PATH=/home/fly1600/bin:/usr/local/bin:/usr/bin:/usr/X11R6/bin:/bin:/usr/games:/opt/gnome2/bin:/opt/gnome/bin:/opt/kde3/bin:/usr/lib/java/jre/bin:/opt/gnome/bin
Start 2012-08-07T05:46:00
ActivePerl-1600 CPAN-1.9402
Going to read '/home/fly1600/var/cpan/Metadata'
Database was generated on Sat, 04 Aug 2012 21:39:03 GMT
Running make for C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz
Checksum for /net/nas/data/cpan/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz ok
BioPerl-1.6.901
BioPerl-1.6.901/AUTHORS
BioPerl-1.6.901/BioPerl.pm
BioPerl-1.6.901/BUGS
BioPerl-1.6.901/Build.PL
BioPerl-1.6.901/Changes
BioPerl-1.6.901/DEPENDENCIES
BioPerl-1.6.901/DEPRECATED
BioPerl-1.6.901/INSTALL
BioPerl-1.6.901/INSTALL.SKIP
BioPerl-1.6.901/INSTALL.WIN
BioPerl-1.6.901/LICENSE
BioPerl-1.6.901/MANIFEST
BioPerl-1.6.901/META.json
BioPerl-1.6.901/META.yml
BioPerl-1.6.901/README
BioPerl-1.6.901/Bio
BioPerl-1.6.901/Bio/AlignIO.pm
BioPerl-1.6.901/Bio/AnalysisI.pm
BioPerl-1.6.901/Bio/AnalysisParserI.pm
BioPerl-1.6.901/Bio/AnalysisResultI.pm
BioPerl-1.6.901/Bio/AnnotatableI.pm
BioPerl-1.6.901/Bio/AnnotationCollectionI.pm
BioPerl-1.6.901/Bio/AnnotationI.pm
BioPerl-1.6.901/Bio/Biblio.pm
BioPerl-1.6.901/Bio/ClusterI.pm
BioPerl-1.6.901/Bio/ClusterIO.pm
BioPerl-1.6.901/Bio/DasI.pm
BioPerl-1.6.901/Bio/DBLinkContainerI.pm
BioPerl-1.6.901/Bio/DescribableI.pm
BioPerl-1.6.901/Bio/FeatureHolderI.pm
BioPerl-1.6.901/Bio/FeatureIO.pm
BioPerl-1.6.901/Bio/HandlerBaseI.pm
BioPerl-1.6.901/Bio/IdCollectionI.pm
BioPerl-1.6.901/Bio/IdentifiableI.pm
BioPerl-1.6.901/Bio/LocatableSeq.pm
BioPerl-1.6.901/Bio/LocationI.pm
BioPerl-1.6.901/Bio/MapIO.pm
BioPerl-1.6.901/Bio/NexmlIO.pm
BioPerl-1.6.901/Bio/OntologyIO.pm
BioPerl-1.6.901/Bio/ParameterBaseI.pm
BioPerl-1.6.901/Bio/Perl.pm
BioPerl-1.6.901/Bio/PhyloNetwork.pm
BioPerl-1.6.901/Bio/PrimarySeq.pm
BioPerl-1.6.901/Bio/PrimarySeqI.pm
BioPerl-1.6.901/Bio/PullParserI.pm
BioPerl-1.6.901/Bio/Range.pm
BioPerl-1.6.901/Bio/RangeI.pm
BioPerl-1.6.901/Bio/SearchDist.pm
BioPerl-1.6.901/Bio/SearchIO.pm
BioPerl-1.6.901/Bio/Seq.pm
BioPerl-1.6.901/Bio/SeqAnalysisParserI.pm
BioPerl-1.6.901/Bio/SeqFeatureI.pm
BioPerl-1.6.901/Bio/SeqI.pm
BioPerl-1.6.901/Bio/SeqIO.pm
BioPerl-1.6.901/Bio/SeqUtils.pm
BioPerl-1.6.901/Bio/SimpleAlign.pm
BioPerl-1.6.901/Bio/SimpleAnalysisI.pm
BioPerl-1.6.901/Bio/Species.pm
BioPerl-1.6.901/Bio/Taxon.pm
BioPerl-1.6.901/Bio/Taxonomy.pm
BioPerl-1.6.901/Bio/TreeIO.pm
BioPerl-1.6.901/Bio/UpdateableSeqI.pm
BioPerl-1.6.901/Bio/WebAgent.pm
BioPerl-1.6.901/Bio/Align
BioPerl-1.6.901/Bio/Align/AlignI.pm
BioPerl-1.6.901/Bio/Align/DNAStatistics.pm
BioPerl-1.6.901/Bio/Align/Graphics.pm
BioPerl-1.6.901/Bio/Align/PairwiseStatistics.pm
BioPerl-1.6.901/Bio/Align/ProteinStatistics.pm
BioPerl-1.6.901/Bio/Align/StatisticsI.pm
BioPerl-1.6.901/Bio/Align/Utilities.pm
BioPerl-1.6.901/Bio/AlignIO
BioPerl-1.6.901/Bio/AlignIO/arp.pm
BioPerl-1.6.901/Bio/AlignIO/bl2seq.pm
BioPerl-1.6.901/Bio/AlignIO/clustalw.pm
BioPerl-1.6.901/Bio/AlignIO/emboss.pm
BioPerl-1.6.901/Bio/AlignIO/fasta.pm
BioPerl-1.6.901/Bio/AlignIO/largemultifasta.pm
BioPerl-1.6.901/Bio/AlignIO/maf.pm
BioPerl-1.6.901/Bio/AlignIO/mase.pm
BioPerl-1.6.901/Bio/AlignIO/mega.pm
BioPerl-1.6.901/Bio/AlignIO/meme.pm
BioPerl-1.6.901/Bio/AlignIO/metafasta.pm
BioPerl-1.6.901/Bio/AlignIO/msf.pm
BioPerl-1.6.901/Bio/AlignIO/nexml.pm
BioPerl-1.6.901/Bio/AlignIO/nexus.pm
BioPerl-1.6.901/Bio/AlignIO/pfam.pm
BioPerl-1.6.901/Bio/AlignIO/phylip.pm
BioPerl-1.6.901/Bio/AlignIO/po.pm
BioPerl-1.6.901/Bio/AlignIO/proda.pm
BioPerl-1.6.901/Bio/AlignIO/prodom.pm
BioPerl-1.6.901/Bio/AlignIO/psi.pm
BioPerl-1.6.901/Bio/AlignIO/selex.pm
BioPerl-1.6.901/Bio/AlignIO/stockholm.pm
BioPerl-1.6.901/Bio/AlignIO/xmfa.pm
BioPerl-1.6.901/Bio/AlignIO/Handler
BioPerl-1.6.901/Bio/AlignIO/Handler/GenericAlignHandler.pm
BioPerl-1.6.901/Bio/Annotation
BioPerl-1.6.901/Bio/Annotation/AnnotationFactory.pm
BioPerl-1.6.901/Bio/Annotation/Collection.pm
BioPerl-1.6.901/Bio/Annotation/Comment.pm
BioPerl-1.6.901/Bio/Annotation/DBLink.pm
BioPerl-1.6.901/Bio/Annotation/OntologyTerm.pm
BioPerl-1.6.901/Bio/Annotation/Reference.pm
BioPerl-1.6.901/Bio/Annotation/Relation.pm
BioPerl-1.6.901/Bio/Annotation/SimpleValue.pm
BioPerl-1.6.901/Bio/Annotation/StructuredValue.pm
BioPerl-1.6.901/Bio/Annotation/TagTree.pm
BioPerl-1.6.901/Bio/Annotation/Target.pm
BioPerl-1.6.901/Bio/Annotation/Tree.pm
BioPerl-1.6.901/Bio/Annotation/TypeManager.pm
BioPerl-1.6.901/Bio/Assembly
BioPerl-1.6.901/Bio/Assembly/Contig.pm
BioPerl-1.6.901/Bio/Assembly/ContigAnalysis.pm
BioPerl-1.6.901/Bio/Assembly/IO.pm
BioPerl-1.6.901/Bio/Assembly/Scaffold.pm
BioPerl-1.6.901/Bio/Assembly/ScaffoldI.pm
BioPerl-1.6.901/Bio/Assembly/Singlet.pm
BioPerl-1.6.901/Bio/Assembly/IO
BioPerl-1.6.901/Bio/Assembly/IO/ace.pm
BioPerl-1.6.901/Bio/Assembly/IO/bowtie.pm
BioPerl-1.6.901/Bio/Assembly/IO/maq.pm
BioPerl-1.6.901/Bio/Assembly/IO/phrap.pm
BioPerl-1.6.901/Bio/Assembly/IO/sam.pm
BioPerl-1.6.901/Bio/Assembly/IO/tigr.pm
BioPerl-1.6.901/Bio/Assembly/Tools
BioPerl-1.6.901/Bio/Assembly/Tools/ContigSpectrum.pm
BioPerl-1.6.901/Bio/Biblio
BioPerl-1.6.901/Bio/Biblio/Article.pm
BioPerl-1.6.901/Bio/Biblio/BiblioBase.pm
BioPerl-1.6.901/Bio/Biblio/Book.pm
BioPerl-1.6.901/Bio/Biblio/BookArticle.pm
BioPerl-1.6.901/Bio/Biblio/IO.pm
BioPerl-1.6.901/Bio/Biblio/Journal.pm
BioPerl-1.6.901/Bio/Biblio/JournalArticle.pm
BioPerl-1.6.901/Bio/Biblio/MedlineArticle.pm
BioPerl-1.6.901/Bio/Biblio/MedlineBook.pm
BioPerl-1.6.901/Bio/Biblio/MedlineBookArticle.pm
BioPerl-1.6.901/Bio/Biblio/MedlineJournal.pm
BioPerl-1.6.901/Bio/Biblio/MedlineJournalArticle.pm
BioPerl-1.6.901/Bio/Biblio/Organisation.pm
BioPerl-1.6.901/Bio/Biblio/Patent.pm
BioPerl-1.6.901/Bio/Biblio/Person.pm
BioPerl-1.6.901/Bio/Biblio/Proceeding.pm
BioPerl-1.6.901/Bio/Biblio/Provider.pm
BioPerl-1.6.901/Bio/Biblio/PubmedArticle.pm
BioPerl-1.6.901/Bio/Biblio/PubmedBookArticle.pm
BioPerl-1.6.901/Bio/Biblio/PubmedJournalArticle.pm
BioPerl-1.6.901/Bio/Biblio/Ref.pm
BioPerl-1.6.901/Bio/Biblio/Service.pm
BioPerl-1.6.901/Bio/Biblio/TechReport.pm
BioPerl-1.6.901/Bio/Biblio/Thesis.pm
BioPerl-1.6.901/Bio/Biblio/WebResource.pm
BioPerl-1.6.901/Bio/Biblio/IO
BioPerl-1.6.901/Bio/Biblio/IO/medline2ref.pm
BioPerl-1.6.901/Bio/Biblio/IO/medlinexml.pm
BioPerl-1.6.901/Bio/Biblio/IO/pubmed2ref.pm
BioPerl-1.6.901/Bio/Biblio/IO/pubmedxml.pm
BioPerl-1.6.901/Bio/Cluster
BioPerl-1.6.901/Bio/Cluster/ClusterFactory.pm
BioPerl-1.6.901/Bio/Cluster/FamilyI.pm
BioPerl-1.6.901/Bio/Cluster/SequenceFamily.pm
BioPerl-1.6.901/Bio/Cluster/UniGene.pm
BioPerl-1.6.901/Bio/Cluster/UniGeneI.pm
BioPerl-1.6.901/Bio/ClusterIO
BioPerl-1.6.901/Bio/ClusterIO/dbsnp.pm
BioPerl-1.6.901/Bio/ClusterIO/unigene.pm
BioPerl-1.6.901/Bio/CodonUsage
BioPerl-1.6.901/Bio/CodonUsage/IO.pm
BioPerl-1.6.901/Bio/CodonUsage/Table.pm
BioPerl-1.6.901/Bio/Coordinate
BioPerl-1.6.901/Bio/Coordinate/Chain.pm
BioPerl-1.6.901/Bio/Coordinate/Collection.pm
BioPerl-1.6.901/Bio/Coordinate/ExtrapolatingPair.pm
BioPerl-1.6.901/Bio/Coordinate/GeneMapper.pm
BioPerl-1.6.901/Bio/Coordinate/Graph.pm
BioPerl-1.6.901/Bio/Coordinate/MapperI.pm
BioPerl-1.6.901/Bio/Coordinate/Pair.pm
BioPerl-1.6.901/Bio/Coordinate/Result.pm
BioPerl-1.6.901/Bio/Coordinate/ResultI.pm
BioPerl-1.6.901/Bio/Coordinate/Utils.pm
BioPerl-1.6.901/Bio/Coordinate/Result
BioPerl-1.6.901/Bio/Coordinate/Result/Gap.pm
BioPerl-1.6.901/Bio/Coordinate/Result/Match.pm
BioPerl-1.6.901/Bio/Das
BioPerl-1.6.901/Bio/Das/FeatureTypeI.pm
BioPerl-1.6.901/Bio/Das/SegmentI.pm
BioPerl-1.6.901/Bio/DB
BioPerl-1.6.901/Bio/DB/Ace.pm
BioPerl-1.6.901/Bio/DB/BiblioI.pm
BioPerl-1.6.901/Bio/DB/BioFetch.pm
BioPerl-1.6.901/Bio/DB/CUTG.pm
BioPerl-1.6.901/Bio/DB/DBFetch.pm
BioPerl-1.6.901/Bio/DB/EMBL.pm
BioPerl-1.6.901/Bio/DB/EntrezGene.pm
BioPerl-1.6.901/Bio/DB/EUtilities.pm
BioPerl-1.6.901/Bio/DB/Expression.pm
BioPerl-1.6.901/Bio/DB/Failover.pm
BioPerl-1.6.901/Bio/DB/Fasta.pm
BioPerl-1.6.901/Bio/DB/FileCache.pm
BioPerl-1.6.901/Bio/DB/Flat.pm
BioPerl-1.6.901/Bio/DB/GenBank.pm
BioPerl-1.6.901/Bio/DB/GenericWebAgent.pm
BioPerl-1.6.901/Bio/DB/GenPept.pm
BioPerl-1.6.901/Bio/DB/GFF.pm
BioPerl-1.6.901/Bio/DB/HIV.pm
BioPerl-1.6.901/Bio/DB/InMemoryCache.pm
BioPerl-1.6.901/Bio/DB/LocationI.pm
BioPerl-1.6.901/Bio/DB/MeSH.pm
BioPerl-1.6.901/Bio/DB/NCBIHelper.pm
BioPerl-1.6.901/Bio/DB/Qual.pm
BioPerl-1.6.901/Bio/DB/QueryI.pm
BioPerl-1.6.901/Bio/DB/RandomAccessI.pm
BioPerl-1.6.901/Bio/DB/ReferenceI.pm
BioPerl-1.6.901/Bio/DB/RefSeq.pm
BioPerl-1.6.901/Bio/DB/Registry.pm
BioPerl-1.6.901/Bio/DB/SeqFeature.pm
BioPerl-1.6.901/Bio/DB/SeqHound.pm
BioPerl-1.6.901/Bio/DB/SeqI.pm
BioPerl-1.6.901/Bio/DB/SeqVersion.pm
BioPerl-1.6.901/Bio/DB/SwissProt.pm
BioPerl-1.6.901/Bio/DB/Taxonomy.pm
BioPerl-1.6.901/Bio/DB/TFBS.pm
BioPerl-1.6.901/Bio/DB/Universal.pm
BioPerl-1.6.901/Bio/DB/UpdateableSeqI.pm
BioPerl-1.6.901/Bio/DB/WebDBSeqI.pm
BioPerl-1.6.901/Bio/DB/Biblio
BioPerl-1.6.901/Bio/DB/Biblio/biofetch.pm
BioPerl-1.6.901/Bio/DB/Biblio/eutils.pm
BioPerl-1.6.901/Bio/DB/Biblio/soap.pm
BioPerl-1.6.901/Bio/DB/Expression
BioPerl-1.6.901/Bio/DB/Expression/geo.pm
BioPerl-1.6.901/Bio/DB/Flat
BioPerl-1.6.901/Bio/DB/Flat/BDB.pm
BioPerl-1.6.901/Bio/DB/Flat/BinarySearch.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB
BioPerl-1.6.901/Bio/DB/Flat/BDB/embl.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB/fasta.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB/genbank.pm
BioPerl-1.6.901/Bio/DB/Flat/BDB/swiss.pm
BioPerl-1.6.901/Bio/DB/GFF
BioPerl-1.6.901/Bio/DB/GFF/Aggregator.pm
BioPerl-1.6.901/Bio/DB/GFF/Featname.pm
BioPerl-1.6.901/Bio/DB/GFF/Feature.pm
BioPerl-1.6.901/Bio/DB/GFF/Homol.pm
BioPerl-1.6.901/Bio/DB/GFF/RelSegment.pm
BioPerl-1.6.901/Bio/DB/GFF/Segment.pm
BioPerl-1.6.901/Bio/DB/GFF/Typename.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/ace.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/berkeleydb.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/biofetch.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/biofetch_oracle.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/berkeleydb
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/caching_handle.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/iterator.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysql.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysqlace.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/oracle.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/oracleace.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/pg.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/dbi/pg_fts.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory/feature_serializer.pm
BioPerl-1.6.901/Bio/DB/GFF/Adaptor/memory/iterator.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/alignment.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/clone.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/coding.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/gene.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/match.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/none.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/orf.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/processed_transcript.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/so_transcript.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/transcript.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_acembly.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_ensgene.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_genscan.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_refgene.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_sanger22.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_softberry.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_twinscan.pm
BioPerl-1.6.901/Bio/DB/GFF/Aggregator/ucsc_unigene.pm
BioPerl-1.6.901/Bio/DB/GFF/Util
BioPerl-1.6.901/Bio/DB/GFF/Util/Binning.pm
BioPerl-1.6.901/Bio/DB/GFF/Util/Rearrange.pm
BioPerl-1.6.901/Bio/DB/HIV
BioPerl-1.6.901/Bio/DB/HIV/HIVAnnotProcessor.pm
BioPerl-1.6.901/Bio/DB/HIV/HIVQueryHelper.pm
BioPerl-1.6.901/Bio/DB/HIV/lanl-schema.xml
BioPerl-1.6.901/Bio/DB/Query
BioPerl-1.6.901/Bio/DB/Query/GenBank.pm
BioPerl-1.6.901/Bio/DB/Query/HIVQuery.pm
BioPerl-1.6.901/Bio/DB/Query/WebQuery.pm
BioPerl-1.6.901/Bio/DB/SeqFeature
BioPerl-1.6.901/Bio/DB/SeqFeature/NormalizedFeature.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/NormalizedFeatureI.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/NormalizedTableFeatureI.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Segment.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/bdb.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/berkeleydb.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/berkeleydb3.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/FeatureFileLoader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/GFF2Loader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/GFF3Loader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/Loader.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/LoadHelper.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/memory.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/Iterator.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/mysql.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/Pg.pm
BioPerl-1.6.901/Bio/DB/SeqFeature/Store/DBI/SQLite.pm
BioPerl-1.6.901/Bio/DB/SeqVersion
BioPerl-1.6.901/Bio/DB/SeqVersion/gi.pm
BioPerl-1.6.901/Bio/DB/Taxonomy
BioPerl-1.6.901/Bio/DB/Taxonomy/entrez.pm
BioPerl-1.6.901/Bio/DB/Taxonomy/flatfile.pm
BioPerl-1.6.901/Bio/DB/Taxonomy/list.pm
