFOY-0.14/lib/PPI/App/ppi_version/ PPI-App-ppi_version-BDFOY-0.14/lib/PPI/App/ppi_version/BDFOY.pm PPI-App-ppi_version-BDFOY-0.14/corpus/our.pm PPI-App-ppi_version-BDFOY-0.14/corpus/vars.pm Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for PPI::App::ppi_version::BDFOY Writing MYMETA.yml and MYMETA.json BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp lib/PPI/App/ppi_version/BDFOY.pm blib/lib/PPI/App/ppi_version/BDFOY.pm cp script/ppi_version blib/script/ppi_version "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ppi_version Manifying 1 pod document BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/load.t t/pod.t t/pod_coverage.t t/get_version.t] t/load.t .......... 1..1 ok 1 - use PPI::App::ppi_version::BDFOY; ok t/pod.t ........... 1..2 ok 1 - POD test for blib/lib/PPI/App/ppi_version/BDFOY.pm ok 2 - POD test for blib/script/ppi_version (no pod) ok t/pod_coverage.t .. 1..1 ok 1 - Pod coverage on PPI::App::ppi_version::BDFOY ok t/get_version.t ... ok 1 - use PPI::App::ppi_version::BDFOY; ok 2 - PPI::App::ppi_version::BDFOY->can('get_version') # Subtest: our ok 1 - get_version returns true for corpus/our.pm 1..1 ok 3 - our # Subtest: vars ok 1 - get_version returns true for corpus/vars.pm 1..1 ok 4 - vars 1..4 ok All tests successful. Files=4, Tests=8, 1 wallclock secs ( 0.03 usr 0.01 sys + 0.68 cusr 0.09 csys = 0.81 CPU) Result: PASS BDFOY/PPI-App-ppi_version-BDFOY-0.14.tar.gz make test TEST_VERBOSE=1 -- OK PPD for PPI-App-ppi_version-BDFOY-0.14 already made Running test for module 'Pod::SpeakIt::MacSpeech' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz ok Pod-SpeakIt-MacSpeech-0.11/ Pod-SpeakIt-MacSpeech-0.11/bin/ Pod-SpeakIt-MacSpeech-0.11/bin/pod2speech Pod-SpeakIt-MacSpeech-0.11/Changes Pod-SpeakIt-MacSpeech-0.11/examples/ Pod-SpeakIt-MacSpeech-0.11/examples/placeholder.pl Pod-SpeakIt-MacSpeech-0.11/hack/ Pod-SpeakIt-MacSpeech-0.11/hack/audition.pl Pod-SpeakIt-MacSpeech-0.11/hack/list_voices.pl Pod-SpeakIt-MacSpeech-0.11/lib/ Pod-SpeakIt-MacSpeech-0.11/lib/MacSpeech.pm Pod-SpeakIt-MacSpeech-0.11/LICENSE Pod-SpeakIt-MacSpeech-0.11/Makefile.PL Pod-SpeakIt-MacSpeech-0.11/MANIFEST Pod-SpeakIt-MacSpeech-0.11/META.yml Pod-SpeakIt-MacSpeech-0.11/README Pod-SpeakIt-MacSpeech-0.11/t/ Pod-SpeakIt-MacSpeech-0.11/t/input_pod_dir/ Pod-SpeakIt-MacSpeech-0.11/t/input_pod_dir/one_para.pod Pod-SpeakIt-MacSpeech-0.11/t/lib/ Pod-SpeakIt-MacSpeech-0.11/t/lib/speak_pod_file.pl Pod-SpeakIt-MacSpeech-0.11/t/load.t Pod-SpeakIt-MacSpeech-0.11/t/one_para.t Pod-SpeakIt-MacSpeech-0.11/t/pod.t Pod-SpeakIt-MacSpeech-0.11/t/pod_coverage.t Pod-SpeakIt-MacSpeech-0.11/t/prereq.t Pod-SpeakIt-MacSpeech-0.11/t/test_manifest Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite Mac::Carbon 0.77 not found. Warning: prerequisite Mac::Files 0 not found. Warning: prerequisite Mac::Speech 0 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Pod::SpeakIt::MacSpeech Writing MYMETA.yml and MYMETA.json BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' ---- Unsatisfied dependencies detected during ---- ---- BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz ---- Mac::Carbon [requires] Mac::Speech [requires] Mac::Files [requires] Running test for module 'Mac::Carbon' ______________________ D i s t r o P r e f s ______________________ Mac-Carbon.yml[0] Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz ok Mac-Carbon-0.82/ Mac-Carbon-0.82/AppleEvents/ Mac-Carbon-0.82/Carbon.h Mac-Carbon-0.82/Carbon.pm Mac-Carbon-0.82/Changes Mac-Carbon-0.82/common.pl Mac-Carbon-0.82/Components/ Mac-Carbon-0.82/Files/ Mac-Carbon-0.82/fixargs.pl Mac-Carbon-0.82/Gestalt/ Mac-Carbon-0.82/InternetConfig/ Mac-Carbon-0.82/MacPerl/ Mac-Carbon-0.82/Makefile.PL Mac-Carbon-0.82/MANIFEST Mac-Carbon-0.82/MANIFEST.SKIP Mac-Carbon-0.82/Memory/ Mac-Carbon-0.82/MoreFiles/ Mac-Carbon-0.82/Notification/ Mac-Carbon-0.82/OSA/ Mac-Carbon-0.82/Processes/ Mac-Carbon-0.82/QuickDraw/ Mac-Carbon-0.82/README Mac-Carbon-0.82/Resources/ Mac-Carbon-0.82/Sound/ Mac-Carbon-0.82/Speech/ Mac-Carbon-0.82/t/ Mac-Carbon-0.82/typemap Mac-Carbon-0.82/Types/ Mac-Carbon-0.82/xsubpps/ Mac-Carbon-0.82/xsubpps/xsubpp-5.6.1 Mac-Carbon-0.82/xsubpps/xsubpp-5.8.0 Mac-Carbon-0.82/Types/Makefile.PL Mac-Carbon-0.82/Types/t/ Mac-Carbon-0.82/Types/Types.pm Mac-Carbon-0.82/Types/Types.xs Mac-Carbon-0.82/Types/t/Types.t Mac-Carbon-0.82/t/Carbon.t Mac-Carbon-0.82/Speech/eg/ Mac-Carbon-0.82/Speech/Makefile.PL Mac-Carbon-0.82/Speech/Speech.pm Mac-Carbon-0.82/Speech/Speech.xs Mac-Carbon-0.82/Speech/t/ Mac-Carbon-0.82/Speech/typemap Mac-Carbon-0.82/Speech/t/Speech.t Mac-Carbon-0.82/Speech/eg/Cellist.plx Mac-Carbon-0.82/Speech/eg/DumpVoices.plx Mac-Carbon-0.82/Speech/eg/JukeBox.plx Mac-Carbon-0.82/Speech/eg/Phonemes.plx Mac-Carbon-0.82/Sound/Makefile.PL Mac-Carbon-0.82/Sound/Sound.pm Mac-Carbon-0.82/Sound/Sound.xs Mac-Carbon-0.82/Sound/t/ Mac-Carbon-0.82/Sound/typemap Mac-Carbon-0.82/Sound/t/Scream.rsrc Mac-Carbon-0.82/Sound/t/Sound.t Mac-Carbon-0.82/Resources/Makefile.PL Mac-Carbon-0.82/Resources/Resources.pm Mac-Carbon-0.82/Resources/Resources.xs Mac-Carbon-0.82/Resources/t/ Mac-Carbon-0.82/Resources/t/Resources.t Mac-Carbon-0.82/QuickDraw/typemap Mac-Carbon-0.82/Processes/eg/ Mac-Carbon-0.82/Processes/Makefile.PL Mac-Carbon-0.82/Processes/Processes.pm Mac-Carbon-0.82/Processes/Processes.xs Mac-Carbon-0.82/Processes/t/ Mac-Carbon-0.82/Processes/typemap Mac-Carbon-0.82/Processes/t/Processes.t Mac-Carbon-0.82/Processes/eg/Processes.plx Mac-Carbon-0.82/OSA/eg/ Mac-Carbon-0.82/OSA/Makefile.PL Mac-Carbon-0.82/OSA/OSA.pm Mac-Carbon-0.82/OSA/OSA.xs Mac-Carbon-0.82/OSA/typemap Mac-Carbon-0.82/OSA/eg/AppleScript.eg Mac-Carbon-0.82/OSA/eg/AppleScript2.eg Mac-Carbon-0.82/OSA/eg/Frontier.eg Mac-Carbon-0.82/OSA/eg/Record.eg Mac-Carbon-0.82/Notification/Makefile.PL Mac-Carbon-0.82/Notification/Notification.pm Mac-Carbon-0.82/Notification/Notification.xs Mac-Carbon-0.82/Notification/t/ Mac-Carbon-0.82/Notification/typemap Mac-Carbon-0.82/Notification/t/Notification.rsrc Mac-Carbon-0.82/Notification/t/Notification.t Mac-Carbon-0.82/MoreFiles/eg/ Mac-Carbon-0.82/MoreFiles/Makefile.PL Mac-Carbon-0.82/MoreFiles/MF.xs Mac-Carbon-0.82/MoreFiles/MoreFiles.pm Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/ Mac-Carbon-0.82/MoreFiles/t/ Mac-Carbon-0.82/MoreFiles/t/MoreFiles.t Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/DirectoryCopy.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/DirectoryCopy.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FileCopy.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FileCopy.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FSpCompat.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FSpCompat.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FullPath.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/FullPath.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/IterateDirectory.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/IterateDirectory.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreDesktopMgr.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreDesktopMgr.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFiles.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFiles.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFilesExtras.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/MoreFilesExtras.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/Optimization.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/OptimizationEnd.h Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/Search.c Mac-Carbon-0.82/MoreFiles/MoreFilesSrc/Search.h Mac-Carbon-0.82/MoreFiles/eg/Application.plx Mac-Carbon-0.82/MoreFiles/eg/Iterate.plx Mac-Carbon-0.82/Memory/Makefile.PL Mac-Carbon-0.82/Memory/Memory.pm Mac-Carbon-0.82/Memory/Memory.xs Mac-Carbon-0.82/Memory/t/ Mac-Carbon-0.82/Memory/t/Memory.t Mac-Carbon-0.82/MacPerl/MacPerl.pm Mac-Carbon-0.82/MacPerl/MacPerl.xs Mac-Carbon-0.82/MacPerl/Makefile.PL Mac-Carbon-0.82/MacPerl/OSA.xs Mac-Carbon-0.82/MacPerl/t/ Mac-Carbon-0.82/MacPerl/t/MacPerl.t Mac-Carbon-0.82/InternetConfig/eg/ Mac-Carbon-0.82/InternetConfig/InternetConfig.pm Mac-Carbon-0.82/InternetConfig/InternetConfig.xs Mac-Carbon-0.82/InternetConfig/Makefile.PL Mac-Carbon-0.82/InternetConfig/typemap Mac-Carbon-0.82/InternetConfig/eg/IC.plx Mac-Carbon-0.82/InternetConfig/eg/ICDump.plx Mac-Carbon-0.82/InternetConfig/eg/ICDumpMap.plx Mac-Carbon-0.82/Gestalt/Gestalt.pm Mac-Carbon-0.82/Gestalt/Gestalt.xs Mac-Carbon-0.82/Gestalt/Makefile.PL Mac-Carbon-0.82/Gestalt/t/ Mac-Carbon-0.82/Gestalt/t/Gestalt.t Mac-Carbon-0.82/Files/Files.pm Mac-Carbon-0.82/Files/Files.xs Mac-Carbon-0.82/Files/Makefile.PL Mac-Carbon-0.82/Files/t/ Mac-Carbon-0.82/Files/typemap Mac-Carbon-0.82/Files/t/Alias.t Mac-Carbon-0.82/Files/t/Constants.t Mac-Carbon-0.82/Files/t/Files.t Mac-Carbon-0.82/Files/t/Info.t Mac-Carbon-0.82/Components/Components.pm Mac-Carbon-0.82/Components/Components.xs Mac-Carbon-0.82/Components/eg/ Mac-Carbon-0.82/Components/Makefile.PL Mac-Carbon-0.82/Components/t/ Mac-Carbon-0.82/Components/typemap Mac-Carbon-0.82/Components/t/Components.t Mac-Carbon-0.82/Components/eg/ListComponents.plx Mac-Carbon-0.82/AppleEvents/AppleEvents.pm Mac-Carbon-0.82/AppleEvents/AppleEvents.xs Mac-Carbon-0.82/AppleEvents/CarbonAE.h Mac-Carbon-0.82/AppleEvents/eg/ Mac-Carbon-0.82/AppleEvents/Makefile.PL Mac-Carbon-0.82/AppleEvents/PerlAEUtils.cp Mac-Carbon-0.82/AppleEvents/PerlAEUtils.h Mac-Carbon-0.82/AppleEvents/t/ Mac-Carbon-0.82/AppleEvents/t/desc.t Mac-Carbon-0.82/AppleEvents/t/event.t Mac-Carbon-0.82/AppleEvents/t/helper.pl Mac-Carbon-0.82/AppleEvents/eg/AEReceiver.eg Mac-Carbon-0.82/AppleEvents/eg/AEReceiver2.eg Mac-Carbon-0.82/AppleEvents/eg/AESender.eg Mac-Carbon-0.82/AppleEvents/eg/AESender2.eg Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::AppleEvents Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Components Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Files Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Gestalt Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::InternetConfig Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for MacPerl Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Memory Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::MoreFiles Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Notification Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::OSA Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Processes Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Resources Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Sound Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Speech Writing MYMETA.yml and MYMETA.json Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Mac::Types Writing MYMETA.yml and MYMETA.json Generating a Unix-style Makefile Writing Makefile for Mac::Carbon Writing MYMETA.yml and MYMETA.json CNANDOR/Mac-Carbon-0.82.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for C/CN/CNANDOR/Mac-Carbon-0.82.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp Carbon.pm blib/lib/Mac/Carbon.pm make[1]: Entering directory `/home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1/AppleEvents' cp AppleEvents.pod ../blib/lib/Mac/AppleEvents.pod cp AppleEvents.pm ../blib/lib/Mac/AppleEvents.pm Running Mkbootstrap for Mac::AppleEvents () chmod 644 "AppleEvents.bs" "/home/fly1800/ap1800-297235/bin/perl-static" ../xsubpps/xsubpp-5.8.0 -noprototypes -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" AppleEvents.xs > AppleEvents.xsc && mv AppleEvents.xsc AppleEvents.c gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"1.32\" -DXS_VERSION=\"1.32\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" AppleEvents.c In file included from AppleEvents.xs:63: ../Carbon.h:87:20: error: Events.h: No such file or directory ../Carbon.h:88:21: error: Dialogs.h: No such file or directory ../Carbon.h:89:19: error: Files.h: No such file or directory ../Carbon.h:90:19: error: Types.h: No such file or directory ../Carbon.h:91:31: error: ConditionalMacros.h: No such file or directory In file included from AppleEvents.xs:63: ../Carbon.h:93: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'MacOSRet' ../Carbon.h:94: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'HandleRet' ../Carbon.h:95: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'RawPtr' ../Carbon.h:96: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PtrRet' In file included from AppleEvents.xs:63: ../Carbon.h:125: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'MacPerl_CopyC2P' ../Carbon.h: In function 'ReadHex': ../Carbon.h:146: error: 'nil' undeclared (first use in this function) ../Carbon.h:146: error: (Each undeclared identifier is reported only once ../Carbon.h:146: error: for each function it appears in.) ../Carbon.h: At top level: ../Carbon.h:159: error: expected ')' before 'dataType' ../Carbon.h:183: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'SecondsMac2Unix' ../Carbon.h:194: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'SecondsUnix2Mac' ../Carbon.h:219: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIFSpUp' ../Carbon.h:239: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIFSpDown' ../Carbon.h:276: error: expected ';', ',' or ')' before '*' token ../Carbon.h:322: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIPath2FSp' ../Carbon.h:403: error: expected ';', ',' or ')' before '*' token ../Carbon.h:415: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSISpecial2FSp' ../Carbon.h:423: error: expected ';', ',' or ')' before '*' token ../Carbon.h:432: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'GUSIPath2FS' ../Carbon.h:439: error: expected declaration specifiers or '...' before 'OSType' ../Carbon.h:439: error: expected declaration specifiers or '...' before 'OSType' ../Carbon.h: In function 'fsetfileinfo': ../Carbon.h:441: error: 'FInfo' undeclared (first use in this function) ../Carbon.h:441: error: expected ';' before 'info' ../Carbon.h:442: error: 'FSSpec' undeclared (first use in this function) ../Carbon.h:442: error: 'spec' undeclared (first use in this function) ../Carbon.h:445: error: 'info' undeclared (first use in this function) ../Carbon.h:446: error: 'type' undeclared (first use in this function) ../Carbon.h:447: error: 'creator' undeclared (first use in this function) ../Carbon.h:448: error: 'kHasBeenInited' undeclared (first use in this function) ../Carbon.h: At top level: ../Carbon.h:457: error: expected declaration specifiers or '...' before 'OSType' ../Carbon.h:457: error: expected declaration specifiers or '...' before 'OSType' ../Carbon.h: In function 'fgetfileinfo': ../Carbon.h:459: error: 'FInfo' undeclared (first use in this function) ../Carbon.h:459: error: expected ';' before 'info' ../Carbon.h:460: error: 'FSSpec' undeclared (first use in this function) ../Carbon.h:460: error: 'spec' undeclared (first use in this function) ../Carbon.h:463: error: 'info' undeclared (first use in this function) ../Carbon.h:464: error: 'creator' undeclared (first use in this function) ../Carbon.h:466: error: 'type' undeclared (first use in this function) ../Carbon.h: At top level: ../Carbon.h:476: error: expected ';', ',' or ')' before '*' token ../Carbon.h:488: error: expected ';', ',' or ')' before '*' token ../Carbon.h:499: error: expected ';', ',' or ')' before '*' token In file included from AppleEvents.xs:64: CarbonAE.h:30: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gBuildError' CarbonAE.h: In function 'pAEBuildError': CarbonAE.h:83: error: 'gBuildError' undeclared (first use in this function) CarbonAE.h:85: warning: initialization makes pointer from integer without a cast CarbonAE.h:88: error: 'aeBuildSyntaxBadToken' undeclared (first use in this function) CarbonAE.h:91: error: 'aeBuildSyntaxBadEOF' undeclared (first use in this function) CarbonAE.h:94: error: 'aeBuildSyntaxNoEOF' undeclared (first use in this function) CarbonAE.h:97: error: 'aeBuildSyntaxBadNegative' undeclared (first use in this function) CarbonAE.h:100: error: 'aeBuildSyntaxMissingQuote' undeclared (first use in this function) CarbonAE.h:103: error: 'aeBuildSyntaxBadHex' undeclared (first use in this function) CarbonAE.h:106: error: 'aeBuildSyntaxOddHex' undeclared (first use in this function) CarbonAE.h:109: error: 'aeBuildSyntaxNoCloseHex' undeclared (first use in this function) CarbonAE.h:112: error: 'aeBuildSyntaxUncoercedHex' undeclared (first use in this function) CarbonAE.h:115: error: 'aeBuildSyntaxNoCloseString' undeclared (first use in this function) CarbonAE.h:118: error: 'aeBuildSyntaxBadDesc' undeclared (first use in this function) CarbonAE.h:121: error: 'aeBuildSyntaxBadData' undeclared (first use in this function) CarbonAE.h:124: error: 'aeBuildSyntaxNoCloseParen' undeclared (first use in this function) CarbonAE.h:127: error: 'aeBuildSyntaxNoCloseBracket' undeclared (first use in this function) CarbonAE.h:130: error: 'aeBuildSyntaxNoCloseBrace' undeclared (first use in this function) CarbonAE.h:133: error: 'aeBuildSyntaxNoKey' undeclared (first use in this function) CarbonAE.h:136: error: 'aeBuildSyntaxNoColon' undeclared (first use in this function) CarbonAE.h:139: error: 'aeBuildSyntaxCoercedList' undeclared (first use in this function) CarbonAE.h:142: error: 'aeBuildSyntaxUncoercedDoubleAt' undeclared (first use in this function) AppleEvents.xs:68:20: error: Memory.h: No such file or directory AppleEvents.xs:69:25: error: AppleEvents.h: No such file or directory In file included from AppleEvents.xs:70: PerlAEUtils.h:39:17: error: OSA.h: No such file or directory In file included from AppleEvents.xs:70: PerlAEUtils.h: At top level: PerlAEUtils.h:45: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAECreate' PerlAEUtils.h:46: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAESend' PerlAEUtils.h:47: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEResume' PerlAEUtils.h:48: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEActive' PerlAEUtils.h:53: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEInstall' PerlAEUtils.h:55: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'gPAEArgs' PerlAEUtils.h:58: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEDoNextParam' PerlAEUtils.h:60: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEInstallEventHandler' PerlAEUtils.h:61: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEGetEventHandler' PerlAEUtils.h:62: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAERemoveEventHandler' PerlAEUtils.h:63: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEDoAppleEvent' PerlAEUtils.h:64: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'PAEHasOpenHandler' AppleEvents.c: In function 'XS_AEDesc__new': AppleEvents.c:98: error: 'OSType' undeclared (first use in this function) AppleEvents.c:98: error: expected ';' before 'type' AppleEvents.c:99: error: 'Handle' undeclared (first use in this function) AppleEvents.c:99: error: expected ';' before 'data' AppleEvents.c:100: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:100: error: expected ';' before 'RETVAL' AppleEvents.c:103: error: 'type' undeclared (first use in this function) AppleEvents.c:103:13: warning: multi-character character constant AppleEvents.c:110: error: 'data' undeclared (first use in this function) AppleEvents.c:114: error: expected expression before 'unsigned' AppleEvents.xs:94: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEDesc_type': AppleEvents.c:150: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:150: error: expected ';' before 'desc' AppleEvents.c:151: error: 'OSType' undeclared (first use in this function) AppleEvents.c:151: error: expected ';' before 'newType' AppleEvents.c:152: error: expected ';' before 'RETVAL' AppleEvents.c:155: error: 'desc' undeclared (first use in this function) AppleEvents.c:160: error: 'newType' undeclared (first use in this function) AppleEvents.xs:113: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c:175: error: expected ';' before 'hos' AppleEvents.c:176: error: 'hos' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEDesc_data': AppleEvents.c:189: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:189: error: expected ';' before 'desc' AppleEvents.c:190: error: 'Handle' undeclared (first use in this function) AppleEvents.c:190: error: expected ';' before 'newData' AppleEvents.c:191: error: expected ';' before 'RETVAL' AppleEvents.c:194: error: 'desc' undeclared (first use in this function) AppleEvents.c:199: error: 'newData' undeclared (first use in this function) AppleEvents.c:203: error: expected expression before 'unsigned' AppleEvents.xs:132: error: 'Size' undeclared (first use in this function) AppleEvents.xs:132: error: expected ';' before 'descLen' AppleEvents.xs:141: error: 'descLen' undeclared (first use in this function) AppleEvents.xs:142: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEKeyDesc__new': AppleEvents.c:251: error: 'OSType' undeclared (first use in this function) AppleEvents.c:251: error: expected ';' before 'key' AppleEvents.c:252: error: expected ';' before 'type' AppleEvents.c:253: error: 'Handle' undeclared (first use in this function) AppleEvents.c:253: error: expected ';' before 'data' AppleEvents.c:254: error: 'AEKeyDesc' undeclared (first use in this function) AppleEvents.c:254: error: expected ';' before 'RETVAL' AppleEvents.c:257: error: 'key' undeclared (first use in this function) AppleEvents.c:264: error: 'type' undeclared (first use in this function) AppleEvents.c:264:13: warning: multi-character character constant AppleEvents.c:271: error: 'data' undeclared (first use in this function) AppleEvents.c:275: error: expected expression before 'unsigned' AppleEvents.xs:161: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEKeyDesc_key': AppleEvents.c:312: error: 'AEKeyDesc' undeclared (first use in this function) AppleEvents.c:312: error: expected ';' before 'desc' AppleEvents.c:313: error: 'OSType' undeclared (first use in this function) AppleEvents.c:313: error: expected ';' before 'newKey' AppleEvents.c:314: error: expected ';' before 'RETVAL' AppleEvents.c:317: error: 'desc' undeclared (first use in this function) AppleEvents.c:322: error: 'newKey' undeclared (first use in this function) AppleEvents.xs:186: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c:337: error: expected ';' before 'hos' AppleEvents.c:338: error: 'hos' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEKeyDesc_type': AppleEvents.c:351: error: 'AEKeyDesc' undeclared (first use in this function) AppleEvents.c:351: error: expected ';' before 'desc' AppleEvents.c:352: error: 'OSType' undeclared (first use in this function) AppleEvents.c:352: error: expected ';' before 'newType' AppleEvents.c:353: error: expected ';' before 'RETVAL' AppleEvents.c:356: error: 'desc' undeclared (first use in this function) AppleEvents.c:361: error: 'newType' undeclared (first use in this function) AppleEvents.xs:200: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c:376: error: expected ';' before 'hos' AppleEvents.c:377: error: 'hos' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEKeyDesc_data': AppleEvents.c:390: error: 'AEKeyDesc' undeclared (first use in this function) AppleEvents.c:390: error: expected ';' before 'desc' AppleEvents.c:391: error: 'Handle' undeclared (first use in this function) AppleEvents.c:391: error: expected ';' before 'newData' AppleEvents.c:392: error: expected ';' before 'RETVAL' AppleEvents.c:395: error: 'desc' undeclared (first use in this function) AppleEvents.c:400: error: 'newData' undeclared (first use in this function) AppleEvents.c:404: error: expected expression before 'unsigned' AppleEvents.xs:217: error: 'Size' undeclared (first use in this function) AppleEvents.xs:217: error: expected ';' before 'descLen' AppleEvents.xs:225: error: 'descLen' undeclared (first use in this function) AppleEvents.xs:226: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEKeyDesc_desc': AppleEvents.c:448: error: 'AEKeyDesc' undeclared (first use in this function) AppleEvents.c:448: error: expected ';' before 'desc' AppleEvents.c:449: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:449: error: expected ';' before 'RETVAL' AppleEvents.c:452: error: 'desc' undeclared (first use in this function) AppleEvents.xs:240: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AECreateDesc': AppleEvents.c:475: error: 'OSType' undeclared (first use in this function) AppleEvents.c:475: error: expected ';' before 'typeCode' AppleEvents.c:477: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:477: error: expected ';' before 'RETVAL' AppleEvents.c:479: error: 'typeCode' undeclared (first use in this function) AppleEvents.xs:266: error: 'OSErr' undeclared (first use in this function) AppleEvents.xs:266: error: expected ';' before 'error' AppleEvents.xs:271: error: 'error' undeclared (first use in this function) AppleEvents.xs:271: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AECoerce': AppleEvents.c:508: error: 'OSType' undeclared (first use in this function) AppleEvents.c:508: error: expected ';' before 'typeCode' AppleEvents.c:510: error: expected ';' before 'toType' AppleEvents.c:511: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:511: error: expected ';' before 'RETVAL' AppleEvents.c:513: error: 'typeCode' undeclared (first use in this function) AppleEvents.c:516: error: 'toType' undeclared (first use in this function) AppleEvents.xs:295: error: 'OSErr' undeclared (first use in this function) AppleEvents.xs:295: error: expected ';' before 'error' AppleEvents.xs:300: error: 'error' undeclared (first use in this function) AppleEvents.xs:300: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AECoerceDesc': AppleEvents.c:545: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:545: error: expected ';' before 'theAEDesc' AppleEvents.c:546: error: 'OSType' undeclared (first use in this function) AppleEvents.c:546: error: expected ';' before 'toType' AppleEvents.c:547: error: expected ';' before 'RETVAL' AppleEvents.c:550: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.c:554: error: 'toType' undeclared (first use in this function) AppleEvents.xs:312: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDisposeDesc': AppleEvents.c:572: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:572: error: expected ';' before 'theAEDesc' AppleEvents.c:573: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:573: error: expected ';' before 'RETVAL' AppleEvents.c:577: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.c:581: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDuplicateDesc': AppleEvents.c:594: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:594: error: expected ';' before 'theAEDesc' AppleEvents.c:595: error: expected ';' before 'RETVAL' AppleEvents.c:598: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.xs:344: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AECreateList': AppleEvents.c:618: error: 'Boolean' undeclared (first use in this function) AppleEvents.c:618: error: expected ';' before 'isRecord' AppleEvents.c:619: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:619: error: expected ';' before 'RETVAL' AppleEvents.xs:370: error: 'isRecord' undeclared (first use in this function) AppleEvents.xs:370: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AECountItems': AppleEvents.c:642: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:642: error: expected ';' before 'theAEDescList' AppleEvents.c:646: error: 'theAEDescList' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPut': AppleEvents.c:670: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:670: error: expected ';' before 'theAEDescList' AppleEvents.c:672: error: 'OSType' undeclared (first use in this function) AppleEvents.c:672: error: expected ';' before 'typeCode' AppleEvents.c:674: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:674: error: expected ';' before 'RETVAL' AppleEvents.c:678: error: 'theAEDescList' undeclared (first use in this function) AppleEvents.c:682: error: 'typeCode' undeclared (first use in this function) AppleEvents.xs:412: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutDesc': AppleEvents.c:708: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:708: error: expected ';' before 'theAEDescList' AppleEvents.c:710: error: expected ';' before 'theAEDesc' AppleEvents.c:711: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:711: error: expected ';' before 'RETVAL' AppleEvents.c:715: error: 'theAEDescList' undeclared (first use in this function) AppleEvents.c:720: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.c:724: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutKey': AppleEvents.c:737: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:737: error: expected ';' before 'theAERecord' AppleEvents.c:738: error: 'OSType' undeclared (first use in this function) AppleEvents.c:738: error: expected ';' before 'theAEKeyword' AppleEvents.c:739: error: expected ';' before 'typeCode' AppleEvents.c:741: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:741: error: expected ';' before 'RETVAL' AppleEvents.c:745: error: 'theAERecord' undeclared (first use in this function) AppleEvents.c:749: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:752: error: 'typeCode' undeclared (first use in this function) AppleEvents.xs:448: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutKeyDesc': AppleEvents.c:778: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:778: error: expected ';' before 'theAERecord' AppleEvents.c:779: error: 'OSType' undeclared (first use in this function) AppleEvents.c:779: error: expected ';' before 'theAEKeyword' AppleEvents.c:780: error: expected ';' before 'theAEDesc' AppleEvents.c:781: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:781: error: expected ';' before 'RETVAL' AppleEvents.c:785: error: 'theAERecord' undeclared (first use in this function) AppleEvents.c:789: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:793: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.c:797: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetNthDesc': AppleEvents.c:811: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:811: error: expected ';' before 'theAEDescList' AppleEvents.c:813: error: 'OSType' undeclared (first use in this function) AppleEvents.c:813: error: expected ';' before 'desiredType' AppleEvents.c:816: error: 'theAEDescList' undeclared (first use in this function) AppleEvents.c:821: error: 'desiredType' undeclared (first use in this function) AppleEvents.c:821: error: 'typeWildCard' undeclared (first use in this function) AppleEvents.xs:480: error: expected ';' before 'kw' AppleEvents.xs:481: error: expected ';' before 'desc' AppleEvents.xs:483: error: 'kw' undeclared (first use in this function) AppleEvents.xs:483: error: 'desc' undeclared (first use in this function) AppleEvents.xs:492: error: expected ';' before 'hos' AppleEvents.xs:493: error: 'hos' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetKeyDesc': AppleEvents.c:858: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:858: error: expected ';' before 'theAEDescList' AppleEvents.c:859: error: 'OSType' undeclared (first use in this function) AppleEvents.c:859: error: expected ';' before 'theAEKeyword' AppleEvents.c:860: error: expected ';' before 'desiredType' AppleEvents.c:861: error: expected ';' before 'RETVAL' AppleEvents.c:864: error: 'theAEDescList' undeclared (first use in this function) AppleEvents.c:868: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:872: error: 'desiredType' undeclared (first use in this function) AppleEvents.c:872: error: 'typeWildCard' undeclared (first use in this function) AppleEvents.xs:502: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDeleteItem': AppleEvents.c:893: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:893: error: expected ';' before 'theAEDescList' AppleEvents.c:895: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:895: error: expected ';' before 'RETVAL' AppleEvents.c:899: error: 'theAEDescList' undeclared (first use in this function) AppleEvents.c:903: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutParam': AppleEvents.c:916: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:916: error: expected ';' before 'theAppleEvent' AppleEvents.c:917: error: 'OSType' undeclared (first use in this function) AppleEvents.c:917: error: expected ';' before 'theAEKeyword' AppleEvents.c:918: error: expected ';' before 'typeCode' AppleEvents.c:920: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:920: error: expected ';' before 'RETVAL' AppleEvents.c:924: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:928: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:931: error: 'typeCode' undeclared (first use in this function) AppleEvents.xs:539: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutParamDesc': AppleEvents.c:957: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:957: error: expected ';' before 'theAppleEvent' AppleEvents.c:958: error: 'OSType' undeclared (first use in this function) AppleEvents.c:958: error: expected ';' before 'theAEKeyword' AppleEvents.c:959: error: expected ';' before 'theAEDesc' AppleEvents.c:960: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:960: error: expected ';' before 'RETVAL' AppleEvents.c:964: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:968: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:972: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.c:976: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetParamDesc': AppleEvents.c:989: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:989: error: expected ';' before 'theAppleEvent' AppleEvents.c:990: error: 'OSType' undeclared (first use in this function) AppleEvents.c:990: error: expected ';' before 'theAEKeyword' AppleEvents.c:991: error: expected ';' before 'desiredType' AppleEvents.c:992: error: expected ';' before 'RETVAL' AppleEvents.c:995: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:999: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:1003: error: 'desiredType' undeclared (first use in this function) AppleEvents.c:1003: error: 'typeWildCard' undeclared (first use in this function) AppleEvents.xs:564: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDeleteParam': AppleEvents.c:1024: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1024: error: expected ';' before 'theAppleEvent' AppleEvents.c:1025: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1025: error: expected ';' before 'theAEKeyword' AppleEvents.c:1026: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1026: error: expected ';' before 'RETVAL' AppleEvents.c:1030: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1034: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:1037: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetAttributeDesc': AppleEvents.c:1050: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1050: error: expected ';' before 'theAppleEvent' AppleEvents.c:1051: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1051: error: expected ';' before 'theAEKeyword' AppleEvents.c:1052: error: expected ';' before 'desiredType' AppleEvents.c:1053: error: expected ';' before 'RETVAL' AppleEvents.c:1056: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1060: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:1064: error: 'desiredType' undeclared (first use in this function) AppleEvents.c:1064: error: 'typeWildCard' undeclared (first use in this function) AppleEvents.xs:591: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutAttribute': AppleEvents.c:1085: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1085: error: expected ';' before 'theAppleEvent' AppleEvents.c:1086: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1086: error: expected ';' before 'theAEKeyword' AppleEvents.c:1087: error: expected ';' before 'typeCode' AppleEvents.c:1089: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1089: error: expected ';' before 'RETVAL' AppleEvents.c:1093: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1097: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:1100: error: 'typeCode' undeclared (first use in this function) AppleEvents.xs:619: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPutAttributeDesc': AppleEvents.c:1126: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1126: error: expected ';' before 'theAppleEvent' AppleEvents.c:1127: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1127: error: expected ';' before 'theAEKeyword' AppleEvents.c:1128: error: expected ';' before 'theAEDesc' AppleEvents.c:1129: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1129: error: expected ';' before 'RETVAL' AppleEvents.c:1133: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1137: error: 'theAEKeyword' undeclared (first use in this function) AppleEvents.c:1141: error: 'theAEDesc' undeclared (first use in this function) AppleEvents.c:1145: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AECreateAppleEvent': AppleEvents.c:1158: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1158: error: expected ';' before 'theAEEventClass' AppleEvents.c:1159: error: expected ';' before 'theAEEventID' AppleEvents.c:1160: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1160: error: expected ';' before 'target' AppleEvents.c:1163: error: expected ';' before 'RETVAL' AppleEvents.c:1165: error: 'theAEEventClass' undeclared (first use in this function) AppleEvents.c:1168: error: 'theAEEventID' undeclared (first use in this function) AppleEvents.c:1172: error: 'target' undeclared (first use in this function) AppleEvents.c:1177: error: 'kAutoGenerateReturnID' undeclared (first use in this function) AppleEvents.xs:646: error: 'gPAECreate' undeclared (first use in this function) AppleEvents.xs:647: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AESend': AppleEvents.c:1213: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1213: error: expected ';' before 'theAppleEvent' AppleEvents.c:1217: error: expected ';' before 'RETVAL' AppleEvents.c:1220: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1225: error: 'kAENormalPriority' undeclared (first use in this function) AppleEvents.c:1231: error: 'kAEDefaultTimeout' undeclared (first use in this function) AppleEvents.xs:690: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:690: error: 'nil' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEResetTimer': AppleEvents.c:1271: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1271: error: expected ';' before 'reply' AppleEvents.c:1272: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1272: error: expected ';' before 'RETVAL' AppleEvents.c:1276: error: 'reply' undeclared (first use in this function) AppleEvents.c:1280: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AESuspendTheCurrentEvent': AppleEvents.c:1293: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1293: error: expected ';' before 'theAppleEvent' AppleEvents.c:1294: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1294: error: expected ';' before 'RETVAL' AppleEvents.c:1298: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1302: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEResumeTheCurrentEvent': AppleEvents.c:1315: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1315: error: expected ';' before 'theAppleEvent' AppleEvents.c:1318: error: expected ';' before 'RETVAL' AppleEvents.c:1321: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1326: error: 'kAENoDispatch' undeclared (first use in this function) AppleEvents.xs:739: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:739: error: 'AEEventHandlerUPP' undeclared (first use in this function) AppleEvents.xs:739: error: expected ')' before 'flags' AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetTheCurrentEvent': AppleEvents.c:1354: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1354: error: expected ';' before 'RETVAL' AppleEvents.xs:753: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AESetTheCurrentEvent': AppleEvents.c:1371: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1371: error: expected ';' before 'theAppleEvent' AppleEvents.c:1372: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1372: error: expected ';' before 'RETVAL' AppleEvents.c:1376: error: 'theAppleEvent' undeclared (first use in this function) AppleEvents.c:1380: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs: In function 'XS_Mac__AppleEvents_AEGetInteractionAllowed': AppleEvents.xs:780: error: 'AEInteractAllowed' undeclared (first use in this function) AppleEvents.xs:780: error: expected expression before ')' token AppleEvents.c: In function 'XS_Mac__AppleEvents_AESetInteractionAllowed': AppleEvents.c:1421: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1421: error: expected ';' before 'RETVAL' AppleEvents.xs:796: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:796: error: 'AEInteractAllowed' undeclared (first use in this function) AppleEvents.xs:796: error: expected ')' before 'level' AppleEvents.c: In function 'XS_Mac__AppleEvents_AEInstallEventHandler': AppleEvents.c:1438: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1438: error: expected ';' before 'theAEEventClass' AppleEvents.c:1439: error: expected ';' before 'theAEEventID' AppleEvents.c:1442: error: 'Boolean' undeclared (first use in this function) AppleEvents.c:1442: error: expected ';' before 'isSysHandler' AppleEvents.c:1443: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1443: error: expected ';' before 'RETVAL' AppleEvents.c:1446: error: 'theAEEventClass' undeclared (first use in this function) AppleEvents.c:1449: error: 'theAEEventID' undeclared (first use in this function) AppleEvents.c:1453: error: 'isSysHandler' undeclared (first use in this function) AppleEvents.xs:831: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AERemoveEventHandler': AppleEvents.c:1474: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1474: error: expected ';' before 'theAEEventClass' AppleEvents.c:1475: error: expected ';' before 'theAEEventID' AppleEvents.c:1476: error: 'Boolean' undeclared (first use in this function) AppleEvents.c:1476: error: expected ';' before 'isSysHandler' AppleEvents.c:1477: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1477: error: expected ';' before 'RETVAL' AppleEvents.c:1480: error: 'theAEEventClass' undeclared (first use in this function) AppleEvents.c:1483: error: 'theAEEventID' undeclared (first use in this function) AppleEvents.c:1487: error: 'isSysHandler' undeclared (first use in this function) AppleEvents.xs:848: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetEventHandler': AppleEvents.c:1507: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1507: error: expected ';' before 'theAEEventClass' AppleEvents.c:1508: error: expected ';' before 'theAEEventID' AppleEvents.c:1509: error: 'Boolean' undeclared (first use in this function) AppleEvents.c:1509: error: expected ';' before 'isSysHandler' AppleEvents.c:1511: error: 'theAEEventClass' undeclared (first use in this function) AppleEvents.c:1514: error: 'theAEEventID' undeclared (first use in this function) AppleEvents.c:1518: error: 'isSysHandler' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEManagerInfo': AppleEvents.c:1548: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1548: error: expected ';' before 'keyWord' AppleEvents.c:1551: error: 'keyWord' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEBuild': AppleEvents.c:1575: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1575: error: expected ';' before 'RETVAL' AppleEvents.xs:927: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:927: error: 'gBuildError' undeclared (first use in this function) AppleEvents.xs:927: error: 'gPAEArgs' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEBuildParameters': AppleEvents.c:1608: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1608: error: expected ';' before 'event' AppleEvents.c:1610: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:1610: error: expected ';' before 'RETVAL' AppleEvents.c:1614: error: 'event' undeclared (first use in this function) AppleEvents.xs:961: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:961: error: 'gBuildError' undeclared (first use in this function) AppleEvents.xs:961: error: 'gPAEArgs' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEBuildAppleEvent': AppleEvents.c:1647: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1647: error: expected ';' before 'theClass' AppleEvents.c:1648: error: expected ';' before 'theID' AppleEvents.c:1649: error: expected ';' before 'addressType' AppleEvents.c:1654: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1654: error: expected ';' before 'RETVAL' AppleEvents.c:1656: error: 'theClass' undeclared (first use in this function) AppleEvents.c:1659: error: 'theID' undeclared (first use in this function) AppleEvents.c:1662: error: 'addressType' undeclared (first use in this function) AppleEvents.xs:989: error: expected ';' before 'targetDesc' AppleEvents.xs:990: error: 'OSErr' undeclared (first use in this function) AppleEvents.xs:990: error: expected ';' before 'error' AppleEvents.xs:1004: error: 'error' undeclared (first use in this function) AppleEvents.xs:1004: error: 'targetDesc' undeclared (first use in this function) AppleEvents.xs:1008: error: 'gPAECreate' undeclared (first use in this function) AppleEvents.xs:1009: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:1020: error: 'gBuildError' undeclared (first use in this function) AppleEvents.xs:1020: error: 'gPAEArgs' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEPrint': AppleEvents.c:1721: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1721: error: expected ';' before 'desc' AppleEvents.c:1725: error: 'desc' undeclared (first use in this function) AppleEvents.xs:1041: error: 'Handle' undeclared (first use in this function) AppleEvents.xs:1041: error: expected ';' before 'hand' AppleEvents.xs:1043: error: 'hand' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEDescToSubDesc': AppleEvents.c:1759: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1759: error: expected ';' before 'desc' AppleEvents.c:1763: error: 'desc' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetSubDescType': AppleEvents.c:1790: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1790: error: expected ';' before 'RETVAL' AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetSubDescBasicType': AppleEvents.c:1842: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1842: error: expected ';' before 'RETVAL' AppleEvents.c: In function 'XS_Mac__AppleEvents_AESubDescIsListOrRecord': AppleEvents.c:1894: error: 'Boolean' undeclared (first use in this function) AppleEvents.c:1894: error: expected ';' before 'RETVAL' AppleEvents.c: In function 'XS_Mac__AppleEvents_AESubDescToDesc': AppleEvents.c:1974: error: 'OSType' undeclared (first use in this function) AppleEvents.c:1974: error: expected ';' before 'desiredType' AppleEvents.c:1975: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:1975: error: expected ';' before 'RETVAL' AppleEvents.c:1983: error: 'desiredType' undeclared (first use in this function) AppleEvents.c:1983: error: 'typeWildCard' undeclared (first use in this function) AppleEvents.c:1996: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_Mac__AppleEvents_AEGetKeySubDesc': AppleEvents.c:2084: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2084: error: expected ';' before 'kw' AppleEvents.c:2092: error: 'kw' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_Open': AppleEvents.c:2114: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2114: error: expected ';' before 'RETVAL' AppleEvents.xs:1302: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_CreateEvent': AppleEvents.c:2135: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2135: error: expected ';' before 'theClass' AppleEvents.c:2136: error: expected ';' before 'theID' AppleEvents.c:2137: error: expected ';' before 'addressType' AppleEvents.c:2141: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2141: error: expected ';' before 'RETVAL' AppleEvents.c:2143: error: 'theClass' undeclared (first use in this function) AppleEvents.c:2146: error: 'theID' undeclared (first use in this function) AppleEvents.c:2149: error: 'addressType' undeclared (first use in this function) AppleEvents.c:2153: error: 'kAutoGenerateReturnID' undeclared (first use in this function) AppleEvents.xs:1326: error: 'AEDesc' undeclared (first use in this function) AppleEvents.xs:1326: error: expected ';' before 'targetDesc' AppleEvents.xs:1327: error: 'AppleEvent' undeclared (first use in this function) AppleEvents.xs:1327: error: expected ';' before 'event' AppleEvents.xs:1328: error: 'OSErr' undeclared (first use in this function) AppleEvents.xs:1328: error: expected ';' before 'error' AppleEvents.xs:1333: error: 'error' undeclared (first use in this function) AppleEvents.xs:1333: error: 'targetDesc' undeclared (first use in this function) AppleEvents.xs:1337: error: 'gPAECreate' undeclared (first use in this function) AppleEvents.xs:1338: error: 'event' undeclared (first use in this function) AppleEvents.xs:1352: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_OpenEvent': AppleEvents.c:2210: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:2210: error: expected ';' before 'theEvent' AppleEvents.c:2211: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2211: error: expected ';' before 'RETVAL' AppleEvents.c:2214: error: 'theEvent' undeclared (first use in this function) AppleEvents.xs:1373: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_Close': AppleEvents.c:2237: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2237: error: expected ';' before 'stream' AppleEvents.c:2238: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:2238: error: expected ';' before 'RETVAL' AppleEvents.c:2241: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1389: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_Abort': AppleEvents.c:2262: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2262: error: expected ';' before 'stream' AppleEvents.c:2263: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2263: error: expected ';' before 'RETVAL' AppleEvents.c:2267: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1405: error: 'RETVAL' undeclared (first use in this function) AppleEvents.xs:1405: error: 'nil' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_OpenDesc': AppleEvents.c:2287: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2287: error: expected ';' before 'stream' AppleEvents.c:2288: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2288: error: expected ';' before 'type' AppleEvents.c:2289: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2289: error: expected ';' before 'RETVAL' AppleEvents.c:2293: error: 'stream' undeclared (first use in this function) AppleEvents.c:2297: error: 'type' undeclared (first use in this function) AppleEvents.xs:1430: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_WriteData': AppleEvents.c:2315: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2315: error: expected ';' before 'stream' AppleEvents.c:2317: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2317: error: expected ';' before 'RETVAL' AppleEvents.c:2321: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1449: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_CloseDesc': AppleEvents.c:2347: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2347: error: expected ';' before 'stream' AppleEvents.c:2348: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2348: error: expected ';' before 'RETVAL' AppleEvents.c:2352: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1464: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_WriteDesc': AppleEvents.c:2371: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2371: error: expected ';' before 'stream' AppleEvents.c:2372: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2372: error: expected ';' before 'type' AppleEvents.c:2374: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2374: error: expected ';' before 'RETVAL' AppleEvents.c:2378: error: 'stream' undeclared (first use in this function) AppleEvents.c:2382: error: 'type' undeclared (first use in this function) AppleEvents.xs:1486: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_WriteAEDesc': AppleEvents.c:2410: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2410: error: expected ';' before 'stream' AppleEvents.c:2411: error: 'AEDesc' undeclared (first use in this function) AppleEvents.c:2411: error: expected ';' before 'desc' AppleEvents.c:2412: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2412: error: expected ';' before 'RETVAL' AppleEvents.c:2416: error: 'stream' undeclared (first use in this function) AppleEvents.c:2421: error: 'desc' undeclared (first use in this function) AppleEvents.xs:1503: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_OpenList': AppleEvents.c:2440: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2440: error: expected ';' before 'stream' AppleEvents.c:2441: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2441: error: expected ';' before 'RETVAL' AppleEvents.c:2445: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1516: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_CloseList': AppleEvents.c:2464: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2464: error: expected ';' before 'stream' AppleEvents.c:2465: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2465: error: expected ';' before 'RETVAL' AppleEvents.c:2469: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1536: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_OpenRecord': AppleEvents.c:2488: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2488: error: expected ';' before 'stream' AppleEvents.c:2489: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2489: error: expected ';' before 'type' AppleEvents.c:2490: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2490: error: expected ';' before 'RETVAL' AppleEvents.c:2494: error: 'stream' undeclared (first use in this function) AppleEvents.c:2499: error: 'type' undeclared (first use in this function) AppleEvents.c:2499: error: 'typeAERecord' undeclared (first use in this function) AppleEvents.xs:1550: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_SetRecordType': AppleEvents.c:2520: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2520: error: expected ';' before 'stream' AppleEvents.c:2521: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2521: error: expected ';' before 'type' AppleEvents.c:2522: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2522: error: expected ';' before 'RETVAL' AppleEvents.c:2526: error: 'stream' undeclared (first use in this function) AppleEvents.c:2530: error: 'type' undeclared (first use in this function) AppleEvents.xs:1564: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_CloseRecord': AppleEvents.c:2548: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2548: error: expected ';' before 'stream' AppleEvents.c:2549: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2549: error: expected ';' before 'RETVAL' AppleEvents.c:2553: error: 'stream' undeclared (first use in this function) AppleEvents.xs:1585: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_WriteKeyDesc': AppleEvents.c:2572: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2572: error: expected ';' before 'stream' AppleEvents.c:2573: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2573: error: expected ';' before 'key' AppleEvents.c:2574: error: expected ';' before 'type' AppleEvents.c:2576: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2576: error: expected ';' before 'RETVAL' AppleEvents.c:2580: error: 'stream' undeclared (first use in this function) AppleEvents.c:2584: error: 'key' undeclared (first use in this function) AppleEvents.c:2587: error: 'type' undeclared (first use in this function) AppleEvents.xs:1608: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_OpenKeyDesc': AppleEvents.c:2615: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2615: error: expected ';' before 'stream' AppleEvents.c:2616: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2616: error: expected ';' before 'key' AppleEvents.c:2617: error: expected ';' before 'type' AppleEvents.c:2618: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2618: error: expected ';' before 'RETVAL' AppleEvents.c:2622: error: 'stream' undeclared (first use in this function) AppleEvents.c:2626: error: 'key' undeclared (first use in this function) AppleEvents.c:2629: error: 'type' undeclared (first use in this function) AppleEvents.xs:1627: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_WriteKey': AppleEvents.c:2647: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2647: error: expected ';' before 'stream' AppleEvents.c:2648: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2648: error: expected ';' before 'key' AppleEvents.c:2649: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2649: error: expected ';' before 'RETVAL' AppleEvents.c:2653: error: 'stream' undeclared (first use in this function) AppleEvents.c:2657: error: 'key' undeclared (first use in this function) AppleEvents.xs:1642: error: 'RETVAL' undeclared (first use in this function) AppleEvents.c: In function 'XS_AEStream_OptionalParam': AppleEvents.c:2675: error: 'AEStreamRef' undeclared (first use in this function) AppleEvents.c:2675: error: expected ';' before 'stream' AppleEvents.c:2676: error: 'OSType' undeclared (first use in this function) AppleEvents.c:2676: error: expected ';' before 'key' AppleEvents.c:2677: error: 'MacOSRet' undeclared (first use in this function) AppleEvents.c:2677: error: expected ';' before 'RETVAL' AppleEvents.c:2681: error: 'stream' undeclared (first use in this function) AppleEvents.c:2685: error: 'key' undeclared (first use in this function) AppleEvents.xs:1658: error: 'RETVAL' undeclared (first use in this function) make[1]: *** [AppleEvents.o] Error 1 make[1]: Leaving directory `/home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1/AppleEvents' make: *** [subdirs] Error 2 CNANDOR/Mac-Carbon-0.82.tar.gz make -- NOT OK Running test for module 'Mac::Speech' CNANDOR/Mac-Carbon-0.82.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1 CNANDOR/Mac-Carbon-0.82.tar.gz Has already been prepared CNANDOR/Mac-Carbon-0.82.tar.gz Could not make: Unknown error Running test for module 'Mac::Files' CNANDOR/Mac-Carbon-0.82.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Mac-Carbon-0.82-k_CXA1 CNANDOR/Mac-Carbon-0.82.tar.gz Has already been prepared CNANDOR/Mac-Carbon-0.82.tar.gz Could not make: Unknown error BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz Has already been prepared Running make for B/BD/BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' Warning: Prerequisite 'Mac::Carbon => 0.77' for 'BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz' failed when processing 'CNANDOR/Mac-Carbon-0.82.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited. Warning: Prerequisite 'Mac::Speech => 0' for 'BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz' failed when processing 'CNANDOR/Mac-Carbon-0.82.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited. Warning: Prerequisite 'Mac::Files => 0' for 'BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz' failed when processing 'CNANDOR/Mac-Carbon-0.82.tar.gz' with 'make => NO'. Continuing, but chances to succeed are limited. >>> make cp lib/MacSpeech.pm blib/lib/Pod/SpeakIt/MacSpeech.pm cp bin/pod2speech blib/script/pod2speech "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pod2speech Manifying 1 pod document Manifying 1 pod document BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/load.t t/pod.t t/one_para.t] # Failed test 'use Pod::SpeakIt::MacSpeech;' # at t/load.t line 10. # Tried to use 'Pod::SpeakIt::MacSpeech'. # Error: Can't locate Mac/Files.pm in @INC (you may need to install the Mac::Files module) (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .) at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12. # BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12. # Compilation failed in require at t/load.t line 10. # BEGIN failed--compilation aborted at t/load.t line 10. # Looks like you failed 1 test of 1. t/load.t ...... 1..1 not ok 1 - use Pod::SpeakIt::MacSpeech; bail out! Pod::SpeakIt::MacSpeech did not compile Dubious, test returned 1 (wstat 256, 0x100) Failed 1/1 subtests t/pod.t ....... 1..2 ok 1 - POD test for blib/lib/Pod/SpeakIt/MacSpeech.pm ok 2 - POD test for blib/script/pod2speech ok # Failed test 'use Pod::SpeakIt::MacSpeech;' # at t/lib/speak_pod_file.pl line 5. # Tried to use 'Pod::SpeakIt::MacSpeech'. # Error: Can't locate Mac/Files.pm in @INC (you may need to install the Mac::Files module) (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .) at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12. # BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/Pod-SpeakIt-MacSpeech-0.11-wGx0Wk/blib/lib/Pod/SpeakIt/MacSpeech.pm line 12. # Compilation failed in require at t/lib/speak_pod_file.pl line 5. # BEGIN failed--compilation aborted at t/lib/speak_pod_file.pl line 5. # Looks like you failed 1 test of 4. t/one_para.t .. not ok 1 - use Pod::SpeakIt::MacSpeech; ok 2 - Input directory is there ok 3 - An object of class 'Pod::SpeakIt::MacSpeech' isa 'Pod::SpeakIt::MacSpeech' ok 4 - Input file is there [t/input_pod_dir/one_para.pod] 1..4 Dubious, test returned 1 (wstat 256, 0x100) Failed 1/4 subtests Test Summary Report ------------------- t/load.t (Wstat: 256 Tests: 1 Failed: 1) Failed test: 1 Non-zero exit status: 1 t/one_para.t (Wstat: 256 Tests: 4 Failed: 1) Failed test: 1 Non-zero exit status: 1 Files=3, Tests=7, 1 wallclock secs ( 0.03 usr 0.01 sys + 0.26 cusr 0.02 csys = 0.32 CPU) Result: FAIL Failed 2/3 test programs. 2/7 subtests failed. make: *** [test_dynamic] Error 1 BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz 3 dependencies missing (Mac::Carbon,Mac::Speech,Mac::Files); additionally test harness failed make test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports BDFOY/Pod-SpeakIt-MacSpeech-0.11.tar.gz Running test for module 'App::scriptdist' The module App::scriptdist isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i App::scriptdist'. Running test for module 'MyCPAN::App::DPAN' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz ok MyCPAN-App-DPAN-1.28/ MyCPAN-App-DPAN-1.28/Changes MyCPAN-App-DPAN-1.28/lib/ MyCPAN-App-DPAN-1.28/lib/AsYAML.pm MyCPAN-App-DPAN-1.28/lib/DPAN.pm MyCPAN-App-DPAN-1.28/lib/Indexer.pm MyCPAN-App-DPAN-1.28/lib/Minimal.pm MyCPAN-App-DPAN-1.28/lib/SkipQueue.pm MyCPAN-App-DPAN-1.28/LICENSE MyCPAN-App-DPAN-1.28/Makefile.PL MyCPAN-App-DPAN-1.28/MANIFEST MyCPAN-App-DPAN-1.28/META.yml MyCPAN-App-DPAN-1.28/README MyCPAN-App-DPAN-1.28/script/ MyCPAN-App-DPAN-1.28/script/backpan_indexer.config.dpan MyCPAN-App-DPAN-1.28/script/dpan MyCPAN-App-DPAN-1.28/t/ MyCPAN-App-DPAN-1.28/t/app/ MyCPAN-App-DPAN-1.28/t/app/dpan.t MyCPAN-App-DPAN-1.28/t/compile.t MyCPAN-App-DPAN-1.28/t/create_index_files.t MyCPAN-App-DPAN-1.28/t/get_latest_module_reports.t MyCPAN-App-DPAN-1.28/t/indexer.t MyCPAN-App-DPAN-1.28/t/load.t MyCPAN-App-DPAN-1.28/t/pod.t MyCPAN-App-DPAN-1.28/t/pod_coverage.t MyCPAN-App-DPAN-1.28/t/test_manifest MyCPAN-App-DPAN-1.28/xt/ MyCPAN-App-DPAN-1.28/xt/dpan-corpus.t Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite MyCPAN::Indexer 1.28 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for MyCPAN::App::DPAN Writing MYMETA.yml and MYMETA.json BDFOY/MyCPAN-App-DPAN-1.28.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' ---- Unsatisfied dependencies detected during ---- ---- BDFOY/MyCPAN-App-DPAN-1.28.tar.gz ---- MyCPAN::Indexer [requires] Running test for module 'MyCPAN::Indexer' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz ok MyCPAN-Indexer-1.28/ MyCPAN-Indexer-1.28/Changes MyCPAN-Indexer-1.28/examples/ MyCPAN-Indexer-1.28/examples/backpan_indexer.config.andya MyCPAN-Indexer-1.28/examples/backpan_indexer.config.bdfoy MyCPAN-Indexer-1.28/examples/backpan_indexer.config.dist MyCPAN-Indexer-1.28/examples/backpan_indexer.config.dpan MyCPAN-Indexer-1.28/examples/backpan_indexer.config.inject MyCPAN-Indexer-1.28/examples/backpan_indexer.config.minicpan MyCPAN-Indexer-1.28/examples/backpan_indexer.config.test_census MyCPAN-Indexer-1.28/examples/backpan_indexer.pl MyCPAN-Indexer-1.28/examples/dpan MyCPAN-Indexer-1.28/examples/time_summary.pl MyCPAN-Indexer-1.28/lib/ MyCPAN-Indexer-1.28/lib/App/ MyCPAN-Indexer-1.28/lib/App/Indexer.pm MyCPAN-Indexer-1.28/lib/Component.pm MyCPAN-Indexer-1.28/lib/Coordinator.pm MyCPAN-Indexer-1.28/lib/Dispatcher/ MyCPAN-Indexer-1.28/lib/Dispatcher/Parallel.pm MyCPAN-Indexer-1.28/lib/Dispatcher/Serial.pm MyCPAN-Indexer-1.28/lib/Indexer.pm MyCPAN-Indexer-1.28/lib/Interface/ MyCPAN-Indexer-1.28/lib/Interface/ANSIText.pm MyCPAN-Indexer-1.28/lib/Interface/Curses.pm MyCPAN-Indexer-1.28/lib/Interface/Text.pm MyCPAN-Indexer-1.28/lib/Interface/Tk.pm MyCPAN-Indexer-1.28/lib/Notes.pm MyCPAN-Indexer-1.28/lib/NullTester.pm MyCPAN-Indexer-1.28/lib/Queue.pm MyCPAN-Indexer-1.28/lib/Reporter/ MyCPAN-Indexer-1.28/lib/Reporter/AsYAML.pm MyCPAN-Indexer-1.28/lib/Reporter/Base.pm MyCPAN-Indexer-1.28/lib/TestCensus.pm MyCPAN-Indexer-1.28/lib/Tutorial.pm MyCPAN-Indexer-1.28/lib/Worker.pm MyCPAN-Indexer-1.28/LICENSE MyCPAN-Indexer-1.28/Makefile.PL MyCPAN-Indexer-1.28/MANIFEST MyCPAN-Indexer-1.28/META.yml MyCPAN-Indexer-1.28/README MyCPAN-Indexer-1.28/t/ MyCPAN-Indexer-1.28/t/app/ MyCPAN-Indexer-1.28/t/app/backpan.t MyCPAN-Indexer-1.28/t/app/defaults.t MyCPAN-Indexer-1.28/t/compile.t MyCPAN-Indexer-1.28/t/extract_package_names.t MyCPAN-Indexer-1.28/t/guess_package_names.t MyCPAN-Indexer-1.28/t/load.t MyCPAN-Indexer-1.28/t/pod.t MyCPAN-Indexer-1.28/t/pod_coverage.t MyCPAN-Indexer-1.28/t/reporter/ MyCPAN-Indexer-1.28/t/reporter/base.t MyCPAN-Indexer-1.28/t/test_manifest MyCPAN-Indexer-1.28/test-corpus/ MyCPAN-Indexer-1.28/test-corpus/Chemistry-Elements.pm MyCPAN-Indexer-1.28/test-corpus/Test-Pod.pm Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite Data::UUID 0 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for MyCPAN::Indexer Writing MYMETA.yml and MYMETA.json BDFOY/MyCPAN-Indexer-1.28.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' ---- Unsatisfied dependencies detected during ---- ---- BDFOY/MyCPAN-Indexer-1.28.tar.gz ---- Data::UUID [requires] Running test for module 'Data::UUID' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/R/RJ/RJBS/Data-UUID-1.221.tar.gz ok Data-UUID-1.221/ Data-UUID-1.221/Changes Data-UUID-1.221/LICENSE Data-UUID-1.221/Makefile.PL Data-UUID-1.221/MANIFEST Data-UUID-1.221/META.json Data-UUID-1.221/META.yml Data-UUID-1.221/ptable.h Data-UUID-1.221/README Data-UUID-1.221/smp-test/ Data-UUID-1.221/t/ Data-UUID-1.221/typemap Data-UUID-1.221/UUID.h Data-UUID-1.221/UUID.pm Data-UUID-1.221/UUID.xs Data-UUID-1.221/t/basic.t Data-UUID-1.221/t/from-name-collisions.t Data-UUID-1.221/t/leaky_dollar_bang.t Data-UUID-1.221/t/pod-coverage.t /bin/tar: Read 7168 bytes from - Data-UUID-1.221/t/pod.t Data-UUID-1.221/t/segv.t Data-UUID-1.221/t/threads.t Data-UUID-1.221/smp-test/collision.t Data-UUID-1.221/smp-test/uuid-fork.pl Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring R/RJ/RJBS/Data-UUID-1.221.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Configured options (run perl Makefile.PL --help for how to change this): UUID state storage: /tmp default umask: 0007 Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Data::UUID Writing MYMETA.yml and MYMETA.json RJBS/Data-UUID-1.221.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for R/RJ/RJBS/Data-UUID-1.221.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp UUID.pm blib/lib/Data/UUID.pm Running Mkbootstrap for Data::UUID () chmod 644 "UUID.bs" "/home/fly1800/ap1800-297235/bin/perl-static" "/home/fly1800/cpanfly-5.18/var/megalib/ExtUtils/xsubpp" -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" -typemap "typemap" UUID.xs > UUID.xsc && mv UUID.xsc UUID.c gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"1.221\" -DXS_VERSION=\"1.221\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" -D_STDIR=\"/tmp\" -D__linux__ -D_DEFAULT_UMASK=0007 UUID.c UUID.xs: In function 'inc': UUID.xs:36: warning: cast to pointer from integer of different size UUID.xs: In function 'XS_Data__UUID_DESTROY': UUID.xs:583: warning: cast to pointer from integer of different size rm -f blib/arch/auto/Data/UUID/UUID.so gcc -shared -O2 -fstack-protector UUID.o -o blib/arch/auto/Data/UUID/UUID.so \ \ chmod 755 blib/arch/auto/Data/UUID/UUID.so "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::Command::MM -e 'cp_nonempty' -- UUID.bs blib/arch/auto/Data/UUID/UUID.bs 644 Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 893. Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 894. Manifying 1 pod document RJBS/Data-UUID-1.221.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 Running Mkbootstrap for Data::UUID () chmod 644 "UUID.bs" PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/basic.t ................. 1..28 ok 1 - use Data::UUID; ok 2 - An object of class 'Data::UUID' isa 'Data::UUID' ok 3 - create a new uuid ok 4 - correct length of uuid ok 5 - hexstringify it ok 6 - create a uuid from that string ok 7 - they compare as equal ok 8 - get base64 string of original uuid ok 9 - get base64 string of from_string ok 10 - those base64 strings are equal ok 11 - make uuid from the base64 string ok 12 - and it compares at equal, too ok 13 - we get all unique UUIDs ok 14 - no carriage return in base64 version ok 15 - no carriage return in base64 version ok 16 - no carriage return in base64 version ok 17 - no carriage return in base64 version ok 18 - no carriage return in base64 version ok 19 - no carriage return in base64 version ok 20 - no carriage return in base64 version ok 21 - no carriage return in base64 version ok 22 - no carriage return in base64 version ok 23 - no carriage return in base64 version ok 24 - no carriage return in base64 version ok 25 - no carriage return in base64 version ok 26 - no carriage return in base64 version ok 27 - no carriage return in base64 version ok 28 - no carriage return in base64 version ok t/from-name-collisions.t .. 1..1 ok 1 - no collisions ok t/leaky_dollar_bang.t ..... 1..1 ok 1 - $! didn't leak! ok t/pod-coverage.t .......... skipped: Pod coverage tests are not active. Please set $ENV{AUTHOR_TESTING} to activate. t/pod.t ................... skipped: Pod coverage tests are not active. Please set $ENV{AUTHOR_TESTING} to activate. t/segv.t .................. 1..2 ok 1 ok 2 ok Thread creation failed: pthread_create returned 12 at t/threads.t line 21. Thread creation failed: pthread_create returned 12 at t/threads.t line 21. Can't call method "join" on an undefined value at t/threads.t line 24. # Looks like your test exited with 12 before it could output anything. t/threads.t ............... 1..4 Dubious, test returned 12 (wstat 3072, 0xc00) Failed 4/4 subtests Test Summary Report ------------------- t/threads.t (Wstat: 3072 Tests: 0 Failed: 0) Non-zero exit status: 12 Parse errors: Bad plan. You planned 4 tests but ran 0. Files=7, Tests=32, 0 wallclock secs ( 0.03 usr 0.02 sys + 0.36 cusr 0.06 csys = 0.47 CPU) Result: FAIL Failed 1/7 test programs. 0/32 subtests failed. make: *** [test_dynamic] Error 12 RJBS/Data-UUID-1.221.tar.gz make test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports RJBS/Data-UUID-1.221.tar.gz BDFOY/MyCPAN-Indexer-1.28.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-Indexer-1.28-38NSmn BDFOY/MyCPAN-Indexer-1.28.tar.gz Has already been prepared Running make for B/BD/BDFOY/MyCPAN-Indexer-1.28.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' Warning: Prerequisite 'Data::UUID => 0' for 'BDFOY/MyCPAN-Indexer-1.28.tar.gz' failed when processing 'RJBS/Data-UUID-1.221.tar.gz' with 'make_test => NO'. Continuing, but chances to succeed are limited. >>> make cp lib/Interface/Text.pm blib/lib/MyCPAN/Indexer/Interface/Text.pm cp lib/NullTester.pm blib/lib/MyCPAN/Indexer/NullTester.pm cp lib/Interface/Tk.pm blib/lib/MyCPAN/Indexer/Interface/Tk.pm cp lib/Worker.pm blib/lib/MyCPAN/Indexer/Worker.pm cp lib/Notes.pm blib/lib/MyCPAN/Indexer/Notes.pm cp lib/Reporter/AsYAML.pm blib/lib/MyCPAN/Indexer/Reporter/AsYAML.pm cp lib/App/Indexer.pm blib/lib/MyCPAN/App/BackPAN/Indexer.pm cp lib/Dispatcher/Parallel.pm blib/lib/MyCPAN/Indexer/Dispatcher/Parallel.pm cp lib/Dispatcher/Serial.pm blib/lib/MyCPAN/Indexer/Dispatcher/Serial.pm cp lib/Coordinator.pm blib/lib/MyCPAN/Indexer/Coordinator.pm cp lib/Queue.pm blib/lib/MyCPAN/Indexer/Queue.pm cp lib/Interface/Curses.pm blib/lib/MyCPAN/Indexer/Interface/Curses.pm cp lib/Tutorial.pm blib/lib/MyCPAN/Indexer/Tutorial.pm cp lib/Indexer.pm blib/lib/MyCPAN/Indexer.pm cp lib/TestCensus.pm blib/lib/MyCPAN/Indexer/TestCensus.pm cp lib/Component.pm blib/lib/MyCPAN/Indexer/Component.pm cp lib/Reporter/Base.pm blib/lib/MyCPAN/Indexer/Reporter/Base.pm BDFOY/MyCPAN-Indexer-1.28.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/load.t t/compile.t t/pod.t t/pod_coverage.t t/extract_package_names.t t/guess_package_names.t t/reporter/base.t t/app/backpan.t t/app/defaults.t] t/load.t ................... 1..1 ok 1 - use MyCPAN::Indexer; ok t/compile.t ................ 1..4 ok 1 - examples/backpan_indexer.pl exists ok 2 - Script examples/backpan_indexer.pl compiles ok 3 - examples/time_summary.pl exists ok 4 - Script examples/time_summary.pl compiles ok t/pod.t .................... 1..17 ok 1 - POD test for blib/lib/MyCPAN/Indexer.pm ok 2 - POD test for blib/lib/MyCPAN/App/BackPAN/Indexer.pm (no pod) ok 3 - POD test for blib/lib/MyCPAN/Indexer/Coordinator.pm ok 4 - POD test for blib/lib/MyCPAN/Indexer/Queue.pm ok 5 - POD test for blib/lib/MyCPAN/Indexer/TestCensus.pm ok 6 - POD test for blib/lib/MyCPAN/Indexer/NullTester.pm ok 7 - POD test for blib/lib/MyCPAN/Indexer/Component.pm ok 8 - POD test for blib/lib/MyCPAN/Indexer/Notes.pm ok 9 - POD test for blib/lib/MyCPAN/Indexer/Tutorial.pm ok 10 - POD test for blib/lib/MyCPAN/Indexer/Worker.pm ok 11 - POD test for blib/lib/MyCPAN/Indexer/Dispatcher/Parallel.pm ok 12 - POD test for blib/lib/MyCPAN/Indexer/Dispatcher/Serial.pm ok 13 - POD test for blib/lib/MyCPAN/Indexer/Reporter/AsYAML.pm ok 14 - POD test for blib/lib/MyCPAN/Indexer/Reporter/Base.pm ok 15 - POD test for blib/lib/MyCPAN/Indexer/Interface/Tk.pm ok 16 - POD test for blib/lib/MyCPAN/Indexer/Interface/Text.pm ok 17 - POD test for blib/lib/MyCPAN/Indexer/Interface/Curses.pm ok t/pod_coverage.t ........... 1..1 ok 1 ok t/extract_package_names.t .. ok 1 - use MyCPAN::Indexer; ok 2 - MyCPAN::Indexer->can('extract_module_namespaces') ok 3 - An object of class 'MyCPAN::Indexer' isa 'MyCPAN::Indexer' ok 4 - test-corpus/Test-Pod.pm exists ok 5 - 'packages' key is in the result hash ok 6 - 'packages' value is an array ref ok 7 - 'primary_package' key is in the result hash ok 8 - 'primary_package' value is has the right value [Test::Pod] ok 9 - test-corpus/Chemistry-Elements.pm exists ok 10 - 'packages' key is in the result hash ok 11 - 'packages' value is an array ref ok 12 - 'primary_package' key is in the result hash ok 13 - 'primary_package' value is has the right value [Chemistry::Elements] 1..13 ok t/guess_package_names.t .... ok 1 - use MyCPAN::Indexer; ok 2 - MyCPAN::Indexer->can('guess_primary_package') ok 3 - An object of class 'MyCPAN::Indexer' isa 'MyCPAN::Indexer' ok 4 - Gets right package for Test::Pod ok 5 - Gets right package for Foo::Bar ok 6 - Gets right package for Quux 1..6 ok t/reporter/base.t .......... ok 1 - use MyCPAN::Indexer::Reporter::Base; ok 2 - An object of class 'MyCPAN::Indexer::Reporter::Base' isa 'MyCPAN::Indexer::Reporter::Base' ok 3 - MyCPAN::Indexer::Reporter::Base->can('get_report_file_extension') ok 4 - eval catches an error ok 5 - Abstract get_report_file_extension croaks with right message ok 6 - MyCPAN::Indexer::Reporter::Base->can('get_success_report_subdir') ok 7 ok 8 - MyCPAN::Indexer::Reporter::Base->can('get_error_report_subdir') ok 9 ok 10 - Mock::config->can('get') ok 11 ok 12 ok 13 ok 14 1..14 ok t/app/backpan.t ............ 1..2 ok 1 - use MyCPAN::App::BackPAN::Indexer; ok 2 - MyCPAN::App::BackPAN::Indexer->can('activate') ok t/app/defaults.t ........... ok 1 - use MyCPAN::App::BackPAN::Indexer; ok 2 - MyCPAN::App::BackPAN::Indexer->can('default') ok 3 - alarm in MyCPAN::App::BackPAN::Indexer right ok 4 - indexer_class in MyCPAN::App::BackPAN::Indexer is right 1..4 ok All tests successful. Files=9, Tests=62, 1 wallclock secs ( 0.04 usr 0.03 sys + 1.58 cusr 0.14 csys = 1.79 CPU) Result: PASS BDFOY/MyCPAN-Indexer-1.28.tar.gz Tests succeeded but one dependency not OK (Data::UUID) BDFOY/MyCPAN-Indexer-1.28.tar.gz [dependencies] -- NA BDFOY/MyCPAN-App-DPAN-1.28.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9 BDFOY/MyCPAN-App-DPAN-1.28.tar.gz Has already been prepared Running make for B/BD/BDFOY/MyCPAN-App-DPAN-1.28.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' Warning: Prerequisite 'MyCPAN::Indexer => 1.28' for 'BDFOY/MyCPAN-App-DPAN-1.28.tar.gz' failed when processing 'BDFOY/MyCPAN-Indexer-1.28.tar.gz' with 'make_test => NO one dependency not OK (Data::UUID)'. Continuing, but chances to succeed are limited. >>> make cp lib/AsYAML.pm blib/lib/MyCPAN/App/DPAN/Reporter/AsYAML.pm cp lib/DPAN.pm blib/lib/MyCPAN/App/DPAN.pm cp lib/Minimal.pm blib/lib/MyCPAN/App/DPAN/Reporter/Minimal.pm cp lib/Indexer.pm blib/lib/MyCPAN/App/DPAN/Indexer.pm cp lib/SkipQueue.pm blib/lib/MyCPAN/App/DPAN/SkipQueue.pm cp script/dpan blib/script/dpan "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/dpan Manifying 1 pod document BDFOY/MyCPAN-App-DPAN-1.28.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/load.t t/compile.t t/pod.t t/pod_coverage.t t/indexer.t t/app/dpan.t t/get_latest_module_reports.t t/create_index_files.t t/../xt/dpan-corpus.t] Bailout called. Further testing stopped: MyCPAN::App::DPAN did not compile # Failed test 'use MyCPAN::App::DPAN;' # at t/load.t line 14. # Tried to use 'MyCPAN::App::DPAN'. # Error: Base class package "MyCPAN::App::BackPAN::Indexer" is empty. # (Perhaps you need to 'use' the module which defines that package first, # or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .). # at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN.pm line 5. # BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN.pm line 5. # Compilation failed in require at t/load.t line 14. # BEGIN failed--compilation aborted at t/load.t line 14. # Failed test 'use MyCPAN::App::DPAN::Reporter::AsYAML;' # at t/load.t line 14. # Tried to use 'MyCPAN::App::DPAN::Reporter::AsYAML'. # Error: Base class package "MyCPAN::Indexer::Reporter::AsYAML" is empty. # (Perhaps you need to 'use' the module which defines that package first, # or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .). # at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/AsYAML.pm line 11. # BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/AsYAML.pm line 11. # Compilation failed in require at t/load.t line 14. # BEGIN failed--compilation aborted at t/load.t line 14. # Failed test 'use MyCPAN::App::DPAN::Reporter::Minimal;' # at t/load.t line 14. # Tried to use 'MyCPAN::App::DPAN::Reporter::Minimal'. # Error: Base class package "MyCPAN::Indexer::Reporter::Base" is empty. # (Perhaps you need to 'use' the module which defines that package first, # or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .). # at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/Minimal.pm line 5. # BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Reporter/Minimal.pm line 5. # Compilation failed in require at t/load.t line 14. # BEGIN failed--compilation aborted at t/load.t line 14. # Failed test 'use MyCPAN::App::DPAN::Indexer;' # at t/load.t line 14. # Tried to use 'MyCPAN::App::DPAN::Indexer'. # Error: Base class package "MyCPAN::App::BackPAN::Indexer" is empty. # (Perhaps you need to 'use' the module which defines that package first, # or make that module available in @INC (@INC contains: /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib /home/fly1800/cpanfly-5.18/var/megalib /home/fly1800/ap1800-297235/site/lib /home/fly1800/ap1800-297235/lib .). # at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Indexer.pm line 11. # BEGIN failed--compilation aborted at /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-App-DPAN-1.28-wOCfw9/blib/lib/MyCPAN/App/DPAN/Indexer.pm line 11. # Compilation failed in require at t/load.t line 14. # BEGIN failed--compilation aborted at t/load.t line 14. # Looks like you failed 4 tests of 4. FAILED--Further testing stopped: MyCPAN::App::DPAN did not compile make: *** [test_dynamic] Error 4 BDFOY/MyCPAN-App-DPAN-1.28.tar.gz one dependency not OK (MyCPAN::Indexer); additionally test harness failed make test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports BDFOY/MyCPAN-App-DPAN-1.28.tar.gz Running test for module 'WordPress::Grep' The module WordPress::Grep isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i WordPress::Grep'. Running test for module 'HTTP::Cookies::iCab' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz ok HTTP-Cookies-iCab-1.131/ HTTP-Cookies-iCab-1.131/Changes HTTP-Cookies-iCab-1.131/examples/ HTTP-Cookies-iCab-1.131/hack/ HTTP-Cookies-iCab-1.131/lib/ HTTP-Cookies-iCab-1.131/LICENSE HTTP-Cookies-iCab-1.131/Makefile.PL HTTP-Cookies-iCab-1.131/MANIFEST HTTP-Cookies-iCab-1.131/META.yml HTTP-Cookies-iCab-1.131/README HTTP-Cookies-iCab-1.131/t/ HTTP-Cookies-iCab-1.131/t/compile.t HTTP-Cookies-iCab-1.131/t/Cookies.dat HTTP-Cookies-iCab-1.131/t/Cookies2.dat HTTP-Cookies-iCab-1.131/t/load.t HTTP-Cookies-iCab-1.131/t/pod.t HTTP-Cookies-iCab-1.131/t/pod_coverage.t HTTP-Cookies-iCab-1.131/t/prereq.t HTTP-Cookies-iCab-1.131/t/save.t HTTP-Cookies-iCab-1.131/t/test_manifest HTTP-Cookies-iCab-1.131/lib/HTTP/ HTTP-Cookies-iCab-1.131/lib/HTTP/Cookies/ HTTP-Cookies-iCab-1.131/lib/HTTP/Cookies/iCab.pm HTTP-Cookies-iCab-1.131/hack/load_real HTTP-Cookies-iCab-1.131/examples/README HTTP-Cookies-iCab-1.131/examples/update_dates.pl Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for HTTP::Cookies::iCab Writing MYMETA.yml and MYMETA.json BDFOY/HTTP-Cookies-iCab-1.131.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp lib/HTTP/Cookies/iCab.pm blib/lib/HTTP/Cookies/iCab.pm Manifying 1 pod document BDFOY/HTTP-Cookies-iCab-1.131.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/compile.t t/pod.t t/pod_coverage.t t/load.t t/save.t] t/compile.t ....... 1..1 ok 1 - use HTTP::Cookies::iCab; ok t/pod.t ........... 1..1 ok 1 - POD test for blib/lib/HTTP/Cookies/iCab.pm ok t/pod_coverage.t .. 1..1 ok 1 - Pod coverage on HTTP::Cookies::iCab ok t/load.t .......... 1..8 ok 1 - use HTTP::Cookies::iCab; ok 2 - An object of class 'HTTP::Cookies::iCab' isa 'HTTP::Cookies::iCab' ok 3 - An object of class 'HTTP::Cookies::iCab' isa 'HTTP::Cookies' ok 4 - Count of domains ok 5 - .usatoday.com has 3 cookies ok 6 - .cnn.com has 1 cookies ok 7 - .doubleclick.net has 1 cookies ok 8 - Cookie has right value ok t/save.t .......... 1..2 ok 1 - An object of class 'HTTP::Cookies::iCab' isa 'HTTP::Cookies::iCab' not ok 2 - Saved file is same as original # TODO How can I compare these files? # Failed (TODO) test 'Saved file is same as original' # at t/save.t line 20. ok All tests successful. Files=5, Tests=13, 1 wallclock secs ( 0.03 usr 0.01 sys + 0.34 cusr 0.04 csys = 0.42 CPU) Result: PASS BDFOY/HTTP-Cookies-iCab-1.131.tar.gz make test TEST_VERBOSE=1 -- OK brian d foy <bdfoy@cpan.org> Cookie storage and management for iCab 3 >>> (cd /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo && tar cvf - HTTP-Cookies-iCab-1.131.ppd blib) | gzip -c >/home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY/HTTP-Cookies-iCab-1.131.tar.gz HTTP-Cookies-iCab-1.131.ppd blib/ blib/man3/ blib/man3/HTTP::Cookies::iCab.3 blib/lib/ blib/lib/HTTP/ blib/lib/HTTP/Cookies/ blib/lib/HTTP/Cookies/iCab.pm >>> mv /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/HTTP-Cookies-iCab-1.131.ppd /home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY Running test for module 'Test::WWW::Accessibility' The module Test::WWW::Accessibility isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i Test::WWW::Accessibility'. Running test for module 'Psychic::Ninja' The module Psychic::Ninja isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i Psychic::Ninja'. Running test for module 'PerlPowerTools' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/PerlPowerTools-1.006.tar.gz ok PerlPowerTools-1.006/ PerlPowerTools-1.006/bin/ PerlPowerTools-1.006/Changes PerlPowerTools-1.006/lib/ PerlPowerTools-1.006/LICENSE PerlPowerTools-1.006/Makefile.PL PerlPowerTools-1.006/MANIFEST PerlPowerTools-1.006/MANIFEST.SKIP PerlPowerTools-1.006/META.json PerlPowerTools-1.006/META.yml PerlPowerTools-1.006/README.pod PerlPowerTools-1.006/t/ PerlPowerTools-1.006/TODO PerlPowerTools-1.006/xt/ PerlPowerTools-1.006/xt/changes.t PerlPowerTools-1.006/t/compile.t PerlPowerTools-1.006/t/factor.t PerlPowerTools-1.006/t/false.t PerlPowerTools-1.006/t/true.t PerlPowerTools-1.006/lib/PerlPowerTools.pm PerlPowerTools-1.006/lib/ppt.pm PerlPowerTools-1.006/bin/addbib PerlPowerTools-1.006/bin/apply PerlPowerTools-1.006/bin/ar PerlPowerTools-1.006/bin/arch PerlPowerTools-1.006/bin/arithmetic PerlPowerTools-1.006/bin/asa PerlPowerTools-1.006/bin/awk PerlPowerTools-1.006/bin/banner PerlPowerTools-1.006/bin/basename PerlPowerTools-1.006/bin/bc PerlPowerTools-1.006/bin/cal PerlPowerTools-1.006/bin/cat PerlPowerTools-1.006/bin/chgrp PerlPowerTools-1.006/bin/ching PerlPowerTools-1.006/bin/chmod PerlPowerTools-1.006/bin/chown PerlPowerTools-1.006/bin/clear PerlPowerTools-1.006/bin/cmp PerlPowerTools-1.006/bin/col PerlPowerTools-1.006/bin/colrm PerlPowerTools-1.006/bin/comm PerlPowerTools-1.006/bin/cp PerlPowerTools-1.006/bin/cut PerlPowerTools-1.006/bin/date PerlPowerTools-1.006/bin/dc PerlPowerTools-1.006/bin/deroff PerlPowerTools-1.006/bin/diff PerlPowerTools-1.006/bin/dirname PerlPowerTools-1.006/bin/du PerlPowerTools-1.006/bin/echo PerlPowerTools-1.006/bin/ed PerlPowerTools-1.006/bin/env PerlPowerTools-1.006/bin/expand PerlPowerTools-1.006/bin/expr PerlPowerTools-1.006/bin/factor PerlPowerTools-1.006/bin/false PerlPowerTools-1.006/bin/file PerlPowerTools-1.006/bin/find PerlPowerTools-1.006/bin/fish PerlPowerTools-1.006/bin/fmt PerlPowerTools-1.006/bin/fold PerlPowerTools-1.006/bin/fortune PerlPowerTools-1.006/bin/from PerlPowerTools-1.006/bin/glob PerlPowerTools-1.006/bin/grep PerlPowerTools-1.006/bin/hangman PerlPowerTools-1.006/bin/head PerlPowerTools-1.006/bin/id PerlPowerTools-1.006/bin/install PerlPowerTools-1.006/bin/join PerlPowerTools-1.006/bin/kill PerlPowerTools-1.006/bin/ln PerlPowerTools-1.006/bin/lock PerlPowerTools-1.006/bin/look PerlPowerTools-1.006/bin/ls PerlPowerTools-1.006/bin/mail PerlPowerTools-1.006/bin/make PerlPowerTools-1.006/bin/man PerlPowerTools-1.006/bin/maze PerlPowerTools-1.006/bin/mimedecode PerlPowerTools-1.006/bin/mkdir PerlPowerTools-1.006/bin/mkfifo PerlPowerTools-1.006/bin/moo PerlPowerTools-1.006/bin/morse PerlPowerTools-1.006/bin/od PerlPowerTools-1.006/bin/par PerlPowerTools-1.006/bin/paste PerlPowerTools-1.006/bin/patch PerlPowerTools-1.006/bin/pig PerlPowerTools-1.006/bin/ping PerlPowerTools-1.006/bin/pom PerlPowerTools-1.006/bin/ppt PerlPowerTools-1.006/bin/pr PerlPowerTools-1.006/bin/primes PerlPowerTools-1.006/bin/printenv PerlPowerTools-1.006/bin/printf PerlPowerTools-1.006/bin/pwd PerlPowerTools-1.006/bin/rain PerlPowerTools-1.006/bin/random PerlPowerTools-1.006/bin/rev PerlPowerTools-1.006/bin/rm PerlPowerTools-1.006/bin/rmdir PerlPowerTools-1.006/bin/robots PerlPowerTools-1.006/bin/shar PerlPowerTools-1.006/bin/sleep PerlPowerTools-1.006/bin/sort PerlPowerTools-1.006/bin/spell PerlPowerTools-1.006/bin/split PerlPowerTools-1.006/bin/strings PerlPowerTools-1.006/bin/sum PerlPowerTools-1.006/bin/tac PerlPowerTools-1.006/bin/tail PerlPowerTools-1.006/bin/tar PerlPowerTools-1.006/bin/tee PerlPowerTools-1.006/bin/test PerlPowerTools-1.006/bin/time PerlPowerTools-1.006/bin/touch PerlPowerTools-1.006/bin/tr PerlPowerTools-1.006/bin/true PerlPowerTools-1.006/bin/tsort PerlPowerTools-1.006/bin/tty PerlPowerTools-1.006/bin/uname PerlPowerTools-1.006/bin/unexpand PerlPowerTools-1.006/bin/uniq PerlPowerTools-1.006/bin/units PerlPowerTools-1.006/bin/unpar PerlPowerTools-1.006/bin/unshar PerlPowerTools-1.006/bin/uudecode PerlPowerTools-1.006/bin/uuencode PerlPowerTools-1.006/bin/wc PerlPowerTools-1.006/bin/what PerlPowerTools-1.006/bin/which PerlPowerTools-1.006/bin/whois PerlPowerTools-1.006/bin/words PerlPowerTools-1.006/bin/wump /bin/tar: Read 6144 bytes from - PerlPowerTools-1.006/bin/xargs PerlPowerTools-1.006/bin/yes Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/PerlPowerTools-1.006.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL ---------------------------------------------------------------------- Welcome to Perl Power Tools (http://www.perlpowertools.com). You didn't specify INSTALL_BASE, so I chose ~/perlpowertools. You'll need to add this to PATH to be able to use them. If you want to install them somewhere else, run Makefile.PL again with your installation location: perl Makefile.PL INSTALL_BASE=/where/you/want/them/to/go Most Perl distributions don't do this for you, but I'm doing this because some of these tools installed in the wrong places can hide the real tools, which might cause problems. I'm being careful for you! ---------------------------------------------------------------------- Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for PerlPowerTools Writing MYMETA.yml and MYMETA.json BDFOY/PerlPowerTools-1.006.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/PerlPowerTools-1.006.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp README.pod blib/lib/README.pod cp lib/PerlPowerTools.pm blib/lib/PerlPowerTools.pm cp lib/ppt.pm blib/lib/ppt.pm cp bin/tail blib/script/tail "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tail cp bin/shar blib/script/shar "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/shar cp bin/uname blib/script/uname "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uname cp bin/tsort blib/script/tsort "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tsort cp bin/glob blib/script/glob "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/glob cp bin/chmod blib/script/chmod "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/chmod cp bin/cmp blib/script/cmp "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cmp cp bin/sum blib/script/sum "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/sum cp bin/banner blib/script/banner "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/banner cp bin/uudecode blib/script/uudecode "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uudecode cp bin/sleep blib/script/sleep "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/sleep cp bin/ed blib/script/ed "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ed cp bin/what blib/script/what "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/what cp bin/test blib/script/test "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/test cp bin/ping blib/script/ping "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ping cp bin/cat blib/script/cat "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cat cp bin/split blib/script/split "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/split cp bin/clear blib/script/clear "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/clear cp bin/uuencode blib/script/uuencode "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uuencode cp bin/strings blib/script/strings "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/strings cp bin/mkdir blib/script/mkdir "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mkdir cp bin/fortune blib/script/fortune "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fortune cp bin/mail blib/script/mail "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mail cp bin/moo blib/script/moo "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/moo cp bin/file blib/script/file "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/file cp bin/fold blib/script/fold "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fold cp bin/col blib/script/col "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/col cp bin/unexpand blib/script/unexpand "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/unexpand cp bin/grep blib/script/grep "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/grep cp bin/paste blib/script/paste "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/paste cp bin/apply blib/script/apply "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/apply cp bin/join blib/script/join "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/join cp bin/install blib/script/install "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/install cp bin/which blib/script/which "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/which cp bin/units blib/script/units "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/units cp bin/look blib/script/look "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/look cp bin/addbib blib/script/addbib "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/addbib cp bin/kill blib/script/kill "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/kill cp bin/date blib/script/date "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/date cp bin/from blib/script/from "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/from cp bin/unshar blib/script/unshar "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/unshar cp bin/tac blib/script/tac "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tac cp bin/dc blib/script/dc "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/dc cp bin/pwd blib/script/pwd "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pwd cp bin/find blib/script/find "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/find cp bin/rev blib/script/rev "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rev cp bin/fmt blib/script/fmt "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fmt cp bin/ln blib/script/ln "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ln cp bin/ar blib/script/ar "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ar cp bin/expr blib/script/expr "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/expr cp bin/time blib/script/time "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/time cp bin/cal blib/script/cal "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cal cp bin/dirname blib/script/dirname "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/dirname cp bin/id blib/script/id "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/id cp bin/tr blib/script/tr "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tr cp bin/basename blib/script/basename "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/basename cp bin/arithmetic blib/script/arithmetic "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/arithmetic cp bin/tee blib/script/tee "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tee cp bin/expand blib/script/expand "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/expand cp bin/words blib/script/words "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/words cp bin/maze blib/script/maze "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/maze cp bin/hangman blib/script/hangman "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/hangman cp bin/du blib/script/du "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/du cp bin/comm blib/script/comm "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/comm cp bin/chgrp blib/script/chgrp "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/chgrp cp bin/lock blib/script/lock "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/lock cp bin/unpar blib/script/unpar "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/unpar cp bin/tty blib/script/tty "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tty cp bin/factor blib/script/factor "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/factor cp bin/ls blib/script/ls "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ls cp bin/yes blib/script/yes "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/yes cp bin/true blib/script/true "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/true cp bin/man blib/script/man "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/man cp bin/diff blib/script/diff "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/diff cp bin/pr blib/script/pr "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pr cp bin/cut blib/script/cut "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cut cp bin/head blib/script/head "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/head cp bin/rmdir blib/script/rmdir "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rmdir cp bin/pig blib/script/pig "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pig cp bin/rain blib/script/rain "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rain cp bin/mimedecode blib/script/mimedecode "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mimedecode cp bin/xargs blib/script/xargs "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/xargs cp bin/spell blib/script/spell "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/spell cp bin/touch blib/script/touch "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/touch cp bin/mkfifo blib/script/mkfifo "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/mkfifo cp bin/whois blib/script/whois "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/whois cp bin/ching blib/script/ching "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ching cp bin/env blib/script/env "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/env cp bin/arch blib/script/arch "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/arch cp bin/pom blib/script/pom "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/pom cp bin/false blib/script/false "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/false cp bin/wump blib/script/wump "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/wump cp bin/printf blib/script/printf "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/printf cp bin/make blib/script/make "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/make cp bin/patch blib/script/patch "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/patch cp bin/uniq blib/script/uniq "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/uniq cp bin/asa blib/script/asa "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/asa cp bin/ppt blib/script/ppt "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/ppt cp bin/fish blib/script/fish "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/fish cp bin/cp blib/script/cp "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/cp cp bin/od blib/script/od "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/od cp bin/tar blib/script/tar "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tar cp bin/awk blib/script/awk "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/awk cp bin/primes blib/script/primes "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/primes cp bin/bc blib/script/bc "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bc cp bin/sort blib/script/sort "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/sort cp bin/printenv blib/script/printenv "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/printenv cp bin/deroff blib/script/deroff "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/deroff cp bin/robots blib/script/robots "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/robots cp bin/morse blib/script/morse "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/morse cp bin/chown blib/script/chown "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/chown cp bin/colrm blib/script/colrm "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/colrm cp bin/par blib/script/par "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/par cp bin/rm blib/script/rm "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/rm cp bin/wc blib/script/wc "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/wc cp bin/echo blib/script/echo "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/echo cp bin/random blib/script/random "/home/fly1800/ap1800-297235/bin/perl-static" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/random Manifying 117 pod documents Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 893. Use of uninitialized value $dirs[0] in string eq at /home/fly1800/cpanfly-5.18/var/megalib/Pod/Man.pm line 894. Manifying 2 pod documents BDFOY/PerlPowerTools-1.006.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 PERL_DL_NONLAZY=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t # Parent @INC: # /home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/lib # /home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib # /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib # /home/fly1800/cpanfly-5.18/var/megalib # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib # /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch # /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib # /home/fly1800/cpanfly-5.18/var/megalib # /home/fly1800/ap1800-297235/site/lib # /home/fly1800/ap1800-297235/lib # . # # PERL5LIB: /home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/PerlPowerTools-1.006-FukAj0/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib:/home/fly1800/cpanfly-5.18/var/megalib:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch:/home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib:/home/fly1800/cpanfly-5.18/var/megalib:/home/fly1800/ap1800-297235/site/lib:/home/fly1800/ap1800-297235/lib:. t/compile.t .. # Subtest: bin/addbib ok 1 - bin/addbib compiles 1..1 ok 1 - bin/addbib # Subtest: bin/apply ok 1 - bin/apply compiles 1..1 ok 2 - bin/apply # Subtest: bin/ar ok 1 - bin/ar compiles 1..1 ok 3 - bin/ar # Subtest: bin/arch ok 1 - bin/arch compiles 1..1 ok 4 - bin/arch # Subtest: bin/arithmetic ok 1 - bin/arithmetic compiles 1..1 ok 5 - bin/arithmetic # Subtest: bin/asa ok 1 - bin/asa compiles 1..1 ok 6 - bin/asa # Subtest: bin/awk ok 1 - bin/awk compiles 1..1 ok 7 - bin/awk # Subtest: bin/banner ok 1 - bin/banner compiles 1..1 ok 8 - bin/banner # Subtest: bin/basename ok 1 - bin/basename compiles 1..1 ok 9 - bin/basename # Subtest: bin/bc ok 1 - bin/bc compiles 1..1 ok 10 - bin/bc # Subtest: bin/cal ok 1 - bin/cal compiles 1..1 ok 11 - bin/cal # Subtest: bin/cat ok 1 - bin/cat compiles 1..1 ok 12 - bin/cat # Subtest: bin/chgrp ok 1 - bin/chgrp compiles 1..1 ok 13 - bin/chgrp # Subtest: bin/ching ok 1 - bin/ching compiles 1..1 ok 14 - bin/ching # Subtest: bin/chmod ok 1 - bin/chmod compiles 1..1 ok 15 - bin/chmod # Subtest: bin/chown ok 1 - bin/chown compiles 1..1 ok 16 - bin/chown # Subtest: bin/clear ok 1 - bin/clear compiles 1..1 ok 17 - bin/clear # Subtest: bin/cmp ok 1 - bin/cmp compiles 1..1 ok 18 - bin/cmp # Subtest: bin/col ok 1 - bin/col compiles 1..1 ok 19 - bin/col # Subtest: bin/colrm ok 1 - bin/colrm compiles 1..1 ok 20 - bin/colrm # Subtest: bin/comm ok 1 - bin/comm compiles 1..1 ok 21 - bin/comm # Subtest: bin/cp ok 1 - bin/cp compiles 1..1 ok 22 - bin/cp # Subtest: bin/cut ok 1 - bin/cut compiles 1..1 ok 23 - bin/cut # Subtest: bin/date ok 1 - bin/date compiles 1..1 ok 24 - bin/date # Subtest: bin/dc ok 1 - bin/dc compiles 1..1 ok 25 - bin/dc # Subtest: bin/deroff ok 1 - bin/deroff compiles 1..1 ok 26 - bin/deroff # Subtest: bin/diff ok 1 - bin/diff compiles 1..1 ok 27 - bin/diff # Subtest: bin/dirname ok 1 - bin/dirname compiles 1..1 ok 28 - bin/dirname # Subtest: bin/du ok 1 - bin/du compiles 1..1 ok 29 - bin/du # Subtest: bin/echo ok 1 - bin/echo compiles 1..1 ok 30 - bin/echo # Subtest: bin/ed ok 1 - bin/ed compiles 1..1 ok 31 - bin/ed # Subtest: bin/env ok 1 - bin/env compiles 1..1 ok 32 - bin/env # Subtest: bin/expand ok 1 - bin/expand compiles 1..1 ok 33 - bin/expand # Subtest: bin/expr ok 1 - bin/expr compiles 1..1 ok 34 - bin/expr # Subtest: bin/factor ok 1 - bin/factor compiles 1..1 ok 35 - bin/factor # Subtest: bin/false ok 1 - bin/false compiles 1..1 ok 36 - bin/false # Subtest: bin/file ok 1 - bin/file compiles 1..1 ok 37 - bin/file # Subtest: bin/find ok 1 - bin/find compiles 1..1 ok 38 - bin/find # Subtest: bin/fish ok 1 - bin/fish compiles 1..1 ok 39 - bin/fish # Subtest: bin/fmt ok 1 - bin/fmt compiles 1..1 ok 40 - bin/fmt # Subtest: bin/fold ok 1 - bin/fold compiles 1..1 ok 41 - bin/fold # Subtest: bin/fortune ok 1 - bin/fortune compiles 1..1 ok 42 - bin/fortune # Subtest: bin/from ok 1 - bin/from compiles 1..1 ok 43 - bin/from # Subtest: bin/glob ok 1 - bin/glob compiles 1..1 ok 44 - bin/glob # Subtest: bin/grep ok 1 - bin/grep compiles 1..1 ok 45 - bin/grep # Subtest: bin/hangman ok 1 - bin/hangman compiles 1..1 ok 46 - bin/hangman # Subtest: bin/head ok 1 - bin/head compiles 1..1 ok 47 - bin/head # Subtest: bin/id ok 1 - bin/id compiles 1..1 ok 48 - bin/id # Subtest: bin/install ok 1 - bin/install compiles 1..1 ok 49 - bin/install # Subtest: bin/join ok 1 - bin/join compiles 1..1 ok 50 - bin/join # Subtest: bin/kill ok 1 - bin/kill compiles 1..1 ok 51 - bin/kill # Subtest: bin/ln ok 1 - bin/ln compiles 1..1 ok 52 - bin/ln # Subtest: bin/lock ok 1 - bin/lock compiles 1..1 ok 53 - bin/lock # Subtest: bin/look ok 1 - bin/look compiles 1..1 ok 54 - bin/look # Subtest: bin/ls ok 1 - bin/ls compiles 1..1 ok 55 - bin/ls # Subtest: bin/mail ok 1 - bin/mail compiles 1..1 ok 56 - bin/mail # Subtest: bin/make ok 1 - bin/make compiles 1..1 ok 57 - bin/make # Subtest: bin/man ok 1 - bin/man compiles 1..1 ok 58 - bin/man # Subtest: bin/maze ok 1 - bin/maze compiles 1..1 ok 59 - bin/maze # Subtest: bin/mimedecode ok 1 - bin/mimedecode compiles 1..1 ok 60 - bin/mimedecode # Subtest: bin/mkdir ok 1 - bin/mkdir compiles 1..1 ok 61 - bin/mkdir # Subtest: bin/mkfifo ok 1 - bin/mkfifo compiles 1..1 ok 62 - bin/mkfifo # Subtest: bin/moo ok 1 - bin/moo compiles 1..1 ok 63 - bin/moo # Subtest: bin/morse ok 1 - bin/morse compiles 1..1 ok 64 - bin/morse # Subtest: bin/od ok 1 - bin/od compiles 1..1 ok 65 - bin/od # Subtest: bin/par ok 1 - bin/par compiles 1..1 ok 66 - bin/par # Subtest: bin/paste ok 1 - bin/paste compiles 1..1 ok 67 - bin/paste # Subtest: bin/patch ok 1 - bin/patch compiles 1..1 ok 68 - bin/patch # Subtest: bin/pig ok 1 - bin/pig compiles 1..1 ok 69 - bin/pig # Subtest: bin/ping ok 1 - bin/ping compiles 1..1 ok 70 - bin/ping # Subtest: bin/pom ok 1 - bin/pom compiles 1..1 ok 71 - bin/pom # Subtest: bin/ppt ok 1 - bin/ppt compiles 1..1 ok 72 - bin/ppt # Subtest: bin/pr ok 1 - bin/pr compiles 1..1 ok 73 - bin/pr # Subtest: bin/primes ok 1 - bin/primes compiles 1..1 ok 74 - bin/primes # Subtest: bin/printenv ok 1 - bin/printenv compiles 1..1 ok 75 - bin/printenv # Subtest: bin/printf ok 1 - bin/printf compiles 1..1 ok 76 - bin/printf # Subtest: bin/pwd ok 1 - bin/pwd compiles 1..1 ok 77 - bin/pwd # Subtest: bin/rain ok 1 - bin/rain compiles 1..1 ok 78 - bin/rain # Subtest: bin/random ok 1 - bin/random compiles 1..1 ok 79 - bin/random # Subtest: bin/rev ok 1 - bin/rev compiles 1..1 ok 80 - bin/rev # Subtest: bin/rm ok 1 - bin/rm compiles 1..1 ok 81 - bin/rm # Subtest: bin/rmdir ok 1 - bin/rmdir compiles 1..1 ok 82 - bin/rmdir # Subtest: bin/robots ok 1 - bin/robots compiles 1..1 ok 83 - bin/robots # Subtest: bin/shar ok 1 - bin/shar compiles 1..1 ok 84 - bin/shar # Subtest: bin/sleep ok 1 - bin/sleep compiles 1..1 ok 85 - bin/sleep # Subtest: bin/sort ok 1 - bin/sort compiles 1..1 ok 86 - bin/sort # Subtest: bin/spell ok 1 - bin/spell compiles 1..1 ok 87 - bin/spell # Subtest: bin/split ok 1 - bin/split compiles 1..1 ok 88 - bin/split # Subtest: bin/strings ok 1 - bin/strings compiles 1..1 ok 89 - bin/strings # Subtest: bin/sum ok 1 - bin/sum compiles 1..1 ok 90 - bin/sum # Subtest: bin/tac ok 1 - bin/tac compiles 1..1 ok 91 - bin/tac # Subtest: bin/tail ok 1 - bin/tail compiles 1..1 ok 92 - bin/tail # Subtest: bin/tar ok 1 - bin/tar compiles 1..1 ok 93 - bin/tar # Subtest: bin/tee ok 1 - bin/tee compiles 1..1 ok 94 - bin/tee # Subtest: bin/test ok 1 - bin/test compiles 1..1 ok 95 - bin/test # Subtest: bin/time ok 1 - bin/time compiles 1..1 ok 96 - bin/time # Subtest: bin/touch ok 1 - bin/touch compiles 1..1 ok 97 - bin/touch # Subtest: bin/tr ok 1 - bin/tr compiles 1..1 ok 98 - bin/tr # Subtest: bin/true ok 1 - bin/true compiles 1..1 ok 99 - bin/true # Subtest: bin/tsort ok 1 - bin/tsort compiles 1..1 ok 100 - bin/tsort # Subtest: bin/tty ok 1 - bin/tty compiles 1..1 ok 101 - bin/tty # Subtest: bin/uname ok 1 - bin/uname compiles 1..1 ok 102 - bin/uname # Subtest: bin/unexpand ok 1 - bin/unexpand compiles 1..1 ok 103 - bin/unexpand # Subtest: bin/uniq ok 1 - bin/uniq compiles 1..1 ok 104 - bin/uniq # Subtest: bin/units ok 1 - bin/units compiles 1..1 ok 105 - bin/units # Subtest: bin/unpar ok 1 - bin/unpar compiles 1..1 ok 106 - bin/unpar # Subtest: bin/unshar ok 1 - bin/unshar compiles 1..1 ok 107 - bin/unshar # Subtest: bin/uudecode ok 1 - bin/uudecode compiles 1..1 ok 108 - bin/uudecode # Subtest: bin/uuencode ok 1 - bin/uuencode compiles 1..1 ok 109 - bin/uuencode # Subtest: bin/wc ok 1 - bin/wc compiles 1..1 ok 110 - bin/wc # Subtest: bin/what ok 1 - bin/what compiles 1..1 ok 111 - bin/what # Subtest: bin/which ok 1 - bin/which compiles 1..1 ok 112 - bin/which # Subtest: bin/whois ok 1 - bin/whois compiles 1..1 ok 113 - bin/whois # Subtest: bin/words ok 1 - bin/words compiles 1..1 ok 114 - bin/words # Subtest: bin/wump ok 1 - bin/wump compiles 1..1 ok 115 - bin/wump # Subtest: bin/xargs ok 1 - bin/xargs compiles 1..1 ok 116 - bin/xargs # Subtest: bin/yes ok 1 - bin/yes compiles 1..1 ok 117 - bin/yes 1..117 ok # Failed test 'PerlPowerTools::factor->can('run')' # at t/factor.t line 14. # PerlPowerTools::factor->can('run') failed # Looks like you failed 1 test of 2. # Failed test 'setup' # at t/factor.t line 15. Can't locate object method "run" via package "PerlPowerTools::factor" (perhaps you forgot to load "PerlPowerTools::factor"?) at t/factor.t line 20. # Child (with_filehandle) exited without calling finalize() # Failed test 'with_filehandle' # at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 279. # Tests were run but no plan was declared and done_testing() was not seen. # Looks like your test exited with 1 just after 2. t/factor.t ... # Subtest: setup ok 1 - require 'bin/factor'; not ok 2 - PerlPowerTools::factor->can('run') 1..2 not ok 1 - setup # Subtest: with_filehandle not ok 2 - with_filehandle Dubious, test returned 1 (wstat 256, 0x100) Failed 2/2 subtests t/false.t .... # Subtest: check file ok 1 - blib/script/false exists ok 2 - blib/script/false is executable 1..2 ok 1 - check file # Subtest: exit value ok 1 - false returns a unix false 1..1 ok 2 - exit value 1..2 ok t/true.t ..... # Subtest: check file ok 1 - blib/script/true exists ok 2 - blib/script/true is executable 1..2 ok 1 - check file # Subtest: exit value ok 1 - true returns a unix true 1..1 ok 2 - exit value 1..2 ok Test Summary Report ------------------- t/factor.t (Wstat: 256 Tests: 2 Failed: 2) Failed tests: 1-2 Non-zero exit status: 1 Parse errors: No plan found in TAP output Files=4, Tests=123, 2 wallclock secs ( 0.04 usr 0.06 sys + 1.67 cusr 0.43 csys = 2.20 CPU) Result: FAIL Failed 1/4 test programs. 2/123 subtests failed. make: *** [test_dynamic] Error 255 BDFOY/PerlPowerTools-1.006.tar.gz make test TEST_VERBOSE=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports BDFOY/PerlPowerTools-1.006.tar.gz Running test for module 'Mac::iTerm::LaunchPad' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz ok Mac-iTerm-LaunchPad-1.008/ Mac-iTerm-LaunchPad-1.008/Changes Mac-iTerm-LaunchPad-1.008/examples/ Mac-iTerm-LaunchPad-1.008/examples/placeholder.pl Mac-iTerm-LaunchPad-1.008/lib/ Mac-iTerm-LaunchPad-1.008/lib/LaunchPad.pm Mac-iTerm-LaunchPad-1.008/LICENSE Mac-iTerm-LaunchPad-1.008/Makefile.PL Mac-iTerm-LaunchPad-1.008/MANIFEST Mac-iTerm-LaunchPad-1.008/META.yml Mac-iTerm-LaunchPad-1.008/README Mac-iTerm-LaunchPad-1.008/t/ Mac-iTerm-LaunchPad-1.008/t/load.t Mac-iTerm-LaunchPad-1.008/t/pod.t Mac-iTerm-LaunchPad-1.008/t/pod_coverage.t Mac-iTerm-LaunchPad-1.008/t/prereq.t Mac-iTerm-LaunchPad-1.008/t/test_manifest Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL OS unsupported! You need a Mac for this module! No 'Makefile' created BDFOY/Mac-iTerm-LaunchPad-1.008.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- NOT OK Running test for module 'perlbench' The module perlbench isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i perlbench'. Running test for module 'Mac::OSVersion' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Mac-OSVersion-1.001.tar.gz ok Mac-OSVersion-1.001/ Mac-OSVersion-1.001/Changes Mac-OSVersion-1.001/examples/ Mac-OSVersion-1.001/lib/ Mac-OSVersion-1.001/LICENSE Mac-OSVersion-1.001/Makefile.PL Mac-OSVersion-1.001/MANIFEST Mac-OSVersion-1.001/MANIFEST.SKIP Mac-OSVersion-1.001/META.json Mac-OSVersion-1.001/META.yml Mac-OSVersion-1.001/README Mac-OSVersion-1.001/t/ Mac-OSVersion-1.001/t/build.t Mac-OSVersion-1.001/t/default.t Mac-OSVersion-1.001/t/gestalt.t Mac-OSVersion-1.001/t/kernel.t Mac-OSVersion-1.001/t/load.t Mac-OSVersion-1.001/t/major.t Mac-OSVersion-1.001/t/minor.t Mac-OSVersion-1.001/t/minor_to_name.t Mac-OSVersion-1.001/t/name.t Mac-OSVersion-1.001/t/pod.t Mac-OSVersion-1.001/t/pod_coverage.t Mac-OSVersion-1.001/t/point.t Mac-OSVersion-1.001/t/sw_vers.t Mac-OSVersion-1.001/t/system_profiler.t Mac-OSVersion-1.001/t/test_manifest Mac-OSVersion-1.001/t/uname.t Mac-OSVersion-1.001/t/version.t Mac-OSVersion-1.001/lib/Mac/ Mac-OSVersion-1.001/lib/Mac/OSVersion.pm /bin/tar: Read 5120 bytes from - Mac-OSVersion-1.001/examples/placeholder.pl Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/Mac-OSVersion-1.001.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL OS unsupported. This module only works on Mac OS X. Warning: No success on command[/home/fly1800/ap1800-297235/bin/perl-static Makefile.PL] BDFOY/Mac-OSVersion-1.001.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- NOT OK Running test for module 'HTTP::Cookies::Safari' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz ok HTTP-Cookies-Safari-1.15/ HTTP-Cookies-Safari-1.15/Changes HTTP-Cookies-Safari-1.15/examples/ HTTP-Cookies-Safari-1.15/lib/ HTTP-Cookies-Safari-1.15/LICENSE HTTP-Cookies-Safari-1.15/Makefile.PL HTTP-Cookies-Safari-1.15/MANIFEST HTTP-Cookies-Safari-1.15/MANIFEST.SKIP HTTP-Cookies-Safari-1.15/META.yml HTTP-Cookies-Safari-1.15/README HTTP-Cookies-Safari-1.15/t/ HTTP-Cookies-Safari-1.15/t/compile.t HTTP-Cookies-Safari-1.15/t/Cookies-2039.plist HTTP-Cookies-Safari-1.15/t/Cookies.plist HTTP-Cookies-Safari-1.15/t/epoch-limit.t HTTP-Cookies-Safari-1.15/t/load.t HTTP-Cookies-Safari-1.15/t/pod.t HTTP-Cookies-Safari-1.15/t/pod_coverage.t HTTP-Cookies-Safari-1.15/t/prereq.t HTTP-Cookies-Safari-1.15/t/save.t HTTP-Cookies-Safari-1.15/t/test_manifest HTTP-Cookies-Safari-1.15/lib/HTTP/ HTTP-Cookies-Safari-1.15/lib/HTTP/Cookies/ HTTP-Cookies-Safari-1.15/lib/HTTP/Cookies/Safari.pm HTTP-Cookies-Safari-1.15/examples/README /bin/tar: Read 1024 bytes from - Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for HTTP::Cookies::Safari Writing MYMETA.yml and MYMETA.json BDFOY/HTTP-Cookies-Safari-1.15.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp lib/HTTP/Cookies/Safari.pm blib/lib/HTTP/Cookies/Safari.pm Manifying 1 pod document BDFOY/HTTP-Cookies-Safari-1.15.tar.gz make -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running make test >>> make test TEST_VERBOSE=1 "/home/fly1800/ap1800-297235/bin/perl-static" "-MTest::Manifest" "-e" "run_t_manifest(1, 'blib/lib', 'blib/arch', )" Test::Manifest 2.02 Level is 0 # Test level is 0 Test::Manifest::test_harness found [t/compile.t t/pod.t t/pod_coverage.t t/prereq.t t/load.t t/epoch-limit.t t/save.t] t/compile.t ....... 1..1 ok 1 - use HTTP::Cookies::Safari; ok t/pod.t ........... 1..1 ok 1 - POD test for blib/lib/HTTP/Cookies/Safari.pm ok t/pod_coverage.t .. 1..1 ok 1 - Pod coverage on HTTP::Cookies::Safari ok t/prereq.t ........ 1..1 ok 1 - Prereq test ok t/load.t .......... 1..5 ok 1 - An object of class 'HTTP::Cookies::Safari' isa 'HTTP::Cookies::Safari' ok 2 - Count of domains ok 3 - .usatoday.com has 3 cookies ok 4 - .cnn.com has 1 cookies ok 5 - Cookie has right value ok t/epoch-limit.t ... 1..5 ok 1 - An object of class 'HTTP::Cookies::Safari' isa 'HTTP::Cookies::Safari' ok 2 - Count of domains ok 3 - .cnn.com has 1 cookies ok 4 - Cookie has right value ok 5 - Expiry past 2038 is 0xff_ff_ff_ff instead ok plist is Mac::PropertyList::array=ARRAY(0x857ebc4) t/save.t .......... 1..2 ok 1 - An object of class 'HTTP::Cookies::Safari' isa 'HTTP::Cookies::Safari' not ok 2 - Saved file is same as original # TODO How can I compare these files? # Failed (TODO) test 'Saved file is same as original' # at t/save.t line 21. ok All tests successful. Files=7, Tests=16, 9 wallclock secs ( 0.03 usr 0.02 sys + 7.90 cusr 0.28 csys = 8.23 CPU) Result: PASS BDFOY/HTTP-Cookies-Safari-1.15.tar.gz make test TEST_VERBOSE=1 -- OK brian d foy <bdfoy@cpan.org> Cookie storage and management for Safari >>> (cd /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH && tar cvf - HTTP-Cookies-Safari-1.15.ppd blib) | gzip -c >/home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY/HTTP-Cookies-Safari-1.15.tar.gz HTTP-Cookies-Safari-1.15.ppd blib/ blib/man3/ blib/man3/HTTP::Cookies::Safari.3 blib/lib/ blib/lib/HTTP/ blib/lib/HTTP/Cookies/ blib/lib/HTTP/Cookies/Safari.pm >>> mv /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/HTTP-Cookies-Safari-1.15.ppd /home/fly1800/cpanfly-5.18/var/REPO/B/BD/BDFOY Running test for module 'MyCPAN::Indexer' BDFOY/MyCPAN-Indexer-1.28.tar.gz Has already been unwrapped into directory /home/fly1800/cpanfly-5.18/var/cpan/build/MyCPAN-Indexer-1.28-38NSmn BDFOY/MyCPAN-Indexer-1.28.tar.gz Has already been prepared BDFOY/MyCPAN-Indexer-1.28.tar.gz Has already been made BDFOY/MyCPAN-Indexer-1.28.tar.gz Has already been tested within this command Running test for module 'scriptdist' The module scriptdist isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i scriptdist'. Running test for module 'Unicode::Support' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/B/BD/BDFOY/Unicode-Support-0.001.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Unicode-Support-0.001.tar.gz ok Unicode-Support-0.001 Unicode-Support-0.001/Build Unicode-Support-0.001/Build.PL Unicode-Support-0.001/Changes Unicode-Support-0.001/LICENSE Unicode-Support-0.001/MANIFEST Unicode-Support-0.001/META.json Unicode-Support-0.001/META.yml Unicode-Support-0.001/README Unicode-Support-0.001/lib Unicode-Support-0.001/lib/Unicode Unicode-Support-0.001/lib/Unicode/Support.pm Unicode-Support-0.001/t Unicode-Support-0.001/t/load.t Unicode-Support-0.001/t/pod.t Unicode-Support-0.001/t/pod_coverage.t Unicode-Support-0.001/t/test_manifest Unicode-Support-0.001/t/files Unicode-Support-0.001/t/files/filename_case_folding.t Unicode-Support-0.001/t/files/filenames.t Unicode-Support-0.001/t/files/filenames_with_different_nf.t Unicode-Support-0.001/t/lib Unicode-Support-0.001/t/lib/file_utils.pl /bin/tar: Read 3072 bytes from - Unicode-Support-0.001/t/variables Unicode-Support-0.001/t/variables/case-folding.t Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/Unicode-Support-0.001.tar.gz with Build.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Build.PL Created MYMETA.yml and MYMETA.json Creating new 'Build' script for 'Unicode-Support' version '0.001' BDFOY/Unicode-Support-0.001.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Build.PL -- OK Running Build for B/BD/BDFOY/Unicode-Support-0.001.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> ./Build Building Unicode-Support BDFOY/Unicode-Support-0.001.tar.gz ./Build -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running Build test >>> ./Build test verbose=1 test file [files/filename_case_folding.pl] does not exist! Skipping! at /home/fly1800/cpanfly-5.18/var/cpan/build/Unicode-Support-0.001-m3WjYH/_build/lib/Test/Manifest/MB.pm line 18. Test level is 0 t/load.t ............................... 1..1 ok 1 - use Unicode::Support; ok t/pod.t ................................ 1..1 ok 1 - POD test for blib/lib/Unicode/Support.pm ok t/pod_coverage.t ....................... 1..1 ok 1 - Pod coverage on Unicode::Support ok # Failed test '-e with NFD returns true (U+0065 U+0301)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFD returns true (U+0065 U+0301) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Failed test '-e with NFKD returns true (U+0065 U+0301)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKD returns true (U+0065 U+0301) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Looks like you failed 4 tests of 11. # Failed test 'Input filename [é] with code numbers [U+00E9]' # at t/files/filenames_with_different_nf.t line 88. # Failed test '-e with NFD returns true (U+0075 U+0308)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFD returns true (U+0075 U+0308) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Failed test '-e with NFKD returns true (U+0075 U+0308)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKD returns true (U+0075 U+0308) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Looks like you failed 4 tests of 11. # Failed test 'Input filename [ü] with code numbers [U+00FC]' # at t/files/filenames_with_different_nf.t line 88. # Failed test '-e with NFD returns true (U+0061 U+030A)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFD returns true (U+0061 U+030A) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Failed test '-e with NFKD returns true (U+0061 U+030A)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKD returns true (U+0061 U+030A) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Looks like you failed 4 tests of 11. # Failed test 'Input filename [å] with code numbers [U+00E5]' # at t/files/filenames_with_different_nf.t line 88. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test '-e with NFKC returns true (U+0066 U+0066)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKC returns true (U+0066 U+0066) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Failed test '-e with NFKD returns true (U+0066 U+0066)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKD returns true (U+0066 U+0066) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Looks like you failed 4 tests of 11. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Input filename [ff] with code numbers [U+FB00]' # at t/files/filenames_with_different_nf.t line 88. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test '-e with NFKC returns true (U+0056 U+0049 U+0049 U+0049)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKC returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Failed test '-e with NFKD returns true (U+0056 U+0049 U+0049 U+0049)' # at t/files/filenames_with_different_nf.t line 76. # Failed test 'open() with NFKD returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory' # at t/files/filenames_with_different_nf.t line 80. # Looks like you failed 4 tests of 11. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Input filename [â…§] with code numbers [U+2167]' # at t/files/filenames_with_different_nf.t line 88. # Failed test 'NFD does not always work' # at t/files/filenames_with_different_nf.t line 92. # Failed test 'NFKC does not always work' # at t/files/filenames_with_different_nf.t line 92. # Failed test 'NFKD does not always work' # at t/files/filenames_with_different_nf.t line 92. # Looks like you failed 8 tests of 11. t/files/filenames_with_different_nf.t .. ok 1 - Unlinked 0 of 0 files # Subtest: Input filename [é] with code numbers [U+00E9] ok 1 - [é] does not exist before test ok 2 - There are no files before the test not ok 3 - -e with NFD returns true (U+0065 U+0301) not ok 4 - open() with NFD returns true (U+0065 U+0301) error => No such file or directory ok 5 - -e with NFC returns true (U+00E9) ok 6 - open() with NFC returns true (U+00E9) ok 7 - -e with NFKC returns true (U+00E9) ok 8 - open() with NFKC returns true (U+00E9) not ok 9 - -e with NFKD returns true (U+0065 U+0301) not ok 10 - open() with NFKD returns true (U+0065 U+0301) error => No such file or directory ok 11 - Unlinked 1 of 1 files 1..11 not ok 2 - Input filename [é] with code numbers [U+00E9] # Subtest: Input filename [ü] with code numbers [U+00FC] ok 1 - [ü] does not exist before test ok 2 - There are no files before the test not ok 3 - -e with NFD returns true (U+0075 U+0308) not ok 4 - open() with NFD returns true (U+0075 U+0308) error => No such file or directory ok 5 - -e with NFC returns true (U+00FC) ok 6 - open() with NFC returns true (U+00FC) ok 7 - -e with NFKC returns true (U+00FC) ok 8 - open() with NFKC returns true (U+00FC) not ok 9 - -e with NFKD returns true (U+0075 U+0308) not ok 10 - open() with NFKD returns true (U+0075 U+0308) error => No such file or directory ok 11 - Unlinked 1 of 1 files 1..11 not ok 3 - Input filename [ü] with code numbers [U+00FC] # Subtest: Input filename [å] with code numbers [U+00E5] ok 1 - [å] does not exist before test ok 2 - There are no files before the test not ok 3 - -e with NFD returns true (U+0061 U+030A) not ok 4 - open() with NFD returns true (U+0061 U+030A) error => No such file or directory ok 5 - -e with NFC returns true (U+00E5) ok 6 - open() with NFC returns true (U+00E5) ok 7 - -e with NFKC returns true (U+00E5) ok 8 - open() with NFKC returns true (U+00E5) not ok 9 - -e with NFKD returns true (U+0061 U+030A) not ok 10 - open() with NFKD returns true (U+0061 U+030A) error => No such file or directory ok 11 - Unlinked 1 of 1 files 1..11 not ok 4 - Input filename [å] with code numbers [U+00E5] # Subtest: Input filename [Ï€] with code numbers [U+03C0] ok 1 - [Ï€] does not exist before test ok 2 - There are no files before the test ok 3 - -e with NFD returns true (U+03C0) ok 4 - open() with NFD returns true (U+03C0) ok 5 - -e with NFC returns true (U+03C0) ok 6 - open() with NFC returns true (U+03C0) ok 7 - -e with NFKC returns true (U+03C0) ok 8 - open() with NFKC returns true (U+03C0) ok 9 - -e with NFKD returns true (U+03C0) ok 10 - open() with NFKD returns true (U+03C0) ok 11 - Unlinked 1 of 1 files 1..11 ok 5 - Input filename [Ï€] with code numbers [U+03C0] # Subtest: Input filename [ff] with code numbers [U+FB00] ok 1 - [ff] does not exist before test ok 2 - There are no files before the test ok 3 - -e with NFD returns true (U+FB00) ok 4 - open() with NFD returns true (U+FB00) ok 5 - -e with NFC returns true (U+FB00) ok 6 - open() with NFC returns true (U+FB00) not ok 7 - -e with NFKC returns true (U+0066 U+0066) not ok 8 - open() with NFKC returns true (U+0066 U+0066) error => No such file or directory not ok 9 - -e with NFKD returns true (U+0066 U+0066) not ok 10 - open() with NFKD returns true (U+0066 U+0066) error => No such file or directory ok 11 - Unlinked 1 of 1 files 1..11 not ok 6 - Input filename [ff] with code numbers [U+FB00] # Subtest: Input filename [â…§] with code numbers [U+2167] ok 1 - [â…§] does not exist before test ok 2 - There are no files before the test ok 3 - -e with NFD returns true (U+2167) ok 4 - open() with NFD returns true (U+2167) ok 5 - -e with NFC returns true (U+2167) ok 6 - open() with NFC returns true (U+2167) not ok 7 - -e with NFKC returns true (U+0056 U+0049 U+0049 U+0049) not ok 8 - open() with NFKC returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory not ok 9 - -e with NFKD returns true (U+0056 U+0049 U+0049 U+0049) not ok 10 - open() with NFKD returns true (U+0056 U+0049 U+0049 U+0049) error => No such file or directory ok 11 - Unlinked 1 of 1 files 1..11 not ok 7 - Input filename [â…§] with code numbers [U+2167] not ok 8 - NFD does not always work ok 9 - NFC seems to always work not ok 10 - NFKC does not always work not ok 11 - NFKD does not always work 1..11 Dubious, test returned 8 (wstat 2048, 0x800) Failed 8/11 subtests Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [eÌ] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFKD with filename [eÌ] (U+0065 U+0301)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [ü] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFKD with filename [ü] (U+0075 U+0308)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [aÌŠ] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFKD with filename [aÌŠ] (U+0061 U+030A)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [Ï€] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFKD with filename [Ï€] (U+03C0)' # at t/files/filenames.t line 93. # Testing [ff] # Testing [VIII] # Looks like you failed 4 tests of 6. # Failed test 'Testing NFKD' # at t/files/filenames.t line 96. # Testing [é] # Testing [ü] # Testing [å] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [Ï€] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [ff] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [â…§] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [é] # Testing [ü] # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. # Failed test 'Tested NFKC with filename [ü] (U+00FC)' # at t/files/filenames.t line 93. # Testing [å] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [Ï€] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [ff] # Testing [VIII] # Looks like you failed 1 test of 6. # Failed test 'Testing NFKC' # at t/files/filenames.t line 96. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [eÌ] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFD with filename [eÌ] (U+0065 U+0301)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [ü] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFD with filename [ü] (U+0075 U+0308)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [aÌŠ] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFD with filename [aÌŠ] (U+0061 U+030A)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [Ï€] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFD with filename [Ï€] (U+03C0)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [ff] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFD with filename [ff] (U+FB00)' # at t/files/filenames.t line 93. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Testing [â…§] Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Filename comes back as the same NF type' # at t/files/filenames.t line 87. # Looks like you failed 1 test of 6. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. Wide character in print at /home/fly1800/cpanfly-5.18/var/megalib/Test/Builder.pm line 1826. # Failed test 'Tested NFD with filename [â…§] (U+2167)' # at t/files/filenames.t line 93. # Looks like you failed 6 tests of 6. # Failed test 'Testing NFD' # at t/files/filenames.t line 96. # Looks like you failed 3 tests of 5. t/files/filenames.t .................... ok 1 - Unlinked 0 of 0 files # Subtest: Testing NFKD # Subtest: Tested NFKD with filename [eÌ] (U+0065 U+0301) ok 1 - [eÌ] does not exist before test ok 2 - There are no files before the test ok 3 - [eÌ] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 1 - Tested NFKD with filename [eÌ] (U+0065 U+0301) # Subtest: Tested NFKD with filename [ü] (U+0075 U+0308) ok 1 - [ü] does not exist before test ok 2 - There are no files before the test ok 3 - [ü] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 2 - Tested NFKD with filename [ü] (U+0075 U+0308) # Subtest: Tested NFKD with filename [aÌŠ] (U+0061 U+030A) ok 1 - [aÌŠ] does not exist before test ok 2 - There are no files before the test ok 3 - [aÌŠ] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 3 - Tested NFKD with filename [aÌŠ] (U+0061 U+030A) # Subtest: Tested NFKD with filename [Ï€] (U+03C0) ok 1 - [Ï€] does not exist before test ok 2 - There are no files before the test ok 3 - [Ï€] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 4 - Tested NFKD with filename [Ï€] (U+03C0) # Subtest: Tested NFKD with filename [ff] (U+0066 U+0066) ok 1 - [ff] does not exist before test ok 2 - There are no files before the test ok 3 - [ff] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 5 - Tested NFKD with filename [ff] (U+0066 U+0066) # Subtest: Tested NFKD with filename [VIII] (U+0056 U+0049 U+0049 U+0049) ok 1 - [VIII] does not exist before test ok 2 - There are no files before the test ok 3 - [VIII] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 6 - Tested NFKD with filename [VIII] (U+0056 U+0049 U+0049 U+0049) 1..6 not ok 2 - Testing NFKD # Subtest: Testing NFC # Subtest: Tested NFC with filename [é] (U+00E9) ok 1 - [é] does not exist before test ok 2 - There are no files before the test ok 3 - [é] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 1 - Tested NFC with filename [é] (U+00E9) # Subtest: Tested NFC with filename [ü] (U+00FC) ok 1 - [ü] does not exist before test ok 2 - There are no files before the test ok 3 - [ü] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 2 - Tested NFC with filename [ü] (U+00FC) # Subtest: Tested NFC with filename [å] (U+00E5) ok 1 - [å] does not exist before test ok 2 - There are no files before the test ok 3 - [å] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 3 - Tested NFC with filename [å] (U+00E5) # Subtest: Tested NFC with filename [Ï€] (U+03C0) ok 1 - [Ï€] does not exist before test ok 2 - There are no files before the test ok 3 - [Ï€] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 4 - Tested NFC with filename [Ï€] (U+03C0) # Subtest: Tested NFC with filename [ff] (U+FB00) ok 1 - [ff] does not exist before test ok 2 - There are no files before the test ok 3 - [ff] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 5 - Tested NFC with filename [ff] (U+FB00) # Subtest: Tested NFC with filename [â…§] (U+2167) ok 1 - [â…§] does not exist before test ok 2 - There are no files before the test ok 3 - [â…§] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 6 - Tested NFC with filename [â…§] (U+2167) 1..6 ok 3 - Testing NFC # Subtest: Testing NFKC # Subtest: Tested NFKC with filename [é] (U+00E9) ok 1 - [é] does not exist before test ok 2 - There are no files before the test ok 3 - [é] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 1 - Tested NFKC with filename [é] (U+00E9) # Subtest: Tested NFKC with filename [ü] (U+00FC) ok 1 - [ü] does not exist before test ok 2 - There are no files before the test ok 3 - [ü] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 2 - Tested NFKC with filename [ü] (U+00FC) # Subtest: Tested NFKC with filename [å] (U+00E5) ok 1 - [å] does not exist before test ok 2 - There are no files before the test ok 3 - [å] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 3 - Tested NFKC with filename [å] (U+00E5) # Subtest: Tested NFKC with filename [Ï€] (U+03C0) ok 1 - [Ï€] does not exist before test ok 2 - There are no files before the test ok 3 - [Ï€] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 4 - Tested NFKC with filename [Ï€] (U+03C0) # Subtest: Tested NFKC with filename [ff] (U+0066 U+0066) ok 1 - [ff] does not exist before test ok 2 - There are no files before the test ok 3 - [ff] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 5 - Tested NFKC with filename [ff] (U+0066 U+0066) # Subtest: Tested NFKC with filename [VIII] (U+0056 U+0049 U+0049 U+0049) ok 1 - [VIII] does not exist before test ok 2 - There are no files before the test ok 3 - [VIII] exists after opening ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 ok 6 - Tested NFKC with filename [VIII] (U+0056 U+0049 U+0049 U+0049) 1..6 not ok 4 - Testing NFKC # Subtest: Testing NFD # Subtest: Tested NFD with filename [eÌ] (U+0065 U+0301) ok 1 - [eÌ] does not exist before test ok 2 - There are no files before the test ok 3 - [eÌ] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 1 - Tested NFD with filename [eÌ] (U+0065 U+0301) # Subtest: Tested NFD with filename [ü] (U+0075 U+0308) ok 1 - [ü] does not exist before test ok 2 - There are no files before the test ok 3 - [ü] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 2 - Tested NFD with filename [ü] (U+0075 U+0308) # Subtest: Tested NFD with filename [aÌŠ] (U+0061 U+030A) ok 1 - [aÌŠ] does not exist before test ok 2 - There are no files before the test ok 3 - [aÌŠ] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 3 - Tested NFD with filename [aÌŠ] (U+0061 U+030A) # Subtest: Tested NFD with filename [Ï€] (U+03C0) ok 1 - [Ï€] does not exist before test ok 2 - There are no files before the test ok 3 - [Ï€] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 4 - Tested NFD with filename [Ï€] (U+03C0) # Subtest: Tested NFD with filename [ff] (U+FB00) ok 1 - [ff] does not exist before test ok 2 - There are no files before the test ok 3 - [ff] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 5 - Tested NFD with filename [ff] (U+FB00) # Subtest: Tested NFD with filename [â…§] (U+2167) ok 1 - [â…§] does not exist before test ok 2 - There are no files before the test ok 3 - [â…§] exists after opening not ok 4 - Filename comes back as the same NF type ok 5 - There is exactly one file ok 6 - Unlinked 1 of 1 files 1..6 not ok 6 - Tested NFD with filename [â…§] (U+2167) 1..6 not ok 5 - Testing NFD 1..5 Dubious, test returned 3 (wstat 768, 0x300) Failed 3/5 subtests Test Summary Report ------------------- t/files/filenames_with_different_nf.t (Wstat: 2048 Tests: 11 Failed: 8) Failed tests: 2-4, 6-8, 10-11 Non-zero exit status: 8 t/files/filenames.t (Wstat: 768 Tests: 5 Failed: 3) Failed tests: 2, 4-5 Non-zero exit status: 3 Files=5, Tests=19, 0 wallclock secs ( 0.06 usr 0.03 sys + 0.43 cusr 0.09 csys = 0.61 CPU) Result: FAIL Failed 2/5 test programs. 11/19 subtests failed. BDFOY/Unicode-Support-0.001.tar.gz ./Build test verbose=1 -- NOT OK //hint// to see the cpan-testers results for installing this module, try: reports BDFOY/Unicode-Support-0.001.tar.gz Running test for module 'File::Fingerprint' The module File::Fingerprint isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i File::Fingerprint'. Running test for module 'Task::MasteringPerl' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/B/BD/BDFOY/Task-MasteringPerl-1.002.tar.gz ok Task-MasteringPerl-1.002/ Task-MasteringPerl-1.002/Changes Task-MasteringPerl-1.002/lib/ Task-MasteringPerl-1.002/LICENSE Task-MasteringPerl-1.002/Makefile.PL Task-MasteringPerl-1.002/MANIFEST Task-MasteringPerl-1.002/META.json Task-MasteringPerl-1.002/META.yml Task-MasteringPerl-1.002/MYMETA.json Task-MasteringPerl-1.002/MYMETA.yml Task-MasteringPerl-1.002/README Task-MasteringPerl-1.002/t/ Task-MasteringPerl-1.002/t/load.t Task-MasteringPerl-1.002/t/pod.t Task-MasteringPerl-1.002/lib/Task/ Task-MasteringPerl-1.002/lib/Task/MasteringPerl.pm /bin/tar: Read 6144 bytes from - Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring B/BD/BDFOY/Task-MasteringPerl-1.002.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Warning: prerequisite Apache::PerlRun 0 not found. Warning: prerequisite Apache::Pod 0 not found. Warning: prerequisite App::Smbxfer 0 not found. Warning: prerequisite BioPerl 0 not found. Warning: prerequisite Code::Splice 0 not found. Warning: prerequisite Config::ApacheFile 0 not found. Warning: prerequisite Data::Dump::Steamer 0 not found. Warning: prerequisite Devel::DProf 0 not found. Warning: prerequisite Devel::MyDebugger 0 not found. Warning: prerequisite Devel::ebug 0 not found. Warning: prerequisite Devel::ebug::Console 0 not found. Warning: prerequisite Git::CPAN::Patch 0 not found. Warning: prerequisite Hook::Lex::Wrap 0 not found. Warning: prerequisite JSON::Rabbit 0 not found. Warning: prerequisite ModPerl::PerlRun 0 not found. Warning: prerequisite Module::NotThere 0 not found. Warning: prerequisite Package:Stash 0 not found. Warning: prerequisite Perl::Critic::DEVELOPER 0 not found. Warning: prerequisite Pod::Simple::Subclassing 0 not found. Warning: prerequisite ReturnValue 0 not found. Warning: prerequisite Some::Module 0 not found. Warning: prerequisite Tie:: 0 not found. Warning: prerequisite Tie::File::Timestamp 0 not found. Warning: prerequisite TryCatch 0 not found. Warning: prerequisite Vim::Debug 0 not found. Warning: prerequisite Win32 0 not found. Warning: prerequisite Win32::Registry 0 not found. Warning: prerequisite die 0 not found. Warning: prerequisite perlbench 0 not found. Warning: prerequisite ptkdb 0 not found. Warning: prerequisite require 0 not found. Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Task::MasteringPerl Writing MYMETA.yml and MYMETA.json BDFOY/Task-MasteringPerl-1.002.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for B/BD/BDFOY/Task-MasteringPerl-1.002.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' ---- Unsatisfied dependencies detected during ---- ---- BDFOY/Task-MasteringPerl-1.002.tar.gz ---- perlbench [requires] Devel::DProf [requires] BioPerl [requires] Tie::File::Timestamp [requires] ReturnValue [requires] Devel::MyDebugger [requires] App::Smbxfer [requires] Config::ApacheFile [requires] Data::Dump::Steamer [requires] ptkdb [requires] Win32::Registry [requires] Devel::ebug [requires] Devel::ebug::Console [requires] Vim::Debug [requires] Apache::PerlRun [requires] Git::CPAN::Patch [requires] ModPerl::PerlRun [requires] JSON::Rabbit [requires] require [requires] Some::Module [requires] die [requires] Module::NotThere [requires] Pod::Simple::Subclassing [requires] TryCatch [requires] Code::Splice [requires] Hook::Lex::Wrap [requires] Apache::Pod [requires] Win32 [requires] Perl::Critic::DEVELOPER [requires] Running test for module 'perlbench' The module perlbench isn't available on CPAN. Either the module has not yet been uploaded to CPAN, or it is temporary unavailable. Please contact the author to find out more about the status. Try 'i perlbench'. Running test for module 'Devel::DProf' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Fetching with LWP: http://ppm.activestate.com/CPAN/authors/id/F/FL/FLORA/Devel-DProf-20110802.00.tar.gz Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/F/FL/FLORA/Devel-DProf-20110802.00.tar.gz ok Devel-DProf-20110802.00 Devel-DProf-20110802.00/Todo Devel-DProf-20110802.00/README Devel-DProf-20110802.00/Changes Devel-DProf-20110802.00/LICENSE Devel-DProf-20110802.00/DProf.xs Devel-DProf-20110802.00/DProf.pm Devel-DProf-20110802.00/dist.ini Devel-DProf-20110802.00/META.yml Devel-DProf-20110802.00/MANIFEST Devel-DProf-20110802.00/t Devel-DProf-20110802.00/t/DProf.t Devel-DProf-20110802.00/META.json Devel-DProf-20110802.00/dprof Devel-DProf-20110802.00/dprof/V.pm Devel-DProf-20110802.00/bin Devel-DProf-20110802.00/bin/dprofpp Devel-DProf-20110802.00/Makefile.PL Devel-DProf-20110802.00/dprof/test3_t Devel-DProf-20110802.00/dprof/test1_t Devel-DProf-20110802.00/dprof/test4_v Devel-DProf-20110802.00/dprof/test2_t Devel-DProf-20110802.00/dprof/test7_v Devel-DProf-20110802.00/dprof/test8_v Devel-DProf-20110802.00/dprof/test7_t Devel-DProf-20110802.00/dprof/test5_t Devel-DProf-20110802.00/dprof/test5_v Devel-DProf-20110802.00/dprof/test6_v Devel-DProf-20110802.00/dprof/test6_t Devel-DProf-20110802.00/dprof/test3_v Devel-DProf-20110802.00/dprof/test2_v Devel-DProf-20110802.00/dprof/test1_v Devel-DProf-20110802.00/dprof/test8_t Devel-DProf-20110802.00/dprof/test4_t /bin/tar: Read 2048 bytes from - Devel-DProf-20110802.00/t/release-pod-syntax.t Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring F/FL/FLORA/Devel-DProf-20110802.00.tar.gz with Makefile.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL Checking if your kit is complete... Looks good Have /home/fly1800/cpanfly-5.18/var/megalib Want /home/fly1800/ap1800-297235/lib Your perl and your Config.pm seem to have different ideas about the architecture they are running on. Perl thinks: [megalib] Config says: [i686-linux-thread-multi-64int] This may or may not cause problems. Please check your installation of perl if you have problems building this extension. Generating a Unix-style Makefile Writing Makefile for Devel::DProf Writing MYMETA.yml and MYMETA.json FLORA/Devel-DProf-20110802.00.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Makefile.PL -- OK Running make for F/FL/FLORA/Devel-DProf-20110802.00.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> make cp DProf.pm blib/lib/Devel/DProf.pm Running Mkbootstrap for Devel::DProf () chmod 644 "DProf.bs" "/home/fly1800/ap1800-297235/bin/perl-static" "/home/fly1800/cpanfly-5.18/var/megalib/ExtUtils/xsubpp" -typemap "/home/fly1800/ap1800-297235/lib/ExtUtils/typemap" DProf.xs > DProf.xsc && mv DProf.xsc DProf.c Please specify prototyping behavior for DProf.xs (see perlxs manual) gcc -c -D_REENTRANT -D_GNU_SOURCE -DUSE_SITECUSTOMIZE -DPERL_RELOCATABLE_INCPUSH -fno-merge-constants -fno-strict-aliasing -pipe -fstack-protector -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -DVERSION=\"20110802.00\" -DXS_VERSION=\"20110802.00\" -fPIC "-I/home/fly1800/ap1800-297235/lib/CORE" DProf.c DProf.c:854: error: static declaration of 'XS_Devel__DProf_END' follows non-static declaration DProf.xs:107: error: previous declaration of 'XS_Devel__DProf_END' was here make: *** [DProf.o] Error 1 FLORA/Devel-DProf-20110802.00.tar.gz make -- NOT OK Running test for module 'BioPerl' Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'get' Checksum for /home/fly1800/cpanfly-5.18/var/cpan/sources/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.923.tar.gz ok BioPerl-1.6.923 BioPerl-1.6.923/.travis.yml BioPerl-1.6.923/AUTHORS BioPerl-1.6.923/BioPerl.pm BioPerl-1.6.923/BUGS BioPerl-1.6.923/Build.PL BioPerl-1.6.923/Changes BioPerl-1.6.923/DEPENDENCIES BioPerl-1.6.923/DEPRECATED BioPerl-1.6.923/INSTALL BioPerl-1.6.923/INSTALL.SKIP BioPerl-1.6.923/INSTALL.WIN BioPerl-1.6.923/LICENSE BioPerl-1.6.923/MANIFEST BioPerl-1.6.923/META.json BioPerl-1.6.923/META.yml BioPerl-1.6.923/README BioPerl-1.6.923/README.md BioPerl-1.6.923/Bio BioPerl-1.6.923/Bio/AlignIO.pm BioPerl-1.6.923/Bio/AnalysisI.pm BioPerl-1.6.923/Bio/AnalysisParserI.pm BioPerl-1.6.923/Bio/AnalysisResultI.pm BioPerl-1.6.923/Bio/AnnotatableI.pm BioPerl-1.6.923/Bio/AnnotationCollectionI.pm BioPerl-1.6.923/Bio/AnnotationI.pm BioPerl-1.6.923/Bio/ClusterI.pm BioPerl-1.6.923/Bio/ClusterIO.pm BioPerl-1.6.923/Bio/DasI.pm BioPerl-1.6.923/Bio/DBLinkContainerI.pm BioPerl-1.6.923/Bio/DescribableI.pm BioPerl-1.6.923/Bio/FeatureHolderI.pm BioPerl-1.6.923/Bio/HandlerBaseI.pm BioPerl-1.6.923/Bio/IdCollectionI.pm BioPerl-1.6.923/Bio/IdentifiableI.pm BioPerl-1.6.923/Bio/LocatableSeq.pm BioPerl-1.6.923/Bio/LocationI.pm BioPerl-1.6.923/Bio/MapIO.pm BioPerl-1.6.923/Bio/NexmlIO.pm BioPerl-1.6.923/Bio/OntologyIO.pm BioPerl-1.6.923/Bio/ParameterBaseI.pm BioPerl-1.6.923/Bio/Perl.pm BioPerl-1.6.923/Bio/PhyloNetwork.pm BioPerl-1.6.923/Bio/PrimarySeq.pm BioPerl-1.6.923/Bio/PrimarySeqI.pm BioPerl-1.6.923/Bio/PullParserI.pm BioPerl-1.6.923/Bio/Range.pm BioPerl-1.6.923/Bio/RangeI.pm BioPerl-1.6.923/Bio/SearchDist.pm BioPerl-1.6.923/Bio/SearchIO.pm BioPerl-1.6.923/Bio/Seq.pm BioPerl-1.6.923/Bio/SeqAnalysisParserI.pm BioPerl-1.6.923/Bio/SeqFeatureI.pm BioPerl-1.6.923/Bio/SeqI.pm BioPerl-1.6.923/Bio/SeqIO.pm BioPerl-1.6.923/Bio/SeqUtils.pm BioPerl-1.6.923/Bio/SimpleAlign.pm BioPerl-1.6.923/Bio/SimpleAnalysisI.pm BioPerl-1.6.923/Bio/Species.pm BioPerl-1.6.923/Bio/Taxon.pm BioPerl-1.6.923/Bio/Taxonomy.pm BioPerl-1.6.923/Bio/TreeIO.pm BioPerl-1.6.923/Bio/UpdateableSeqI.pm BioPerl-1.6.923/Bio/WebAgent.pm BioPerl-1.6.923/Bio/Align BioPerl-1.6.923/Bio/Align/AlignI.pm BioPerl-1.6.923/Bio/Align/DNAStatistics.pm BioPerl-1.6.923/Bio/Align/Graphics.pm BioPerl-1.6.923/Bio/Align/PairwiseStatistics.pm BioPerl-1.6.923/Bio/Align/ProteinStatistics.pm BioPerl-1.6.923/Bio/Align/StatisticsI.pm BioPerl-1.6.923/Bio/Align/Utilities.pm BioPerl-1.6.923/Bio/AlignIO BioPerl-1.6.923/Bio/AlignIO/arp.pm BioPerl-1.6.923/Bio/AlignIO/bl2seq.pm BioPerl-1.6.923/Bio/AlignIO/clustalw.pm BioPerl-1.6.923/Bio/AlignIO/emboss.pm BioPerl-1.6.923/Bio/AlignIO/fasta.pm BioPerl-1.6.923/Bio/AlignIO/largemultifasta.pm BioPerl-1.6.923/Bio/AlignIO/maf.pm BioPerl-1.6.923/Bio/AlignIO/mase.pm BioPerl-1.6.923/Bio/AlignIO/mega.pm BioPerl-1.6.923/Bio/AlignIO/meme.pm BioPerl-1.6.923/Bio/AlignIO/metafasta.pm BioPerl-1.6.923/Bio/AlignIO/msf.pm BioPerl-1.6.923/Bio/AlignIO/nexml.pm BioPerl-1.6.923/Bio/AlignIO/nexus.pm BioPerl-1.6.923/Bio/AlignIO/pfam.pm BioPerl-1.6.923/Bio/AlignIO/phylip.pm BioPerl-1.6.923/Bio/AlignIO/po.pm BioPerl-1.6.923/Bio/AlignIO/proda.pm BioPerl-1.6.923/Bio/AlignIO/prodom.pm BioPerl-1.6.923/Bio/AlignIO/psi.pm BioPerl-1.6.923/Bio/AlignIO/selex.pm BioPerl-1.6.923/Bio/AlignIO/stockholm.pm BioPerl-1.6.923/Bio/AlignIO/xmfa.pm BioPerl-1.6.923/Bio/AlignIO/Handler BioPerl-1.6.923/Bio/AlignIO/Handler/GenericAlignHandler.pm BioPerl-1.6.923/Bio/Annotation BioPerl-1.6.923/Bio/Annotation/AnnotationFactory.pm BioPerl-1.6.923/Bio/Annotation/Collection.pm BioPerl-1.6.923/Bio/Annotation/Comment.pm BioPerl-1.6.923/Bio/Annotation/DBLink.pm BioPerl-1.6.923/Bio/Annotation/OntologyTerm.pm BioPerl-1.6.923/Bio/Annotation/Reference.pm BioPerl-1.6.923/Bio/Annotation/Relation.pm BioPerl-1.6.923/Bio/Annotation/SimpleValue.pm BioPerl-1.6.923/Bio/Annotation/StructuredValue.pm BioPerl-1.6.923/Bio/Annotation/TagTree.pm BioPerl-1.6.923/Bio/Annotation/Target.pm BioPerl-1.6.923/Bio/Annotation/Tree.pm BioPerl-1.6.923/Bio/Annotation/TypeManager.pm BioPerl-1.6.923/Bio/Assembly BioPerl-1.6.923/Bio/Assembly/Contig.pm BioPerl-1.6.923/Bio/Assembly/ContigAnalysis.pm BioPerl-1.6.923/Bio/Assembly/IO.pm BioPerl-1.6.923/Bio/Assembly/Scaffold.pm BioPerl-1.6.923/Bio/Assembly/ScaffoldI.pm BioPerl-1.6.923/Bio/Assembly/Singlet.pm BioPerl-1.6.923/Bio/Assembly/IO BioPerl-1.6.923/Bio/Assembly/IO/ace.pm BioPerl-1.6.923/Bio/Assembly/IO/bowtie.pm BioPerl-1.6.923/Bio/Assembly/IO/maq.pm BioPerl-1.6.923/Bio/Assembly/IO/phrap.pm BioPerl-1.6.923/Bio/Assembly/IO/sam.pm BioPerl-1.6.923/Bio/Assembly/IO/tigr.pm BioPerl-1.6.923/Bio/Assembly/Tools BioPerl-1.6.923/Bio/Assembly/Tools/ContigSpectrum.pm BioPerl-1.6.923/Bio/Cluster BioPerl-1.6.923/Bio/Cluster/ClusterFactory.pm BioPerl-1.6.923/Bio/Cluster/FamilyI.pm BioPerl-1.6.923/Bio/Cluster/SequenceFamily.pm BioPerl-1.6.923/Bio/Cluster/UniGene.pm BioPerl-1.6.923/Bio/Cluster/UniGeneI.pm BioPerl-1.6.923/Bio/ClusterIO BioPerl-1.6.923/Bio/ClusterIO/dbsnp.pm BioPerl-1.6.923/Bio/ClusterIO/unigene.pm BioPerl-1.6.923/Bio/CodonUsage BioPerl-1.6.923/Bio/CodonUsage/IO.pm BioPerl-1.6.923/Bio/CodonUsage/Table.pm BioPerl-1.6.923/Bio/Coordinate BioPerl-1.6.923/Bio/Coordinate/Chain.pm BioPerl-1.6.923/Bio/Coordinate/Collection.pm BioPerl-1.6.923/Bio/Coordinate/ExtrapolatingPair.pm BioPerl-1.6.923/Bio/Coordinate/GeneMapper.pm BioPerl-1.6.923/Bio/Coordinate/Graph.pm BioPerl-1.6.923/Bio/Coordinate/MapperI.pm BioPerl-1.6.923/Bio/Coordinate/Pair.pm BioPerl-1.6.923/Bio/Coordinate/Result.pm BioPerl-1.6.923/Bio/Coordinate/ResultI.pm BioPerl-1.6.923/Bio/Coordinate/Utils.pm BioPerl-1.6.923/Bio/Coordinate/Result BioPerl-1.6.923/Bio/Coordinate/Result/Gap.pm BioPerl-1.6.923/Bio/Coordinate/Result/Match.pm BioPerl-1.6.923/Bio/Das BioPerl-1.6.923/Bio/Das/FeatureTypeI.pm BioPerl-1.6.923/Bio/Das/SegmentI.pm BioPerl-1.6.923/Bio/DB BioPerl-1.6.923/Bio/DB/Ace.pm BioPerl-1.6.923/Bio/DB/BioFetch.pm BioPerl-1.6.923/Bio/DB/CUTG.pm BioPerl-1.6.923/Bio/DB/DBFetch.pm BioPerl-1.6.923/Bio/DB/EMBL.pm BioPerl-1.6.923/Bio/DB/EntrezGene.pm BioPerl-1.6.923/Bio/DB/Expression.pm BioPerl-1.6.923/Bio/DB/Failover.pm BioPerl-1.6.923/Bio/DB/Fasta.pm BioPerl-1.6.923/Bio/DB/FileCache.pm BioPerl-1.6.923/Bio/DB/Flat.pm BioPerl-1.6.923/Bio/DB/GenBank.pm BioPerl-1.6.923/Bio/DB/GenericWebAgent.pm BioPerl-1.6.923/Bio/DB/GenPept.pm BioPerl-1.6.923/Bio/DB/GFF.pm BioPerl-1.6.923/Bio/DB/HIV.pm BioPerl-1.6.923/Bio/DB/IndexedBase.pm BioPerl-1.6.923/Bio/DB/InMemoryCache.pm BioPerl-1.6.923/Bio/DB/LocationI.pm BioPerl-1.6.923/Bio/DB/MeSH.pm BioPerl-1.6.923/Bio/DB/NCBIHelper.pm BioPerl-1.6.923/Bio/DB/Qual.pm BioPerl-1.6.923/Bio/DB/QueryI.pm BioPerl-1.6.923/Bio/DB/RandomAccessI.pm BioPerl-1.6.923/Bio/DB/ReferenceI.pm BioPerl-1.6.923/Bio/DB/RefSeq.pm BioPerl-1.6.923/Bio/DB/Registry.pm BioPerl-1.6.923/Bio/DB/SeqFeature.pm BioPerl-1.6.923/Bio/DB/SeqHound.pm BioPerl-1.6.923/Bio/DB/SeqI.pm BioPerl-1.6.923/Bio/DB/SeqVersion.pm BioPerl-1.6.923/Bio/DB/SwissProt.pm BioPerl-1.6.923/Bio/DB/Taxonomy.pm BioPerl-1.6.923/Bio/DB/TFBS.pm BioPerl-1.6.923/Bio/DB/Universal.pm BioPerl-1.6.923/Bio/DB/UpdateableSeqI.pm BioPerl-1.6.923/Bio/DB/WebDBSeqI.pm BioPerl-1.6.923/Bio/DB/Expression BioPerl-1.6.923/Bio/DB/Expression/geo.pm BioPerl-1.6.923/Bio/DB/Flat BioPerl-1.6.923/Bio/DB/Flat/BDB.pm BioPerl-1.6.923/Bio/DB/Flat/BinarySearch.pm BioPerl-1.6.923/Bio/DB/Flat/BDB BioPerl-1.6.923/Bio/DB/Flat/BDB/embl.pm BioPerl-1.6.923/Bio/DB/Flat/BDB/fasta.pm BioPerl-1.6.923/Bio/DB/Flat/BDB/genbank.pm BioPerl-1.6.923/Bio/DB/Flat/BDB/swiss.pm BioPerl-1.6.923/Bio/DB/GFF BioPerl-1.6.923/Bio/DB/GFF/Aggregator.pm BioPerl-1.6.923/Bio/DB/GFF/Featname.pm BioPerl-1.6.923/Bio/DB/GFF/Feature.pm BioPerl-1.6.923/Bio/DB/GFF/Homol.pm BioPerl-1.6.923/Bio/DB/GFF/RelSegment.pm BioPerl-1.6.923/Bio/DB/GFF/Segment.pm BioPerl-1.6.923/Bio/DB/GFF/Typename.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor BioPerl-1.6.923/Bio/DB/GFF/Adaptor/ace.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/berkeleydb.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/biofetch.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/biofetch_oracle.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/berkeleydb BioPerl-1.6.923/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/iterator.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysql.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/oracle.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/oracleace.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/pg.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm BioPerl-1.6.923/Bio/DB/GFF/Adaptor/memory/iterator.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator BioPerl-1.6.923/Bio/DB/GFF/Aggregator/alignment.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/clone.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/coding.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/gene.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/match.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/none.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/orf.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/processed_transcript.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/so_transcript.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/transcript.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_acembly.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_genscan.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_refgene.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_softberry.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm BioPerl-1.6.923/Bio/DB/GFF/Aggregator/ucsc_unigene.pm BioPerl-1.6.923/Bio/DB/GFF/Util BioPerl-1.6.923/Bio/DB/GFF/Util/Binning.pm BioPerl-1.6.923/Bio/DB/GFF/Util/Rearrange.pm BioPerl-1.6.923/Bio/DB/HIV BioPerl-1.6.923/Bio/DB/HIV/HIVAnnotProcessor.pm BioPerl-1.6.923/Bio/DB/HIV/HIVQueryHelper.pm BioPerl-1.6.923/Bio/DB/HIV/lanl-schema.xml BioPerl-1.6.923/Bio/DB/Query BioPerl-1.6.923/Bio/DB/Query/GenBank.pm BioPerl-1.6.923/Bio/DB/Query/HIVQuery.pm BioPerl-1.6.923/Bio/DB/Query/WebQuery.pm BioPerl-1.6.923/Bio/DB/SeqFeature BioPerl-1.6.923/Bio/DB/SeqFeature/NormalizedFeature.pm BioPerl-1.6.923/Bio/DB/SeqFeature/NormalizedFeatureI.pm BioPerl-1.6.923/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Segment.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store BioPerl-1.6.923/Bio/DB/SeqFeature/Store/bdb.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/berkeleydb.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/berkeleydb3.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/GFF2Loader.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/GFF3Loader.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/Loader.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/LoadHelper.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/memory.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/Iterator.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/mysql.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/Pg.pm BioPerl-1.6.923/Bio/DB/SeqFeature/Store/DBI/SQLite.pm BioPerl-1.6.923/Bio/DB/SeqVersion BioPerl-1.6.923/Bio/DB/SeqVersion/gi.pm BioPerl-1.6.923/Bio/DB/Taxonomy BioPerl-1.6.923/Bio/DB/Taxonomy/entrez.pm BioPerl-1.6.923/Bio/DB/Taxonomy/flatfile.pm BioPerl-1.6.923/Bio/DB/Taxonomy/greengenes.pm BioPerl-1.6.923/Bio/DB/Taxonomy/list.pm BioPerl-1.6.923/Bio/DB/Taxonomy/silva.pm BioPerl-1.6.923/Bio/DB/TFBS BioPerl-1.6.923/Bio/DB/TFBS/transfac_pro.pm BioPerl-1.6.923/Bio/Draw BioPerl-1.6.923/Bio/Draw/Pictogram.pm BioPerl-1.6.923/Bio/Event BioPerl-1.6.923/Bio/Event/EventGeneratorI.pm BioPerl-1.6.923/Bio/Event/EventHandlerI.pm BioPerl-1.6.923/Bio/Factory BioPerl-1.6.923/Bio/Factory/AnalysisI.pm BioPerl-1.6.923/Bio/Factory/ApplicationFactoryI.pm BioPerl-1.6.923/Bio/Factory/DriverFactory.pm BioPerl-1.6.923/Bio/Factory/FTLocationFactory.pm BioPerl-1.6.923/Bio/Factory/LocationFactoryI.pm BioPerl-1.6.923/Bio/Factory/MapFactoryI.pm BioPerl-1.6.923/Bio/Factory/ObjectBuilderI.pm BioPerl-1.6.923/Bio/Factory/ObjectFactory.pm BioPerl-1.6.923/Bio/Factory/ObjectFactoryI.pm BioPerl-1.6.923/Bio/Factory/SeqAnalysisParserFactory.pm BioPerl-1.6.923/Bio/Factory/SeqAnalysisParserFactoryI.pm BioPerl-1.6.923/Bio/Factory/SequenceFactoryI.pm BioPerl-1.6.923/Bio/Factory/SequenceProcessorI.pm BioPerl-1.6.923/Bio/Factory/SequenceStreamI.pm BioPerl-1.6.923/Bio/Factory/TreeFactoryI.pm BioPerl-1.6.923/Bio/Index BioPerl-1.6.923/Bio/Index/Abstract.pm BioPerl-1.6.923/Bio/Index/AbstractSeq.pm BioPerl-1.6.923/Bio/Index/Blast.pm BioPerl-1.6.923/Bio/Index/BlastTable.pm BioPerl-1.6.923/Bio/Index/EMBL.pm BioPerl-1.6.923/Bio/Index/Fasta.pm BioPerl-1.6.923/Bio/Index/Fastq.pm BioPerl-1.6.923/Bio/Index/GenBank.pm BioPerl-1.6.923/Bio/Index/Hmmer.pm BioPerl-1.6.923/Bio/Index/Qual.pm BioPerl-1.6.923/Bio/Index/Stockholm.pm BioPerl-1.6.923/Bio/Index/SwissPfam.pm BioPerl-1.6.923/Bio/Index/Swissprot.pm BioPerl-1.6.923/Bio/LiveSeq BioPerl-1.6.923/Bio/LiveSeq/AARange.pm BioPerl-1.6.923/Bio/LiveSeq/Chain.pm BioPerl-1.6.923/Bio/LiveSeq/ChainI.pm BioPerl-1.6.923/Bio/LiveSeq/DNA.pm BioPerl-1.6.923/Bio/LiveSeq/Exon.pm BioPerl-1.6.923/Bio/LiveSeq/Gene.pm BioPerl-1.6.923/Bio/LiveSeq/Intron.pm BioPerl-1.6.923/Bio/LiveSeq/Mutation.pm BioPerl-1.6.923/Bio/LiveSeq/Mutator.pm BioPerl-1.6.923/Bio/LiveSeq/Prim_Transcript.pm BioPerl-1.6.923/Bio/LiveSeq/Range.pm BioPerl-1.6.923/Bio/LiveSeq/Repeat_Region.pm BioPerl-1.6.923/Bio/LiveSeq/Repeat_Unit.pm BioPerl-1.6.923/Bio/LiveSeq/SeqI.pm BioPerl-1.6.923/Bio/LiveSeq/Transcript.pm BioPerl-1.6.923/Bio/LiveSeq/Translation.pm BioPerl-1.6.923/Bio/LiveSeq/IO BioPerl-1.6.923/Bio/LiveSeq/IO/BioPerl.pm BioPerl-1.6.923/Bio/LiveSeq/IO/Loader.pm BioPerl-1.6.923/Bio/LiveSeq/IO/README BioPerl-1.6.923/Bio/Location BioPerl-1.6.923/Bio/Location/Atomic.pm BioPerl-1.6.923/Bio/Location/AvWithinCoordPolicy.pm BioPerl-1.6.923/Bio/Location/CoordinatePolicyI.pm BioPerl-1.6.923/Bio/Location/Fuzzy.pm BioPerl-1.6.923/Bio/Location/FuzzyLocationI.pm BioPerl-1.6.923/Bio/Location/NarrowestCoordPolicy.pm BioPerl-1.6.923/Bio/Location/Simple.pm BioPerl-1.6.923/Bio/Location/Split.pm BioPerl-1.6.923/Bio/Location/SplitLocationI.pm BioPerl-1.6.923/Bio/Location/WidestCoordPolicy.pm BioPerl-1.6.923/Bio/Map BioPerl-1.6.923/Bio/Map/Clone.pm BioPerl-1.6.923/Bio/Map/Contig.pm BioPerl-1.6.923/Bio/Map/CytoMap.pm BioPerl-1.6.923/Bio/Map/CytoMarker.pm BioPerl-1.6.923/Bio/Map/CytoPosition.pm BioPerl-1.6.923/Bio/Map/EntityI.pm BioPerl-1.6.923/Bio/Map/FPCMarker.pm BioPerl-1.6.923/Bio/Map/Gene.pm BioPerl-1.6.923/Bio/Map/GeneMap.pm BioPerl-1.6.923/Bio/Map/GenePosition.pm BioPerl-1.6.923/Bio/Map/GeneRelative.pm BioPerl-1.6.923/Bio/Map/LinkageMap.pm BioPerl-1.6.923/Bio/Map/LinkagePosition.pm BioPerl-1.6.923/Bio/Map/MapI.pm BioPerl-1.6.923/Bio/Map/Mappable.pm BioPerl-1.6.923/Bio/Map/MappableI.pm BioPerl-1.6.923/Bio/Map/Marker.pm BioPerl-1.6.923/Bio/Map/MarkerI.pm BioPerl-1.6.923/Bio/Map/Microsatellite.pm BioPerl-1.6.923/Bio/Map/OrderedPosition.pm BioPerl-1.6.923/Bio/Map/OrderedPositionWithDistance.pm BioPerl-1.6.923/Bio/Map/Physical.pm BioPerl-1.6.923/Bio/Map/Position.pm BioPerl-1.6.923/Bio/Map/PositionHandler.pm BioPerl-1.6.923/Bio/Map/PositionHandlerI.pm BioPerl-1.6.923/Bio/Map/PositionI.pm BioPerl-1.6.923/Bio/Map/PositionWithSequence.pm BioPerl-1.6.923/Bio/Map/Prediction.pm BioPerl-1.6.923/Bio/Map/Relative.pm BioPerl-1.6.923/Bio/Map/RelativeI.pm BioPerl-1.6.923/Bio/Map/SimpleMap.pm BioPerl-1.6.923/Bio/Map/TranscriptionFactor.pm BioPerl-1.6.923/Bio/MapIO BioPerl-1.6.923/Bio/MapIO/fpc.pm BioPerl-1.6.923/Bio/MapIO/mapmaker.pm BioPerl-1.6.923/Bio/Matrix BioPerl-1.6.923/Bio/Matrix/Generic.pm BioPerl-1.6.923/Bio/Matrix/IO.pm BioPerl-1.6.923/Bio/Matrix/MatrixI.pm BioPerl-1.6.923/Bio/Matrix/Mlagan.pm BioPerl-1.6.923/Bio/Matrix/PhylipDist.pm BioPerl-1.6.923/Bio/Matrix/Scoring.pm BioPerl-1.6.923/Bio/Matrix/IO BioPerl-1.6.923/Bio/Matrix/IO/mlagan.pm BioPerl-1.6.923/Bio/Matrix/IO/phylip.pm BioPerl-1.6.923/Bio/Matrix/IO/scoring.pm BioPerl-1.6.923/Bio/Matrix/PSM BioPerl-1.6.923/Bio/Matrix/PSM/InstanceSite.pm BioPerl-1.6.923/Bio/Matrix/PSM/InstanceSiteI.pm BioPerl-1.6.923/Bio/Matrix/PSM/IO.pm BioPerl-1.6.923/Bio/Matrix/PSM/ProtMatrix.pm BioPerl-1.6.923/Bio/Matrix/PSM/ProtPsm.pm BioPerl-1.6.923/Bio/Matrix/PSM/Psm.pm BioPerl-1.6.923/Bio/Matrix/PSM/PsmHeader.pm BioPerl-1.6.923/Bio/Matrix/PSM/PsmHeaderI.pm BioPerl-1.6.923/Bio/Matrix/PSM/PsmI.pm BioPerl-1.6.923/Bio/Matrix/PSM/SiteMatrix.pm BioPerl-1.6.923/Bio/Matrix/PSM/SiteMatrixI.pm BioPerl-1.6.923/Bio/Matrix/PSM/IO BioPerl-1.6.923/Bio/Matrix/PSM/IO/mast.pm BioPerl-1.6.923/Bio/Matrix/PSM/IO/masta.pm BioPerl-1.6.923/Bio/Matrix/PSM/IO/meme.pm BioPerl-1.6.923/Bio/Matrix/PSM/IO/psiblast.pm BioPerl-1.6.923/Bio/Matrix/PSM/IO/transfac.pm BioPerl-1.6.923/Bio/MolEvol BioPerl-1.6.923/Bio/MolEvol/CodonModel.pm BioPerl-1.6.923/Bio/Nexml BioPerl-1.6.923/Bio/Nexml/Factory.pm BioPerl-1.6.923/Bio/Ontology BioPerl-1.6.923/Bio/Ontology/DocumentRegistry.pm BioPerl-1.6.923/Bio/Ontology/GOterm.pm BioPerl-1.6.923/Bio/Ontology/InterProTerm.pm BioPerl-1.6.923/Bio/Ontology/OBOEngine.pm BioPerl-1.6.923/Bio/Ontology/OBOterm.pm BioPerl-1.6.923/Bio/Ontology/Ontology.pm BioPerl-1.6.923/Bio/Ontology/OntologyEngineI.pm BioPerl-1.6.923/Bio/Ontology/OntologyI.pm BioPerl-1.6.923/Bio/Ontology/OntologyStore.pm BioPerl-1.6.923/Bio/Ontology/Path.pm BioPerl-1.6.923/Bio/Ontology/PathI.pm BioPerl-1.6.923/Bio/Ontology/Relationship.pm BioPerl-1.6.923/Bio/Ontology/RelationshipFactory.pm BioPerl-1.6.923/Bio/Ontology/RelationshipI.pm BioPerl-1.6.923/Bio/Ontology/RelationshipType.pm BioPerl-1.6.923/Bio/Ontology/SimpleOntologyEngine.pm BioPerl-1.6.923/Bio/Ontology/Term.pm BioPerl-1.6.923/Bio/Ontology/TermFactory.pm BioPerl-1.6.923/Bio/Ontology/TermI.pm BioPerl-1.6.923/Bio/Ontology/SimpleGOEngine BioPerl-1.6.923/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm BioPerl-1.6.923/Bio/OntologyIO BioPerl-1.6.923/Bio/OntologyIO/dagflat.pm BioPerl-1.6.923/Bio/OntologyIO/goflat.pm BioPerl-1.6.923/Bio/OntologyIO/InterProParser.pm BioPerl-1.6.923/Bio/OntologyIO/obo.pm BioPerl-1.6.923/Bio/OntologyIO/simplehierarchy.pm BioPerl-1.6.923/Bio/OntologyIO/soflat.pm BioPerl-1.6.923/Bio/OntologyIO/Handlers BioPerl-1.6.923/Bio/OntologyIO/Handlers/BaseSAXHandler.pm BioPerl-1.6.923/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm BioPerl-1.6.923/Bio/OntologyIO/Handlers/InterProHandler.pm BioPerl-1.6.923/Bio/Phenotype BioPerl-1.6.923/Bio/Phenotype/Correlate.pm BioPerl-1.6.923/Bio/Phenotype/Measure.pm BioPerl-1.6.923/Bio/Phenotype/Phenotype.pm BioPerl-1.6.923/Bio/Phenotype/PhenotypeI.pm BioPerl-1.6.923/Bio/Phenotype/MeSH BioPerl-1.6.923/Bio/Phenotype/MeSH/Term.pm BioPerl-1.6.923/Bio/Phenotype/MeSH/Twig.pm BioPerl-1.6.923/Bio/Phenotype/OMIM BioPerl-1.6.923/Bio/Phenotype/OMIM/MiniMIMentry.pm BioPerl-1.6.923/Bio/Phenotype/OMIM/OMIMentry.pm BioPerl-1.6.923/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm BioPerl-1.6.923/Bio/Phenotype/OMIM/OMIMparser.pm BioPerl-1.6.923/Bio/PhyloNetwork BioPerl-1.6.923/Bio/PhyloNetwork/Factory.pm BioPerl-1.6.923/Bio/PhyloNetwork/FactoryX.pm BioPerl-1.6.923/Bio/PhyloNetwork/GraphViz.pm BioPerl-1.6.923/Bio/PhyloNetwork/muVector.pm BioPerl-1.6.923/Bio/PhyloNetwork/RandomFactory.pm BioPerl-1.6.923/Bio/PhyloNetwork/TreeFactory.pm BioPerl-1.6.923/Bio/PhyloNetwork/TreeFactoryMulti.pm BioPerl-1.6.923/Bio/PhyloNetwork/TreeFactoryX.pm BioPerl-1.6.923/Bio/PopGen BioPerl-1.6.923/Bio/PopGen/Genotype.pm BioPerl-1.6.923/Bio/PopGen/GenotypeI.pm BioPerl-1.6.923/Bio/PopGen/HtSNP.pm BioPerl-1.6.923/Bio/PopGen/Individual.pm BioPerl-1.6.923/Bio/PopGen/IndividualI.pm BioPerl-1.6.923/Bio/PopGen/IO.pm BioPerl-1.6.923/Bio/PopGen/Marker.pm BioPerl-1.6.923/Bio/PopGen/MarkerI.pm BioPerl-1.6.923/Bio/PopGen/PopStats.pm BioPerl-1.6.923/Bio/PopGen/Population.pm BioPerl-1.6.923/Bio/PopGen/PopulationI.pm BioPerl-1.6.923/Bio/PopGen/Statistics.pm BioPerl-1.6.923/Bio/PopGen/TagHaplotype.pm BioPerl-1.6.923/Bio/PopGen/Utilities.pm BioPerl-1.6.923/Bio/PopGen/IO BioPerl-1.6.923/Bio/PopGen/IO/csv.pm BioPerl-1.6.923/Bio/PopGen/IO/hapmap.pm BioPerl-1.6.923/Bio/PopGen/IO/phase.pm BioPerl-1.6.923/Bio/PopGen/IO/prettybase.pm BioPerl-1.6.923/Bio/PopGen/Simulation BioPerl-1.6.923/Bio/PopGen/Simulation/Coalescent.pm BioPerl-1.6.923/Bio/PopGen/Simulation/GeneticDrift.pm BioPerl-1.6.923/Bio/Restriction BioPerl-1.6.923/Bio/Restriction/Analysis.pm BioPerl-1.6.923/Bio/Restriction/Enzyme.pm BioPerl-1.6.923/Bio/Restriction/EnzymeCollection.pm BioPerl-1.6.923/Bio/Restriction/EnzymeI.pm BioPerl-1.6.923/Bio/Restriction/IO.pm BioPerl-1.6.923/Bio/Restriction/Enzyme BioPerl-1.6.923/Bio/Restriction/Enzyme/MultiCut.pm BioPerl-1.6.923/Bio/Restriction/Enzyme/MultiSite.pm BioPerl-1.6.923/Bio/Restriction/IO BioPerl-1.6.923/Bio/Restriction/IO/bairoch.pm BioPerl-1.6.923/Bio/Restriction/IO/base.pm BioPerl-1.6.923/Bio/Restriction/IO/itype2.pm BioPerl-1.6.923/Bio/Restriction/IO/prototype.pm BioPerl-1.6.923/Bio/Restriction/IO/withrefm.pm BioPerl-1.6.923/Bio/Root BioPerl-1.6.923/Bio/Root/Build.pm BioPerl-1.6.923/Bio/Root/Exception.pm BioPerl-1.6.923/Bio/Root/HTTPget.pm BioPerl-1.6.923/Bio/Root/IO.pm BioPerl-1.6.923/Bio/Root/Root.pm BioPerl-1.6.923/Bio/Root/RootI.pm BioPerl-1.6.923/Bio/Root/Storable.pm BioPerl-1.6.923/Bio/Root/Test.pm BioPerl-1.6.923/Bio/Root/Utilities.pm BioPerl-1.6.923/Bio/Root/Version.pm BioPerl-1.6.923/Bio/Search BioPerl-1.6.923/Bio/Search/BlastStatistics.pm BioPerl-1.6.923/Bio/Search/BlastUtils.pm BioPerl-1.6.923/Bio/Search/DatabaseI.pm BioPerl-1.6.923/Bio/Search/GenericDatabase.pm BioPerl-1.6.923/Bio/Search/GenericStatistics.pm BioPerl-1.6.923/Bio/Search/Processor.pm BioPerl-1.6.923/Bio/Search/SearchUtils.pm BioPerl-1.6.923/Bio/Search/StatisticsI.pm BioPerl-1.6.923/Bio/Search/Hit BioPerl-1.6.923/Bio/Search/Hit/BlastHit.pm BioPerl-1.6.923/Bio/Search/Hit/BlastPullHit.pm BioPerl-1.6.923/Bio/Search/Hit/Fasta.pm BioPerl-1.6.923/Bio/Search/Hit/GenericHit.pm BioPerl-1.6.923/Bio/Search/Hit/HitFactory.pm BioPerl-1.6.923/Bio/Search/Hit/HitI.pm BioPerl-1.6.923/Bio/Search/Hit/hmmer3Hit.pm BioPerl-1.6.923/Bio/Search/Hit/HMMERHit.pm BioPerl-1.6.923/Bio/Search/Hit/HmmpfamHit.pm BioPerl-1.6.923/Bio/Search/Hit/ModelHit.pm BioPerl-1.6.923/Bio/Search/Hit/PsiBlastHit.pm BioPerl-1.6.923/Bio/Search/Hit/PullHitI.pm BioPerl-1.6.923/Bio/Search/HSP BioPerl-1.6.923/Bio/Search/HSP/BlastHSP.pm BioPerl-1.6.923/Bio/Search/HSP/BlastPullHSP.pm BioPerl-1.6.923/Bio/Search/HSP/FastaHSP.pm BioPerl-1.6.923/Bio/Search/HSP/GenericHSP.pm BioPerl-1.6.923/Bio/Search/HSP/HMMERHSP.pm BioPerl-1.6.923/Bio/Search/HSP/HmmpfamHSP.pm BioPerl-1.6.923/Bio/Search/HSP/HSPFactory.pm BioPerl-1.6.923/Bio/Search/HSP/HSPI.pm BioPerl-1.6.923/Bio/Search/HSP/ModelHSP.pm BioPerl-1.6.923/Bio/Search/HSP/PsiBlastHSP.pm BioPerl-1.6.923/Bio/Search/HSP/PSLHSP.pm BioPerl-1.6.923/Bio/Search/HSP/PullHSPI.pm BioPerl-1.6.923/Bio/Search/HSP/WABAHSP.pm BioPerl-1.6.923/Bio/Search/Iteration BioPerl-1.6.923/Bio/Search/Iteration/GenericIteration.pm BioPerl-1.6.923/Bio/Search/Iteration/IterationI.pm BioPerl-1.6.923/Bio/Search/Result BioPerl-1.6.923/Bio/Search/Result/BlastPullResult.pm BioPerl-1.6.923/Bio/Search/Result/BlastResult.pm BioPerl-1.6.923/Bio/Search/Result/CrossMatchResult.pm BioPerl-1.6.923/Bio/Search/Result/GenericResult.pm BioPerl-1.6.923/Bio/Search/Result/hmmer3Result.pm BioPerl-1.6.923/Bio/Search/Result/HMMERResult.pm BioPerl-1.6.923/Bio/Search/Result/HmmpfamResult.pm BioPerl-1.6.923/Bio/Search/Result/PullResultI.pm BioPerl-1.6.923/Bio/Search/Result/ResultFactory.pm BioPerl-1.6.923/Bio/Search/Result/ResultI.pm BioPerl-1.6.923/Bio/Search/Result/WABAResult.pm BioPerl-1.6.923/Bio/Search/Tiling BioPerl-1.6.923/Bio/Search/Tiling/MapTileUtils.pm BioPerl-1.6.923/Bio/Search/Tiling/MapTiling.pm BioPerl-1.6.923/Bio/Search/Tiling/TilingI.pm BioPerl-1.6.923/Bio/SearchIO BioPerl-1.6.923/Bio/SearchIO/axt.pm BioPerl-1.6.923/Bio/SearchIO/blast.pm BioPerl-1.6.923/Bio/SearchIO/blast_pull.pm BioPerl-1.6.923/Bio/SearchIO/blasttable.pm BioPerl-1.6.923/Bio/SearchIO/blastxml.pm BioPerl-1.6.923/Bio/SearchIO/cross_match.pm BioPerl-1.6.923/Bio/SearchIO/erpin.pm BioPerl-1.6.923/Bio/SearchIO/EventHandlerI.pm BioPerl-1.6.923/Bio/SearchIO/exonerate.pm BioPerl-1.6.923/Bio/SearchIO/fasta.pm BioPerl-1.6.923/Bio/SearchIO/FastHitEventBuilder.pm BioPerl-1.6.923/Bio/SearchIO/gmap_f9.pm BioPerl-1.6.923/Bio/SearchIO/hmmer.pm BioPerl-1.6.923/Bio/SearchIO/hmmer2.pm BioPerl-1.6.923/Bio/SearchIO/hmmer3.pm BioPerl-1.6.923/Bio/SearchIO/hmmer_pull.pm BioPerl-1.6.923/Bio/SearchIO/infernal.pm BioPerl-1.6.923/Bio/SearchIO/IteratedSearchResultEventBuilder.pm BioPerl-1.6.923/Bio/SearchIO/megablast.pm BioPerl-1.6.923/Bio/SearchIO/psl.pm BioPerl-1.6.923/Bio/SearchIO/rnamotif.pm BioPerl-1.6.923/Bio/SearchIO/SearchResultEventBuilder.pm BioPerl-1.6.923/Bio/SearchIO/SearchWriterI.pm BioPerl-1.6.923/Bio/SearchIO/sim4.pm BioPerl-1.6.923/Bio/SearchIO/waba.pm BioPerl-1.6.923/Bio/SearchIO/wise.pm BioPerl-1.6.923/Bio/SearchIO/Writer BioPerl-1.6.923/Bio/SearchIO/Writer/BSMLResultWriter.pm BioPerl-1.6.923/Bio/SearchIO/Writer/GbrowseGFF.pm BioPerl-1.6.923/Bio/SearchIO/Writer/HitTableWriter.pm BioPerl-1.6.923/Bio/SearchIO/Writer/HSPTableWriter.pm BioPerl-1.6.923/Bio/SearchIO/Writer/HTMLResultWriter.pm BioPerl-1.6.923/Bio/SearchIO/Writer/ResultTableWriter.pm BioPerl-1.6.923/Bio/SearchIO/Writer/TextResultWriter.pm BioPerl-1.6.923/Bio/SearchIO/XML BioPerl-1.6.923/Bio/SearchIO/XML/BlastHandler.pm BioPerl-1.6.923/Bio/SearchIO/XML/PsiBlastHandler.pm BioPerl-1.6.923/Bio/Seq BioPerl-1.6.923/Bio/Seq/BaseSeqProcessor.pm BioPerl-1.6.923/Bio/Seq/EncodedSeq.pm BioPerl-1.6.923/Bio/Seq/LargeLocatableSeq.pm BioPerl-1.6.923/Bio/Seq/LargePrimarySeq.pm BioPerl-1.6.923/Bio/Seq/LargeSeq.pm BioPerl-1.6.923/Bio/Seq/LargeSeqI.pm BioPerl-1.6.923/Bio/Seq/Meta.pm BioPerl-1.6.923/Bio/Seq/MetaI.pm BioPerl-1.6.923/Bio/Seq/PrimaryQual.pm BioPerl-1.6.923/Bio/Seq/PrimedSeq.pm BioPerl-1.6.923/Bio/Seq/QualI.pm BioPerl-1.6.923/Bio/Seq/Quality.pm BioPerl-1.6.923/Bio/Seq/RichSeq.pm BioPerl-1.6.923/Bio/Seq/RichSeqI.pm BioPerl-1.6.923/Bio/Seq/SeqBuilder.pm BioPerl-1.6.923/Bio/Seq/SeqFactory.pm BioPerl-1.6.923/Bio/Seq/SeqFastaSpeedFactory.pm BioPerl-1.6.923/Bio/Seq/SequenceTrace.pm BioPerl-1.6.923/Bio/Seq/SeqWithQuality.pm BioPerl-1.6.923/Bio/Seq/SimulatedRead.pm BioPerl-1.6.923/Bio/Seq/TraceI.pm BioPerl-1.6.923/Bio/Seq/Meta BioPerl-1.6.923/Bio/Seq/Meta/Array.pm BioPerl-1.6.923/Bio/SeqEvolution BioPerl-1.6.923/Bio/SeqEvolution/DNAPoint.pm BioPerl-1.6.923/Bio/SeqEvolution/EvolutionI.pm BioPerl-1.6.923/Bio/SeqEvolution/Factory.pm BioPerl-1.6.923/Bio/SeqFeature BioPerl-1.6.923/Bio/SeqFeature/Amplicon.pm BioPerl-1.6.923/Bio/SeqFeature/AnnotationAdaptor.pm BioPerl-1.6.923/Bio/SeqFeature/Collection.pm BioPerl-1.6.923/Bio/SeqFeature/CollectionI.pm BioPerl-1.6.923/Bio/SeqFeature/Computation.pm BioPerl-1.6.923/Bio/SeqFeature/FeaturePair.pm BioPerl-1.6.923/Bio/SeqFeature/Generic.pm BioPerl-1.6.923/Bio/SeqFeature/Lite.pm BioPerl-1.6.923/Bio/SeqFeature/PositionProxy.pm BioPerl-1.6.923/Bio/SeqFeature/Primer.pm BioPerl-1.6.923/Bio/SeqFeature/Similarity.pm BioPerl-1.6.923/Bio/SeqFeature/SimilarityPair.pm BioPerl-1.6.923/Bio/SeqFeature/SubSeq.pm BioPerl-1.6.923/Bio/SeqFeature/TypedSeqFeatureI.pm BioPerl-1.6.923/Bio/SeqFeature/Gene BioPerl-1.6.923/Bio/SeqFeature/Gene/Exon.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/ExonI.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/GeneStructure.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/GeneStructureI.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/Intron.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/NC_Feature.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/Poly_A_site.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/Promoter.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/Transcript.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/TranscriptI.pm BioPerl-1.6.923/Bio/SeqFeature/Gene/UTR.pm BioPerl-1.6.923/Bio/SeqFeature/SiRNA BioPerl-1.6.923/Bio/SeqFeature/SiRNA/Oligo.pm BioPerl-1.6.923/Bio/SeqFeature/SiRNA/Pair.pm BioPerl-1.6.923/Bio/SeqFeature/Tools BioPerl-1.6.923/Bio/SeqFeature/Tools/FeatureNamer.pm BioPerl-1.6.923/Bio/SeqFeature/Tools/IDHandler.pm BioPerl-1.6.923/Bio/SeqFeature/Tools/TypeMapper.pm BioPerl-1.6.923/Bio/SeqFeature/Tools/Unflattener.pm BioPerl-1.6.923/Bio/SeqIO BioPerl-1.6.923/Bio/SeqIO/abi.pm BioPerl-1.6.923/Bio/SeqIO/ace.pm BioPerl-1.6.923/Bio/SeqIO/agave.pm BioPerl-1.6.923/Bio/SeqIO/alf.pm BioPerl-1.6.923/Bio/SeqIO/asciitree.pm BioPerl-1.6.923/Bio/SeqIO/bsml.pm BioPerl-1.6.923/Bio/SeqIO/bsml_sax.pm BioPerl-1.6.923/Bio/SeqIO/chadoxml.pm BioPerl-1.6.923/Bio/SeqIO/chaos.pm BioPerl-1.6.923/Bio/SeqIO/chaosxml.pm BioPerl-1.6.923/Bio/SeqIO/ctf.pm BioPerl-1.6.923/Bio/SeqIO/embl.pm BioPerl-1.6.923/Bio/SeqIO/embldriver.pm BioPerl-1.6.923/Bio/SeqIO/entrezgene.pm BioPerl-1.6.923/Bio/SeqIO/excel.pm BioPerl-1.6.923/Bio/SeqIO/exp.pm BioPerl-1.6.923/Bio/SeqIO/fasta.pm BioPerl-1.6.923/Bio/SeqIO/fastq.pm BioPerl-1.6.923/Bio/SeqIO/flybase_chadoxml.pm BioPerl-1.6.923/Bio/SeqIO/FTHelper.pm BioPerl-1.6.923/Bio/SeqIO/game.pm BioPerl-1.6.923/Bio/SeqIO/gbdriver.pm BioPerl-1.6.923/Bio/SeqIO/gbxml.pm BioPerl-1.6.923/Bio/SeqIO/gcg.pm BioPerl-1.6.923/Bio/SeqIO/genbank.pm BioPerl-1.6.923/Bio/SeqIO/interpro.pm BioPerl-1.6.923/Bio/SeqIO/kegg.pm BioPerl-1.6.923/Bio/SeqIO/largefasta.pm BioPerl-1.6.923/Bio/SeqIO/lasergene.pm BioPerl-1.6.923/Bio/SeqIO/locuslink.pm BioPerl-1.6.923/Bio/SeqIO/mbsout.pm BioPerl-1.6.923/Bio/SeqIO/metafasta.pm BioPerl-1.6.923/Bio/SeqIO/msout.pm BioPerl-1.6.923/Bio/SeqIO/MultiFile.pm BioPerl-1.6.923/Bio/SeqIO/nexml.pm BioPerl-1.6.923/Bio/SeqIO/phd.pm BioPerl-1.6.923/Bio/SeqIO/pir.pm BioPerl-1.6.923/Bio/SeqIO/pln.pm BioPerl-1.6.923/Bio/SeqIO/qual.pm BioPerl-1.6.923/Bio/SeqIO/raw.pm BioPerl-1.6.923/Bio/SeqIO/scf.pm BioPerl-1.6.923/Bio/SeqIO/seqxml.pm BioPerl-1.6.923/Bio/SeqIO/strider.pm BioPerl-1.6.923/Bio/SeqIO/swiss.pm BioPerl-1.6.923/Bio/SeqIO/swissdriver.pm BioPerl-1.6.923/Bio/SeqIO/tab.pm BioPerl-1.6.923/Bio/SeqIO/table.pm BioPerl-1.6.923/Bio/SeqIO/tigr.pm BioPerl-1.6.923/Bio/SeqIO/tigrxml.pm BioPerl-1.6.923/Bio/SeqIO/tinyseq.pm BioPerl-1.6.923/Bio/SeqIO/ztr.pm BioPerl-1.6.923/Bio/SeqIO/game BioPerl-1.6.923/Bio/SeqIO/game/featHandler.pm BioPerl-1.6.923/Bio/SeqIO/game/gameHandler.pm BioPerl-1.6.923/Bio/SeqIO/game/gameSubs.pm BioPerl-1.6.923/Bio/SeqIO/game/gameWriter.pm BioPerl-1.6.923/Bio/SeqIO/game/seqHandler.pm BioPerl-1.6.923/Bio/SeqIO/Handler BioPerl-1.6.923/Bio/SeqIO/Handler/GenericRichSeqHandler.pm BioPerl-1.6.923/Bio/SeqIO/tinyseq BioPerl-1.6.923/Bio/SeqIO/tinyseq/tinyseqHandler.pm BioPerl-1.6.923/Bio/Structure BioPerl-1.6.923/Bio/Structure/Atom.pm BioPerl-1.6.923/Bio/Structure/Chain.pm BioPerl-1.6.923/Bio/Structure/Entry.pm BioPerl-1.6.923/Bio/Structure/IO.pm BioPerl-1.6.923/Bio/Structure/Model.pm BioPerl-1.6.923/Bio/Structure/Residue.pm BioPerl-1.6.923/Bio/Structure/StructureI.pm BioPerl-1.6.923/Bio/Structure/IO BioPerl-1.6.923/Bio/Structure/IO/pdb.pm BioPerl-1.6.923/Bio/Structure/SecStr BioPerl-1.6.923/Bio/Structure/SecStr/DSSP BioPerl-1.6.923/Bio/Structure/SecStr/DSSP/Res.pm BioPerl-1.6.923/Bio/Structure/SecStr/STRIDE BioPerl-1.6.923/Bio/Structure/SecStr/STRIDE/Res.pm BioPerl-1.6.923/Bio/Symbol BioPerl-1.6.923/Bio/Symbol/Alphabet.pm BioPerl-1.6.923/Bio/Symbol/AlphabetI.pm BioPerl-1.6.923/Bio/Symbol/DNAAlphabet.pm BioPerl-1.6.923/Bio/Symbol/ProteinAlphabet.pm BioPerl-1.6.923/Bio/Symbol/README.Symbol BioPerl-1.6.923/Bio/Symbol/Symbol.pm BioPerl-1.6.923/Bio/Symbol/SymbolI.pm BioPerl-1.6.923/Bio/Taxonomy BioPerl-1.6.923/Bio/Taxonomy/FactoryI.pm BioPerl-1.6.923/Bio/Taxonomy/Node.pm BioPerl-1.6.923/Bio/Taxonomy/Taxon.pm BioPerl-1.6.923/Bio/Taxonomy/Tree.pm BioPerl-1.6.923/Bio/Tools BioPerl-1.6.923/Bio/Tools/AlignFactory.pm BioPerl-1.6.923/Bio/Tools/AmpliconSearch.pm BioPerl-1.6.923/Bio/Tools/AnalysisResult.pm BioPerl-1.6.923/Bio/Tools/Blat.pm BioPerl-1.6.923/Bio/Tools/CodonTable.pm BioPerl-1.6.923/Bio/Tools/Coil.pm BioPerl-1.6.923/Bio/Tools/dpAlign.pm BioPerl-1.6.923/Bio/Tools/ECnumber.pm BioPerl-1.6.923/Bio/Tools/EPCR.pm BioPerl-1.6.923/Bio/Tools/Eponine.pm BioPerl-1.6.923/Bio/Tools/ERPIN.pm BioPerl-1.6.923/Bio/Tools/Est2Genome.pm BioPerl-1.6.923/Bio/Tools/ESTScan.pm BioPerl-1.6.923/Bio/Tools/Fgenesh.pm BioPerl-1.6.923/Bio/Tools/FootPrinter.pm BioPerl-1.6.923/Bio/Tools/Gel.pm BioPerl-1.6.923/Bio/Tools/Geneid.pm BioPerl-1.6.923/Bio/Tools/Genemark.pm BioPerl-1.6.923/Bio/Tools/Genewise.pm BioPerl-1.6.923/Bio/Tools/Genomewise.pm BioPerl-1.6.923/Bio/Tools/Genscan.pm BioPerl-1.6.923/Bio/Tools/GFF.pm BioPerl-1.6.923/Bio/Tools/Glimmer.pm BioPerl-1.6.923/Bio/Tools/Grail.pm BioPerl-1.6.923/Bio/Tools/GuessSeqFormat.pm BioPerl-1.6.923/Bio/Tools/Hmmpfam.pm BioPerl-1.6.923/Bio/Tools/Infernal.pm BioPerl-1.6.923/Bio/Tools/ipcress.pm BioPerl-1.6.923/Bio/Tools/isPcr.pm BioPerl-1.6.923/Bio/Tools/IUPAC.pm BioPerl-1.6.923/Bio/Tools/Lucy.pm BioPerl-1.6.923/Bio/Tools/Match.pm BioPerl-1.6.923/Bio/Tools/MZEF.pm BioPerl-1.6.923/Bio/Tools/OddCodes.pm BioPerl-1.6.923/Bio/Tools/pICalculator.pm BioPerl-1.6.923/Bio/Tools/Primer3.pm BioPerl-1.6.923/Bio/Tools/Prints.pm BioPerl-1.6.923/Bio/Tools/Profile.pm BioPerl-1.6.923/Bio/Tools/Promoterwise.pm BioPerl-1.6.923/Bio/Tools/PrositeScan.pm BioPerl-1.6.923/Bio/Tools/Protparam.pm BioPerl-1.6.923/Bio/Tools/Pseudowise.pm BioPerl-1.6.923/Bio/Tools/pSW.pm BioPerl-1.6.923/Bio/Tools/QRNA.pm BioPerl-1.6.923/Bio/Tools/RandomDistFunctions.pm BioPerl-1.6.923/Bio/Tools/RepeatMasker.pm BioPerl-1.6.923/Bio/Tools/RNAMotif.pm BioPerl-1.6.923/Bio/Tools/Seg.pm BioPerl-1.6.923/Bio/Tools/SeqPattern.pm BioPerl-1.6.923/Bio/Tools/SeqStats.pm BioPerl-1.6.923/Bio/Tools/SeqWords.pm BioPerl-1.6.923/Bio/Tools/Sigcleave.pm BioPerl-1.6.923/Bio/Tools/Signalp.pm BioPerl-1.6.923/Bio/Tools/SiRNA.pm BioPerl-1.6.923/Bio/Tools/TandemRepeatsFinder.pm BioPerl-1.6.923/Bio/Tools/TargetP.pm BioPerl-1.6.923/Bio/Tools/Tmhmm.pm BioPerl-1.6.923/Bio/Tools/tRNAscanSE.pm BioPerl-1.6.923/Bio/Tools/Alignment BioPerl-1.6.923/Bio/Tools/Alignment/Consed.pm BioPerl-1.6.923/Bio/Tools/Alignment/Trim.pm BioPerl-1.6.923/Bio/Tools/Analysis BioPerl-1.6.923/Bio/Tools/Analysis/SimpleAnalysisBase.pm BioPerl-1.6.923/Bio/Tools/Analysis/DNA BioPerl-1.6.923/Bio/Tools/Analysis/DNA/ESEfinder.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Domcut.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/ELM.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/GOR4.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/HNN.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Mitoprot.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/NetPhos.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Scansite.pm BioPerl-1.6.923/Bio/Tools/Analysis/Protein/Sopma.pm BioPerl-1.6.923/Bio/Tools/EMBOSS BioPerl-1.6.923/Bio/Tools/EMBOSS/Palindrome.pm BioPerl-1.6.923/Bio/Tools/HMMER BioPerl-1.6.923/Bio/Tools/HMMER/Domain.pm BioPerl-1.6.923/Bio/Tools/HMMER/Results.pm BioPerl-1.6.923/Bio/Tools/HMMER/Set.pm BioPerl-1.6.923/Bio/Tools/Phylo BioPerl-1.6.923/Bio/Tools/Phylo/Gerp.pm BioPerl-1.6.923/Bio/Tools/Phylo/Gumby.pm BioPerl-1.6.923/Bio/Tools/Phylo/Molphy.pm BioPerl-1.6.923/Bio/Tools/Phylo/PAML.pm BioPerl-1.6.923/Bio/Tools/Phylo/Molphy BioPerl-1.6.923/Bio/Tools/Phylo/Molphy/Result.pm BioPerl-1.6.923/Bio/Tools/Phylo/PAML BioPerl-1.6.923/Bio/Tools/Phylo/PAML/Codeml.pm BioPerl-1.6.923/Bio/Tools/Phylo/PAML/ModelResult.pm BioPerl-1.6.923/Bio/Tools/Phylo/PAML/Result.pm BioPerl-1.6.923/Bio/Tools/Phylo/Phylip BioPerl-1.6.923/Bio/Tools/Phylo/Phylip/ProtDist.pm BioPerl-1.6.923/Bio/Tools/Prediction BioPerl-1.6.923/Bio/Tools/Prediction/Exon.pm BioPerl-1.6.923/Bio/Tools/Prediction/Gene.pm BioPerl-1.6.923/Bio/Tools/Primer BioPerl-1.6.923/Bio/Tools/Primer/AssessorI.pm BioPerl-1.6.923/Bio/Tools/Primer/Feature.pm BioPerl-1.6.923/Bio/Tools/Primer/Pair.pm BioPerl-1.6.923/Bio/Tools/Primer/Assessor BioPerl-1.6.923/Bio/Tools/Primer/Assessor/Base.pm BioPerl-1.6.923/Bio/Tools/Run BioPerl-1.6.923/Bio/Tools/Run/GenericParameters.pm BioPerl-1.6.923/Bio/Tools/Run/hmmer3.pm BioPerl-1.6.923/Bio/Tools/Run/ParametersI.pm BioPerl-1.6.923/Bio/Tools/Run/README BioPerl-1.6.923/Bio/Tools/Run/RemoteBlast.pm BioPerl-1.6.923/Bio/Tools/Run/StandAloneBlast.pm BioPerl-1.6.923/Bio/Tools/Run/StandAloneNCBIBlast.pm BioPerl-1.6.923/Bio/Tools/Run/StandAloneWUBlast.pm BioPerl-1.6.923/Bio/Tools/Run/WrapperBase.pm BioPerl-1.6.923/Bio/Tools/Run/WrapperBase BioPerl-1.6.923/Bio/Tools/Run/WrapperBase/CommandExts.pm BioPerl-1.6.923/Bio/Tools/SeqPattern BioPerl-1.6.923/Bio/Tools/SeqPattern/Backtranslate.pm BioPerl-1.6.923/Bio/Tools/Signalp BioPerl-1.6.923/Bio/Tools/Signalp/ExtendedSignalp.pm BioPerl-1.6.923/Bio/Tools/Sim4 BioPerl-1.6.923/Bio/Tools/Sim4/Exon.pm BioPerl-1.6.923/Bio/Tools/Sim4/Results.pm BioPerl-1.6.923/Bio/Tools/SiRNA BioPerl-1.6.923/Bio/Tools/SiRNA/Ruleset BioPerl-1.6.923/Bio/Tools/SiRNA/Ruleset/saigo.pm BioPerl-1.6.923/Bio/Tools/SiRNA/Ruleset/tuschl.pm BioPerl-1.6.923/Bio/Tools/Spidey BioPerl-1.6.923/Bio/Tools/Spidey/Exon.pm BioPerl-1.6.923/Bio/Tools/Spidey/Results.pm BioPerl-1.6.923/Bio/Tree BioPerl-1.6.923/Bio/Tree/AlleleNode.pm BioPerl-1.6.923/Bio/Tree/AnnotatableNode.pm BioPerl-1.6.923/Bio/Tree/Compatible.pm BioPerl-1.6.923/Bio/Tree/DistanceFactory.pm BioPerl-1.6.923/Bio/Tree/Node.pm BioPerl-1.6.923/Bio/Tree/NodeI.pm BioPerl-1.6.923/Bio/Tree/NodeNHX.pm BioPerl-1.6.923/Bio/Tree/RandomFactory.pm BioPerl-1.6.923/Bio/Tree/Statistics.pm BioPerl-1.6.923/Bio/Tree/Tree.pm BioPerl-1.6.923/Bio/Tree/TreeFunctionsI.pm BioPerl-1.6.923/Bio/Tree/TreeI.pm BioPerl-1.6.923/Bio/Tree/Draw BioPerl-1.6.923/Bio/Tree/Draw/Cladogram.pm BioPerl-1.6.923/Bio/TreeIO BioPerl-1.6.923/Bio/TreeIO/cluster.pm BioPerl-1.6.923/Bio/TreeIO/lintree.pm BioPerl-1.6.923/Bio/TreeIO/newick.pm BioPerl-1.6.923/Bio/TreeIO/NewickParser.pm BioPerl-1.6.923/Bio/TreeIO/nexml.pm BioPerl-1.6.923/Bio/TreeIO/nexus.pm BioPerl-1.6.923/Bio/TreeIO/nhx.pm BioPerl-1.6.923/Bio/TreeIO/pag.pm BioPerl-1.6.923/Bio/TreeIO/phyloxml.pm BioPerl-1.6.923/Bio/TreeIO/svggraph.pm BioPerl-1.6.923/Bio/TreeIO/tabtree.pm BioPerl-1.6.923/Bio/TreeIO/TreeEventBuilder.pm BioPerl-1.6.923/Bio/Variation BioPerl-1.6.923/Bio/Variation/AAChange.pm BioPerl-1.6.923/Bio/Variation/AAReverseMutate.pm BioPerl-1.6.923/Bio/Variation/Allele.pm BioPerl-1.6.923/Bio/Variation/DNAMutation.pm BioPerl-1.6.923/Bio/Variation/IO.pm BioPerl-1.6.923/Bio/Variation/README BioPerl-1.6.923/Bio/Variation/RNAChange.pm BioPerl-1.6.923/Bio/Variation/SeqDiff.pm BioPerl-1.6.923/Bio/Variation/SNP.pm BioPerl-1.6.923/Bio/Variation/VariantI.pm BioPerl-1.6.923/Bio/Variation/IO BioPerl-1.6.923/Bio/Variation/IO/flat.pm BioPerl-1.6.923/Bio/Variation/IO/xml.pm BioPerl-1.6.923/doc BioPerl-1.6.923/doc/makedoc.PL BioPerl-1.6.923/doc/README BioPerl-1.6.923/doc/Deobfuscator BioPerl-1.6.923/doc/Deobfuscator/Build.PL BioPerl-1.6.923/doc/Deobfuscator/Changes BioPerl-1.6.923/doc/Deobfuscator/excluded_modules.txt BioPerl-1.6.923/doc/Deobfuscator/LICENSE BioPerl-1.6.923/doc/Deobfuscator/Makefile.PL BioPerl-1.6.923/doc/Deobfuscator/MANIFEST BioPerl-1.6.923/doc/Deobfuscator/META.yml BioPerl-1.6.923/doc/Deobfuscator/README BioPerl-1.6.923/doc/Deobfuscator/bin BioPerl-1.6.923/doc/Deobfuscator/bin/deob_index.pl BioPerl-1.6.923/doc/Deobfuscator/bin/run-deobfuscator-update.pl BioPerl-1.6.923/doc/Deobfuscator/cgi-bin BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_detail.cgi BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_flowchart.png BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_help.html BioPerl-1.6.923/doc/Deobfuscator/cgi-bin/deob_interface.cgi BioPerl-1.6.923/doc/Deobfuscator/lib BioPerl-1.6.923/doc/Deobfuscator/lib/Deobfuscator.pm BioPerl-1.6.923/doc/Deobfuscator/t BioPerl-1.6.923/doc/Deobfuscator/t/00.load.t BioPerl-1.6.923/doc/Deobfuscator/t/pod.t BioPerl-1.6.923/examples BioPerl-1.6.923/examples/bioperl.pl BioPerl-1.6.923/examples/generate_random_seq.pl BioPerl-1.6.923/examples/longorf.pl BioPerl-1.6.923/examples/make_primers.pl BioPerl-1.6.923/examples/rev_and_trans.pl BioPerl-1.6.923/examples/revcom_dir.pl BioPerl-1.6.923/examples/subsequence.cgi BioPerl-1.6.923/examples/align BioPerl-1.6.923/examples/align/align_on_codons.pl BioPerl-1.6.923/examples/align/aligntutorial.pl BioPerl-1.6.923/examples/align/clustalw.pl BioPerl-1.6.923/examples/align/FastAlign.pl BioPerl-1.6.923/examples/align/simplealign.pl BioPerl-1.6.923/examples/Bio-DB-GFF BioPerl-1.6.923/examples/Bio-DB-GFF/load_ucsc.pl BioPerl-1.6.923/examples/cluster BioPerl-1.6.923/examples/cluster/dbsnp.pl BioPerl-1.6.923/examples/contributed BioPerl-1.6.923/examples/contributed/nmrpdb_parse.pl BioPerl-1.6.923/examples/contributed/prosite2perl.pl BioPerl-1.6.923/examples/contributed/rebase2list.pl BioPerl-1.6.923/examples/db BioPerl-1.6.923/examples/db/dbfetch BioPerl-1.6.923/examples/db/est_tissue_query.pl BioPerl-1.6.923/examples/db/gb2features.pl BioPerl-1.6.923/examples/db/get_seqs.pl BioPerl-1.6.923/examples/db/getGenBank.pl BioPerl-1.6.923/examples/db/rfetch.pl BioPerl-1.6.923/examples/db/use_registry.pl BioPerl-1.6.923/examples/liveseq BioPerl-1.6.923/examples/liveseq/change_gene.pl BioPerl-1.6.923/examples/popgen BioPerl-1.6.923/examples/popgen/parse_calc_stats.pl BioPerl-1.6.923/examples/quality BioPerl-1.6.923/examples/quality/svgtrace.pl BioPerl-1.6.923/examples/root BioPerl-1.6.923/examples/root/exceptions1.pl BioPerl-1.6.923/examples/root/exceptions2.pl BioPerl-1.6.923/examples/root/exceptions3.pl BioPerl-1.6.923/examples/root/exceptions4.pl BioPerl-1.6.923/examples/root/README BioPerl-1.6.923/examples/root/lib BioPerl-1.6.923/examples/root/lib/TestInterface.pm BioPerl-1.6.923/examples/root/lib/TestObject.pm BioPerl-1.6.923/examples/searchio BioPerl-1.6.923/examples/searchio/blast_example.pl BioPerl-1.6.923/examples/searchio/custom_writer.pl BioPerl-1.6.923/examples/searchio/hitwriter.pl BioPerl-1.6.923/examples/searchio/hspwriter.pl BioPerl-1.6.923/examples/searchio/htmlwriter.pl BioPerl-1.6.923/examples/searchio/psiblast_features.pl BioPerl-1.6.923/examples/searchio/psiblast_iterations.pl BioPerl-1.6.923/examples/searchio/rawwriter.pl BioPerl-1.6.923/examples/searchio/resultwriter.pl BioPerl-1.6.923/examples/searchio/waba2gff.pl BioPerl-1.6.923/examples/searchio/waba2gff3.pl BioPerl-1.6.923/examples/sirna BioPerl-1.6.923/examples/sirna/rnai_finder.cgi BioPerl-1.6.923/examples/sirna/TAG BioPerl-1.6.923/examples/structure BioPerl-1.6.923/examples/structure/structure-io.pl BioPerl-1.6.923/examples/tk BioPerl-1.6.923/examples/tk/gsequence.pl BioPerl-1.6.923/examples/tk/hitdisplay.pl BioPerl-1.6.923/examples/tools BioPerl-1.6.923/examples/tools/extract_genes.pl BioPerl-1.6.923/examples/tools/gb_to_gff.pl BioPerl-1.6.923/examples/tools/gff2ps.pl BioPerl-1.6.923/examples/tools/parse_codeml.pl BioPerl-1.6.923/examples/tools/psw.pl BioPerl-1.6.923/examples/tools/reverse-translate.pl BioPerl-1.6.923/examples/tools/run_genscan.pl BioPerl-1.6.923/examples/tools/run_primer3.pl BioPerl-1.6.923/examples/tools/seq_pattern.pl BioPerl-1.6.923/examples/tools/standaloneblast.pl BioPerl-1.6.923/examples/tree BioPerl-1.6.923/examples/tree/paup2phylip.pl BioPerl-1.6.923/ide BioPerl-1.6.923/ide/bioperl.komodo BioPerl-1.6.923/ide/bioperl-mode BioPerl-1.6.923/ide/bioperl-mode/README BioPerl-1.6.923/ide/bioperl-mode/dist BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5 BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode.tar BioPerl-1.6.923/ide/bioperl-mode/dist/bioperl-mode.tar.md5 BioPerl-1.6.923/ide/bioperl-mode/dist/Changes BioPerl-1.6.923/ide/bioperl-mode/dist/package-me BioPerl-1.6.923/ide/bioperl-mode/dist/SKIP BioPerl-1.6.923/ide/bioperl-mode/etc BioPerl-1.6.923/ide/bioperl-mode/etc/images BioPerl-1.6.923/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm BioPerl-1.6.923/ide/bioperl-mode/etc/images/bpmode-tool.xpm BioPerl-1.6.923/ide/bioperl-mode/site-lisp BioPerl-1.6.923/ide/bioperl-mode/site-lisp/bioperl-init.el BioPerl-1.6.923/ide/bioperl-mode/site-lisp/bioperl-mode.el BioPerl-1.6.923/ide/bioperl-mode/site-lisp/bioperl-skel.el BioPerl-1.6.923/ide/bioperl-mode/site-lisp/pod.el BioPerl-1.6.923/maintenance BioPerl-1.6.923/maintenance/authors.pl BioPerl-1.6.923/maintenance/check_NAME.pl BioPerl-1.6.923/maintenance/check_URLs.pl BioPerl-1.6.923/maintenance/cvs2cl_by_file.pl BioPerl-1.6.923/maintenance/dependencies.pl BioPerl-1.6.923/maintenance/deprecated.pl BioPerl-1.6.923/maintenance/find_mod_deps.pl BioPerl-1.6.923/maintenance/module_usage.pl BioPerl-1.6.923/maintenance/modules.pl BioPerl-1.6.923/maintenance/ncbi_blast_switches.pl BioPerl-1.6.923/maintenance/perltidy.conf BioPerl-1.6.923/maintenance/pod.pl BioPerl-1.6.923/maintenance/README BioPerl-1.6.923/maintenance/symlink_script.pl BioPerl-1.6.923/maintenance/version.pl BioPerl-1.6.923/maintenance/big_split BioPerl-1.6.923/maintenance/big_split/file_classification.csv BioPerl-1.6.923/maintenance/big_split/rbuels_notes.txt BioPerl-1.6.923/models BioPerl-1.6.923/models/biblio.dia BioPerl-1.6.923/models/bio_liveseq_variation.dia BioPerl-1.6.923/models/bio_map.dia BioPerl-1.6.923/models/bio_restriction.dia BioPerl-1.6.923/models/bioperl.dia BioPerl-1.6.923/models/coordinatemapper.dia BioPerl-1.6.923/models/map_proposal.txt BioPerl-1.6.923/models/maps_and_markers.dia BioPerl-1.6.923/models/popgen.dia BioPerl-1.6.923/models/population_proposal.txt BioPerl-1.6.923/models/README BioPerl-1.6.923/scripts BioPerl-1.6.923/scripts/README BioPerl-1.6.923/scripts/Bio-DB-GFF BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_bulk_load_gff.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_fast_load_gff.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_genbank2gff.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_genbank2gff3.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_generate_histogram.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_load_gff.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_meta_gff.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_process_gadfly.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_process_sgd.