BioPerl-1.6.901/Bio/DB/TFBS
BioPerl-1.6.901/Bio/DB/TFBS/transfac_pro.pm
BioPerl-1.6.901/Bio/Draw
BioPerl-1.6.901/Bio/Draw/Pictogram.pm
BioPerl-1.6.901/Bio/Event
BioPerl-1.6.901/Bio/Event/EventGeneratorI.pm
BioPerl-1.6.901/Bio/Event/EventHandlerI.pm
BioPerl-1.6.901/Bio/Factory
BioPerl-1.6.901/Bio/Factory/AnalysisI.pm
BioPerl-1.6.901/Bio/Factory/ApplicationFactoryI.pm
BioPerl-1.6.901/Bio/Factory/DriverFactory.pm
BioPerl-1.6.901/Bio/Factory/FTLocationFactory.pm
BioPerl-1.6.901/Bio/Factory/LocationFactoryI.pm
BioPerl-1.6.901/Bio/Factory/MapFactoryI.pm
BioPerl-1.6.901/Bio/Factory/ObjectBuilderI.pm
BioPerl-1.6.901/Bio/Factory/ObjectFactory.pm
BioPerl-1.6.901/Bio/Factory/ObjectFactoryI.pm
BioPerl-1.6.901/Bio/Factory/SeqAnalysisParserFactory.pm
BioPerl-1.6.901/Bio/Factory/SeqAnalysisParserFactoryI.pm
BioPerl-1.6.901/Bio/Factory/SequenceFactoryI.pm
BioPerl-1.6.901/Bio/Factory/SequenceProcessorI.pm
BioPerl-1.6.901/Bio/Factory/SequenceStreamI.pm
BioPerl-1.6.901/Bio/Factory/TreeFactoryI.pm
BioPerl-1.6.901/Bio/FeatureIO
BioPerl-1.6.901/Bio/FeatureIO/bed.pm
BioPerl-1.6.901/Bio/FeatureIO/gff.pm
BioPerl-1.6.901/Bio/FeatureIO/gtf.pm
BioPerl-1.6.901/Bio/FeatureIO/interpro.pm
BioPerl-1.6.901/Bio/FeatureIO/ptt.pm
BioPerl-1.6.901/Bio/FeatureIO/vecscreen_simple.pm
BioPerl-1.6.901/Bio/Index
BioPerl-1.6.901/Bio/Index/Abstract.pm
BioPerl-1.6.901/Bio/Index/AbstractSeq.pm
BioPerl-1.6.901/Bio/Index/Blast.pm
BioPerl-1.6.901/Bio/Index/BlastTable.pm
BioPerl-1.6.901/Bio/Index/EMBL.pm
BioPerl-1.6.901/Bio/Index/Fasta.pm
BioPerl-1.6.901/Bio/Index/Fastq.pm
BioPerl-1.6.901/Bio/Index/GenBank.pm
BioPerl-1.6.901/Bio/Index/Hmmer.pm
BioPerl-1.6.901/Bio/Index/Qual.pm
BioPerl-1.6.901/Bio/Index/Stockholm.pm
BioPerl-1.6.901/Bio/Index/SwissPfam.pm
BioPerl-1.6.901/Bio/Index/Swissprot.pm
BioPerl-1.6.901/Bio/LiveSeq
BioPerl-1.6.901/Bio/LiveSeq/AARange.pm
BioPerl-1.6.901/Bio/LiveSeq/Chain.pm
BioPerl-1.6.901/Bio/LiveSeq/ChainI.pm
BioPerl-1.6.901/Bio/LiveSeq/DNA.pm
BioPerl-1.6.901/Bio/LiveSeq/Exon.pm
BioPerl-1.6.901/Bio/LiveSeq/Gene.pm
BioPerl-1.6.901/Bio/LiveSeq/Intron.pm
BioPerl-1.6.901/Bio/LiveSeq/Mutation.pm
BioPerl-1.6.901/Bio/LiveSeq/Mutator.pm
BioPerl-1.6.901/Bio/LiveSeq/Prim_Transcript.pm
BioPerl-1.6.901/Bio/LiveSeq/Range.pm
BioPerl-1.6.901/Bio/LiveSeq/Repeat_Region.pm
BioPerl-1.6.901/Bio/LiveSeq/Repeat_Unit.pm
BioPerl-1.6.901/Bio/LiveSeq/SeqI.pm
BioPerl-1.6.901/Bio/LiveSeq/Transcript.pm
BioPerl-1.6.901/Bio/LiveSeq/Translation.pm
BioPerl-1.6.901/Bio/LiveSeq/IO
BioPerl-1.6.901/Bio/LiveSeq/IO/BioPerl.pm
BioPerl-1.6.901/Bio/LiveSeq/IO/Loader.pm
BioPerl-1.6.901/Bio/LiveSeq/IO/README
BioPerl-1.6.901/Bio/Location
BioPerl-1.6.901/Bio/Location/Atomic.pm
BioPerl-1.6.901/Bio/Location/AvWithinCoordPolicy.pm
BioPerl-1.6.901/Bio/Location/CoordinatePolicyI.pm
BioPerl-1.6.901/Bio/Location/Fuzzy.pm
BioPerl-1.6.901/Bio/Location/FuzzyLocationI.pm
BioPerl-1.6.901/Bio/Location/NarrowestCoordPolicy.pm
BioPerl-1.6.901/Bio/Location/Simple.pm
BioPerl-1.6.901/Bio/Location/Split.pm
BioPerl-1.6.901/Bio/Location/SplitLocationI.pm
BioPerl-1.6.901/Bio/Location/WidestCoordPolicy.pm
BioPerl-1.6.901/Bio/Map
BioPerl-1.6.901/Bio/Map/Clone.pm
BioPerl-1.6.901/Bio/Map/Contig.pm
BioPerl-1.6.901/Bio/Map/CytoMap.pm
BioPerl-1.6.901/Bio/Map/CytoMarker.pm
BioPerl-1.6.901/Bio/Map/CytoPosition.pm
BioPerl-1.6.901/Bio/Map/EntityI.pm
BioPerl-1.6.901/Bio/Map/FPCMarker.pm
BioPerl-1.6.901/Bio/Map/Gene.pm
BioPerl-1.6.901/Bio/Map/GeneMap.pm
BioPerl-1.6.901/Bio/Map/GenePosition.pm
BioPerl-1.6.901/Bio/Map/GeneRelative.pm
BioPerl-1.6.901/Bio/Map/LinkageMap.pm
BioPerl-1.6.901/Bio/Map/LinkagePosition.pm
BioPerl-1.6.901/Bio/Map/MapI.pm
BioPerl-1.6.901/Bio/Map/Mappable.pm
BioPerl-1.6.901/Bio/Map/MappableI.pm
BioPerl-1.6.901/Bio/Map/Marker.pm
BioPerl-1.6.901/Bio/Map/MarkerI.pm
BioPerl-1.6.901/Bio/Map/Microsatellite.pm
BioPerl-1.6.901/Bio/Map/OrderedPosition.pm
BioPerl-1.6.901/Bio/Map/OrderedPositionWithDistance.pm
BioPerl-1.6.901/Bio/Map/Physical.pm
BioPerl-1.6.901/Bio/Map/Position.pm
BioPerl-1.6.901/Bio/Map/PositionHandler.pm
BioPerl-1.6.901/Bio/Map/PositionHandlerI.pm
BioPerl-1.6.901/Bio/Map/PositionI.pm
BioPerl-1.6.901/Bio/Map/PositionWithSequence.pm
BioPerl-1.6.901/Bio/Map/Prediction.pm
BioPerl-1.6.901/Bio/Map/Relative.pm
BioPerl-1.6.901/Bio/Map/RelativeI.pm
BioPerl-1.6.901/Bio/Map/SimpleMap.pm
BioPerl-1.6.901/Bio/Map/TranscriptionFactor.pm
BioPerl-1.6.901/Bio/MapIO
BioPerl-1.6.901/Bio/MapIO/fpc.pm
BioPerl-1.6.901/Bio/MapIO/mapmaker.pm
BioPerl-1.6.901/Bio/Matrix
BioPerl-1.6.901/Bio/Matrix/Generic.pm
BioPerl-1.6.901/Bio/Matrix/IO.pm
BioPerl-1.6.901/Bio/Matrix/MatrixI.pm
BioPerl-1.6.901/Bio/Matrix/Mlagan.pm
BioPerl-1.6.901/Bio/Matrix/PhylipDist.pm
BioPerl-1.6.901/Bio/Matrix/Scoring.pm
BioPerl-1.6.901/Bio/Matrix/IO
BioPerl-1.6.901/Bio/Matrix/IO/mlagan.pm
BioPerl-1.6.901/Bio/Matrix/IO/phylip.pm
BioPerl-1.6.901/Bio/Matrix/IO/scoring.pm
BioPerl-1.6.901/Bio/Matrix/PSM
BioPerl-1.6.901/Bio/Matrix/PSM/InstanceSite.pm
BioPerl-1.6.901/Bio/Matrix/PSM/InstanceSiteI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO.pm
BioPerl-1.6.901/Bio/Matrix/PSM/ProtMatrix.pm
BioPerl-1.6.901/Bio/Matrix/PSM/ProtPsm.pm
BioPerl-1.6.901/Bio/Matrix/PSM/Psm.pm
BioPerl-1.6.901/Bio/Matrix/PSM/PsmHeader.pm
BioPerl-1.6.901/Bio/Matrix/PSM/PsmHeaderI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/PsmI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/SiteMatrix.pm
BioPerl-1.6.901/Bio/Matrix/PSM/SiteMatrixI.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO
BioPerl-1.6.901/Bio/Matrix/PSM/IO/mast.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/masta.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/meme.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/psiblast.pm
BioPerl-1.6.901/Bio/Matrix/PSM/IO/transfac.pm
BioPerl-1.6.901/Bio/MolEvol
BioPerl-1.6.901/Bio/MolEvol/CodonModel.pm
BioPerl-1.6.901/Bio/Nexml
BioPerl-1.6.901/Bio/Nexml/Factory.pm
BioPerl-1.6.901/Bio/Ontology
BioPerl-1.6.901/Bio/Ontology/DocumentRegistry.pm
BioPerl-1.6.901/Bio/Ontology/GOterm.pm
BioPerl-1.6.901/Bio/Ontology/InterProTerm.pm
BioPerl-1.6.901/Bio/Ontology/OBOEngine.pm
BioPerl-1.6.901/Bio/Ontology/OBOterm.pm
BioPerl-1.6.901/Bio/Ontology/Ontology.pm
BioPerl-1.6.901/Bio/Ontology/OntologyEngineI.pm
BioPerl-1.6.901/Bio/Ontology/OntologyI.pm
BioPerl-1.6.901/Bio/Ontology/OntologyStore.pm
BioPerl-1.6.901/Bio/Ontology/Path.pm
BioPerl-1.6.901/Bio/Ontology/PathI.pm
BioPerl-1.6.901/Bio/Ontology/Relationship.pm
BioPerl-1.6.901/Bio/Ontology/RelationshipFactory.pm
BioPerl-1.6.901/Bio/Ontology/RelationshipI.pm
BioPerl-1.6.901/Bio/Ontology/RelationshipType.pm
BioPerl-1.6.901/Bio/Ontology/SimpleOntologyEngine.pm
BioPerl-1.6.901/Bio/Ontology/Term.pm
BioPerl-1.6.901/Bio/Ontology/TermFactory.pm
BioPerl-1.6.901/Bio/Ontology/TermI.pm
BioPerl-1.6.901/Bio/Ontology/SimpleGOEngine
BioPerl-1.6.901/Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
BioPerl-1.6.901/Bio/Ontology/SimpleGOEngine/GraphAdaptor02.pm
BioPerl-1.6.901/Bio/OntologyIO
BioPerl-1.6.901/Bio/OntologyIO/dagflat.pm
BioPerl-1.6.901/Bio/OntologyIO/goflat.pm
BioPerl-1.6.901/Bio/OntologyIO/InterProParser.pm
BioPerl-1.6.901/Bio/OntologyIO/obo.pm
BioPerl-1.6.901/Bio/OntologyIO/simplehierarchy.pm
BioPerl-1.6.901/Bio/OntologyIO/soflat.pm
BioPerl-1.6.901/Bio/OntologyIO/Handlers
BioPerl-1.6.901/Bio/OntologyIO/Handlers/BaseSAXHandler.pm
BioPerl-1.6.901/Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
BioPerl-1.6.901/Bio/OntologyIO/Handlers/InterProHandler.pm
BioPerl-1.6.901/Bio/Phenotype
BioPerl-1.6.901/Bio/Phenotype/Correlate.pm
BioPerl-1.6.901/Bio/Phenotype/Measure.pm
BioPerl-1.6.901/Bio/Phenotype/Phenotype.pm
BioPerl-1.6.901/Bio/Phenotype/PhenotypeI.pm
BioPerl-1.6.901/Bio/Phenotype/MeSH
BioPerl-1.6.901/Bio/Phenotype/MeSH/Term.pm
BioPerl-1.6.901/Bio/Phenotype/MeSH/Twig.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM
BioPerl-1.6.901/Bio/Phenotype/OMIM/MiniMIMentry.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM/OMIMentry.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm
BioPerl-1.6.901/Bio/Phenotype/OMIM/OMIMparser.pm
BioPerl-1.6.901/Bio/PhyloNetwork
BioPerl-1.6.901/Bio/PhyloNetwork/Factory.pm
BioPerl-1.6.901/Bio/PhyloNetwork/FactoryX.pm
BioPerl-1.6.901/Bio/PhyloNetwork/GraphViz.pm
BioPerl-1.6.901/Bio/PhyloNetwork/muVector.pm
BioPerl-1.6.901/Bio/PhyloNetwork/RandomFactory.pm
BioPerl-1.6.901/Bio/PhyloNetwork/TreeFactory.pm
BioPerl-1.6.901/Bio/PhyloNetwork/TreeFactoryMulti.pm
BioPerl-1.6.901/Bio/PhyloNetwork/TreeFactoryX.pm
BioPerl-1.6.901/Bio/PopGen
BioPerl-1.6.901/Bio/PopGen/Genotype.pm
BioPerl-1.6.901/Bio/PopGen/GenotypeI.pm
BioPerl-1.6.901/Bio/PopGen/HtSNP.pm
BioPerl-1.6.901/Bio/PopGen/Individual.pm
BioPerl-1.6.901/Bio/PopGen/IndividualI.pm
BioPerl-1.6.901/Bio/PopGen/IO.pm
BioPerl-1.6.901/Bio/PopGen/Marker.pm
BioPerl-1.6.901/Bio/PopGen/MarkerI.pm
BioPerl-1.6.901/Bio/PopGen/PopStats.pm
BioPerl-1.6.901/Bio/PopGen/Population.pm
BioPerl-1.6.901/Bio/PopGen/PopulationI.pm
BioPerl-1.6.901/Bio/PopGen/Statistics.pm
BioPerl-1.6.901/Bio/PopGen/TagHaplotype.pm
BioPerl-1.6.901/Bio/PopGen/Utilities.pm
BioPerl-1.6.901/Bio/PopGen/IO
BioPerl-1.6.901/Bio/PopGen/IO/csv.pm
BioPerl-1.6.901/Bio/PopGen/IO/hapmap.pm
BioPerl-1.6.901/Bio/PopGen/IO/phase.pm
BioPerl-1.6.901/Bio/PopGen/IO/prettybase.pm
BioPerl-1.6.901/Bio/PopGen/Simulation
BioPerl-1.6.901/Bio/PopGen/Simulation/Coalescent.pm
BioPerl-1.6.901/Bio/PopGen/Simulation/GeneticDrift.pm
BioPerl-1.6.901/Bio/Restriction
BioPerl-1.6.901/Bio/Restriction/Analysis.pm
BioPerl-1.6.901/Bio/Restriction/Enzyme.pm
BioPerl-1.6.901/Bio/Restriction/EnzymeCollection.pm
BioPerl-1.6.901/Bio/Restriction/EnzymeI.pm
BioPerl-1.6.901/Bio/Restriction/IO.pm
BioPerl-1.6.901/Bio/Restriction/Enzyme
BioPerl-1.6.901/Bio/Restriction/Enzyme/MultiCut.pm
BioPerl-1.6.901/Bio/Restriction/Enzyme/MultiSite.pm
BioPerl-1.6.901/Bio/Restriction/IO
BioPerl-1.6.901/Bio/Restriction/IO/bairoch.pm
BioPerl-1.6.901/Bio/Restriction/IO/base.pm
BioPerl-1.6.901/Bio/Restriction/IO/itype2.pm
BioPerl-1.6.901/Bio/Restriction/IO/prototype.pm
BioPerl-1.6.901/Bio/Restriction/IO/withrefm.pm
BioPerl-1.6.901/Bio/Root
BioPerl-1.6.901/Bio/Root/Build.pm
BioPerl-1.6.901/Bio/Root/Exception.pm
BioPerl-1.6.901/Bio/Root/HTTPget.pm
BioPerl-1.6.901/Bio/Root/IO.pm
BioPerl-1.6.901/Bio/Root/Root.pm
BioPerl-1.6.901/Bio/Root/RootI.pm
BioPerl-1.6.901/Bio/Root/Storable.pm
BioPerl-1.6.901/Bio/Root/Test.pm
BioPerl-1.6.901/Bio/Root/Utilities.pm
BioPerl-1.6.901/Bio/Root/Version.pm
BioPerl-1.6.901/Bio/Root/Test
BioPerl-1.6.901/Bio/Root/Test/Warn.pm
BioPerl-1.6.901/Bio/Search
BioPerl-1.6.901/Bio/Search/BlastStatistics.pm
BioPerl-1.6.901/Bio/Search/BlastUtils.pm
BioPerl-1.6.901/Bio/Search/DatabaseI.pm
BioPerl-1.6.901/Bio/Search/GenericDatabase.pm
BioPerl-1.6.901/Bio/Search/GenericStatistics.pm
BioPerl-1.6.901/Bio/Search/Processor.pm
BioPerl-1.6.901/Bio/Search/SearchUtils.pm
BioPerl-1.6.901/Bio/Search/StatisticsI.pm
BioPerl-1.6.901/Bio/Search/Hit
BioPerl-1.6.901/Bio/Search/Hit/BlastHit.pm
BioPerl-1.6.901/Bio/Search/Hit/BlastPullHit.pm
BioPerl-1.6.901/Bio/Search/Hit/Fasta.pm
BioPerl-1.6.901/Bio/Search/Hit/GenericHit.pm
BioPerl-1.6.901/Bio/Search/Hit/HitFactory.pm
BioPerl-1.6.901/Bio/Search/Hit/HitI.pm
BioPerl-1.6.901/Bio/Search/Hit/hmmer3Hit.pm
BioPerl-1.6.901/Bio/Search/Hit/HMMERHit.pm
BioPerl-1.6.901/Bio/Search/Hit/HmmpfamHit.pm
BioPerl-1.6.901/Bio/Search/Hit/ModelHit.pm
BioPerl-1.6.901/Bio/Search/Hit/PsiBlastHit.pm
BioPerl-1.6.901/Bio/Search/Hit/PullHitI.pm
BioPerl-1.6.901/Bio/Search/HSP
BioPerl-1.6.901/Bio/Search/HSP/BlastHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/BlastPullHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/FastaHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/GenericHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/hmmer3HSP.pm
BioPerl-1.6.901/Bio/Search/HSP/HMMERHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/HmmpfamHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/HSPFactory.pm
BioPerl-1.6.901/Bio/Search/HSP/HSPI.pm
BioPerl-1.6.901/Bio/Search/HSP/ModelHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/PsiBlastHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/PSLHSP.pm
BioPerl-1.6.901/Bio/Search/HSP/PullHSPI.pm
BioPerl-1.6.901/Bio/Search/HSP/WABAHSP.pm
BioPerl-1.6.901/Bio/Search/Iteration
BioPerl-1.6.901/Bio/Search/Iteration/GenericIteration.pm
BioPerl-1.6.901/Bio/Search/Iteration/IterationI.pm
BioPerl-1.6.901/Bio/Search/Result
BioPerl-1.6.901/Bio/Search/Result/BlastPullResult.pm
BioPerl-1.6.901/Bio/Search/Result/BlastResult.pm
BioPerl-1.6.901/Bio/Search/Result/CrossMatchResult.pm
BioPerl-1.6.901/Bio/Search/Result/GenericResult.pm
BioPerl-1.6.901/Bio/Search/Result/hmmer3Result.pm
BioPerl-1.6.901/Bio/Search/Result/HMMERResult.pm
BioPerl-1.6.901/Bio/Search/Result/HmmpfamResult.pm
BioPerl-1.6.901/Bio/Search/Result/PullResultI.pm
BioPerl-1.6.901/Bio/Search/Result/ResultFactory.pm
BioPerl-1.6.901/Bio/Search/Result/ResultI.pm
BioPerl-1.6.901/Bio/Search/Result/WABAResult.pm
BioPerl-1.6.901/Bio/Search/Tiling
BioPerl-1.6.901/Bio/Search/Tiling/MapTileUtils.pm
BioPerl-1.6.901/Bio/Search/Tiling/MapTiling.pm
BioPerl-1.6.901/Bio/Search/Tiling/TilingI.pm
BioPerl-1.6.901/Bio/SearchIO
BioPerl-1.6.901/Bio/SearchIO/axt.pm
BioPerl-1.6.901/Bio/SearchIO/blast.pm
BioPerl-1.6.901/Bio/SearchIO/blast_pull.pm
BioPerl-1.6.901/Bio/SearchIO/blasttable.pm
BioPerl-1.6.901/Bio/SearchIO/blastxml.pm
BioPerl-1.6.901/Bio/SearchIO/cross_match.pm
BioPerl-1.6.901/Bio/SearchIO/erpin.pm
BioPerl-1.6.901/Bio/SearchIO/EventHandlerI.pm
BioPerl-1.6.901/Bio/SearchIO/exonerate.pm
BioPerl-1.6.901/Bio/SearchIO/fasta.pm
BioPerl-1.6.901/Bio/SearchIO/FastHitEventBuilder.pm