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/bp_process_wormbase.pl BioPerl-1.6.923/scripts/Bio-DB-GFF/README BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl BioPerl-1.6.923/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl BioPerl-1.6.923/scripts/das BioPerl-1.6.923/scripts/das/bp_das_server.pl BioPerl-1.6.923/scripts/das/README BioPerl-1.6.923/scripts/das/TAG BioPerl-1.6.923/scripts/DB BioPerl-1.6.923/scripts/DB/bp_biofetch_genbank_proxy.pl BioPerl-1.6.923/scripts/DB/bp_bioflat_index.pl BioPerl-1.6.923/scripts/DB/bp_biogetseq.pl BioPerl-1.6.923/scripts/DB/bp_flanks.pl BioPerl-1.6.923/scripts/DB/TAG BioPerl-1.6.923/scripts/DB-HIV BioPerl-1.6.923/scripts/DB-HIV/bp_hivq.pl BioPerl-1.6.923/scripts/index BioPerl-1.6.923/scripts/index/bp_fetch.pl BioPerl-1.6.923/scripts/index/bp_index.pl BioPerl-1.6.923/scripts/index/bp_seqret.pl BioPerl-1.6.923/scripts/index/TAG BioPerl-1.6.923/scripts/popgen BioPerl-1.6.923/scripts/popgen/bp_composite_LD.pl BioPerl-1.6.923/scripts/popgen/bp_heterogeneity_test.pl BioPerl-1.6.923/scripts/searchio BioPerl-1.6.923/scripts/searchio/bp_fastam9_to_table.pl BioPerl-1.6.923/scripts/searchio/bp_filter_search.pl BioPerl-1.6.923/scripts/searchio/bp_hmmer_to_table.pl BioPerl-1.6.923/scripts/searchio/bp_parse_hmmsearch.pl BioPerl-1.6.923/scripts/searchio/bp_search2table.pl BioPerl-1.6.923/scripts/searchio/README BioPerl-1.6.923/scripts/searchio/TAG BioPerl-1.6.923/scripts/seq BioPerl-1.6.923/scripts/seq/bp_extract_feature_seq.pl BioPerl-1.6.923/scripts/seq/bp_make_mrna_protein.pl BioPerl-1.6.923/scripts/seq/bp_seqconvert.pl BioPerl-1.6.923/scripts/seq/bp_seqcut.pl BioPerl-1.6.923/scripts/seq/bp_seqpart.pl BioPerl-1.6.923/scripts/seq/bp_seqretsplit.pl BioPerl-1.6.923/scripts/seq/bp_split_seq.pl BioPerl-1.6.923/scripts/seq/bp_translate_seq.pl BioPerl-1.6.923/scripts/seq/bp_unflatten_seq.pl BioPerl-1.6.923/scripts/seq/TAG BioPerl-1.6.923/scripts/seqstats BioPerl-1.6.923/scripts/seqstats/bp_aacomp.pl BioPerl-1.6.923/scripts/seqstats/bp_chaos_plot.pl BioPerl-1.6.923/scripts/seqstats/bp_gccalc.pl BioPerl-1.6.923/scripts/seqstats/bp_oligo_count.pl BioPerl-1.6.923/scripts/seqstats/TAG BioPerl-1.6.923/scripts/taxa BioPerl-1.6.923/scripts/taxa/bp_classify_hits_kingdom.pl BioPerl-1.6.923/scripts/taxa/bp_local_taxonomydb_query.pl BioPerl-1.6.923/scripts/taxa/bp_query_entrez_taxa.pl BioPerl-1.6.923/scripts/taxa/bp_taxid4species.pl BioPerl-1.6.923/scripts/taxa/bp_taxonomy2tree.pl BioPerl-1.6.923/scripts/taxa/TAG BioPerl-1.6.923/scripts/tree BioPerl-1.6.923/scripts/tree/bp_blast2tree.pl BioPerl-1.6.923/scripts/tree/bp_nexus2nh.pl BioPerl-1.6.923/scripts/tree/bp_tree2pag.pl BioPerl-1.6.923/scripts/tree/TAG BioPerl-1.6.923/scripts/utilities BioPerl-1.6.923/scripts/utilities/bp_dbsplit.pl BioPerl-1.6.923/scripts/utilities/bp_download_query_genbank.pl BioPerl-1.6.923/scripts/utilities/bp_mask_by_search.pl BioPerl-1.6.923/scripts/utilities/bp_mrtrans.pl BioPerl-1.6.923/scripts/utilities/bp_mutate.pl BioPerl-1.6.923/scripts/utilities/bp_netinstall.pl BioPerl-1.6.923/scripts/utilities/bp_nrdb.pl BioPerl-1.6.923/scripts/utilities/bp_pairwise_kaks.pl BioPerl-1.6.923/scripts/utilities/bp_remote_blast.pl BioPerl-1.6.923/scripts/utilities/bp_revtrans-motif.pl BioPerl-1.6.923/scripts/utilities/bp_search2alnblocks.pl BioPerl-1.6.923/scripts/utilities/bp_search2BSML.pl BioPerl-1.6.923/scripts/utilities/bp_search2gff.pl BioPerl-1.6.923/scripts/utilities/bp_search2tribe.pl BioPerl-1.6.923/scripts/utilities/bp_seq_length.pl BioPerl-1.6.923/scripts/utilities/bp_sreformat.pl BioPerl-1.6.923/scripts/utilities/README BioPerl-1.6.923/scripts/utilities/TAG BioPerl-1.6.923/t BioPerl-1.6.923/t/Alphabet.t BioPerl-1.6.923/t/nexml.t BioPerl-1.6.923/t/Perl.t BioPerl-1.6.923/t/PodSyntax.t BioPerl-1.6.923/t/SearchDist.t BioPerl-1.6.923/t/SeqEvolution.t BioPerl-1.6.923/t/Species.t BioPerl-1.6.923/t/Symbol.t BioPerl-1.6.923/t/TaxonTree.t BioPerl-1.6.923/t/Align BioPerl-1.6.923/t/Align/AlignStats.t BioPerl-1.6.923/t/Align/AlignUtil.t BioPerl-1.6.923/t/Align/Graphics.t BioPerl-1.6.923/t/Align/SimpleAlign.t BioPerl-1.6.923/t/Align/TreeBuild.t BioPerl-1.6.923/t/Align/Utilities.t BioPerl-1.6.923/t/AlignIO BioPerl-1.6.923/t/AlignIO/AlignIO.t BioPerl-1.6.923/t/AlignIO/arp.t BioPerl-1.6.923/t/AlignIO/bl2seq.t BioPerl-1.6.923/t/AlignIO/clustalw.t BioPerl-1.6.923/t/AlignIO/emboss.t BioPerl-1.6.923/t/AlignIO/fasta.t BioPerl-1.6.923/t/AlignIO/largemultifasta.t BioPerl-1.6.923/t/AlignIO/maf.t BioPerl-1.6.923/t/AlignIO/mase.t BioPerl-1.6.923/t/AlignIO/mega.t BioPerl-1.6.923/t/AlignIO/meme.t BioPerl-1.6.923/t/AlignIO/metafasta.t BioPerl-1.6.923/t/AlignIO/msf.t BioPerl-1.6.923/t/AlignIO/nexml.t BioPerl-1.6.923/t/AlignIO/nexus.t BioPerl-1.6.923/t/AlignIO/pfam.t BioPerl-1.6.923/t/AlignIO/phylip.t BioPerl-1.6.923/t/AlignIO/po.t BioPerl-1.6.923/t/AlignIO/prodom.t BioPerl-1.6.923/t/AlignIO/psi.t BioPerl-1.6.923/t/AlignIO/selex.t BioPerl-1.6.923/t/AlignIO/stockholm.t BioPerl-1.6.923/t/AlignIO/xmfa.t BioPerl-1.6.923/t/Annotation BioPerl-1.6.923/t/Annotation/Annotation.t BioPerl-1.6.923/t/Annotation/AnnotationAdaptor.t BioPerl-1.6.923/t/Assembly BioPerl-1.6.923/t/Assembly/ContigSpectrum.t BioPerl-1.6.923/t/Assembly/core.t BioPerl-1.6.923/t/Assembly/IO BioPerl-1.6.923/t/Assembly/IO/bowtie.t BioPerl-1.6.923/t/Assembly/IO/sam.t BioPerl-1.6.923/t/Cluster BioPerl-1.6.923/t/Cluster/UniGene.t BioPerl-1.6.923/t/ClusterIO BioPerl-1.6.923/t/ClusterIO/ClusterIO.t BioPerl-1.6.923/t/ClusterIO/SequenceFamily.t BioPerl-1.6.923/t/ClusterIO/unigene.t BioPerl-1.6.923/t/Coordinate BioPerl-1.6.923/t/Coordinate/CoordinateBoundaryTest.t BioPerl-1.6.923/t/Coordinate/CoordinateGraph.t BioPerl-1.6.923/t/Coordinate/CoordinateMapper.t BioPerl-1.6.923/t/Coordinate/GeneCoordinateMapper.t BioPerl-1.6.923/t/data BioPerl-1.6.923/t/data/01_basic.xml BioPerl-1.6.923/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.923/t/data/02_dogfish_no_taxrefs.xml BioPerl-1.6.923/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.923/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.923/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml BioPerl-1.6.923/t/data/02_mackerel_no_taxrefs.xml BioPerl-1.6.923/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml BioPerl-1.6.923/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml BioPerl-1.6.923/t/data/03_bootstraps.xml BioPerl-1.6.923/t/data/03_bootstraps_in_tag.xml BioPerl-1.6.923/t/data/04_labeled_ancestors.xml BioPerl-1.6.923/t/data/05_ancestral_states.xml BioPerl-1.6.923/t/data/13-pilE-F.scf BioPerl-1.6.923/t/data/1A11.pdb BioPerl-1.6.923/t/data/1A3I.pdb BioPerl-1.6.923/t/data/1BPT.pdb BioPerl-1.6.923/t/data/1ZZ19XR301R-Alignment.tblastn BioPerl-1.6.923/t/data/2008.blasttable BioPerl-1.6.923/t/data/27-contig_Newbler.ace BioPerl-1.6.923/t/data/503384.MEGABLAST.0 BioPerl-1.6.923/t/data/503384.MEGABLAST.2 BioPerl-1.6.923/t/data/5X_1895.FASTXY BioPerl-1.6.923/t/data/8HVP.pdb BioPerl-1.6.923/t/data/a_thaliana.blastn BioPerl-1.6.923/t/data/AAC12660.fa BioPerl-1.6.923/t/data/aaml.mlc BioPerl-1.6.923/t/data/aaml_pairwise.mlc BioPerl-1.6.923/t/data/AB077698.gb BioPerl-1.6.923/t/data/acefile.ace.1 BioPerl-1.6.923/t/data/acefile.singlets BioPerl-1.6.923/t/data/adh.mb_tree.nexus BioPerl-1.6.923/t/data/AE003528_ecoli.bls BioPerl-1.6.923/t/data/AE003644_Adh-genomic.gb BioPerl-1.6.923/t/data/AF032047.gbk BioPerl-1.6.923/t/data/AF165282.gb BioPerl-1.6.923/t/data/AF305198.gb BioPerl-1.6.923/t/data/AHCYL1.kegg BioPerl-1.6.923/t/data/alleles.fas BioPerl-1.6.923/t/data/alnfile.fasta BioPerl-1.6.923/t/data/amino.fa BioPerl-1.6.923/t/data/AnnIX-v003.gbk BioPerl-1.6.923/t/data/ar.embl BioPerl-1.6.923/t/data/assembly_with_singlets.ace BioPerl-1.6.923/t/data/ATF14F8.gbk BioPerl-1.6.923/t/data/atp1.matrix BioPerl-1.6.923/t/data/ay007676.gb BioPerl-1.6.923/t/data/AY095303S1.gbk BioPerl-1.6.923/t/data/ay116458.gb BioPerl-1.6.923/t/data/ay149291.gb BioPerl-1.6.923/t/data/AY763288.gb BioPerl-1.6.923/t/data/BAB68554.gb BioPerl-1.6.923/t/data/badfasta.fa BioPerl-1.6.923/t/data/barns-combined.nex BioPerl-1.6.923/t/data/baseml.pairwise BioPerl-1.6.923/t/data/baseml.usertree BioPerl-1.6.923/t/data/basic-bush.nex BioPerl-1.6.923/t/data/basic-ladder.nex BioPerl-1.6.923/t/data/BC000007.gbk BioPerl-1.6.923/t/data/BEL16-LTR_AG.embl BioPerl-1.6.923/t/data/biofpc.cor BioPerl-1.6.923/t/data/biofpc.fpc BioPerl-1.6.923/t/data/biorecipe.nhx BioPerl-1.6.923/t/data/Bird_Ovomucoids.nex BioPerl-1.6.923/t/data/BK000016-tpa.gbk BioPerl-1.6.923/t/data/bl2seq.blastn BioPerl-1.6.923/t/data/bl2seq.blastn.rev BioPerl-1.6.923/t/data/bl2seq.blastx.out BioPerl-1.6.923/t/data/bl2seq.bug940.out BioPerl-1.6.923/t/data/bl2seq.out BioPerl-1.6.923/t/data/bl2seq.tblastn.out BioPerl-1.6.923/t/data/bl2seq.tblastx.out BioPerl-1.6.923/t/data/blast.report BioPerl-1.6.923/t/data/blast_no_hit_desc.txt BioPerl-1.6.923/t/data/blast_plus.blastp BioPerl-1.6.923/t/data/blastp2215.blast BioPerl-1.6.923/t/data/blat.psLayout3 BioPerl-1.6.923/t/data/BLOSUM50 BioPerl-1.6.923/t/data/blosum62.bla BioPerl-1.6.923/t/data/BN000066-tpa.embl BioPerl-1.6.923/t/data/bootstrap.tre BioPerl-1.6.923/t/data/BOSS_DROME.FASTP_v35_04 BioPerl-1.6.923/t/data/branchSite.mlc BioPerl-1.6.923/t/data/brassica_ATH.WUBLASTN BioPerl-1.6.923/t/data/bug1986.blast2 BioPerl-1.6.923/t/data/bug1986.blastp BioPerl-1.6.923/t/data/bug2120.phd BioPerl-1.6.923/t/data/bug2246.blast BioPerl-1.6.923/t/data/bug2391.megablast BioPerl-1.6.923/t/data/bug2399.tblastn BioPerl-1.6.923/t/data/bug2453.maf BioPerl-1.6.923/t/data/bug2473.fasta BioPerl-1.6.923/t/data/bug2862.pmr BioPerl-1.6.923/t/data/bug2869.tree BioPerl-1.6.923/t/data/bug2901.fa BioPerl-1.6.923/t/data/bug2937.fasta BioPerl-1.6.923/t/data/bug2942.blastx BioPerl-1.6.923/t/data/bug2982.embl BioPerl-1.6.923/t/data/bug2982.gb BioPerl-1.6.923/t/data/bug3021.gmap BioPerl-1.6.923/t/data/bug3086.embl BioPerl-1.6.923/t/data/bug3331.mlc BioPerl-1.6.923/t/data/c200-vs-yeast.BLASTN BioPerl-1.6.923/t/data/c200-vs-yeast.BLASTN.m8 BioPerl-1.6.923/t/data/calm.swiss BioPerl-1.6.923/t/data/catalase-webblast.BLASTP BioPerl-1.6.923/t/data/cds-266.fas BioPerl-1.6.923/t/data/cds_sample.embl BioPerl-1.6.923/t/data/CG11099.fasaln BioPerl-1.6.923/t/data/CG2865.fasaln BioPerl-1.6.923/t/data/chad100.scf BioPerl-1.6.923/t/data/char-interleave.nex BioPerl-1.6.923/t/data/char-matrix-spaces.nex BioPerl-1.6.923/t/data/characters+trees.nexml.xml BioPerl-1.6.923/t/data/characters.nexml.old.xml BioPerl-1.6.923/t/data/codeml.mlc BioPerl-1.6.923/t/data/codeml315.mlc BioPerl-1.6.923/t/data/codeml4.mlc BioPerl-1.6.923/t/data/codeml43.mlc BioPerl-1.6.923/t/data/codeml43_nssites.mlc BioPerl-1.6.923/t/data/codeml45.mlc BioPerl-1.6.923/t/data/codeml45b.mlc BioPerl-1.6.923/t/data/codeml_nan.mlc BioPerl-1.6.923/t/data/codeml_nssites.mlc BioPerl-1.6.923/t/data/compLD_missingtest.prettybase BioPerl-1.6.923/t/data/compLD_test.prettybase BioPerl-1.6.923/t/data/component.ontology.test BioPerl-1.6.923/t/data/component.ontology.test2 BioPerl-1.6.923/t/data/contig-by-hand.wublastp BioPerl-1.6.923/t/data/contigspectrumtest.tigr BioPerl-1.6.923/t/data/crab.dat.cn BioPerl-1.6.923/t/data/crab.nj BioPerl-1.6.923/t/data/crab.njb BioPerl-1.6.923/t/data/crypto.sim4-0 BioPerl-1.6.923/t/data/crypto.sim4-3 BioPerl-1.6.923/t/data/crypto.sim4-4 BioPerl-1.6.923/t/data/ctgdemo.fpc BioPerl-1.6.923/t/data/cys1_dicdi.water BioPerl-1.6.923/t/data/cysprot.fa BioPerl-1.6.923/t/data/cysprot.msf BioPerl-1.6.923/t/data/cysprot.needle BioPerl-1.6.923/t/data/cysprot.tblastn BioPerl-1.6.923/t/data/cysprot.water BioPerl-1.6.923/t/data/cysprot1.fa BioPerl-1.6.923/t/data/cysprot1.FASTA BioPerl-1.6.923/t/data/cysprot1a.fa BioPerl-1.6.923/t/data/cysprot1a.msf BioPerl-1.6.923/t/data/cysprot1b.fa BioPerl-1.6.923/t/data/cysprot1b.hmmsearch BioPerl-1.6.923/t/data/cysprot1b.msf BioPerl-1.6.923/t/data/cysprot1b.newick BioPerl-1.6.923/t/data/cysprot_vs_gadfly.FASTA BioPerl-1.6.923/t/data/D10483.gbk BioPerl-1.6.923/t/data/D12555.gbk BioPerl-1.6.923/t/data/dcr1_sp.WUBLASTP BioPerl-1.6.923/t/data/dmel_2Lchunk.gb BioPerl-1.6.923/t/data/dna1.fa BioPerl-1.6.923/t/data/dna2.fa BioPerl-1.6.923/t/data/dnaE-bsub-prot.fa BioPerl-1.6.923/t/data/dnaE-bsub.fa BioPerl-1.6.923/t/data/dnaEbsub_ecoli.wublastx BioPerl-1.6.923/t/data/dnaEbsub_ecoli.wutblastn BioPerl-1.6.923/t/data/dnaEbsub_ecoli.wutblastx BioPerl-1.6.923/t/data/DQ018368.gb BioPerl-1.6.923/t/data/dq519393.gb BioPerl-1.6.923/t/data/ECAPAH02.embl BioPerl-1.6.923/t/data/echofilter.wublastn BioPerl-1.6.923/t/data/ecoli-trna-qrna.out BioPerl-1.6.923/t/data/ecoli_domains.rps.xml BioPerl-1.6.923/t/data/ecoli_domains.rpsblast BioPerl-1.6.923/t/data/ecolitst.bls BioPerl-1.6.923/t/data/ecolitst.fa BioPerl-1.6.923/t/data/ecolitst.noseqs.wublastp BioPerl-1.6.923/t/data/ecolitst.wublastp BioPerl-1.6.923/t/data/EG352462.gbxml BioPerl-1.6.923/t/data/empty.bl2seq BioPerl-1.6.923/t/data/ENr111.mfa.example.elems BioPerl-1.6.923/t/data/entrezgene.dat BioPerl-1.6.923/t/data/ex1.nucl.nhx BioPerl-1.6.923/t/data/example.hap BioPerl-1.6.923/t/data/example.phase BioPerl-1.6.923/t/data/example.vcf BioPerl-1.6.923/t/data/exonerate.output.dontwork BioPerl-1.6.923/t/data/exonerate.output.negativescore.works BioPerl-1.6.923/t/data/exonerate.output.works BioPerl-1.6.923/t/data/exonerate.whitespace_before_query.works BioPerl-1.6.923/t/data/expected.blast.out BioPerl-1.6.923/t/data/exsignalp.out BioPerl-1.6.923/t/data/factor7.embl BioPerl-1.6.923/t/data/Fang_2003.xml BioPerl-1.6.923/t/data/fgenesh.out BioPerl-1.6.923/t/data/footprinter.out BioPerl-1.6.923/t/data/forward_primer.fa BioPerl-1.6.923/t/data/forward_reverse_primers.fa BioPerl-1.6.923/t/data/frac_problems.blast BioPerl-1.6.923/t/data/frac_problems2.blast BioPerl-1.6.923/t/data/frac_problems3.blast BioPerl-1.6.923/t/data/geneid_1.0.out BioPerl-1.6.923/t/data/genemark-fragment.out BioPerl-1.6.923/t/data/genemark.out BioPerl-1.6.923/t/data/genewise.out BioPerl-1.6.923/t/data/genewise_output.paracel_btk BioPerl-1.6.923/t/data/genomewise.out BioPerl-1.6.923/t/data/genomic-seq.epcr BioPerl-1.6.923/t/data/genomic-seq.fasta BioPerl-1.6.923/t/data/genomic-seq.genscan BioPerl-1.6.923/t/data/genomic-seq.mzef BioPerl-1.6.923/t/data/Genscan.FastA BioPerl-1.6.923/t/data/gf-s71.needle BioPerl-1.6.923/t/data/Glimmer2.out BioPerl-1.6.923/t/data/glimmer3-fragment.detail BioPerl-1.6.923/t/data/glimmer3-fragment.predict BioPerl-1.6.923/t/data/Glimmer3.detail BioPerl-1.6.923/t/data/Glimmer3.predict BioPerl-1.6.923/t/data/GlimmerHMM.out BioPerl-1.6.923/t/data/GlimmerM.out BioPerl-1.6.923/t/data/gmap_f9-multiple_results.txt BioPerl-1.6.923/t/data/gmap_f9-reverse-strand.txt BioPerl-1.6.923/t/data/gmap_f9.txt BioPerl-1.6.923/t/data/GO.defs.test BioPerl-1.6.923/t/data/GO.defs.test2 BioPerl-1.6.923/t/data/headerless.psl BioPerl-1.6.923/t/data/hemoglobinA.meg BioPerl-1.6.923/t/data/hg16_chroms.gff BioPerl-1.6.923/t/data/hmmpfam.out BioPerl-1.6.923/t/data/hmmpfam_cs.out BioPerl-1.6.923/t/data/hmmpfam_fake.out BioPerl-1.6.923/t/data/hmmpfam_HSPdashline.txt BioPerl-1.6.923/t/data/hmmpfam_multiresult.out BioPerl-1.6.923/t/data/hmmscan.out BioPerl-1.6.923/t/data/hmmscan_multi_domain.out BioPerl-1.6.923/t/data/hmmscan_sec_struct.out BioPerl-1.6.923/t/data/hmmsearch.out BioPerl-1.6.923/t/data/hmmsearch3.out BioPerl-1.6.923/t/data/hs_est.est2genome BioPerl-1.6.923/t/data/hs_fugu.newick BioPerl-1.6.923/t/data/hs_owlmonkey.aln BioPerl-1.6.923/t/data/hs_owlmonkey.fas BioPerl-1.6.923/t/data/hs_owlmonkey.fasta BioPerl-1.6.923/t/data/hsinsulin.blastcl3.blastn BioPerl-1.6.923/t/data/HUMBETGLOA.fa BioPerl-1.6.923/t/data/HUMBETGLOA.FASTA BioPerl-1.6.923/t/data/HUMBETGLOA.gff BioPerl-1.6.923/t/data/HUMBETGLOA.grail BioPerl-1.6.923/t/data/HUMBETGLOA.grailexp BioPerl-1.6.923/t/data/HUMBETGLOA.mzef BioPerl-1.6.923/t/data/HUMBETGLOA.tblastx BioPerl-1.6.923/t/data/humor.maf BioPerl-1.6.923/t/data/humts1.pal BioPerl-1.6.923/t/data/hybrid2.gff3 BioPerl-1.6.923/t/data/in.fasta BioPerl-1.6.923/t/data/insulin.water BioPerl-1.6.923/t/data/interpro.xml BioPerl-1.6.923/t/data/interpro_ebi.xml BioPerl-1.6.923/t/data/interpro_relationship.xml BioPerl-1.6.923/t/data/interpro_sample.xml BioPerl-1.6.923/t/data/interpro_short.xml BioPerl-1.6.923/t/data/intrablock-comment.nex BioPerl-1.6.923/t/data/Kingdoms_DNA.nex BioPerl-1.6.923/t/data/L77119.hmmer BioPerl-1.6.923/t/data/little.largemultifasta BioPerl-1.6.923/t/data/LittleChrY.dbsnp.xml BioPerl-1.6.923/t/data/LOAD_Ccd1.dnd BioPerl-1.6.923/t/data/long-names.nex BioPerl-1.6.923/t/data/longnames.aln BioPerl-1.6.923/t/data/longnames.dnd BioPerl-1.6.923/t/data/lucy.info BioPerl-1.6.923/t/data/lucy.qual BioPerl-1.6.923/t/data/lucy.seq BioPerl-1.6.923/t/data/lucy.stderr BioPerl-1.6.923/t/data/lysozyme6.protml BioPerl-1.6.923/t/data/lysozyme6.simple.protml BioPerl-1.6.923/t/data/M0.mlc BioPerl-1.6.923/t/data/M12730.gb BioPerl-1.6.923/t/data/mapmaker.out BioPerl-1.6.923/t/data/mapmaker.txt BioPerl-1.6.923/t/data/mast.dat BioPerl-1.6.923/t/data/masta.dat BioPerl-1.6.923/t/data/match.output BioPerl-1.6.923/t/data/Mcjanrna_rdbII.gbk BioPerl-1.6.923/t/data/megablast_output.paracel_btk BioPerl-1.6.923/t/data/meme.dat BioPerl-1.6.923/t/data/mini-AE001405.gb BioPerl-1.6.923/t/data/mini-align.aln BioPerl-1.6.923/t/data/mixedmast.dat BioPerl-1.6.923/t/data/MmCT BioPerl-1.6.923/t/data/mpath.ontology.test BioPerl-1.6.923/t/data/MSGEFTUA.gb BioPerl-1.6.923/t/data/multi.blast.m8 BioPerl-1.6.923/t/data/multi.blast.m9 BioPerl-1.6.923/t/data/multi.phd BioPerl-1.6.923/t/data/multi_1.fa BioPerl-1.6.923/t/data/multi_2.fa BioPerl-1.6.923/t/data/multi_blast.bls BioPerl-1.6.923/t/data/multifa.seq BioPerl-1.6.923/t/data/multifa.seq.qual BioPerl-1.6.923/t/data/multiline-intrablock-comment.nex BioPerl-1.6.923/t/data/multiresult_blastn+.bls BioPerl-1.6.923/t/data/multiseq.bls BioPerl-1.6.923/t/data/multiseq_tags.phd BioPerl-1.6.923/t/data/mus.bls.xml BioPerl-1.6.923/t/data/mutations.dat BioPerl-1.6.923/t/data/mutations.old.dat BioPerl-1.6.923/t/data/mutations.old.xml BioPerl-1.6.923/t/data/mutations.xml BioPerl-1.6.923/t/data/myco_sites.gff BioPerl-1.6.923/t/data/NC_000007-ribosomal-slippage.gb BioPerl-1.6.923/t/data/NC_001284.gbk BioPerl-1.6.923/t/data/NC_002058_multDBLINK_bug3375.gb BioPerl-1.6.923/t/data/NC_006346.gb BioPerl-1.6.923/t/data/NC_006511-short.gbk BioPerl-1.6.923/t/data/NC_008536.gb BioPerl-1.6.923/t/data/nei_gojobori_test.aln BioPerl-1.6.923/t/data/neighbor.dist BioPerl-1.6.923/t/data/new_blastn.txt BioPerl-1.6.923/t/data/newblast.xml BioPerl-1.6.923/t/data/nhmmer-3.1.out BioPerl-1.6.923/t/data/nhx-bacteria.nhx BioPerl-1.6.923/t/data/NM_002254.gb BioPerl-1.6.923/t/data/no-genes.genscan BioPerl-1.6.923/t/data/no_cds_example.gb BioPerl-1.6.923/t/data/no_FH.embl BioPerl-1.6.923/t/data/no_hsps.blastp BioPerl-1.6.923/t/data/no_semicolon.newick BioPerl-1.6.923/t/data/noninterleaved.phy BioPerl-1.6.923/t/data/NT_021877.gbk BioPerl-1.6.923/t/data/nucmatrix.txt BioPerl-1.6.923/t/data/O_sat.wgs BioPerl-1.6.923/t/data/omim_genemap_test BioPerl-1.6.923/t/data/omim_genemap_test_nolinebreak BioPerl-1.6.923/t/data/omim_text_test BioPerl-1.6.923/t/data/P33897 BioPerl-1.6.923/t/data/P35527.gb BioPerl-1.6.923/t/data/P39765.gb BioPerl-1.6.923/t/data/PAM250 BioPerl-1.6.923/t/data/pep-266.aln BioPerl-1.6.923/t/data/pfam_tests.stk BioPerl-1.6.923/t/data/pfamOutput-bug3376.out BioPerl-1.6.923/t/data/phi.out BioPerl-1.6.923/t/data/phipsi.out BioPerl-1.6.923/t/data/phylipdist-36.out BioPerl-1.6.923/t/data/phylipdist.out BioPerl-1.6.923/t/data/phyloxml_examples.xml BioPerl-1.6.923/t/data/pictogram.fa BioPerl-1.6.923/t/data/plague_yeast.bls.xml BioPerl-1.6.923/t/data/polymorphism.dat BioPerl-1.6.923/t/data/polymorphism.old.xml BioPerl-1.6.923/t/data/polymorphism.xml BioPerl-1.6.923/t/data/popgen_saureus.dat BioPerl-1.6.923/t/data/popgen_saureus.multidat BioPerl-1.6.923/t/data/popstats.prettybase BioPerl-1.6.923/t/data/pre_rel9.swiss BioPerl-1.6.923/t/data/Primate_mtDNA.nex BioPerl-1.6.923/t/data/primedseq.fa BioPerl-1.6.923/t/data/primer3_infile.txt BioPerl-1.6.923/t/data/primer3_outfile.txt BioPerl-1.6.923/t/data/primer3_output.txt BioPerl-1.6.923/t/data/prints.out BioPerl-1.6.923/t/data/promoterwise.out BioPerl-1.6.923/t/data/protpars.phy BioPerl-1.6.923/t/data/protpars_longid.phy BioPerl-1.6.923/t/data/pseudowise.out BioPerl-1.6.923/t/data/psi_xml.dat BioPerl-1.6.923/t/data/psiblast.xml BioPerl-1.6.923/t/data/psiblastreport.out BioPerl-1.6.923/t/data/purine_v081.infernal BioPerl-1.6.923/t/data/puzzle.tre BioPerl-1.6.923/t/data/PX1CG.gb BioPerl-1.6.923/t/data/Q8GBD3.swiss BioPerl-1.6.923/t/data/qrna-relloc.out BioPerl-1.6.923/t/data/qualfile.qual BioPerl-1.6.923/t/data/quoted-strings1.nex BioPerl-1.6.923/t/data/quoted-strings2.nex BioPerl-1.6.923/t/data/Rab1.chaos-xml BioPerl-1.6.923/t/data/radical-whitespace.nex BioPerl-1.6.923/t/data/radical-whitespace_02.nex BioPerl-1.6.923/t/data/rebase.itype2 BioPerl-1.6.923/t/data/rebase.withrefm BioPerl-1.6.923/t/data/reference_ace.ace BioPerl-1.6.923/t/data/regulation_test.obo BioPerl-1.6.923/t/data/rel9.swiss BioPerl-1.6.923/t/data/repeatmasker.fa.out BioPerl-1.6.923/t/data/revcomp_mrna.gb BioPerl-1.6.923/t/data/rfam_tests.stk BioPerl-1.6.923/t/data/ribosome-slippage.gb BioPerl-1.6.923/t/data/roa1.dat BioPerl-1.6.923/t/data/roa1.gbxml BioPerl-1.6.923/t/data/roa1.genbank BioPerl-1.6.923/t/data/roa1.swiss BioPerl-1.6.923/t/data/roa1_v2.dat BioPerl-1.6.923/t/data/rpsblast.bls BioPerl-1.6.923/t/data/rpsblast_no_hits.bls BioPerl-1.6.923/t/data/sample_dataset.tigr BioPerl-1.6.923/t/data/sbay_c127.fas BioPerl-1.6.923/t/data/sbay_c545-yeast.BLASTZ.PSL BioPerl-1.6.923/t/data/seg.out BioPerl-1.6.923/t/data/semicolon.newick BioPerl-1.6.923/t/data/seqdatabase.ini BioPerl-1.6.923/t/data/seqfile.pir BioPerl-1.6.923/t/data/seqs.fas BioPerl-1.6.923/t/data/sequencefamily.dat BioPerl-1.6.923/t/data/seqxml.xml BioPerl-1.6.923/t/data/short.blx BioPerl-1.6.923/t/data/signalp.hmm.short BioPerl-1.6.923/t/data/signalp.hmm.summary BioPerl-1.6.923/t/data/signalp.negative.out BioPerl-1.6.923/t/data/signalp.nn.short BioPerl-1.6.923/t/data/signalp.nn.summary BioPerl-1.6.923/t/data/signalp.positive.out BioPerl-1.6.923/t/data/signalp.short BioPerl-1.6.923/t/data/signalp.summary BioPerl-1.6.923/t/data/sim4.for.for BioPerl-1.6.923/t/data/sim4.for.rev BioPerl-1.6.923/t/data/sim4.rev BioPerl-1.6.923/t/data/singleNSsite.mlc BioPerl-1.6.923/t/data/singlescore.gbk BioPerl-1.6.923/t/data/singlet_w_CT.ace BioPerl-1.6.923/t/data/so.obo BioPerl-1.6.923/t/data/sofa.ontology BioPerl-1.6.923/t/data/sp_subset.obo BioPerl-1.6.923/t/data/spaced_fasta.fa BioPerl-1.6.923/t/data/spaces.nex BioPerl-1.6.923/t/data/SPAN_Family4nl.nex BioPerl-1.6.923/t/data/SPAN_Family7n.nex BioPerl-1.6.923/t/data/SPAN_Family8a.nex BioPerl-1.6.923/t/data/sparsealn.needle BioPerl-1.6.923/t/data/spidey.noalignment BioPerl-1.6.923/t/data/spidey.test1 BioPerl-1.6.923/t/data/sprintf.rnamotif BioPerl-1.6.923/t/data/ssp160.embl.1 BioPerl-1.6.923/t/data/sv40_small.xml BioPerl-1.6.923/t/data/swiss.dat BioPerl-1.6.923/t/data/swisspfam.data BioPerl-1.6.923/t/data/SwissProt.dat BioPerl-1.6.923/t/data/T7.aln BioPerl-1.6.923/t/data/tab1part.mif BioPerl-1.6.923/t/data/tab2part.mif BioPerl-1.6.923/t/data/tab3part.mif BioPerl-1.6.923/t/data/tandem_repeats_finder.dat BioPerl-1.6.923/t/data/tandem_repeats_finder.noresults BioPerl-1.6.923/t/data/tandem_repeats_finder_no_desc.dat BioPerl-1.6.923/t/data/targetp.out BioPerl-1.6.923/t/data/tblastn.out BioPerl-1.6.923/t/data/test 2.txt BioPerl-1.6.923/t/data/test-3.0-1.meme BioPerl-1.6.923/t/data/test-3.0-2.meme BioPerl-1.6.923/t/data/test-4.9.meme BioPerl-1.6.923/t/data/test.abi BioPerl-1.6.923/t/data/test.ace BioPerl-1.6.923/t/data/test.bam BioPerl-1.6.923/t/data/test.bowtie BioPerl-1.6.923/t/data/test.cns.fastq BioPerl-1.6.923/t/data/test.ctf BioPerl-1.6.923/t/data/test.embl BioPerl-1.6.923/t/data/test.embl2sq BioPerl-1.6.923/t/data/test.exp BioPerl-1.6.923/t/data/test.fasta BioPerl-1.6.923/t/data/test.fastq BioPerl-1.6.923/t/data/test.game BioPerl-1.6.923/t/data/test.gcg BioPerl-1.6.923/t/data/test.gcgblast BioPerl-1.6.923/t/data/test.gcgfasta BioPerl-1.6.923/t/data/test.genbank BioPerl-1.6.923/t/data/test.genbank.noseq BioPerl-1.6.923/t/data/test.infernal BioPerl-1.6.923/t/data/test.interpro BioPerl-1.6.923/t/data/test.interpro-go.xml BioPerl-1.6.923/t/data/test.lasergene BioPerl-1.6.923/t/data/test.locuslink BioPerl-1.6.923/t/data/test.maq BioPerl-1.6.923/t/data/test.mase BioPerl-1.6.923/t/data/test.metafasta BioPerl-1.6.923/t/data/test.nh BioPerl-1.6.923/t/data/test.nhx BioPerl-1.6.923/t/data/test.pfam BioPerl-1.6.923/t/data/test.phd BioPerl-1.6.923/t/data/test.pir BioPerl-1.6.923/t/data/test.pln BioPerl-1.6.923/t/data/test.raw BioPerl-1.6.923/t/data/test.ref.fas BioPerl-1.6.923/t/data/test.swiss BioPerl-1.6.923/t/data/test.tab BioPerl-1.6.923/t/data/test.tigrxml BioPerl-1.6.923/t/data/test.tseq BioPerl-1.6.923/t/data/test.tsv BioPerl-1.6.923/t/data/test.txt BioPerl-1.6.923/t/data/test.waba BioPerl-1.6.923/t/data/test.xls BioPerl-1.6.923/t/data/test.ztr BioPerl-1.6.923/t/data/test1.blasttab3 BioPerl-1.6.923/t/data/test1.wublastp BioPerl-1.6.923/t/data/test2.infernal BioPerl-1.6.923/t/data/test2.raw BioPerl-1.6.923/t/data/test_badlf.gcg BioPerl-1.6.923/t/data/test_clear_range.fastq BioPerl-1.6.923/t/data/test_data.axt BioPerl-1.6.923/t/data/test_singlets.cns.fastq BioPerl-1.6.923/t/data/test_singlets.maq BioPerl-1.6.923/t/data/testaln.aln BioPerl-1.6.923/t/data/testaln.arp BioPerl-1.6.923/t/data/testaln.fasta BioPerl-1.6.923/t/data/testaln.fastq BioPerl-1.6.923/t/data/testaln.list BioPerl-1.6.923/t/data/testaln.mase BioPerl-1.6.923/t/data/testaln.metafasta BioPerl-1.6.923/t/data/testaln.msf BioPerl-1.6.923/t/data/testaln.nexus BioPerl-1.6.923/t/data/testaln.pfam BioPerl-1.6.923/t/data/testaln.phylip BioPerl-1.6.923/t/data/testaln.po BioPerl-1.6.923/t/data/testaln.prodom BioPerl-1.6.923/t/data/testaln.psi BioPerl-1.6.923/t/data/testaln.selex BioPerl-1.6.923/t/data/testaln.stockholm BioPerl-1.6.923/t/data/testaln.xmfa BioPerl-1.6.923/t/data/testaln2.arp BioPerl-1.6.923/t/data/testaln2.fasta BioPerl-1.6.923/t/data/testdat.exonerate BioPerl-1.6.923/t/data/testdata.crossmatch BioPerl-1.6.923/t/data/testdbaccnums.out BioPerl-1.6.923/t/data/testfile.erpin BioPerl-1.6.923/t/data/testfuzzy.genbank BioPerl-1.6.923/t/data/tiny.stk BioPerl-1.6.923/t/data/tmhmm.out BioPerl-1.6.923/t/data/tmp.fst BioPerl-1.6.923/t/data/tol-2010-02-18.nhx BioPerl-1.6.923/t/data/traits.tab BioPerl-1.6.923/t/data/traittree.nexus BioPerl-1.6.923/t/data/transfac.dat BioPerl-1.6.923/t/data/tree_nonewline.nexus BioPerl-1.6.923/t/data/Treebase-chlamy-dna.nex BioPerl-1.6.923/t/data/trees.nexml.old.xml BioPerl-1.6.923/t/data/tricky.wublast BioPerl-1.6.923/t/data/trna.strict.rnamotif BioPerl-1.6.923/t/data/U58726.gb BioPerl-1.6.923/t/data/U71225.gb BioPerl-1.6.923/t/data/U71225.gb.unix BioPerl-1.6.923/t/data/U71225.gb.win BioPerl-1.6.923/t/data/U83300.bsml BioPerl-1.6.923/t/data/UnaSmithHIV-both.nex BioPerl-1.6.923/t/data/unigene.data BioPerl-1.6.923/t/data/urease.tre.nexus BioPerl-1.6.923/t/data/version2.scf BioPerl-1.6.923/t/data/version3.scf BioPerl-1.6.923/t/data/wellcome_tol.nhx BioPerl-1.6.923/t/data/withrefm.906 BioPerl-1.6.923/t/data/worm_fam_2785.cdna BioPerl-1.6.923/t/data/X98338_Adh-mRNA.gb BioPerl-1.6.923/t/data/yeast.tRNAscanSE BioPerl-1.6.923/t/data/yn00.mlc BioPerl-1.6.923/t/data/yn00_45.mlc BioPerl-1.6.923/t/data/YP_007988852.gp BioPerl-1.6.923/t/data/ZABJ4EA7014.CH878695.1.blast.txt BioPerl-1.6.923/t/data/bad_dbfa BioPerl-1.6.923/t/data/bad_dbfa/bug3172.fa BioPerl-1.6.923/t/data/bad_dbfa/shotdb.fa BioPerl-1.6.923/t/data/biodbgff BioPerl-1.6.923/t/data/biodbgff/test.gff BioPerl-1.6.923/t/data/biodbgff/test.gff3 BioPerl-1.6.923/t/data/codeml_lysozyme BioPerl-1.6.923/t/data/codeml_lysozyme/2NG.dN BioPerl-1.6.923/t/data/codeml_lysozyme/2NG.dS BioPerl-1.6.923/t/data/codeml_lysozyme/2NG.tt BioPerl-1.6.923/t/data/codeml_lysozyme/4fold.nuc BioPerl-1.6.923/t/data/codeml_lysozyme/lnf BioPerl-1.6.923/t/data/codeml_lysozyme/lysozymeSmall.ctl BioPerl-1.6.923/t/data/codeml_lysozyme/lysozymeSmall.trees BioPerl-1.6.923/t/data/codeml_lysozyme/lysozymeSmall.txt BioPerl-1.6.923/t/data/codeml_lysozyme/mlc BioPerl-1.6.923/t/data/codeml_lysozyme/rst BioPerl-1.6.923/t/data/codeml_lysozyme/rst1 BioPerl-1.6.923/t/data/codeml_lysozyme/rub BioPerl-1.6.923/t/data/consed_project BioPerl-1.6.923/t/data/consed_project/edit_dir BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.contigs BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.log BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1 BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2 BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.log BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.problems BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.qual BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.fasta.screen.view BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.newtags BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.phrap.out BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project.screen.out BioPerl-1.6.923/t/data/consed_project/edit_dir/test_project_to_alu.cross BioPerl-1.6.923/t/data/consed_project/edit_dir/test_projectNewChromats.fof BioPerl-1.6.923/t/data/consed_project/phd_dir BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4922R.phd.1 BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4924F.phd.1 BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4924R.phd.1 BioPerl-1.6.923/t/data/consed_project/phd_dir/ML4947F.phd.1 BioPerl-1.6.923/t/data/dbfa BioPerl-1.6.923/t/data/dbfa/1.fa BioPerl-1.6.923/t/data/dbfa/2.fa BioPerl-1.6.923/t/data/dbfa/3.fa BioPerl-1.6.923/t/data/dbfa/4.fa BioPerl-1.6.923/t/data/dbfa/5.fa BioPerl-1.6.923/t/data/dbfa/6.fa BioPerl-1.6.923/t/data/dbfa/7.fa BioPerl-1.6.923/t/data/dbfa/mixed_alphabet.fasta BioPerl-1.6.923/t/data/dbqual BioPerl-1.6.923/t/data/dbqual/1.qual BioPerl-1.6.923/t/data/dbqual/2.qual BioPerl-1.6.923/t/data/dbqual/3.qual BioPerl-1.6.923/t/data/fastq BioPerl-1.6.923/t/data/fastq/bug2335.fastq BioPerl-1.6.923/t/data/fastq/error_diff_ids.fastq BioPerl-1.6.923/t/data/fastq/error_double_qual.fastq BioPerl-1.6.923/t/data/fastq/error_double_seq.fastq BioPerl-1.6.923/t/data/fastq/error_long_qual.fastq BioPerl-1.6.923/t/data/fastq/error_no_qual.fastq BioPerl-1.6.923/t/data/fastq/error_qual_del.fastq BioPerl-1.6.923/t/data/fastq/error_qual_escape.fastq BioPerl-1.6.923/t/data/fastq/error_qual_null.fastq BioPerl-1.6.923/t/data/fastq/error_qual_space.fastq BioPerl-1.6.923/t/data/fastq/error_qual_tab.fastq BioPerl-1.6.923/t/data/fastq/error_qual_unit_sep.fastq BioPerl-1.6.923/t/data/fastq/error_qual_vtab.fastq BioPerl-1.6.923/t/data/fastq/error_short_qual.fastq BioPerl-1.6.923/t/data/fastq/error_spaces.fastq BioPerl-1.6.923/t/data/fastq/error_tabs.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_at_plus.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_at_qual.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_at_seq.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_in_plus.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_in_qual.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_in_seq.fastq BioPerl-1.6.923/t/data/fastq/error_trunc_in_title.fastq BioPerl-1.6.923/t/data/fastq/evil_wrapping.fastq BioPerl-1.6.923/t/data/fastq/example.fasta BioPerl-1.6.923/t/data/fastq/example.fastq BioPerl-1.6.923/t/data/fastq/example.qual BioPerl-1.6.923/t/data/fastq/illumina_faked.fastq BioPerl-1.6.923/t/data/fastq/sanger_93.fastq BioPerl-1.6.923/t/data/fastq/sanger_faked.fastq BioPerl-1.6.923/t/data/fastq/solexa_example.fastq BioPerl-1.6.923/t/data/fastq/solexa_faked.fastq BioPerl-1.6.923/t/data/fastq/test1_sanger.fastq BioPerl-1.6.923/t/data/fastq/test2_solexa.fastq BioPerl-1.6.923/t/data/fastq/test3_illumina.fastq BioPerl-1.6.923/t/data/fastq/tricky.fastq BioPerl-1.6.923/t/data/fastq/wrapping_issues.fastq BioPerl-1.6.923/t/data/fastq/zero_qual.fastq BioPerl-1.6.923/t/data/map_hem BioPerl-1.6.923/t/data/map_hem/HEM1-HEM12.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM12.fa.revcom BioPerl-1.6.923/t/data/map_hem/HEM1-HEM12.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1-HEM13.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM13.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1-HEM14.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM14.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1-HEM2.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM2.fa.revcom BioPerl-1.6.923/t/data/map_hem/HEM1-HEM2.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1-HEM3.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM3.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1-HEM4.fa BioPerl-1.6.923/t/data/map_hem/HEM1-HEM4.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM1.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM1.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM12-HEM13.fa BioPerl-1.6.923/t/data/map_hem/HEM12-HEM13.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM12-HEM14.fa BioPerl-1.6.923/t/data/map_hem/HEM12-HEM14.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM12-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM12-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM12.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM12.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM13-HEM14.fa BioPerl-1.6.923/t/data/map_hem/HEM13-HEM14.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM13-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM13-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM13.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM13.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM14-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM14-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM14.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM14.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM15.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM15.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM2-HEM12.fa BioPerl-1.6.923/t/data/map_hem/HEM2-HEM12.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM2-HEM13.fa BioPerl-1.6.923/t/data/map_hem/HEM2-HEM13.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM2-HEM14.fa BioPerl-1.6.923/t/data/map_hem/HEM2-HEM14.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM2-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM2-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM2-HEM3.fa BioPerl-1.6.923/t/data/map_hem/HEM2-HEM3.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM2-HEM4.fa BioPerl-1.6.923/t/data/map_hem/HEM2-HEM4.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM2.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM2.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM3-HEM12.fa BioPerl-1.6.923/t/data/map_hem/HEM3-HEM12.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM3-HEM13.fa BioPerl-1.6.923/t/data/map_hem/HEM3-HEM13.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM3-HEM14.fa BioPerl-1.6.923/t/data/map_hem/HEM3-HEM14.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM3-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM3-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM3-HEM4.fa BioPerl-1.6.923/t/data/map_hem/HEM3-HEM4.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM3.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM3.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/HEM4-HEM12.fa BioPerl-1.6.923/t/data/map_hem/HEM4-HEM12.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM4-HEM13.fa BioPerl-1.6.923/t/data/map_hem/HEM4-HEM13.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM4-HEM14.fa BioPerl-1.6.923/t/data/map_hem/HEM4-HEM14.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM4-HEM15.fa BioPerl-1.6.923/t/data/map_hem/HEM4-HEM15.meme.txt BioPerl-1.6.923/t/data/map_hem/HEM4.ups.fa_ BioPerl-1.6.923/t/data/map_hem/HEM4.ups.fa_.revcom BioPerl-1.6.923/t/data/map_hem/yeast.nc.1.freq BioPerl-1.6.923/t/data/mbsout BioPerl-1.6.923/t/data/mbsout/mbsout_infile1 BioPerl-1.6.923/t/data/mbsout/mbsout_infile2 BioPerl-1.6.923/t/data/mbsout/mbsout_infile3 BioPerl-1.6.923/t/data/msout BioPerl-1.6.923/t/data/msout/bad_msout_infile1 BioPerl-1.6.923/t/data/msout/bad_msout_infile2 BioPerl-1.6.923/t/data/msout/msout_infile1 BioPerl-1.6.923/t/data/msout/msout_infile2 BioPerl-1.6.923/t/data/msout/msout_infile3 BioPerl-1.6.923/t/data/msout/msout_infile4 BioPerl-1.6.923/t/data/nexml BioPerl-1.6.923/t/data/nexml/characters.nexml.8.xml BioPerl-1.6.923/t/data/nexml/characters.nexml.xml BioPerl-1.6.923/t/data/nexml/trees.nexml.8.xml BioPerl-1.6.923/t/data/nexml/trees.nexml.xml BioPerl-1.6.923/t/data/registry BioPerl-1.6.923/t/data/registry/bdb BioPerl-1.6.923/t/data/registry/bdb/seqdatabase.ini BioPerl-1.6.923/t/data/registry/flat BioPerl-1.6.923/t/data/registry/flat/seqdatabase.ini BioPerl-1.6.923/t/data/seqfeaturedb BioPerl-1.6.923/t/data/seqfeaturedb/test.gff3 BioPerl-1.6.923/t/data/taxdump BioPerl-1.6.923/t/data/taxdump/names.dmp BioPerl-1.6.923/t/data/taxdump/nodes.dmp BioPerl-1.6.923/t/data/taxonomy BioPerl-1.6.923/t/data/taxonomy/greengenes_taxonomy_16S_candiv_gg_2011_1.txt BioPerl-1.6.923/t/data/taxonomy/silva_SSURef_108_tax_silva_trunc.fasta BioPerl-1.6.923/t/data/transfac_pro BioPerl-1.6.923/t/data/transfac_pro/factor.dat BioPerl-1.6.923/t/data/transfac_pro/fragment.dat BioPerl-1.6.923/t/data/transfac_pro/gene.dat BioPerl-1.6.923/t/data/transfac_pro/matrix.dat BioPerl-1.6.923/t/data/transfac_pro/readme.txt BioPerl-1.6.923/t/data/transfac_pro/reference.dat BioPerl-1.6.923/t/data/transfac_pro/site.dat BioPerl-1.6.923/t/Draw BioPerl-1.6.923/t/Draw/Pictogram.t BioPerl-1.6.923/t/lib BioPerl-1.6.923/t/lib/Error.pm BioPerl-1.6.923/t/LiveSeq BioPerl-1.6.923/t/LiveSeq/Chain.t BioPerl-1.6.923/t/LiveSeq/LiveSeq.t BioPerl-1.6.923/t/LiveSeq/Mutation.t BioPerl-1.6.923/t/LiveSeq/Mutator.t BioPerl-1.6.923/t/LocalDB BioPerl-1.6.923/t/LocalDB/BioDBGFF.t BioPerl-1.6.923/t/LocalDB/Fasta.t BioPerl-1.6.923/t/LocalDB/Flat.t BioPerl-1.6.923/t/LocalDB/Qual.t BioPerl-1.6.923/t/LocalDB/Registry.t BioPerl-1.6.923/t/LocalDB/SeqFeature.t BioPerl-1.6.923/t/LocalDB/transfac_pro.t BioPerl-1.6.923/t/LocalDB/Index BioPerl-1.6.923/t/LocalDB/Index/Blast.t BioPerl-1.6.923/t/LocalDB/Index/BlastTable.t BioPerl-1.6.923/t/LocalDB/Index/Index.t BioPerl-1.6.923/t/LocalDB/Taxonomy BioPerl-1.6.923/t/LocalDB/Taxonomy/greengenes.t BioPerl-1.6.923/t/LocalDB/Taxonomy/silva.t BioPerl-1.6.923/t/Map BioPerl-1.6.923/t/Map/Cyto.t BioPerl-1.6.923/t/Map/Linkage.t BioPerl-1.6.923/t/Map/Map.t BioPerl-1.6.923/t/Map/MapIO.t BioPerl-1.6.923/t/Map/MicrosatelliteMarker.t BioPerl-1.6.923/t/Map/Physical.t BioPerl-1.6.923/t/Matrix BioPerl-1.6.923/t/Matrix/InstanceSite.t BioPerl-1.6.923/t/Matrix/Matrix.t BioPerl-1.6.923/t/Matrix/ProtMatrix.t BioPerl-1.6.923/t/Matrix/ProtPsm.t BioPerl-1.6.923/t/Matrix/SiteMatrix.t BioPerl-1.6.923/t/Matrix/IO BioPerl-1.6.923/t/Matrix/IO/masta.t BioPerl-1.6.923/t/Matrix/IO/psm.t BioPerl-1.6.923/t/Ontology BioPerl-1.6.923/t/Ontology/GOterm.t BioPerl-1.6.923/t/Ontology/GraphAdaptor.t BioPerl-1.6.923/t/Ontology/Ontology.t BioPerl-1.6.923/t/Ontology/OntologyEngine.t BioPerl-1.6.923/t/Ontology/OntologyStore.t BioPerl-1.6.923/t/Ontology/Relationship.t BioPerl-1.6.923/t/Ontology/RelationshipType.t BioPerl-1.6.923/t/Ontology/Term.t BioPerl-1.6.923/t/Ontology/IO BioPerl-1.6.923/t/Ontology/IO/go.t BioPerl-1.6.923/t/Ontology/IO/interpro.t BioPerl-1.6.923/t/Ontology/IO/obo.t BioPerl-1.6.923/t/Phenotype BioPerl-1.6.923/t/Phenotype/Correlate.t BioPerl-1.6.923/t/Phenotype/Measure.t BioPerl-1.6.923/t/Phenotype/MeSH.t BioPerl-1.6.923/t/Phenotype/MiniMIMentry.t BioPerl-1.6.923/t/Phenotype/OMIMentry.t BioPerl-1.6.923/t/Phenotype/OMIMentryAllelicVariant.t BioPerl-1.6.923/t/Phenotype/OMIMparser.t BioPerl-1.6.923/t/Phenotype/Phenotype.t BioPerl-1.6.923/t/PopGen BioPerl-1.6.923/t/PopGen/Coalescent.t BioPerl-1.6.923/t/PopGen/HtSNP.t BioPerl-1.6.923/t/PopGen/MK.t BioPerl-1.6.923/t/PopGen/PopGen.t BioPerl-1.6.923/t/PopGen/PopGenSims.t BioPerl-1.6.923/t/PopGen/TagHaplotype.t BioPerl-1.6.923/t/RemoteDB BioPerl-1.6.923/t/RemoteDB/BioFetch.t BioPerl-1.6.923/t/RemoteDB/CUTG.t BioPerl-1.6.923/t/RemoteDB/EMBL.t BioPerl-1.6.923/t/RemoteDB/EntrezGene.t BioPerl-1.6.923/t/RemoteDB/GenBank.t BioPerl-1.6.923/t/RemoteDB/GenPept.t BioPerl-1.6.923/t/RemoteDB/MeSH.t BioPerl-1.6.923/t/RemoteDB/RefSeq.t BioPerl-1.6.923/t/RemoteDB/SeqHound.t BioPerl-1.6.923/t/RemoteDB/SeqRead_fail.t BioPerl-1.6.923/t/RemoteDB/SeqVersion.t BioPerl-1.6.923/t/RemoteDB/SwissProt.t BioPerl-1.6.923/t/RemoteDB/Taxonomy.t BioPerl-1.6.923/t/RemoteDB/HIV BioPerl-1.6.923/t/RemoteDB/HIV/HIV.t BioPerl-1.6.923/t/RemoteDB/HIV/HIVAnnotProcessor.t BioPerl-1.6.923/t/RemoteDB/HIV/HIVQuery.t BioPerl-1.6.923/t/RemoteDB/HIV/HIVQueryHelper.t BioPerl-1.6.923/t/RemoteDB/Query BioPerl-1.6.923/t/RemoteDB/Query/GenBank.t BioPerl-1.6.923/t/Restriction BioPerl-1.6.923/t/Restriction/Analysis-refac.t BioPerl-1.6.923/t/Restriction/Analysis.t BioPerl-1.6.923/t/Restriction/Gel.t BioPerl-1.6.923/t/Restriction/IO.t BioPerl-1.6.923/t/Root BioPerl-1.6.923/t/Root/Exception.t BioPerl-1.6.923/t/Root/HTTPget.t BioPerl-1.6.923/t/Root/RootI.t BioPerl-1.6.923/t/Root/RootIO.t BioPerl-1.6.923/t/Root/Storable.t BioPerl-1.6.923/t/Root/Tempfile.t BioPerl-1.6.923/t/Root/Utilities.t BioPerl-1.6.923/t/SearchIO BioPerl-1.6.923/t/SearchIO/axt.t BioPerl-1.6.923/t/SearchIO/blast.t BioPerl-1.6.923/t/SearchIO/blast_pull.t BioPerl-1.6.923/t/SearchIO/blasttable.t BioPerl-1.6.923/t/SearchIO/blastxml.t BioPerl-1.6.923/t/SearchIO/CigarString.t BioPerl-1.6.923/t/SearchIO/cross_match.t BioPerl-1.6.923/t/SearchIO/erpin.t BioPerl-1.6.923/t/SearchIO/exonerate.t BioPerl-1.6.923/t/SearchIO/fasta.t BioPerl-1.6.923/t/SearchIO/gmap_f9.t BioPerl-1.6.923/t/SearchIO/hmmer.t BioPerl-1.6.923/t/SearchIO/hmmer_pull.t BioPerl-1.6.923/t/SearchIO/infernal.t BioPerl-1.6.923/t/SearchIO/megablast.t BioPerl-1.6.923/t/SearchIO/psl.t BioPerl-1.6.923/t/SearchIO/rnamotif.t BioPerl-1.6.923/t/SearchIO/SearchIO.t BioPerl-1.6.923/t/SearchIO/sim4.t BioPerl-1.6.923/t/SearchIO/SimilarityPair.t BioPerl-1.6.923/t/SearchIO/Tiling.t BioPerl-1.6.923/t/SearchIO/waba.t BioPerl-1.6.923/t/SearchIO/wise.t BioPerl-1.6.923/t/SearchIO/Writer BioPerl-1.6.923/t/SearchIO/Writer/GbrowseGFF.t BioPerl-1.6.923/t/SearchIO/Writer/HitTableWriter.t BioPerl-1.6.923/t/SearchIO/Writer/HSPTableWriter.t BioPerl-1.6.923/t/SearchIO/Writer/HTMLWriter.t BioPerl-1.6.923/t/SearchIO/Writer/TextWriter.t BioPerl-1.6.923/t/Seq BioPerl-1.6.923/t/Seq/DBLink.t BioPerl-1.6.923/t/Seq/EncodedSeq.t BioPerl-1.6.923/t/Seq/LargeLocatableSeq.t BioPerl-1.6.923/t/Seq/LargePSeq.t BioPerl-1.6.923/t/Seq/LocatableSeq.t BioPerl-1.6.923/t/Seq/MetaSeq.t BioPerl-1.6.923/t/Seq/PrimaryQual.t BioPerl-1.6.923/t/Seq/PrimarySeq.t BioPerl-1.6.923/t/Seq/PrimedSeq.t BioPerl-1.6.923/t/Seq/Quality.t BioPerl-1.6.923/t/Seq/Seq.t BioPerl-1.6.923/t/Seq/SimulatedRead.t BioPerl-1.6.923/t/Seq/WithQuality.t BioPerl-1.6.923/t/SeqFeature BioPerl-1.6.923/t/SeqFeature/Amplicon.t BioPerl-1.6.923/t/SeqFeature/Clone.t BioPerl-1.6.923/t/SeqFeature/Collection.t BioPerl-1.6.923/t/SeqFeature/Computation.t BioPerl-1.6.923/t/SeqFeature/FeaturePair.t BioPerl-1.6.923/t/SeqFeature/Gene.t BioPerl-1.6.923/t/SeqFeature/Generic.t BioPerl-1.6.923/t/SeqFeature/Location.t BioPerl-1.6.923/t/SeqFeature/LocationFactory.t BioPerl-1.6.923/t/SeqFeature/Primer.t BioPerl-1.6.923/t/SeqFeature/Range.t BioPerl-1.6.923/t/SeqFeature/RangeI.t BioPerl-1.6.923/t/SeqFeature/SeqAnalysisParser.t BioPerl-1.6.923/t/SeqFeature/SubSeq.t BioPerl-1.6.923/t/SeqFeature/Unflattener.t BioPerl-1.6.923/t/SeqFeature/Unflattener2.t BioPerl-1.6.923/t/SeqIO BioPerl-1.6.923/t/SeqIO/abi.t BioPerl-1.6.923/t/SeqIO/ace.t BioPerl-1.6.923/t/SeqIO/agave.t BioPerl-1.6.923/t/SeqIO/alf.t BioPerl-1.6.923/t/SeqIO/asciitree.t BioPerl-1.6.923/t/SeqIO/bsml.t BioPerl-1.6.923/t/SeqIO/bsml_sax.t BioPerl-1.6.923/t/SeqIO/chadoxml.t BioPerl-1.6.923/t/SeqIO/chaos.t BioPerl-1.6.923/t/SeqIO/chaosxml.t BioPerl-1.6.923/t/SeqIO/ctf.t BioPerl-1.6.923/t/SeqIO/embl.t BioPerl-1.6.923/t/SeqIO/entrezgene.t BioPerl-1.6.923/t/SeqIO/excel.t BioPerl-1.6.923/t/SeqIO/exp.t BioPerl-1.6.923/t/SeqIO/fasta.t BioPerl-1.6.923/t/SeqIO/fastq.t BioPerl-1.6.923/t/SeqIO/flybase_chadoxml.t BioPerl-1.6.923/t/SeqIO/game.t BioPerl-1.6.923/t/SeqIO/gbxml.t BioPerl-1.6.923/t/SeqIO/gcg.t BioPerl-1.6.923/t/SeqIO/genbank.t BioPerl-1.6.923/t/SeqIO/Handler.t BioPerl-1.6.923/t/SeqIO/interpro.t BioPerl-1.6.923/t/SeqIO/kegg.t BioPerl-1.6.923/t/SeqIO/largefasta.t BioPerl-1.6.923/t/SeqIO/lasergene.t BioPerl-1.6.923/t/SeqIO/locuslink.t BioPerl-1.6.923/t/SeqIO/mbsout.t BioPerl-1.6.923/t/SeqIO/metafasta.t BioPerl-1.6.923/t/SeqIO/msout.t BioPerl-1.6.923/t/SeqIO/MultiFile.t BioPerl-1.6.923/t/SeqIO/Multiple_fasta.t BioPerl-1.6.923/t/SeqIO/nexml.t BioPerl-1.6.923/t/SeqIO/phd.t BioPerl-1.6.923/t/SeqIO/pir.t BioPerl-1.6.923/t/SeqIO/pln.t BioPerl-1.6.923/t/SeqIO/qual.t BioPerl-1.6.923/t/SeqIO/raw.t BioPerl-1.6.923/t/SeqIO/scf.t BioPerl-1.6.923/t/SeqIO/SeqBuilder.t BioPerl-1.6.923/t/SeqIO/SeqIO.t BioPerl-1.6.923/t/SeqIO/seqxml.t BioPerl-1.6.923/t/SeqIO/Splicedseq.t BioPerl-1.6.923/t/SeqIO/strider.t BioPerl-1.6.923/t/SeqIO/swiss.t BioPerl-1.6.923/t/SeqIO/tab.t BioPerl-1.6.923/t/SeqIO/table.t BioPerl-1.6.923/t/SeqIO/tigr.t BioPerl-1.6.923/t/SeqIO/tigrxml.t BioPerl-1.6.923/t/SeqIO/tinyseq.t BioPerl-1.6.923/t/SeqIO/ztr.t BioPerl-1.6.923/t/SeqTools BioPerl-1.6.923/t/SeqTools/Backtranslate.t BioPerl-1.6.923/t/SeqTools/CodonTable.t BioPerl-1.6.923/t/SeqTools/ECnumber.t BioPerl-1.6.923/t/SeqTools/GuessSeqFormat.t BioPerl-1.6.923/t/SeqTools/OddCodes.t BioPerl-1.6.923/t/SeqTools/SeqPattern.t BioPerl-1.6.923/t/SeqTools/SeqStats.t BioPerl-1.6.923/t/SeqTools/SeqUtils.t BioPerl-1.6.923/t/SeqTools/SeqWords.t BioPerl-1.6.923/t/Structure BioPerl-1.6.923/t/Structure/IO.t BioPerl-1.6.923/t/Structure/Structure.t BioPerl-1.6.923/t/Tools BioPerl-1.6.923/t/Tools/AmpliconSearch.t BioPerl-1.6.923/t/Tools/ePCR.t BioPerl-1.6.923/t/Tools/Est2Genome.t BioPerl-1.6.923/t/Tools/FootPrinter.t BioPerl-1.6.923/t/Tools/Geneid.t BioPerl-1.6.923/t/Tools/Genewise.t BioPerl-1.6.923/t/Tools/Genomewise.t BioPerl-1.6.923/t/Tools/Genpred.t BioPerl-1.6.923/t/Tools/GFF.t BioPerl-1.6.923/t/Tools/GuessSeqFormat.t BioPerl-1.6.923/t/Tools/Hmmer.t BioPerl-1.6.923/t/Tools/IUPAC.t BioPerl-1.6.923/t/Tools/Lucy.t BioPerl-1.6.923/t/Tools/Match.t BioPerl-1.6.923/t/Tools/pICalculator.t BioPerl-1.6.923/t/Tools/Primer3.t BioPerl-1.6.923/t/Tools/Promoterwise.t BioPerl-1.6.923/t/Tools/Pseudowise.t BioPerl-1.6.923/t/Tools/QRNA.t BioPerl-1.6.923/t/Tools/RandDistFunctions.t BioPerl-1.6.923/t/Tools/RepeatMasker.t BioPerl-1.6.923/t/Tools/rnamotif.t BioPerl-1.6.923/t/Tools/Seg.t BioPerl-1.6.923/t/Tools/Sigcleave.t BioPerl-1.6.923/t/Tools/Signalp.t BioPerl-1.6.923/t/Tools/Sim4.t BioPerl-1.6.923/t/Tools/SiRNA.t BioPerl-1.6.923/t/Tools/TandemRepeatsFinder.t BioPerl-1.6.923/t/Tools/TargetP.t BioPerl-1.6.923/t/Tools/Tmhmm.t BioPerl-1.6.923/t/Tools/tRNAscanSE.t BioPerl-1.6.923/t/Tools/Alignment BioPerl-1.6.923/t/Tools/Alignment/Consed.t BioPerl-1.6.923/t/Tools/Analysis BioPerl-1.6.923/t/Tools/Analysis/DNA BioPerl-1.6.923/t/Tools/Analysis/DNA/ESEfinder.t BioPerl-1.6.923/t/Tools/Analysis/Protein BioPerl-1.6.923/t/Tools/Analysis/Protein/Domcut.t BioPerl-1.6.923/t/Tools/Analysis/Protein/ELM.t BioPerl-1.6.923/t/Tools/Analysis/Protein/GOR4.t BioPerl-1.6.923/t/Tools/Analysis/Protein/HNN.t BioPerl-1.6.923/t/Tools/Analysis/Protein/Mitoprot.t BioPerl-1.6.923/t/Tools/Analysis/Protein/NetPhos.t BioPerl-1.6.923/t/Tools/Analysis/Protein/Scansite.t BioPerl-1.6.923/t/Tools/Analysis/Protein/Sopma.t BioPerl-1.6.923/t/Tools/EMBOSS BioPerl-1.6.923/t/Tools/EMBOSS/Palindrome.t BioPerl-1.6.923/t/Tools/Phylo BioPerl-1.6.923/t/Tools/Phylo/Gerp.t BioPerl-1.6.923/t/Tools/Phylo/Molphy.t BioPerl-1.6.923/t/Tools/Phylo/PAML.t BioPerl-1.6.923/t/Tools/Phylo/Phylip BioPerl-1.6.923/t/Tools/Phylo/Phylip/ProtDist.t BioPerl-1.6.923/t/Tools/Run BioPerl-1.6.923/t/Tools/Run/Dummy.pm BioPerl-1.6.923/t/Tools/Run/RemoteBlast.t BioPerl-1.6.923/t/Tools/Run/RemoteBlast_rpsblast.t BioPerl-1.6.923/t/Tools/Run/StandAloneBlast.t BioPerl-1.6.923/t/Tools/Run/WBCommandExts.t BioPerl-1.6.923/t/Tools/Run/WrapperBase.t BioPerl-1.6.923/t/Tools/Run/Dummy BioPerl-1.6.923/t/Tools/Run/Dummy/Config.pm BioPerl-1.6.923/t/Tools/Signalp BioPerl-1.6.923/t/Tools/Signalp/ExtendedSignalp.t BioPerl-1.6.923/t/Tools/Spidey BioPerl-1.6.923/t/Tools/Spidey/Spidey.t BioPerl-1.6.923/t/Tree BioPerl-1.6.923/t/Tree/Compatible.t BioPerl-1.6.923/t/Tree/Node.t BioPerl-1.6.923/t/Tree/RandomTreeFactory.t BioPerl-1.6.923/t/Tree/Tree.t BioPerl-1.6.923/t/Tree/TreeIO.t BioPerl-1.6.923/t/Tree/TreeStatistics.t BioPerl-1.6.923/t/Tree/PhyloNetwork BioPerl-1.6.923/t/Tree/PhyloNetwork/Factory.t BioPerl-1.6.923/t/Tree/PhyloNetwork/GraphViz.t BioPerl-1.6.923/t/Tree/PhyloNetwork/MuVector.t BioPerl-1.6.923/t/Tree/PhyloNetwork/PhyloNetwork.t BioPerl-1.6.923/t/Tree/PhyloNetwork/RandomFactory.t BioPerl-1.6.923/t/Tree/PhyloNetwork/TreeFactory.t BioPerl-1.6.923/t/Tree/TreeIO BioPerl-1.6.923/t/Tree/TreeIO/lintree.t BioPerl-1.6.923/t/Tree/TreeIO/newick.t BioPerl-1.6.923/t/Tree/TreeIO/nexml.t BioPerl-1.6.923/t/Tree/TreeIO/nexus.t BioPerl-1.6.923/t/Tree/TreeIO/nhx.t BioPerl-1.6.923/t/Tree/TreeIO/phyloxml.t BioPerl-1.6.923/t/Tree/TreeIO/svggraph.t BioPerl-1.6.923/t/Tree/TreeIO/tabtree.t BioPerl-1.6.923/t/Variation BioPerl-1.6.923/t/Variation/AAChange.t BioPerl-1.6.923/t/Variation/AAReverseMutate.t BioPerl-1.6.923/t/Variation/Allele.t BioPerl-1.6.923/t/Variation/DNAMutation.t BioPerl-1.6.923/t/Variation/RNAChange.t BioPerl-1.6.923/t/Variation/SeqDiff.t BioPerl-1.6.923/t/Variation/SNP.t BioPerl-1.6.923/t/Variation/Variation_IO.t /bin/tar: Read 3072 bytes from - BioPerl-1.6.923/travis_scripts BioPerl-1.6.923/travis_scripts/dependency_installs Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'prepare' Configuring C/CJ/CJFIELDS/BioPerl-1.6.923.tar.gz with Build.PL >>> /home/fly1800/ap1800-297235/bin/perl-static Build.PL could not find ParserDetails.ini in /home/fly1800/cpanfly-5.18/var/megalib/XML/SAX Checking prerequisites... recommends: * GraphViz is not installed Checking optional features... EntrezGene............disabled requires: ! Bio::ASN1::EntrezGene is not installed ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions of the modules indicated above before proceeding with this installation Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts Do you want to run tests that require connection to servers across the internet (likely to cause some failures)? y/n [n] - will not run internet-requiring tests Created MYMETA.yml and MYMETA.json Creating new 'Build' script for 'BioPerl' version '1.006923' CJFIELDS/BioPerl-1.6.923.tar.gz /home/fly1800/ap1800-297235/bin/perl-static Build.PL -- OK Running Build for C/CJ/CJFIELDS/BioPerl-1.6.923.tar.gz Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'make' >>> ./Build Building BioPerl CJFIELDS/BioPerl-1.6.923.tar.gz ./Build -- OK Prepending /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Safari-1.15-6fURQH/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-iCab-1.131-zkvleo/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/PPI-App-ppi_version-BDFOY-0.14-KwZwFg/blib/lib /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/arch /home/fly1800/cpanfly-5.18/var/cpan/build/HTTP-Cookies-Omniweb-1.13-WocZ4J/blib/lib to PERL5LIB for 'test' Running Build test >>> ./Build test verbose=1 t/Align/AlignStats.t ................... 1..45 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::AlignIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::Matrix::PhylipDist' isa 'Bio::Matrix::PhylipDist' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 43 ok 44 - Warn if seqs don't overlap ok 45 ok t/Align/AlignUtil.t .................... 1..47 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqIO; ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok t/Align/Graphics.t ..................... 1..41 ok 1 - use Bio::Align::Graphics; ok 2 - require Bio::Align::Graphics; ok 3 - Bio::Align::Graphics->can(...) ok 4 - input is defined ok 5 - AlignIO object is defined ok 6 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 7 - alignment is there and defined ok 8 - all starts are present ok 9 - all ends are present ok 10 - all colors are present ok 11 - first end is further than first start ok 12 - second end is further than second start ok 13 - third end is further than third start ok 14 - domain labels are present ok 15 - domain starts are present ok 16 - domain ends are present ok 17 - domain colors are present ok 18 - label - first end is further than first start ok 19 - label - second end is further than second start ok 20 - label - third end is further than third start ok 21 - first label start is within domain range ok 22 - second label start is within domain range ok 23 - third label start is within domain range ok 24 - first label end is within domain range ok 25 - second label end is within domain range ok 26 - third label end is within domain range ok 27 - individual labels work ok 28 - An object of class 'Bio::Align::Graphics' isa 'Bio::Align::Graphics' ok 29 - new object is defined ok 30 - pad_bottom is right ok 31 - default pad_top is right ok 32 - start point loaded ok 33 - end point loaded ok 34 - color of domain loaded ok 35 - domain labels loaded ok 36 - label starts loaded ok 37 - label ends loaded ok 38 - label colors loaded ok 39 - labels loaded ok 40 - output file is png ok 41 - wrapping length is not zero ok t/Align/SimpleAlign.t .................. 1..206 ok 1 - use Bio::SimpleAlign; ok 2 - use Bio::AlignIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Location::Simple; ok 5 - use Bio::Location::Split; ok 6 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 7 - pfam input test ok 8 - match_line ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - num_sequences ok 11 - num_sequences ok 12 - select_noncont ok 13 - select_noncont ok 14 - num_sequences ok 15 - select_noncont ok 16 - select_noncont ok 17 - select_noncont_by_name ok 18 - select_noncont_by_name ok 19 - select_noncont_by_name ok 20 - select_noncont_by_name ok 21 - each_seq ok 22 - get_nse ok 23 - id ok 24 - num_gaps ok 25 - each_alphabetically ok 26 - column_from_residue_number ok 27 - display_name get/set ok 28 - display_name get ok 29 - consensus_string ok 30 - consensus_string ok 31 - consensus_string ok 32 ok 33 - each_seq_with_id ok 34 - is_flush ok 35 - id get/set ok 36 - length ok 37 - num_residues ok 38 - num_sequences ok 39 - overall_percentage_identity ok 40 - overall_percentage_identity (align) ok 41 - overall_percentage_identity (short) ok 42 - overall_percentage_identity (long) ok 43 - average_percentage_identity ok 44 ok 45 - set_displayname_count ok 46 ok 47 - set_displayname_flat ok 48 ok 49 - set_displayname_normal ok 50 ok 51 ok 52 - uppercase, map_chars ok 53 - match_line ok 54 - remove_seqs ok 55 - remove_seqs ok 56 - add_seq ok 57 - add_seq ok 58 - get_seq_by_pos ok 59 - get_seq_by_pos ok 60 ok 61 ok 62 ok 63 - purge ok 64 - purge ok 65 - IO::String consensus_iupac ok 66 - IO::String write_aln normal ok 67 - IO::String write_aln slice ok 68 - IO::String write_aln slice ok 69 - IO::String write_aln slice ok 70 - IO::String write_aln slice ok 71 - IO::String write_aln slice ok 72 ok 73 - remove_columns by position ok 74 - remove_columns by position (wrong order) ok 75 - cigar_line ok 76 - cigar_line ok 77 - cigar_line ok 78 - cigar_line ok 79 - sort_alphabetically - before ok 80 ok 81 - sort_alphabetically - after ok 82 - remove_gaps ok 83 - remove_gaps all_gaps_only ok 84 - set_new_reference ok 85 - set_new_reference ok 86 - uniq_seq ok 87 - bug 2099 ok 88 - bug 2099 ok 89 - bug 2793 ok 90 - bug 2793 ok 91 - bug 2793 ok 92 - bug 2793 ok 93 - Bad sequence, bad! ok 94 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 95 - added 3 seqs ok 96 - first 2 features added ok 97 - 3rd feature added ok 98 ok 99 - slice 1 len ok 100 - correct masked seq ok 101 - correct masked seq ok 102 - correct masked seq ok 103 ok 104 - slice 2 len ok 105 - correct masked seq ok 106 - correct masked seq ok 107 - correct masked seq ok 108 ok 109 - slice 3 len ok 110 - correct masked seq ok 111 - correct masked seq ok 112 - correct masked seq ok 113 ok 114 - slice 4 len ok 115 - correct masked seq ok 116 - correct masked seq ok 117 - correct masked seq ok 118 - initial display id ok ok 119 - safe display id ok ok 120 - restored display id ok ok 121 - sort by list ok ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 - BIC:GGATCCATT[C/C]CTACT ok 129 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT ok 130 - BIC:G[G/C]ATCCATT[C/G]CTACT ok 131 - BIC:GGATCCATT[C/G]CTACT ok 132 - BIC:GGATCCATT[C/G]CTAC[T/A] ok 133 - BIC:GGATCCATT[C/G]CTA[C/G][T/A] ok 134 - BIC:GGATCCATT[C/G]CTACT ok 135 - BIC:GGATCCATT{C.C}CTACT ok 136 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT ok 137 - BIC:G{G.C}ATCCATT{C.G}CTACT ok 138 - BIC:GGATCCATT{C.G}CTACT ok 139 - BIC:GGATCCATT{C.G}CTAC{T.A} ok 140 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A} ok 141 - BIC:GGATCCATT{C.G}CTACT ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 200 - consensus string looks ok ok 201 - conservation length ok 202 - conservation scores ok 203 - looks like correct unmasked alignment (from clustalw) ok 204 - looks like correct masked alignment (from clustalw) ok 205 ok 206 - align after looks ok ok t/Align/TreeBuild.t .................... 1..13 ok 1 - use Bio::Align::DNAStatistics; ok 2 - use Bio::Align::ProteinStatistics; ok 3 - use Bio::Align::Utilities; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Tree::DistanceFactory; ok 6 - use Bio::TreeIO; ok 7 - 'SimpleAlign object parsed out' isa 'Bio::SimpleAlign' ok 8 - 'Protein distance matrix retrieved' isa 'Bio::Matrix::MatrixI' ok 9 - 'Tree object gotten back' isa 'Bio::Tree::TreeI' ok 10 - NJ calculated Branch length ok 11 - NJ calculated Branch length ok 12 - Make sure two nodes are sister ok 13 - 10 replicates formulated ok t/Align/Utilities.t .................... 1..13 ok 1 - use Bio::Align::Utilities; ok 2 - use Bio::SimpleAlign; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::AlignIO; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok t/AlignIO/AlignIO.t .................... 1..29 ok 1 - use Bio::AlignIO; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::AnnotatableI' ok 3 - input filehandle method test : prodom ok 4 - input filehandle method test : mase ok 5 - input filehandle method test : po ok 6 - input filehandle method test : stockholm ok 7 - input filehandle method test : pfam ok 8 - input filehandle method test : selex ok 9 - input filehandle method test : nexus ok 10 - input filehandle method test : psi ok 11 - input filehandle method test : clustalw ok 12 - input filehandle method test : metafasta ok 13 - input filehandle method test : arp ok 14 - input filehandle method test : xmfa ok 15 - input filehandle method test : msf ok 16 - input filehandle method test : phylip ok 17 - input filehandle method test : fasta ok 18 - filehandle output test : po ok 19 - filehandle output test : stockholm ok 20 - filehandle output test : pfam ok 21 - filehandle output test : selex ok 22 - filehandle output test : nexus ok 23 - filehandle output test : psi ok 24 - filehandle output test : clustalw ok 25 - filehandle output test : metafasta ok 26 - filehandle output test : xmfa ok 27 - filehandle output test : msf ok 28 - filehandle output test : phylip ok 29 - filehandle output test : fasta ok t/AlignIO/arp.t ........................ 1..48 ok 1 - use Bio::AlignIO::arp; ok 2 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 - ARP get_nse() ok 5 ok 6 - ARP num_sequences() ok 7 - ARP id() ok 8 - ARP description() ok 9 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 10 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::arp' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 - ARP get_nse() ok 18 - ARP num_sequences() ok 19 - ARP id() ok 20 - ARP description() ok 21 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 22 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 23 ok 24 ok 25 ok 26 ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - ARP get_nse() ok 29 - ARP num_sequences() ok 30 - ARP id() ok 31 - ARP description() ok 32 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 33 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 34 ok 35 ok 36 ok 37 ok 38 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 39 - ARP get_nse() ok 40 - ARP num_sequences() ok 41 - ARP id() ok 42 - ARP description() ok 43 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 44 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 45 ok 46 ok 47 ok 48 ok t/AlignIO/bl2seq.t ..................... 1..7 ok 1 - use Bio::AlignIO::bl2seq; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - BLAST bl2seq format test ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 ok t/AlignIO/clustalw.t ................... 1..6 ok 1 - use Bio::AlignIO::clustalw; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - clustalw consensus_string test ok 4 - clustalw (.aln) output test ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - clustalw (.aln) input test ok t/AlignIO/emboss.t ..................... 1..37 ok 1 - use Bio::AlignIO::emboss; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 19 ok 20 ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 33 ok 34 ok 35 ok 36 ok 37 ok t/AlignIO/fasta.t ...................... 1..10 ok 1 - use Bio::AlignIO::fasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for end ok 7 - fasta input test for description ok 8 - fasta output test ok 9 - filehandle input test ok 10 - filehandle output test ok t/AlignIO/largemultifasta.t ............ 1..7 ok 1 - use Bio::AlignIO::largemultifasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - fasta input test ok 4 - fasta input test for description ok 5 - fasta input test for id ok 6 - fasta input test for description ok 7 - fasta output test ok t/AlignIO/maf.t ........................ 1..11 ok 1 - use Bio::AlignIO::maf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - maf input test ok 4 ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 6 - maf input test ok 7 ok 8 - maf input test ok 9 ok 10 - maf input test ok 11 ok t/AlignIO/mase.t ....................... 1..3 ok 1 - use Bio::AlignIO::mase; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - mase input test ok t/AlignIO/mega.t ....................... 1..6 ok 1 - use Bio::AlignIO::mega; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 ok 5 ok 6 - mega output test ok t/AlignIO/meme.t ....................... 1..20 ok 1 - use Bio::AlignIO::meme; ok 2 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::AlignIO::meme' isa 'Bio::AlignIO' ok 16 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 17 ok 18 ok 19 ok 20 ok t/AlignIO/metafasta.t .................. 1..4 ok 1 - use Bio::AlignIO::metafasta; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - consensus_string on metafasta ok 4 - symbol_chars() using metafasta ok t/AlignIO/msf.t ........................ 1..4 ok 1 - use Bio::AlignIO::msf; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - msf input test ok 4 - msf output test ok # WARNING: NeXML parsing for NeXML v0.9 is currently very experimental support t/AlignIO/nexml.t ...................... 1..125 ok 1 - use Bio::AlignIO::nexml; ok 2 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 3 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 4 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 5 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 6 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 7 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 8 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 9 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 10 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 11 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 12 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 13 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 14 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 15 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 16 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 17 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 18 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 19 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 20 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 21 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 22 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 23 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 24 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 25 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 26 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 27 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 28 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 29 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 30 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 31 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 32 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 33 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 34 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 35 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 36 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 37 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 38 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 39 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 40 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 41 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 42 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 43 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 44 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 45 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 46 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 47 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 48 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 49 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 50 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 51 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 52 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 53 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 54 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 55 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 56 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 57 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 58 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 59 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 60 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 61 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 62 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 63 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 64 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 65 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 66 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 67 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 68 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 69 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 70 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 71 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 72 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 73 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 74 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 75 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 76 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 77 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 78 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 79 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 80 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 81 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 82 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 83 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 84 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 85 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 86 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 87 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 88 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 89 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 90 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 91 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 92 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 93 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 94 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 95 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 96 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 97 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 98 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 99 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 100 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 101 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 102 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 103 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 104 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 105 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 106 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 107 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 108 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 109 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 110 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 111 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 112 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 113 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 114 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 115 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 116 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 117 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 118 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 119 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 120 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 121 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 122 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 123 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 124 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok 125 # skip NeXML parsing for NeXML v0.9 is currently very experimental support ok t/AlignIO/nexus.t ...................... 1..43 ok 1 - use Bio::AlignIO::nexus; ok 2 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - nexus output test ok 6 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 11 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 12 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 15 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 16 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 17 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 18 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 19 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 20 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 21 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 22 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 23 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 24 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 25 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 26 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 27 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 28 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 31 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 32 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 33 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 34 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 35 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 36 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 37 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 38 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 40 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 41 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 42 - An object of class 'Bio::AlignIO::nexus' isa 'Bio::AlignIO' ok 43 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok t/AlignIO/pfam.t ....................... 1..5 ok 1 - use Bio::AlignIO::pfam; ok 2 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - pfam output test ok t/AlignIO/phylip.t ..................... 1..17 ok 1 - use Bio::AlignIO::phylip; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 ok 4 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 - phylip output test ok 12 ok 13 ok 14 not ok 15 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 81. # got: undef # expected: '0' not ok 16 # TODO problems with default strand, length? # Failed (TODO) test at t/AlignIO/phylip.t line 82. # got: '50' # expected: '47' ok 17 - newline between header and sequences is parsed correctly ok t/AlignIO/po.t ......................... 1..11 ok 1 - use Bio::AlignIO::po; ok 2 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 - An object of class 'Bio::AlignIO::clustalw' isa 'Bio::AlignIO' ok 6 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 7 - po output test ok 8 - An object of class 'Bio::AlignIO::po' isa 'Bio::AlignIO' ok 9 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 10 ok 11 ok t/AlignIO/prodom.t ..................... 1..3 ok 1 - use Bio::AlignIO::prodom; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - prodom input test ok t/AlignIO/psi.t ........................ 1..5 ok 1 - use Bio::AlignIO::psi; ok 2 - An object of class 'Bio::AlignIO::psi' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok t/AlignIO/selex.t ...................... 1..4 ok 1 - use Bio::AlignIO::selex; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - selex format test ok 4 - selex output test ok t/AlignIO/stockholm.t .................. 1..87 ok 1 - use Bio::AlignIO::stockholm; ok 2 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO' ok 3 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 10 - Stockholm annotation ok 11 - Stockholm annotation ok 12 - stockholm output test ok 13 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 - 'Stockholm annotation' isa 'Bio::Annotation::Reference' ok 21 - Stockholm annotation ok 22 - Stockholm annotation ok 23 - Stockholm annotation ok 24 - Stockholm annotation ok 25 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 26 - Rfam meta data ok 27 - Rfam meta data ok 28 ok 29 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 36 - Rfam meta data ok 37 - Rfam meta data ok 38 - An object of class 'Bio::AlignIO::stockholm' isa 'Bio::AlignIO' ok 39 ok 40 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 41 ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 46 - Pfam annotation ok 47 ok 48 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 49 ok 50 ok 51 ok 52 ok 53 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::MetaI' ok 60 - Pfam aln meta data ok 61 - Pfam aln meta data ok 62 - Pfam aln meta data ok 63 - Pfam aln meta data ok 64 - Pfam aln meta data ok 65 - Pfam aln meta data ok 66 - Pfam seq meta data ok 67 - Pfam seq meta data ok 68 - Pfam seq meta data ok 69 - Pfam seq meta data ok 70 ok 71 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI' ok 72 - An object of class 'Bio::Seq::Meta' isa 'Bio::Seq::Meta' ok 73 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 74 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::DBLink' ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok t/AlignIO/xmfa.t ....................... 1..30 ok 1 - use Bio::AlignIO::xmfa; ok 2 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 3 - xmfa input test ok 4 - xmfa input test for start ok 5 - xmfa input test for end ok 6 - xmfa strand test ok 7 - xmfa input test for id ok 8 - xmfa input test for id ok 9 - xmfa input test ok 10 - xmfa input test for start ok 11 - xmfa input test for end ok 12 - xmfa strand test ok 13 - xmfa input test for id ok 14 - xmfa input test for id ok 15 - xmfa input test ok 16 - xmfa input test for start ok 17 - xmfa input test for end ok 18 - xmfa strand test ok 19 - xmfa input test for id ok 20 - xmfa input test for id ok 21 - xmfa alignment score ok 22 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 23 - xmfa input test ok 24 - xmfa strand ok 25 - xmfa input test for description ok 26 - xmfa input test for id ok 27 - xmfa input test for end ok 28 - xmfa input test for end ok 29 - xmfa alignment score ok 30 - xmfa output test ok t/Alphabet.t ........................... 1..100 ok 1 - use Bio::Symbol::Alphabet; ok 2 - use Bio::Symbol::Symbol; ok 3 - use Bio::Symbol::DNAAlphabet; ok 4 - use Bio::Symbol::ProteinAlphabet; ok 5 - An object of class 'Bio::Symbol::Alphabet' isa 'Bio::Symbol::Alphabet' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Symbol::DNAAlphabet' isa 'Bio::Symbol::AlphabetI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - An object of class 'Bio::Symbol::ProteinAlphabet' isa 'Bio::Symbol::AlphabetI' ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok t/Annotation/Annotation.t .............. 1..152 ok 1 - use Bio::Annotation::Collection; ok 2 - use Bio::Annotation::DBLink; ok 3 - use Bio::Annotation::Comment; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Annotation::SimpleValue; ok 6 - use Bio::Annotation::Target; ok 7 - use Bio::Annotation::AnnotationFactory; ok 8 - use Bio::Annotation::StructuredValue; ok 9 - use Bio::Annotation::TagTree; ok 10 - use Bio::Annotation::Tree; ok 11 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::AnnotationI' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Annotation::DBLink' isa 'Bio::AnnotationI' ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 23 ok 24 ok 25 - An object of class 'Bio::Annotation::Target' isa 'Bio::AnnotationI' ok 26 ok 27 - An object of class 'Bio::Annotation::Reference' isa 'Bio::AnnotationI' ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::AnnotationI' ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 66 ok 67 ok 68 ok 69 ok 70 - An object of class 'Bio::Annotation::StructuredValue' isa 'Bio::Annotation::StructuredValue' ok 71 ok 72 ok 73 ok 74 ok 75 - use Bio::Annotation::OntologyTerm; ok 76 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::Term' ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 - 'isa SeqFeatureI' isa 'Bio::SeqFeatureI' ok 83 - 'isa AnnotatableI' isa 'Bio::AnnotatableI' ok 84 - 'isa SeqFeatureI' isa 'Bio::SeqFeatureI' ok 85 - 'isa AnnotatableI' isa 'Bio::AnnotatableI' ok 86 - An object of class 'Bio::Annotation::AnnotationFactory' isa 'Bio::Factory::ObjectFactoryI' ok 87 - An object of class 'Bio::Annotation::SimpleValue' isa 'Bio::Annotation::SimpleValue' ok 88 ok 89 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Annotation::OntologyTerm' ok 90 - Bio::Annotation::Comment ok 91 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 92 ok 93 - Bio::Annotation::Comment ok 94 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 95 - Bio::Annotation::Comment ok 96 - An object of class 'Bio::Annotation::Comment' isa 'Bio::Annotation::Comment' ok 97 ok 98 - An object of class 'Bio::Annotation::Target' isa 'Bio::Annotation::Target' ok 99 ok 100 ok 101 - An object of class 'Bio::Annotation::Tree' isa 'Bio::AnnotationI' ok 102 - tree_id() ok 103 - tagname() ok 104 ok 105 - add tree to AlignI ok 106 - get seq from node id ok 107 ok 108 - An object of class 'Bio::Annotation::Tree' isa 'Bio::Annotation::Tree' ok 109 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 110 - default itext ok 111 - roundtrip ok 112 - itext ok 113 - spxr ok 114 - indent ok 115 - xml ok 116 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 117 ok 118 - child changes ok 119 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 120 ok 121 - child changes ok 122 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 123 ok 124 - child changes ok 125 - child changes in parent node ok 126 - no tags ok 127 - before Stag node ok 128 - after Stag node ok 129 - both stag nodes ok 130 - different instances ok 131 - before TagTree ok 132 - after TagTree ok 133 - both stag nodes ok 134 - different instances ok 135 - before TagTree ok 136 - after TagTree ok 137 - stag nodes ok 138 - same instance ok 139 - before TagTree ok 140 - after TagTree ok 141 - stag nodes ok 142 - different instance ok 143 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::AnnotationI' ok 144 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 145 - child changes ok 146 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 147 - child changes ok 148 - An object of class 'Data::Stag::StagImpl' isa 'Data::Stag::StagI' ok 149 - child changes ok 150 ok 151 ok 152 - An object of class 'Bio::Annotation::TagTree' isa 'Bio::Annotation::TagTree' ok t/Annotation/AnnotationAdaptor.t ....... 1..23 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::AnnotationAdaptor; ok 3 - use Bio::Annotation::DBLink; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Assembly/ContigSpectrum.t ............ 1..239 ok 1 - use Bio::Assembly::IO; ok 2 - use Bio::Assembly::Tools::ContigSpectrum; ok 3 - An object of class 'Bio::Assembly::IO::tigr' isa 'Bio::Assembly::IO' ok 4 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold' ok 5 - get/set methods ok 6 - An object of class 'Bio::Assembly::Tools::ContigSpectrum' isa 'Bio::Assembly::Tools::ContigSpectrum' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - simple spectrum ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - contig spectrum score ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 - mixed contig spectrum ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 - dissolved contig spectrum ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 - cross-contig spectrum ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 - cross-contig spectrum ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 - cross-contig spectrum ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 - contig spectrum sum ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - average contig spectrum ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 - drop assembly ok 190 ok 191 - An object of class 'Bio::Assembly::IO::ace' isa 'Bio::Assembly::IO' ok 192 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold' ok 193 - large contig spectrum ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 - 74.7485808732225 ok 207 - 74.7485808732225 ok 208 - large cross-contig spectrum ok 209 ok 210 - 88.7692307692308 ok 211 - 88.7692307692308 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 - one contig at a time ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok t/Assembly/IO/bowtie.t ................. skipped: The optional module Bio::DB::Sam (or dependencies thereof) was not installed t/Assembly/IO/sam.t .................... skipped: The optional module Bio::DB::Sam (or dependencies thereof) was not installed t/Assembly/core.t ...................... 1..890 ok 1 - use Bio::Seq; ok 2 - use Bio::LocatableSeq; ok 3 - use Bio::Seq::Quality; ok 4 - use Bio::Assembly::IO; ok 5 - use Bio::Assembly::Singlet; ok 6 - singlet from Bio::PrimarySeq ok 7 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 8 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Singlet' ok 9 ok 10 ok 11 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 - singlet from Bio::Seq::Quality ok 25 ok 26 ok 27 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::QualI' ok 28 ok 29 - singlet from LocatableSeq ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 - singlet from LocatableSeq with set coordinates ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - consed ok 49 ok 50 ok 51 ok 52 ok 53 - An object of class 'Bio::Assembly::IO::phrap' isa 'Bio::Assembly::IO' ok 54 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 55 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 56 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 57 - An object of class 'Bio::Assembly::IO::phrap' isa 'Bio::Assembly::IO' not ok 58 # TODO phrap parser doesn't include the sequence string in the sequence objects. # Failed (TODO) test at t/Assembly/core.t line 126. ok 59 ok 60 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold' ok 61 ok 62 ok 63 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 64 - no annotations in Annotation collection? ok 65 ok 66 ok 67 - get_nof_singlets ok 68 - get_contig_seq_ids ok 69 - get_contig_ids ok 70 - get_singlet_ids ok 71 - 'the contig is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 72 - 'the singlet is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 73 - 'the singlet is a Bio::Assembly::Singlet' isa 'Bio::Assembly::Singlet' ok 74 - get_contig_seq_ids ok 75 ok 76 ok 77 ok 78 - get_contig_ids ok 79 ok 80 ok 81 - get_singlet_ids ok 82 ok 83 ok 84 ok 85 - get_all_seq_ids ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 - contig features ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - get_nof_singlets ok 100 - get_contig_seq_ids ok 101 - get_contig_ids ok 102 - get_singlet_ids ok 103 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 104 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 105 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 106 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 107 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 108 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 109 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 110 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 111 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 112 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 113 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 114 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 115 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 116 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 117 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 118 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 119 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 120 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 121 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 122 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 123 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 124 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 125 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 126 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 127 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 128 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 129 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 130 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 131 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 132 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 133 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 134 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 135 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 136 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 137 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 138 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 139 ok 140 - 'the contig is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 - get_nof_singlets ok 147 - 'the singlet is a Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 148 - 'the singlet is a Bio::Assembly::Singlet' isa 'Bio::Assembly::Singlet' ok 149 - get_contig_seq_ids ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 - get_contig_ids ok 158 ok 159 ok 160 ok 161 ok 162 - get_singlet_ids ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 - get_all_seq_ids ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 - 454 ACE variant coordinates check ok 240 ok 241 - 454 ACE variant consensus check ok 242 ok 243 ok 244 ok 245 ok 246 - writing in the ACE format ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 253 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 254 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 255 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 256 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 257 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 258 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 259 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 260 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 261 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 262 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 263 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 264 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 265 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 266 - An object of class 'Bio::Assembly::Scaffold' isa 'Bio::Assembly::Scaffold' ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 275 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 276 ok 277 ok 278 ok 279 - An object of class 'Bio::Annotation::Collection' isa 'Bio::AnnotationCollectionI' ok 280 - no annotations in Annotation collection? ok 281 - writing in the TIGR format ok 282 - init maq IO object ok 283 - get maq assy ok 284 - got all contigs ok 285 - read test file as text ok 286 - recorded all maq reads ok 287 - no singlets ok 288 ok 289 - An object of class 'Bio::Assembly::IO::maq' isa 'Bio::Assembly::IO' ok 290 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 291 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 292 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 293 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 294 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 295 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 296 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 297 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 298 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 299 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 300 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 301 ok 302 - get maq assy ok 303 - An object of class 'Bio::Assembly::IO::maq' isa 'Bio::Assembly::IO' ok 304 - get_contig_seq_ids ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 ok 415 ok 416 ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 - get_contig_ids ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 - get_singlet_ids ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 - get_all_seq_ids ok 598 ok 599 ok 600 ok 601 ok 602 ok 603 ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 851 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 852 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 853 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 854 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 855 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 856 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 857 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 858 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 859 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 860 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 861 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 862 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 863 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 864 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 865 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 866 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 867 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 868 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 869 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 870 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 871 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 872 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 873 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 874 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 875 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 876 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 877 - An object of class 'Bio::Assembly::Singlet' isa 'Bio::Assembly::Contig' ok 878 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 879 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 880 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 881 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 882 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 883 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 884 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 885 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 886 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 887 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 888 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 889 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok 890 - An object of class 'Bio::Assembly::Contig' isa 'Bio::Assembly::Contig' ok t/Cluster/UniGene.t .................... 1..2 ok 1 - use Bio::Cluster::UniGene; ok 2 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::AnnotatableI' ok t/ClusterIO/ClusterIO.t ................ 1..12 ok 1 - use Bio::ClusterIO; ok 2 - use Bio::Cluster::ClusterFactory; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok 12 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok t/ClusterIO/SequenceFamily.t ........... 1..17 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Cluster::SequenceFamily; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/ClusterIO/unigene.t .................. 1..73 ok 1 - use Bio::ClusterIO; ok 2 - new Bio::ClusterIO object defined ok 3 ok 4 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::Cluster::UniGeneI' ok 5 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::ClusterI' ok 6 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::IdentifiableI' ok 7 - An object of class 'Bio::Cluster::UniGene' isa 'Bio::DescribableI' ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 49 ok 50 ok 51 - annotation object defined ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::PrimarySeqI' ok 67 ok 68 - next cluster ok 69 ok 70 ok 71 ok 72 ok 73 ok t/Coordinate/CoordinateBoundaryTest.t .. 1..174 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 ok 4 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 5 ok 6 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 7 ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 9 ok 10 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 11 ok 12 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 33 ok 34 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 35 ok 36 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 51 ok 52 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 53 ok 54 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 69 ok 70 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 71 ok 72 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 89 ok 90 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 91 ok 92 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 109 ok 110 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 111 ok 112 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 113 ok 114 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 115 ok 116 - An object of class 'Bio::Coordinate::Pair' isa 'Bio::Coordinate::Pair' ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 133 ok 134 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 143 ok 144 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 153 ok 154 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 165 ok 166 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok t/Coordinate/CoordinateGraph.t ......... 1..7 ok 1 - use Bio::Coordinate::Graph; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok t/Coordinate/CoordinateMapper.t ........ 1..175 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::Result::Match; ok 4 - use Bio::Coordinate::Result::Gap; ok 5 - use Bio::Coordinate::Chain; ok 6 - use Bio::Coordinate::Collection; ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Coordinate::Result' ok 15 - An object of class 'Bio::Coordinate::Result' isa 'Bio::Location::SplitLocationI' ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::LocationI' ok 20 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match' ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::Coordinate::Result::Gap' ok 38 - An object of class 'Bio::Coordinate::Result::Gap' isa 'Bio::LocationI' ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Coordinate::Result::Match' ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Match: |314696| Test: 314696| ok 139 ok 140 ok 141 ok 142 - Match: |341| Test: 341| ok 143 ok 144 ok 145 ok 146 - Match: |315843| Test: 315843| ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 - Match: |627011| Test: 627011| ok 153 ok 154 ok 155 ok 156 - Match: |chr1| Test: chr1| ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok t/Coordinate/GeneCoordinateMapper.t .... 1..116 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Coordinate::Pair; ok 3 - use Bio::Coordinate::ExtrapolatingPair; ok 4 - use Bio::Coordinate::GeneMapper; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple' ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 - An object of class 'Bio::Coordinate::Result::Match' isa 'Bio::Location::Simple' ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/Draw/Pictogram.t ..................... 1..6 ok 1 - use Bio::Draw::Pictogram; ok 2 - use Bio::SeqIO; ok 3 - use Bio::Matrix::PSM::IO; ok 4 - An object of class 'Bio::Draw::Pictogram' isa 'Bio::Draw::Pictogram' ok 5 ok 6 ok t/LiveSeq/Chain.t ...................... 1..45 ok 1 - use Bio::LiveSeq::Chain; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok t/LiveSeq/LiveSeq.t .................... 1..48 ok 1 - use Bio::LiveSeq::IO::BioPerl; ok 2 ok 3 ok 4 - Bio::LiveSeq::Gene ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok t/LiveSeq/Mutation.t ................... 1..19 ok 1 - use Bio::LiveSeq::Mutation; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/LiveSeq/Mutator.t .................... 1..24 ok 1 - use Bio::LiveSeq::Mutator; ok 2 - use Bio::LiveSeq::IO::BioPerl; ok 3 - use Bio::Variation::IO; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok You are loading a Bio::DB::GFF database with GFF3 formatted data. While this will likely work fine, the Bio::DB::GFF schema does not always faithfully capture the complexity represented in GFF3 files. Unless you have a specific reason for using Bio::DB::GFF, we suggest that you use a Bio::DB::SeqFeature::Store database and its corresponding loader, bp_seqfeature_load.pl. t/LocalDB/BioDBGFF.t ................... 1..275 ok 1 - use Bio::DB::GFF; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 # skip fetch_feature_by_gid() not implemented by this adaptor ok 102 # skip fetch_feature_by_gid() not implemented by this adaptor ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 # skip delete_groups() not implemented by this adaptor ok 133 # skip delete_groups() not implemented by this adaptor ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 # skip fetch_feature_by_gid() not implemented by this adaptor ok 239 # skip fetch_feature_by_gid() not implemented by this adaptor ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 # skip preferred groups are not supported by gff3 ok 247 # skip preferred groups are not supported by gff3 ok 248 # skip preferred groups are not supported by gff3 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 # skip delete_groups() not implemented by this adaptor ok 270 # skip delete_groups() not implemented by this adaptor ok 271 ok 272 ok 273 ok 274 ok 275 ok t/LocalDB/Fasta.t ...................... 1..107 ok 1 - Index a directory ok 2 ok 3 - An object of class 'Bio::DB::Fasta' isa 'Bio::DB::Fasta' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 29 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - bug 3126 ok 38 ok 39 ok 40 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 41 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 42 ok 43 ok 44 ok 45 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeq::Fasta' ok 46 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 47 ok 48 ok 49 - use Class::Unload; ok 50 - Re-open an existing index ok 51 ok 52 - Tied hash access ok 53 ok 54 ok 55 ok 56 ok 57 - Writing with SeqIO ok 58 ok 59 ok 60 - Index a single file ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 - Make single ID ok 89 ok 90 ok 91 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 92 - Make multiple IDs, bug \#3389 ok 93 ok 94 ok 95 - An object of class 'Bio::PrimarySeq::Fasta' isa 'Bio::PrimarySeqI' ok 96 - Index a set of files ok 97 ok 98 ok 99 ok 100 ok 101 - threw Regexp ((?^:FASTA header doesn't match)) ok 102 - threw Regexp ((?^:Blank lines can only precede header lines)) ok 103 ok 104 - length is correct in sequences past spaces ok 105 ok 106 - subseq is correct ok 107 - subseq is correct ok t/LocalDB/Flat.t ....................... 1..25 ok 1 - use Bio::DB::Flat; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok t/LocalDB/Index/Blast.t ................ 1..26 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::Blast; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok t/LocalDB/Index/BlastTable.t ........... 1..27 ok 1 - use Cwd; ok 2 - use Bio::SearchIO; ok 3 - use Bio::Index::BlastTable; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/LocalDB/Index/Index.t ................ 1..69 ok 1 - use Bio::Index::Fasta; ok 2 - use Bio::Index::Qual; ok 3 - use Bio::Index::SwissPfam; ok 4 - use Bio::Index::EMBL; ok 5 - use Bio::Index::GenBank; ok 6 - use Bio::Index::Stockholm; ok 7 - use Bio::Index::Swissprot; ok 8 - use Bio::DB::InMemoryCache; ok 9 - use Bio::DB::InMemoryCache; ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - An object of class 'Bio::Index::Stockholm' isa 'Bio::Index::Stockholm' ok 68 ok 69 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok t/LocalDB/Qual.t ....................... 1..56 ok 1 - use Bio::Root::IO; ok 2 - use File::Copy; ok 3 ok 4 ok 5 - An object of class 'Bio::DB::Qual' isa 'Bio::DB::Qual' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 23 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 38 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::QualI' ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual::Qual' ok 43 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 44 ok 45 ok 46 ok 47 ok 48 - An object of class 'Bio::DB::Indexed::Stream' isa 'Bio::DB::Indexed::Stream' ok 49 ok 50 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 51 ok 52 - An object of class 'Bio::Seq::PrimaryQual::Qual' isa 'Bio::Seq::PrimaryQual' ok 53 ok 54 ok 55 ok 56 ok t/LocalDB/Registry.t ................... 1..14 ok 1 - use Bio::DB::Registry; ok 2 - use Bio::DB::Flat; ok 3 ok 4 ok 5 ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok t/LocalDB/SeqFeature.t ................. 1..116 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::DB::SeqFeature::Store; ok 3 - use Bio::DB::SeqFeature::Store::GFF3Loader; ok 4 - use Bio::Root::IO; ok 5 - use Bio::DB::Fasta; ok 6 - use File::Copy; ok 7 ok 8 ok 9 ok 10 - adding a feature ok 11 ok 12 ok 13 ok 14 - adding a feature with no primary_id ok 15 ok 16 - searching for a feature that shouldnt exist ok 17 - simple type ok 18 - base type with colon ok 19 - base type alone ok 20 - queried types are not interpolated ok 21 ok 22 ok 23 - An object of class 'Bio::DB::GFF::Typename' isa 'Bio::DB::GFF::Typename' ok 24 - feature deletion ok 25 ok 26 ok 27 - adding subfeatures ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - feature names should be case insensitive ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 - base type ok 65 - base:source type ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 - An object of class 'Bio::Location::Split' isa 'Bio::Location::Split' ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 - keyword search; 1 term ok 103 - keyword search; 2 terms ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors ok 112 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors ok 113 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors ok 114 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors ok 115 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors ok 116 # skip Namespaces only supported for DBI::mysql and DBI::Pg adaptors ok t/LocalDB/Taxonomy/greengenes.t ........ 1..38 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::greengenes' ok 5 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::greengenes' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok t/LocalDB/Taxonomy/silva.t ............. 1..42 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::silva' ok 5 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy::list' ok 6 - An object of class 'Bio::DB::Taxonomy::silva' isa 'Bio::DB::Taxonomy' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok t/LocalDB/transfac_pro.t ............... 1..115 ok 1 - use Bio::Matrix::PSM::IO; ok 2 - use Bio::DB::TFBS; ok 3 - use Bio::DB::Taxonomy; ok 4 ok 5 ok 6 ok 7 ok 8 - An object of class 'Bio::Annotation::Reference' isa 'Bio::Annotation::Reference' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 - An object of class 'Bio::Seq' isa 'Bio::Seq' ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 - An object of class 'Bio::Matrix::PSM::SiteMatrix' isa 'Bio::Matrix::PSM::SiteMatrix' ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 - An object of class 'Bio::Map::TranscriptionFactor' isa 'Bio::Map::TranscriptionFactor' ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok t/Map/Cyto.t ........................... 1..110 ok 1 - use Bio::Map::CytoMap; ok 2 - use Bio::Map::CytoPosition; ok 3 - use Bio::Map::CytoMarker; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::Map::CytoPosition' isa 'Bio::Map::CytoPosition' ok 15 ok 16 ok 17 ok 18 - An object of class 'Bio::Range' isa 'Bio::Range' ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok t/Map/Linkage.t ........................ 1..18 ok 1 - use Bio::Map::LinkagePosition; ok 2 - use Bio::Map::Microsatellite; ok 3 - use Bio::Map::LinkageMap; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok t/Map/Map.t ............................ 1..267 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Marker; ok 3 - use Bio::Map::Position; ok 4 - use Bio::Map::Relative; ok 5 - use Bio::Map::Mappable; ok 6 ok 7 ok 8 ok 9 ok 10 - Length is 0 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 - use Bio::Map::Gene; ok 152 - use Bio::Map::GeneMap; ok 153 - use Bio::Map::TranscriptionFactor; ok 154 - use Bio::Map::GeneRelative; ok 155 - use Bio::Map::GenePosition; ok 156 - use Bio::Map::Prediction; ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed ok t/Map/MapIO.t .......................... 1..51 ok 1 - use Bio::MapIO; ok 2 ok 3 - An object of class 'Bio::Map::SimpleMap' isa 'Bio::Map::MapI' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok t/Map/MicrosatelliteMarker.t ........... 1..8 ok 1 - use Bio::Map::SimpleMap; ok 2 - use Bio::Map::Position; ok 3 - use Bio::Map::Microsatellite; ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Map/Physical.t ....................... 1..40 ok 1 - use Bio::Map::Physical; ok 2 - use Bio::MapIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - code holds and returns a string, definition requires a boolean ok 13 - code holds and returns a string, definition requires a boolean ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 not ok 40 # TODO Possible hash randomization-related bug, sum of contig pos values sometimes fails with off-by-one # Failed (TODO) test at t/Map/Physical.t line 101. # got: '1248' # expected: '1249' ok t/Matrix/IO/masta.t .................... 1..16 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok t/Matrix/IO/psm.t ...................... 1..63 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok t/Matrix/InstanceSite.t ................ 1..6 ok 1 - use Bio::Matrix::PSM::InstanceSite; ok 2 ok 3 ok 4 ok 5 ok 6 ok t/Matrix/Matrix.t ...................... 1..77 ok 1 - use Bio::Matrix::Generic; ok 2 - use Bio::Matrix::IO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - An object of class 'Bio::Matrix::Scoring' isa 'Bio::Matrix::Scoring' ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok t/Matrix/ProtMatrix.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::ProtMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Matrix/ProtPsm.t ..................... 1..14 ok 1 - use Bio::Matrix::PSM::IO; ok 2 ok 3 ok 4 ok 5 # skip TODO: Module incomplete ok 6 # skip TODO: Module incomplete ok 7 # skip TODO: Module incomplete ok 8 # skip TODO: Module incomplete ok 9 # skip TODO: Module incomplete ok 10 # skip TODO: Module incomplete ok 11 # skip TODO: Module incomplete ok 12 # skip TODO: Module incomplete ok 13 # skip TODO: Module incomplete ok 14 # skip TODO: Module incomplete ok t/Matrix/SiteMatrix.t .................. 1..14 ok 1 - use Bio::Matrix::PSM::SiteMatrix; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok t/Ontology/GOterm.t .................... 1..62 ok 1 - use Bio::Ontology::GOterm; ok 2 - use Bio::Ontology::Ontology; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok t/Ontology/GraphAdaptor.t .............. 1..28 ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok t/Ontology/IO/go.t ..................... 1..102 ok 1 - use Bio::OntologyIO; ok 2 ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::OntologyI' ok 4 ok 5 - An object of class 'Bio::Ontology::OBOEngine' isa 'Bio::Ontology::OntologyEngineI' ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/Ontology/IO/interpro.t ............... 1..69 ok 1 - use Bio::OntologyIO; ok 2 - An object of class 'Bio::OntologyIO::InterProParser' isa 'Bio::OntologyIO::InterProParser' ok 3 ok 4 - get_dbxrefs on leaf terms is non-empty ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty ok 11 - get_members on leaf terms is non-empty ok 12 - class_list on leaf terms is non-empty ok 13 - get_examples on leaf terms is non-empty ok 14 - get_external_documents on leaf terms is non-empty ok 15 - get_references on leaf terms is non-empty ok 16 - protein_count on leaf terms is non-empty ok 17 - to_string looks reasonable ok 18 - There are 8 root InterPro terms ok 19 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 20 - term Kringle in ontology InterPro ok 21 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 22 - term Repeat in ontology InterPro ok 23 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 24 - term Conserved Site in ontology InterPro ok 25 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 26 - term Active Site in ontology InterPro ok 27 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 28 - term Integrins alpha chain in ontology InterPro ok 29 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 30 - term post-translational modification in ontology InterPro ok 31 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 32 - term Region in ontology InterPro ok 33 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 34 - term Binding Site in ontology InterPro ok 35 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 36 - term Helix-turn-helix, AraC type in ontology InterPro ok 37 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 38 - term Cdc20/Fizzy in ontology InterPro ok 39 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 40 - term Active Site in ontology InterPro ok 41 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 42 - term Binding Site in ontology InterPro ok 43 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 44 - term Conserved Site in ontology InterPro ok 45 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 46 - term Domain in ontology InterPro ok 47 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 48 - term Family in ontology InterPro ok 49 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 50 - term Region in ontology InterPro ok 51 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 52 - term Repeat in ontology InterPro ok 53 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 54 - term post-translational modification in ontology InterPro ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 - Kringle term has one parent ok 62 - Kringle term has one ancestor ok 63 - Integrins alpha chain term has one parent ok 64 - Integrins alpha chain term has one ancestor ok 65 - Helix-turn-helix, AraC type term has one parent ok 66 - Helix-turn-helix, AraC type term has one ancestor ok 67 - Cdc20/Fizzy term has one parent ok 68 - Cdc20/Fizzy term has one ancestor ok 69 - secondary accession map has 2 keys ok t/Ontology/IO/obo.t .................... 1..92 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 47 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 48 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 49 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 50 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 51 - 'got ontology parser2' isa 'Bio::Ontology::Ontology' ok 52 - 'got OBO engine object' isa 'Bio::Ontology::OBOEngine' ok 53 - Gene ontology ok 54 - biological process ok 55 - molecular function ok 56 - Got root ok 57 - Got root ok 58 - Got regulates # from gene_ontology ok 59 - Got # positively regulates from gene_ontology ok 60 - Got # regulates from biological_process ok 61 - Got # positively regulates from biological_process ok 62 - Got predicates for gene_ontology ok 63 - Got predicates for biological_process ok 64 - Got regulates predicate ok 65 - Got positively regulates predicate ok 66 - Got relationships for biological_process ok 67 - Got relationships for molecular_function ok 68 - Got is a relationship from # molecular_function ok 69 - 'Got term object' isa 'Bio::Ontology::Term' ok 70 - Got term id ok 71 - Got term name ok 72 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 73 - Got regulated term1 id ok 74 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 75 - Got back the child ok 76 - 'Got term object' isa 'Bio::Ontology::Term' ok 77 - Got term id ok 78 - Got term name ok 79 - 'Got regulated object' isa 'Bio::Ontology::Term' ok 80 - Got regulated term1 id ok 81 - Got identical regulation ok 82 - 'Got term1 object' isa 'Bio::Ontology::Term' ok 83 - Got back the child ok 84 - 'got a ontology IO handler' isa 'Bio::OntologyIO' ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok t/Ontology/Ontology.t .................. 1..55 ok 1 - use Bio::OntologyIO; ok 2 - use Bio::Ontology::RelationshipType; ok 3 - An object of class 'Bio::Ontology::Ontology' isa 'Bio::Ontology::Ontology' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 - Interpro XML file interpro.xml can be parsed ok 54 - Interpro XML file interpro_sample.xml can be parsed ok 55 - Interpro XML file interpro_relationship.xml can be parsed ok t/Ontology/OntologyEngine.t ............ 1..31 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::Relationship; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - use Bio::Ontology::SimpleOntologyEngine; ok 5 - use Bio::Ontology::Ontology; ok 6 - An object of class 'Bio::Ontology::SimpleOntologyEngine' isa 'Bio::Ontology::OntologyEngineI' ok 7 ok 8 - adding a relationship with an undef object term fails ok 9 - adding a relationship with an undef object term fails ok 10 - adding a relationship with an undef subject term fails ok 11 - adding a relationship with an undef subject term fails ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/Ontology/OntologyStore.t ............. skipped: Network tests have not been requested t/Ontology/Relationship.t .............. 1..12 ok 1 - use Bio::Ontology::Relationship; ok 2 - use Bio::Ontology::GOterm; ok 3 - use Bio::Ontology::RelationshipType; ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 5 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 6 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 7 - An object of class 'Bio::Ontology::Relationship' isa 'Bio::Ontology::Relationship' ok 8 ok 9 ok 10 ok 11 ok 12 ok t/Ontology/RelationshipType.t .......... 1..23 ok 1 - use Bio::Ontology::RelationshipType; ok 2 - use Bio::Ontology::Ontology; ok 3 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::RelationshipType' ok 4 - An object of class 'Bio::Ontology::RelationshipType' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok t/Ontology/Term.t ...................... 1..54 ok 1 - use Bio::Ontology::Term; ok 2 - use Bio::Ontology::TermFactory; ok 3 - use Bio::Annotation::DBLink; ok 4 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - An object of class 'Bio::Ontology::Term' isa 'Bio::Ontology::TermI' ok 45 ok 46 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::TermI' ok 47 - An object of class 'Bio::Ontology::GOterm' isa 'Bio::Ontology::GOterm' ok 48 ok 49 ok 50 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::Ontology::TermI' ok 51 - An object of class 'Bio::Annotation::OntologyTerm' isa 'Bio::AnnotationI' ok 52 ok 53 ok 54 ok t/Perl.t ............................... 1..31 ok 1 - use Bio::Perl; ok 2 ok 3 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 4 ok 5 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::SeqI' ok 6 ok 7 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 8 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 9 ok 10 ok 11 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 12 ok 13 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 14 ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 16 ok 17 ok 18 ok 19 ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok t/Phenotype/Correlate.t ................ 1..17 ok 1 - use Bio::Phenotype::Correlate; ok 2 - use Bio::Species; ok 3 - An object of class 'Bio::Phenotype::Correlate' isa 'Bio::Phenotype::Correlate' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok t/Phenotype/MeSH.t ..................... 1..24 ok 1 - use Bio::Phenotype::MeSH::Term; ok 2 - use Bio::Phenotype::MeSH::Twig; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/Phenotype/Measure.t .................. 1..21 ok 1 - use Bio::Phenotype::Measure; ok 2 - An object of class 'Bio::Phenotype::Measure' isa 'Bio::Phenotype::Measure' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok t/Phenotype/MiniMIMentry.t ............. 1..15 ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 2 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/Phenotype/OMIMentry.t ................ 1..153 ok 1 - use Bio::Phenotype::OMIM::OMIMentry; ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry; ok 3 - use Bio::Species; ok 4 - use Bio::Annotation::Reference; ok 5 - use Bio::Map::CytoPosition; ok 6 - use Bio::Phenotype::Correlate; ok 7 - use Bio::Phenotype::Measure; ok 8 - use Bio::Annotation::DBLink; ok 9 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 - operator overloading in AnnotationI is deprecated ok 80 - operator overloading in AnnotationI is deprecated ok 81 ok 82 ok 83 - operator overloading in AnnotationI is deprecated ok 84 - operator overloading in AnnotationI is deprecated ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 - operator overloading in AnnotationI is deprecated ok 137 - operator overloading in AnnotationI is deprecated ok 138 ok 139 ok 140 - operator overloading in AnnotationI is deprecated ok 141 - operator overloading in AnnotationI is deprecated ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok t/Phenotype/OMIMentryAllelicVariant.t .. 1..27 ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant; ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' isa 'Bio::Phenotype::OMIM::OMIMentryAllelicVariant' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok t/Phenotype/OMIMparser.t ............... 1..175 ok 1 - use Bio::Phenotype::OMIM::OMIMparser; ok 2 - An object of class 'Bio::Phenotype::OMIM::OMIMparser' isa 'Bio::Phenotype::OMIM::OMIMparser' ok 3 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - An object of class 'Bio::Phenotype::OMIM::OMIMentry' isa 'Bio::Phenotype::OMIM::OMIMentry' ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 - An object of class 'Bio::Phenotype::OMIM::MiniMIMentry' isa 'Bio::Phenotype::OMIM::MiniMIMentry' ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 - missing linebreak caught ok t/Phenotype/Phenotype.t ................ 1..116 ok 1 - use Bio::Phenotype::Phenotype; ok 2 - use Bio::Species; ok 3 - use Bio::Annotation::Reference; ok 4 - use Bio::Map::CytoPosition; ok 5 - use Bio::Phenotype::Correlate; ok 6 - use Bio::Phenotype::Measure; ok 7 - use Bio::Annotation::DBLink; ok 8 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::PhenotypeI' ok 9 - An object of class 'Bio::Phenotype::Phenotype' isa 'Bio::Phenotype::Phenotype' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 - operator overloading in AnnotationI is deprecated ok 43 - operator overloading in AnnotationI is deprecated ok 44 ok 45 ok 46 - operator overloading in AnnotationI is deprecated ok 47 - operator overloading in AnnotationI is deprecated ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - operator overloading in AnnotationI is deprecated ok 100 - operator overloading in AnnotationI is deprecated ok 101 ok 102 ok 103 - operator overloading in AnnotationI is deprecated ok 104 - operator overloading in AnnotationI is deprecated ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok t/PodSyntax.t .......................... 1..953 ok 1 - POD test for Bio/NexmlIO.pm ok 2 - POD test for Bio/AnalysisParserI.pm ok 3 - POD test for Bio/AlignIO.pm ok 4 - POD test for Bio/IdCollectionI.pm ok 5 - POD test for Bio/ClusterI.pm ok 6 - POD test for Bio/AnalysisI.pm ok 7 - POD test for Bio/FeatureHolderI.pm ok 8 - POD test for Bio/AnalysisResultI.pm ok 9 - POD test for Bio/LocatableSeq.pm ok 10 - POD test for Bio/PrimarySeq.pm ok 11 - POD test for Bio/SeqUtils.pm ok 12 - POD test for Bio/SimpleAlign.pm ok 13 - POD test for Bio/AnnotationCollectionI.pm ok 14 - POD test for Bio/PrimarySeqI.pm ok 15 - POD test for Bio/DBLinkContainerI.pm ok 16 - POD test for Bio/LocationI.pm ok 17 - POD test for Bio/OntologyIO.pm ok 18 - POD test for Bio/SearchIO.pm ok 19 - POD test for Bio/WebAgent.pm ok 20 - POD test for Bio/Taxon.pm ok 21 - POD test for Bio/SeqI.pm ok 22 - POD test for Bio/Seq.pm ok 23 - POD test for Bio/SeqFeatureI.pm ok 24 - POD test for Bio/IdentifiableI.pm ok 25 - POD test for Bio/Range.pm ok 26 - POD test for Bio/TreeIO.pm ok 27 - POD test for Bio/PhyloNetwork.pm ok 28 - POD test for Bio/DescribableI.pm ok 29 - POD test for Bio/SeqAnalysisParserI.pm ok 30 - POD test for Bio/MapIO.pm ok 31 - POD test for Bio/PullParserI.pm ok 32 - POD test for Bio/RangeI.pm ok 33 - POD test for Bio/DasI.pm ok 34 - POD test for Bio/AnnotationI.pm ok 35 - POD test for Bio/ParameterBaseI.pm ok 36 - POD test for Bio/SimpleAnalysisI.pm ok 37 - POD test for Bio/HandlerBaseI.pm ok 38 - POD test for Bio/AnnotatableI.pm ok 39 - POD test for Bio/SearchDist.pm ok 40 - POD test for Bio/Perl.pm ok 41 - POD test for Bio/Taxonomy.pm ok 42 - POD test for Bio/UpdateableSeqI.pm ok 43 - POD test for Bio/SeqIO.pm ok 44 - POD test for Bio/ClusterIO.pm ok 45 - POD test for Bio/Species.pm ok 46 - POD test for Bio/Taxonomy/Taxon.pm ok 47 - POD test for Bio/Taxonomy/Node.pm ok 48 - POD test for Bio/Taxonomy/Tree.pm ok 49 - POD test for Bio/Taxonomy/FactoryI.pm ok 50 - POD test for Bio/Das/SegmentI.pm ok 51 - POD test for Bio/Das/FeatureTypeI.pm ok 52 - POD test for Bio/SeqEvolution/DNAPoint.pm ok 53 - POD test for Bio/SeqEvolution/Factory.pm ok 54 - POD test for Bio/SeqEvolution/EvolutionI.pm ok 55 - POD test for Bio/ClusterIO/dbsnp.pm ok 56 - POD test for Bio/ClusterIO/unigene.pm ok 57 - POD test for Bio/Annotation/TypeManager.pm ok 58 - POD test for Bio/Annotation/StructuredValue.pm ok 59 - POD test for Bio/Annotation/DBLink.pm ok 60 - POD test for Bio/Annotation/Reference.pm ok 61 - POD test for Bio/Annotation/OntologyTerm.pm ok 62 - POD test for Bio/Annotation/SimpleValue.pm ok 63 - POD test for Bio/Annotation/Target.pm ok 64 - POD test for Bio/Annotation/AnnotationFactory.pm ok 65 - POD test for Bio/Annotation/Relation.pm ok 66 - POD test for Bio/Annotation/Tree.pm ok 67 - POD test for Bio/Annotation/Collection.pm ok 68 - POD test for Bio/Annotation/Comment.pm ok 69 - POD test for Bio/Annotation/TagTree.pm ok 70 - POD test for Bio/Seq/RichSeq.pm ok 71 - POD test for Bio/Seq/Quality.pm ok 72 - POD test for Bio/Seq/MetaI.pm ok 73 - POD test for Bio/Seq/SeqBuilder.pm ok 74 - POD test for Bio/Seq/BaseSeqProcessor.pm ok 75 - POD test for Bio/Seq/EncodedSeq.pm ok 76 - POD test for Bio/Seq/QualI.pm ok 77 - POD test for Bio/Seq/PrimedSeq.pm ok 78 - POD test for Bio/Seq/PrimaryQual.pm ok 79 - POD test for Bio/Seq/SeqFactory.pm ok 80 - POD test for Bio/Seq/LargeSeqI.pm ok 81 - POD test for Bio/Seq/LargeSeq.pm ok 82 - POD test for Bio/Seq/LargeLocatableSeq.pm ok 83 - POD test for Bio/Seq/LargePrimarySeq.pm ok 84 - POD test for Bio/Seq/TraceI.pm ok 85 - POD test for Bio/Seq/SeqWithQuality.pm ok 86 - POD test for Bio/Seq/SimulatedRead.pm ok 87 - POD test for Bio/Seq/RichSeqI.pm ok 88 - POD test for Bio/Seq/SequenceTrace.pm ok 89 - POD test for Bio/Seq/SeqFastaSpeedFactory.pm ok 90 - POD test for Bio/Seq/Meta.pm ok 91 - POD test for Bio/Seq/Meta/Array.pm ok 92 - POD test for Bio/Index/Abstract.pm ok 93 - POD test for Bio/Index/Qual.pm ok 94 - POD test for Bio/Index/GenBank.pm ok 95 - POD test for Bio/Index/Blast.pm ok 96 - POD test for Bio/Index/AbstractSeq.pm ok 97 - POD test for Bio/Index/Fasta.pm ok 98 - POD test for Bio/Index/EMBL.pm ok 99 - POD test for Bio/Index/Stockholm.pm ok 100 - POD test for Bio/Index/Hmmer.pm ok 101 - POD test for Bio/Index/BlastTable.pm ok 102 - POD test for Bio/Index/SwissPfam.pm ok 103 - POD test for Bio/Index/Fastq.pm ok 104 - POD test for Bio/Index/Swissprot.pm ok 105 - POD test for Bio/Nexml/Factory.pm ok 106 - POD test for Bio/Ontology/DocumentRegistry.pm ok 107 - POD test for Bio/Ontology/RelationshipFactory.pm ok 108 - POD test for Bio/Ontology/OntologyI.pm ok 109 - POD test for Bio/Ontology/RelationshipType.pm ok 110 - POD test for Bio/Ontology/TermFactory.pm ok 111 - POD test for Bio/Ontology/InterProTerm.pm ok 112 - POD test for Bio/Ontology/OntologyStore.pm ok 113 - POD test for Bio/Ontology/PathI.pm ok 114 - POD test for Bio/Ontology/TermI.pm ok 115 - POD test for Bio/Ontology/OntologyEngineI.pm ok 116 - POD test for Bio/Ontology/RelationshipI.pm ok 117 - POD test for Bio/Ontology/Term.pm ok 118 - POD test for Bio/Ontology/OBOEngine.pm ok 119 - POD test for Bio/Ontology/Ontology.pm ok 120 - POD test for Bio/Ontology/Relationship.pm ok 121 - POD test for Bio/Ontology/GOterm.pm ok 122 - POD test for Bio/Ontology/SimpleOntologyEngine.pm ok 123 - POD test for Bio/Ontology/OBOterm.pm ok 124 - POD test for Bio/Ontology/Path.pm ok 125 - POD test for Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm ok 126 - POD test for Bio/MapIO/fpc.pm ok 127 - POD test for Bio/MapIO/mapmaker.pm ok 128 - POD test for Bio/TreeIO/phyloxml.pm ok 129 - POD test for Bio/TreeIO/pag.pm ok 130 - POD test for Bio/TreeIO/nexml.pm ok 131 - POD test for Bio/TreeIO/cluster.pm ok 132 - POD test for Bio/TreeIO/tabtree.pm ok 133 - POD test for Bio/TreeIO/lintree.pm ok 134 - POD test for Bio/TreeIO/newick.pm ok 135 - POD test for Bio/TreeIO/NewickParser.pm ok 136 - POD test for Bio/TreeIO/TreeEventBuilder.pm ok 137 - POD test for Bio/TreeIO/nexus.pm ok 138 - POD test for Bio/TreeIO/svggraph.pm ok 139 - POD test for Bio/TreeIO/nhx.pm ok 140 - POD test for Bio/MolEvol/CodonModel.pm ok 141 - POD test for Bio/LiveSeq/Exon.pm ok 142 - POD test for Bio/LiveSeq/Repeat_Region.pm ok 143 - POD test for Bio/LiveSeq/AARange.pm ok 144 - POD test for Bio/LiveSeq/Mutator.pm ok 145 - POD test for Bio/LiveSeq/Intron.pm ok 146 - POD test for Bio/LiveSeq/DNA.pm ok 147 - POD test for Bio/LiveSeq/ChainI.pm ok 148 - POD test for Bio/LiveSeq/Transcript.pm ok 149 - POD test for Bio/LiveSeq/Gene.pm ok 150 - POD test for Bio/LiveSeq/SeqI.pm ok 151 - POD test for Bio/LiveSeq/Chain.pm ok 152 - POD test for Bio/LiveSeq/Range.pm ok 153 - POD test for Bio/LiveSeq/Mutation.pm ok 154 - POD test for Bio/LiveSeq/Repeat_Unit.pm ok 155 - POD test for Bio/LiveSeq/Translation.pm ok 156 - POD test for Bio/LiveSeq/Prim_Transcript.pm ok 157 - POD test for Bio/LiveSeq/IO/Loader.pm ok 158 - POD test for Bio/LiveSeq/IO/BioPerl.pm ok 159 - POD test for Bio/CodonUsage/IO.pm ok 160 - POD test for Bio/CodonUsage/Table.pm ok 161 - POD test for Bio/Draw/Pictogram.pm ok 162 - POD test for Bio/Symbol/ProteinAlphabet.pm ok 163 - POD test for Bio/Symbol/DNAAlphabet.pm ok 164 - POD test for Bio/Symbol/SymbolI.pm ok 165 - POD test for Bio/Symbol/AlphabetI.pm ok 166 - POD test for Bio/Symbol/Symbol.pm ok 167 - POD test for Bio/Symbol/Alphabet.pm ok 168 - POD test for Bio/Tools/GuessSeqFormat.pm ok 169 - POD test for Bio/Tools/Profile.pm ok 170 - POD test for Bio/Tools/ipcress.pm ok 171 - POD test for Bio/Tools/AmpliconSearch.pm ok 172 - POD test for Bio/Tools/Coil.pm ok 173 - POD test for Bio/Tools/Fgenesh.pm ok 174 - POD test for Bio/Tools/ECnumber.pm ok 175 - POD test for Bio/Tools/CodonTable.pm ok 176 - POD test for Bio/Tools/pICalculator.pm ok 177 - POD test for Bio/Tools/EPCR.pm ok 178 - POD test for Bio/Tools/Pseudowise.pm ok 179 - POD test for Bio/Tools/Eponine.pm ok 180 - POD test for Bio/Tools/Genscan.pm ok 181 - POD test for Bio/Tools/Tmhmm.pm ok 182 - POD test for Bio/Tools/SeqWords.pm ok 183 - POD test for Bio/Tools/tRNAscanSE.pm ok 184 - POD test for Bio/Tools/AlignFactory.pm ok 185 - POD test for Bio/Tools/Grail.pm ok 186 - POD test for Bio/Tools/ERPIN.pm ok 187 - POD test for Bio/Tools/RepeatMasker.pm ok 188 - POD test for Bio/Tools/Gel.pm ok 189 - POD test for Bio/Tools/isPcr.pm ok 190 - POD test for Bio/Tools/PrositeScan.pm ok 191 - POD test for Bio/Tools/Blat.pm ok 192 - POD test for Bio/Tools/IUPAC.pm ok 193 - POD test for Bio/Tools/Seg.pm ok 194 - POD test for Bio/Tools/Genemark.pm ok 195 - POD test for Bio/Tools/Geneid.pm ok 196 - POD test for Bio/Tools/Protparam.pm ok 197 - POD test for Bio/Tools/Lucy.pm ok 198 - POD test for Bio/Tools/pSW.pm ok 199 - POD test for Bio/Tools/Match.pm ok 200 - POD test for Bio/Tools/Prints.pm ok 201 - POD test for Bio/Tools/Glimmer.pm ok 202 - POD test for Bio/Tools/AnalysisResult.pm ok 203 - POD test for Bio/Tools/Signalp.pm ok 204 - POD test for Bio/Tools/Promoterwise.pm ok 205 - POD test for Bio/Tools/TandemRepeatsFinder.pm ok 206 - POD test for Bio/Tools/RandomDistFunctions.pm ok 207 - POD test for Bio/Tools/QRNA.pm ok 208 - POD test for Bio/Tools/Genomewise.pm ok 209 - POD test for Bio/Tools/OddCodes.pm ok 210 - POD test for Bio/Tools/Sigcleave.pm ok 211 - POD test for Bio/Tools/Primer3.pm ok 212 - POD test for Bio/Tools/GFF.pm ok 213 - POD test for Bio/Tools/ESTScan.pm ok 214 - POD test for Bio/Tools/SeqStats.pm ok 215 - POD test for Bio/Tools/TargetP.pm ok 216 - POD test for Bio/Tools/SiRNA.pm ok 217 - POD test for Bio/Tools/Infernal.pm ok 218 - POD test for Bio/Tools/Genewise.pm ok 219 - POD test for Bio/Tools/Est2Genome.pm ok 220 - POD test for Bio/Tools/MZEF.pm ok 221 - POD test for Bio/Tools/FootPrinter.pm ok 222 - POD test for Bio/Tools/SeqPattern.pm ok 223 - POD test for Bio/Tools/dpAlign.pm ok 224 - POD test for Bio/Tools/Hmmpfam.pm ok 225 - POD test for Bio/Tools/RNAMotif.pm ok 226 - POD test for Bio/Tools/Signalp/ExtendedSignalp.pm ok 227 - POD test for Bio/Tools/Primer/Feature.pm ok 228 - POD test for Bio/Tools/Primer/AssessorI.pm ok 229 - POD test for Bio/Tools/Primer/Pair.pm ok 230 - POD test for Bio/Tools/Primer/Assessor/Base.pm ok 231 - POD test for Bio/Tools/SiRNA/Ruleset/saigo.pm ok 232 - POD test for Bio/Tools/SiRNA/Ruleset/tuschl.pm ok 233 - POD test for Bio/Tools/Spidey/Exon.pm ok 234 - POD test for Bio/Tools/Spidey/Results.pm ok 235 - POD test for Bio/Tools/Analysis/SimpleAnalysisBase.pm ok 236 - POD test for