BioPerl-1.6.901/Bio/SearchIO/gmap_f9.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer2.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer3.pm
BioPerl-1.6.901/Bio/SearchIO/hmmer_pull.pm
BioPerl-1.6.901/Bio/SearchIO/infernal.pm
BioPerl-1.6.901/Bio/SearchIO/IteratedSearchResultEventBuilder.pm
BioPerl-1.6.901/Bio/SearchIO/megablast.pm
BioPerl-1.6.901/Bio/SearchIO/psl.pm
BioPerl-1.6.901/Bio/SearchIO/rnamotif.pm
BioPerl-1.6.901/Bio/SearchIO/SearchResultEventBuilder.pm
BioPerl-1.6.901/Bio/SearchIO/SearchWriterI.pm
BioPerl-1.6.901/Bio/SearchIO/sim4.pm
BioPerl-1.6.901/Bio/SearchIO/waba.pm
BioPerl-1.6.901/Bio/SearchIO/wise.pm
BioPerl-1.6.901/Bio/SearchIO/Writer
BioPerl-1.6.901/Bio/SearchIO/Writer/BSMLResultWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/GbrowseGFF.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/HitTableWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/HSPTableWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/HTMLResultWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/ResultTableWriter.pm
BioPerl-1.6.901/Bio/SearchIO/Writer/TextResultWriter.pm
BioPerl-1.6.901/Bio/SearchIO/XML
BioPerl-1.6.901/Bio/SearchIO/XML/BlastHandler.pm
BioPerl-1.6.901/Bio/SearchIO/XML/PsiBlastHandler.pm
BioPerl-1.6.901/Bio/Seq
BioPerl-1.6.901/Bio/Seq/BaseSeqProcessor.pm
BioPerl-1.6.901/Bio/Seq/EncodedSeq.pm
BioPerl-1.6.901/Bio/Seq/LargeLocatableSeq.pm
BioPerl-1.6.901/Bio/Seq/LargePrimarySeq.pm
BioPerl-1.6.901/Bio/Seq/LargeSeq.pm
BioPerl-1.6.901/Bio/Seq/LargeSeqI.pm
BioPerl-1.6.901/Bio/Seq/Meta.pm
BioPerl-1.6.901/Bio/Seq/MetaI.pm
BioPerl-1.6.901/Bio/Seq/PrimaryQual.pm
BioPerl-1.6.901/Bio/Seq/PrimedSeq.pm
BioPerl-1.6.901/Bio/Seq/QualI.pm
BioPerl-1.6.901/Bio/Seq/Quality.pm
BioPerl-1.6.901/Bio/Seq/RichSeq.pm
BioPerl-1.6.901/Bio/Seq/RichSeqI.pm
BioPerl-1.6.901/Bio/Seq/SeqBuilder.pm
BioPerl-1.6.901/Bio/Seq/SeqFactory.pm
BioPerl-1.6.901/Bio/Seq/SeqFastaSpeedFactory.pm
BioPerl-1.6.901/Bio/Seq/SequenceTrace.pm
BioPerl-1.6.901/Bio/Seq/SeqWithQuality.pm
BioPerl-1.6.901/Bio/Seq/TraceI.pm
BioPerl-1.6.901/Bio/Seq/Meta
BioPerl-1.6.901/Bio/Seq/Meta/Array.pm
BioPerl-1.6.901/Bio/SeqEvolution
BioPerl-1.6.901/Bio/SeqEvolution/DNAPoint.pm
BioPerl-1.6.901/Bio/SeqEvolution/EvolutionI.pm
BioPerl-1.6.901/Bio/SeqEvolution/Factory.pm
BioPerl-1.6.901/Bio/SeqFeature
BioPerl-1.6.901/Bio/SeqFeature/Annotated.pm
BioPerl-1.6.901/Bio/SeqFeature/AnnotationAdaptor.pm
BioPerl-1.6.901/Bio/SeqFeature/Collection.pm
BioPerl-1.6.901/Bio/SeqFeature/CollectionI.pm
BioPerl-1.6.901/Bio/SeqFeature/Computation.pm
BioPerl-1.6.901/Bio/SeqFeature/FeaturePair.pm
BioPerl-1.6.901/Bio/SeqFeature/Generic.pm
BioPerl-1.6.901/Bio/SeqFeature/Lite.pm
BioPerl-1.6.901/Bio/SeqFeature/PositionProxy.pm
BioPerl-1.6.901/Bio/SeqFeature/Primer.pm
BioPerl-1.6.901/Bio/SeqFeature/Similarity.pm
BioPerl-1.6.901/Bio/SeqFeature/SimilarityPair.pm
BioPerl-1.6.901/Bio/SeqFeature/TypedSeqFeatureI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene
BioPerl-1.6.901/Bio/SeqFeature/Gene/Exon.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/ExonI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/GeneStructure.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/GeneStructureI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Intron.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/NC_Feature.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Poly_A_site.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Promoter.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/Transcript.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/TranscriptI.pm
BioPerl-1.6.901/Bio/SeqFeature/Gene/UTR.pm
BioPerl-1.6.901/Bio/SeqFeature/SiRNA
BioPerl-1.6.901/Bio/SeqFeature/SiRNA/Oligo.pm
BioPerl-1.6.901/Bio/SeqFeature/SiRNA/Pair.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools
BioPerl-1.6.901/Bio/SeqFeature/Tools/FeatureNamer.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools/IDHandler.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools/TypeMapper.pm
BioPerl-1.6.901/Bio/SeqFeature/Tools/Unflattener.pm
BioPerl-1.6.901/Bio/SeqIO
BioPerl-1.6.901/Bio/SeqIO/abi.pm
BioPerl-1.6.901/Bio/SeqIO/ace.pm
BioPerl-1.6.901/Bio/SeqIO/agave.pm
BioPerl-1.6.901/Bio/SeqIO/alf.pm
BioPerl-1.6.901/Bio/SeqIO/asciitree.pm
BioPerl-1.6.901/Bio/SeqIO/bsml.pm
BioPerl-1.6.901/Bio/SeqIO/bsml_sax.pm
BioPerl-1.6.901/Bio/SeqIO/chadoxml.pm
BioPerl-1.6.901/Bio/SeqIO/chaos.pm
BioPerl-1.6.901/Bio/SeqIO/chaosxml.pm
BioPerl-1.6.901/Bio/SeqIO/ctf.pm
BioPerl-1.6.901/Bio/SeqIO/embl.pm
BioPerl-1.6.901/Bio/SeqIO/embldriver.pm
BioPerl-1.6.901/Bio/SeqIO/entrezgene.pm
BioPerl-1.6.901/Bio/SeqIO/excel.pm
BioPerl-1.6.901/Bio/SeqIO/exp.pm
BioPerl-1.6.901/Bio/SeqIO/fasta.pm
BioPerl-1.6.901/Bio/SeqIO/fastq.pm
BioPerl-1.6.901/Bio/SeqIO/flybase_chadoxml.pm
BioPerl-1.6.901/Bio/SeqIO/FTHelper.pm
BioPerl-1.6.901/Bio/SeqIO/game.pm
BioPerl-1.6.901/Bio/SeqIO/gbdriver.pm
BioPerl-1.6.901/Bio/SeqIO/gbxml.pm
BioPerl-1.6.901/Bio/SeqIO/gcg.pm
BioPerl-1.6.901/Bio/SeqIO/genbank.pm
BioPerl-1.6.901/Bio/SeqIO/interpro.pm
BioPerl-1.6.901/Bio/SeqIO/kegg.pm
BioPerl-1.6.901/Bio/SeqIO/largefasta.pm
BioPerl-1.6.901/Bio/SeqIO/lasergene.pm
BioPerl-1.6.901/Bio/SeqIO/locuslink.pm
BioPerl-1.6.901/Bio/SeqIO/mbsout.pm
BioPerl-1.6.901/Bio/SeqIO/metafasta.pm
BioPerl-1.6.901/Bio/SeqIO/msout.pm
BioPerl-1.6.901/Bio/SeqIO/MultiFile.pm
BioPerl-1.6.901/Bio/SeqIO/nexml.pm
BioPerl-1.6.901/Bio/SeqIO/phd.pm
BioPerl-1.6.901/Bio/SeqIO/pir.pm
BioPerl-1.6.901/Bio/SeqIO/pln.pm
BioPerl-1.6.901/Bio/SeqIO/qual.pm
BioPerl-1.6.901/Bio/SeqIO/raw.pm
BioPerl-1.6.901/Bio/SeqIO/scf.pm
BioPerl-1.6.901/Bio/SeqIO/seqxml.pm
BioPerl-1.6.901/Bio/SeqIO/strider.pm
BioPerl-1.6.901/Bio/SeqIO/swiss.pm
BioPerl-1.6.901/Bio/SeqIO/swissdriver.pm
BioPerl-1.6.901/Bio/SeqIO/tab.pm
BioPerl-1.6.901/Bio/SeqIO/table.pm
BioPerl-1.6.901/Bio/SeqIO/tigr.pm
BioPerl-1.6.901/Bio/SeqIO/tigrxml.pm
BioPerl-1.6.901/Bio/SeqIO/tinyseq.pm
BioPerl-1.6.901/Bio/SeqIO/ztr.pm
BioPerl-1.6.901/Bio/SeqIO/game
BioPerl-1.6.901/Bio/SeqIO/game/featHandler.pm
BioPerl-1.6.901/Bio/SeqIO/game/gameHandler.pm
BioPerl-1.6.901/Bio/SeqIO/game/gameSubs.pm
BioPerl-1.6.901/Bio/SeqIO/game/gameWriter.pm
BioPerl-1.6.901/Bio/SeqIO/game/seqHandler.pm
BioPerl-1.6.901/Bio/SeqIO/Handler
BioPerl-1.6.901/Bio/SeqIO/Handler/GenericRichSeqHandler.pm
BioPerl-1.6.901/Bio/SeqIO/tinyseq
BioPerl-1.6.901/Bio/SeqIO/tinyseq/tinyseqHandler.pm
BioPerl-1.6.901/Bio/Structure
BioPerl-1.6.901/Bio/Structure/Atom.pm
BioPerl-1.6.901/Bio/Structure/Chain.pm
BioPerl-1.6.901/Bio/Structure/Entry.pm
BioPerl-1.6.901/Bio/Structure/IO.pm
BioPerl-1.6.901/Bio/Structure/Model.pm
BioPerl-1.6.901/Bio/Structure/Residue.pm
BioPerl-1.6.901/Bio/Structure/StructureI.pm
BioPerl-1.6.901/Bio/Structure/IO
BioPerl-1.6.901/Bio/Structure/IO/pdb.pm
BioPerl-1.6.901/Bio/Structure/SecStr
BioPerl-1.6.901/Bio/Structure/SecStr/DSSP
BioPerl-1.6.901/Bio/Structure/SecStr/DSSP/Res.pm
BioPerl-1.6.901/Bio/Structure/SecStr/STRIDE
BioPerl-1.6.901/Bio/Structure/SecStr/STRIDE/Res.pm
BioPerl-1.6.901/Bio/Symbol
BioPerl-1.6.901/Bio/Symbol/Alphabet.pm
BioPerl-1.6.901/Bio/Symbol/AlphabetI.pm
BioPerl-1.6.901/Bio/Symbol/DNAAlphabet.pm
BioPerl-1.6.901/Bio/Symbol/ProteinAlphabet.pm
BioPerl-1.6.901/Bio/Symbol/README.Symbol
BioPerl-1.6.901/Bio/Symbol/Symbol.pm
BioPerl-1.6.901/Bio/Symbol/SymbolI.pm
BioPerl-1.6.901/Bio/Taxonomy
BioPerl-1.6.901/Bio/Taxonomy/FactoryI.pm
BioPerl-1.6.901/Bio/Taxonomy/Node.pm
BioPerl-1.6.901/Bio/Taxonomy/Taxon.pm
BioPerl-1.6.901/Bio/Taxonomy/Tree.pm
BioPerl-1.6.901/Bio/Tools
BioPerl-1.6.901/Bio/Tools/AlignFactory.pm
BioPerl-1.6.901/Bio/Tools/AnalysisResult.pm
BioPerl-1.6.901/Bio/Tools/Blat.pm
BioPerl-1.6.901/Bio/Tools/CodonTable.pm
BioPerl-1.6.901/Bio/Tools/Coil.pm
BioPerl-1.6.901/Bio/Tools/dpAlign.pm
BioPerl-1.6.901/Bio/Tools/ECnumber.pm
BioPerl-1.6.901/Bio/Tools/EPCR.pm
BioPerl-1.6.901/Bio/Tools/Eponine.pm
BioPerl-1.6.901/Bio/Tools/ERPIN.pm
BioPerl-1.6.901/Bio/Tools/Est2Genome.pm
BioPerl-1.6.901/Bio/Tools/ESTScan.pm
BioPerl-1.6.901/Bio/Tools/EUtilities.pm
BioPerl-1.6.901/Bio/Tools/Fgenesh.pm
BioPerl-1.6.901/Bio/Tools/FootPrinter.pm
BioPerl-1.6.901/Bio/Tools/Gel.pm
BioPerl-1.6.901/Bio/Tools/Geneid.pm
BioPerl-1.6.901/Bio/Tools/Genemark.pm
BioPerl-1.6.901/Bio/Tools/Genewise.pm
BioPerl-1.6.901/Bio/Tools/Genomewise.pm
BioPerl-1.6.901/Bio/Tools/Genscan.pm
BioPerl-1.6.901/Bio/Tools/GFF.pm
BioPerl-1.6.901/Bio/Tools/Glimmer.pm
BioPerl-1.6.901/Bio/Tools/Grail.pm
BioPerl-1.6.901/Bio/Tools/GuessSeqFormat.pm
BioPerl-1.6.901/Bio/Tools/Hmmpfam.pm
BioPerl-1.6.901/Bio/Tools/Infernal.pm
BioPerl-1.6.901/Bio/Tools/ipcress.pm
BioPerl-1.6.901/Bio/Tools/isPcr.pm
BioPerl-1.6.901/Bio/Tools/IUPAC.pm
BioPerl-1.6.901/Bio/Tools/Lucy.pm
BioPerl-1.6.901/Bio/Tools/Match.pm
BioPerl-1.6.901/Bio/Tools/MZEF.pm
BioPerl-1.6.901/Bio/Tools/OddCodes.pm
BioPerl-1.6.901/Bio/Tools/pICalculator.pm
BioPerl-1.6.901/Bio/Tools/Primer3.pm
BioPerl-1.6.901/Bio/Tools/Prints.pm
BioPerl-1.6.901/Bio/Tools/Profile.pm
BioPerl-1.6.901/Bio/Tools/Promoterwise.pm
BioPerl-1.6.901/Bio/Tools/PrositeScan.pm
BioPerl-1.6.901/Bio/Tools/Protparam.pm
BioPerl-1.6.901/Bio/Tools/Pseudowise.pm
BioPerl-1.6.901/Bio/Tools/pSW.pm
BioPerl-1.6.901/Bio/Tools/QRNA.pm
BioPerl-1.6.901/Bio/Tools/RandomDistFunctions.pm
BioPerl-1.6.901/Bio/Tools/RepeatMasker.pm
BioPerl-1.6.901/Bio/Tools/RNAMotif.pm
BioPerl-1.6.901/Bio/Tools/Seg.pm
BioPerl-1.6.901/Bio/Tools/SeqPattern.pm
BioPerl-1.6.901/Bio/Tools/SeqStats.pm
BioPerl-1.6.901/Bio/Tools/SeqWords.pm
BioPerl-1.6.901/Bio/Tools/Sigcleave.pm
BioPerl-1.6.901/Bio/Tools/Signalp.pm
BioPerl-1.6.901/Bio/Tools/SiRNA.pm
BioPerl-1.6.901/Bio/Tools/TandemRepeatsFinder.pm
BioPerl-1.6.901/Bio/Tools/TargetP.pm
BioPerl-1.6.901/Bio/Tools/Tmhmm.pm
BioPerl-1.6.901/Bio/Tools/tRNAscanSE.pm
BioPerl-1.6.901/Bio/Tools/Alignment
BioPerl-1.6.901/Bio/Tools/Alignment/Consed.pm
BioPerl-1.6.901/Bio/Tools/Alignment/Trim.pm
BioPerl-1.6.901/Bio/Tools/Analysis
BioPerl-1.6.901/Bio/Tools/Analysis/SimpleAnalysisBase.pm
BioPerl-1.6.901/Bio/Tools/Analysis/DNA
BioPerl-1.6.901/Bio/Tools/Analysis/DNA/ESEfinder.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Domcut.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/ELM.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/GOR4.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/HNN.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Mitoprot.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/NetPhos.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Scansite.pm
BioPerl-1.6.901/Bio/Tools/Analysis/Protein/Sopma.pm
BioPerl-1.6.901/Bio/Tools/EMBOSS
BioPerl-1.6.901/Bio/Tools/EMBOSS/Palindrome.pm
BioPerl-1.6.901/Bio/Tools/EUtilities
BioPerl-1.6.901/Bio/Tools/EUtilities/EUtilDataI.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/EUtilParameters.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/History.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/HistoryI.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Info.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Link.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Query.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Info
BioPerl-1.6.901/Bio/Tools/EUtilities/Info/FieldInfo.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Info/LinkInfo.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Link
BioPerl-1.6.901/Bio/Tools/EUtilities/Link/LinkSet.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Link/UrlLink.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Query
BioPerl-1.6.901/Bio/Tools/EUtilities/Query/GlobalQuery.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary/DocSum.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary/Item.pm
BioPerl-1.6.901/Bio/Tools/EUtilities/Summary/ItemContainerI.pm
BioPerl-1.6.901/Bio/Tools/HMMER
BioPerl-1.6.901/Bio/Tools/HMMER/Domain.pm
BioPerl-1.6.901/Bio/Tools/HMMER/Results.pm
BioPerl-1.6.901/Bio/Tools/HMMER/Set.pm
BioPerl-1.6.901/Bio/Tools/Phylo
BioPerl-1.6.901/Bio/Tools/Phylo/Gerp.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Gumby.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Molphy.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Molphy
BioPerl-1.6.901/Bio/Tools/Phylo/Molphy/Result.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML
BioPerl-1.6.901/Bio/Tools/Phylo/PAML/Codeml.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML/ModelResult.pm
BioPerl-1.6.901/Bio/Tools/Phylo/PAML/Result.pm
BioPerl-1.6.901/Bio/Tools/Phylo/Phylip
BioPerl-1.6.901/Bio/Tools/Phylo/Phylip/ProtDist.pm
BioPerl-1.6.901/Bio/Tools/Prediction
BioPerl-1.6.901/Bio/Tools/Prediction/Exon.pm
BioPerl-1.6.901/Bio/Tools/Prediction/Gene.pm
BioPerl-1.6.901/Bio/Tools/Primer
BioPerl-1.6.901/Bio/Tools/Primer/AssessorI.pm
BioPerl-1.6.901/Bio/Tools/Primer/Feature.pm
BioPerl-1.6.901/Bio/Tools/Primer/Pair.pm
BioPerl-1.6.901/Bio/Tools/Primer/Assessor
BioPerl-1.6.901/Bio/Tools/Primer/Assessor/Base.pm
BioPerl-1.6.901/Bio/Tools/Run
BioPerl-1.6.901/Bio/Tools/Run/GenericParameters.pm
BioPerl-1.6.901/Bio/Tools/Run/hmmer3.pm
BioPerl-1.6.901/Bio/Tools/Run/ParametersI.pm
BioPerl-1.6.901/Bio/Tools/Run/README
BioPerl-1.6.901/Bio/Tools/Run/RemoteBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/StandAloneBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/StandAloneNCBIBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/StandAloneWUBlast.pm
BioPerl-1.6.901/Bio/Tools/Run/WrapperBase.pm
BioPerl-1.6.901/Bio/Tools/Run/WrapperBase
BioPerl-1.6.901/Bio/Tools/Run/WrapperBase/CommandExts.pm
BioPerl-1.6.901/Bio/Tools/SeqPattern
BioPerl-1.6.901/Bio/Tools/SeqPattern/Backtranslate.pm
BioPerl-1.6.901/Bio/Tools/Signalp
BioPerl-1.6.901/Bio/Tools/Signalp/ExtendedSignalp.pm
BioPerl-1.6.901/Bio/Tools/Sim4