Bio/Tools/Analysis/Protein/Sopma.pm ok 237 - POD test for Bio/Tools/Analysis/Protein/ELM.pm ok 238 - POD test for Bio/Tools/Analysis/Protein/NetPhos.pm ok 239 - POD test for Bio/Tools/Analysis/Protein/Scansite.pm ok 240 - POD test for Bio/Tools/Analysis/Protein/Domcut.pm ok 241 - POD test for Bio/Tools/Analysis/Protein/GOR4.pm ok 242 - POD test for Bio/Tools/Analysis/Protein/HNN.pm ok 243 - POD test for Bio/Tools/Analysis/Protein/Mitoprot.pm ok 244 - POD test for Bio/Tools/Analysis/DNA/ESEfinder.pm ok 245 - POD test for Bio/Tools/Phylo/Gerp.pm ok 246 - POD test for Bio/Tools/Phylo/PAML.pm ok 247 - POD test for Bio/Tools/Phylo/Gumby.pm ok 248 - POD test for Bio/Tools/Phylo/Molphy.pm ok 249 - POD test for Bio/Tools/Phylo/Molphy/Result.pm ok 250 - POD test for Bio/Tools/Phylo/PAML/Codeml.pm ok 251 - POD test for Bio/Tools/Phylo/PAML/Result.pm ok 252 - POD test for Bio/Tools/Phylo/PAML/ModelResult.pm ok 253 - POD test for Bio/Tools/Phylo/Phylip/ProtDist.pm ok 254 - POD test for Bio/Tools/Prediction/Exon.pm ok 255 - POD test for Bio/Tools/Prediction/Gene.pm ok 256 - POD test for Bio/Tools/EMBOSS/Palindrome.pm ok 257 - POD test for Bio/Tools/SeqPattern/Backtranslate.pm ok 258 - POD test for Bio/Tools/Alignment/Trim.pm ok 259 - POD test for Bio/Tools/Alignment/Consed.pm ok 260 - POD test for Bio/Tools/HMMER/Results.pm ok 261 - POD test for Bio/Tools/HMMER/Domain.pm ok 262 - POD test for Bio/Tools/HMMER/Set.pm ok 263 - POD test for Bio/Tools/Run/WrapperBase.pm ok 264 - POD test for Bio/Tools/Run/GenericParameters.pm ok 265 - POD test for Bio/Tools/Run/StandAloneWUBlast.pm ok 266 - POD test for Bio/Tools/Run/StandAloneBlast.pm ok 267 - POD test for Bio/Tools/Run/ParametersI.pm ok 268 - POD test for Bio/Tools/Run/hmmer3.pm (no pod) ok 269 - POD test for Bio/Tools/Run/RemoteBlast.pm ok 270 - POD test for Bio/Tools/Run/StandAloneNCBIBlast.pm ok 271 - POD test for Bio/Tools/Run/WrapperBase/CommandExts.pm ok 272 - POD test for Bio/Tools/Sim4/Exon.pm ok 273 - POD test for Bio/Tools/Sim4/Results.pm ok 274 - POD test for Bio/Tree/TreeFunctionsI.pm ok 275 - POD test for Bio/Tree/AnnotatableNode.pm ok 276 - POD test for Bio/Tree/Statistics.pm ok 277 - POD test for Bio/Tree/Compatible.pm ok 278 - POD test for Bio/Tree/Node.pm ok 279 - POD test for Bio/Tree/NodeNHX.pm ok 280 - POD test for Bio/Tree/AlleleNode.pm ok 281 - POD test for Bio/Tree/TreeI.pm ok 282 - POD test for Bio/Tree/Tree.pm ok 283 - POD test for Bio/Tree/NodeI.pm ok 284 - POD test for Bio/Tree/DistanceFactory.pm ok 285 - POD test for Bio/Tree/RandomFactory.pm ok 286 - POD test for Bio/Tree/Draw/Cladogram.pm ok 287 - POD test for Bio/Factory/TreeFactoryI.pm ok 288 - POD test for Bio/Factory/ObjectFactoryI.pm ok 289 - POD test for Bio/Factory/AnalysisI.pm ok 290 - POD test for Bio/Factory/MapFactoryI.pm ok 291 - POD test for Bio/Factory/SequenceProcessorI.pm ok 292 - POD test for Bio/Factory/ObjectFactory.pm ok 293 - POD test for Bio/Factory/SeqAnalysisParserFactoryI.pm ok 294 - POD test for Bio/Factory/SeqAnalysisParserFactory.pm ok 295 - POD test for Bio/Factory/LocationFactoryI.pm ok 296 - POD test for Bio/Factory/SequenceFactoryI.pm ok 297 - POD test for Bio/Factory/FTLocationFactory.pm ok 298 - POD test for Bio/Factory/ObjectBuilderI.pm ok 299 - POD test for Bio/Factory/SequenceStreamI.pm ok 300 - POD test for Bio/Factory/DriverFactory.pm ok 301 - POD test for Bio/Factory/ApplicationFactoryI.pm ok 302 - POD test for Bio/Assembly/Contig.pm ok 303 - POD test for Bio/Assembly/ContigAnalysis.pm ok 304 - POD test for Bio/Assembly/IO.pm ok 305 - POD test for Bio/Assembly/Singlet.pm ok 306 - POD test for Bio/Assembly/Scaffold.pm ok 307 - POD test for Bio/Assembly/ScaffoldI.pm ok 308 - POD test for Bio/Assembly/Tools/ContigSpectrum.pm ok 309 - POD test for Bio/Assembly/IO/tigr.pm ok 310 - POD test for Bio/Assembly/IO/phrap.pm ok 311 - POD test for Bio/Assembly/IO/bowtie.pm ok 312 - POD test for Bio/Assembly/IO/maq.pm ok 313 - POD test for Bio/Assembly/IO/sam.pm ok 314 - POD test for Bio/Assembly/IO/ace.pm ok 315 - POD test for Bio/Structure/StructureI.pm ok 316 - POD test for Bio/Structure/Entry.pm ok 317 - POD test for Bio/Structure/Model.pm ok 318 - POD test for Bio/Structure/IO.pm ok 319 - POD test for Bio/Structure/Chain.pm ok 320 - POD test for Bio/Structure/Residue.pm ok 321 - POD test for Bio/Structure/Atom.pm ok 322 - POD test for Bio/Structure/SecStr/STRIDE/Res.pm ok 323 - POD test for Bio/Structure/SecStr/DSSP/Res.pm ok 324 - POD test for Bio/Structure/IO/pdb.pm ok 325 - POD test for Bio/Matrix/Mlagan.pm ok 326 - POD test for Bio/Matrix/PhylipDist.pm ok 327 - POD test for Bio/Matrix/IO.pm ok 328 - POD test for Bio/Matrix/Scoring.pm ok 329 - POD test for Bio/Matrix/MatrixI.pm ok 330 - POD test for Bio/Matrix/Generic.pm ok 331 - POD test for Bio/Matrix/IO/mlagan.pm ok 332 - POD test for Bio/Matrix/IO/phylip.pm ok 333 - POD test for Bio/Matrix/IO/scoring.pm ok 334 - POD test for Bio/Matrix/PSM/PsmHeader.pm ok 335 - POD test for Bio/Matrix/PSM/SiteMatrixI.pm ok 336 - POD test for Bio/Matrix/PSM/Psm.pm ok 337 - POD test for Bio/Matrix/PSM/InstanceSite.pm ok 338 - POD test for Bio/Matrix/PSM/IO.pm ok 339 - POD test for Bio/Matrix/PSM/PsmHeaderI.pm ok 340 - POD test for Bio/Matrix/PSM/PsmI.pm ok 341 - POD test for Bio/Matrix/PSM/ProtPsm.pm ok 342 - POD test for Bio/Matrix/PSM/InstanceSiteI.pm ok 343 - POD test for Bio/Matrix/PSM/SiteMatrix.pm ok 344 - POD test for Bio/Matrix/PSM/ProtMatrix.pm ok 345 - POD test for Bio/Matrix/PSM/IO/transfac.pm ok 346 - POD test for Bio/Matrix/PSM/IO/masta.pm ok 347 - POD test for Bio/Matrix/PSM/IO/psiblast.pm ok 348 - POD test for Bio/Matrix/PSM/IO/mast.pm ok 349 - POD test for Bio/Matrix/PSM/IO/meme.pm ok 350 - POD test for Bio/Variation/RNAChange.pm ok 351 - POD test for Bio/Variation/Allele.pm ok 352 - POD test for Bio/Variation/DNAMutation.pm ok 353 - POD test for Bio/Variation/SeqDiff.pm ok 354 - POD test for Bio/Variation/IO.pm ok 355 - POD test for Bio/Variation/VariantI.pm ok 356 - POD test for Bio/Variation/AAReverseMutate.pm ok 357 - POD test for Bio/Variation/SNP.pm ok 358 - POD test for Bio/Variation/AAChange.pm ok 359 - POD test for Bio/Variation/IO/xml.pm ok 360 - POD test for Bio/Variation/IO/flat.pm ok 361 - POD test for Bio/AlignIO/prodom.pm ok 362 - POD test for Bio/AlignIO/proda.pm ok 363 - POD test for Bio/AlignIO/emboss.pm ok 364 - POD test for Bio/AlignIO/nexml.pm ok 365 - POD test for Bio/AlignIO/selex.pm ok 366 - POD test for Bio/AlignIO/arp.pm ok 367 - POD test for Bio/AlignIO/xmfa.pm ok 368 - POD test for Bio/AlignIO/stockholm.pm ok 369 - POD test for Bio/AlignIO/msf.pm ok 370 - POD test for Bio/AlignIO/psi.pm ok 371 - POD test for Bio/AlignIO/fasta.pm ok 372 - POD test for Bio/AlignIO/phylip.pm ok 373 - POD test for Bio/AlignIO/metafasta.pm ok 374 - POD test for Bio/AlignIO/bl2seq.pm ok 375 - POD test for Bio/AlignIO/maf.pm ok 376 - POD test for Bio/AlignIO/largemultifasta.pm ok 377 - POD test for Bio/AlignIO/pfam.pm ok 378 - POD test for Bio/AlignIO/meme.pm ok 379 - POD test for Bio/AlignIO/nexus.pm ok 380 - POD test for Bio/AlignIO/mase.pm ok 381 - POD test for Bio/AlignIO/mega.pm ok 382 - POD test for Bio/AlignIO/po.pm ok 383 - POD test for Bio/AlignIO/clustalw.pm ok 384 - POD test for Bio/AlignIO/Handler/GenericAlignHandler.pm ok 385 - POD test for Bio/PhyloNetwork/TreeFactoryMulti.pm ok 386 - POD test for Bio/PhyloNetwork/TreeFactoryX.pm ok 387 - POD test for Bio/PhyloNetwork/Factory.pm ok 388 - POD test for Bio/PhyloNetwork/muVector.pm ok 389 - POD test for Bio/PhyloNetwork/TreeFactory.pm ok 390 - POD test for Bio/PhyloNetwork/FactoryX.pm ok 391 - POD test for Bio/PhyloNetwork/RandomFactory.pm ok 392 - POD test for Bio/PhyloNetwork/GraphViz.pm ok 393 - POD test for Bio/Coordinate/MapperI.pm ok 394 - POD test for Bio/Coordinate/Graph.pm ok 395 - POD test for Bio/Coordinate/Chain.pm ok 396 - POD test for Bio/Coordinate/GeneMapper.pm ok 397 - POD test for Bio/Coordinate/ResultI.pm ok 398 - POD test for Bio/Coordinate/ExtrapolatingPair.pm ok 399 - POD test for Bio/Coordinate/Collection.pm ok 400 - POD test for Bio/Coordinate/Result.pm ok 401 - POD test for Bio/Coordinate/Utils.pm ok 402 - POD test for Bio/Coordinate/Pair.pm ok 403 - POD test for Bio/Coordinate/Result/Match.pm ok 404 - POD test for Bio/Coordinate/Result/Gap.pm ok 405 - POD test for Bio/OntologyIO/simplehierarchy.pm ok 406 - POD test for Bio/OntologyIO/soflat.pm ok 407 - POD test for Bio/OntologyIO/goflat.pm ok 408 - POD test for Bio/OntologyIO/dagflat.pm ok 409 - POD test for Bio/OntologyIO/InterProParser.pm ok 410 - POD test for Bio/OntologyIO/obo.pm ok 411 - POD test for Bio/OntologyIO/Handlers/BaseSAXHandler.pm ok 412 - POD test for Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm ok 413 - POD test for Bio/OntologyIO/Handlers/InterProHandler.pm ok 414 - POD test for Bio/Align/Graphics.pm ok 415 - POD test for Bio/Align/Utilities.pm ok 416 - POD test for Bio/Align/ProteinStatistics.pm ok 417 - POD test for Bio/Align/StatisticsI.pm ok 418 - POD test for Bio/Align/PairwiseStatistics.pm ok 419 - POD test for Bio/Align/DNAStatistics.pm ok 420 - POD test for Bio/Align/AlignI.pm ok 421 - POD test for Bio/Map/OrderedPosition.pm ok 422 - POD test for Bio/Map/EntityI.pm ok 423 - POD test for Bio/Map/MarkerI.pm ok 424 - POD test for Bio/Map/TranscriptionFactor.pm ok 425 - POD test for Bio/Map/Prediction.pm ok 426 - POD test for Bio/Map/Contig.pm ok 427 - POD test for Bio/Map/LinkageMap.pm ok 428 - POD test for Bio/Map/PositionHandlerI.pm ok 429 - POD test for Bio/Map/Physical.pm ok 430 - POD test for Bio/Map/GenePosition.pm ok 431 - POD test for Bio/Map/Gene.pm ok 432 - POD test for Bio/Map/GeneMap.pm ok 433 - POD test for Bio/Map/Mappable.pm ok 434 - POD test for Bio/Map/OrderedPositionWithDistance.pm ok 435 - POD test for Bio/Map/Relative.pm ok 436 - POD test for Bio/Map/GeneRelative.pm ok 437 - POD test for Bio/Map/MapI.pm ok 438 - POD test for Bio/Map/CytoPosition.pm ok 439 - POD test for Bio/Map/MappableI.pm ok 440 - POD test for Bio/Map/PositionHandler.pm ok 441 - POD test for Bio/Map/Clone.pm ok 442 - POD test for Bio/Map/RelativeI.pm ok 443 - POD test for Bio/Map/Position.pm ok 444 - POD test for Bio/Map/PositionWithSequence.pm ok 445 - POD test for Bio/Map/Marker.pm ok 446 - POD test for Bio/Map/FPCMarker.pm ok 447 - POD test for Bio/Map/LinkagePosition.pm ok 448 - POD test for Bio/Map/Microsatellite.pm ok 449 - POD test for Bio/Map/CytoMap.pm ok 450 - POD test for Bio/Map/CytoMarker.pm ok 451 - POD test for Bio/Map/SimpleMap.pm ok 452 - POD test for Bio/Map/PositionI.pm ok 453 - POD test for Bio/Location/Atomic.pm ok 454 - POD test for Bio/Location/Simple.pm ok 455 - POD test for Bio/Location/Fuzzy.pm ok 456 - POD test for Bio/Location/CoordinatePolicyI.pm ok 457 - POD test for Bio/Location/Split.pm ok 458 - POD test for Bio/Location/SplitLocationI.pm ok 459 - POD test for Bio/Location/AvWithinCoordPolicy.pm ok 460 - POD test for Bio/Location/FuzzyLocationI.pm ok 461 - POD test for Bio/Location/WidestCoordPolicy.pm ok 462 - POD test for Bio/Location/NarrowestCoordPolicy.pm ok 463 - POD test for Bio/Search/SearchUtils.pm ok 464 - POD test for Bio/Search/BlastUtils.pm ok 465 - POD test for Bio/Search/StatisticsI.pm ok 466 - POD test for Bio/Search/GenericDatabase.pm ok 467 - POD test for Bio/Search/DatabaseI.pm ok 468 - POD test for Bio/Search/GenericStatistics.pm ok 469 - POD test for Bio/Search/BlastStatistics.pm ok 470 - POD test for Bio/Search/Processor.pm ok 471 - POD test for Bio/Search/Hit/ModelHit.pm ok 472 - POD test for Bio/Search/Hit/hmmer3Hit.pm ok 473 - POD test for Bio/Search/Hit/PsiBlastHit.pm ok 474 - POD test for Bio/Search/Hit/Fasta.pm ok 475 - POD test for Bio/Search/Hit/PullHitI.pm ok 476 - POD test for Bio/Search/Hit/GenericHit.pm ok 477 - POD test for Bio/Search/Hit/HMMERHit.pm ok 478 - POD test for Bio/Search/Hit/HitFactory.pm ok 479 - POD test for Bio/Search/Hit/HitI.pm ok 480 - POD test for Bio/Search/Hit/BlastHit.pm ok 481 - POD test for Bio/Search/Hit/BlastPullHit.pm ok 482 - POD test for Bio/Search/Hit/HmmpfamHit.pm ok 483 - POD test for Bio/Search/Tiling/MapTileUtils.pm ok 484 - POD test for Bio/Search/Tiling/TilingI.pm ok 485 - POD test for Bio/Search/Tiling/MapTiling.pm ok 486 - POD test for Bio/Search/Result/hmmer3Result.pm ok 487 - POD test for Bio/Search/Result/HmmpfamResult.pm ok 488 - POD test for Bio/Search/Result/PullResultI.pm ok 489 - POD test for Bio/Search/Result/ResultFactory.pm ok 490 - POD test for Bio/Search/Result/HMMERResult.pm ok 491 - POD test for Bio/Search/Result/BlastResult.pm ok 492 - POD test for Bio/Search/Result/WABAResult.pm ok 493 - POD test for Bio/Search/Result/GenericResult.pm ok 494 - POD test for Bio/Search/Result/ResultI.pm ok 495 - POD test for Bio/Search/Result/BlastPullResult.pm ok 496 - POD test for Bio/Search/Result/CrossMatchResult.pm ok 497 - POD test for Bio/Search/Iteration/GenericIteration.pm ok 498 - POD test for Bio/Search/Iteration/IterationI.pm ok 499 - POD test for Bio/Search/HSP/BlastHSP.pm ok 500 - POD test for Bio/Search/HSP/ModelHSP.pm ok 501 - POD test for Bio/Search/HSP/HSPI.pm ok 502 - POD test for Bio/Search/HSP/PSLHSP.pm ok 503 - POD test for Bio/Search/HSP/HSPFactory.pm ok 504 - POD test for Bio/Search/HSP/PsiBlastHSP.pm ok 505 - POD test for Bio/Search/HSP/PullHSPI.pm ok 506 - POD test for Bio/Search/HSP/HmmpfamHSP.pm ok 507 - POD test for Bio/Search/HSP/GenericHSP.pm ok 508 - POD test for Bio/Search/HSP/BlastPullHSP.pm ok 509 - POD test for Bio/Search/HSP/FastaHSP.pm ok 510 - POD test for Bio/Search/HSP/HMMERHSP.pm ok 511 - POD test for Bio/Search/HSP/WABAHSP.pm ok 512 - POD test for Bio/SeqFeature/Similarity.pm ok 513 - POD test for Bio/SeqFeature/TypedSeqFeatureI.pm ok 514 - POD test for Bio/SeqFeature/PositionProxy.pm ok 515 - POD test for Bio/SeqFeature/SubSeq.pm ok 516 - POD test for Bio/SeqFeature/SimilarityPair.pm ok 517 - POD test for Bio/SeqFeature/CollectionI.pm ok 518 - POD test for Bio/SeqFeature/Primer.pm ok 519 - POD test for Bio/SeqFeature/AnnotationAdaptor.pm ok 520 - POD test for Bio/SeqFeature/FeaturePair.pm ok 521 - POD test for Bio/SeqFeature/Amplicon.pm ok 522 - POD test for Bio/SeqFeature/Generic.pm ok 523 - POD test for Bio/SeqFeature/Computation.pm ok 524 - POD test for Bio/SeqFeature/Collection.pm ok 525 - POD test for Bio/SeqFeature/Lite.pm ok 526 - POD test for Bio/SeqFeature/SiRNA/Oligo.pm ok 527 - POD test for Bio/SeqFeature/SiRNA/Pair.pm ok 528 - POD test for Bio/SeqFeature/Tools/IDHandler.pm ok 529 - POD test for Bio/SeqFeature/Tools/TypeMapper.pm ok 530 - POD test for Bio/SeqFeature/Tools/Unflattener.pm ok 531 - POD test for Bio/SeqFeature/Tools/FeatureNamer.pm ok 532 - POD test for Bio/SeqFeature/Gene/Exon.pm ok 533 - POD test for Bio/SeqFeature/Gene/GeneStructureI.pm ok 534 - POD test for Bio/SeqFeature/Gene/UTR.pm ok 535 - POD test for Bio/SeqFeature/Gene/Intron.pm ok 536 - POD test for Bio/SeqFeature/Gene/Poly_A_site.pm ok 537 - POD test for Bio/SeqFeature/Gene/GeneStructure.pm ok 538 - POD test for Bio/SeqFeature/Gene/NC_Feature.pm ok 539 - POD test for Bio/SeqFeature/Gene/Transcript.pm ok 540 - POD test for Bio/SeqFeature/Gene/ExonI.pm ok 541 - POD test for Bio/SeqFeature/Gene/TranscriptI.pm ok 542 - POD test for Bio/SeqFeature/Gene/Promoter.pm ok 543 - POD test for Bio/Event/EventHandlerI.pm ok 544 - POD test for Bio/Event/EventGeneratorI.pm ok 545 - POD test for Bio/SeqIO/locuslink.pm ok 546 - POD test for Bio/SeqIO/tab.pm ok 547 - POD test for Bio/SeqIO/tigr.pm ok 548 - POD test for Bio/SeqIO/raw.pm ok 549 - POD test for Bio/SeqIO/nexml.pm ok 550 - POD test for Bio/SeqIO/MultiFile.pm ok 551 - POD test for Bio/SeqIO/abi.pm ok 552 - POD test for Bio/SeqIO/chaos.pm ok 553 - POD test for Bio/SeqIO/entrezgene.pm ok 554 - POD test for Bio/SeqIO/gbxml.pm ok 555 - POD test for Bio/SeqIO/agave.pm ok 556 - POD test for Bio/SeqIO/table.pm ok 557 - POD test for Bio/SeqIO/bsml_sax.pm ok 558 - POD test for Bio/SeqIO/swissdriver.pm ok 559 - POD test for Bio/SeqIO/gcg.pm ok 560 - POD test for Bio/SeqIO/ctf.pm ok 561 - POD test for Bio/SeqIO/lasergene.pm ok 562 - POD test for Bio/SeqIO/chaosxml.pm ok 563 - POD test for Bio/SeqIO/fasta.pm ok 564 - POD test for Bio/SeqIO/flybase_chadoxml.pm ok 565 - POD test for Bio/SeqIO/phd.pm ok 566 - POD test for Bio/SeqIO/alf.pm ok 567 - POD test for Bio/SeqIO/metafasta.pm ok 568 - POD test for Bio/SeqIO/embldriver.pm ok 569 - POD test for Bio/SeqIO/qual.pm ok 570 - POD test for Bio/SeqIO/chadoxml.pm ok 571 - POD test for Bio/SeqIO/mbsout.pm ok 572 - POD test for Bio/SeqIO/bsml.pm ok 573 - POD test for Bio/SeqIO/kegg.pm ok 574 - POD test for Bio/SeqIO/excel.pm ok 575 - POD test for Bio/SeqIO/seqxml.pm ok 576 - POD test for Bio/SeqIO/pir.pm ok 577 - POD test for Bio/SeqIO/gbdriver.pm ok 578 - POD test for Bio/SeqIO/ace.pm ok 579 - POD test for Bio/SeqIO/interpro.pm ok 580 - POD test for Bio/SeqIO/tigrxml.pm ok 581 - POD test for Bio/SeqIO/genbank.pm ok 582 - POD test for Bio/SeqIO/msout.pm ok 583 - POD test for Bio/SeqIO/embl.pm ok 584 - POD test for Bio/SeqIO/tinyseq.pm ok 585 - POD test for Bio/SeqIO/ztr.pm ok 586 - POD test for Bio/SeqIO/fastq.pm ok 587 - POD test for Bio/SeqIO/game.pm ok 588 - POD test for Bio/SeqIO/pln.pm ok 589 - POD test for Bio/SeqIO/swiss.pm ok 590 - POD test for Bio/SeqIO/asciitree.pm ok 591 - POD test for Bio/SeqIO/scf.pm ok 592 - POD test for Bio/SeqIO/exp.pm ok 593 - POD test for Bio/SeqIO/largefasta.pm ok 594 - POD test for Bio/SeqIO/FTHelper.pm ok 595 - POD test for Bio/SeqIO/strider.pm ok 596 - POD test for Bio/SeqIO/tinyseq/tinyseqHandler.pm ok 597 - POD test for Bio/SeqIO/game/gameWriter.pm ok 598 - POD test for Bio/SeqIO/game/featHandler.pm ok 599 - POD test for Bio/SeqIO/game/gameHandler.pm ok 600 - POD test for Bio/SeqIO/game/seqHandler.pm ok 601 - POD test for Bio/SeqIO/game/gameSubs.pm ok 602 - POD test for Bio/SeqIO/Handler/GenericRichSeqHandler.pm ok 603 - POD test for Bio/Root/Exception.pm ok 604 - POD test for Bio/Root/Test.pm ok 605 - POD test for Bio/Root/Build.pm ok 606 - POD test for Bio/Root/Root.pm ok 607 - POD test for Bio/Root/Utilities.pm ok 608 - POD test for Bio/Root/IO.pm ok 609 - POD test for Bio/Root/RootI.pm ok 610 - POD test for Bio/Root/Storable.pm ok 611 - POD test for Bio/Root/Version.pm ok 612 - POD test for Bio/Root/HTTPget.pm ok 613 - POD test for Bio/DB/RefSeq.pm ok 614 - POD test for Bio/DB/DBFetch.pm ok 615 - POD test for Bio/DB/Ace.pm ok 616 - POD test for Bio/DB/SeqHound.pm ok 617 - POD test for Bio/DB/FileCache.pm ok 618 - POD test for Bio/DB/Qual.pm ok 619 - POD test for Bio/DB/NCBIHelper.pm ok 620 - POD test for Bio/DB/SwissProt.pm ok 621 - POD test for Bio/DB/GenBank.pm ok 622 - POD test for Bio/DB/Expression.pm ok 623 - POD test for Bio/DB/Universal.pm ok 624 - POD test for Bio/DB/SeqVersion.pm ok 625 - POD test for Bio/DB/GenericWebAgent.pm ok 626 - POD test for Bio/DB/LocationI.pm ok 627 - POD test for Bio/DB/IndexedBase.pm ok 628 - POD test for Bio/DB/Fasta.pm ok 629 - POD test for Bio/DB/SeqI.pm ok 630 - POD test for Bio/DB/RandomAccessI.pm ok 631 - POD test for Bio/DB/CUTG.pm ok 632 - POD test for Bio/DB/EMBL.pm ok 633 - POD test for Bio/DB/Failover.pm ok 634 - POD test for Bio/DB/TFBS.pm ok 635 - POD test for Bio/DB/GFF.pm ok 636 - POD test for Bio/DB/InMemoryCache.pm ok 637 - POD test for Bio/DB/SeqFeature.pm ok 638 - POD test for Bio/DB/GenPept.pm ok 639 - POD test for Bio/DB/ReferenceI.pm ok 640 - POD test for Bio/DB/QueryI.pm ok 641 - POD test for Bio/DB/WebDBSeqI.pm ok 642 - POD test for Bio/DB/Taxonomy.pm ok 643 - POD test for Bio/DB/EntrezGene.pm ok 644 - POD test for Bio/DB/HIV.pm ok 645 - POD test for Bio/DB/MeSH.pm ok 646 - POD test for Bio/DB/UpdateableSeqI.pm ok 647 - POD test for Bio/DB/BioFetch.pm ok 648 - POD test for Bio/DB/Registry.pm ok 649 - POD test for Bio/DB/Flat.pm ok 650 - POD test for Bio/DB/Taxonomy/list.pm ok 651 - POD test for Bio/DB/Taxonomy/greengenes.pm ok 652 - POD test for Bio/DB/Taxonomy/silva.pm ok 653 - POD test for Bio/DB/Taxonomy/flatfile.pm ok 654 - POD test for Bio/DB/Taxonomy/entrez.pm ok 655 - POD test for Bio/DB/HIV/HIVAnnotProcessor.pm ok 656 - POD test for Bio/DB/HIV/HIVQueryHelper.pm ok 657 - POD test for Bio/DB/SeqVersion/gi.pm ok 658 - POD test for Bio/DB/TFBS/transfac_pro.pm ok 659 - POD test for Bio/DB/GFF/Feature.pm ok 660 - POD test for Bio/DB/GFF/Featname.pm ok 661 - POD test for Bio/DB/GFF/Homol.pm ok 662 - POD test for Bio/DB/GFF/RelSegment.pm ok 663 - POD test for Bio/DB/GFF/Aggregator.pm ok 664 - POD test for Bio/DB/GFF/Typename.pm ok 665 - POD test for Bio/DB/GFF/Segment.pm ok 666 - POD test for Bio/DB/GFF/Util/Rearrange.pm ok 667 - POD test for Bio/DB/GFF/Util/Binning.pm ok 668 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22.pm ok 669 - POD test for Bio/DB/GFF/Aggregator/processed_transcript.pm ok 670 - POD test for Bio/DB/GFF/Aggregator/clone.pm ok 671 - POD test for Bio/DB/GFF/Aggregator/ucsc_refgene.pm ok 672 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm ok 673 - POD test for Bio/DB/GFF/Aggregator/coding.pm ok 674 - POD test for Bio/DB/GFF/Aggregator/ucsc_ensgene.pm ok 675 - POD test for Bio/DB/GFF/Aggregator/none.pm ok 676 - POD test for Bio/DB/GFF/Aggregator/ucsc_unigene.pm ok 677 - POD test for Bio/DB/GFF/Aggregator/transcript.pm ok 678 - POD test for Bio/DB/GFF/Aggregator/ucsc_acembly.pm ok 679 - POD test for Bio/DB/GFF/Aggregator/ucsc_genscan.pm ok 680 - POD test for Bio/DB/GFF/Aggregator/ucsc_softberry.pm ok 681 - POD test for Bio/DB/GFF/Aggregator/gene.pm ok 682 - POD test for Bio/DB/GFF/Aggregator/ucsc_twinscan.pm ok 683 - POD test for Bio/DB/GFF/Aggregator/so_transcript.pm ok 684 - POD test for Bio/DB/GFF/Aggregator/alignment.pm ok 685 - POD test for Bio/DB/GFF/Aggregator/orf.pm ok 686 - POD test for Bio/DB/GFF/Aggregator/match.pm ok 687 - POD test for Bio/DB/GFF/Adaptor/dbi.pm ok 688 - POD test for Bio/DB/GFF/Adaptor/memory.pm ok 689 - POD test for Bio/DB/GFF/Adaptor/berkeleydb.pm ok 690 - POD test for Bio/DB/GFF/Adaptor/ace.pm ok 691 - POD test for Bio/DB/GFF/Adaptor/biofetch.pm ok 692 - POD test for Bio/DB/GFF/Adaptor/biofetch_oracle.pm ok 693 - POD test for Bio/DB/GFF/Adaptor/dbi/oracle.pm ok 694 - POD test for Bio/DB/GFF/Adaptor/dbi/pg.pm ok 695 - POD test for Bio/DB/GFF/Adaptor/dbi/oracleace.pm ok 696 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm ok 697 - POD test for Bio/DB/GFF/Adaptor/dbi/iterator.pm ok 698 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlace.pm ok 699 - POD test for Bio/DB/GFF/Adaptor/dbi/mysql.pm ok 700 - POD test for Bio/DB/GFF/Adaptor/dbi/pg_fts.pm ok 701 - POD test for Bio/DB/GFF/Adaptor/dbi/caching_handle.pm ok 702 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm ok 703 - POD test for Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm ok 704 - POD test for Bio/DB/GFF/Adaptor/memory/feature_serializer.pm ok 705 - POD test for Bio/DB/GFF/Adaptor/memory/iterator.pm ok 706 - POD test for Bio/DB/Expression/geo.pm ok 707 - POD test for Bio/DB/Flat/BinarySearch.pm ok 708 - POD test for Bio/DB/Flat/BDB.pm ok 709 - POD test for Bio/DB/Flat/BDB/fasta.pm ok 710 - POD test for Bio/DB/Flat/BDB/genbank.pm ok 711 - POD test for Bio/DB/Flat/BDB/embl.pm ok 712 - POD test for Bio/DB/Flat/BDB/swiss.pm ok 713 - POD test for Bio/DB/SeqFeature/NormalizedTableFeatureI.pm ok 714 - POD test for Bio/DB/SeqFeature/Store.pm ok 715 - POD test for Bio/DB/SeqFeature/NormalizedFeature.pm ok 716 - POD test for Bio/DB/SeqFeature/NormalizedFeatureI.pm ok 717 - POD test for Bio/DB/SeqFeature/Segment.pm ok 718 - POD test for Bio/DB/SeqFeature/Store/LoadHelper.pm ok 719 - POD test for Bio/DB/SeqFeature/Store/GFF3Loader.pm ok 720 - POD test for Bio/DB/SeqFeature/Store/GFF2Loader.pm ok 721 - POD test for Bio/DB/SeqFeature/Store/Loader.pm ok 722 - POD test for Bio/DB/SeqFeature/Store/memory.pm ok 723 - POD test for Bio/DB/SeqFeature/Store/berkeleydb.pm ok 724 - POD test for Bio/DB/SeqFeature/Store/berkeleydb3.pm ok 725 - POD test for Bio/DB/SeqFeature/Store/FeatureFileLoader.pm ok 726 - POD test for Bio/DB/SeqFeature/Store/bdb.pm ok 727 - POD test for Bio/DB/SeqFeature/Store/DBI/Iterator.pm ok 728 - POD test for Bio/DB/SeqFeature/Store/DBI/SQLite.pm ok 729 - POD test for Bio/DB/SeqFeature/Store/DBI/mysql.pm ok 730 - POD test for Bio/DB/SeqFeature/Store/DBI/Pg.pm ok 731 - POD test for Bio/DB/Query/GenBank.pm ok 732 - POD test for Bio/DB/Query/HIVQuery.pm ok 733 - POD test for Bio/DB/Query/WebQuery.pm ok 734 - POD test for Bio/SearchIO/hmmer.pm ok 735 - POD test for Bio/SearchIO/EventHandlerI.pm ok 736 - POD test for Bio/SearchIO/IteratedSearchResultEventBuilder.pm ok 737 - POD test for Bio/SearchIO/blasttable.pm ok 738 - POD test for Bio/SearchIO/blastxml.pm ok 739 - POD test for Bio/SearchIO/psl.pm ok 740 - POD test for Bio/SearchIO/hmmer_pull.pm ok 741 - POD test for Bio/SearchIO/sim4.pm ok 742 - POD test for Bio/SearchIO/blast.pm ok 743 - POD test for Bio/SearchIO/fasta.pm ok 744 - POD test for Bio/SearchIO/infernal.pm ok 745 - POD test for Bio/SearchIO/gmap_f9.pm ok 746 - POD test for Bio/SearchIO/axt.pm ok 747 - POD test for Bio/SearchIO/rnamotif.pm ok 748 - POD test for Bio/SearchIO/SearchResultEventBuilder.pm ok 749 - POD test for Bio/SearchIO/waba.pm ok 750 - POD test for Bio/SearchIO/exonerate.pm ok 751 - POD test for Bio/SearchIO/erpin.pm ok 752 - POD test for Bio/SearchIO/SearchWriterI.pm ok 753 - POD test for Bio/SearchIO/hmmer2.pm ok 754 - POD test for Bio/SearchIO/hmmer3.pm ok 755 - POD test for Bio/SearchIO/FastHitEventBuilder.pm ok 756 - POD test for Bio/SearchIO/wise.pm ok 757 - POD test for Bio/SearchIO/megablast.pm ok 758 - POD test for Bio/SearchIO/cross_match.pm ok 759 - POD test for Bio/SearchIO/blast_pull.pm ok 760 - POD test for Bio/SearchIO/Writer/TextResultWriter.pm ok 761 - POD test for Bio/SearchIO/Writer/HitTableWriter.pm ok 762 - POD test for Bio/SearchIO/Writer/HTMLResultWriter.pm ok 763 - POD test for Bio/SearchIO/Writer/HSPTableWriter.pm ok 764 - POD test for Bio/SearchIO/Writer/BSMLResultWriter.pm ok 765 - POD test for Bio/SearchIO/Writer/GbrowseGFF.pm ok 766 - POD test for Bio/SearchIO/Writer/ResultTableWriter.pm ok 767 - POD test for Bio/SearchIO/XML/PsiBlastHandler.pm ok 768 - POD test for Bio/SearchIO/XML/BlastHandler.pm ok 769 - POD test for Bio/Phenotype/Measure.pm ok 770 - POD test for Bio/Phenotype/PhenotypeI.pm ok 771 - POD test for Bio/Phenotype/Phenotype.pm ok 772 - POD test for Bio/Phenotype/Correlate.pm ok 773 - POD test for Bio/Phenotype/OMIM/OMIMentry.pm ok 774 - POD test for Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm ok 775 - POD test for Bio/Phenotype/OMIM/OMIMparser.pm ok 776 - POD test for Bio/Phenotype/OMIM/MiniMIMentry.pm ok 777 - POD test for Bio/Phenotype/MeSH/Term.pm ok 778 - POD test for Bio/Phenotype/MeSH/Twig.pm ok 779 - POD test for Bio/Restriction/IO.pm ok 780 - POD test for Bio/Restriction/EnzymeI.pm ok 781 - POD test for Bio/Restriction/Enzyme.pm ok 782 - POD test for Bio/Restriction/EnzymeCollection.pm ok 783 - POD test for Bio/Restriction/Analysis.pm ok 784 - POD test for Bio/Restriction/Enzyme/MultiCut.pm ok 785 - POD test for Bio/Restriction/Enzyme/MultiSite.pm ok 786 - POD test for Bio/Restriction/IO/base.pm ok 787 - POD test for Bio/Restriction/IO/itype2.pm ok 788 - POD test for Bio/Restriction/IO/withrefm.pm ok 789 - POD test for Bio/Restriction/IO/prototype.pm ok 790 - POD test for Bio/Restriction/IO/bairoch.pm ok 791 - POD test for Bio/PopGen/MarkerI.pm ok 792 - POD test for Bio/PopGen/PopulationI.pm ok 793 - POD test for Bio/PopGen/IndividualI.pm ok 794 - POD test for Bio/PopGen/Population.pm ok 795 - POD test for Bio/PopGen/Genotype.pm ok 796 - POD test for Bio/PopGen/PopStats.pm ok 797 - POD test for Bio/PopGen/Utilities.pm ok 798 - POD test for Bio/PopGen/Statistics.pm ok 799 - POD test for Bio/PopGen/GenotypeI.pm ok 800 - POD test for Bio/PopGen/IO.pm ok 801 - POD test for Bio/PopGen/HtSNP.pm ok 802 - POD test for Bio/PopGen/Marker.pm ok 803 - POD test for Bio/PopGen/Individual.pm ok 804 - POD test for Bio/PopGen/TagHaplotype.pm ok 805 - POD test for Bio/PopGen/Simulation/Coalescent.pm ok 806 - POD test for Bio/PopGen/Simulation/GeneticDrift.pm ok 807 - POD test for Bio/PopGen/IO/prettybase.pm ok 808 - POD test for Bio/PopGen/IO/phase.pm ok 809 - POD test for Bio/PopGen/IO/hapmap.pm ok 810 - POD test for Bio/PopGen/IO/csv.pm ok 811 - POD test for Bio/Cluster/ClusterFactory.pm ok 812 - POD test for Bio/Cluster/UniGene.pm ok 813 - POD test for Bio/Cluster/SequenceFamily.pm ok 814 - POD test for Bio/Cluster/FamilyI.pm ok 815 - POD test for Bio/Cluster/UniGeneI.pm ok 816 - POD test for scripts/seq/bp_seqconvert.pl ok 817 - POD test for scripts/seq/bp_make_mrna_protein.pl ok 818 - POD test for scripts/seq/bp_seqpart.pl ok 819 - POD test for scripts/seq/bp_translate_seq.pl ok 820 - POD test for scripts/seq/bp_seqretsplit.pl ok 821 - POD test for scripts/seq/bp_extract_feature_seq.pl ok 822 - POD test for scripts/seq/bp_seqcut.pl ok 823 - POD test for scripts/seq/bp_split_seq.pl ok 824 - POD test for scripts/seq/bp_unflatten_seq.pl ok 825 - POD test for scripts/popgen/bp_composite_LD.pl ok 826 - POD test for scripts/popgen/bp_heterogeneity_test.pl ok 827 - POD test for scripts/index/bp_index.pl ok 828 - POD test for scripts/index/bp_seqret.pl ok 829 - POD test for scripts/index/bp_fetch.pl ok 830 - POD test for scripts/Bio-DB-GFF/bp_fast_load_gff.pl ok 831 - POD test for scripts/Bio-DB-GFF/bp_process_sgd.pl ok 832 - POD test for scripts/Bio-DB-GFF/bp_process_wormbase.pl ok 833 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff3.pl ok 834 - POD test for scripts/Bio-DB-GFF/bp_bulk_load_gff.pl ok 835 - POD test for scripts/Bio-DB-GFF/bp_meta_gff.pl ok 836 - POD test for scripts/Bio-DB-GFF/bp_load_gff.pl ok 837 - POD test for scripts/Bio-DB-GFF/bp_genbank2gff.pl ok 838 - POD test for scripts/Bio-DB-GFF/bp_generate_histogram.pl ok 839 - POD test for scripts/Bio-DB-GFF/bp_process_gadfly.pl ok 840 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.pl ok 841 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.pl (no pod) ok 842 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.pl (no pod) ok 843 - POD test for scripts/taxa/bp_query_entrez_taxa.pl ok 844 - POD test for scripts/taxa/bp_taxid4species.pl ok 845 - POD test for scripts/taxa/bp_taxonomy2tree.pl ok 846 - POD test for scripts/taxa/bp_classify_hits_kingdom.pl ok 847 - POD test for scripts/taxa/bp_local_taxonomydb_query.pl ok 848 - POD test for scripts/seqstats/bp_aacomp.pl ok 849 - POD test for scripts/seqstats/bp_gccalc.pl ok 850 - POD test for scripts/seqstats/bp_oligo_count.pl ok 851 - POD test for scripts/seqstats/bp_chaos_plot.pl ok 852 - POD test for scripts/searchio/bp_fastam9_to_table.pl ok 853 - POD test for scripts/searchio/bp_filter_search.pl ok 854 - POD test for scripts/searchio/bp_parse_hmmsearch.pl ok 855 - POD test for scripts/searchio/bp_hmmer_to_table.pl ok 856 - POD test for scripts/searchio/bp_search2table.pl ok 857 - POD test for scripts/utilities/bp_pairwise_kaks.pl ok 858 - POD test for scripts/utilities/bp_revtrans-motif.pl ok 859 - POD test for scripts/utilities/bp_search2alnblocks.pl ok 860 - POD test for scripts/utilities/bp_search2tribe.pl ok 861 - POD test for scripts/utilities/bp_netinstall.pl ok 862 - POD test for scripts/utilities/bp_sreformat.pl ok 863 - POD test for scripts/utilities/bp_search2BSML.pl ok 864 - POD test for scripts/utilities/bp_download_query_genbank.pl ok 865 - POD test for scripts/utilities/bp_remote_blast.pl ok 866 - POD test for scripts/utilities/bp_nrdb.pl ok 867 - POD test for scripts/utilities/bp_mask_by_search.pl ok 868 - POD test for scripts/utilities/bp_search2gff.pl ok 869 - POD test for scripts/utilities/bp_seq_length.pl ok 870 - POD test for scripts/utilities/bp_dbsplit.pl ok 871 - POD test for scripts/utilities/bp_mutate.pl ok 872 - POD test for scripts/utilities/bp_mrtrans.pl ok 873 - POD test for scripts/das/bp_das_server.pl (no pod) ok 874 - POD test for scripts/DB-HIV/bp_hivq.pl ok 875 - POD test for scripts/tree/bp_blast2tree.pl ok 876 - POD test for scripts/tree/bp_tree2pag.pl ok 877 - POD test for scripts/tree/bp_nexus2nh.pl ok 878 - POD test for scripts/DB/bp_bioflat_index.pl ok 879 - POD test for scripts/DB/bp_biofetch_genbank_proxy.pl ok 880 - POD test for scripts/DB/bp_flanks.pl ok 881 - POD test for scripts/DB/bp_biogetseq.pl ok 882 - POD test for examples/bioperl.pl (no pod) ok 883 - POD test for examples/make_primers.pl (no pod) ok 884 - POD test for examples/generate_random_seq.pl (no pod) ok 885 - POD test for examples/revcom_dir.pl (no pod) ok 886 - POD test for examples/rev_and_trans.pl (no pod) ok 887 - POD test for examples/longorf.pl ok 888 - POD test for examples/subsequence.cgi (no pod) ok 889 - POD test for examples/quality/svgtrace.pl (no pod) ok 890 - POD test for examples/cluster/dbsnp.pl (no pod) ok 891 - POD test for examples/sirna/rnai_finder.cgi ok 892 - POD test for examples/db/use_registry.pl (no pod) ok 893 - POD test for examples/db/dbfetch ok 894 - POD test for examples/db/rfetch.pl (no pod) ok 895 - POD test for examples/db/est_tissue_query.pl (no pod) ok 896 - POD test for examples/db/get_seqs.pl (no pod) ok 897 - POD test for examples/db/gb2features.pl (no pod) ok 898 - POD test for examples/db/getGenBank.pl (no pod) ok 899 - POD test for examples/contributed/rebase2list.pl (no pod) ok 900 - POD test for examples/contributed/nmrpdb_parse.pl (no pod) ok 901 - POD test for examples/contributed/prosite2perl.pl (no pod) ok 902 - POD test for examples/tk/hitdisplay.pl (no pod) ok 903 - POD test for examples/tk/gsequence.pl (no pod) ok 904 - POD test for examples/popgen/parse_calc_stats.pl (no pod) ok 905 - POD test for examples/tools/psw.pl (no pod) ok 906 - POD test for examples/tools/run_genscan.pl (no pod) ok 907 - POD test for examples/tools/reverse-translate.pl ok 908 - POD test for examples/tools/gff2ps.pl ok 909 - POD test for examples/tools/gb_to_gff.pl (no pod) ok 910 - POD test for examples/tools/seq_pattern.pl (no pod) ok 911 - POD test for examples/tools/run_primer3.pl ok 912 - POD test for examples/tools/standaloneblast.pl (no pod) ok 913 - POD test for examples/tools/parse_codeml.pl (no pod) ok 914 - POD test for examples/tools/extract_genes.pl ok 915 - POD test for examples/Bio-DB-GFF/load_ucsc.pl (no pod) ok 916 - POD test for examples/root/exceptions3.pl (no pod) ok 917 - POD test for examples/root/exceptions4.pl (no pod) ok 918 - POD test for examples/root/exceptions2.pl (no pod) ok 919 - POD test for examples/root/exceptions1.pl (no pod) ok 920 - POD test for examples/root/lib/TestObject.pm ok 921 - POD test for examples/root/lib/TestInterface.pm ok 922 - POD test for examples/liveseq/change_gene.pl (no pod) ok 923 - POD test for examples/searchio/psiblast_iterations.pl (no pod) ok 924 - POD test for examples/searchio/resultwriter.pl (no pod) ok 925 - POD test for examples/searchio/psiblast_features.pl (no pod) ok 926 - POD test for examples/searchio/htmlwriter.pl (no pod) ok 927 - POD test for examples/searchio/waba2gff.pl (no pod) ok 928 - POD test for examples/searchio/waba2gff3.pl ok 929 - POD test for examples/searchio/hspwriter.pl (no pod) ok 930 - POD test for examples/searchio/hitwriter.pl (no pod) ok 931 - POD test for examples/searchio/rawwriter.pl (no pod) ok 932 - POD test for examples/searchio/custom_writer.pl (no pod) ok 933 - POD test for examples/searchio/blast_example.pl (no pod) ok 934 - POD test for examples/structure/structure-io.pl (no pod) ok 935 - POD test for examples/align/FastAlign.pl ok 936 - POD test for examples/align/aligntutorial.pl (no pod) ok 937 - POD test for examples/align/simplealign.pl (no pod) ok 938 - POD test for examples/align/align_on_codons.pl (no pod) ok 939 - POD test for examples/align/clustalw.pl (no pod) ok 940 - POD test for examples/tree/paup2phylip.pl (no pod) ok 941 - POD test for maintenance/modules.pl ok 942 - POD test for maintenance/module_usage.pl (no pod) ok 943 - POD test for maintenance/version.pl ok 944 - POD test for maintenance/dependencies.pl ok 945 - POD test for maintenance/check_URLs.pl ok 946 - POD test for maintenance/check_NAME.pl ok 947 - POD test for maintenance/pod.pl ok 948 - POD test for maintenance/deprecated.pl ok 949 - POD test for maintenance/symlink_script.pl ok 950 - POD test for maintenance/ncbi_blast_switches.pl (no pod) ok 951 - POD test for maintenance/cvs2cl_by_file.pl ok 952 - POD test for maintenance/authors.pl ok 953 - POD test for maintenance/find_mod_deps.pl ok t/PopGen/Coalescent.t .................. 1..13 ok 1 - use Bio::PopGen::Simulation::Coalescent; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::TreeIO; ok 4 ok 5 ok 6 - pi ok 7 - theta ok 8 - tajimaD ok 9 - all the mutations should be polymorphic (by definition) ok 10 - fu and li D ok 11 - fu and li D* ok 12 - fu and li F ok 13 - fu and li F ok t/PopGen/HtSNP.t ....................... 1..8 ok 1 - use Bio::PopGen::HtSNP; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/PopGen/MK.t .......................... 1..46 ok 1 - use Bio::AlignIO; ok 2 - use Bio::PopGen::Statistics; ok 3 - use Bio::PopGen::Utilities; ok 4 - An object of class 'Bio::PopGen::Statistics' isa 'Bio::PopGen::Statistics' ok 5 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 6 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population' ok 7 - Marker Names ok 8 - Number of Inds ok 9 - number of ingroup sequences ok 10 - number of outgroup1 sequences ok 11 - number of outgroup2 sequences ok 12 - NSpoly ok 13 - NSfixed ok 14 - Spoly ok 15 - Sfixed ok 16 - McDonald Kreitman ok 17 - NSpoly ok 18 - NSfixed ok 19 - Spoly ok 20 - Sfixed ok 21 - McDonald Kreitman ok 22 - NSpoly ok 23 - NSfixed ok 24 - Spoly ok 25 - Sfixed ok 26 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok 27 - An object of class 'Bio::PopGen::Population' isa 'Bio::PopGen::Population' ok 28 - Marker Names ok 29 - Number of Inds ok 30 - number of ingroup sequences ok 31 - number of outgroup1 sequences ok 32 - number of outgroup2 sequences ok 33 - NSpoly ok 34 - NSfixed ok 35 - Spoly ok 36 - Sfixed ok 37 - McDonald Kreitman ok 38 - NSpoly ok 39 - NSfixed ok 40 - Spoly ok 41 - Sfixed ok 42 - McDonald Kreitman ok 43 - NSpoly ok 44 - NSfixed ok 45 - Spoly ok 46 - Sfixed ok t/PopGen/PopGen.t ...................... 1..105 ok 1 - use IO::String; ok 2 - use Bio::PopGen::Individual; ok 3 - use Bio::PopGen::Genotype; ok 4 - use Bio::PopGen::Population; ok 5 - use Bio::PopGen::IO; ok 6 - use Bio::PopGen::PopStats; ok 7 - use Bio::AlignIO; ok 8 - use Bio::PopGen::Statistics; ok 9 - use Bio::PopGen::Utilities; ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 - mrsa,mssa aflp1 ok 41 - all pops, aflp1 ok 42 - mrsa,envpop aflp1,aflp2 ok 43 ok 44 ok 45 ok 46 - mssa,mrsa all_bands ok 47 - env,mssa mkr1 ok 48 - env,mssa,mrsa all bands ok 49 - env,mssa,mrsa mkr2 ok 50 - mrsa,nc all_bands ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 - Pi on 3-allele data ok 105 - Theta on 3-allele data ok t/PopGen/PopGenSims.t .................. 1..23 ok 1 - use Bio::PopGen::Simulation::GeneticDrift; ok 2 - Allele freqs should sum to 1 ok 3 - Allele freqs should sum to 1 ok 4 - Allele freqs should sum to 1 ok 5 - Allele freqs should sum to 1 ok 6 - Allele freqs should sum to 1 ok 7 - Allele freqs should sum to 1 ok 8 - Allele freqs should sum to 1 ok 9 - Allele freqs should sum to 1 ok 10 - Allele freqs should sum to 1 ok 11 - Allele freqs should sum to 1 ok 12 ok 13 - All frequencies should be <= 1 ok 14 - Allele freqs should sum to 1 ok 15 - Allele freqs should sum to 1 ok 16 - Allele freqs should sum to 1 ok 17 - Allele freqs should sum to 1 ok 18 - Allele freqs should sum to 1 ok 19 - Allele freqs should sum to 1 ok 20 - Allele freqs should sum to 1 ok 21 - Allele freqs should sum to 1 ok 22 - Allele freqs should sum to 1 ok 23 - Allele freqs should sum to 1 ok t/PopGen/TagHaplotype.t ................ 1..3 ok 1 - use Bio::PopGen::TagHaplotype; ok 2 ok 3 ok t/RemoteDB/BioFetch.t .................. skipped: Network tests have not been requested t/RemoteDB/CUTG.t ...................... 1..37 ok 1 - use Bio::DB::CUTG; ok 2 - use Bio::CodonUsage::Table; ok 3 - use Bio::CodonUsage::IO; ok 4 - use Bio::SeqIO; ok 5 - use Bio::Tools::SeqStats; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok t/RemoteDB/EMBL.t ...................... skipped: Network tests have not been requested t/RemoteDB/EntrezGene.t ................ skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/RemoteDB/GenBank.t ................... skipped: Network tests have not been requested t/RemoteDB/GenPept.t ................... skipped: Network tests have not been requested t/RemoteDB/HIV/HIV.t ................... 1..30 ok 1 - use Bio::DB::HIV; ok 2 - use Bio::DB::WebDBSeqI; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - An object of class 'Bio::DB::HIV' isa 'Bio::DB::HIV' ok 5 - An object of class 'Bio::DB::HIV' isa 'Bio::Root::Root' ok 6 - Bio::DB::HIV->can(...) ok 7 - Bio::DB::HIV->can(...) ok 8 - Bio::DB::HIV->can(...) ok 9 - lanl_base set in default object ok 10 - map_db set in default object ok 11 - make_search_if set in default object ok 12 - search_ set in default object ok 13 - url_base_address set in default object ok 14 - default sequence request format (fasta) ok 15 - sorry till implemented ok 16 - sorry till implemented ok 17 - HIVQuery type exception check ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVAnnotProcessor.t ..... 1..11 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::DB::HIV::HIVAnnotProcessor; ok 4 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::DB::HIV::HIVAnnotProcessor' ok 5 - An object of class 'Bio::DB::HIV::HIVAnnotProcessor' isa 'Bio::Root::Root' ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...) ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query') ok 8 - bad type set exception ok 9 - attach stream ok 10 - write exception ok 11 - access stream ok t/RemoteDB/HIV/HIVQuery.t .............. 1..41 ok 1 - use Bio::DB::Query::HIVQuery; ok 2 - use Bio::DB::HIV; ok 3 - use Bio::Annotation::Collection; ok 4 - use Bio::Annotation::Comment; ok 5 - use Bio::Annotation::Reference; ok 6 - use Bio::DB::HIV::HIVQueryHelper; ok 7 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::DB::Query::HIVQuery' ok 8 - An object of class 'Bio::DB::Query::HIVQuery' isa 'Bio::Root::Root' ok 9 - Bio::DB::Query::HIVQuery->can(...) ok 10 - Bio::DB::Query::HIVQuery->can(...) ok 11 - Bio::DB::Query::HIVQuery->can(...) ok 12 - _map_db_uri set in default object ok 13 - _make_search_if_uri set in default object ok 14 - _search_uri set in default object ok 15 - _schema_file set in default object ok 16 - _run_option set in default object ok 17 - annotations container available ok 18 - query syntax check 1 ok 19 - query syntax check 2 ok 20 - query syntax check 3 ok 21 - query parser check ok 22 - multiquery parse check ok 23 - use HTML::Parser; ok 24 - help html to file ok 25 - help html parsed ok 26 - bad field exception check ok 27 - bad match data exception check ok 28 - empty field not ok exception check ok 29 - uninitialized schema exception check ok 30 - query not run (level 1) warning check ok 31 - query not run (level 2) warning check ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok t/RemoteDB/HIV/HIVQueryHelper.t ........ 1..40 ok 1 - use Bio::DB::HIV::HIVQueryHelper; ok 2 - An object of class 'HIVSchema' isa 'HIVSchema' ok 3 - An object of class 'QRY' isa 'QRY' ok 4 - An object of class 'R' isa 'R' ok 5 - An object of class 'Q' isa 'Q' ok 6 - schema load ok 7 - HIVSchema->can(...) ok 8 - fields complete ok 9 - tables complete ok 10 - aliases complete ok 11 ok 12 - test field syntax ok ok 13 - test field syntax ok ok 14 - test alias by field name ok 15 - correct primary key for SequenceEntry ok 16 - correct number of foreign keys for AUthor ok 17 - correct foreign table for au_pub_id ok 18 - correct annotation key hash ok 19 - QRY->can(...) ok 20 - R->can(...) ok 21 - Q->can(...) ok 22 - null QRY ok 23 - null R (request object) ok 24 - null Q (atomic query object) ok 25 - R obj create and init (1) ok 26 - R obj create and init (2) ok 27 - R::In ok 28 - !R::In ok 29 - R::Eq ok 30 - QRY obj create and init (1) ok 31 - QRY obj create and init (2) ok 32 - QRY obj create and init (3) ok 33 - QRY overload | ok 34 - QRY overload & ok 35 - QRY nontrivial & ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]} ok 37 - make: 2 queries returned ok 38 - {annotation fields} parsed correctly ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]} ok 40 - above query is null ok t/RemoteDB/MeSH.t ...................... skipped: Network tests have not been requested t/RemoteDB/Query/GenBank.t ............. skipped: Network tests have not been requested t/RemoteDB/RefSeq.t .................... 1..16 ok 1 - use Bio::DB::RefSeq; ok 2 - use Bio::DB::GenBank; ok 3 - use Bio::DB::EMBL; ok 4 ok 5 ok 6 ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok t/RemoteDB/SeqHound.t .................. skipped: Network tests have not been requested t/RemoteDB/SeqRead_fail.t .............. skipped: Network tests have not been requested t/RemoteDB/SeqVersion.t ................ ok 1 - use Bio::DB::SeqVersion; ok 2 ok 3 # skip Network tests have not been requested ok 4 # skip Network tests have not been requested ok 5 # skip Network tests have not been requested ok 6 # skip Network tests have not been requested ok 7 # skip Network tests have not been requested ok 8 # skip Network tests have not been requested ok 9 # skip Network tests have not been requested ok 10 # skip Network tests have not been requested 1..10 ok t/RemoteDB/SwissProt.t ................. skipped: Network tests have not been requested t/RemoteDB/Taxonomy.t .................. 1..191 ok 1 - use Bio::DB::Taxonomy; ok 2 - use Bio::Tree::Tree; ok 3 ok 4 - An object of class 'Bio::DB::Taxonomy::entrez' isa 'Bio::DB::Taxonomy::entrez' ok 5 - An object of class 'Bio::DB::Taxonomy::entrez' isa 'Bio::DB::Taxonomy' ok 6 ok 7 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy::flatfile' ok 8 - An object of class 'Bio::DB::Taxonomy::flatfile' isa 'Bio::DB::Taxonomy' ok 9 ok 10 # skip Network tests have not been requested ok 11 # skip Network tests have not been requested ok 12 # skip Network tests have not been requested ok 13 # skip Network tests have not been requested ok 14 # skip Network tests have not been requested ok 15 # skip Network tests have not been requested ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok 19 # skip Network tests have not been requested ok 20 # skip Network tests have not been requested ok 21 # skip Network tests have not been requested ok 22 # skip Network tests have not been requested ok 23 # skip Network tests have not been requested ok 24 # skip Network tests have not been requested ok 25 # skip Network tests have not been requested ok 26 # skip Network tests have not been requested ok 27 # skip Network tests have not been requested ok 28 # skip Network tests have not been requested ok 29 # skip Network tests have not been requested ok 30 # skip Network tests have not been requested ok 31 # skip Network tests have not been requested ok 32 # skip Network tests have not been requested ok 33 # skip Network tests have not been requested ok 34 # skip Network tests have not been requested ok 35 # skip Network tests have not been requested ok 36 # skip Network tests have not been requested ok 37 # skip Network tests have not been requested ok 38 # skip Network tests have not been requested ok 39 # skip Network tests have not been requested ok 40 # skip Network tests have not been requested ok 41 # skip Network tests have not been requested ok 42 # skip Network tests have not been requested ok 43 # skip Network tests have not been requested ok 44 # skip Network tests have not been requested ok 45 # skip Network tests have not been requested ok 46 # skip Network tests have not been requested ok 47 # skip Network tests have not been requested ok 48 # skip Network tests have not been requested ok 49 # skip Network tests have not been requested ok 50 # skip Network tests have not been requested ok 51 # skip Network tests have not been requested ok 52 # skip Network tests have not been requested ok 53 # skip Network tests have not been requested ok 54 # skip Network tests have not been requested ok 55 # skip Network tests have not been requested ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - Bio::DB::Taxonomy::flatfile: common names ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy::list' ok 101 - An object of class 'Bio::DB::Taxonomy::list' isa 'Bio::DB::Taxonomy' ok 102 ok 103 ok 104 ok 105 ok 106 - Ranks ok 107 ok 108 ok 109 - Ranks ok 110 ok 111 - An object of class 'Bio::Tree::Tree' isa 'Bio::Tree::TreeI' ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 # skip Network tests have not been requested ok 129 # skip Network tests have not been requested ok 130 # skip Network tests have not been requested ok 131 # skip Network tests have not been requested ok 132 # skip Network tests have not been requested ok 133 # skip Network tests have not been requested ok 134 # skip Network tests have not been requested ok 135 # skip Network tests have not been requested ok 136 # skip Network tests have not been requested ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 # skip Network tests have not been requested ok 149 - List context ok 150 - 'Scalar context' isa 'SCALAR' ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 - DB with ambiguous names ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok t/Restriction/Analysis-refac.t ......... 1..91 ok 1 - use Bio::Restriction::IO; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Restriction::EnzymeCollection; ok 4 - use Bio::Restriction::Enzyme; ok 5 - read withrefm file ok 6 - parse withrefm file ok 7 - HindIII: nonambiguous intrasite cutter ok 8 - AarI: nonambiguous extrasite cutter ok 9 - AasI: ambiguous intrasite cutter ok 10 - BceSI: ambiguous extrasite cutter ok 11 - AjuI: cutter with central recog site ok 12 - TaqII: multi-extrasite cutter ok 13 ok 14 - HindIII plus ok 15 - HindIII minus ok 16 - AasI plus ok 17 - AasI minus ok 18 - AarI plus ok 19 - AarI minus ok 20 - BceSI plus ok 21 - BceSI minus ok 22 - AjuI plus ok 23 - AjuI minus ok 24 - TaqII plus ok 25 - TaqII minus ok 26 - build real B:R::Analysis object ok 27 - 13 fragments ok 28 - circularize ok 29 - recut ok 30 - circ: AasI # site at origin ok 31 - circ: still 13 fragments (cut site at origin) ok 32 - use Bio::Restriction::IO; ok 33 - use Bio::Restriction::Analysis; ok 34 - read withrefm file ok 35 - parse withrefm file ok 36 - Collection initiated ok 37 - AbeI: found ok into collection ok 38 - AccBSI: found ok into collection ok 39 - AciI: found ok into collection ok 40 - Asp26HI: found ok into collection ok 41 - BmgBI: found ok into collection ok 42 - AbeI plus ok 43 - AbeI minus ok 44 - AbeI fragment ok 45 - AbeI positions ok 46 - AbeI Overhang ok 47 - AbeI name ok 48 - AbeI site ok 49 - AbeI revcom_site ok 50 - AbeI cut ok 51 - AbeI complementary_cut ok 52 - AccBSI plus ok 53 - AccBSI minus ok 54 - AccBSI fragment ok 55 - AccBSI positions ok 56 - AccBSI Overhang ok 57 - AccBSI name ok 58 - AccBSI site ok 59 - AccBSI revcom_site ok 60 - AccBSI cut ok 61 - AccBSI complementary_cut ok 62 - AciI plus ok 63 - AciI minus ok 64 - AciI fragment ok 65 - AciI positions ok 66 - AciI Overhang ok 67 - AciI name ok 68 - AciI site ok 69 - AciI revcom_site ok 70 - AciI cut ok 71 - AciI complementary_cut ok 72 - Asp26HI plus ok 73 - Asp26HI minus ok 74 - Asp26HI fragment ok 75 - Asp26HI positions ok 76 - Asp26HI Overhang ok 77 - Asp26HI name ok 78 - Asp26HI site ok 79 - Asp26HI revcom_site ok 80 - Asp26HI cut ok 81 - Asp26HI complementary_cut ok 82 - BmgBI plus ok 83 - BmgBI minus ok 84 - BmgBI fragment ok 85 - BmgBI positions ok 86 - BmgBI Overhang ok 87 - BmgBI name ok 88 - BmgBI site ok 89 - BmgBI revcom_site ok 90 - BmgBI cut ok 91 - BmgBI complementary_cut ok t/Restriction/Analysis.t ............... 1..182 ok 1 - use Bio::Restriction::Enzyme; ok 2 - use Bio::Restriction::Enzyme::MultiCut; ok 3 - use Bio::Restriction::Enzyme::MultiSite; ok 4 - use Bio::Restriction::EnzymeCollection; ok 5 - use Bio::Restriction::Analysis; ok 6 - use Bio::SeqIO; ok 7 ok 8 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::EnzymeI' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - bug 2179 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI' ok 77 - An object of class 'Bio::Restriction::Enzyme::MultiSite' isa 'Bio::Restriction::EnzymeI' ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI' ok 88 - An object of class 'Bio::Restriction::Enzyme::MultiCut' isa 'Bio::Restriction::EnzymeI' ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme' ok 100 ok 101 ok 102 - An object of class 'Bio::Restriction::Enzyme' isa 'Bio::Restriction::Enzyme' ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 - number of unique cutters ok 119 - number of RsaI fragments ok 120 - number of maximum cutters ok 121 - number of zero cutters ok 122 - number of cutters ok 123 - number of 3x cutters ok 124 - 4 MseI fragments ok 125 - 3 MseI cut sites ok 126 - expected 2 PspEI fragments ok 127 ok 128 ok 129 - expected 2 sizes for PspEI ok 130 ok 131 - expected 2 sizes for PspEI ok 132 ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut ok 134 ok 135 ok 136 - number of RsaI fragments ok 137 - 3 circular MseI fragments ok 138 - 3 circular MseI cut sites ok 139 - number for AciI a non-palindromic enzyme ok 140 - 1 fragment for MwoI as it cuts across the circ point ok 141 ok 142 ok 143 ok 144 ok 145 - 7 fragments in the multiple digest ok 146 - 7 positions in the multiple digest ok 147 - 7 sizes in the multiple digest ok 148 ok 149 - expected 9 cuts for HindI ok 150 - expect 9 fragment maps for HindI ok 151 - sequence for GT ok 152 - start at 40 ok 153 - end at 41 ok 154 - sequence for GGATTAAAAAAAGAGT ok 155 - start at 42 ok 156 - end at 57 ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT ok 158 - start at 58 ok 159 - end at 92 ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA ok 161 - start at 93 ok 162 - end at 123 ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA ok 164 - start at 124 ok 165 - end at 155 ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA ok 167 - start at 156 ok 168 - end at 181 ok 169 - sequence for CAACATCCATGAAACGCATTAGCA ok 170 - start at 182 ok 171 - end at 205 ok 172 - sequence for CCA ok 173 - start at 206 ok 174 - end at 208 ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT ok 176 - start at 209 ok 177 - end at 39 ok 178 ok 179 - bug 2139 ok 180 - number of HindIII fragments ok 181 - number of EcoRI fragments ok 182 - number of RsaI fragments ok t/Restriction/Gel.t .................... 1..9 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Restriction::Analysis; ok 3 - use Bio::Tools::Gel; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok t/Restriction/IO.t ..................... 1..18 ok 1 - use Bio::Restriction::IO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT! # Failed (TODO) test at t/Restriction/IO.t line 31. ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 # skip Network tests have not been requested ok 17 # skip Network tests have not been requested ok 18 # skip Network tests have not been requested ok t/Root/Exception.t ..................... 1..8 ok 1 - use TestObject; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Root/HTTPget.t ....................... skipped: Network tests have not been requested t/Root/RootI.t ......................... 1..63 ok 1 - use Bio::Root::Root; ok 2 - use Bio::Seq; ok 3 ok 4 - An object of class 'Bio::Root::Root' isa 'Bio::Root::RootI' ok 5 - threw Regexp ((?^:Testing throw)) ok 6 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented)) ok 7 - threw Regexp ((?^:EXCEPTION )) ok 8 - threw Regexp ((?^:Testing throw)) ok 9 ok 10 - threw Regexp ((?^:Testing throw)) ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 - simple ok 17 - simple ok 18 - warns for versions below current version 1.006923 ok 19 - warns for versions below current version 1.006923 ok 20 - throws for versions above 1.006923 ok 21 - throws for versions above 1.006923 ok 22 - throws for versions equal to 1.006923 ok 23 - simple ok 24 - simple ok 25 - warns for versions below current version 1.006923 ok 26 - warns for versions below current version 1.006923 ok 27 - throws for versions above 1.006923 ok 28 - throws for versions above 1.006923 ok 29 - arg callable since method was created ok 30 - mal-formed arg callable since method was created with good name ok 31 - Bio::Foo2->can('t3') ok 32 - Methods don't pollute original Bio::Root::Root namespace ok 33 - Bio::Foo2->can('test_4') ok 34 - Methods don't pollute original Bio::Root::Root namespace ok 35 - Bio::Foo3->can('t5') ok 36 - arg not in method list not created ok 37 - Bio::Foo3->can('t5') ok 38 - Methods don't pollute original Bio::Root::Root namespace ok 39 - verbose was set correctly ok 40 - synonym was set correctly ok 41 - real method of synonym was set correctly ok 42 - mal-formed arg correctly resolved to created method ok 43 - synonym of set method was set correctly ok 44 - Bio::Foo4->can('t7') ok 45 - Methods don't pollute original Bio::Root::Root namespace ok 46 - Bio::Foo4->can('test7') ok 47 - Methods don't pollute original Bio::Root::Root namespace ok 48 - Bio::Foo4->can('test_8') ok 49 - Methods don't pollute original Bio::Root::Root namespace ok 50 - Bio::Foo4->can('t8') ok 51 - Methods don't pollute original Bio::Root::Root namespace ok 52 - clone ok 53 - clone ok 54 - clone ok 55 - clone changed, original didn't ok 56 - parameters passed to clone() modify object ok 57 - original is not modified ok 58 - must use proper versioning scheme ok 59 - warns for versions >= 1.006923 ok 60 - warns for versions >= 1.006923 ok 61 - throws for versions >= 1.006923 ok 62 - throws for versions >= 1.006923 ok 63 - No warnings/exceptions below 1.006923 ok t/Root/RootIO.t ........................ 1..77 ok 1 - use Bio::Root::IO; ok 2 - use Bio::SeqIO; ok 3 - use Bio::Assembly::IO; ok 4 ok 5 - throw() ok 6 - throw() verbose(-1) ok 7 - warn() ok 8 - throw() verbose(1) ok 9 - stack_trace() ok 10 - set verbosity to 1 ok 11 ok 12 ok 13 - executable file ok 14 - non-executable file ok 15 - executable dir ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 - filename, read ok 22 ok 23 ok 24 - filename, write ok 25 ok 26 ok 27 ok 28 ok 29 - handle, read ok 30 ok 31 ok 32 - handle, write ok 33 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 34 - is a write handle ok 35 - no warnings in ->close call ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 - _print ok 45 ok 46 - _insert at middle of file ok 47 ok 48 ok 49 ok 50 ok 51 - _insert in empty file ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 - Bio::Root::IO->new can handle a Path::Class object ok 64 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 65 # skip Network tests have not been requested ok 66 # skip Network tests have not been requested ok 67 - default -string method ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok t/Root/Storable.t ...................... 1..35 ok 1 - use Bio::Root::Storable; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok t/Root/Tempfile.t ...................... 1..18 ok 1 - use Bio::Root::IO; ok 2 ok 3 - An object of class 'Bio::Root::IO' isa 'Bio::Root::IO' ok 4 ok 5 ok 6 - auto UNLINK => 1 ok 7 ok 8 ok 9 - tempfile deleted ok 10 ok 11 - UNLINK => 0 ok 12 ok 13 ok 14 ok 15 - tempfile suffix ok 16 ok 17 - tempfile() in scalar context ok 18 ok --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip. --------------------------------------------------- --------------------- WARNING --------------------- MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip. --------------------------------------------------- t/Root/Utilities.t ..................... 1..56 ok 1 - use Bio::Root::Utilities; ok 2 - An object of class 'Bio::Root::Utilities' isa 'Bio::Root::Utilities' ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 - file_date() ok 38 - unix (\n or 012 or ^J) ok 39 - date format ok 40 - date format ok 41 - date format ok 42 - date format ok 43 - date format ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok t/SearchDist.t ......................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed t/SearchIO/CigarString.t ............... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/SearchIO.t .................. 1..19 ok 1 - use Bio::SearchIO; ok 2 - fasta for f.ssearch ok 3 - blast for filename.blast ok 4 - blastxml for f.blastxml ok 5 - blastxml for f.xml ok 6 - blast for fast.bls ok 7 - fasta for f.psearch ok 8 - exonerate for f.exonerate ok 9 - blast for f.blx ok 10 - fasta for f.osearch ok 11 - blast for filename.bls ok 12 - exonerate for f.exon ok 13 - fasta for f.fa ok 14 - fasta for f.fasta ok 15 - fasta for f.SSEARCH.m9 ok 16 - fasta for f.fx ok 17 - fasta for f.m9 ok 18 - blast for f.tblx ok 19 - fasta for f.fy ok t/SearchIO/SimilarityPair.t ............ 1..12 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SeqIO; ok 3 ok 4 - An object of class 'Bio::Seq' isa 'Bio::SeqI' ok 5 ok 6 - An object of class 'Bio::SearchIO::blast' isa 'Bio::SearchIO' ok 7 ok 8 - An object of class 'Bio::Search::Hit::BlastHit' isa 'Bio::Search::Hit::HitI' ok 9 ok 10 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 11 ok 12 ok t/SearchIO/Tiling.t .................... 1..1141 ok 1 - use Bio::Search::Tiling::MapTiling; ok 2 - use Bio::Search::Tiling::MapTileUtils; ok 3 - use Bio::SearchIO; ok 4 - use Bio::Search::Hit::BlastHit; ok 5 - use File::Spec; ok 6 - parse data file ok 7 - got test hit ok 8 - create tiling ok 9 - An object of class 'Bio::Search::Tiling::MapTiling' isa 'Bio::Search::Tiling::TilingI' ok 10 - implements 'next_tiling' ok 11 - implements 'rewind_tilings' ok 12 - implements 'identities' ok 13 - implements 'conserved' ok 14 - implements 'length' ok 15 - identities regression test ok 16 - conserved regression test ok 17 - tiling iterator regression test(1) ok 18 - tiling iterator regression test(2) ok 19 - tiling iterator regression test(3, rewind) ok 20 - ecolitst.wublastp ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - dnaEbsub_ecoli.wublastx ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 - tricky.wublast ok 37 - tricky.wublast(1) ok 38 - tricky.wublast(2) ok 39 - tricky.wublast(3) ok 40 - tricky.wublast(4) ok 41 - ecolitst.bls ok 42 - tile ecolitst.bls hit 1 \#hsps 1 ok 43 - q id: est (0.98293) = fast (0.98293) ok 44 - q cn: est (0.98293) = fast (0.98293) ok 45 - h id: est (0.98293) = fast (0.98293) ok 46 - h cn: est (0.98293) = fast (0.98293) ok 47 - tile ecolitst.bls hit 2 \#hsps 1 ok 48 - q id: est (0.30074) = fast (0.30074) ok 49 - q cn: est (0.49876) = fast (0.49876) ok 50 - h id: est (0.30759) = fast (0.30759) ok 51 - h cn: est (0.51013) = fast (0.51013) ok 52 - tile ecolitst.bls hit 3 \#hsps 1 ok 53 - q id: est (0.31004) = fast (0.31004) ok 54 - q cn: est (0.49782) = fast (0.49782) ok 55 - h id: est (0.32054) = fast (0.32054) ok 56 - h cn: est (0.51467) = fast (0.51467) ok 57 - tile ecolitst.bls hit 4 \#hsps 1 ok 58 - q id: est (0.30435) = fast (0.30435) ok 59 - q cn: est (0.47826) = fast (0.47826) ok 60 - h id: est (0.29787) = fast (0.29787) ok 61 - h cn: est (0.46809) = fast (0.46809) ok 62 - tricky.wublast ok 63 - tile tricky.wublast hit 1 \#hsps 7 ok 64 - q id: exact (0.22153) ~ est (0.22153) ok 65 - q id: exact (0.22153) <= max (0.22153) ok 66 - q cn: exact (0.42760) ~ est (0.42760) ok 67 - q cn: exact (0.42760) <= max (0.42760) ok 68 - h id: exact (0.22704) ~ est (0.22704) ok 69 - h id: exact (0.22704) <= max (0.22704) ok 70 - h cn: exact (0.43335) ~ est (0.43335) ok 71 - h cn: exact (0.43335) <= max (0.43335) ok 72 - a_thaliana.blastn ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1 ok 74 - q id: est (0.96667) = fast (0.96667) ok 75 - q cn: est (0.96667) = fast (0.96667) ok 76 - h id: est (0.98305) = fast (0.98305) ok 77 - h cn: est (0.98305) = fast (0.98305) ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1 ok 79 - q id: est (0.96667) = fast (0.96667) ok 80 - q cn: est (0.96667) = fast (0.96667) ok 81 - h id: est (0.98305) = fast (0.98305) ok 82 - h cn: est (0.98305) = fast (0.98305) ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1 ok 84 - q id: est (1.00000) = fast (1.00000) ok 85 - q cn: est (1.00000) = fast (1.00000) ok 86 - h id: est (1.00000) = fast (1.00000) ok 87 - h cn: est (1.00000) = fast (1.00000) ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1 ok 89 - q id: est (1.00000) = fast (1.00000) ok 90 - q cn: est (1.00000) = fast (1.00000) ok 91 - h id: est (1.00000) = fast (1.00000) ok 92 - h cn: est (1.00000) = fast (1.00000) ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1 ok 94 - q id: est (0.92308) = fast (0.92308) ok 95 - q cn: est (0.92308) = fast (0.92308) ok 96 - h id: est (0.92308) = fast (0.92308) ok 97 - h cn: est (0.92308) = fast (0.92308) ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1 ok 99 - q id: est (1.00000) = fast (1.00000) ok 100 - q cn: est (1.00000) = fast (1.00000) ok 101 - h id: est (1.00000) = fast (1.00000) ok 102 - h cn: est (1.00000) = fast (1.00000) ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1 ok 104 - q id: est (1.00000) = fast (1.00000) ok 105 - q cn: est (1.00000) = fast (1.00000) ok 106 - h id: est (1.00000) = fast (1.00000) ok 107 - h cn: est (1.00000) = fast (1.00000) ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1 ok 109 - q id: est (1.00000) = fast (1.00000) ok 110 - q cn: est (1.00000) = fast (1.00000) ok 111 - h id: est (1.00000) = fast (1.00000) ok 112 - h cn: est (1.00000) = fast (1.00000) ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1 ok 114 - q id: est (1.00000) = fast (1.00000) ok 115 - q cn: est (1.00000) = fast (1.00000) ok 116 - h id: est (1.00000) = fast (1.00000) ok 117 - h cn: est (1.00000) = fast (1.00000) ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1 ok 119 - q id: est (1.00000) = fast (1.00000) ok 120 - q cn: est (1.00000) = fast (1.00000) ok 121 - h id: est (1.00000) = fast (1.00000) ok 122 - h cn: est (1.00000) = fast (1.00000) ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1 ok 124 - q id: est (1.00000) = fast (1.00000) ok 125 - q cn: est (1.00000) = fast (1.00000) ok 126 - h id: est (1.00000) = fast (1.00000) ok 127 - h cn: est (1.00000) = fast (1.00000) ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1 ok 129 - q id: est (1.00000) = fast (1.00000) ok 130 - q cn: est (1.00000) = fast (1.00000) ok 131 - h id: est (1.00000) = fast (1.00000) ok 132 - h cn: est (1.00000) = fast (1.00000) ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1 ok 134 - q id: est (1.00000) = fast (1.00000) ok 135 - q cn: est (1.00000) = fast (1.00000) ok 136 - h id: est (1.00000) = fast (1.00000) ok 137 - h cn: est (1.00000) = fast (1.00000) ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1 ok 139 - q id: est (1.00000) = fast (1.00000) ok 140 - q cn: est (1.00000) = fast (1.00000) ok 141 - h id: est (1.00000) = fast (1.00000) ok 142 - h cn: est (1.00000) = fast (1.00000) ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1 ok 144 - q id: est (1.00000) = fast (1.00000) ok 145 - q cn: est (1.00000) = fast (1.00000) ok 146 - h id: est (1.00000) = fast (1.00000) ok 147 - h cn: est (1.00000) = fast (1.00000) ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1 ok 149 - q id: est (1.00000) = fast (1.00000) ok 150 - q cn: est (1.00000) = fast (1.00000) ok 151 - h id: est (1.00000) = fast (1.00000) ok 152 - h cn: est (1.00000) = fast (1.00000) ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1 ok 154 - q id: est (1.00000) = fast (1.00000) ok 155 - q cn: est (1.00000) = fast (1.00000) ok 156 - h id: est (1.00000) = fast (1.00000) ok 157 - h cn: est (1.00000) = fast (1.00000) ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1 ok 159 - q id: est (1.00000) = fast (1.00000) ok 160 - q cn: est (1.00000) = fast (1.00000) ok 161 - h id: est (1.00000) = fast (1.00000) ok 162 - h cn: est (1.00000) = fast (1.00000) ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1 ok 164 - q id: est (1.00000) = fast (1.00000) ok 165 - q cn: est (1.00000) = fast (1.00000) ok 166 - h id: est (1.00000) = fast (1.00000) ok 167 - h cn: est (1.00000) = fast (1.00000) ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1 ok 169 - q id: est (0.95238) = fast (0.95238) ok 170 - q cn: est (0.95238) = fast (0.95238) ok 171 - h id: est (0.95238) = fast (0.95238) ok 172 - h cn: est (0.95238) = fast (0.95238) ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1 ok 174 - q id: est (1.00000) = fast (1.00000) ok 175 - q cn: est (1.00000) = fast (1.00000) ok 176 - h id: est (1.00000) = fast (1.00000) ok 177 - h cn: est (1.00000) = fast (1.00000) ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1 ok 179 - q id: est (0.95238) = fast (0.95238) ok 180 - q cn: est (0.95238) = fast (0.95238) ok 181 - h id: est (0.95238) = fast (0.95238) ok 182 - h cn: est (0.95238) = fast (0.95238) ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1 ok 184 - q id: est (1.00000) = fast (1.00000) ok 185 - q cn: est (1.00000) = fast (1.00000) ok 186 - h id: est (1.00000) = fast (1.00000) ok 187 - h cn: est (1.00000) = fast (1.00000) ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1 ok 189 - q id: est (0.95238) = fast (0.95238) ok 190 - q cn: est (0.95238) = fast (0.95238) ok 191 - h id: est (0.95238) = fast (0.95238) ok 192 - h cn: est (0.95238) = fast (0.95238) ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1 ok 194 - q id: est (1.00000) = fast (1.00000) ok 195 - q cn: est (1.00000) = fast (1.00000) ok 196 - h id: est (1.00000) = fast (1.00000) ok 197 - h cn: est (1.00000) = fast (1.00000) ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1 ok 199 - q id: est (1.00000) = fast (1.00000) ok 200 - q cn: est (1.00000) = fast (1.00000) ok 201 - h id: est (1.00000) = fast (1.00000) ok 202 - h cn: est (1.00000) = fast (1.00000) ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1 ok 204 - q id: est (1.00000) = fast (1.00000) ok 205 - q cn: est (1.00000) = fast (1.00000) ok 206 - h id: est (1.00000) = fast (1.00000) ok 207 - h cn: est (1.00000) = fast (1.00000) ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1 ok 209 - q id: est (1.00000) = fast (1.00000) ok 210 - q cn: est (1.00000) = fast (1.00000) ok 211 - h id: est (1.00000) = fast (1.00000) ok 212 - h cn: est (1.00000) = fast (1.00000) ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1 ok 214 - q id: est (1.00000) = fast (1.00000) ok 215 - q cn: est (1.00000) = fast (1.00000) ok 216 - h id: est (1.00000) = fast (1.00000) ok 217 - h cn: est (1.00000) = fast (1.00000) ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1 ok 219 - q id: est (1.00000) = fast (1.00000) ok 220 - q cn: est (1.00000) = fast (1.00000) ok 221 - h id: est (1.00000) = fast (1.00000) ok 222 - h cn: est (1.00000) = fast (1.00000) ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1 ok 224 - q id: est (1.00000) = fast (1.00000) ok 225 - q cn: est (1.00000) = fast (1.00000) ok 226 - h id: est (1.00000) = fast (1.00000) ok 227 - h cn: est (1.00000) = fast (1.00000) ok 228 - brassica_ATH.WUBLASTN ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3 ok 230 - q id: exact (0.82465) ~ est (0.82343) ok 231 - q id: exact (0.82465) <= max (0.83333) ok 232 - q cn: exact (0.85590) ~ est (0.85312) ok 233 - q cn: exact (0.85590) <= max (0.86458) ok 234 - h id: exact (0.83920) ~ est (0.83920) ok 235 - h id: exact (0.83920) <= max (0.83920) ok 236 - h cn: exact (0.86935) ~ est (0.86935) ok 237 - h cn: exact (0.86935) <= max (0.86935) ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2 ok 239 - q id: exact (0.82486) ~ est (0.82486) ok 240 - q id: exact (0.82486) <= max (0.82486) ok 241 - q cn: exact (0.85122) ~ est (0.85122) ok 242 - q cn: exact (0.85122) <= max (0.85122) ok 243 - h id: exact (0.82955) ~ est (0.82955) ok 244 - h id: exact (0.82955) <= max (0.82955) ok 245 - h cn: exact (0.85606) ~ est (0.85606) ok 246 - h cn: exact (0.85606) <= max (0.85606) ok 247 - no_hsps.blastp ok 248 - tile no_hsps.blastp hit 1 \#hsps 0 ok 249 - tile no_hsps.blastp hit 2 \#hsps 0 ok 250 - tile no_hsps.blastp hit 3 \#hsps 0 ok 251 - tile no_hsps.blastp hit 4 \#hsps 0 ok 252 - tile no_hsps.blastp hit 5 \#hsps 0 ok 253 - tile no_hsps.blastp hit 6 \#hsps 0 ok 254 - tile no_hsps.blastp hit 7 \#hsps 0 ok 255 - tile no_hsps.blastp hit 8 \#hsps 0 ok 256 - tile no_hsps.blastp hit 9 \#hsps 0 ok 257 - tile no_hsps.blastp hit 10 \#hsps 0 ok 258 - tile no_hsps.blastp hit 11 \#hsps 0 ok 259 - tile no_hsps.blastp hit 12 \#hsps 0 ok 260 - tile no_hsps.blastp hit 13 \#hsps 0 ok 261 - tile no_hsps.blastp hit 14 \#hsps 0 ok 262 - tile no_hsps.blastp hit 15 \#hsps 0 ok 263 - tile no_hsps.blastp hit 16 \#hsps 0 ok 264 - tile no_hsps.blastp hit 17 \#hsps 0 ok 265 - tile no_hsps.blastp hit 18 \#hsps 0 ok 266 - tile no_hsps.blastp hit 19 \#hsps 0 ok 267 - tile no_hsps.blastp hit 20 \#hsps 0 ok 268 - tile no_hsps.blastp hit 21 \#hsps 0 ok 269 - tile no_hsps.blastp hit 22 \#hsps 0 ok 270 - tile no_hsps.blastp hit 23 \#hsps 0 ok 271 - tile no_hsps.blastp hit 24 \#hsps 0 ok 272 - tile no_hsps.blastp hit 25 \#hsps 0 ok 273 - tile no_hsps.blastp hit 26 \#hsps 0 ok 274 - tile no_hsps.blastp hit 27 \#hsps 0 ok 275 - tile no_hsps.blastp hit 28 \#hsps 0 ok 276 - tile no_hsps.blastp hit 29 \#hsps 0 ok 277 - tile no_hsps.blastp hit 30 \#hsps 0 ok 278 - tile no_hsps.blastp hit 31 \#hsps 0 ok 279 - tile no_hsps.blastp hit 32 \#hsps 0 ok 280 - tile no_hsps.blastp hit 33 \#hsps 0 ok 281 - tile no_hsps.blastp hit 34 \#hsps 0 ok 282 - tile no_hsps.blastp hit 35 \#hsps 0 ok 283 - tile no_hsps.blastp hit 36 \#hsps 0 ok 284 - tile no_hsps.blastp hit 37 \#hsps 0 ok 285 - tile no_hsps.blastp hit 38 \#hsps 0 ok 286 - tile no_hsps.blastp hit 39 \#hsps 0 ok 287 - tile no_hsps.blastp hit 40 \#hsps 0 ok 288 - tile no_hsps.blastp hit 41 \#hsps 0 ok 289 - tile no_hsps.blastp hit 42 \#hsps 0 ok 290 - tile no_hsps.blastp hit 43 \#hsps 0 ok 291 - tile no_hsps.blastp hit 44 \#hsps 0 ok 292 - tile no_hsps.blastp hit 45 \#hsps 0 ok 293 - tile no_hsps.blastp hit 46 \#hsps 0 ok 294 - tile no_hsps.blastp hit 47 \#hsps 0 ok 295 - tile no_hsps.blastp hit 48 \#hsps 0 ok 296 - tile no_hsps.blastp hit 49 \#hsps 0 ok 297 - tile no_hsps.blastp hit 50 \#hsps 0 ok 298 - tile no_hsps.blastp hit 51 \#hsps 0 ok 299 - tile no_hsps.blastp hit 52 \#hsps 0 ok 300 - tile no_hsps.blastp hit 53 \#hsps 0 ok 301 - tile no_hsps.blastp hit 54 \#hsps 0 ok 302 - tile no_hsps.blastp hit 55 \#hsps 0 ok 303 - tile no_hsps.blastp hit 56 \#hsps 0 ok 304 - tile no_hsps.blastp hit 57 \#hsps 0 ok 305 - tile no_hsps.blastp hit 58 \#hsps 0 ok 306 - tile no_hsps.blastp hit 59 \#hsps 0 ok 307 - tile no_hsps.blastp hit 60 \#hsps 0 ok 308 - tile no_hsps.blastp hit 61 \#hsps 0 ok 309 - tile no_hsps.blastp hit 62 \#hsps 0 ok 310 - tile no_hsps.blastp hit 63 \#hsps 0 ok 311 - tile no_hsps.blastp hit 64 \#hsps 0 ok 312 - tile no_hsps.blastp hit 65 \#hsps 0 ok 313 - tile no_hsps.blastp hit 66 \#hsps 0 ok 314 - tile no_hsps.blastp hit 67 \#hsps 0 ok 315 - tile no_hsps.blastp hit 68 \#hsps 0 ok 316 - tile no_hsps.blastp hit 69 \#hsps 0 ok 317 - tile no_hsps.blastp hit 70 \#hsps 0 ok 318 - tile no_hsps.blastp hit 71 \#hsps 0 ok 319 - tile no_hsps.blastp hit 72 \#hsps 0 ok 320 - tile no_hsps.blastp hit 73 \#hsps 0 ok 321 - tile no_hsps.blastp hit 74 \#hsps 0 ok 322 - tile no_hsps.blastp hit 75 \#hsps 0 ok 323 - tile no_hsps.blastp hit 76 \#hsps 0 ok 324 - tile no_hsps.blastp hit 77 \#hsps 0 ok 325 - tile no_hsps.blastp hit 78 \#hsps 0 ok 326 - tile no_hsps.blastp hit 79 \#hsps 0 ok 327 - tile no_hsps.blastp hit 80 \#hsps 0 ok 328 - tile no_hsps.blastp hit 81 \#hsps 0 ok 329 - tile no_hsps.blastp hit 82 \#hsps 0 ok 330 - tile no_hsps.blastp hit 83 \#hsps 0 ok 331 - tile no_hsps.blastp hit 84 \#hsps 0 ok 332 - tile no_hsps.blastp hit 85 \#hsps 0 ok 333 - tile no_hsps.blastp hit 86 \#hsps 0 ok 334 - tile no_hsps.blastp hit 87 \#hsps 0 ok 335 - tile no_hsps.blastp hit 88 \#hsps 0 ok 336 - tile no_hsps.blastp hit 89 \#hsps 0 ok 337 - tile no_hsps.blastp hit 90 \#hsps 0 ok 338 - tile no_hsps.blastp hit 91 \#hsps 0 ok 339 - tile no_hsps.blastp hit 92 \#hsps 0 ok 340 - tile no_hsps.blastp hit 93 \#hsps 0 ok 341 - tile no_hsps.blastp hit 94 \#hsps 0 ok 342 - tile no_hsps.blastp hit 95 \#hsps 0 ok 343 - tile no_hsps.blastp hit 96 \#hsps 0 ok 344 - tile no_hsps.blastp hit 97 \#hsps 0 ok 345 - tile no_hsps.blastp hit 98 \#hsps 0 ok 346 - tile no_hsps.blastp hit 99 \#hsps 0 ok 347 - tile no_hsps.blastp hit 100 \#hsps 0 ok 348 - tile no_hsps.blastp hit 101 \#hsps 0 ok 349 - tile no_hsps.blastp hit 102 \#hsps 0 ok 350 - tile no_hsps.blastp hit 103 \#hsps 0 ok 351 - tile no_hsps.blastp hit 104 \#hsps 0 ok 352 - tile no_hsps.blastp hit 105 \#hsps 0 ok 353 - tile no_hsps.blastp hit 106 \#hsps 0 ok 354 - tile no_hsps.blastp hit 107 \#hsps 0 ok 355 - tile no_hsps.blastp hit 108 \#hsps 0 ok 356 - tile no_hsps.blastp hit 109 \#hsps 0 ok 357 - tile no_hsps.blastp hit 110 \#hsps 0 ok 358 - tile no_hsps.blastp hit 111 \#hsps 0 ok 359 - tile no_hsps.blastp hit 112 \#hsps 0 ok 360 - tile no_hsps.blastp hit 113 \#hsps 0 ok 361 - tile no_hsps.blastp hit 114 \#hsps 0 ok 362 - tile no_hsps.blastp hit 115 \#hsps 0 ok 363 - tile no_hsps.blastp hit 116 \#hsps 0 ok 364 - tile no_hsps.blastp hit 117 \#hsps 0 ok 365 - tile no_hsps.blastp hit 118 \#hsps 0 ok 366 - tile no_hsps.blastp hit 119 \#hsps 0 ok 367 - tile no_hsps.blastp hit 120 \#hsps 0 ok 368 - tile no_hsps.blastp hit 121 \#hsps 0 ok 369 - tile no_hsps.blastp hit 122 \#hsps 0 ok 370 - tile no_hsps.blastp hit 123 \#hsps 0 ok 371 - tile no_hsps.blastp hit 124 \#hsps 0 ok 372 - tile no_hsps.blastp hit 125 \#hsps 0 ok 373 - tile no_hsps.blastp hit 126 \#hsps 0 ok 374 - tile no_hsps.blastp hit 127 \#hsps 0 ok 375 - tile no_hsps.blastp hit 128 \#hsps 0 ok 376 - tile no_hsps.blastp hit 129 \#hsps 0 ok 377 - tile no_hsps.blastp hit 130 \#hsps 0 ok 378 - tile no_hsps.blastp hit 131 \#hsps 0 ok 379 - tile no_hsps.blastp hit 132 \#hsps 0 ok 380 - tile no_hsps.blastp hit 133 \#hsps 0 ok 381 - tile no_hsps.blastp hit 134 \#hsps 0 ok 382 - tile no_hsps.blastp hit 135 \#hsps 0 ok 383 - tile no_hsps.blastp hit 136 \#hsps 0 ok 384 - tile no_hsps.blastp hit 137 \#hsps 0 ok 385 - tile no_hsps.blastp hit 138 \#hsps 0 ok 386 - tile no_hsps.blastp hit 139 \#hsps 0 ok 387 - tile no_hsps.blastp hit 140 \#hsps 0 ok 388 - tile no_hsps.blastp hit 141 \#hsps 0 ok 389 - tile no_hsps.blastp hit 142 \#hsps 0 ok 390 - tile no_hsps.blastp hit 143 \#hsps 0 ok 391 - tile no_hsps.blastp hit 144 \#hsps 0 ok 392 - tile no_hsps.blastp hit 145 \#hsps 0 ok 393 - tile no_hsps.blastp hit 146 \#hsps 0 ok 394 - tile no_hsps.blastp hit 147 \#hsps 0 ok 395 - tile no_hsps.blastp hit 148 \#hsps 0 ok 396 - tile no_hsps.blastp hit 149 \#hsps 0 ok 397 - tile no_hsps.blastp hit 150 \#hsps 0 ok 398 - tile no_hsps.blastp hit 151 \#hsps 0 ok 399 - tile no_hsps.blastp hit 152 \#hsps 0 ok 400 - tile no_hsps.blastp hit 153 \#hsps 0 ok 401 - tile no_hsps.blastp hit 154 \#hsps 0 ok 402 - tile no_hsps.blastp hit 155 \#hsps 0 ok 403 - tile no_hsps.blastp hit 156 \#hsps 0 ok 404 - tile no_hsps.blastp hit 157 \#hsps 0 ok 405 - tile no_hsps.blastp hit 158 \#hsps 0 ok 406 - tile no_hsps.blastp hit 159 \#hsps 0 ok 407 - tile no_hsps.blastp hit 160 \#hsps 0 ok 408 - tile no_hsps.blastp hit 161 \#hsps 0 ok 409 - tile no_hsps.blastp hit 162 \#hsps 0 ok 410 - tile no_hsps.blastp hit 163 \#hsps 0 ok 411 - tile no_hsps.blastp hit 164 \#hsps 0 ok 412 - tile no_hsps.blastp hit 165 \#hsps 0 ok 413 - tile no_hsps.blastp hit 166 \#hsps 0 ok 414 - tile no_hsps.blastp hit 167 \#hsps 0 ok 415 - tile no_hsps.blastp hit 168 \#hsps 0 ok 416 - tile no_hsps.blastp hit 169 \#hsps 0 ok 417 - tile no_hsps.blastp hit 170 \#hsps 0 ok 418 - tile no_hsps.blastp hit 171 \#hsps 0 ok 419 - tile no_hsps.blastp hit 172 \#hsps 0 ok 420 - tile no_hsps.blastp hit 173 \#hsps 0 ok 421 - tile no_hsps.blastp hit 174 \#hsps 0 ok 422 - tile no_hsps.blastp hit 175 \#hsps 0 ok 423 - tile no_hsps.blastp hit 176 \#hsps 0 ok 424 - tile no_hsps.blastp hit 177 \#hsps 0 ok 425 - tile no_hsps.blastp hit 178 \#hsps 0 ok 426 - tile no_hsps.blastp hit 179 \#hsps 0 ok 427 - tile no_hsps.blastp hit 180 \#hsps 0 ok 428 - tile no_hsps.blastp hit 181 \#hsps 0 ok 429 - tile no_hsps.blastp hit 182 \#hsps 0 ok 430 - tile no_hsps.blastp hit 183 \#hsps 0 ok 431 - tile no_hsps.blastp hit 184 \#hsps 0 ok 432 - tile no_hsps.blastp hit 185 \#hsps 0 ok 433 - tile no_hsps.blastp hit 186 \#hsps 0 ok 434 - tile no_hsps.blastp hit 187 \#hsps 0 ok 435 - tile no_hsps.blastp hit 188 \#hsps 0 ok 436 - tile no_hsps.blastp hit 189 \#hsps 0 ok 437 - tile no_hsps.blastp hit 190 \#hsps 0 ok 438 - tile no_hsps.blastp hit 191 \#hsps 0 ok 439 - tile no_hsps.blastp hit 192 \#hsps 0 ok 440 - tile no_hsps.blastp hit 193 \#hsps 0 ok 441 - tile no_hsps.blastp hit 194 \#hsps 0 ok 442 - tile no_hsps.blastp hit 195 \#hsps 0 ok 443 - tile no_hsps.blastp hit 196 \#hsps 0 ok 444 - tile no_hsps.blastp hit 197 \#hsps 0 ok 445 - tile no_hsps.blastp hit 198 \#hsps 0 ok 446 - tile no_hsps.blastp hit 199 \#hsps 0 ok 447 - tile no_hsps.blastp hit 200 \#hsps 0 ok 448 - tile no_hsps.blastp hit 201 \#hsps 0 ok 449 - tile no_hsps.blastp hit 202 \#hsps 0 ok 450 - tile no_hsps.blastp hit 203 \#hsps 0 ok 451 - tile no_hsps.blastp hit 204 \#hsps 0 ok 452 - tile no_hsps.blastp hit 205 \#hsps 0 ok 453 - tile no_hsps.blastp hit 206 \#hsps 0 ok 454 - tile no_hsps.blastp hit 207 \#hsps 0 ok 455 - tile no_hsps.blastp hit 208 \#hsps 0 ok 456 - tile no_hsps.blastp hit 209 \#hsps 0 ok 457 - tile no_hsps.blastp hit 210 \#hsps 0 ok 458 - tile no_hsps.blastp hit 211 \#hsps 0 ok 459 - tile no_hsps.blastp hit 212 \#hsps 0 ok 460 - tile no_hsps.blastp hit 213 \#hsps 0 ok 461 - tile no_hsps.blastp hit 214 \#hsps 0 ok 462 - tile no_hsps.blastp hit 215 \#hsps 0 ok 463 - tile no_hsps.blastp hit 216 \#hsps 0 ok 464 - tile no_hsps.blastp hit 217 \#hsps 0 ok 465 - tile no_hsps.blastp hit 218 \#hsps 0 ok 466 - tile no_hsps.blastp hit 219 \#hsps 0 ok 467 - tile no_hsps.blastp hit 220 \#hsps 0 ok 468 - tile no_hsps.blastp hit 221 \#hsps 0 ok 469 - tile no_hsps.blastp hit 222 \#hsps 0 ok 470 - tile no_hsps.blastp hit 223 \#hsps 0 ok 471 - tile no_hsps.blastp hit 224 \#hsps 0 ok 472 - tile no_hsps.blastp hit 225 \#hsps 0 ok 473 - tile no_hsps.blastp hit 226 \#hsps 0 ok 474 - tile no_hsps.blastp hit 227 \#hsps 0 ok 475 - tile no_hsps.blastp hit 228 \#hsps 0 ok 476 - tile no_hsps.blastp hit 229 \#hsps 0 ok 477 - tile no_hsps.blastp hit 230 \#hsps 0 ok 478 - tile no_hsps.blastp hit 231 \#hsps 0 ok 479 - tile no_hsps.blastp hit 232 \#hsps 0 ok 480 - tile no_hsps.blastp hit 233 \#hsps 0 ok 481 - tile no_hsps.blastp hit 234 \#hsps 0 ok 482 - tile no_hsps.blastp hit 235 \#hsps 0 ok 483 - tile no_hsps.blastp hit 236 \#hsps 0 ok 484 - tile no_hsps.blastp hit 237 \#hsps 0 ok 485 - tile no_hsps.blastp hit 238 \#hsps 0 ok 486 - tile no_hsps.blastp hit 239 \#hsps 0 ok 487 - tile no_hsps.blastp hit 240 \#hsps 0 ok 488 - tile no_hsps.blastp hit 241 \#hsps 0 ok 489 - tile no_hsps.blastp hit 242 \#hsps 0 ok 490 - tile no_hsps.blastp hit 243 \#hsps 0 ok 491 - tile no_hsps.blastp hit 244 \#hsps 0 ok 492 - tile no_hsps.blastp hit 245 \#hsps 0 ok 493 - tile no_hsps.blastp hit 246 \#hsps 0 ok 494 - tile no_hsps.blastp hit 247 \#hsps 0 ok 495 - tile no_hsps.blastp hit 248 \#hsps 0 ok 496 - tile no_hsps.blastp hit 249 \#hsps 0 ok 497 - tile no_hsps.blastp hit 250 \#hsps 0 ok 498 - tile no_hsps.blastp hit 251 \#hsps 0 ok 499 - tile no_hsps.blastp hit 252 \#hsps 0 ok 500 - tile no_hsps.blastp hit 253 \#hsps 0 ok 501 - tile no_hsps.blastp hit 254 \#hsps 0 ok 502 - tile no_hsps.blastp hit 255 \#hsps 0 ok 503 - tile no_hsps.blastp hit 256 \#hsps 0 ok 504 - tile no_hsps.blastp hit 257 \#hsps 0 ok 505 - tile no_hsps.blastp hit 258 \#hsps 0 ok 506 - tile no_hsps.blastp hit 259 \#hsps 0 ok 507 - tile no_hsps.blastp hit 260 \#hsps 0 ok 508 - tile no_hsps.blastp hit 261 \#hsps 0 ok 509 - tile no_hsps.blastp hit 262 \#hsps 0 ok 510 - tile no_hsps.blastp hit 263 \#hsps 0 ok 511 - tile no_hsps.blastp hit 264 \#hsps 0 ok 512 - tile no_hsps.blastp hit 265 \#hsps 0 ok 513 - tile no_hsps.blastp hit 266 \#hsps 0 ok 514 - tile no_hsps.blastp hit 267 \#hsps 0 ok 515 - tile no_hsps.blastp hit 268 \#hsps 0 ok 516 - tile no_hsps.blastp hit 269 \#hsps 0 ok 517 - tile no_hsps.blastp hit 270 \#hsps 0 ok 518 - tile no_hsps.blastp hit 271 \#hsps 0 ok 519 - tile no_hsps.blastp hit 272 \#hsps 0 ok 520 - tile no_hsps.blastp hit 273 \#hsps 0 ok 521 - tile no_hsps.blastp hit 274 \#hsps 0 ok 522 - tile no_hsps.blastp hit 275 \#hsps 0 ok 523 - tile no_hsps.blastp hit 276 \#hsps 0 ok 524 - tile no_hsps.blastp hit 277 \#hsps 0 ok 525 - tile no_hsps.blastp hit 278 \#hsps 0 ok 526 - tile no_hsps.blastp hit 279 \#hsps 0 ok 527 - tile no_hsps.blastp hit 280 \#hsps 0 ok 528 - tile no_hsps.blastp hit 281 \#hsps 0 ok 529 - tile no_hsps.blastp hit 282 \#hsps 0 ok 530 - tile no_hsps.blastp hit 283 \#hsps 0 ok 531 - tile no_hsps.blastp hit 284 \#hsps 0 ok 532 - tile no_hsps.blastp hit 285 \#hsps 0 ok 533 - tile no_hsps.blastp hit 286 \#hsps 0 ok 534 - tile no_hsps.blastp hit 287 \#hsps 0 ok 535 - tile no_hsps.blastp hit 288 \#hsps 0 ok 536 - tile no_hsps.blastp hit 289 \#hsps 0 ok 537 - tile no_hsps.blastp hit 290 \#hsps 0 ok 538 - tile no_hsps.blastp hit 291 \#hsps 0 ok 539 - tile no_hsps.blastp hit 292 \#hsps 0 ok 540 - tile no_hsps.blastp hit 293 \#hsps 0 ok 541 - tile no_hsps.blastp hit 294 \#hsps 0 ok 542 - tile no_hsps.blastp hit 295 \#hsps 0 ok 543 - tile no_hsps.blastp hit 296 \#hsps 0 ok 544 - tile no_hsps.blastp hit 297 \#hsps 0 ok 545 - tile no_hsps.blastp hit 298 \#hsps 0 ok 546 - tile no_hsps.blastp hit 299 \#hsps 0 ok 547 - tile no_hsps.blastp hit 300 \#hsps 0 ok 548 - tile no_hsps.blastp hit 301 \#hsps 0 ok 549 - tile no_hsps.blastp hit 302 \#hsps 0 ok 550 - tile no_hsps.blastp hit 303 \#hsps 0 ok 551 - tile no_hsps.blastp hit 304 \#hsps 0 ok 552 - tile no_hsps.blastp hit 305 \#hsps 0 ok 553 - tile no_hsps.blastp hit 306 \#hsps 0 ok 554 - tile no_hsps.blastp hit 307 \#hsps 0 ok 555 - tile no_hsps.blastp hit 308 \#hsps 0 ok 556 - tile no_hsps.blastp hit 309 \#hsps 0 ok 557 - tile no_hsps.blastp hit 310 \#hsps 0 ok 558 - tile no_hsps.blastp hit 311 \#hsps 0 ok 559 - tile no_hsps.blastp hit 312 \#hsps 0 ok 560 - tile no_hsps.blastp hit 313 \#hsps 0 ok 561 - tile no_hsps.blastp hit 314 \#hsps 0 ok 562 - tile no_hsps.blastp hit 315 \#hsps 0 ok 563 - tile no_hsps.blastp hit 316 \#hsps 0 ok 564 - tile no_hsps.blastp hit 317 \#hsps 0 ok 565 - tile no_hsps.blastp hit 318 \#hsps 0 ok 566 - tile no_hsps.blastp hit 319 \#hsps 0 ok 567 - tile no_hsps.blastp hit 320 \#hsps 0 ok 568 - tile no_hsps.blastp hit 321 \#hsps 0 ok 569 - tile no_hsps.blastp hit 322 \#hsps 0 ok 570 - tile no_hsps.blastp hit 323 \#hsps 0 ok 571 - tile no_hsps.blastp hit 324 \#hsps 0 ok 572 - tile no_hsps.blastp hit 325 \#hsps 0 ok 573 - tile no_hsps.blastp hit 326 \#hsps 0 ok 574 - tile no_hsps.blastp hit 327 \#hsps 0 ok 575 - tile no_hsps.blastp hit 328 \#hsps 0 ok 576 - tile no_hsps.blastp hit 329 \#hsps 0 ok 577 - tile no_hsps.blastp hit 330 \#hsps 0 ok 578 - tile no_hsps.blastp hit 331 \#hsps 0 ok 579 - tile no_hsps.blastp hit 332 \#hsps 0 ok 580 - tile no_hsps.blastp hit 333 \#hsps 0 ok 581 - tile no_hsps.blastp hit 334 \#hsps 0 ok 582 - tile no_hsps.blastp hit 335 \#hsps 0 ok 583 - tile no_hsps.blastp hit 336 \#hsps 0 ok 584 - tile no_hsps.blastp hit 337 \#hsps 0 ok 585 - tile no_hsps.blastp hit 338 \#hsps 0 ok 586 - tile no_hsps.blastp hit 339 \#hsps 0 ok 587 - tile no_hsps.blastp hit 340 \#hsps 0 ok 588 - tile no_hsps.blastp hit 341 \#hsps 0 ok 589 - tile no_hsps.blastp hit 342 \#hsps 0 ok 590 - tile no_hsps.blastp hit 343 \#hsps 0 ok 591 - tile no_hsps.blastp hit 344 \#hsps 0 ok 592 - tile no_hsps.blastp hit 345 \#hsps 0 ok 593 - tile no_hsps.blastp hit 346 \#hsps 0 ok 594 - tile no_hsps.blastp hit 347 \#hsps 0 ok 595 - tile no_hsps.blastp hit 348 \#hsps 0 ok 596 - tile no_hsps.blastp hit 349 \#hsps 0 ok 597 - tile no_hsps.blastp hit 350 \#hsps 0 ok 598 - tile no_hsps.blastp hit 351 \#hsps 0 ok 599 - tile no_hsps.blastp hit 352 \#hsps 0 ok 600 - tile no_hsps.blastp hit 353 \#hsps 0 ok 601 - tile no_hsps.blastp hit 354 \#hsps 0 ok 602 - tile no_hsps.blastp hit 355 \#hsps 0 ok 603 - tile no_hsps.blastp hit 356 \#hsps 0 ok 604 - tile no_hsps.blastp hit 357 \#hsps 0 ok 605 - tile no_hsps.blastp hit 358 \#hsps 0 ok 606 - tile no_hsps.blastp hit 359 \#hsps 0 ok 607 - tile no_hsps.blastp hit 360 \#hsps 0 ok 608 - tile no_hsps.blastp hit 361 \#hsps 0 ok 609 - tile no_hsps.blastp hit 362 \#hsps 0 ok 610 - tile no_hsps.blastp hit 363 \#hsps 0 ok 611 - tile no_hsps.blastp hit 364 \#hsps 0 ok 612 - tile no_hsps.blastp hit 365 \#hsps 0 ok 613 - tile no_hsps.blastp hit 366 \#hsps 0 ok 614 - tile no_hsps.blastp hit 367 \#hsps 0 ok 615 - tile no_hsps.blastp hit 368 \#hsps 0 ok 616 - tile no_hsps.blastp hit 369 \#hsps 0 ok 617 - tile no_hsps.blastp hit 370 \#hsps 0 ok 618 - tile no_hsps.blastp hit 371 \#hsps 0 ok 619 - tile no_hsps.blastp hit 372 \#hsps 0 ok 620 - tile no_hsps.blastp hit 373 \#hsps 0 ok 621 - tile no_hsps.blastp hit 374 \#hsps 0 ok 622 - tile no_hsps.blastp hit 375 \#hsps 0 ok 623 - tile no_hsps.blastp hit 376 \#hsps 0 ok 624 - tile no_hsps.blastp hit 377 \#hsps 0 ok 625 - tile no_hsps.blastp hit 378 \#hsps 0 ok 626 - tile no_hsps.blastp hit 379 \#hsps 0 ok 627 - tile no_hsps.blastp hit 380 \#hsps 0 ok 628 - tile no_hsps.blastp hit 381 \#hsps 0 ok 629 - tile no_hsps.blastp hit 382 \#hsps 0 ok 630 - tile no_hsps.blastp hit 383 \#hsps 0 ok 631 - tile no_hsps.blastp hit 384 \#hsps 0 ok 632 - tile no_hsps.blastp hit 385 \#hsps 0 ok 633 - tile no_hsps.blastp hit 386 \#hsps 0 ok 634 - tile no_hsps.blastp hit 387 \#hsps 0 ok 635 - tile no_hsps.blastp hit 388 \#hsps 0 ok 636 - tile no_hsps.blastp hit 389 \#hsps 0 ok 637 - tile no_hsps.blastp hit 390 \#hsps 0 ok 638 - tile no_hsps.blastp hit 391 \#hsps 0 ok 639 - tile no_hsps.blastp hit 392 \#hsps 0 ok 640 - tile no_hsps.blastp hit 393 \#hsps 0 ok 641 - tile no_hsps.blastp hit 394 \#hsps 0 ok 642 - tile no_hsps.blastp hit 395 \#hsps 0 ok 643 - tile no_hsps.blastp hit 396 \#hsps 0 ok 644 - tile no_hsps.blastp hit 397 \#hsps 0 ok 645 - tile no_hsps.blastp hit 398 \#hsps 0 ok 646 - tile no_hsps.blastp hit 399 \#hsps 0 ok 647 - tile no_hsps.blastp hit 400 \#hsps 0 ok 648 - tile no_hsps.blastp hit 401 \#hsps 0 ok 649 - tile no_hsps.blastp hit 402 \#hsps 0 ok 650 - tile no_hsps.blastp hit 403 \#hsps 0 ok 651 - tile no_hsps.blastp hit 404 \#hsps 0 ok 652 - tile no_hsps.blastp hit 405 \#hsps 0 ok 653 - tile no_hsps.blastp hit 406 \#hsps 0 ok 654 - tile no_hsps.blastp hit 407 \#hsps 0 ok 655 - tile no_hsps.blastp hit 408 \#hsps 0 ok 656 - tile no_hsps.blastp hit 409 \#hsps 0 ok 657 - tile no_hsps.blastp hit 410 \#hsps 0 ok 658 - tile no_hsps.blastp hit 411 \#hsps 0 ok 659 - tile no_hsps.blastp hit 412 \#hsps 0 ok 660 - tile no_hsps.blastp hit 413 \#hsps 0 ok 661 - tile no_hsps.blastp hit 414 \#hsps 0 ok 662 - tile no_hsps.blastp hit 415 \#hsps 0 ok 663 - catalase-webblast.BLASTP ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1 ok 665 - q id: est (1.00000) = fast (1.00000) ok 666 - q cn: est (1.00000) = fast (1.00000) ok 667 - h id: est (1.00000) = fast (1.00000) ok 668 - h cn: est (1.00000) = fast (1.00000) ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1 ok 670 - q id: est (0.80973) = fast (0.80973) ok 671 - q cn: est (0.89006) = fast (0.89006) ok 672 - h id: est (0.82543) = fast (0.82543) ok 673 - h cn: est (0.90733) = fast (0.90733) ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1 ok 675 - q id: est (0.71670) = fast (0.71670) ok 676 - q cn: est (0.84144) = fast (0.84144) ok 677 - h id: est (0.72747) = fast (0.72747) ok 678 - h cn: est (0.85408) = fast (0.85408) ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1 ok 680 - q id: est (0.58910) = fast (0.58910) ok 681 - q cn: est (0.70860) = fast (0.70860) ok 682 - h id: est (0.65654) = fast (0.65654) ok 683 - h cn: est (0.78972) = fast (0.78972) ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1 ok 685 - q id: est (0.49245) = fast (0.49245) ok 686 - q cn: est (0.65257) = fast (0.65257) ok 687 - h id: est (0.49544) = fast (0.49544) ok 688 - h cn: est (0.65653) = fast (0.65653) ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1 ok 690 - q id: est (0.44366) = fast (0.44366) ok 691 - q cn: est (0.58920) = fast (0.58920) ok 692 - h id: est (0.44787) = fast (0.44787) ok 693 - h cn: est (0.59479) = fast (0.59479) ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1 ok 695 - q id: est (0.42564) = fast (0.42564) ok 696 - q cn: est (0.61282) = fast (0.61282) ok 697 - h id: est (0.43229) = fast (0.43229) ok 698 - h cn: est (0.62240) = fast (0.62240) ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1 ok 700 - q id: est (0.48358) = fast (0.48358) ok 701 - q cn: est (0.63881) = fast (0.63881) ok 702 - h id: est (0.48943) = fast (0.48943) ok 703 - h cn: est (0.64653) = fast (0.64653) ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1 ok 705 - q id: est (0.42308) = fast (0.42308) ok 706 - q cn: est (0.61282) = fast (0.61282) ok 707 - h id: est (0.42969) = fast (0.42969) ok 708 - h cn: est (0.62240) = fast (0.62240) ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1 ok 710 - q id: est (0.39675) = fast (0.39675) ok 711 - q cn: est (0.58933) = fast (0.58933) ok 712 - h id: est (0.39767) = fast (0.39767) ok 713 - h cn: est (0.59070) = fast (0.59070) ok 714 - dcr1_sp.WUBLASTP ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1 ok 716 - q id: est (1.00000) = fast (1.00000) ok 717 - q cn: est (1.00000) = fast (1.00000) ok 718 - h id: est (1.00000) = fast (1.00000) ok 719 - h cn: est (1.00000) = fast (1.00000) ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4 ok 721 - q id: exact (0.36876) ~ est (0.36973) ok 722 - q id: exact (0.36876) <= max (0.37070) ok 723 - q cn: exact (0.55022) ~ est (0.55041) ok 724 - q cn: exact (0.55022) <= max (0.55105) ok 725 - h id: exact (0.35111) ~ est (0.35111) ok 726 - h id: exact (0.35111) <= max (0.35111) ok 727 - h cn: exact (0.52305) ~ est (0.52305) ok 728 - h cn: exact (0.52305) <= max (0.52305) ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1 ok 730 - q id: est (0.38685) = fast (0.38685) ok 731 - q cn: est (0.55397) = fast (0.55397) ok 732 - h id: est (0.37613) = fast (0.37613) ok 733 - h cn: est (0.53863) = fast (0.53863) ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1 ok 735 - q id: est (0.38247) = fast (0.38247) ok 736 - q cn: est (0.55068) = fast (0.55068) ok 737 - h id: est (0.37306) = fast (0.37306) ok 738 - h cn: est (0.53715) = fast (0.53715) ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5 ok 740 - q id: exact (0.35010) ~ est (0.35010) ok 741 - q id: exact (0.35010) <= max (0.35010) ok 742 - q cn: exact (0.53183) ~ est (0.53183) ok 743 - q cn: exact (0.53183) <= max (0.53183) ok 744 - h id: exact (0.35082) ~ est (0.35082) ok 745 - h id: exact (0.35082) <= max (0.35082) ok 746 - h cn: exact (0.53292) ~ est (0.53292) ok 747 - h cn: exact (0.53292) <= max (0.53292) ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8 ok 749 - q id: exact (0.30547) ~ est (0.30659) ok 750 - q id: exact (0.30547) <= max (0.30623) ok 751 - q cn: exact (0.50076) ~ est (0.50205) ok 752 - q cn: exact (0.50076) <= max (0.50076) ok 753 - h id: exact (0.31390) ~ est (0.31179) ok 754 - h id: exact (0.31390) <= max (0.31795) ok 755 - h cn: exact (0.50531) ~ est (0.50557) ok 756 - h cn: exact (0.50531) <= max (0.51091) ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7 ok 758 - q id: exact (0.30136) ~ est (0.30184) ok 759 - q id: exact (0.30136) <= max (0.30498) ok 760 - q cn: exact (0.48688) ~ est (0.48742) ok 761 - q cn: exact (0.48688) <= max (0.49140) ok 762 - h id: exact (0.30944) ~ est (0.31034) ok 763 - h id: exact (0.30944) <= max (0.30988) ok 764 - h cn: exact (0.50178) ~ est (0.50277) ok 765 - h cn: exact (0.50178) <= max (0.50223) ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10 ok 767 - q id: exact (0.28918) ~ est (0.28961) ok 768 - q id: exact (0.28918) <= max (0.28955) ok 769 - q cn: exact (0.46418) ~ est (0.46247) ok 770 - q cn: exact (0.46418) <= max (0.46866) ok 771 - h id: exact (0.30166) ~ est (0.30299) ok 772 - h id: exact (0.30166) <= max (0.30800) ok 773 - h cn: exact (0.48179) ~ est (0.48439) ok 774 - h cn: exact (0.48179) <= max (0.48535) ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8 ok 776 - q id: exact (0.30289) ~ est (0.30238) ok 777 - q id: exact (0.30289) <= max (0.30651) ok 778 - q cn: exact (0.49955) ~ est (0.49787) ok 779 - q cn: exact (0.49955) <= max (0.50362) ok 780 - h id: exact (0.31395) ~ est (0.31347) ok 781 - h id: exact (0.31395) <= max (0.31721) ok 782 - h cn: exact (0.51535) ~ est (0.51578) ok 783 - h cn: exact (0.51535) <= max (0.51814) ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5 ok 785 - q id: exact (0.29334) ~ est (0.29534) ok 786 - q id: exact (0.29334) <= max (0.29810) ok 787 - q cn: exact (0.46617) ~ est (0.46719) ok 788 - q cn: exact (0.46617) <= max (0.47040) ok 789 - h id: exact (0.31176) ~ est (0.31176) ok 790 - h id: exact (0.31176) <= max (0.31176) ok 791 - h cn: exact (0.49299) ~ est (0.49299) ok 792 - h cn: exact (0.49299) <= max (0.49299) ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7 ok 794 - q id: exact (0.30456) ~ est (0.30514) ok 795 - q id: exact (0.30456) <= max (0.30650) ok 796 - q cn: exact (0.48739) ~ est (0.48879) ok 797 - q cn: exact (0.48739) <= max (0.49370) ok 798 - h id: exact (0.32062) ~ est (0.31987) ok 799 - h id: exact (0.32062) <= max (0.32932) ok 800 - h cn: exact (0.51071) ~ est (0.51306) ok 801 - h cn: exact (0.51071) <= max (0.52410) ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8 ok 803 - q id: exact (0.29615) ~ est (0.29879) ok 804 - q id: exact (0.29615) <= max (0.30009) ok 805 - q cn: exact (0.47419) ~ est (0.47394) ok 806 - q cn: exact (0.47419) <= max (0.48119) ok 807 - h id: exact (0.31611) ~ est (0.31482) ok 808 - h id: exact (0.31611) <= max (0.32227) ok 809 - h cn: exact (0.49779) ~ est (0.49788) ok 810 - h cn: exact (0.49779) <= max (0.50616) ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8 ok 812 - q id: exact (0.30390) ~ est (0.30440) ok 813 - q id: exact (0.30390) <= max (0.30701) ok 814 - q cn: exact (0.45874) ~ est (0.45993) ok 815 - q cn: exact (0.45874) <= max (0.45963) ok 816 - h id: exact (0.32282) ~ est (0.32324) ok 817 - h id: exact (0.32282) <= max (0.32560) ok 818 - h cn: exact (0.48052) ~ est (0.48136) ok 819 - h cn: exact (0.48052) <= max (0.48330) ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6 ok 821 - q id: exact (0.29769) ~ est (0.29851) ok 822 - q id: exact (0.29769) <= max (0.29769) ok 823 - q cn: exact (0.48480) ~ est (0.48628) ok 824 - q cn: exact (0.48480) <= max (0.48637) ok 825 - h id: exact (0.30704) ~ est (0.30810) ok 826 - h id: exact (0.30704) <= max (0.30917) ok 827 - h cn: exact (0.50107) ~ est (0.50292) ok 828 - h cn: exact (0.50107) <= max (0.50320) ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6 ok 830 - q id: exact (0.27854) ~ est (0.27854) ok 831 - q id: exact (0.27854) <= max (0.27854) ok 832 - q cn: exact (0.48174) ~ est (0.48174) ok 833 - q cn: exact (0.48174) <= max (0.48174) ok 834 - h id: exact (0.28514) ~ est (0.28623) ok 835 - h id: exact (0.28514) <= max (0.28594) ok 836 - h cn: exact (0.49197) ~ est (0.49154) ok 837 - h cn: exact (0.49197) <= max (0.49237) ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8 ok 839 - q id: exact (0.30362) ~ est (0.30824) ok 840 - q id: exact (0.30362) <= max (0.30852) ok 841 - q cn: exact (0.47111) ~ est (0.47587) ok 842 - q cn: exact (0.47111) <= max (0.47405) ok 843 - h id: exact (0.32347) ~ est (0.32392) ok 844 - h id: exact (0.32347) <= max (0.32643) ok 845 - h cn: exact (0.49310) ~ est (0.49360) ok 846 - h cn: exact (0.49310) <= max (0.49606) ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4 ok 848 - q id: exact (0.29174) ~ est (0.29174) ok 849 - q id: exact (0.29174) <= max (0.29174) ok 850 - q cn: exact (0.46230) ~ est (0.46230) ok 851 - q cn: exact (0.46230) <= max (0.46230) ok 852 - h id: exact (0.30204) ~ est (0.30204) ok 853 - h id: exact (0.30204) <= max (0.30204) ok 854 - h cn: exact (0.47862) ~ est (0.47862) ok 855 - h cn: exact (0.47862) <= max (0.47862) ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6 ok 857 - q id: exact (0.29064) ~ est (0.29089) ok 858 - q id: exact (0.29064) <= max (0.29115) ok 859 - q cn: exact (0.48765) ~ est (0.48670) ok 860 - q cn: exact (0.48765) <= max (0.48868) ok 861 - h id: exact (0.29848) ~ est (0.29887) ok 862 - h id: exact (0.29848) <= max (0.29902) ok 863 - h cn: exact (0.50108) ~ est (0.50116) ok 864 - h cn: exact (0.50108) <= max (0.50163) ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5 ok 866 - q id: exact (0.29510) ~ est (0.29505) ok 867 - q id: exact (0.29510) <= max (0.29510) ok 868 - q cn: exact (0.48982) ~ est (0.49039) ok 869 - q cn: exact (0.48982) <= max (0.49029) ok 870 - h id: exact (0.30019) ~ est (0.30019) ok 871 - h id: exact (0.30019) <= max (0.30019) ok 872 - h cn: exact (0.49906) ~ est (0.49906) ok 873 - h cn: exact (0.49906) <= max (0.49906) ok 874 - 503384.MEGABLAST.2 ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5 ok 876 - q id: exact (0.91435) ~ est (0.91435) ok 877 - q id: exact (0.91435) <= max (0.91435) ok 878 - q cn: exact (0.91435) ~ est (0.91435) ok 879 - q cn: exact (0.91435) <= max (0.91435) ok 880 - h id: exact (0.91157) ~ est (0.91157) ok 881 - h id: exact (0.91157) <= max (0.91157) ok 882 - h cn: exact (0.91157) ~ est (0.91157) ok 883 - h cn: exact (0.91157) <= max (0.91157) ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9 ok 885 - q id: exact (0.92895) ~ est (0.92895) ok 886 - q id: exact (0.92895) <= max (0.92895) ok 887 - q cn: exact (0.92895) ~ est (0.92895) ok 888 - q cn: exact (0.92895) <= max (0.92895) ok 889 - h id: exact (0.92854) ~ est (0.92854) ok 890 - h id: exact (0.92854) <= max (0.92854) ok 891 - h cn: exact (0.92854) ~ est (0.92854) ok 892 - h cn: exact (0.92854) <= max (0.92854) ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3 ok 894 - q id: exact (0.93516) ~ est (0.93516) ok 895 - q id: exact (0.93516) <= max (0.93516) ok 896 - q cn: exact (0.93516) ~ est (0.93516) ok 897 - q cn: exact (0.93516) <= max (0.93516) ok 898 - h id: exact (0.93651) ~ est (0.93651) ok 899 - h id: exact (0.93651) <= max (0.93651) ok 900 - h cn: exact (0.93651) ~ est (0.93651) ok 901 - h cn: exact (0.93651) <= max (0.93651) ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3 ok 903 - q id: exact (0.93064) ~ est (0.93064) ok 904 - q id: exact (0.93064) <= max (0.93064) ok 905 - q cn: exact (0.93064) ~ est (0.93064) ok 906 - q cn: exact (0.93064) <= max (0.93064) ok 907 - h id: exact (0.92885) ~ est (0.92885) ok 908 - h id: exact (0.92885) <= max (0.92885) ok 909 - h cn: exact (0.92885) ~ est (0.92885) ok 910 - h cn: exact (0.92885) <= max (0.92885) ok 911 - bl2seq.blastx.out ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6 ok 913 - q id: exact (0.70536) ~ est (0.70495) ok 914 - q id: exact (0.70536) <= max (0.94286) ok 915 - q cn: exact (0.78810) ~ est (0.78803) ok 916 - q cn: exact (0.78810) <= max (0.96429) ok 917 - q id: est (0.35714) = fast (0.35714) ok 918 - q cn: est (0.57143) = fast (0.57143) ok 919 - q id: est (0.71429) = fast (0.71429) ok 920 - q cn: est (1.00000) = fast (1.00000) ok 921 - h id: exact (0.61923) ~ est (0.61955) ok 922 - h id: exact (0.61923) <= max (0.64231) ok 923 - h cn: exact (0.73077) ~ est (0.73077) ok 924 - h cn: exact (0.73077) <= max (0.75000) ok 925 - dnaEbsub_ecoli.wublastx ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1 ok 927 - q id: est (0.36386) = fast (0.36386) ok 928 - q cn: est (0.53735) = fast (0.53735) ok 929 - h id: est (0.36562) = fast (0.36562) ok 930 - h cn: est (0.53995) = fast (0.53995) ok 931 - tblastn.out ok 932 - tile tblastn.out hit 1 \#hsps 2 ok 933 - q id: exact (0.31250) ~ est (0.33325) ok 934 - q id: exact (0.31250) <= max (0.33333) ok 935 - q cn: exact (0.44792) ~ est (0.47055) ok 936 - q cn: exact (0.44792) <= max (0.45833) ok 937 - h id: exact (0.33333) ~ est (0.33333) ok 938 - h id: exact (0.33333) <= max (0.33333) ok 939 - h cn: exact (0.47059) ~ est (0.47059) ok 940 - h cn: exact (0.47059) <= max (0.47059) ok 941 - tile tblastn.out hit 2 \#hsps 2 ok 942 - q id: exact (0.68750) ~ est (0.68750) ok 943 - q id: exact (0.68750) <= max (0.68750) ok 944 - q cn: exact (0.81250) ~ est (0.81250) ok 945 - q cn: exact (0.81250) <= max (0.81250) ok 946 - h id: est (0.66667) = fast (0.66667) ok 947 - h cn: est (0.77778) = fast (0.77778) ok 948 - h id: est (0.71429) = fast (0.71429) ok 949 - h cn: est (0.85714) = fast (0.85714) ok 950 - dnaEbsub_ecoli.wutblastn ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1 ok 952 - q id: est (0.36386) = fast (0.36386) ok 953 - q cn: est (0.53735) = fast (0.53735) ok 954 - h id: est (0.36562) = fast (0.36562) ok 955 - h cn: est (0.53995) = fast (0.53995) ok 956 - HUMBETGLOA.tblastx ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1 ok 958 - q id: est (0.42308) = fast (0.42308) ok 959 - q cn: est (0.61538) = fast (0.61538) ok 960 - h id: est (0.42308) = fast (0.42308) ok 961 - h cn: est (0.61538) = fast (0.61538) ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1 ok 963 - q id: est (0.47059) = fast (0.47059) ok 964 - q cn: est (0.76471) = fast (0.76471) ok 965 - h id: est (0.47059) = fast (0.47059) ok 966 - h cn: est (0.76471) = fast (0.76471) ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1 ok 968 - q id: est (0.36000) = fast (0.36000) ok 969 - q cn: est (0.56000) = fast (0.56000) ok 970 - h id: est (0.36000) = fast (0.36000) ok 971 - h cn: est (0.56000) = fast (0.56000) ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1 ok 973 - q id: est (0.29268) = fast (0.29268) ok 974 - q cn: est (0.58537) = fast (0.58537) ok 975 - h id: est (0.29268) = fast (0.29268) ok 976 - h cn: est (0.58537) = fast (0.58537) ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1 ok 978 - q id: est (0.38889) = fast (0.38889) ok 979 - q cn: est (0.55556) = fast (0.55556) ok 980 - h id: est (0.38889) = fast (0.38889) ok 981 - h cn: est (0.55556) = fast (0.55556) ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1 ok 983 - q id: est (0.43590) = fast (0.43590) ok 984 - q cn: est (0.51282) = fast (0.51282) ok 985 - h id: est (0.43590) = fast (0.43590) ok 986 - h cn: est (0.51282) = fast (0.51282) ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1 ok 988 - q id: est (0.35714) = fast (0.35714) ok 989 - q cn: est (0.42857) = fast (0.42857) ok 990 - h id: est (0.35714) = fast (0.35714) ok 991 - h cn: est (0.42857) = fast (0.42857) ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1 ok 993 - q id: est (0.33333) = fast (0.33333) ok 994 - q cn: est (0.66667) = fast (0.66667) ok 995 - h id: est (0.33333) = fast (0.33333) ok 996 - h cn: est (0.66667) = fast (0.66667) ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2 ok 998 - q id: exact (0.40541) ~ est (0.40541) ok 999 - q id: exact (0.40541) <= max (0.40541) ok 1000 - q cn: exact (0.56757) ~ est (0.56757) ok 1001 - q cn: exact (0.56757) <= max (0.56757) ok 1002 - h id: est (0.42308) = fast (0.42308) ok 1003 - h cn: est (0.53846) = fast (0.53846) ok 1004 - h id: est (0.36364) = fast (0.36364) ok 1005 - h cn: est (0.63636) = fast (0.63636) ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1 ok 1007 - q id: est (0.29167) = fast (0.29167) ok 1008 - q cn: est (0.39583) = fast (0.39583) ok 1009 - h id: est (0.29167) = fast (0.29167) ok 1010 - h cn: est (0.39583) = fast (0.39583) ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1 ok 1012 - q id: est (0.60000) = fast (0.60000) ok 1013 - q cn: est (0.65000) = fast (0.65000) ok 1014 - h id: est (0.60000) = fast (0.60000) ok 1015 - h cn: est (0.65000) = fast (0.65000) ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1 ok 1017 - q id: est (0.50000) = fast (0.50000) ok 1018 - q cn: est (0.68182) = fast (0.68182) ok 1019 - h id: est (0.50000) = fast (0.50000) ok 1020 - h cn: est (0.68182) = fast (0.68182) ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1 ok 1022 - q id: est (0.29630) = fast (0.29630) ok 1023 - q cn: est (0.48148) = fast (0.48148) ok 1024 - h id: est (0.29630) = fast (0.29630) ok 1025 - h cn: est (0.48148) = fast (0.48148) ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1 ok 1027 - q id: est (0.47826) = fast (0.47826) ok 1028 - q cn: est (0.52174) = fast (0.52174) ok 1029 - h id: est (0.47826) = fast (0.47826) ok 1030 - h cn: est (0.52174) = fast (0.52174) ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1 ok 1032 - q id: est (0.47368) = fast (0.47368) ok 1033 - q cn: est (0.63158) = fast (0.63158) ok 1034 - h id: est (0.47368) = fast (0.47368) ok 1035 - h cn: est (0.63158) = fast (0.63158) ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1 ok 1037 - q id: est (0.44444) = fast (0.44444) ok 1038 - q cn: est (0.55556) = fast (0.55556) ok 1039 - h id: est (0.44444) = fast (0.44444) ok 1040 - h cn: est (0.55556) = fast (0.55556) ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1 ok 1042 - q id: est (0.47059) = fast (0.47059) ok 1043 - q cn: est (0.70588) = fast (0.70588) ok 1044 - h id: est (0.47059) = fast (0.47059) ok 1045 - h cn: est (0.70588) = fast (0.70588) ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1 ok 1047 - q id: est (0.38889) = fast (0.38889) ok 1048 - q cn: est (0.66667) = fast (0.66667) ok 1049 - h id: est (0.38889) = fast (0.38889) ok 1050 - h cn: est (0.66667) = fast (0.66667) ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1 ok 1052 - q id: est (0.27660) = fast (0.27660) ok 1053 - q cn: est (0.48936) = fast (0.48936) ok 1054 - h id: est (0.27660) = fast (0.27660) ok 1055 - h cn: est (0.48936) = fast (0.48936) ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1 ok 1057 - q id: est (0.40000) = fast (0.40000) ok 1058 - q cn: est (0.60000) = fast (0.60000) ok 1059 - h id: est (0.40000) = fast (0.40000) ok 1060 - h cn: est (0.60000) = fast (0.60000) ok 1061 - dnaEbsub_ecoli.wutblastx ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12 ok 1063 - q id: est (0.37500) = fast (0.37500) ok 1064 - q cn: est (0.62500) = fast (0.62500) ok 1065 - q id: exact (0.44118) ~ est (0.44118) ok 1066 - q id: exact (0.44118) <= max (0.44118) ok 1067 - q cn: exact (0.54412) ~ est (0.54412) ok 1068 - q cn: exact (0.54412) <= max (0.54412) ok 1069 - q id: est (0.25352) = fast (0.25352) ok 1070 - q cn: est (0.47887) = fast (0.47887) ok 1071 - q id: exact (0.40224) ~ est (0.40912) ok 1072 - q id: exact (0.40224) <= max (0.42628) ok 1073 - q cn: exact (0.58494) ~ est (0.58968) ok 1074 - q cn: exact (0.58494) <= max (0.62179) ok 1075 - h id: exact (0.44118) ~ est (0.44118) ok 1076 - h id: exact (0.44118) <= max (0.44118) ok 1077 - h cn: exact (0.54412) ~ est (0.54412) ok 1078 - h cn: exact (0.54412) <= max (0.54412) ok 1079 - h id: est (0.25352) = fast (0.25352) ok 1080 - h cn: est (0.47887) = fast (0.47887) ok 1081 - h id: exact (0.39848) ~ est (0.40304) ok 1082 - h id: exact (0.39848) <= max (0.40355) ok 1083 - h cn: exact (0.58376) ~ est (0.58889) ok 1084 - h cn: exact (0.58376) <= max (0.58883) ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2 ok 1086 - q id: exact (0.41818) ~ est (0.41818) ok 1087 - q id: exact (0.41818) <= max (0.41818) ok 1088 - q cn: exact (0.52727) ~ est (0.52727) ok 1089 - q cn: exact (0.52727) <= max (0.52727) ok 1090 - h id: est (0.53333) = fast (0.53333) ok 1091 - h cn: est (0.66667) = fast (0.66667) ok 1092 - h id: est (0.37500) = fast (0.37500) ok 1093 - h cn: est (0.47500) = fast (0.47500) ok 1094 - bug2942: query m0: range correct ok 1095 - bug2942: query m1: range correct ok 1096 - bug2942: query m2: range correct ok 1097 - bug2942: subject all : range correct ok 1098 - get_tiled_alns ok 1099 - got all alns ok 1100 ok 1101 - aln and qfeat lengths correspond ok 1102 - q length correct ok 1103 ok 1104 - features on q and s correspond ok 1105 - aln and hfeat lengths correspond ok 1106 - s length correct ok 1107 ok 1108 - aln and qfeat lengths correspond ok 1109 - q length correct ok 1110 ok 1111 - features on q and s correspond ok 1112 - aln and hfeat lengths correspond ok 1113 - s length correct ok 1114 ok 1115 - aln and qfeat lengths correspond ok 1116 - q length correct ok 1117 ok 1118 - features on q and s correspond ok 1119 - aln and hfeat lengths correspond ok 1120 - s length correct ok 1121 ok 1122 - aln and qfeat lengths correspond ok 1123 - q length correct ok 1124 ok 1125 - features on q and s correspond ok 1126 - aln and hfeat lengths correspond ok 1127 - s length correct ok 1128 ok 1129 - aln and qfeat lengths correspond ok 1130 - q length correct ok 1131 ok 1132 - features on q and s correspond ok 1133 - aln and hfeat lengths correspond ok 1134 - s length correct ok 1135 ok 1136 - aln and qfeat lengths correspond ok 1137 - q length correct ok 1138 ok 1139 - features on q and s correspond ok 1140 - aln and hfeat lengths correspond ok 1141 - s length correct ok t/SearchIO/Writer/GbrowseGFF.t ......... 1..4 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok t/SearchIO/Writer/HSPTableWriter.t ..... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HSPTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/HTMLWriter.t ......... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/HitTableWriter.t ..... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::HitTableWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/Writer/TextWriter.t ......... 1..8 ok 1 - use Bio::SearchIO; ok 2 - use Bio::SearchIO::Writer::TextResultWriter; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 ok 7 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 8 ok t/SearchIO/axt.t ....................... 1..19 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok t/SearchIO/blast.t ..................... 1..1360 ok 1 - use Bio::SearchIO; ok 2 - Bio::SearchIO->new can handle a Path::Class object ok 3 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 4 - Bio::SearchIO->new can handle a Path::Class object ok 5 - An object of class 'Bio::SearchIO::blast' isa 'Bio::Root::IO' ok 6 ok 7 - database_name() ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok 392 ok 393 ok 394 ok 395 ok 396 ok 397 ok 398 ok 399 ok 400 ok 401 ok 402 ok 403 ok 404 ok 405 ok 406 ok 407 ok 408 ok 409 ok 410 ok 411 ok 412 ok 413 ok 414 not ok 415 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 668. # '0.852' # > # '0.9' not ok 416 # TODO frac_identical & frac_conserved are still too wrong # Failed (TODO) test at t/SearchIO/blast.t line 669. # '1.599' # <= # '1' ok 417 ok 418 ok 419 ok 420 ok 421 ok 422 ok 423 ok 424 ok 425 ok 426 ok 427 ok 428 ok 429 ok 430 ok 431 ok 432 ok 433 ok 434 ok 435 ok 436 ok 437 ok 438 ok 439 ok 440 ok 441 ok 442 ok 443 ok 444 ok 445 ok 446 ok 447 ok 448 ok 449 ok 450 ok 451 ok 452 ok 453 ok 454 ok 455 ok 456 ok 457 ok 458 ok 459 ok 460 ok 461 ok 462 ok 463 ok 464 ok 465 ok 466 ok 467 ok 468 ok 469 ok 470 ok 471 ok 472 ok 473 ok 474 ok 475 ok 476 ok 477 ok 478 ok 479 ok 480 ok 481 ok 482 ok 483 ok 484 ok 485 ok 486 ok 487 ok 488 ok 489 ok 490 ok 491 ok 492 ok 493 ok 494 ok 495 ok 496 ok 497 ok 498 ok 499 ok 500 ok 501 ok 502 ok 503 ok 504 ok 505 ok 506 ok 507 ok 508 ok 509 ok 510 ok 511 ok 512 ok 513 ok 514 ok 515 ok 516 ok 517 ok 518 ok 519 ok 520 ok 521 ok 522 ok 523 ok 524 ok 525 ok 526 ok 527 ok 528 ok 529 ok 530 ok 531 ok 532 ok 533 ok 534 ok 535 ok 536 ok 537 ok 538 ok 539 ok 540 ok 541 ok 542 ok 543 ok 544 ok 545 ok 546 ok 547 ok 548 ok 549 ok 550 ok 551 ok 552 ok 553 ok 554 ok 555 ok 556 ok 557 ok 558 ok 559 ok 560 ok 561 ok 562 ok 563 ok 564 ok 565 ok 566 ok 567 ok 568 ok 569 ok 570 ok 571 ok 572 ok 573 ok 574 ok 575 ok 576 ok 577 ok 578 ok 579 ok 580 ok 581 ok 582 ok 583 ok 584 ok 585 ok 586 ok 587 ok 588 ok 589 ok 590 ok 591 ok 592 ok 593 ok 594 ok 595 ok 596 ok 597 - Multiblast query test ok 598 ok 599 - Multiblast query test ok 600 ok 601 - Multiblast query test ok 602 ok 603 - Multiblast query test ok 604 ok 605 ok 606 ok 607 ok 608 ok 609 ok 610 ok 611 ok 612 ok 613 ok 614 ok 615 ok 616 ok 617 ok 618 ok 619 ok 620 ok 621 ok 622 ok 623 ok 624 ok 625 ok 626 ok 627 ok 628 ok 629 ok 630 ok 631 ok 632 ok 633 ok 634 ok 635 ok 636 ok 637 ok 638 ok 639 ok 640 ok 641 ok 642 ok 643 ok 644 ok 645 ok 646 ok 647 ok 648 ok 649 ok 650 ok 651 ok 652 ok 653 ok 654 ok 655 ok 656 ok 657 ok 658 ok 659 ok 660 ok 661 ok 662 ok 663 ok 664 ok 665 ok 666 ok 667 ok 668 ok 669 ok 670 ok 671 ok 672 ok 673 ok 674 ok 675 ok 676 ok 677 ok 678 ok 679 ok 680 ok 681 ok 682 ok 683 ok 684 ok 685 ok 686 ok 687 ok 688 ok 689 ok 690 ok 691 ok 692 ok 693 ok 694 ok 695 ok 696 ok 697 ok 698 ok 699 ok 700 ok 701 ok 702 ok 703 ok 704 ok 705 ok 706 ok 707 ok 708 ok 709 ok 710 ok 711 ok 712 ok 713 ok 714 ok 715 ok 716 ok 717 ok 718 ok 719 ok 720 ok 721 ok 722 ok 723 ok 724 ok 725 ok 726 ok 727 ok 728 ok 729 ok 730 ok 731 ok 732 ok 733 ok 734 ok 735 ok 736 ok 737 ok 738 ok 739 ok 740 ok 741 ok 742 ok 743 ok 744 ok 745 ok 746 ok 747 ok 748 ok 749 ok 750 ok 751 ok 752 ok 753 ok 754 ok 755 ok 756 ok 757 ok 758 ok 759 ok 760 ok 761 ok 762 ok 763 ok 764 ok 765 ok 766 ok 767 ok 768 ok 769 ok 770 ok 771 ok 772 ok 773 ok 774 ok 775 ok 776 ok 777 ok 778 ok 779 ok 780 ok 781 ok 782 ok 783 ok 784 ok 785 ok 786 ok 787 ok 788 ok 789 ok 790 ok 791 ok 792 ok 793 ok 794 ok 795 ok 796 ok 797 ok 798 ok 799 ok 800 ok 801 ok 802 ok 803 ok 804 ok 805 ok 806 ok 807 ok 808 ok 809 ok 810 ok 811 ok 812 ok 813 ok 814 ok 815 ok 816 ok 817 ok 818 ok 819 ok 820 ok 821 ok 822 ok 823 ok 824 ok 825 ok 826 ok 827 ok 828 ok 829 ok 830 ok 831 ok 832 ok 833 ok 834 ok 835 ok 836 ok 837 ok 838 ok 839 ok 840 ok 841 ok 842 ok 843 ok 844 ok 845 ok 846 ok 847 ok 848 ok 849 ok 850 ok 851 ok 852 ok 853 ok 854 ok 855 ok 856 ok 857 ok 858 ok 859 ok 860 ok 861 ok 862 ok 863 ok 864 ok 865 ok 866 ok 867 ok 868 ok 869 ok 870 ok 871 ok 872 ok 873 ok 874 ok 875 ok 876 ok 877 ok 878 ok 879 ok 880 ok 881 ok 882 ok 883 ok 884 ok 885 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 886 ok 887 ok 888 ok 889 ok 890 ok 891 ok 892 ok 893 ok 894 ok 895 ok 896 ok 897 ok 898 ok 899 ok 900 ok 901 ok 902 ok 903 ok 904 ok 905 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 906 ok 907 ok 908 ok 909 ok 910 ok 911 ok 912 ok 913 ok 914 ok 915 ok 916 ok 917 ok 918 ok 919 ok 920 ok 921 ok 922 ok 923 ok 924 ok 925 ok 926 ok 927 ok 928 ok 929 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 930 ok 931 ok 932 ok 933 ok 934 ok 935 ok 936 ok 937 ok 938 ok 939 ok 940 ok 941 ok 942 ok 943 ok 944 ok 945 ok 946 ok 947 ok 948 ok 949 ok 950 ok 951 ok 952 ok 953 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 954 ok 955 ok 956 ok 957 ok 958 ok 959 ok 960 ok 961 ok 962 ok 963 ok 964 ok 965 ok 966 ok 967 ok 968 ok 969 ok 970 ok 971 ok 972 ok 973 ok 974 ok 975 ok 976 ok 977 ok 978 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 979 ok 980 ok 981 ok 982 ok 983 ok 984 ok 985 ok 986 ok 987 ok 988 ok 989 ok 990 ok 991 ok 992 ok 993 ok 994 ok 995 ok 996 ok 997 ok 998 ok 999 ok 1000 ok 1001 ok 1002 ok 1003 ok 1004 ok 1005 ok 1006 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1007 ok 1008 ok 1009 ok 1010 ok 1011 ok 1012 ok 1013 ok 1014 ok 1015 ok 1016 ok 1017 ok 1018 ok 1019 ok 1020 ok 1021 ok 1022 ok 1023 ok 1024 ok 1025 ok 1026 ok 1027 ok 1028 ok 1029 ok 1030 ok 1031 ok 1032 ok 1033 ok 1034 ok 1035 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 1036 ok 1037 ok 1038 ok 1039 ok 1040 ok 1041 ok 1042 ok 1043 ok 1044 ok 1045 ok 1046 ok 1047 ok 1048 ok 1049 ok 1050 ok 1051 ok 1052 ok 1053 ok 1054 - fasta for f.fasta ok 1055 - fasta for f.ssearch ok 1056 - fasta for f.fx ok 1057 - exonerate for f.exonerate ok 1058 - fasta for f.fy ok 1059 - blast for filename.bls ok 1060 - exonerate for f.exon ok 1061 - blastxml for f.xml ok 1062 - blast for f.tblx ok 1063 - blast for filename.blast ok 1064 - fasta for f.osearch ok 1065 - fasta for f.m9 ok 1066 - fasta for f.SSEARCH.m9 ok 1067 - fasta for f.psearch ok 1068 - blast for f.blx ok 1069 - blastxml for f.blastxml ok 1070 - blast for fast.bls ok 1071 - fasta for f.fa ok 1072 ok 1073 ok 1074 ok 1075 ok 1076 ok 1077 ok 1078 ok 1079 ok 1080 ok 1081 ok 1082 ok 1083 ok 1084 ok 1085 ok 1086 ok 1087 - full hit name ok 1088 - hit accession ok 1089 ok 1090 ok 1091 - query start ok 1092 - query start ok 1093 ok 1094 ok 1095 ok 1096 ok 1097 ok 1098 ok 1099 ok 1100 ok 1101 ok 1102 ok 1103 ok 1104 ok 1105 ok 1106 ok 1107 ok 1108 ok 1109 ok 1110 ok 1111 ok 1112 ok 1113 ok 1114 ok 1115 ok 1116 ok 1117 ok 1118 ok 1119 ok 1120 ok 1121 ok 1122 ok 1123 ok 1124 ok 1125 ok 1126 ok 1127 ok 1128 ok 1129 ok 1130 ok 1131 ok 1132 ok 1133 ok 1134 ok 1135 ok 1136 ok 1137 ok 1138 ok 1139 ok 1140 ok 1141 ok 1142 ok 1143 ok 1144 ok 1145 ok 1146 ok 1147 ok 1148 ok 1149 ok 1150 ok 1151 ok 1152 ok 1153 ok 1154 ok 1155 ok 1156 ok 1157 ok 1158 ok 1159 ok 1160 ok 1161 ok 1162 ok 1163 ok 1164 ok 1165 ok 1166 ok 1167 ok 1168 ok 1169 ok 1170 ok 1171 ok 1172 ok 1173 ok 1174 ok 1175 ok 1176 ok 1177 ok 1178 ok 1179 ok 1180 ok 1181 ok 1182 ok 1183 ok 1184 ok 1185 ok 1186 ok 1187 ok 1188 ok 1189 ok 1190 ok 1191 ok 1192 ok 1193 ok 1194 ok 1195 ok 1196 ok 1197 ok 1198 ok 1199 ok 1200 ok 1201 ok 1202 ok 1203 ok 1204 ok 1205 ok 1206 ok 1207 ok 1208 ok 1209 ok 1210 ok 1211 ok 1212 ok 1213 ok 1214 ok 1215 ok 1216 ok 1217 ok 1218 ok 1219 ok 1220 ok 1221 ok 1222 ok 1223 ok 1224 ok 1225 ok 1226 ok 1227 ok 1228 ok 1229 ok 1230 ok 1231 ok 1232 ok 1233 ok 1234 ok 1235 ok 1236 ok 1237 ok 1238 ok 1239 ok 1240 ok 1241 ok 1242 ok 1243 ok 1244 ok 1245 ok 1246 ok 1247 ok 1248 ok 1249 ok 1250 ok 1251 ok 1252 ok 1253 ok 1254 ok 1255 ok 1256 ok 1257 ok 1258 ok 1259 ok 1260 ok 1261 ok 1262 ok 1263 ok 1264 ok 1265 ok 1266 ok 1267 ok 1268 ok 1269 ok 1270 ok 1271 ok 1272 ok 1273 ok 1274 ok 1275 ok 1276 ok 1277 ok 1278 ok 1279 ok 1280 ok 1281 ok 1282 ok 1283 ok 1284 ok 1285 ok 1286 ok 1287 ok 1288 ok 1289 ok 1290 ok 1291 ok 1292 ok 1293 ok 1294 ok 1295 ok 1296 ok 1297 ok 1298 ok 1299 ok 1300 ok 1301 ok 1302 ok 1303 ok 1304 ok 1305 ok 1306 ok 1307 ok 1308 ok 1309 ok 1310 ok 1311 ok 1312 ok 1313 ok 1314 ok 1315 ok 1316 ok 1317 ok 1318 ok 1319 ok 1320 ok 1321 ok 1322 ok 1323 ok 1324 ok 1325 ok 1326 ok 1327 ok 1328 ok 1329 ok 1330 ok 1331 ok 1332 ok 1333 ok 1334 ok 1335 ok 1336 ok 1337 ok 1338 ok 1339 ok 1340 ok 1341 ok 1342 ok 1343 ok 1344 ok 1345 ok 1346 ok 1347 ok 1348 ok 1349 ok 1350 ok 1351 ok 1352 ok 1353 ok 1354 ok 1355 - testing Bug 3298 ok 1356 - testing Bug 3298 ok 1357 - testing Bug 3298 ok 1358 - testing Bug 3251 ok 1359 - testing Bug 3251 ok 1360 - testing Bug 3251 ok t/SearchIO/blast_pull.t ................ 1..289 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 - database_name() ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 not ok 191 # TODO frac_identical failing! # Failed (TODO) test at t/SearchIO/blast_pull.t line 260. # got: '0.946' # expected: '0.943' ok 192 ok 193 ok 194 ok 195 ok 196 - Multiblast query test ok 197 - Multiblast query test ok 198 - Multiblast query test ok 199 - Multiblast query test ok 200 ok 201 ok 202 ok 203 - full hit name ok 204 - hit accession ok 205 ok 206 - query start ok 207 - query start ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok t/SearchIO/blasttable.t ................ 1..166 ok 1 - use Bio::SearchIO; ok 2 - use Bio::Search::SearchUtils; ok 3 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 4 ok 5 ok 6 - hit1_bits ok 7 - hit1_name ok 8 - hsp1_bits ok 9 - hsp1_gaps ok 10 - hsp1_he ok 11 - hsp1_hs ok 12 - hsp1_hstr ok 13 - hsp1_qe ok 14 - hsp1_qs ok 15 - hsp1_qstr ok 16 - hsp2_bits ok 17 - hsp2_gaps ok 18 - hsp2_he ok 19 - hsp2_hs ok 20 - hsp2_hstr ok 21 - hsp2_qe ok 22 - hsp2_qs ok 23 - hsp2_qstr ok 24 - hsp3_bits ok 25 - hsp3_gaps ok 26 - hsp3_he ok 27 - hsp3_hs ok 28 - hsp3_hstr ok 29 - hsp3_qe ok 30 - hsp3_qs ok 31 - hsp3_qstr ok 32 - hsp4_bits ok 33 - hsp4_gaps ok 34 - hsp4_he ok 35 - hsp4_hs ok 36 - hsp4_hstr ok 37 - hsp4_qe ok 38 - hsp4_qs ok 39 - hsp4_qstr ok 40 - hsp5_bits ok 41 - hsp5_gaps ok 42 - hsp5_he ok 43 - hsp5_hs ok 44 - hsp5_hstr ok 45 - hsp5_qe ok 46 - hsp5_qs ok 47 - hsp5_qstr ok 48 - hsp6_bits ok 49 - hsp6_gaps ok 50 - hsp6_he ok 51 - hsp6_hs ok 52 - hsp6_hstr ok 53 - hsp6_qe ok 54 - hsp6_qs ok 55 - hsp6_qstr ok 56 - hsp7_bits ok 57 - hsp7_gaps ok 58 - hsp7_he ok 59 - hsp7_hs ok 60 - hsp7_hstr ok 61 - hsp7_qe ok 62 - hsp7_qs ok 63 - hsp7_qstr ok 64 - hsp8_bits ok 65 - hsp8_gaps ok 66 - hsp8_he ok 67 - hsp8_hs ok 68 - hsp8_hstr ok 69 - hsp8_qe ok 70 - hsp8_qs ok 71 - hsp8_qstr ok 72 - query_name ok 73 - An object of class 'Bio::Search::Result::BlastResult' isa 'Bio::Search::Result::ResultI' ok 74 ok 75 ok 76 - hit1_bits ok 77 - hit1_name ok 78 - hsp1_bits ok 79 - hsp1_gaps ok 80 - hsp1_he ok 81 - hsp1_hs ok 82 - hsp1_hstr ok 83 - hsp1_qe ok 84 - hsp1_qs ok 85 - hsp1_qstr ok 86 - hsp2_bits ok 87 - hsp2_gaps ok 88 - hsp2_he ok 89 - hsp2_hs ok 90 - hsp2_hstr ok 91 - hsp2_qe ok 92 - hsp2_qs ok 93 - hsp2_qstr ok 94 - hsp3_bits ok 95 - hsp3_gaps ok 96 - hsp3_he ok 97 - hsp3_hs ok 98 - hsp3_hstr ok 99 - hsp3_qe ok 100 - hsp3_qs ok 101 - hsp3_qstr ok 102 - hsp4_bits ok 103 - hsp4_gaps ok 104 - hsp4_he ok 105 - hsp4_hs ok 106 - hsp4_hstr ok 107 - hsp4_qe ok 108 - hsp4_qs ok 109 - hsp4_qstr ok 110 - hsp5_bits ok 111 - hsp5_gaps ok 112 - hsp5_he ok 113 - hsp5_hs ok 114 - hsp5_hstr ok 115 - hsp5_qe ok 116 - hsp5_qs ok 117 - hsp5_qstr ok 118 - hsp6_bits ok 119 - hsp6_gaps ok 120 - hsp6_he ok 121 - hsp6_hs ok 122 - hsp6_hstr ok 123 - hsp6_qe ok 124 - hsp6_qs ok 125 - hsp6_qstr ok 126 - hsp7_bits ok 127 - hsp7_gaps ok 128 - hsp7_he ok 129 - hsp7_hs ok 130 - hsp7_hstr ok 131 - hsp7_qe ok 132 - hsp7_qs ok 133 - hsp7_qstr ok 134 - hsp8_bits ok 135 - hsp8_gaps ok 136 - hsp8_he ok 137 - hsp8_hs ok 138 - hsp8_hstr ok 139 - hsp8_qe ok 140 - hsp8_qs ok 141 - hsp8_qstr ok 142 - query_name ok 143 ok 144 ok 145 ok 146 ok 147 - hit score ok 148 - hit raw_score ok 149 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::SeqFeatureI' ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 - fixed bug 3343 (percent identity) ok 158 - side effect of fixing bug 3343 (number of gaps) ok 159 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 160 ok 161 ok 162 ok 163 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeatureI' ok 164 ok 165 ok 166 ok t/SearchIO/blastxml.t .................. 1..391 ok 1 - use Bio::SearchIO; ok 2 ok 3 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 4 - database_name() ok 5 - query_name() ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 - database_name() ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 - query name on HSP ok 61 - query desc on HSP ok 62 - hitname ok 63 - hitdesc ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 - query name on HSP ok 169 - query desc on HSP ok 170 - hitname ok 171 - hitdesc ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 - query name on HSP ok 215 - query desc on HSP ok 216 - hitname ok 217 - hitdesc ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok 291 ok 292 ok 293 ok 294 ok 295 ok 296 ok 297 ok 298 ok 299 ok 300 ok 301 ok 302 ok 303 ok 304 ok 305 ok 306 ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 ok 313 ok 314 ok 315 ok 316 ok 317 ok 318 ok 319 ok 320 ok 321 ok 322 ok 323 ok 324 ok 325 ok 326 ok 327 ok 328 ok 329 ok 330 ok 331 ok 332 ok 333 ok 334 ok 335 ok 336 ok 337 ok 338 ok 339 ok 340 ok 341 ok 342 ok 343 ok 344 ok 345 ok 346 ok 347 ok 348 ok 349 ok 350 ok 351 ok 352 ok 353 ok 354 ok 355 ok 356 ok 357 ok 358 ok 359 ok 360 ok 361 ok 362 ok 363 ok 364 ok 365 ok 366 ok 367 ok 368 ok 369 ok 370 ok 371 ok 372 ok 373 ok 374 ok 375 ok 376 ok 377 ok 378 ok 379 ok 380 ok 381 ok 382 ok 383 ok 384 ok 385 ok 386 ok 387 ok 388 ok 389 ok 390 ok 391 ok t/SearchIO/cross_match.t ............... 1..15 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok t/SearchIO/erpin.t ..................... 1..91 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result ERPIN ok 4 - Result ERPIN reference ok 5 - Result ERPIN version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_name ok 16 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 17 - Hit accession ok 18 - Hit GI ok 19 - Hit algorithm ok 20 - Hit bits ok 21 - Hit description ok 22 - Hit length ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit overlap ok 28 - Hit query_length ok 29 - Hit rank ok 30 - Hit raw_score ok 31 - Hit score ok 32 ok 33 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 34 - HSP algorithm ok 35 ok 36 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 37 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 38 - HSP frame ok 39 - HSP gaps ok 40 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 41 - HSP hit_string ok 42 - HSP homology_string ok 43 - HSP hsp_group ok 44 - HSP hsp_length ok 45 - HSP length ok 46 - HSP links ok 47 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 48 - HSP query_string ok 49 - HSP range ok 50 - HSP rank ok 51 ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 ok 59 ok 60 - HSP strand ok 61 ok 62 ok 63 - ERPIN get_aln warning ok 64 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 65 - HSP algorithm ok 66 ok 67 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 68 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 69 - HSP frame ok 70 - HSP gaps ok 71 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 72 - HSP hit_string ok 73 - HSP homology_string ok 74 - HSP query_string ok 75 - HSP hsp_group ok 76 - HSP hsp_length ok 77 - HSP length ok 78 - HSP links ok 79 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 80 - HSP range ok 81 - HSP rank ok 82 ok 83 - HSP end ok 84 - HSP expect ok 85 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 86 - HSP seq_str ok 87 - HSP start ok 88 - HSP custom_score ok 89 ok 90 ok 91 - HSP strand ok t/SearchIO/exonerate.t ................. 