BioPerl-1.6.901/Bio/Tools/Sim4/Exon.pm
BioPerl-1.6.901/Bio/Tools/Sim4/Results.pm
BioPerl-1.6.901/Bio/Tools/SiRNA
BioPerl-1.6.901/Bio/Tools/SiRNA/Ruleset
BioPerl-1.6.901/Bio/Tools/SiRNA/Ruleset/saigo.pm
BioPerl-1.6.901/Bio/Tools/SiRNA/Ruleset/tuschl.pm
BioPerl-1.6.901/Bio/Tools/Spidey
BioPerl-1.6.901/Bio/Tools/Spidey/Exon.pm
BioPerl-1.6.901/Bio/Tools/Spidey/Results.pm
BioPerl-1.6.901/Bio/Tree
BioPerl-1.6.901/Bio/Tree/AlleleNode.pm
BioPerl-1.6.901/Bio/Tree/AnnotatableNode.pm
BioPerl-1.6.901/Bio/Tree/Compatible.pm
BioPerl-1.6.901/Bio/Tree/DistanceFactory.pm
BioPerl-1.6.901/Bio/Tree/Node.pm
BioPerl-1.6.901/Bio/Tree/NodeI.pm
BioPerl-1.6.901/Bio/Tree/NodeNHX.pm
BioPerl-1.6.901/Bio/Tree/RandomFactory.pm
BioPerl-1.6.901/Bio/Tree/Statistics.pm
BioPerl-1.6.901/Bio/Tree/Tree.pm
BioPerl-1.6.901/Bio/Tree/TreeFunctionsI.pm
BioPerl-1.6.901/Bio/Tree/TreeI.pm
BioPerl-1.6.901/Bio/Tree/Draw
BioPerl-1.6.901/Bio/Tree/Draw/Cladogram.pm
BioPerl-1.6.901/Bio/TreeIO
BioPerl-1.6.901/Bio/TreeIO/cluster.pm
BioPerl-1.6.901/Bio/TreeIO/lintree.pm
BioPerl-1.6.901/Bio/TreeIO/newick.pm
BioPerl-1.6.901/Bio/TreeIO/NewickParser.pm
BioPerl-1.6.901/Bio/TreeIO/nexml.pm
BioPerl-1.6.901/Bio/TreeIO/nexus.pm
BioPerl-1.6.901/Bio/TreeIO/nhx.pm
BioPerl-1.6.901/Bio/TreeIO/pag.pm
BioPerl-1.6.901/Bio/TreeIO/phyloxml.pm
BioPerl-1.6.901/Bio/TreeIO/svggraph.pm
BioPerl-1.6.901/Bio/TreeIO/tabtree.pm
BioPerl-1.6.901/Bio/TreeIO/TreeEventBuilder.pm
BioPerl-1.6.901/Bio/Variation
BioPerl-1.6.901/Bio/Variation/AAChange.pm
BioPerl-1.6.901/Bio/Variation/AAReverseMutate.pm
BioPerl-1.6.901/Bio/Variation/Allele.pm
BioPerl-1.6.901/Bio/Variation/DNAMutation.pm
BioPerl-1.6.901/Bio/Variation/IO.pm
BioPerl-1.6.901/Bio/Variation/README
BioPerl-1.6.901/Bio/Variation/RNAChange.pm
BioPerl-1.6.901/Bio/Variation/SeqDiff.pm
BioPerl-1.6.901/Bio/Variation/SNP.pm
BioPerl-1.6.901/Bio/Variation/VariantI.pm
BioPerl-1.6.901/Bio/Variation/IO
BioPerl-1.6.901/Bio/Variation/IO/flat.pm
BioPerl-1.6.901/Bio/Variation/IO/xml.pm
BioPerl-1.6.901/doc
BioPerl-1.6.901/doc/makedoc.PL
BioPerl-1.6.901/doc/README
BioPerl-1.6.901/doc/Deobfuscator
BioPerl-1.6.901/doc/Deobfuscator/Build.PL
BioPerl-1.6.901/doc/Deobfuscator/Changes
BioPerl-1.6.901/doc/Deobfuscator/excluded_modules.txt
BioPerl-1.6.901/doc/Deobfuscator/LICENSE
BioPerl-1.6.901/doc/Deobfuscator/Makefile.PL
BioPerl-1.6.901/doc/Deobfuscator/MANIFEST
BioPerl-1.6.901/doc/Deobfuscator/META.yml
BioPerl-1.6.901/doc/Deobfuscator/README
BioPerl-1.6.901/doc/Deobfuscator/bin
BioPerl-1.6.901/doc/Deobfuscator/bin/deob_index.pl
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_detail.cgi
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_flowchart.png
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_help.html
BioPerl-1.6.901/doc/Deobfuscator/cgi-bin/deob_interface.cgi
BioPerl-1.6.901/doc/Deobfuscator/lib
BioPerl-1.6.901/doc/Deobfuscator/lib/Deobfuscator.pm
BioPerl-1.6.901/doc/Deobfuscator/t
BioPerl-1.6.901/doc/Deobfuscator/t/00.load.t
BioPerl-1.6.901/doc/Deobfuscator/t/pod.t
BioPerl-1.6.901/examples
BioPerl-1.6.901/examples/bioperl.pl
BioPerl-1.6.901/examples/generate_random_seq.pl
BioPerl-1.6.901/examples/longorf.pl
BioPerl-1.6.901/examples/make_primers.pl
BioPerl-1.6.901/examples/rev_and_trans.pl
BioPerl-1.6.901/examples/revcom_dir.pl
BioPerl-1.6.901/examples/subsequence.cgi
BioPerl-1.6.901/examples/align
BioPerl-1.6.901/examples/align/align_on_codons.pl
BioPerl-1.6.901/examples/align/aligntutorial.pl
BioPerl-1.6.901/examples/align/clustalw.pl
BioPerl-1.6.901/examples/align/simplealign.pl
BioPerl-1.6.901/examples/biblio
BioPerl-1.6.901/examples/biblio/biblio-eutils-example.pl
BioPerl-1.6.901/examples/biblio/biblio-soap-example.pl
BioPerl-1.6.901/examples/biblio/biblio_soap.pl
BioPerl-1.6.901/examples/Bio-DB-GFF
BioPerl-1.6.901/examples/Bio-DB-GFF/load_ucsc.pl
BioPerl-1.6.901/examples/cluster
BioPerl-1.6.901/examples/cluster/dbsnp.pl
BioPerl-1.6.901/examples/contributed
BioPerl-1.6.901/examples/contributed/nmrpdb_parse.pl
BioPerl-1.6.901/examples/contributed/prosite2perl.pl
BioPerl-1.6.901/examples/contributed/rebase2list.pl
BioPerl-1.6.901/examples/db
BioPerl-1.6.901/examples/db/dbfetch
BioPerl-1.6.901/examples/db/est_tissue_query.pl
BioPerl-1.6.901/examples/db/gb2features.pl
BioPerl-1.6.901/examples/db/get_seqs.pl
BioPerl-1.6.901/examples/db/getGenBank.pl
BioPerl-1.6.901/examples/db/rfetch.pl
BioPerl-1.6.901/examples/db/use_registry.pl
BioPerl-1.6.901/examples/liveseq
BioPerl-1.6.901/examples/liveseq/change_gene.pl
BioPerl-1.6.901/examples/popgen
BioPerl-1.6.901/examples/popgen/parse_calc_stats.pl
BioPerl-1.6.901/examples/quality
BioPerl-1.6.901/examples/quality/svgtrace.pl
BioPerl-1.6.901/examples/root
BioPerl-1.6.901/examples/root/exceptions1.pl
BioPerl-1.6.901/examples/root/exceptions2.pl
BioPerl-1.6.901/examples/root/exceptions3.pl
BioPerl-1.6.901/examples/root/exceptions4.pl
BioPerl-1.6.901/examples/root/README
BioPerl-1.6.901/examples/root/lib
BioPerl-1.6.901/examples/root/lib/TestInterface.pm
BioPerl-1.6.901/examples/root/lib/TestObject.pm
BioPerl-1.6.901/examples/searchio
BioPerl-1.6.901/examples/searchio/blast_example.pl
BioPerl-1.6.901/examples/searchio/custom_writer.pl
BioPerl-1.6.901/examples/searchio/hitwriter.pl
BioPerl-1.6.901/examples/searchio/hspwriter.pl
BioPerl-1.6.901/examples/searchio/htmlwriter.pl
BioPerl-1.6.901/examples/searchio/psiblast_features.pl
BioPerl-1.6.901/examples/searchio/psiblast_iterations.pl
BioPerl-1.6.901/examples/searchio/rawwriter.pl
BioPerl-1.6.901/examples/searchio/resultwriter.pl
BioPerl-1.6.901/examples/searchio/waba2gff.pl
BioPerl-1.6.901/examples/searchio/waba2gff3.pl
BioPerl-1.6.901/examples/sirna
BioPerl-1.6.901/examples/sirna/rnai_finder.cgi
BioPerl-1.6.901/examples/sirna/TAG
BioPerl-1.6.901/examples/structure
BioPerl-1.6.901/examples/structure/structure-io.pl
BioPerl-1.6.901/examples/tk
BioPerl-1.6.901/examples/tk/gsequence.pl
BioPerl-1.6.901/examples/tk/hitdisplay.pl
BioPerl-1.6.901/examples/tools
BioPerl-1.6.901/examples/tools/extract_genes.pl
BioPerl-1.6.901/examples/tools/gb_to_gff.pl
BioPerl-1.6.901/examples/tools/gff2ps.pl
BioPerl-1.6.901/examples/tools/parse_codeml.pl
BioPerl-1.6.901/examples/tools/psw.pl
BioPerl-1.6.901/examples/tools/reverse-translate.pl
BioPerl-1.6.901/examples/tools/run_genscan.pl
BioPerl-1.6.901/examples/tools/run_primer3.pl
BioPerl-1.6.901/examples/tools/seq_pattern.pl
BioPerl-1.6.901/examples/tools/standaloneblast.pl
BioPerl-1.6.901/examples/tree
BioPerl-1.6.901/examples/tree/paup2phylip.pl
BioPerl-1.6.901/ide
BioPerl-1.6.901/ide/bioperl.komodo
BioPerl-1.6.901/ide/bioperl-mode
BioPerl-1.6.901/ide/bioperl-mode/README
BioPerl-1.6.901/ide/bioperl-mode/dist
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode-xemacs.tar.md5
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode.tar
BioPerl-1.6.901/ide/bioperl-mode/dist/bioperl-mode.tar.md5
BioPerl-1.6.901/ide/bioperl-mode/dist/Changes
BioPerl-1.6.901/ide/bioperl-mode/dist/package-me
BioPerl-1.6.901/ide/bioperl-mode/dist/SKIP
BioPerl-1.6.901/ide/bioperl-mode/etc
BioPerl-1.6.901/ide/bioperl-mode/etc/images
BioPerl-1.6.901/ide/bioperl-mode/etc/images/bpmode-tool-dis.xpm
BioPerl-1.6.901/ide/bioperl-mode/etc/images/bpmode-tool.xpm
BioPerl-1.6.901/ide/bioperl-mode/site-lisp
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/bioperl-init.el
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/bioperl-mode.el
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/bioperl-skel.el
BioPerl-1.6.901/ide/bioperl-mode/site-lisp/pod.el
BioPerl-1.6.901/maintenance
BioPerl-1.6.901/maintenance/authors.pl
BioPerl-1.6.901/maintenance/check_NAME.pl
BioPerl-1.6.901/maintenance/check_URLs.pl
BioPerl-1.6.901/maintenance/cvs2cl_by_file.pl
BioPerl-1.6.901/maintenance/dependencies.pl
BioPerl-1.6.901/maintenance/deprecated.pl
BioPerl-1.6.901/maintenance/find_mod_deps.pl
BioPerl-1.6.901/maintenance/module_usage.pl
BioPerl-1.6.901/maintenance/modules.pl
BioPerl-1.6.901/maintenance/ncbi_blast_switches.pl
BioPerl-1.6.901/maintenance/perltidy.conf
BioPerl-1.6.901/maintenance/pod.pl
BioPerl-1.6.901/maintenance/README
BioPerl-1.6.901/maintenance/symlink_script.pl
BioPerl-1.6.901/maintenance/version.pl
BioPerl-1.6.901/maintenance/big_split
BioPerl-1.6.901/maintenance/big_split/file_classification.csv
BioPerl-1.6.901/maintenance/big_split/rbuels_notes.txt
BioPerl-1.6.901/models
BioPerl-1.6.901/models/biblio.dia
BioPerl-1.6.901/models/bio_liveseq_variation.dia
BioPerl-1.6.901/models/bio_map.dia
BioPerl-1.6.901/models/bio_restriction.dia
BioPerl-1.6.901/models/bioperl.dia
BioPerl-1.6.901/models/coordinatemapper.dia
BioPerl-1.6.901/models/map_proposal.txt
BioPerl-1.6.901/models/maps_and_markers.dia
BioPerl-1.6.901/models/popgen.dia
BioPerl-1.6.901/models/population_proposal.txt
BioPerl-1.6.901/models/README
BioPerl-1.6.901/scripts
BioPerl-1.6.901/scripts/README
BioPerl-1.6.901/scripts/biblio
BioPerl-1.6.901/scripts/biblio/biblio.PLS
BioPerl-1.6.901/scripts/biblio/TAG
BioPerl-1.6.901/scripts/Bio-DB-EUtilities
BioPerl-1.6.901/scripts/Bio-DB-EUtilities/einfo.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF
BioPerl-1.6.901/scripts/Bio-DB-GFF/bulk_load_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/fast_load_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/genbank2gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/genbank2gff3.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/generate_histogram.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/load_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/meta_gff.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/process_gadfly.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/process_sgd.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/process_wormbase.PLS
BioPerl-1.6.901/scripts/Bio-DB-GFF/README
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.PLS
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.PLS
BioPerl-1.6.901/scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.PLS
BioPerl-1.6.901/scripts/das
BioPerl-1.6.901/scripts/das/das_server.pl
BioPerl-1.6.901/scripts/das/README
BioPerl-1.6.901/scripts/das/TAG
BioPerl-1.6.901/scripts/DB
BioPerl-1.6.901/scripts/DB/biofetch_genbank_proxy.PLS
BioPerl-1.6.901/scripts/DB/bioflat_index.PLS
BioPerl-1.6.901/scripts/DB/biogetseq.PLS
BioPerl-1.6.901/scripts/DB/flanks.PLS
BioPerl-1.6.901/scripts/DB/TAG
BioPerl-1.6.901/scripts/DB-HIV
BioPerl-1.6.901/scripts/DB-HIV/hivq.PLS
BioPerl-1.6.901/scripts/index
BioPerl-1.6.901/scripts/index/bp_fetch.PLS
BioPerl-1.6.901/scripts/index/bp_index.PLS
BioPerl-1.6.901/scripts/index/bp_seqret.PLS
BioPerl-1.6.901/scripts/index/TAG
BioPerl-1.6.901/scripts/popgen
BioPerl-1.6.901/scripts/popgen/composite_LD.PLS
BioPerl-1.6.901/scripts/popgen/heterogeneity_test.PLS
BioPerl-1.6.901/scripts/searchio
BioPerl-1.6.901/scripts/searchio/fastam9_to_table.PLS
BioPerl-1.6.901/scripts/searchio/filter_search.PLS
BioPerl-1.6.901/scripts/searchio/hmmer_to_table.PLS
BioPerl-1.6.901/scripts/searchio/parse_hmmsearch.PLS
BioPerl-1.6.901/scripts/searchio/README
BioPerl-1.6.901/scripts/searchio/search2table.PLS
BioPerl-1.6.901/scripts/searchio/TAG
BioPerl-1.6.901/scripts/seq
BioPerl-1.6.901/scripts/seq/extract_feature_seq.PLS
BioPerl-1.6.901/scripts/seq/make_mrna_protein.PLS
BioPerl-1.6.901/scripts/seq/seqconvert.PLS
BioPerl-1.6.901/scripts/seq/seqretsplit.PLS
BioPerl-1.6.901/scripts/seq/split_seq.PLS
BioPerl-1.6.901/scripts/seq/TAG
BioPerl-1.6.901/scripts/seq/translate_seq.PLS
BioPerl-1.6.901/scripts/seq/unflatten_seq.PLS
BioPerl-1.6.901/scripts/seqstats
BioPerl-1.6.901/scripts/seqstats/aacomp.PLS
BioPerl-1.6.901/scripts/seqstats/chaos_plot.PLS
BioPerl-1.6.901/scripts/seqstats/gccalc.PLS
BioPerl-1.6.901/scripts/seqstats/oligo_count.PLS
BioPerl-1.6.901/scripts/seqstats/TAG
BioPerl-1.6.901/scripts/taxa
BioPerl-1.6.901/scripts/taxa/classify_hits_kingdom.PLS
BioPerl-1.6.901/scripts/taxa/local_taxonomydb_query.PLS
BioPerl-1.6.901/scripts/taxa/query_entrez_taxa.PLS
BioPerl-1.6.901/scripts/taxa/TAG
BioPerl-1.6.901/scripts/taxa/taxid4species.PLS
BioPerl-1.6.901/scripts/taxa/taxonomy2tree.PLS
BioPerl-1.6.901/scripts/tree
BioPerl-1.6.901/scripts/tree/blast2tree.PLS
BioPerl-1.6.901/scripts/tree/nexus2nh.PLS
BioPerl-1.6.901/scripts/tree/TAG
BioPerl-1.6.901/scripts/tree/tree2pag.PLS
BioPerl-1.6.901/scripts/utilities
BioPerl-1.6.901/scripts/utilities/bp_mrtrans.PLS
BioPerl-1.6.901/scripts/utilities/bp_netinstall.PLS
BioPerl-1.6.901/scripts/utilities/bp_nrdb.PLS
BioPerl-1.6.901/scripts/utilities/bp_sreformat.PLS
BioPerl-1.6.901/scripts/utilities/dbsplit.PLS
BioPerl-1.6.901/scripts/utilities/download_query_genbank.PLS
BioPerl-1.6.901/scripts/utilities/mask_by_search.PLS
BioPerl-1.6.901/scripts/utilities/mutate.PLS
BioPerl-1.6.901/scripts/utilities/pairwise_kaks.PLS
BioPerl-1.6.901/scripts/utilities/README
BioPerl-1.6.901/scripts/utilities/remote_blast.PLS
BioPerl-1.6.901/scripts/utilities/revtrans-motif.PLS
BioPerl-1.6.901/scripts/utilities/search2alnblocks.PLS
BioPerl-1.6.901/scripts/utilities/search2BSML.PLS
BioPerl-1.6.901/scripts/utilities/search2gff.PLS
BioPerl-1.6.901/scripts/utilities/search2tribe.PLS
BioPerl-1.6.901/scripts/utilities/seq_length.PLS
BioPerl-1.6.901/scripts/utilities/TAG
BioPerl-1.6.901/t
BioPerl-1.6.901/t/Alphabet.t
BioPerl-1.6.901/t/nexml.t
BioPerl-1.6.901/t/Perl.t
BioPerl-1.6.901/t/PodSyntax.t
BioPerl-1.6.901/t/SearchDist.t
BioPerl-1.6.901/t/SeqEvolution.t
BioPerl-1.6.901/t/Species.t
BioPerl-1.6.901/t/Symbol.t
BioPerl-1.6.901/t/TaxonTree.t
BioPerl-1.6.901/t/Align
BioPerl-1.6.901/t/Align/AlignStats.t
BioPerl-1.6.901/t/Align/AlignUtil.t
BioPerl-1.6.901/t/Align/Graphics.t
BioPerl-1.6.901/t/Align/SimpleAlign.t
BioPerl-1.6.901/t/Align/TreeBuild.t
BioPerl-1.6.901/t/Align/Utilities.t
BioPerl-1.6.901/t/AlignIO
BioPerl-1.6.901/t/AlignIO/AlignIO.t
BioPerl-1.6.901/t/AlignIO/arp.t
BioPerl-1.6.901/t/AlignIO/bl2seq.t
BioPerl-1.6.901/t/AlignIO/clustalw.t
BioPerl-1.6.901/t/AlignIO/emboss.t
BioPerl-1.6.901/t/AlignIO/fasta.t
BioPerl-1.6.901/t/AlignIO/largemultifasta.t
BioPerl-1.6.901/t/AlignIO/maf.t
BioPerl-1.6.901/t/AlignIO/mase.t
BioPerl-1.6.901/t/AlignIO/mega.t
BioPerl-1.6.901/t/AlignIO/meme.t
BioPerl-1.6.901/t/AlignIO/metafasta.t
BioPerl-1.6.901/t/AlignIO/msf.t
BioPerl-1.6.901/t/AlignIO/nexml.t
BioPerl-1.6.901/t/AlignIO/nexus.t
BioPerl-1.6.901/t/AlignIO/pfam.t
BioPerl-1.6.901/t/AlignIO/phylip.t
BioPerl-1.6.901/t/AlignIO/po.t
BioPerl-1.6.901/t/AlignIO/prodom.t
BioPerl-1.6.901/t/AlignIO/psi.t
BioPerl-1.6.901/t/AlignIO/selex.t
BioPerl-1.6.901/t/AlignIO/stockholm.t
BioPerl-1.6.901/t/AlignIO/xmfa.t
BioPerl-1.6.901/t/Annotation
BioPerl-1.6.901/t/Annotation/Annotation.t
BioPerl-1.6.901/t/Annotation/AnnotationAdaptor.t
BioPerl-1.6.901/t/Assembly
BioPerl-1.6.901/t/Assembly/ContigSpectrum.t
BioPerl-1.6.901/t/Assembly/core.t
BioPerl-1.6.901/t/Assembly/IO
BioPerl-1.6.901/t/Assembly/IO/bowtie.t
BioPerl-1.6.901/t/Assembly/IO/sam.t
BioPerl-1.6.901/t/Biblio
BioPerl-1.6.901/t/Biblio/Biblio.t
BioPerl-1.6.901/t/Biblio/biofetch.t
BioPerl-1.6.901/t/Biblio/eutils.t
BioPerl-1.6.901/t/Biblio/References.t
BioPerl-1.6.901/t/ClusterIO
BioPerl-1.6.901/t/ClusterIO/ClusterIO.t
BioPerl-1.6.901/t/ClusterIO/SequenceFamily.t
BioPerl-1.6.901/t/ClusterIO/unigene.t
BioPerl-1.6.901/t/Coordinate
BioPerl-1.6.901/t/Coordinate/CoordinateBoundaryTest.t
BioPerl-1.6.901/t/Coordinate/CoordinateGraph.t
BioPerl-1.6.901/t/Coordinate/CoordinateMapper.t
BioPerl-1.6.901/t/Coordinate/GeneCoordinateMapper.t
BioPerl-1.6.901/t/data
BioPerl-1.6.901/t/data/01_basic.xml
BioPerl-1.6.901/t/data/02_dogfish_dict_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_dogfish_no_taxrefs.xml
BioPerl-1.6.901/t/data/02_dogfish_rdfa_2_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_dogfish_rdfa_tdwg_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_dict_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_no_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_rdfa_2_cdao_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/02_mackerel_rdfa_tdwg_lsid_taxrefs.xml
BioPerl-1.6.901/t/data/03_bootstraps.xml
BioPerl-1.6.901/t/data/03_bootstraps_in_tag.xml
BioPerl-1.6.901/t/data/04_labeled_ancestors.xml
BioPerl-1.6.901/t/data/05_ancestral_states.xml
BioPerl-1.6.901/t/data/1.bed
BioPerl-1.6.901/t/data/13-pilE-F.scf
BioPerl-1.6.901/t/data/1A11.pdb
BioPerl-1.6.901/t/data/1A3I.pdb
BioPerl-1.6.901/t/data/1BPT.pdb
BioPerl-1.6.901/t/data/1ZZ19XR301R-Alignment.tblastn
BioPerl-1.6.901/t/data/2008.blasttable
BioPerl-1.6.901/t/data/27-contig_Newbler.ace
BioPerl-1.6.901/t/data/503384.MEGABLAST.0
BioPerl-1.6.901/t/data/503384.MEGABLAST.2
BioPerl-1.6.901/t/data/5X_1895.FASTXY
BioPerl-1.6.901/t/data/8HVP.pdb
BioPerl-1.6.901/t/data/a_thaliana.blastn
BioPerl-1.6.901/t/data/AAC12660.fa
BioPerl-1.6.901/t/data/aaml.mlc
BioPerl-1.6.901/t/data/aaml_pairwise.mlc
BioPerl-1.6.901/t/data/AB077698.gb
BioPerl-1.6.901/t/data/acefile.ace.1
BioPerl-1.6.901/t/data/acefile.singlets
BioPerl-1.6.901/t/data/adh.mb_tree.nexus
BioPerl-1.6.901/t/data/AE003528_ecoli.bls
BioPerl-1.6.901/t/data/AE003644_Adh-genomic.gb
BioPerl-1.6.901/t/data/AF032047.gbk
BioPerl-1.6.901/t/data/AF165282.gb
BioPerl-1.6.901/t/data/AF305198.gb
BioPerl-1.6.901/t/data/AHCYL1.kegg
BioPerl-1.6.901/t/data/alleles.fas
BioPerl-1.6.901/t/data/alnfile.fasta
BioPerl-1.6.901/t/data/amino.fa
BioPerl-1.6.901/t/data/AnnIX-v003.gbk
BioPerl-1.6.901/t/data/ar.embl
BioPerl-1.6.901/t/data/assembly_with_singlets.ace
BioPerl-1.6.901/t/data/ATF14F8.gbk
BioPerl-1.6.901/t/data/atp1.matrix
BioPerl-1.6.901/t/data/ay007676.gb
BioPerl-1.6.901/t/data/AY095303S1.gbk
BioPerl-1.6.901/t/data/ay116458.gb
BioPerl-1.6.901/t/data/ay149291.gb
BioPerl-1.6.901/t/data/AY763288.gb
BioPerl-1.6.901/t/data/BAB68554.gb
BioPerl-1.6.901/t/data/barns-combined.nex
BioPerl-1.6.901/t/data/baseml.pairwise
BioPerl-1.6.901/t/data/baseml.usertree
BioPerl-1.6.901/t/data/basic-bush.nex
BioPerl-1.6.901/t/data/basic-ladder.nex
BioPerl-1.6.901/t/data/BC000007.gbk
BioPerl-1.6.901/t/data/BEL16-LTR_AG.embl
BioPerl-1.6.901/t/data/biofpc.cor
BioPerl-1.6.901/t/data/biofpc.fpc
BioPerl-1.6.901/t/data/biorecipe.nhx
BioPerl-1.6.901/t/data/Bird_Ovomucoids.nex
BioPerl-1.6.901/t/data/BK000016-tpa.gbk
BioPerl-1.6.901/t/data/bl2seq.blastn
BioPerl-1.6.901/t/data/bl2seq.blastn.rev
BioPerl-1.6.901/t/data/bl2seq.blastx.out
BioPerl-1.6.901/t/data/bl2seq.bug940.out
BioPerl-1.6.901/t/data/bl2seq.out
BioPerl-1.6.901/t/data/bl2seq.tblastx.out
BioPerl-1.6.901/t/data/blast.report
BioPerl-1.6.901/t/data/blast_no_hit_desc.txt
BioPerl-1.6.901/t/data/blast_plus.blastp
BioPerl-1.6.901/t/data/blastp2215.blast
BioPerl-1.6.901/t/data/blat.psLayout3
BioPerl-1.6.901/t/data/BLOSUM50
BioPerl-1.6.901/t/data/blosum62.bla
BioPerl-1.6.901/t/data/BN000066-tpa.embl
BioPerl-1.6.901/t/data/bootstrap.tre
BioPerl-1.6.901/t/data/BOSS_DROME.FASTP_v35_04
BioPerl-1.6.901/t/data/branchSite.mlc
BioPerl-1.6.901/t/data/brassica_ATH.WUBLASTN
BioPerl-1.6.901/t/data/bug1986.blast2
BioPerl-1.6.901/t/data/bug1986.blastp
BioPerl-1.6.901/t/data/bug2120.phd
BioPerl-1.6.901/t/data/bug2246.blast
BioPerl-1.6.901/t/data/bug2391.megablast
BioPerl-1.6.901/t/data/bug2399.tblastn
BioPerl-1.6.901/t/data/bug2453.maf
BioPerl-1.6.901/t/data/bug2473.fasta
BioPerl-1.6.901/t/data/bug2862.pmr
BioPerl-1.6.901/t/data/bug2869.tree
BioPerl-1.6.901/t/data/bug2901.fa
BioPerl-1.6.901/t/data/bug2937.fasta
BioPerl-1.6.901/t/data/bug2942.blastx
BioPerl-1.6.901/t/data/bug2982.embl
BioPerl-1.6.901/t/data/bug2982.gb
BioPerl-1.6.901/t/data/bug3021.gmap
BioPerl-1.6.901/t/data/bug3086.embl
BioPerl-1.6.901/t/data/c200-vs-yeast.BLASTN
BioPerl-1.6.901/t/data/c200-vs-yeast.BLASTN.m8
BioPerl-1.6.901/t/data/calm.swiss
BioPerl-1.6.901/t/data/catalase-webblast.BLASTP
BioPerl-1.6.901/t/data/cds-266.fas
BioPerl-1.6.901/t/data/cds_sample.embl
BioPerl-1.6.901/t/data/CG11099.fasaln
BioPerl-1.6.901/t/data/CG2865.fasaln
BioPerl-1.6.901/t/data/chad100.scf
BioPerl-1.6.901/t/data/char-interleave.nex
BioPerl-1.6.901/t/data/char-matrix-spaces.nex
BioPerl-1.6.901/t/data/characters+trees.nexml.xml
BioPerl-1.6.901/t/data/characters.nexml.old.xml
BioPerl-1.6.901/t/data/codeml.mlc
BioPerl-1.6.901/t/data/codeml315.mlc
BioPerl-1.6.901/t/data/codeml4.mlc
BioPerl-1.6.901/t/data/codeml43.mlc
BioPerl-1.6.901/t/data/codeml43_nssites.mlc
BioPerl-1.6.901/t/data/codeml_nan.mlc
BioPerl-1.6.901/t/data/codeml_nssites.mlc
BioPerl-1.6.901/t/data/compLD_missingtest.prettybase
BioPerl-1.6.901/t/data/compLD_test.prettybase
BioPerl-1.6.901/t/data/component.ontology.test
BioPerl-1.6.901/t/data/component.ontology.test2
BioPerl-1.6.901/t/data/contig-by-hand.wublastp
BioPerl-1.6.901/t/data/contigspectrumtest.tigr
BioPerl-1.6.901/t/data/crab.dat.cn
BioPerl-1.6.901/t/data/crab.nj
BioPerl-1.6.901/t/data/crab.njb
BioPerl-1.6.901/t/data/crypto.sim4-0
BioPerl-1.6.901/t/data/crypto.sim4-3
BioPerl-1.6.901/t/data/crypto.sim4-4
BioPerl-1.6.901/t/data/ctgdemo.fpc
BioPerl-1.6.901/t/data/cys1_dicdi.water
BioPerl-1.6.901/t/data/cysprot.fa
BioPerl-1.6.901/t/data/cysprot.msf
BioPerl-1.6.901/t/data/cysprot.needle
BioPerl-1.6.901/t/data/cysprot.tblastn
BioPerl-1.6.901/t/data/cysprot.water
BioPerl-1.6.901/t/data/cysprot1.fa
BioPerl-1.6.901/t/data/cysprot1.FASTA
BioPerl-1.6.901/t/data/cysprot1a.fa
BioPerl-1.6.901/t/data/cysprot1a.msf
BioPerl-1.6.901/t/data/cysprot1b.fa
BioPerl-1.6.901/t/data/cysprot1b.hmmsearch
BioPerl-1.6.901/t/data/cysprot1b.msf
BioPerl-1.6.901/t/data/cysprot1b.newick
BioPerl-1.6.901/t/data/cysprot_vs_gadfly.FASTA
BioPerl-1.6.901/t/data/D10483.gbk
BioPerl-1.6.901/t/data/D12555.gbk
BioPerl-1.6.901/t/data/dcr1_sp.WUBLASTP
BioPerl-1.6.901/t/data/directives.gff3
BioPerl-1.6.901/t/data/dmel_2Lchunk.gb
BioPerl-1.6.901/t/data/dna1.fa
BioPerl-1.6.901/t/data/dna2.fa
BioPerl-1.6.901/t/data/dnaE-bsub-prot.fa
BioPerl-1.6.901/t/data/dnaE-bsub.fa
BioPerl-1.6.901/t/data/dnaEbsub_ecoli.wublastx
BioPerl-1.6.901/t/data/dnaEbsub_ecoli.wutblastn
BioPerl-1.6.901/t/data/dnaEbsub_ecoli.wutblastx
BioPerl-1.6.901/t/data/DQ018368.gb
BioPerl-1.6.901/t/data/dq519393.gb
BioPerl-1.6.901/t/data/ECAPAH02.embl
BioPerl-1.6.901/t/data/echofilter.wublastn
BioPerl-1.6.901/t/data/ecoli-trna-qrna.out
BioPerl-1.6.901/t/data/ecoli_domains.rps.xml
BioPerl-1.6.901/t/data/ecoli_domains.rpsblast
BioPerl-1.6.901/t/data/ecolitst.bls
BioPerl-1.6.901/t/data/ecolitst.fa
BioPerl-1.6.901/t/data/ecolitst.noseqs.wublastp
BioPerl-1.6.901/t/data/ecolitst.wublastp
BioPerl-1.6.901/t/data/EG352462.gbxml
BioPerl-1.6.901/t/data/empty.bl2seq
BioPerl-1.6.901/t/data/ENr111.mfa.example.elems
BioPerl-1.6.901/t/data/entrezgene.dat
BioPerl-1.6.901/t/data/ex1.nucl.nhx
BioPerl-1.6.901/t/data/example.hap
BioPerl-1.6.901/t/data/example.phase
BioPerl-1.6.901/t/data/example.vcf
BioPerl-1.6.901/t/data/exonerate.output.dontwork
BioPerl-1.6.901/t/data/exonerate.output.works
BioPerl-1.6.901/t/data/exonerate.whitespace_before_query.works
BioPerl-1.6.901/t/data/expected.blast.out
BioPerl-1.6.901/t/data/exsignalp.out
BioPerl-1.6.901/t/data/factor7.embl
BioPerl-1.6.901/t/data/Fang_2003.xml
BioPerl-1.6.901/t/data/fgenesh.out
BioPerl-1.6.901/t/data/footprinter.out
BioPerl-1.6.901/t/data/frac_problems.blast
BioPerl-1.6.901/t/data/frac_problems2.blast
BioPerl-1.6.901/t/data/frac_problems3.blast
BioPerl-1.6.901/t/data/geneid_1.0.out
BioPerl-1.6.901/t/data/genemark-fragment.out
BioPerl-1.6.901/t/data/genemark.out
BioPerl-1.6.901/t/data/genewise.out
BioPerl-1.6.901/t/data/genewise_output.paracel_btk
BioPerl-1.6.901/t/data/genomewise.out
BioPerl-1.6.901/t/data/genomic-seq.epcr
BioPerl-1.6.901/t/data/genomic-seq.fasta
BioPerl-1.6.901/t/data/genomic-seq.genscan
BioPerl-1.6.901/t/data/genomic-seq.mzef
BioPerl-1.6.901/t/data/Genscan.FastA
BioPerl-1.6.901/t/data/gf-s71.needle
BioPerl-1.6.901/t/data/Glimmer2.out
BioPerl-1.6.901/t/data/glimmer3-fragment.detail
BioPerl-1.6.901/t/data/glimmer3-fragment.predict
BioPerl-1.6.901/t/data/Glimmer3.detail
BioPerl-1.6.901/t/data/Glimmer3.predict
BioPerl-1.6.901/t/data/GlimmerHMM.out
BioPerl-1.6.901/t/data/GlimmerM.out
BioPerl-1.6.901/t/data/gmap_f9-multiple_results.txt
BioPerl-1.6.901/t/data/gmap_f9-reverse-strand.txt
BioPerl-1.6.901/t/data/gmap_f9.txt
BioPerl-1.6.901/t/data/GO.defs.test
BioPerl-1.6.901/t/data/GO.defs.test2
BioPerl-1.6.901/t/data/headerless.psl
BioPerl-1.6.901/t/data/hemoglobinA.meg
BioPerl-1.6.901/t/data/hg16_chroms.gff
BioPerl-1.6.901/t/data/hmmpfam.out
BioPerl-1.6.901/t/data/hmmpfam_cs.out
BioPerl-1.6.901/t/data/hmmpfam_fake.out
BioPerl-1.6.901/t/data/hmmscan.out
BioPerl-1.6.901/t/data/hmmscan_multi_domain.out
BioPerl-1.6.901/t/data/hmmscan_sec_struct.out
BioPerl-1.6.901/t/data/hmmsearch.out
BioPerl-1.6.901/t/data/hmmsearch3.out
BioPerl-1.6.901/t/data/hs_est.est2genome
BioPerl-1.6.901/t/data/hs_fugu.newick
BioPerl-1.6.901/t/data/hs_owlmonkey.aln
BioPerl-1.6.901/t/data/hs_owlmonkey.fas
BioPerl-1.6.901/t/data/hs_owlmonkey.fasta
BioPerl-1.6.901/t/data/hsinsulin.blastcl3.blastn
BioPerl-1.6.901/t/data/HUMBETGLOA.fa
BioPerl-1.6.901/t/data/HUMBETGLOA.FASTA
BioPerl-1.6.901/t/data/HUMBETGLOA.gff
BioPerl-1.6.901/t/data/HUMBETGLOA.grail
BioPerl-1.6.901/t/data/HUMBETGLOA.grailexp
BioPerl-1.6.901/t/data/HUMBETGLOA.mzef
BioPerl-1.6.901/t/data/HUMBETGLOA.tblastx
BioPerl-1.6.901/t/data/humor.maf
BioPerl-1.6.901/t/data/humts1.pal
BioPerl-1.6.901/t/data/hybrid1.gff3
BioPerl-1.6.901/t/data/hybrid2.gff3
BioPerl-1.6.901/t/data/in.fasta
BioPerl-1.6.901/t/data/insulin.water
BioPerl-1.6.901/t/data/interpro.xml
BioPerl-1.6.901/t/data/interpro_ebi.xml
BioPerl-1.6.901/t/data/interpro_relationship.xml
BioPerl-1.6.901/t/data/interpro_sample.xml
BioPerl-1.6.901/t/data/interpro_short.xml
BioPerl-1.6.901/t/data/intrablock-comment.nex
BioPerl-1.6.901/t/data/Kingdoms_DNA.nex
BioPerl-1.6.901/t/data/knownGene.gff3
BioPerl-1.6.901/t/data/L77119.hmmer
BioPerl-1.6.901/t/data/little.largemultifasta
BioPerl-1.6.901/t/data/LittleChrY.dbsnp.xml
BioPerl-1.6.901/t/data/LOAD_Ccd1.dnd
BioPerl-1.6.901/t/data/long-names.nex
BioPerl-1.6.901/t/data/longnames.aln
BioPerl-1.6.901/t/data/longnames.dnd
BioPerl-1.6.901/t/data/lucy.info
BioPerl-1.6.901/t/data/lucy.qual
BioPerl-1.6.901/t/data/lucy.seq
BioPerl-1.6.901/t/data/lucy.stderr
BioPerl-1.6.901/t/data/lysozyme6.protml
BioPerl-1.6.901/t/data/lysozyme6.simple.protml
BioPerl-1.6.901/t/data/M0.mlc
BioPerl-1.6.901/t/data/M12730.gb
BioPerl-1.6.901/t/data/mapmaker.out
BioPerl-1.6.901/t/data/mapmaker.txt
BioPerl-1.6.901/t/data/mast.dat
BioPerl-1.6.901/t/data/masta.dat
BioPerl-1.6.901/t/data/match.output
BioPerl-1.6.901/t/data/Mcjanrna_rdbII.gbk
BioPerl-1.6.901/t/data/megablast_output.paracel_btk
BioPerl-1.6.901/t/data/meme.dat
BioPerl-1.6.901/t/data/mini-AE001405.gb
BioPerl-1.6.901/t/data/mini-align.aln
BioPerl-1.6.901/t/data/mixedmast.dat
BioPerl-1.6.901/t/data/MmCT
BioPerl-1.6.901/t/data/mpath.ontology.test
BioPerl-1.6.901/t/data/MSGEFTUA.gb
BioPerl-1.6.901/t/data/multi.blast.m8
BioPerl-1.6.901/t/data/multi.blast.m9
BioPerl-1.6.901/t/data/multi.phd
BioPerl-1.6.901/t/data/multi_1.fa
BioPerl-1.6.901/t/data/multi_2.fa
BioPerl-1.6.901/t/data/multi_blast.bls
BioPerl-1.6.901/t/data/multifa.seq
BioPerl-1.6.901/t/data/multifa.seq.qual
BioPerl-1.6.901/t/data/multiline-intrablock-comment.nex
BioPerl-1.6.901/t/data/multiseq.bls
BioPerl-1.6.901/t/data/multiseq_tags.phd
BioPerl-1.6.901/t/data/mus.bls.xml