1..52 ok 1 - use Bio::SearchIO; ok 2 ok 3 # skip no query length available in default output ok 4 ok 5 # skip no hit length available in default output ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 # skip no query length available in default output ok 26 ok 27 # skip no hit length available in default output ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - query_name ok 47 ok 48 - query_name ok 49 ok 50 - query_name ok 51 ok 52 ok t/SearchIO/fasta.t ..................... 1..299 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 - TFASTXY ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 - num_identical() ok 287 - num_conserved() ok 288 - bug 2937 and FASTA version 3.5 ok 289 - algorithm version ok 290 - query name ok 291 - query description ok 292 - query length ok 293 - algorithm ok 294 - num_identical() ok 295 - num_conserved() ok 296 - hsp->strand(hit) ok 297 - hsp->hit->strand ok 298 - hsp->strand(query) ok 299 - hsp->query->strand ok t/SearchIO/gmap_f9.t ................... 1..54 ok 1 - use Bio::SearchIO; ok 2 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 3 - Did we get the expected number of hits? ok 4 - Did we get the expected algorithm? ok 5 - Did we get the expected query_name? ok 6 - 'Did we get a Hit?' isa 'Bio::Search::Hit::GenericHit' ok 7 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 8 - Check the name ok 9 - Check the hit length ok 10 - Check the number of hsps ok 11 - Check the query length ok 12 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 13 - Check the algorithm ok 14 - Count gaps in the query ok 15 - Count gaps in the hit ok 16 - Length of the query ok 17 - Length of the hit ok 18 - Query sequence ok 19 - Hit sequence ok 20 - Check query start ok 21 - Check query end ok 22 - Check query end ok 23 - Check the homology string ok 24 - Check seq_inds ok 25 - Check hit start ok 26 - Check hit end ok 27 - Check hit end ok 28 - 'Did we get a Result?' isa 'Bio::Search::Result::GenericResult' ok 29 - Did we get the expected number of hits? ok 30 - Did we get the expected algorithm? ok 31 - Did we get the expected query_name? ok 32 - An object of class 'Bio::Search::Hit::GenericHit' isa 'Bio::Search::Hit::HitI' ok 33 - Check the name ok 34 - Check the hit length ok 35 - Check the number of hsps ok 36 - Check the query length ok 37 - An object of class 'Bio::Search::HSP::GenericHSP' isa 'Bio::Search::HSP::HSPI' ok 38 - Check the algorithm ok 39 - Count gaps in the query ok 40 - Count gaps in the hit ok 41 - Length of the query ok 42 - Length of the hit ok 43 - Query sequence ok 44 - Hit sequence ok 45 - Check query start ok 46 - Check query end ok 47 - Check query end ok 48 - Check the homology string ok 49 - Check seq_inds ok 50 - Check hit start ok 51 - Check hit end ok 52 - Check hit end ok 53 - Can we loop over multiple results properly (expecting 58)? ok 54 - simple query_name now caught, bug 3021 ok t/SearchIO/hmmer.t ..................... 1..327 ok 1 - use Bio::SearchIO; ok 2 - Check for the correct result reference type ok 3 - Check algorithm ok 4 - Check algorithm version ok 5 - Check hmm_name ok 6 - Check sequence_file ok 7 - Check query_name ok 8 - Check query_description ok 9 - Check num_hits ok 10 - Check hit name ok 11 - Check hit raw_score ok 12 - Check hit significance ok 13 - Check for the correct hit reference type ok 14 - Check num_hsps ok 15 - Check for hit hmmfrom value ok 16 - Check for hit hmm to value ok 17 - Check for query alifrom value ok 18 - Check for query ali to value ok 19 - Check for hsp score ok 20 - Check for hsp c-Evalue ok 21 - Check for query string ok 22 - Check for number of gaps in query ok 23 - Check for hit string ok 24 - Check for homology string ok 25 - Check if homology string and hit string have an equal lenght ok 26 - Check if query string and homology string have an equal lenght ok 27 - Check for hit hmmfrom value ok 28 - Check for hit hmm to value ok 29 - Check for query alifrom value ok 30 - Check for query ali to value ok 31 - Check for hsp score ok 32 - Check for hsp c-Evalue ok 33 - Check for query string ok 34 - Check for number of gaps in query ok 35 - Check for hit string ok 36 - Check for homology string ok 37 - Check if homology string and hit string have an equal lenght ok 38 - Check if query string and homology string have an equal lenght ok 39 - Check for the correct result reference type ok 40 - Check algorithm ok 41 - Check algorithm version ok 42 - Check hmm_name ok 43 - Check sequence_file ok 44 - Check database_name ok 45 - Check query_name ok 46 - Check query_description ok 47 - Check num_hits ok 48 - Check hit name ok 49 - Check for hit description ok 50 - Check hit significance ok 51 - Check hit raw_score ok 52 - Check for hsp score ok 53 - Check for hsp c-Evalue ok 54 - Check for query alifrom value ok 55 - Check for query ali to value ok 56 - Check for hit hmmfrom value ok 57 - Check for hit hmm to value ok 58 - Check for query seq_id ok 59 - Check for hit seq_id ok 60 - Check for the correct result reference type ok 61 - Check algorithm ok 62 - Check algorithm version ok 63 - Check hmm_name ok 64 - Check sequence_file ok 65 - Check query_name ok 66 - Check query_description ok 67 - Check num_hits ok 68 - Check hit name ok 69 - Check for hit description ok 70 - Check hit significance ok 71 - Check hit raw_score ok 72 - Check for hsp score ok 73 - Check for hsp evalue ok 74 - Check for query alifrom value ok 75 - Check for query ali to value ok 76 - Check for hit hmmfrom value ok 77 - Check for hit hmm to value ok 78 - Check for query seq_id ok 79 - Check for hit seq_id ok 80 - Check for hiy string ok 81 - Check for query string ok 82 - Check for homology string ok 83 - Check for nomatch indices in query ok 84 - Check for nomatch indices in hit ok 85 - Check for gap indices in query ok 86 - Check for gap indices in hit ok 87 - Check for the correct result reference type ok 88 - Check algorithm ok 89 - Check algorithm version ok 90 - Check hmm_name ok 91 - Check database_name ok 92 - Check sequence_file ok 93 - Check query_name ok 94 - Check query_accession ok 95 - Check query_description ok 96 - Check num_hits ok 97 - Check hit name ok 98 - Check for hit description ok 99 - Check hit significance ok 100 - Check hit raw_score ok 101 - Check for hsp score ok 102 - Check for hsp evalue ok 103 - Check for query alifrom value ok 104 - Check for query ali to value ok 105 - Check for hit hmmfrom value ok 106 - Check for hit hmm to value ok 107 - Check for query seq_id ok 108 - Check for hit seq_id ok 109 - Check for hiy string ok 110 - Check for homology string ok 111 - Check for query string ok 112 - Check hit name ok 113 - Check for hit description ok 114 - Check hit significance ok 115 - Check hit raw_score ok 116 - Check for hsp seq_str ok 117 - Check if correct searchio object is returned ok 118 - Check for the correct result reference type ok 119 - Check algorithm ok 120 - Check algorithm version ok 121 - Check hmm_name ok 122 - Check sequence_file ok 123 - Check query_name ok 124 - Check query_length ok 125 - Check query_description ok 126 - Check num_hits ok 127 - Check for the correct hit reference type ok 128 - Check hit name ok 129 - Check for hit description ok 130 - Check hit raw_score ok 131 - Check hit significance ok 132 - Check num_hsps ok 133 - Check for correct hsp reference type ok 134 - Check for hit hmmfrom value ok 135 - Check for hit hmm to value ok 136 - Check for query alifrom value ok 137 - Check for query ali to value ok 138 - Check for hsp score ok 139 - Check for hsp c-Evalue ok 140 - Check for query string ok 141 - Check for hit string ok 142 - Check for homology string ok 143 - Check for the correct result reference type ok 144 - Check algorithm ok 145 - Check algorithm version ok 146 - Check hmm_name ok 147 - Check sequence_file ok 148 - Check query_name ok 149 - Check query_length ok 150 - Check query_description ok 151 - Check num_hits ok 152 - Check for the correct result reference type ok 153 - Check algorithm ok 154 - Check algorithm version ok 155 - Check hmm_name ok 156 - Check sequence_file ok 157 - Check query_name ok 158 - Check query_length ok 159 - Check query_description ok 160 - Check num_hits ok 161 - Check for the correct hit reference type ok 162 - Check hit name ok 163 - Check for hit description ok 164 - Check hit raw_score ok 165 - Check hit significance ok 166 - Check num_hsps ok 167 - Check for correct hsp reference type ok 168 - Check for hit envfrom value ok 169 - Check for hit env to value ok 170 - Check for query hmmfrom value ok 171 - Check for query hmm to value ok 172 - Check for hsp score ok 173 - Check for hsp c-Evalue ok 174 - Check for correct hsp reference type ok 175 - Check for hit envfrom value ok 176 - Check for hit env to value ok 177 - Check for query hmmfrom value ok 178 - Check for query hmm to value ok 179 - Check for hsp score ok 180 - Check for hsp c-Evalue ok 181 - Check for correct hsp reference type ok 182 - Check for hit envfrom value ok 183 - Check for hit env to value ok 184 - Check for query hmmfrom value ok 185 - Check for query hmm to value ok 186 - Check for hsp score ok 187 - Check for hsp c-Evalue ok 188 - Check for correct hsp reference type ok 189 - Check for hit envfrom value ok 190 - Check for hit env to value ok 191 - Check for query hmmfrom value ok 192 - Check for query hmm to value ok 193 - Check for hsp score ok 194 - Check for hsp c-Evalue ok 195 - Check for correct hsp reference type ok 196 - Check for hit envfrom value ok 197 - Check for hit env to value ok 198 - Check for query hmmfrom value ok 199 - Check for query hmm to value ok 200 - Check for hsp score ok 201 - Check for hsp c-Evalue ok 202 - Check for correct hsp reference type ok 203 - Check for hit envfrom value ok 204 - Check for hit env to value ok 205 - Check for query hmmfrom value ok 206 - Check for query hmm to value ok 207 - Check for hsp score ok 208 - Check for hsp c-Evalue ok 209 - Check for the correct hit reference type ok 210 - Check hit name ok 211 - Check for hit description ok 212 - Check hit raw_score ok 213 - Check hit significance ok 214 - Check num_hsps ok 215 - Check for correct hsp reference type ok 216 - Check for hit envfrom value ok 217 - Check for hit env to value ok 218 - Check for query hmmfrom value ok 219 - Check for query hmm to value ok 220 - Check for hsp score ok 221 - Check for hsp c-Evalue ok 222 - Check for correct hsp reference type ok 223 - Check for hit envfrom value ok 224 - Check for hit env to value ok 225 - Check for query hmmfrom value ok 226 - Check for query hmm to value ok 227 - Check for hsp score ok 228 - Check for hsp c-Evalue ok 229 - Check for correct hsp reference type ok 230 - Check for hit envfrom value ok 231 - Check for hit env to value ok 232 - Check for query hmmfrom value ok 233 - Check for query hmm to value ok 234 - Check for hsp score ok 235 - Check for hsp c-Evalue ok 236 - Check for the correct result reference type ok 237 - Check algorithm ok 238 - Check algorithm version ok 239 - Check hmm_name ok 240 - Check sequence_file ok 241 - Check query_name ok 242 - Check query_length ok 243 - Check query_description ok 244 - Check num_hits ok 245 - Check for the correct hit reference type ok 246 - Check hit name ok 247 - Check for hit description ok 248 - Check hit raw_score ok 249 - Check hit significance ok 250 - Check num_hsps ok 251 - Check for correct hsp reference type ok 252 - Check hit sequence ok 253 - Check query sequence ok 254 - Check for correct hsp reference type ok 255 - Check hit sequence ok 256 - Check query sequence ok 257 - Check for the correct hit reference type ok 258 - Check hit name ok 259 - Check for hit description ok 260 - Check hit raw_score ok 261 - Check hit significance ok 262 - Check num_hsps ok 263 - Check for correct hsp reference type ok 264 - Check hit sequence ok 265 - Check query sequence ok 266 - Check for correct hsp reference type ok 267 - Check hit sequence ok 268 - Check query sequence ok 269 - Check for the correct hit reference type ok 270 - Check hit name ok 271 - Check for hit description ok 272 - Check hit raw_score ok 273 - Check hit significance ok 274 - Check num_hsps ok 275 - Check for correct hsp reference type ok 276 - Check hit sequence ok 277 - Check query sequence ok 278 - Check for correct hsp reference type ok 279 - Check hit sequence ok 280 - Check query sequence ok 281 - Check if loading hmmpfam output via the hmm2 parser directly works ok 282 - Check for the correct result reference type ok 283 - Check if loading hmmsearch2 output via the hmm2 parser directly works ok 284 - Check for the correct result reference type ok 285 - Check if loading hmmscan output via the hmm3 parser directly works ok 286 - Check for the correct result reference type ok 287 - Check if loading hmmsearch3 output via the hmm3 parser directly works ok 288 - Check for the correct result reference type ok 289 - Check if selecting the correct hmmpfam parser using -version works ok 290 - Check for the correct result reference type ok 291 - Check if selecting the correct hmmsearch2 parser using -version works ok 292 - Check for the correct result reference type ok 293 - Check if selecting the correct hmmscan parser using -version works ok 294 - Check for the correct result reference type ok 295 - Check if selecting the correct hmmsearch3 parser using -version works ok 296 - Check for the correct result reference type ok 297 - Check if reading from a pipe works ok 298 - Check for the correct result reference type ok 299 - Check num_hits ok 300 - bug3376 ok 301 - bug3421 - Check if can correctly parse an HSP with line full of dashes ok 302 - bug3302 - Check if can parse multiresult hmmer ok 303 - Check nhmmer algorithm version ok 304 - Check nhmmer hit name ok 305 - Check nhmmer hit description ok 306 - Check nhmmer hit significance ok 307 - Check nhmmer hit score ok 308 - Check nhmmer hsp score ok 309 - Check nhmmer hsp score ok 310 - Check nhmmer hsp hit start ok 311 - Check nhmmer hsp hit end ok 312 - Check nhmmer hsp query start ok 313 - Check nhmmer hsp query end ok 314 - Check nhmmer hsp hit strand ok 315 - Check nhmmer hsp query strand ok 316 - Check nhmmer hit name ok 317 - Check nhmmer hit description ok 318 - Check nhmmer hit significance ok 319 - Check nhmmer hit score ok 320 - Check nhmmer hsp score ok 321 - Check nhmmer hsp score ok 322 - Check nhmmer hsp query start ok 323 - Check nhmmer hsp query end ok 324 - Check nhmmer hsp hit start ok 325 - Check nhmmer hsp hit end ok 326 - Check nhmmer hsp hit strand ok 327 - Check nhmmer hsp query strand ok t/SearchIO/hmmer_pull.t ................ 1..290 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok 288 ok 289 ok 290 ok t/SearchIO/infernal.t .................. 1..412 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result ok 4 - Result reference ok 5 - Result version ok 6 - Result parameters ok 7 - Result statistics ok 8 - Result entries ok 9 - Result letters ok 10 - Result database_name ok 11 - Result num_hits ok 12 - Result program_reference ok 13 - Result query_accession ok 14 - Result query_description ok 15 - Result query_length ok 16 - Result query_name ok 17 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 18 - Hit GI ok 19 - Hit accession ok 20 - Hit algorithm ok 21 - Hit bits ok 22 - Hit description ok 23 - Hit locus ok 24 - Hit n ok 25 - Hit name ok 26 - Hit num_hsps ok 27 - Hit length_aln() not implemented ok 28 - Hit num_unaligned_hit() not implemented ok 29 - Hit num_unaligned_query() not implemented ok 30 - Hit num_unaligned_sbjct() not implemented ok 31 - Hit start not implemented ok 32 - Hit end not implemented ok 33 - Hit strand not implemented ok 34 - Hit logical_length not implemented ok 35 - Hit frac_aligned_hit not implemented ok 36 - Hit frac_aligned_query not implemented ok 37 - Hit frac_conserved not implemented ok 38 - Hit frac_identical not implemented ok 39 - Hit matches not implemented ok 40 - Hit gaps not implemented ok 41 - Hit frame not implemented ok 42 - Hit range not implemented ok 43 - Hit seq_inds not implemented ok 44 - Hit length ok 45 - Hit overlap ok 46 - Hit query_length ok 47 - Hit rank ok 48 - Hit raw_score ok 49 - Hit score ok 50 - Hit p ok 51 ok 52 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 53 - HSP algorithm ok 54 ok 55 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 56 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 57 ok 58 ok 59 - HSP frame ok 60 - HSP gaps ok 61 - Hit length ok 62 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 63 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 64 - HSP hit_string ok 65 - HSP homology_string ok 66 - HSP hsp_group ok 67 - HSP hsp_length ok 68 - HSP length ok 69 - HSP links ok 70 - HSP n ok 71 - HSP pvalue ok 72 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 73 - HSP query_string ok 74 - HSP range ok 75 - HSP rank ok 76 ok 77 - HSP end ok 78 - HSP expect ok 79 - HSP seq_inds not implemented ok 80 - HSP matches not implemented ok 81 - HSP frac_conserved not implemented ok 82 - HSP frac_identical not implemented ok 83 - HSP num_conserved not implemented ok 84 - HSP num_identical not implemented ok 85 - HSP percent_identity not implemented ok 86 - HSP cigar_string not implemented ok 87 - HSP cigar_string not implemented ok 88 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 89 - HSP seq_str ok 90 - HSP start ok 91 - HSP custom_score ok 92 - HSP meta ok 93 - HSP strand ok 94 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 95 - HSP algorithm ok 96 ok 97 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 98 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 99 - HSP frame ok 100 - HSP gaps ok 101 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 102 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 103 - HSP hit_string ok 104 - HSP homology_string ok 105 - HSP hsp_group ok 106 - HSP hsp_length ok 107 - HSP length ok 108 - HSP links ok 109 - HSP n ok 110 - HSP pvalue ok 111 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 112 - HSP query_string ok 113 - HSP range ok 114 - HSP rank ok 115 ok 116 - HSP end ok 117 - HSP expect ok 118 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 119 - HSP seq_str ok 120 - HSP start ok 121 - HSP custom_score ok 122 - HSP meta ok 123 - HSP strand ok 124 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 125 - Result CMSEARCH ok 126 - Result CMSEARCH reference ok 127 - Result CMSEARCH version ok 128 - Result parameters ok 129 - Result statistics ok 130 - Result entries ok 131 - Result letters ok 132 - Result database_name ok 133 - Result num_hits ok 134 - Result program_reference ok 135 - Result query_accession ok 136 - Result query_description ok 137 - Result query_length ok 138 - Result query_name ok 139 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 140 - Hit GI ok 141 - Hit accession ok 142 - Hit algorithm ok 143 - Hit bits ok 144 - Hit description ok 145 - Hit locus ok 146 - Hit n ok 147 - Hit name ok 148 - Hit num_hsps ok 149 - No p values ok 150 - Hit length ok 151 - Hit overlap ok 152 - Hit query_length ok 153 - Hit rank ok 154 - Hit raw_score ok 155 - Hit score ok 156 ok 157 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 158 - HSP algorithm ok 159 ok 160 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 161 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 162 ok 163 ok 164 - HSP frame ok 165 - HSP gaps ok 166 - Hit length ok 167 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 168 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 169 - HSP hit_string ok 170 - HSP homology_string ok 171 - HSP hsp_group ok 172 - HSP hsp_length ok 173 - HSP length ok 174 - HSP links ok 175 - HSP n ok 176 - HSP pvalue ok 177 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 178 - HSP query_string ok 179 - HSP range ok 180 - HSP rank ok 181 ok 182 - HSP end ok 183 - HSP expect ok 184 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 185 - HSP seq_str ok 186 - HSP start ok 187 - HSP custom_score ok 188 - HSP meta ok 189 - HSP strand ok 190 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 191 - HSP algorithm ok 192 ok 193 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 194 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 195 - HSP frame ok 196 - HSP gaps ok 197 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 198 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 199 - HSP hit_string ok 200 - HSP homology_string ok 201 - HSP hsp_group ok 202 - HSP hsp_length ok 203 - HSP length ok 204 - HSP links ok 205 - HSP n ok 206 - HSP pvalue ok 207 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 208 - HSP query_string ok 209 - HSP range ok 210 - HSP rank ok 211 ok 212 - HSP end ok 213 - HSP expect ok 214 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 215 - HSP seq_str ok 216 - HSP start ok 217 - HSP custom_score ok 218 - HSP meta ok 219 - HSP strand ok 220 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 221 - Hit accession ok 222 - Hit GI ok 223 - Hit algorithm ok 224 - Hit bits ok 225 - Hit description ok 226 - Hit length ok 227 - Hit locus ok 228 - Hit n ok 229 - Hit name ok 230 - Hit num_hsps ok 231 - Hit overlap ok 232 - Hit query_length ok 233 - Hit rank ok 234 - Hit raw_score ok 235 - Hit score ok 236 ok 237 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 238 - HSP algorithm ok 239 ok 240 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 241 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 242 - HSP frame ok 243 - HSP gaps ok 244 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 245 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 246 - HSP hit_string ok 247 - HSP homology_string ok 248 - HSP hsp_group ok 249 - HSP hsp_length ok 250 - HSP length ok 251 - HSP links ok 252 - HSP n ok 253 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 254 - HSP query_string ok 255 - HSP range ok 256 - HSP rank ok 257 ok 258 - HSP end ok 259 - HSP expect ok 260 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 261 - HSP seq_str ok 262 - HSP start ok 263 - HSP custom_score ok 264 - HSP meta ok 265 - HSP strand ok 266 - HSP meta gap bug ok 267 - HSP meta ok 268 - HSP meta ok 269 ok 270 ok 271 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 272 - Result CMSEARCH ok 273 - Result CMSEARCH reference ok 274 - Result CMSEARCH version ok 275 - Result parameters ok 276 - Result statistics ok 277 - Result entries ok 278 - Result letters ok 279 - Result database_name ok 280 - Result num_hits ok 281 - Result program_reference ok 282 - Result query_accession ok 283 - Result query_description ok 284 - Result query_length ok 285 - Result query_name ok 286 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 287 - Hit GI ok 288 - Hit accession ok 289 - Hit algorithm ok 290 - Hit bits ok 291 - Hit description ok 292 - Hit locus ok 293 - Hit n ok 294 - Hit name ok 295 - Hit num_hsps ok 296 - No p values ok 297 - Hit length ok 298 - Hit overlap ok 299 - Hit query_length ok 300 - Hit rank ok 301 - Hit raw_score ok 302 - Hit score ok 303 ok 304 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 305 - HSP algorithm ok 306 ok 307 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 308 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 309 ok 310 ok 311 - HSP frame ok 312 - HSP gaps ok 313 - Hit length ok 314 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 315 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 316 - HSP hit_string ok 317 - HSP homology_string ok 318 - HSP hsp_group ok 319 - HSP hsp_length ok 320 - HSP length ok 321 - HSP links ok 322 - HSP n ok 323 - HSP pvalue ok 324 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 325 - HSP query_string ok 326 - HSP range ok 327 - HSP rank ok 328 ok 329 - HSP end ok 330 - HSP expect ok 331 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 332 - HSP seq_str ok 333 - HSP start ok 334 - HSP custom_score ok 335 - HSP meta ok 336 - HSP strand ok 337 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 338 - HSP algorithm ok 339 ok 340 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 341 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 342 - HSP frame ok 343 - HSP gaps ok 344 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 345 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 346 - HSP hit_string ok 347 - HSP homology_string ok 348 - HSP hsp_group ok 349 - HSP hsp_length ok 350 - HSP length ok 351 - HSP links ok 352 - HSP n ok 353 - HSP pvalue ok 354 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 355 - HSP query_string ok 356 - HSP range ok 357 - HSP rank ok 358 ok 359 - HSP end ok 360 - HSP expect ok 361 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 362 - HSP seq_str ok 363 - HSP start ok 364 - HSP custom_score ok 365 - HSP meta ok 366 - HSP strand ok 367 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 368 - Hit accession ok 369 - Hit GI ok 370 - Hit algorithm ok 371 - Hit bits ok 372 - Hit description ok 373 - Hit length ok 374 - Hit locus ok 375 - Hit n ok 376 - Hit name ok 377 - Hit num_hsps ok 378 - Hit overlap ok 379 - Hit query_length ok 380 - Hit rank ok 381 - Hit raw_score ok 382 - Hit score ok 383 ok 384 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 385 - HSP algorithm ok 386 ok 387 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 388 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 389 - HSP frame ok 390 - HSP gaps ok 391 - An object of class 'Bio::SimpleAlign' isa 'Bio::Align::AlignI' ok 392 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 393 - HSP hit_string ok 394 - HSP homology_string ok 395 - HSP hsp_group ok 396 - HSP hsp_length ok 397 - HSP length ok 398 - HSP links ok 399 - HSP n ok 400 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 401 - HSP query_string ok 402 - HSP range ok 403 - HSP rank ok 404 ok 405 - HSP end ok 406 - HSP expect ok 407 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 408 - HSP seq_str ok 409 - HSP start ok 410 - HSP custom_score ok 411 - HSP meta ok 412 - HSP strand ok t/SearchIO/megablast.t ................. 1..31 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok t/SearchIO/psl.t ....................... 1..53 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - next_hsp should be undef ok 51 - next_hit should be undef not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string # Failed (TODO) test 'next_result should be undef' # at t/SearchIO/psl.t line 97. # got: '' # expected: undef ok 53 ok t/SearchIO/rnamotif.t .................. 1..60 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::Search::Result::GenericResult' isa 'Bio::Search::Result::ResultI' ok 3 - Result RNAMOTIF ok 4 - Result RNAMOTIF reference ok 5 - Result RNAMOTIF version ok 6 - Result entries ok 7 - Result letters ok 8 - Result database_name ok 9 - Result num_hits ok 10 - Result program_reference ok 11 - Result query_accession ok 12 - Result query_description ok 13 - Result query_length ok 14 - Result query_name ok 15 - An object of class 'Bio::Search::Hit::ModelHit' isa 'Bio::Search::Hit::HitI' ok 16 - Hit accession ok 17 - Hit GI ok 18 - Hit algorithm ok 19 - Hit description ok 20 - Hit length ok 21 - Hit locus ok 22 - Hit n ok 23 - Hit name ok 24 - Hit num_hsps ok 25 - Hit overlap ok 26 - Hit rank ok 27 - Hit raw_score ok 28 - Hit score ok 29 ok 30 - An object of class 'Bio::Search::HSP::ModelHSP' isa 'Bio::Search::HSP::HSPI' ok 31 - HSP algorithm ok 32 ok 33 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 34 - An object of class 'Bio::SeqFeature::Similarity' isa 'Bio::SeqFeature::Similarity' ok 35 - HSP frame ok 36 - HSP gaps ok 37 - RNAMotif get_aln warning ok 38 - 'HSP hit' isa 'Bio::SeqFeature::Similarity' ok 39 - HSP hit_string ok 40 - HSP homology_string ok 41 - HSP hsp_group ok 42 - HSP hsp_length ok 43 - HSP length ok 44 - HSP links ok 45 - HSP n ok 46 - 'HSP query' isa 'Bio::SeqFeature::Similarity' ok 47 - HSP query_string ok 48 - HSP range ok 49 - HSP rank ok 50 ok 51 - HSP end ok 52 - HSP expect ok 53 - An object of class 'Bio::LocatableSeq' isa 'Bio::LocatableSeq' ok 54 - HSP seq_str ok 55 - HSP start ok 56 - HSP custom_score ok 57 - HSP meta ok 58 - HSP strand ok 59 ok 60 ok t/SearchIO/sim4.t ...................... 1..102 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok t/SearchIO/waba.t ...................... 1..64 ok 1 - use Bio::SearchIO; ok 2 - An object of class 'Bio::SearchIO::waba' isa 'Bio::SearchIO' ok 3 - query_name ok 4 - query database ok 5 - database name ok 6 - name ok 7 - hsps ok 8 - total length ok 9 - start ok 10 - end ok 11 - strand ok 12 - start ok 13 - end ok 14 - strand ok 15 - query string ok 16 - hit_string ok 17 - hmmstate string ok 18 ok 19 ok 20 ok 21 - total length ok 22 - start ok 23 - end ok 24 - strand ok 25 - start ok 26 - end ok 27 - strand ok 28 - query string ok 29 - hit_string ok 30 - hmmstate string ok 31 ok 32 ok 33 ok 34 - total length ok 35 - start ok 36 - end ok 37 - strand ok 38 - start ok 39 - end ok 40 - strand ok 41 - query string ok 42 - hit_string ok 43 - hmmstate string ok 44 ok 45 ok 46 ok 47 - query_name ok 48 - query database ok 49 - database name ok 50 - name ok 51 - hsps ok 52 - total length ok 53 - start ok 54 - end ok 55 - strand ok 56 - start ok 57 - end ok 58 - strand ok 59 - query string ok 60 - hit_string ok 61 - hmmstate string ok 62 ok 63 ok 64 ok t/SearchIO/wise.t ...................... 1..20 ok 1 - use Bio::SearchIO; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok t/Seq/DBLink.t ......................... 1..131 ok 1 - use Bio::SeqIO; ok 2 - "swissprot:K1C9_HUMAN" ok 3 - no double colon ok 4 - no trailing colon ok 5 - no double space ok 6 - dblink value is splittable ok 7 - "GenBank:Z29074.1" ok 8 - no double colon ok 9 - no trailing colon ok 10 - no double space ok 11 - dblink value is splittable ok 12 - "GenPept:CAA82315.1" ok 13 - no double colon ok 14 - no trailing colon ok 15 - no double space ok 16 - dblink value is splittable ok 17 - "GenBank:S69510.1" ok 18 - no double colon ok 19 - no trailing colon ok 20 - no double space ok 21 - dblink value is splittable ok 22 - "GenPept:AAC60619.1" ok 23 - no double colon ok 24 - no trailing colon ok 25 - no double space ok 26 - dblink value is splittable ok 27 - "GenBank:X75015.1" ok 28 - no double colon ok 29 - no trailing colon ok 30 - no double space ok 31 - dblink value is splittable ok 32 - "GenPept:CAA52924.1" ok 33 - no double colon ok 34 - no trailing colon ok 35 - no double space ok 36 - dblink value is splittable ok 37 - "GenBank:AB001594.1" ok 38 - no double colon ok 39 - no trailing colon ok 40 - no double space ok 41 - dblink value is splittable ok 42 - "GenPept:BAA19418.1" ok 43 - no double colon ok 44 - no trailing colon ok 45 - no double space ok 46 - dblink value is splittable ok 47 - "GenBank:I37984" ok 48 - no double colon ok 49 - no trailing colon ok 50 - no double space ok 51 - dblink value is splittable ok 52 - "HSSP:P08670" ok 53 - no double colon ok 54 - no trailing colon ok 55 - no double space ok 56 - dblink value is splittable ok 57 - "IntAct:P35527" ok 58 - no double colon ok 59 - no trailing colon ok 60 - no double space ok 61 - dblink value is splittable ok 62 - "Ensembl:ENSG00000171403" ok 63 - no double colon ok 64 - no trailing colon ok 65 - no double space ok 66 - dblink value is splittable ok 67 - "KEGG:hsa:3857" ok 68 - no double colon ok 69 - no trailing colon ok 70 - no double space ok 71 - dblink value is splittable ok 72 - "HGNC:6447" ok 73 - no double colon ok 74 - no trailing colon ok 75 - no double space ok 76 - dblink value is splittable ok 77 - "MIM:144200" ok 78 - no double colon ok 79 - no trailing colon ok 80 - no double space ok 81 - dblink value is splittable ok 82 - "MIM:607606" ok 83 - no double colon ok 84 - no trailing colon ok 85 - no double space ok 86 - dblink value is splittable ok 87 - "ArrayExpress:P35527" ok 88 - no double colon ok 89 - no trailing colon ok 90 - no double space ok 91 - dblink value is splittable ok 92 - "GO:0005200" ok 93 - no double colon ok 94 - no trailing colon ok 95 - no double space ok 96 - dblink value is splittable ok 97 - "GO:0008544" ok 98 - no double colon ok 99 - no trailing colon ok 100 - no double space ok 101 - dblink value is splittable ok 102 - "InterPro:IPR011000" ok 103 - no double colon ok 104 - no trailing colon ok 105 - no double space ok 106 - dblink value is splittable ok 107 - "InterPro:IPR001664" ok 108 - no double colon ok 109 - no trailing colon ok 110 - no double space ok 111 - dblink value is splittable ok 112 - "InterPro:IPR002957" ok 113 - no double colon ok 114 - no trailing colon ok 115 - no double space ok 116 - dblink value is splittable ok 117 - "Pfam:PF00038" ok 118 - no double colon ok 119 - no trailing colon ok 120 - no double space ok 121 - dblink value is splittable ok 122 - "PRINTS:PR01248" ok 123 - no double colon ok 124 - no trailing colon ok 125 - no double space ok 126 - dblink value is splittable ok 127 - "PROSITE:PS00226" ok 128 - no double colon ok 129 - no trailing colon ok 130 - no double space ok 131 - dblink value is splittable ok t/Seq/EncodedSeq.t ..................... 1..37 ok 1 - use Bio::Seq::EncodedSeq; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 12 ok 13 ok 14 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok t/Seq/LargeLocatableSeq.t .............. 1..8 ok 1 - use Bio::Seq::LargeLocatableSeq; ok 2 ok 3 - An object of class 'Bio::Seq::LargeLocatableSeq' isa 'Bio::Seq::LargeSeqI' ok 4 ok 5 ok 6 ok 7 ok 8 ok t/Seq/LargePSeq.t ...................... 1..30 ok 1 - use Bio::Seq::LargePrimarySeq; ok 2 - use Bio::Seq::LargeSeq; ok 3 - use Bio::Location::Simple; ok 4 - use Bio::Location::Fuzzy; ok 5 - use Bio::Location::Split; ok 6 - use Bio::SeqIO; ok 7 ok 8 ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 10 - Subseq is GGGGT ok 11 ok 12 ok 13 ok 14 - trunc seq was GGGGTGAA ok 15 ok 16 ok 17 ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT ok 19 ok 20 - output via Bio::SeqIO::fasta ok 21 - Subseq is GGGGT ok 22 - trunc seq was GGGGTGAA ok 23 ok 24 ok 25 ok 26 - Sequence is ATGGGGTGGGGT ok 27 - Subseq is GGGGT ok 28 - trunc seq was GGGGT ok 29 ok 30 ok t/Seq/LocatableSeq.t ................... 1..119 ok 1 - use Bio::LocatableSeq; ok 2 - use Bio::AlignIO; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 13 ok 14 ok 15 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 16 ok 17 ok 18 ok 19 not ok 20 # TODO Need to fix columns before start of seq w/ start > 1 # Failed (TODO) test at t/Seq/LocatableSeq.t line 47. # got: 'Bio::Location::Simple=HASH(0x990ea3c)' # expected: undef ok 21 ok 22 - An object of class 'Bio::AlignIO::pfam' isa 'Bio::AlignIO' ok 23 ok 24 ok 25 ok 26 ok 27 - threw Regexp ((?^:.+)) ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 51 ok 52 ok 53 - An object of class 'Bio::Location::Simple' isa 'Bio::Location::Simple' ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 - * is counted in length ok 107 - * is counted in length, but end is wrong ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 307. # got: '\-\.=~' # expected: '-\?' not ok 119 # TODO Bio::LocatableSeq global variables have scoping issues # Failed (TODO) test at t/Seq/LocatableSeq.t line 309. # got: '19' # expected: anything else ok t/Seq/MetaSeq.t ........................ 1..132 ok 1 - use Bio::Seq::Meta; ok 2 - use Bio::Seq::Meta::Array; ok 3 - use Bio::SeqIO; ok 4 - use Bio::AlignIO; ok 5 - use Bio::Seq::Quality; ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - aa-bb bb ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok t/Seq/PrimaryQual.t .................... 1..70 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 - A reference of type 'ARRAY' isa 'ARRAY' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - threw Regexp ((?^:.+)) ok 27 - threw Regexp ((?^:.+)) ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 - threw Regexp ((?^:EX)) ok 34 ok 35 ok 36 - threw Regexp ((?^:EX)) ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok t/Seq/PrimarySeq.t ..................... 1..287 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::Location::Split; ok 5 - Bare object ok 6 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::IdentifiableI' ok 26 - An object of class 'Bio::PrimarySeq' isa 'Bio::DescribableI' ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 - threw Regexp ((?^:.+)) ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 59 ok 60 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 61 ok 62 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 63 ok 64 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 - Translation: LVAST ok 77 - Translation: MVAST ok 78 - Translation: MVAST ok 79 - Translation: MVAST* ok 80 - Translation: M* ok 81 - Translation: M ok 82 ok 83 - Translation: MWP ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 - Alphabet ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 - Bug 2438 ok 130 ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 ok 138 - Bug \#2864 ok 139 - Terminator + inside sequence ok 140 ok 141 - Length method ok 142 ok 143 ok 144 ok 145 ok 146 ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 ok 156 ok 157 ok 158 ok 159 ok 160 ok 161 - threw Regexp ((?^:.+)) ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 - threw Regexp ((?^:.+)) ok 174 - Validation ok 175 ok 176 ok 177 - threw Regexp ((?^:.+)) ok 178 ok 179 ok 180 - _find_orfs 1 ok 181 - orfs are sorted by descending length ok 182 - got correct -orf => "longest" seq ok 183 - _find_orfs 1 ok 184 - orfs are sorted by descending length ok 185 - got correct -orf => "longest" seq ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 ok 200 ok 201 ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 ok 211 ok 212 ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 ok 222 ok 223 ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 ok 233 ok 234 ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 ok 244 ok 245 ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 ok 255 ok 256 ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 ok 266 ok 267 ok 268 ok 269 ok 270 ok 271 ok 272 ok 273 ok 274 ok 275 ok 276 ok 277 ok 278 ok 279 ok 280 ok 281 ok 282 ok 283 ok 284 ok 285 ok 286 ok 287 ok t/Seq/PrimedSeq.t ...................... 1..65 ok 1 - use Bio::SeqIO; ok 2 - use Bio::Seq::PrimedSeq; ok 3 - Priming the target with sequence objects ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 13 ok 14 ok 15 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 - Priming the target with primer objects ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 - Priming the target with located primer objects ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok t/Seq/Quality.t ........................ 1..85 ok 1 - use Bio::Seq::Quality; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bug 2845 ok 73 ok 74 - Bug 2845 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok t/Seq/Seq.t ............................ 1..73 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::RichSeq; ok 3 - use Bio::SeqFeature::Generic; ok 4 - use Bio::Species; ok 5 - use Bio::Annotation::SimpleValue; ok 6 ok 7 - An object of class 'Bio::Seq' isa 'Bio::AnnotatableI' ok 8 ok 9 ok 10 ok 11 - truncated sequence length ok 12 - truncated sequence string ok 13 ok 14 ok 15 - alphabet ok 16 - id ok 17 - accession number ok 18 - subseq ok 19 - An object of class 'Bio::Seq' isa 'Bio::IdentifiableI' ok 20 - An object of class 'Bio::Seq' isa 'Bio::DescribableI' ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - translated sequence ok 35 - translated sequence with explicit unambiguous codons ok 36 - translated sequence with unknown unambiguous codons ok 37 - translated sequence with unknown unambiguous codons, completed ok 38 - translated sequence with unambiguous codons ok 39 - translated sequence with unambiguous codons ok 40 - translated sequence with unknown unambiguous codons, completed ok 41 - translated sequence with unambiguous codons ok 42 - translated sequence with unknown unambiguous codons, completed ok 43 - translated sequence with stop ok 44 - translated sequence ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 - Bug \#2864 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok t/Seq/SimulatedRead.t .................. 1..194 ok 1 - use Bio::Seq; ok 2 - use Bio::Seq::Quality; ok 3 - use Bio::PrimarySeq; ok 4 - use Bio::LocatableSeq; ok 5 - use Bio::Seq::SimulatedRead; ok 6 ok 7 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::SimulatedRead' ok 8 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::LocatableSeq' ok 9 - An object of class 'Bio::Seq::SimulatedRead' isa 'Bio::Seq::Quality' ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 ok 57 ok 58 ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 ok 79 ok 80 ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 ok 90 ok 91 ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 ok 101 ok 102 - redundant errors ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 ok 112 ok 113 ok 114 - errors() ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 ok 123 ok 124 ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 - track() ok 131 ok 132 ok 133 ok 134 ok 135 ok 136 ok 137 - qual_levels() ok 138 ok 139 - reference() ok 140 ok 141 - mid() ok 142 ok 143 ok 144 ok 145 - ACGT ok 146 ok 147 ok 148 ok 149 ok 150 - TTTAAA ok 151 ok 152 ok 153 ok 154 ok 155 - Bio::Seq::Quality ok 156 - Bio::Seq ok 157 - Bio::PrimarySeq ok 158 - Bio::LocatableSeq ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 ok 167 ok 168 ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 ok 178 ok 179 ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 ok 189 ok 190 ok 191 ok 192 ok 193 ok 194 ok t/Seq/WithQuality.t .................... 1..22 ok 1 - use Bio::Seq::SeqWithQuality; ok 2 - use Bio::PrimarySeq; ok 3 - use Bio::Seq::PrimaryQual; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::Seq::PrimaryQual' isa 'Bio::Seq::PrimaryQual' ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 21 ok 22 ok t/SeqEvolution.t ....................... 1..39 ok 1 - use Bio::SeqEvolution::Factory; ok 2 - use Bio::PrimarySeq; ok 3 ok 4 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint' ok 5 ok 6 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint' ok 7 ok 8 - An object of class 'Bio::SeqEvolution::DNAPoint' isa 'Bio::SeqEvolution::DNAPoint' ok 9 ok 10 ok 11 - get rate() ok 12 - get and set rate() ok 13 - identity() ok 14 - identity() ok 15 - pam() ok 16 - pam() ok 17 - mutation_count() ok 18 - mutation_count() ok 19 - seq_type() ok 20 - seq_type() ok 21 - next_seq() ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - each_mutation() ok 28 ok 29 ok 30 - get_alignment_identity() ok 31 ok 32 ok 33 - get_mutation_counter() ok 34 - get_sequence_counter() ok 35 - reset_sequence_counter() ok 36 - get_sequence_counter() == 0 ok 37 ok 38 ok 39 - An object of class 'Bio::SimpleAlign' isa 'Bio::SimpleAlign' ok t/SeqFeature/Amplicon.t ................ 1..21 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::Primer; ok 3 - use Bio::SeqFeature::Amplicon; ok 4 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::Amplicon' ok 5 - An object of class 'Bio::SeqFeature::Amplicon' isa 'Bio::SeqFeature::SubSeq' ok 6 ok 7 ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 16 ok 17 ok 18 ok 19 ok 20 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 21 ok t/SeqFeature/Clone.t ................... 1..17 ok 1 - clone() ok 2 - start() clone set ok 3 - start() clone get ok 4 - start() original unchanged ok 5 - clone() with arguments ok 6 - start() orig get ok 7 - end() orig get ok 8 - start() clone get ok 9 - end() clone get ok 10 - start() clone set ok 11 - start() clone get ok 12 - start() original unchanged ok 13 - location() Bio::Location::Split ok 14 - clone() ok 15 - start() clone set ok 16 - start() clone get ok 17 - start() original unchanged ok t/SeqFeature/Collection.t .............. 1..24 ok 1 - use Bio::SeqFeature::Collection; ok 2 - use Bio::Location::Simple; ok 3 - use Bio::Tools::GFF; ok 4 - use Bio::SeqIO; ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok t/SeqFeature/Computation.t ............. 1..12 ok 1 - use Bio::SeqFeature::Computation; ok 2 ok 3 - computation id ok 4 - score value ok 5 ok 6 ok 7 ok 8 - sft[0] is exon ok 9 ok 10 - computation id ok 11 ok 12 - score value ok t/SeqFeature/FeaturePair.t ............. 1..19 ok 1 - use Bio::SeqFeature::Generic; ok 2 - use Bio::SeqFeature::FeaturePair; ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 - feature1 of pair stored ok 9 - feature2 of pair stored ok 10 - feature start ok 11 - feature end ok 12 - primary tag ok 13 - source tag ok 14 - hstart ok 15 - hend ok 16 - hprimary tag ok 17 - hsource tag ok 18 ok 19 - inverted end ok t/SeqFeature/Gene.t .................... 1..28 ok 1 - use Bio::SeqIO; ok 2 - use Bio::SeqFeature::Gene::Transcript; ok 3 - use Bio::SeqFeature::Gene::UTR; ok 4 - use Bio::SeqFeature::Gene::Exon; ok 5 - use Bio::SeqFeature::Gene::Poly_A_site; ok 6 - use Bio::SeqFeature::Gene::GeneStructure; ok 7 - use Bio::Location::Fuzzy; ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 - mRNA spliced length ok 28 - has 2 UTRs ok t/SeqFeature/Generic.t ................. 1..362 ok 1 - use Bio::Seq; ok 2 - use Bio::SeqIO; ok 3 - use Bio::SeqFeature::Generic; ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 - Start of feature location ok 10 - End of feature location ok 11 - Primary tag ok 12 - Source tag ok 13 - Display name ok 14 - Undef phase by default ok 15 - Phase accessor returns ok 16 - Phase is persistent ok 17 ok 18 ok 19 - Set phase from constructor ok 20 ok 21 ok 22 - Start of first seqfeature ok 23 - End of first seqfeature ok 24 - Strand of first seqfeature ok 25 ok 26 - Sequence of first seqfeature ok 27 ok 28 ok 29 ok 30 - Start of second seqfeature ok 31 - End of second seqfeature ok 32 - Strand of second seqfeature ok 33 ok 34 - Sequence of second seqfeature ok 35 ok 36 ok 37 ok 38 - sfeat start for EXPAND-ED feature (bug \#947) ok 39 - sfeat end for EXPAND-ED feature (bug \#947) ok 40 ok 41 ok 42 - Can create feature starting and ending at 0 ok 43 ok 44 - Can create feature starting and ending at 0 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 55 ok 56 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 57 ok 58 # skip Network tests have not been requested ok 59 # skip Network tests have not been requested ok 60 # skip Network tests have not been requested ok 61 # skip Network tests have not been requested ok 62 # skip Network tests have not been requested ok 63 ok 64 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 65 ok 66 - An object of class 'Bio::Seq::RichSeq' isa 'Bio::Seq' ok 67 ok 68 # skip Network tests have not been requested ok 69 # skip Network tests have not been requested ok 70 ok 71 - An object of class 'Bio::SeqIO::genbank' isa 'Bio::SeqIO' ok 72 ok 73 ok 74 - spliced_seq translation matches expected ok 75 ok 76 - spliced_seq translation matches expected ok 77 ok 78 - spliced_seq translation matches expected ok 79 ok 80 - spliced_seq translation matches expected ok 81 ok 82 - spliced_seq translation matches expected ok 83 ok 84 - spliced_seq translation matches expected ok 85 ok 86 - spliced_seq translation matches expected ok 87 ok 88 - spliced_seq translation matches expected ok 89 ok 90 - spliced_seq translation matches expected ok 91 ok 92 - spliced_seq translation matches expected ok 93 ok 94 - spliced_seq translation matches expected ok 95 ok 96 - spliced_seq translation matches expected ok 97 ok 98 - spliced_seq translation matches expected ok 99 ok 100 - spliced_seq translation matches expected ok 101 ok 102 - spliced_seq translation matches expected ok 103 ok 104 - spliced_seq translation matches expected ok 105 ok 106 - spliced_seq translation matches expected ok 107 ok 108 - spliced_seq translation matches expected ok 109 ok 110 - spliced_seq translation matches expected ok 111 ok 112 - spliced_seq translation matches expected ok 113 ok 114 - spliced_seq translation matches expected ok 115 ok 116 - spliced_seq translation matches expected ok 117 ok 118 - spliced_seq translation matches expected ok 119 ok 120 - spliced_seq translation matches expected ok 121 ok 122 - spliced_seq translation matches expected ok 123 ok 124 - spliced_seq translation matches expected ok 125 ok 126 - spliced_seq translation matches expected ok 127 ok 128 - spliced_seq translation matches expected ok 129 ok 130 - spliced_seq translation matches expected ok 131 ok 132 - spliced_seq translation matches expected ok 133 ok 134 - spliced_seq translation matches expected ok 135 ok 136 - spliced_seq translation matches expected ok 137 ok 138 - spliced_seq translation matches expected ok 139 ok 140 - spliced_seq translation matches expected ok 141 ok 142 - spliced_seq translation matches expected ok 143 ok 144 - spliced_seq translation matches expected ok 145 ok 146 - spliced_seq translation matches expected ok 147 ok 148 - spliced_seq translation matches expected ok 149 ok 150 - spliced_seq translation matches expected ok 151 ok 152 - spliced_seq translation matches expected ok 153 ok 154 - spliced_seq translation matches expected ok 155 ok 156 - spliced_seq translation matches expected ok 157 ok 158 - spliced_seq translation matches expected ok 159 ok 160 - spliced_seq translation matches expected ok 161 ok 162 - spliced_seq translation matches expected ok 163 ok 164 - spliced_seq translation matches expected ok 165 ok 166 - spliced_seq translation matches expected ok 167 ok 168 - spliced_seq translation matches expected ok 169 ok 170 - spliced_seq translation matches expected ok 171 ok 172 - spliced_seq translation matches expected ok 173 ok 174 - spliced_seq translation matches expected ok 175 ok 176 - spliced_seq translation matches expected ok 177 ok 178 - spliced_seq translation matches expected ok 179 ok 180 - spliced_seq translation matches expected ok 181 ok 182 - spliced_seq translation matches expected ok 183 ok 184 - spliced_seq translation matches expected ok 185 ok 186 - spliced_seq translation matches expected ok 187 ok 188 - spliced_seq translation matches expected ok 189 ok 190 - spliced_seq translation matches expected ok 191 ok 192 - spliced_seq translation matches expected ok 193 ok 194 - spliced_seq translation matches expected ok 195 ok 196 - spliced_seq translation matches expected ok 197 ok 198 - spliced_seq translation matches expected ok 199 ok 200 - spliced_seq translation matches expected ok 201 ok 202 - spliced_seq translation matches expected ok 203 ok 204 - spliced_seq translation matches expected ok 205 ok 206 - spliced_seq translation matches expected ok 207 ok 208 - spliced_seq translation matches expected ok 209 ok 210 - spliced_seq translation matches expected ok 211 ok 212 - spliced_seq translation matches expected ok 213 ok 214 - spliced_seq translation matches expected ok 215 ok 216 - spliced_seq translation matches expected ok 217 ok 218 - spliced_seq translation matches expected ok 219 ok 220 - spliced_seq translation matches expected ok 221 ok 222 - spliced_seq translation matches expected ok 223 ok 224 - spliced_seq translation matches expected ok 225 ok 226 - spliced_seq translation matches expected ok 227 ok 228 - spliced_seq translation matches expected ok 229 ok 230 - spliced_seq translation matches expected ok 231 ok 232 - spliced_seq translation matches expected ok 233 ok 234 - spliced_seq translation matches expected ok 235 ok 236 - spliced_seq translation matches expected ok 237 ok 238 - spliced_seq translation matches expected ok 239 ok 240 - spliced_seq translation matches expected ok 241 ok 242 - spliced_seq translation matches expected ok 243 ok 244 - spliced_seq translation matches expected ok 245 ok 246 - spliced_seq translation matches expected ok 247 ok 248 - spliced_seq translation matches expected ok 249 ok 250 - spliced_seq translation matches expected ok 251 ok 252 - spliced_seq translation matches expected ok 253 ok 254 - spliced_seq translation matches expected ok 255 ok 256 - spliced_seq translation matches expected ok 257 ok 258 - spliced_seq translation matches expected ok 259 ok 260 - spliced_seq translation matches expected ok 261 ok 262 - spliced_seq translation matches expected ok 263 ok 264 - spliced_seq translation matches expected ok 265 ok 266 - spliced_seq translation matches expected ok 267 ok 268 - spliced_seq translation matches expected ok 269 ok 270 - spliced_seq translation matches expected ok 271 ok 272 - spliced_seq translation matches expected ok 273 ok 274 - spliced_seq translation matches expected ok 275 ok 276 - spliced_seq translation matches expected ok 277 ok 278 - spliced_seq translation matches expected ok 279 ok 280 - spliced_seq translation matches expected ok 281 ok 282 - spliced_seq translation matches expected ok 283 ok 284 - spliced_seq translation matches expected ok 285 ok 286 - spliced_seq translation matches expected ok 287 ok 288 - spliced_seq translation matches expected ok 289 ok 290 - spliced_seq translation matches expected ok 291 ok 292 - spliced_seq translation matches expected ok 293 ok 294 - spliced_seq translation matches expected ok 295 ok 296 - spliced_seq translation matches expected ok 297 ok 298 - spliced_seq translation matches expected ok 299 ok 300 - spliced_seq translation matches expected ok 301 ok 302 - spliced_seq translation matches expected ok 303 ok 304 - spliced_seq translation matches expected ok 305 ok 306 - spliced_seq translation matches expected ok 307 ok 308 ok 309 ok 310 ok 311 ok 312 - phase check ok 313 ok 314 ok 315 - phase check ok 316 ok 317 ok 318 - phase check ok 319 ok 320 ok 321 - phase check ok 322 ok 323 ok 324 - phase check ok 325 ok 326 ok 327 ok 328 - Tags found ok 329 - get_tagset_values tag values found ok 330 - get_tagset_values tag values for multiple tags found ok 331 - get_tag_values tag values found ok 332 - get_tag_values lives with tag ok 333 - get_tagset_values no tag values found ok 334 - get_tagset_values lives with no tag ok 335 - get_tag_values throws with no tag ok 336 - Phi-X174 genome is circular ok 337 ok 338 - Only 3 split locations ok 339 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 340 ok 341 - Feature string ok 342 - First ten nucleotides ok 343 - Strand ok 344 - Start ok 345 - End ok 346 - Expected length ok 347 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 348 ok 349 - Feature string ok 350 - First ten nucleotides ok 351 - Strand ok 352 - Start ok 353 - End ok 354 - Expected length ok 355 - An object of class 'Bio::Location::Split' isa 'Bio::Location::SplitLocationI' ok 356 ok 357 - Feature string ok 358 - First ten nucleotides ok 359 - Strand ok 360 - Start ok 361 - End ok 362 - Expected length ok t/SeqFeature/Location.t ................ 1..103 ok 1 - use Bio::Location::Simple; ok 2 - use Bio::Location::Split; ok 3 - use Bio::Location::Fuzzy; ok 4 - use Bio::SeqFeature::Generic; ok 5 - use Bio::SeqFeature::SimilarityPair; ok 6 - use Bio::SeqFeature::FeaturePair; ok 7 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 8 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI' ok 9 - Bio::Location::Simple tests ok 10 ok 11 ok 12 ok 13 ok 14 - 'Bio::SeqFeature::Generic' isa 'Bio::SeqFeatureI' ok 15 - An object of class 'Bio::SeqFeature::Generic' isa 'Bio::RangeI' ok 16 ok 17 ok 18 - Bio::SeqFeature::FeaturePair tests ok 19 ok 20 ok 21 ok 22 - Bio::SeqFeature::Generic tests ok 23 ok 24 - Bio::Location::Fuzzy tests ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 - Bio::Location::Split tests ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 ok 46 ok 47 ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 - Bugfix 1074 ok 56 ok 57 ok 58 ok 59 - Positive length ok 60 ok 61 - seq_id() on Bio::Location::Split ok 62 ok 63 ok 64 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 65 - An object of class 'Bio::Location::Simple' isa 'Bio::RangeI' ok 66 - Bio::Location::Simple EXACT ok 67 ok 68 ok 69 ok 70 ok 71 ok 72 - Bio::Location::Simple IN-BETWEEN ok 73 ok 74 ok 75 ok 76 ok 77 - Testing error handling ok 78 ok 79 ok 80 ok 81 - use Bio::Location::WidestCoordPolicy; ok 82 - use Bio::Location::NarrowestCoordPolicy; ok 83 - use Bio::Location::AvWithinCoordPolicy; ok 84 - Default coodinate policy ok 85 ok 86 ok 87 ok 88 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy' ok 89 - Narrowest coodinate policy ok 90 ok 91 ok 92 ok 93 - An object of class 'Bio::Location::NarrowestCoordPolicy' isa 'Bio::Location::NarrowestCoordPolicy' ok 94 - Average coodinate policy ok 95 ok 96 ok 97 ok 98 - An object of class 'Bio::Location::AvWithinCoordPolicy' isa 'Bio::Location::AvWithinCoordPolicy' ok 99 - Widest coodinate policy ok 100 ok 101 ok 102 ok 103 - An object of class 'Bio::Location::WidestCoordPolicy' isa 'Bio::Location::WidestCoordPolicy' ok t/SeqFeature/LocationFactory.t ......... 1..272 ok 1 - use Bio::Factory::FTLocationFactory; ok 2 - An object of class 'Bio::Factory::FTLocationFactory' isa 'Bio::Factory::LocationFactoryI' ok 3 - Bio::Location::Fuzzy ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 - Location String: complement(34..(122.126)) ok 13 ok 14 - Bio::Location::Fuzzy ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 - Location String: (102.110) ok 24 ok 25 - Bio::Location::Fuzzy ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 - Location String: (23.45)..600 ok 35 ok 36 - Bio::Location::Simple ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - Location String: 123^124 ok 46 ok 47 - Bio::Location::Fuzzy ok 48 ok 49 ok 50 ok 51 ok 52 ok 53 ok 54 ok 55 ok 56 - Location String: 1..? ok 57 ok 58 - Bio::Location::Fuzzy ok 59 ok 60 ok 61 ok 62 ok 63 ok 64 ok 65 ok 66 ok 67 - Location String: ?22..?64 ok 68 ok 69 - Bio::Location::Fuzzy ok 70 ok 71 ok 72 ok 73 ok 74 ok 75 ok 76 ok 77 ok 78 - Location String: ?..>393 ok 79 ok 80 - Bio::Location::Simple ok 81 ok 82 ok 83 ok 84 ok 85 ok 86 ok 87 ok 88 ok 89 - Location String: J00194:100..202 ok 90 ok 91 - Bio::Location::Fuzzy ok 92 ok 93 ok 94 ok 95 ok 96 ok 97 ok 98 ok 99 ok 100 - Location String: <345..500 ok 101 ok 102 - Bio::Location::Fuzzy ok 103 ok 104 ok 105 ok 106 ok 107 ok 108 ok 109 ok 110 ok 111 - Location String: <1..? ok 112 ok 113 - Bio::Location::Fuzzy ok 114 ok 115 ok 116 ok 117 ok 118 ok 119 ok 120 ok 121 ok 122 - Location String: <1..888 ok 123 ok 124 - Bio::Location::Fuzzy ok 125 ok 126 ok 127 ok 128 ok 129 ok 130 ok 131 ok 132 ok 133 - Location String: ?..? ok 134 ok 135 - Bio::Location::Fuzzy ok 136 ok 137 ok 138 ok 139 ok 140 ok 141 ok 142 ok 143 ok 144 - Location String: (122.133)..(204.221) ok 145 ok 146 - Bio::Location::Split ok 147 ok 148 ok 149 ok 150 ok 151 ok 152 ok 153 ok 154 ok 155 - Location String: complement(join(4918..5163,2691..4571)) ok 156 ok 157 - Bio::Location::Fuzzy ok 158 ok 159 ok 160 ok 161 ok 162 ok 163 ok 164 ok 165 ok 166 - Location String: (122.133)..(204.221) ok 167 ok 168 - Bio::Location::Fuzzy ok 169 ok 170 ok 171 ok 172 ok 173 ok 174 ok 175 ok 176 ok 177 - Location String: 145^177 ok 178 ok 179 - Bio::Location::Fuzzy ok 180 ok 181 ok 182 ok 183 ok 184 ok 185 ok 186 ok 187 ok 188 - Location String: 22..?64 ok 189 ok 190 - Bio::Location::Simple ok 191 ok 192 ok 193 ok 194 ok 195 ok 196 ok 197 ok 198 ok 199 - Location String: J00194:100..202 ok 200 ok 201 - Bio::Location::Split ok 202 ok 203 ok 204 ok 205 ok 206 ok 207 ok 208 ok 209 ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599) ok 211 ok 212 - Bio::Location::Fuzzy ok 213 ok 214 ok 215 ok 216 ok 217 ok 218 ok 219 ok 220 ok 221 - Location String: ?2465..2774 ok 222 ok 223 - Bio::Location::Split ok 224 ok 225 ok 226 ok 227 ok 228 ok 229 ok 230 ok 231 ok 232 - Location String: join(12..78,134..202) ok 233 ok 234 - Bio::Location::Simple ok 235 ok 236 ok 237 ok 238 ok 239 ok 240 ok 241 ok 242 ok 243 - Location String: 467 ok 244 ok 245 - Bio::Location::Simple ok 246 ok 247 ok 248 ok 249 ok 250 ok 251 ok 252 ok 253 ok 254 - Location String: 340..565 ok 255 ok 256 - Bio::Location::Fuzzy ok 257 ok 258 ok 259 ok 260 ok 261 ok 262 ok 263 ok 264 ok 265 - Location String: ?..536 ok 266 ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294))) ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081))) ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669))) ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672))) ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000) ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19)) ok t/SeqFeature/Primer.t .................. 1..47 ok 1 - use Bio::SeqFeature::Primer; ok 2 - use Bio::PrimarySeq; ok 3 - Implied primer sequence ok 4 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 5 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::SubSeq' ok 6 ok 7 ok 8 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 9 ok 10 - PrimarySeq primer ok 11 ok 12 ok 13 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeqI' ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 - An object of class 'Bio::Location::Simple' isa 'Bio::LocationI' ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 42 ok 43 ok 44 - An object of class 'Bio::SeqFeature::Primer' isa 'Bio::SeqFeature::Primer' ok 45 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 46 ok 47 ok t/SeqFeature/Range.t ................... 1..49 ok 1 - use Bio::Range; ok 2 - 'BioRange object' isa 'Bio::Range' ok 3 ok 4 - 'BioRange object' isa 'Bio::Range' ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 - 'BioRange object' isa 'Bio::Range' ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - 'BioRange object' isa 'Bio::Range' ok 26 - 'BioRange object' isa 'Bio::Range' ok 27 - 'BioRange object' isa 'Bio::Range' ok 28 - 1 & -1 ok 29 - 1 & 1 true ok 30 - 1 & 0 true ok 31 - 1 & -1 false ok 32 - 1 & 1 true ok 33 - 1 & 0 false ok 34 - 1 & -1 false ok 35 ok 36 ok 37 ok 38 ok 39 ok 40 ok 41 ok 42 ok 43 ok 44 ok 45 - 'Bio::Range object' isa 'Bio::Range' ok 46 ok 47 ok 48 ok 49 ok t/SeqFeature/RangeI.t .................. 1..45 ok 1 - use Bio::SeqFeature::Generic; ok 2 ok 3 ok 4 ok 5 ok 6 ok 7 ok 8 ok 9 ok 10 ok 11 ok 12 ok 13 ok 14 ok 15 ok 16 ok 17 ok 18 ok 19 ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 ok 26 ok 27 ok 28 ok 29 ok 30 ok 31 ok 32 ok 33 ok 34 ok 35 ok 36 ok 37 ok 38 ok 39 - subtract() of split features ok 40 - 0 start ok 41 - 0 end ok 42 - 1 start ok 43 - 1 end ok 44 - 2 start ok 45 - 2 end ok t/SeqFeature/SeqAnalysisParser.t ....... 1..14 ok 1 - use Bio::Factory::SeqAnalysisParserFactory; ok 2 - use Bio::SeqIO; ok 3 - An object of class 'Bio::SeqIO::fasta' isa 'Bio::SeqIO' ok 4 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 5 - An object of class 'Bio::Tools::Genscan' isa 'Bio::SeqAnalysisParserI' ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::Seq' isa 'Bio::PrimarySeqI' ok 10 - An object of class 'Bio::Tools::MZEF' isa 'Bio::SeqAnalysisParserI' ok 11 ok 12 ok 13 - An object of class 'Bio::Tools::EPCR' isa 'Bio::SeqAnalysisParserI' ok 14 ok t/SeqFeature/SubSeq.t .................. 1..37 ok 1 - use Bio::PrimarySeq; ok 2 - use Bio::SeqFeature::SubSeq; ok 3 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::SubSeq' ok 4 - An object of class 'Bio::SeqFeature::SubSeq' isa 'Bio::SeqFeature::Generic' ok 5 ok 6 ok 7 ok 8 ok 9 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 10 ok 11 ok 12 ok 13 ok 14 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 15 ok 16 ok 17 ok 18 ok 19 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 20 ok 21 ok 22 ok 23 ok 24 ok 25 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 26 ok 27 ok 28 ok 29 ok 30 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 31 ok 32 ok 33 ok 34 ok 35 - An object of class 'Bio::PrimarySeq' isa 'Bio::PrimarySeq' ok 36 ok 37 ok Timeout (max run time is 300s) /home/fly1800/ap1800-297235/bin/perl-static killed by signal 15.