BioPerl-1.6.901/t/data/mutations.dat
BioPerl-1.6.901/t/data/mutations.old.dat
BioPerl-1.6.901/t/data/mutations.old.xml
BioPerl-1.6.901/t/data/mutations.xml
BioPerl-1.6.901/t/data/myco_sites.gff
BioPerl-1.6.901/t/data/NC_001284.gbk
BioPerl-1.6.901/t/data/NC_006346.gb
BioPerl-1.6.901/t/data/NC_006511-short.gbk
BioPerl-1.6.901/t/data/NC_008536.gb
BioPerl-1.6.901/t/data/nei_gojobori_test.aln
BioPerl-1.6.901/t/data/neighbor.dist
BioPerl-1.6.901/t/data/new_blastn.txt
BioPerl-1.6.901/t/data/newblast.xml
BioPerl-1.6.901/t/data/nhx-bacteria.nhx
BioPerl-1.6.901/t/data/NM_002254.gb
BioPerl-1.6.901/t/data/no-genes.genscan
BioPerl-1.6.901/t/data/no_cds_example.gb
BioPerl-1.6.901/t/data/no_FH.embl
BioPerl-1.6.901/t/data/no_hsps.blastp
BioPerl-1.6.901/t/data/no_semicolon.newick
BioPerl-1.6.901/t/data/noninterleaved.phy
BioPerl-1.6.901/t/data/NT_021877.gbk
BioPerl-1.6.901/t/data/nucmatrix.txt
BioPerl-1.6.901/t/data/O_sat.wgs
BioPerl-1.6.901/t/data/omim_genemap_test
BioPerl-1.6.901/t/data/omim_genemap_test_nolinebreak
BioPerl-1.6.901/t/data/omim_text_test
BioPerl-1.6.901/t/data/P33897
BioPerl-1.6.901/t/data/P35527.gb
BioPerl-1.6.901/t/data/P39765.gb
BioPerl-1.6.901/t/data/PAM250
BioPerl-1.6.901/t/data/pep-266.aln
BioPerl-1.6.901/t/data/pfam_tests.stk
BioPerl-1.6.901/t/data/phi.out
BioPerl-1.6.901/t/data/phipsi.out
BioPerl-1.6.901/t/data/phylipdist-36.out
BioPerl-1.6.901/t/data/phylipdist.out
BioPerl-1.6.901/t/data/phyloxml_examples.xml
BioPerl-1.6.901/t/data/pictogram.fa
BioPerl-1.6.901/t/data/plague_yeast.bls.xml
BioPerl-1.6.901/t/data/polymorphism.dat
BioPerl-1.6.901/t/data/polymorphism.old.xml
BioPerl-1.6.901/t/data/polymorphism.xml
BioPerl-1.6.901/t/data/popgen_saureus.dat
BioPerl-1.6.901/t/data/popgen_saureus.multidat
BioPerl-1.6.901/t/data/popstats.prettybase
BioPerl-1.6.901/t/data/pre_rel9.swiss
BioPerl-1.6.901/t/data/Primate_mtDNA.nex
BioPerl-1.6.901/t/data/primedseq.fa
BioPerl-1.6.901/t/data/primer3_infile.txt
BioPerl-1.6.901/t/data/primer3_outfile.txt
BioPerl-1.6.901/t/data/primer3_output.txt
BioPerl-1.6.901/t/data/prints.out
BioPerl-1.6.901/t/data/promoterwise.out
BioPerl-1.6.901/t/data/protpars.phy
BioPerl-1.6.901/t/data/protpars_longid.phy
BioPerl-1.6.901/t/data/pseudowise.out
BioPerl-1.6.901/t/data/psi_xml.dat
BioPerl-1.6.901/t/data/psiblast.xml
BioPerl-1.6.901/t/data/psiblastreport.out
BioPerl-1.6.901/t/data/purine_v081.infernal
BioPerl-1.6.901/t/data/puzzle.tre
BioPerl-1.6.901/t/data/PX1CG.gb
BioPerl-1.6.901/t/data/Q8GBD3.swiss
BioPerl-1.6.901/t/data/qrna-relloc.out
BioPerl-1.6.901/t/data/qualfile.qual
BioPerl-1.6.901/t/data/quoted-strings1.nex
BioPerl-1.6.901/t/data/quoted-strings2.nex
BioPerl-1.6.901/t/data/Rab1.chaos-xml
BioPerl-1.6.901/t/data/radical-whitespace.nex
BioPerl-1.6.901/t/data/radical-whitespace_02.nex
BioPerl-1.6.901/t/data/rebase.itype2
BioPerl-1.6.901/t/data/rebase.withrefm
BioPerl-1.6.901/t/data/reference_ace.ace
BioPerl-1.6.901/t/data/regulation_test.obo
BioPerl-1.6.901/t/data/rel9.swiss
BioPerl-1.6.901/t/data/repeatmasker.fa.out
BioPerl-1.6.901/t/data/revcomp_mrna.gb
BioPerl-1.6.901/t/data/rfam_tests.stk
BioPerl-1.6.901/t/data/ribosome-slippage.gb
BioPerl-1.6.901/t/data/roa1.dat
BioPerl-1.6.901/t/data/roa1.gbxml
BioPerl-1.6.901/t/data/roa1.genbank
BioPerl-1.6.901/t/data/roa1.swiss
BioPerl-1.6.901/t/data/roa1_v2.dat
BioPerl-1.6.901/t/data/rpsblast.bls
BioPerl-1.6.901/t/data/sample_dataset.tigr
BioPerl-1.6.901/t/data/sbay_c127.fas
BioPerl-1.6.901/t/data/sbay_c545-yeast.BLASTZ.PSL
BioPerl-1.6.901/t/data/seg.out
BioPerl-1.6.901/t/data/semicolon.newick
BioPerl-1.6.901/t/data/seqdatabase.ini
BioPerl-1.6.901/t/data/seqfile.pir
BioPerl-1.6.901/t/data/seqs.fas
BioPerl-1.6.901/t/data/sequencefamily.dat
BioPerl-1.6.901/t/data/seqxml.xml
BioPerl-1.6.901/t/data/short.blx
BioPerl-1.6.901/t/data/signalp.hmm.short
BioPerl-1.6.901/t/data/signalp.hmm.summary
BioPerl-1.6.901/t/data/signalp.negative.out
BioPerl-1.6.901/t/data/signalp.nn.short
BioPerl-1.6.901/t/data/signalp.nn.summary
BioPerl-1.6.901/t/data/signalp.positive.out
BioPerl-1.6.901/t/data/signalp.short
BioPerl-1.6.901/t/data/signalp.summary
BioPerl-1.6.901/t/data/sim4.for.for
BioPerl-1.6.901/t/data/sim4.for.rev
BioPerl-1.6.901/t/data/sim4.rev
BioPerl-1.6.901/t/data/singleNSsite.mlc
BioPerl-1.6.901/t/data/singlet_w_CT.ace
BioPerl-1.6.901/t/data/so.obo
BioPerl-1.6.901/t/data/sofa.ontology
BioPerl-1.6.901/t/data/sp_subset.obo
BioPerl-1.6.901/t/data/spaces.nex
BioPerl-1.6.901/t/data/SPAN_Family4nl.nex
BioPerl-1.6.901/t/data/SPAN_Family7n.nex
BioPerl-1.6.901/t/data/SPAN_Family8a.nex
BioPerl-1.6.901/t/data/sparsealn.needle
BioPerl-1.6.901/t/data/spidey.noalignment
BioPerl-1.6.901/t/data/spidey.test1
BioPerl-1.6.901/t/data/sprintf.rnamotif
BioPerl-1.6.901/t/data/ssp160.embl.1
BioPerl-1.6.901/t/data/stress_test_medline.xml
BioPerl-1.6.901/t/data/stress_test_pubmed.xml
BioPerl-1.6.901/t/data/sv40_small.xml
BioPerl-1.6.901/t/data/swiss.dat
BioPerl-1.6.901/t/data/swisspfam.data
BioPerl-1.6.901/t/data/SwissProt.dat
BioPerl-1.6.901/t/data/T7.aln
BioPerl-1.6.901/t/data/tab1part.mif
BioPerl-1.6.901/t/data/tab2part.mif
BioPerl-1.6.901/t/data/tab3part.mif
BioPerl-1.6.901/t/data/tandem_repeats_finder.dat
BioPerl-1.6.901/t/data/tandem_repeats_finder.noresults
BioPerl-1.6.901/t/data/tandem_repeats_finder_no_desc.dat
BioPerl-1.6.901/t/data/targetp.out
BioPerl-1.6.901/t/data/tblastn.out
BioPerl-1.6.901/t/data/test 2.txt
BioPerl-1.6.901/t/data/test.abi
BioPerl-1.6.901/t/data/test.ace
BioPerl-1.6.901/t/data/test.bam
BioPerl-1.6.901/t/data/test.bowtie
BioPerl-1.6.901/t/data/test.cns.fastq
BioPerl-1.6.901/t/data/test.ctf
BioPerl-1.6.901/t/data/test.embl
BioPerl-1.6.901/t/data/test.embl2sq
BioPerl-1.6.901/t/data/test.exp
BioPerl-1.6.901/t/data/test.fasta
BioPerl-1.6.901/t/data/test.fastq
BioPerl-1.6.901/t/data/test.game
BioPerl-1.6.901/t/data/test.gcg
BioPerl-1.6.901/t/data/test.gcgblast
BioPerl-1.6.901/t/data/test.gcgfasta
BioPerl-1.6.901/t/data/test.genbank
BioPerl-1.6.901/t/data/test.genbank.noseq
BioPerl-1.6.901/t/data/test.infernal
BioPerl-1.6.901/t/data/test.interpro
BioPerl-1.6.901/t/data/test.interpro-go.xml
BioPerl-1.6.901/t/data/test.lasergene
BioPerl-1.6.901/t/data/test.locuslink
BioPerl-1.6.901/t/data/test.maq
BioPerl-1.6.901/t/data/test.mase
BioPerl-1.6.901/t/data/test.meme
BioPerl-1.6.901/t/data/test.meme2
BioPerl-1.6.901/t/data/test.metafasta
BioPerl-1.6.901/t/data/test.nh
BioPerl-1.6.901/t/data/test.nhx
BioPerl-1.6.901/t/data/test.pfam
BioPerl-1.6.901/t/data/test.phd
BioPerl-1.6.901/t/data/test.pir
BioPerl-1.6.901/t/data/test.pln
BioPerl-1.6.901/t/data/test.ptt
BioPerl-1.6.901/t/data/test.raw
BioPerl-1.6.901/t/data/test.ref.fas
BioPerl-1.6.901/t/data/test.swiss
BioPerl-1.6.901/t/data/test.tab
BioPerl-1.6.901/t/data/test.tigrxml
BioPerl-1.6.901/t/data/test.tseq
BioPerl-1.6.901/t/data/test.tsv
BioPerl-1.6.901/t/data/test.txt
BioPerl-1.6.901/t/data/test.waba
BioPerl-1.6.901/t/data/test.xls
BioPerl-1.6.901/t/data/test.ztr
BioPerl-1.6.901/t/data/test1.blasttab3
BioPerl-1.6.901/t/data/test1.wublastp
BioPerl-1.6.901/t/data/test2.infernal
BioPerl-1.6.901/t/data/test2.raw
BioPerl-1.6.901/t/data/test_badlf.gcg
BioPerl-1.6.901/t/data/test_clear_range.fastq
BioPerl-1.6.901/t/data/test_data.axt
BioPerl-1.6.901/t/data/test_singlets.cns.fastq
BioPerl-1.6.901/t/data/test_singlets.maq
BioPerl-1.6.901/t/data/testaln.aln
BioPerl-1.6.901/t/data/testaln.arp
BioPerl-1.6.901/t/data/testaln.fasta
BioPerl-1.6.901/t/data/testaln.fastq
BioPerl-1.6.901/t/data/testaln.list
BioPerl-1.6.901/t/data/testaln.mase
BioPerl-1.6.901/t/data/testaln.metafasta
BioPerl-1.6.901/t/data/testaln.msf
BioPerl-1.6.901/t/data/testaln.nexus
BioPerl-1.6.901/t/data/testaln.pfam
BioPerl-1.6.901/t/data/testaln.phylip
BioPerl-1.6.901/t/data/testaln.po
BioPerl-1.6.901/t/data/testaln.prodom
BioPerl-1.6.901/t/data/testaln.psi
BioPerl-1.6.901/t/data/testaln.selex
BioPerl-1.6.901/t/data/testaln.stockholm
BioPerl-1.6.901/t/data/testaln.xmfa
BioPerl-1.6.901/t/data/testaln2.arp
BioPerl-1.6.901/t/data/testaln2.fasta
BioPerl-1.6.901/t/data/testdat.exonerate
BioPerl-1.6.901/t/data/testdata.crossmatch
BioPerl-1.6.901/t/data/testdbaccnums.out
BioPerl-1.6.901/t/data/testfile.erpin
BioPerl-1.6.901/t/data/testfuzzy.genbank
BioPerl-1.6.901/t/data/tmhmm.out
BioPerl-1.6.901/t/data/tmp.fst
BioPerl-1.6.901/t/data/tol-2010-02-18.nhx
BioPerl-1.6.901/t/data/traits.tab
BioPerl-1.6.901/t/data/traittree.nexus
BioPerl-1.6.901/t/data/transfac.dat
BioPerl-1.6.901/t/data/tree_nonewline.nexus
BioPerl-1.6.901/t/data/Treebase-chlamy-dna.nex
BioPerl-1.6.901/t/data/trees.nexml.old.xml
BioPerl-1.6.901/t/data/tricky.wublast
BioPerl-1.6.901/t/data/trna.strict.rnamotif
BioPerl-1.6.901/t/data/U58726.gb
BioPerl-1.6.901/t/data/U71225.gb
BioPerl-1.6.901/t/data/U71225.gb.unix
BioPerl-1.6.901/t/data/U71225.gb.win
BioPerl-1.6.901/t/data/U83300.bsml
BioPerl-1.6.901/t/data/UnaSmithHIV-both.nex
BioPerl-1.6.901/t/data/unigene.data
BioPerl-1.6.901/t/data/urease.tre.nexus
BioPerl-1.6.901/t/data/vecscreen_simple.test_output
BioPerl-1.6.901/t/data/version2.scf
BioPerl-1.6.901/t/data/version3.scf
BioPerl-1.6.901/t/data/wellcome_tol.nhx
BioPerl-1.6.901/t/data/withrefm.906
BioPerl-1.6.901/t/data/worm_fam_2785.cdna
BioPerl-1.6.901/t/data/X98338_Adh-mRNA.gb
BioPerl-1.6.901/t/data/yeast.tRNAscanSE
BioPerl-1.6.901/t/data/yn00.mlc
BioPerl-1.6.901/t/data/ZABJ4EA7014.CH878695.1.blast.txt
BioPerl-1.6.901/t/data/bad_dbfa
BioPerl-1.6.901/t/data/bad_dbfa/bug3172.fa
BioPerl-1.6.901/t/data/biodbgff
BioPerl-1.6.901/t/data/biodbgff/test.gff
BioPerl-1.6.901/t/data/biodbgff/test.gff3
BioPerl-1.6.901/t/data/codeml_lysozyme
BioPerl-1.6.901/t/data/codeml_lysozyme/2NG.dN
BioPerl-1.6.901/t/data/codeml_lysozyme/2NG.dS
BioPerl-1.6.901/t/data/codeml_lysozyme/2NG.tt
BioPerl-1.6.901/t/data/codeml_lysozyme/4fold.nuc
BioPerl-1.6.901/t/data/codeml_lysozyme/lnf
BioPerl-1.6.901/t/data/codeml_lysozyme/lysozymeSmall.ctl
BioPerl-1.6.901/t/data/codeml_lysozyme/lysozymeSmall.trees
BioPerl-1.6.901/t/data/codeml_lysozyme/lysozymeSmall.txt
BioPerl-1.6.901/t/data/codeml_lysozyme/mlc
BioPerl-1.6.901/t/data/codeml_lysozyme/rst
BioPerl-1.6.901/t/data/codeml_lysozyme/rst1
BioPerl-1.6.901/t/data/codeml_lysozyme/rub
BioPerl-1.6.901/t/data/consed_project
BioPerl-1.6.901/t/data/consed_project/edit_dir
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.contigs
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.log
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.1
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.ace.2
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.contigs.qual
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.log
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.problems
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.problems.qual
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.qual
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.singlets
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.fasta.screen.view
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.newtags
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.phrap.out
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project.screen.out
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_project_to_alu.cross
BioPerl-1.6.901/t/data/consed_project/edit_dir/test_projectNewChromats.fof
BioPerl-1.6.901/t/data/consed_project/phd_dir
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4922R.phd.1
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4924F.phd.1
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4924R.phd.1
BioPerl-1.6.901/t/data/consed_project/phd_dir/ML4947F.phd.1
BioPerl-1.6.901/t/data/dbfa
BioPerl-1.6.901/t/data/dbfa/1.fa
BioPerl-1.6.901/t/data/dbfa/2.fa
BioPerl-1.6.901/t/data/dbfa/3.fa
BioPerl-1.6.901/t/data/dbfa/4.fa
BioPerl-1.6.901/t/data/dbfa/5.fa
BioPerl-1.6.901/t/data/dbfa/6.fa
BioPerl-1.6.901/t/data/dbfa/7.fa
BioPerl-1.6.901/t/data/dbqual
BioPerl-1.6.901/t/data/dbqual/1.qual
BioPerl-1.6.901/t/data/dbqual/2.qual
BioPerl-1.6.901/t/data/dbqual/3.qual
BioPerl-1.6.901/t/data/eutils
BioPerl-1.6.901/t/data/eutils/egquery.xml
BioPerl-1.6.901/t/data/eutils/einfo.xml
BioPerl-1.6.901/t/data/eutils/einfo_dbs.xml
BioPerl-1.6.901/t/data/eutils/elink_acheck.xml
BioPerl-1.6.901/t/data/eutils/elink_acheck_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_dball.xml
BioPerl-1.6.901/t/data/eutils/elink_lcheck.xml
BioPerl-1.6.901/t/data/eutils/elink_lcheck_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_llinks.xml
BioPerl-1.6.901/t/data/eutils/elink_llinks_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_multidb.xml
BioPerl-1.6.901/t/data/eutils/elink_multidb_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_ncheck.xml
BioPerl-1.6.901/t/data/eutils/elink_ncheck_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_neighbor.xml
BioPerl-1.6.901/t/data/eutils/elink_neighbor_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_nhist.xml
BioPerl-1.6.901/t/data/eutils/elink_nhist_corr.xml
BioPerl-1.6.901/t/data/eutils/elink_scores.xml
BioPerl-1.6.901/t/data/eutils/epost.xml
BioPerl-1.6.901/t/data/eutils/esearch1.xml
BioPerl-1.6.901/t/data/eutils/esearch2.xml
BioPerl-1.6.901/t/data/eutils/espell.xml
BioPerl-1.6.901/t/data/eutils/esummary1.xml
BioPerl-1.6.901/t/data/eutils/esummary2.xml
BioPerl-1.6.901/t/data/fastq
BioPerl-1.6.901/t/data/fastq/bug2335.fastq
BioPerl-1.6.901/t/data/fastq/error_diff_ids.fastq
BioPerl-1.6.901/t/data/fastq/error_double_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_double_seq.fastq
BioPerl-1.6.901/t/data/fastq/error_long_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_no_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_del.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_escape.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_null.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_space.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_tab.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_unit_sep.fastq
BioPerl-1.6.901/t/data/fastq/error_qual_vtab.fastq
BioPerl-1.6.901/t/data/fastq/error_short_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_spaces.fastq
BioPerl-1.6.901/t/data/fastq/error_tabs.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_at_plus.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_at_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_at_seq.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_plus.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_qual.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_seq.fastq
BioPerl-1.6.901/t/data/fastq/error_trunc_in_title.fastq
BioPerl-1.6.901/t/data/fastq/evil_wrapping.fastq
BioPerl-1.6.901/t/data/fastq/example.fasta
BioPerl-1.6.901/t/data/fastq/example.fastq
BioPerl-1.6.901/t/data/fastq/example.qual
BioPerl-1.6.901/t/data/fastq/illumina_faked.fastq
BioPerl-1.6.901/t/data/fastq/sanger_93.fastq
BioPerl-1.6.901/t/data/fastq/sanger_faked.fastq
BioPerl-1.6.901/t/data/fastq/solexa_example.fastq
BioPerl-1.6.901/t/data/fastq/solexa_faked.fastq
BioPerl-1.6.901/t/data/fastq/test1_sanger.fastq
BioPerl-1.6.901/t/data/fastq/test2_solexa.fastq
BioPerl-1.6.901/t/data/fastq/test3_illumina.fastq
BioPerl-1.6.901/t/data/fastq/tricky.fastq
BioPerl-1.6.901/t/data/fastq/wrapping_issues.fastq
BioPerl-1.6.901/t/data/map_hem
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM12.fa.revcom
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM2.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM2.fa.revcom
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM2.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM3.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM3.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM4.fa
BioPerl-1.6.901/t/data/map_hem/HEM1-HEM4.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM1.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM1.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM12-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM12.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM12.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM13-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM13.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM13.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM14-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM14-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM14.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM14.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM15.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM15.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM3.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM3.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM4.fa
BioPerl-1.6.901/t/data/map_hem/HEM2-HEM4.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM2.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM2.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM4.fa
BioPerl-1.6.901/t/data/map_hem/HEM3-HEM4.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM3.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM3.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM12.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM12.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM13.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM13.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM14.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM14.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM15.fa
BioPerl-1.6.901/t/data/map_hem/HEM4-HEM15.meme.txt
BioPerl-1.6.901/t/data/map_hem/HEM4.ups.fa_
BioPerl-1.6.901/t/data/map_hem/HEM4.ups.fa_.revcom
BioPerl-1.6.901/t/data/map_hem/yeast.nc.1.freq
BioPerl-1.6.901/t/data/mbsout
BioPerl-1.6.901/t/data/mbsout/mbsout_infile1
BioPerl-1.6.901/t/data/mbsout/mbsout_infile2
BioPerl-1.6.901/t/data/mbsout/mbsout_infile3
BioPerl-1.6.901/t/data/msout
BioPerl-1.6.901/t/data/msout/msout_infile1
BioPerl-1.6.901/t/data/msout/msout_infile2
BioPerl-1.6.901/t/data/msout/msout_infile3
BioPerl-1.6.901/t/data/msout/msout_infile4
BioPerl-1.6.901/t/data/nexml
BioPerl-1.6.901/t/data/nexml/characters.nexml.8.xml
BioPerl-1.6.901/t/data/nexml/characters.nexml.xml
BioPerl-1.6.901/t/data/nexml/trees.nexml.8.xml
BioPerl-1.6.901/t/data/nexml/trees.nexml.xml
BioPerl-1.6.901/t/data/registry
BioPerl-1.6.901/t/data/registry/bdb
BioPerl-1.6.901/t/data/registry/bdb/seqdatabase.ini
BioPerl-1.6.901/t/data/registry/flat
BioPerl-1.6.901/t/data/registry/flat/seqdatabase.ini
BioPerl-1.6.901/t/data/seqfeaturedb
BioPerl-1.6.901/t/data/seqfeaturedb/test.gff3
BioPerl-1.6.901/t/data/taxdump
BioPerl-1.6.901/t/data/taxdump/names.dmp
BioPerl-1.6.901/t/data/taxdump/nodes.dmp
BioPerl-1.6.901/t/data/transfac_pro
BioPerl-1.6.901/t/data/transfac_pro/factor.dat
BioPerl-1.6.901/t/data/transfac_pro/fragment.dat
BioPerl-1.6.901/t/data/transfac_pro/gene.dat
BioPerl-1.6.901/t/data/transfac_pro/matrix.dat
BioPerl-1.6.901/t/data/transfac_pro/readme.txt
BioPerl-1.6.901/t/data/transfac_pro/reference.dat
BioPerl-1.6.901/t/data/transfac_pro/site.dat
BioPerl-1.6.901/t/Draw
BioPerl-1.6.901/t/Draw/Pictogram.t
BioPerl-1.6.901/t/lib
BioPerl-1.6.901/t/lib/Error.pm
BioPerl-1.6.901/t/lib/Array
BioPerl-1.6.901/t/lib/Array/Compare.pm
BioPerl-1.6.901/t/lib/Sub
BioPerl-1.6.901/t/lib/Sub/Uplevel.pm
BioPerl-1.6.901/t/lib/Test
BioPerl-1.6.901/t/lib/Test/Builder.pm
BioPerl-1.6.901/t/lib/Test/Exception.pm
BioPerl-1.6.901/t/lib/Test/Harness.pm
BioPerl-1.6.901/t/lib/Test/More.pm
BioPerl-1.6.901/t/lib/Test/Simple.pm
BioPerl-1.6.901/t/lib/Test/Tutorial.pod
BioPerl-1.6.901/t/lib/Test/Warn.pm
BioPerl-1.6.901/t/lib/Test/Builder
BioPerl-1.6.901/t/lib/Test/Builder/Module.pm
BioPerl-1.6.901/t/lib/Test/Builder/Tester.pm
BioPerl-1.6.901/t/lib/Test/Builder/Tester
BioPerl-1.6.901/t/lib/Test/Builder/Tester/Color.pm
BioPerl-1.6.901/t/lib/Test/Harness
BioPerl-1.6.901/t/lib/Test/Harness/Assert.pm
BioPerl-1.6.901/t/lib/Test/Harness/Iterator.pm
BioPerl-1.6.901/t/lib/Test/Harness/Point.pm
BioPerl-1.6.901/t/lib/Test/Harness/Results.pm
BioPerl-1.6.901/t/lib/Test/Harness/Straps.pm
BioPerl-1.6.901/t/lib/Test/Harness/TAP.pod
BioPerl-1.6.901/t/lib/Test/Harness/Util.pm
BioPerl-1.6.901/t/lib/Tree
BioPerl-1.6.901/t/lib/Tree/DAG_Node.pm
BioPerl-1.6.901/t/LiveSeq
BioPerl-1.6.901/t/LiveSeq/Chain.t
BioPerl-1.6.901/t/LiveSeq/LiveSeq.t
BioPerl-1.6.901/t/LiveSeq/Mutation.t
BioPerl-1.6.901/t/LiveSeq/Mutator.t
BioPerl-1.6.901/t/LocalDB
BioPerl-1.6.901/t/LocalDB/BioDBGFF.t
BioPerl-1.6.901/t/LocalDB/DBFasta.t
BioPerl-1.6.901/t/LocalDB/DBQual.t
BioPerl-1.6.901/t/LocalDB/Flat.t
BioPerl-1.6.901/t/LocalDB/Registry.t
BioPerl-1.6.901/t/LocalDB/SeqFeature.t
BioPerl-1.6.901/t/LocalDB/transfac_pro.t
BioPerl-1.6.901/t/LocalDB/Index
BioPerl-1.6.901/t/LocalDB/Index/Blast.t
BioPerl-1.6.901/t/LocalDB/Index/BlastTable.t
BioPerl-1.6.901/t/LocalDB/Index/Index.t
BioPerl-1.6.901/t/Map
BioPerl-1.6.901/t/Map/Cyto.t
BioPerl-1.6.901/t/Map/Linkage.t
BioPerl-1.6.901/t/Map/Map.t
BioPerl-1.6.901/t/Map/MapIO.t
BioPerl-1.6.901/t/Map/MicrosatelliteMarker.t
BioPerl-1.6.901/t/Map/Physical.t
BioPerl-1.6.901/t/Matrix
BioPerl-1.6.901/t/Matrix/InstanceSite.t
BioPerl-1.6.901/t/Matrix/Matrix.t
BioPerl-1.6.901/t/Matrix/ProtMatrix.t
BioPerl-1.6.901/t/Matrix/ProtPsm.t
BioPerl-1.6.901/t/Matrix/SiteMatrix.t
BioPerl-1.6.901/t/Matrix/IO
BioPerl-1.6.901/t/Matrix/IO/masta.t
BioPerl-1.6.901/t/Matrix/IO/psm.t
BioPerl-1.6.901/t/Ontology
BioPerl-1.6.901/t/Ontology/GOterm.t
BioPerl-1.6.901/t/Ontology/GraphAdaptor.t
BioPerl-1.6.901/t/Ontology/Ontology.t
BioPerl-1.6.901/t/Ontology/OntologyEngine.t
BioPerl-1.6.901/t/Ontology/OntologyStore.t
BioPerl-1.6.901/t/Ontology/Relationship.t
BioPerl-1.6.901/t/Ontology/RelationshipType.t
BioPerl-1.6.901/t/Ontology/Term.t
BioPerl-1.6.901/t/Ontology/IO
BioPerl-1.6.901/t/Ontology/IO/go.t
BioPerl-1.6.901/t/Ontology/IO/interpro.t
BioPerl-1.6.901/t/Ontology/IO/obo.t
BioPerl-1.6.901/t/Phenotype
BioPerl-1.6.901/t/Phenotype/Correlate.t
BioPerl-1.6.901/t/Phenotype/Measure.t
BioPerl-1.6.901/t/Phenotype/MeSH.t
BioPerl-1.6.901/t/Phenotype/MiniMIMentry.t
BioPerl-1.6.901/t/Phenotype/OMIMentry.t
BioPerl-1.6.901/t/Phenotype/OMIMentryAllelicVariant.t
BioPerl-1.6.901/t/Phenotype/OMIMparser.t
BioPerl-1.6.901/t/Phenotype/Phenotype.t
BioPerl-1.6.901/t/PopGen
BioPerl-1.6.901/t/PopGen/Coalescent.t
BioPerl-1.6.901/t/PopGen/HtSNP.t
BioPerl-1.6.901/t/PopGen/MK.t
BioPerl-1.6.901/t/PopGen/PopGen.t
BioPerl-1.6.901/t/PopGen/PopGenSims.t
BioPerl-1.6.901/t/PopGen/TagHaplotype.t
BioPerl-1.6.901/t/RemoteDB
BioPerl-1.6.901/t/RemoteDB/BioFetch.t
BioPerl-1.6.901/t/RemoteDB/CUTG.t
BioPerl-1.6.901/t/RemoteDB/EMBL.t
BioPerl-1.6.901/t/RemoteDB/EntrezGene.t
BioPerl-1.6.901/t/RemoteDB/EUtilities.t
BioPerl-1.6.901/t/RemoteDB/GenBank.t
BioPerl-1.6.901/t/RemoteDB/GenPept.t
BioPerl-1.6.901/t/RemoteDB/MeSH.t
BioPerl-1.6.901/t/RemoteDB/RefSeq.t
BioPerl-1.6.901/t/RemoteDB/SeqHound.t
BioPerl-1.6.901/t/RemoteDB/SeqRead_fail.t
BioPerl-1.6.901/t/RemoteDB/SeqVersion.t
BioPerl-1.6.901/t/RemoteDB/SwissProt.t
BioPerl-1.6.901/t/RemoteDB/Taxonomy.t
BioPerl-1.6.901/t/RemoteDB/HIV
BioPerl-1.6.901/t/RemoteDB/HIV/HIV.t
BioPerl-1.6.901/t/RemoteDB/HIV/HIVAnnotProcessor.t
BioPerl-1.6.901/t/RemoteDB/HIV/HIVQuery.t
BioPerl-1.6.901/t/RemoteDB/HIV/HIVQueryHelper.t
BioPerl-1.6.901/t/RemoteDB/Query
BioPerl-1.6.901/t/RemoteDB/Query/GenBank.t
BioPerl-1.6.901/t/Restriction
BioPerl-1.6.901/t/Restriction/Analysis-refac.t
BioPerl-1.6.901/t/Restriction/Analysis.t
BioPerl-1.6.901/t/Restriction/Gel.t
BioPerl-1.6.901/t/Restriction/IO.t
BioPerl-1.6.901/t/Root
BioPerl-1.6.901/t/Root/Exception.t
BioPerl-1.6.901/t/Root/HTTPget.t
BioPerl-1.6.901/t/Root/RootI.t
BioPerl-1.6.901/t/Root/RootIO.t
BioPerl-1.6.901/t/Root/Storable.t
BioPerl-1.6.901/t/Root/Tempfile.t
BioPerl-1.6.901/t/Root/Utilities.t
BioPerl-1.6.901/t/SearchIO
BioPerl-1.6.901/t/SearchIO/axt.t
BioPerl-1.6.901/t/SearchIO/blast.t
BioPerl-1.6.901/t/SearchIO/blast_pull.t
BioPerl-1.6.901/t/SearchIO/blasttable.t
BioPerl-1.6.901/t/SearchIO/blastxml.t
BioPerl-1.6.901/t/SearchIO/CigarString.t
BioPerl-1.6.901/t/SearchIO/cross_match.t
BioPerl-1.6.901/t/SearchIO/erpin.t
BioPerl-1.6.901/t/SearchIO/exonerate.t
BioPerl-1.6.901/t/SearchIO/fasta.t
BioPerl-1.6.901/t/SearchIO/gmap_f9.t
BioPerl-1.6.901/t/SearchIO/hmmer.t
BioPerl-1.6.901/t/SearchIO/hmmer_pull.t
BioPerl-1.6.901/t/SearchIO/infernal.t
BioPerl-1.6.901/t/SearchIO/megablast.t
BioPerl-1.6.901/t/SearchIO/psl.t
BioPerl-1.6.901/t/SearchIO/rnamotif.t
BioPerl-1.6.901/t/SearchIO/SearchIO.t
BioPerl-1.6.901/t/SearchIO/sim4.t
BioPerl-1.6.901/t/SearchIO/SimilarityPair.t
BioPerl-1.6.901/t/SearchIO/Tiling.t
BioPerl-1.6.901/t/SearchIO/waba.t
BioPerl-1.6.901/t/SearchIO/wise.t
BioPerl-1.6.901/t/SearchIO/Writer
BioPerl-1.6.901/t/SearchIO/Writer/GbrowseGFF.t
BioPerl-1.6.901/t/SearchIO/Writer/HitTableWriter.t
BioPerl-1.6.901/t/SearchIO/Writer/HSPTableWriter.t
BioPerl-1.6.901/t/SearchIO/Writer/HTMLWriter.t
BioPerl-1.6.901/t/SearchIO/Writer/TextWriter.t
BioPerl-1.6.901/t/Seq
BioPerl-1.6.901/t/Seq/DBLink.t
BioPerl-1.6.901/t/Seq/EncodedSeq.t
BioPerl-1.6.901/t/Seq/LargeLocatableSeq.t
BioPerl-1.6.901/t/Seq/LargePSeq.t
BioPerl-1.6.901/t/Seq/LocatableSeq.t
BioPerl-1.6.901/t/Seq/MetaSeq.t
BioPerl-1.6.901/t/Seq/PrimaryQual.t
BioPerl-1.6.901/t/Seq/PrimarySeq.t
BioPerl-1.6.901/t/Seq/PrimedSeq.t
BioPerl-1.6.901/t/Seq/Quality.t
BioPerl-1.6.901/t/Seq/Seq.t
BioPerl-1.6.901/t/Seq/WithQuality.t
BioPerl-1.6.901/t/SeqFeature
BioPerl-1.6.901/t/SeqFeature/Clone.t
BioPerl-1.6.901/t/SeqFeature/FeatureIO.t
BioPerl-1.6.901/t/SeqFeature/Location.t
BioPerl-1.6.901/t/SeqFeature/LocationFactory.t
BioPerl-1.6.901/t/SeqFeature/Primer.t
BioPerl-1.6.901/t/SeqFeature/Range.t
BioPerl-1.6.901/t/SeqFeature/RangeI.t
BioPerl-1.6.901/t/SeqFeature/SeqAnalysisParser.t
BioPerl-1.6.901/t/SeqFeature/SeqFeatAnnotated.t
BioPerl-1.6.901/t/SeqFeature/SeqFeatCollection.t
BioPerl-1.6.901/t/SeqFeature/SeqFeature.t
BioPerl-1.6.901/t/SeqFeature/SeqFeaturePrimer.t
BioPerl-1.6.901/t/SeqFeature/Unflattener.t
BioPerl-1.6.901/t/SeqFeature/Unflattener2.t
BioPerl-1.6.901/t/SeqIO
BioPerl-1.6.901/t/SeqIO/abi.t
BioPerl-1.6.901/t/SeqIO/ace.t
BioPerl-1.6.901/t/SeqIO/agave.t
BioPerl-1.6.901/t/SeqIO/alf.t
BioPerl-1.6.901/t/SeqIO/asciitree.t
BioPerl-1.6.901/t/SeqIO/bsml.t
BioPerl-1.6.901/t/SeqIO/bsml_sax.t
BioPerl-1.6.901/t/SeqIO/chadoxml.t
BioPerl-1.6.901/t/SeqIO/chaos.t
BioPerl-1.6.901/t/SeqIO/chaosxml.t
BioPerl-1.6.901/t/SeqIO/ctf.t
BioPerl-1.6.901/t/SeqIO/embl.t
BioPerl-1.6.901/t/SeqIO/entrezgene.t
BioPerl-1.6.901/t/SeqIO/excel.t
BioPerl-1.6.901/t/SeqIO/exp.t
BioPerl-1.6.901/t/SeqIO/fasta.t
BioPerl-1.6.901/t/SeqIO/fastq.t
BioPerl-1.6.901/t/SeqIO/flybase_chadoxml.t
BioPerl-1.6.901/t/SeqIO/game.t
BioPerl-1.6.901/t/SeqIO/gbxml.t
BioPerl-1.6.901/t/SeqIO/gcg.t
BioPerl-1.6.901/t/SeqIO/genbank.t
BioPerl-1.6.901/t/SeqIO/Handler.t
BioPerl-1.6.901/t/SeqIO/interpro.t
BioPerl-1.6.901/t/SeqIO/kegg.t
BioPerl-1.6.901/t/SeqIO/largefasta.t
BioPerl-1.6.901/t/SeqIO/lasergene.t
BioPerl-1.6.901/t/SeqIO/locuslink.t
BioPerl-1.6.901/t/SeqIO/mbsout.t
BioPerl-1.6.901/t/SeqIO/metafasta.t
BioPerl-1.6.901/t/SeqIO/msout.t
BioPerl-1.6.901/t/SeqIO/MultiFile.t
BioPerl-1.6.901/t/SeqIO/Multiple_fasta.t
BioPerl-1.6.901/t/SeqIO/nexml.t
BioPerl-1.6.901/t/SeqIO/phd.t
BioPerl-1.6.901/t/SeqIO/pir.t
BioPerl-1.6.901/t/SeqIO/pln.t
BioPerl-1.6.901/t/SeqIO/qual.t
BioPerl-1.6.901/t/SeqIO/raw.t
BioPerl-1.6.901/t/SeqIO/scf.t
BioPerl-1.6.901/t/SeqIO/SeqBuilder.t
BioPerl-1.6.901/t/SeqIO/SeqIO.t
BioPerl-1.6.901/t/SeqIO/seqxml.t
BioPerl-1.6.901/t/SeqIO/Splicedseq.t
BioPerl-1.6.901/t/SeqIO/strider.t
BioPerl-1.6.901/t/SeqIO/swiss.t
BioPerl-1.6.901/t/SeqIO/tab.t
BioPerl-1.6.901/t/SeqIO/table.t
BioPerl-1.6.901/t/SeqIO/tigr.t
BioPerl-1.6.901/t/SeqIO/tigrxml.t
BioPerl-1.6.901/t/SeqIO/tinyseq.t
BioPerl-1.6.901/t/SeqIO/ztr.t
BioPerl-1.6.901/t/SeqTools
BioPerl-1.6.901/t/SeqTools/Backtranslate.t
BioPerl-1.6.901/t/SeqTools/CodonTable.t
BioPerl-1.6.901/t/SeqTools/ECnumber.t
BioPerl-1.6.901/t/SeqTools/GuessSeqFormat.t
BioPerl-1.6.901/t/SeqTools/OddCodes.t
BioPerl-1.6.901/t/SeqTools/SeqPattern.t
BioPerl-1.6.901/t/SeqTools/SeqStats.t
BioPerl-1.6.901/t/SeqTools/SeqUtils.t
BioPerl-1.6.901/t/SeqTools/SeqWords.t
BioPerl-1.6.901/t/Structure
BioPerl-1.6.901/t/Structure/IO.t
BioPerl-1.6.901/t/Structure/Structure.t
BioPerl-1.6.901/t/Tools
BioPerl-1.6.901/t/Tools/ePCR.t
BioPerl-1.6.901/t/Tools/Est2Genome.t
BioPerl-1.6.901/t/Tools/FootPrinter.t
BioPerl-1.6.901/t/Tools/Geneid.t
BioPerl-1.6.901/t/Tools/Genewise.t
BioPerl-1.6.901/t/Tools/Genomewise.t
BioPerl-1.6.901/t/Tools/Genpred.t
BioPerl-1.6.901/t/Tools/GFF.t
BioPerl-1.6.901/t/Tools/GuessSeqFormat.t
BioPerl-1.6.901/t/Tools/Hmmer.t
BioPerl-1.6.901/t/Tools/IUPAC.t
BioPerl-1.6.901/t/Tools/Lucy.t
BioPerl-1.6.901/t/Tools/Match.t
BioPerl-1.6.901/t/Tools/pICalculator.t
BioPerl-1.6.901/t/Tools/Primer3.t
BioPerl-1.6.901/t/Tools/Promoterwise.t
BioPerl-1.6.901/t/Tools/Pseudowise.t
BioPerl-1.6.901/t/Tools/QRNA.t
BioPerl-1.6.901/t/Tools/RandDistFunctions.t
BioPerl-1.6.901/t/Tools/RepeatMasker.t
BioPerl-1.6.901/t/Tools/rnamotif.t
BioPerl-1.6.901/t/Tools/Seg.t
BioPerl-1.6.901/t/Tools/Sigcleave.t
BioPerl-1.6.901/t/Tools/Signalp.t
BioPerl-1.6.901/t/Tools/Sim4.t
BioPerl-1.6.901/t/Tools/SiRNA.t
BioPerl-1.6.901/t/Tools/TandemRepeatsFinder.t
BioPerl-1.6.901/t/Tools/TargetP.t
BioPerl-1.6.901/t/Tools/Tmhmm.t
BioPerl-1.6.901/t/Tools/tRNAscanSE.t
BioPerl-1.6.901/t/Tools/Alignment
BioPerl-1.6.901/t/Tools/Alignment/Consed.t
BioPerl-1.6.901/t/Tools/Analysis
BioPerl-1.6.901/t/Tools/Analysis/DNA
BioPerl-1.6.901/t/Tools/Analysis/DNA/ESEfinder.t
BioPerl-1.6.901/t/Tools/Analysis/Protein
BioPerl-1.6.901/t/Tools/Analysis/Protein/Domcut.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/ELM.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/GOR4.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/HNN.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/Mitoprot.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/NetPhos.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/Scansite.t
BioPerl-1.6.901/t/Tools/Analysis/Protein/Sopma.t
BioPerl-1.6.901/t/Tools/EMBOSS
BioPerl-1.6.901/t/Tools/EMBOSS/Palindrome.t
BioPerl-1.6.901/t/Tools/EUtilities
BioPerl-1.6.901/t/Tools/EUtilities/egquery.t
BioPerl-1.6.901/t/Tools/EUtilities/einfo.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_acheck.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_lcheck.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_llinks.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_ncheck.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_neighbor.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_neighbor_history.t
BioPerl-1.6.901/t/Tools/EUtilities/elink_scores.t
BioPerl-1.6.901/t/Tools/EUtilities/epost.t
BioPerl-1.6.901/t/Tools/EUtilities/esearch.t
BioPerl-1.6.901/t/Tools/EUtilities/espell.t
BioPerl-1.6.901/t/Tools/EUtilities/esummary.t
BioPerl-1.6.901/t/Tools/EUtilities/EUtilParameters.t
BioPerl-1.6.901/t/Tools/Phylo
BioPerl-1.6.901/t/Tools/Phylo/Gerp.t
BioPerl-1.6.901/t/Tools/Phylo/Molphy.t
BioPerl-1.6.901/t/Tools/Phylo/PAML.t
BioPerl-1.6.901/t/Tools/Phylo/Phylip
BioPerl-1.6.901/t/Tools/Phylo/Phylip/ProtDist.t
BioPerl-1.6.901/t/Tools/Run
BioPerl-1.6.901/t/Tools/Run/Dummy.pm
BioPerl-1.6.901/t/Tools/Run/RemoteBlast.t
BioPerl-1.6.901/t/Tools/Run/RemoteBlast_rpsblast.t
BioPerl-1.6.901/t/Tools/Run/StandAloneBlast.t
BioPerl-1.6.901/t/Tools/Run/WBCommandExts.t
BioPerl-1.6.901/t/Tools/Run/WrapperBase.t
BioPerl-1.6.901/t/Tools/Run/Dummy
BioPerl-1.6.901/t/Tools/Run/Dummy/Config.pm
BioPerl-1.6.901/t/Tools/Signalp
BioPerl-1.6.901/t/Tools/Signalp/ExtendedSignalp.t
BioPerl-1.6.901/t/Tools/Spidey
BioPerl-1.6.901/t/Tools/Spidey/Spidey.t
BioPerl-1.6.901/t/Tree
BioPerl-1.6.901/t/Tree/Compatible.t
BioPerl-1.6.901/t/Tree/Node.t
BioPerl-1.6.901/t/Tree/RandomTreeFactory.t
BioPerl-1.6.901/t/Tree/Tree.t
BioPerl-1.6.901/t/Tree/TreeIO.t
BioPerl-1.6.901/t/Tree/TreeStatistics.t
BioPerl-1.6.901/t/Tree/PhyloNetwork
BioPerl-1.6.901/t/Tree/PhyloNetwork/Factory.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/GraphViz.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/MuVector.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/PhyloNetwork.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/RandomFactory.t
BioPerl-1.6.901/t/Tree/PhyloNetwork/TreeFactory.t
BioPerl-1.6.901/t/Tree/TreeIO
BioPerl-1.6.901/t/Tree/TreeIO/lintree.t
BioPerl-1.6.901/t/Tree/TreeIO/newick.t
BioPerl-1.6.901/t/Tree/TreeIO/nexml.t
BioPerl-1.6.901/t/Tree/TreeIO/nexus.t
BioPerl-1.6.901/t/Tree/TreeIO/nhx.t
BioPerl-1.6.901/t/Tree/TreeIO/phyloxml.t
BioPerl-1.6.901/t/Tree/TreeIO/svggraph.t
BioPerl-1.6.901/t/Tree/TreeIO/tabtree.t
BioPerl-1.6.901/t/Variation
BioPerl-1.6.901/t/Variation/AAChange.t
BioPerl-1.6.901/t/Variation/AAReverseMutate.t
BioPerl-1.6.901/t/Variation/Allele.t
BioPerl-1.6.901/t/Variation/DNAMutation.t
BioPerl-1.6.901/t/Variation/RNAChange.t
BioPerl-1.6.901/t/Variation/SeqDiff.t
BioPerl-1.6.901/t/Variation/SNP.t
BioPerl-1.6.901/t/Variation/Variation_IO.t
CPAN.pm: Going to build C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz
>>> /home/fly1600/ap1600/bin/perl-static Build.PL
could not find ParserDetails.ini in /home/fly1600/var/megalib/XML/SAX
Checking prerequisites...
recommends:
* GraphViz is not installed
Checking optional features...
EntrezGene............disabled
requires:
! Bio::ASN1::EntrezGene is not installed
ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the versions
of the modules indicated above before proceeding with this installation
############################# WARNING #############################
Bio::ASN1::EntrezGene not found. This is an *optional* module;
however, because it has a circular dependency with BioPerl we do not
include it on our list of recommended modules.
If you require EntrezGene functionality, you can install
Bio::ASN1::EntrezGene after BioPerl has finished installing.
############################# WARNING #############################
Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database tests
Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts
Do you want to run tests that require connection to servers across the internet
(likely to cause some failures)? y/n [n] - will not run internet-requiring tests
Created MYMETA.yml and MYMETA.json
Creating new 'Build' script for 'BioPerl' version '1.006901'
>>> ./Build
Building BioPerl
CJFIELDS/BioPerl-1.6.901.tar.gz
./Build -- OK
Running Build test
>>> ./Build test verbose=1
Copying scripts/utilities/bp_sreformat.PLS -> blib/script/bp_sreformat.PLS
Changing sharpbang in blib/script/bp_sreformat.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_sreformat.PLS.bak
Copying scripts/tree/tree2pag.PLS -> blib/script/tree2pag.PLS
Changing sharpbang in blib/script/tree2pag.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/tree2pag.PLS.bak
Copying scripts/Bio-DB-GFF/meta_gff.PLS -> blib/script/meta_gff.PLS
Changing sharpbang in blib/script/meta_gff.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/meta_gff.PLS.bak
Copying scripts/popgen/heterogeneity_test.PLS -> blib/script/heterogeneity_test.PLS
Changing sharpbang in blib/script/heterogeneity_test.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/heterogeneity_test.PLS.bak
Copying scripts/DB/flanks.PLS -> blib/script/flanks.PLS
Changing sharpbang in blib/script/flanks.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/flanks.PLS.bak
Copying scripts/DB/biogetseq.PLS -> blib/script/biogetseq.PLS
Changing sharpbang in blib/script/biogetseq.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/biogetseq.PLS.bak
Copying scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.PLS -> blib/script/bp_seqfeature_delete.PLS
Changing sharpbang in blib/script/bp_seqfeature_delete.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_seqfeature_delete.PLS.bak
Copying scripts/searchio/fastam9_to_table.PLS -> blib/script/fastam9_to_table.PLS
Changing sharpbang in blib/script/fastam9_to_table.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/fastam9_to_table.PLS.bak
Copying scripts/utilities/seq_length.PLS -> blib/script/seq_length.PLS
Changing sharpbang in blib/script/seq_length.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/seq_length.PLS.bak
Copying scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.PLS -> blib/script/bp_seqfeature_load.PLS
Changing sharpbang in blib/script/bp_seqfeature_load.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_seqfeature_load.PLS.bak
Copying scripts/Bio-DB-GFF/genbank2gff.PLS -> blib/script/genbank2gff.PLS
Changing sharpbang in blib/script/genbank2gff.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/genbank2gff.PLS.bak
Copying scripts/das/das_server.pl -> blib/script/das_server.pl
Changing sharpbang in blib/script/das_server.pl to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/das_server.pl.bak
Copying scripts/taxa/taxid4species.PLS -> blib/script/taxid4species.PLS
Changing sharpbang in blib/script/taxid4species.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/taxid4species.PLS.bak
Copying scripts/tree/blast2tree.PLS -> blib/script/blast2tree.PLS
Changing sharpbang in blib/script/blast2tree.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/blast2tree.PLS.bak
Copying scripts/taxa/query_entrez_taxa.PLS -> blib/script/query_entrez_taxa.PLS
Changing sharpbang in blib/script/query_entrez_taxa.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/query_entrez_taxa.PLS.bak
Copying scripts/utilities/bp_netinstall.PLS -> blib/script/bp_netinstall.PLS
Changing sharpbang in blib/script/bp_netinstall.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_netinstall.PLS.bak
Copying scripts/utilities/search2alnblocks.PLS -> blib/script/search2alnblocks.PLS
Changing sharpbang in blib/script/search2alnblocks.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/search2alnblocks.PLS.bak
Copying scripts/taxa/taxonomy2tree.PLS -> blib/script/taxonomy2tree.PLS
Changing sharpbang in blib/script/taxonomy2tree.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/taxonomy2tree.PLS.bak
Copying scripts/utilities/download_query_genbank.PLS -> blib/script/download_query_genbank.PLS
Changing sharpbang in blib/script/download_query_genbank.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/download_query_genbank.PLS.bak
Copying scripts/utilities/mask_by_search.PLS -> blib/script/mask_by_search.PLS
Changing sharpbang in blib/script/mask_by_search.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/mask_by_search.PLS.bak
Copying scripts/seqstats/gccalc.PLS -> blib/script/gccalc.PLS
Changing sharpbang in blib/script/gccalc.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/gccalc.PLS.bak
Copying scripts/popgen/composite_LD.PLS -> blib/script/composite_LD.PLS
Changing sharpbang in blib/script/composite_LD.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/composite_LD.PLS.bak
Copying scripts/seqstats/aacomp.PLS -> blib/script/aacomp.PLS
Changing sharpbang in blib/script/aacomp.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/aacomp.PLS.bak
Copying scripts/Bio-DB-GFF/process_wormbase.PLS -> blib/script/process_wormbase.PLS
Changing sharpbang in blib/script/process_wormbase.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/process_wormbase.PLS.bak
Copying scripts/taxa/local_taxonomydb_query.PLS -> blib/script/local_taxonomydb_query.PLS
Changing sharpbang in blib/script/local_taxonomydb_query.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/local_taxonomydb_query.PLS.bak
Copying scripts/biblio/biblio.PLS -> blib/script/biblio.PLS
Changing sharpbang in blib/script/biblio.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/biblio.PLS.bak
Copying scripts/seq/seqretsplit.PLS -> blib/script/seqretsplit.PLS
Changing sharpbang in blib/script/seqretsplit.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/seqretsplit.PLS.bak
Copying scripts/Bio-DB-GFF/genbank2gff3.PLS -> blib/script/genbank2gff3.PLS
Changing sharpbang in blib/script/genbank2gff3.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/genbank2gff3.PLS.bak
Copying scripts/utilities/search2BSML.PLS -> blib/script/search2BSML.PLS
Changing sharpbang in blib/script/search2BSML.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/search2BSML.PLS.bak
Copying scripts/seq/seqconvert.PLS -> blib/script/seqconvert.PLS
Changing sharpbang in blib/script/seqconvert.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/seqconvert.PLS.bak
Copying scripts/DB-HIV/hivq.PLS -> blib/script/hivq.PLS
Changing sharpbang in blib/script/hivq.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/hivq.PLS.bak
Copying scripts/searchio/parse_hmmsearch.PLS -> blib/script/parse_hmmsearch.PLS
Changing sharpbang in blib/script/parse_hmmsearch.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/parse_hmmsearch.PLS.bak
Copying scripts/index/bp_seqret.PLS -> blib/script/bp_seqret.PLS
Changing sharpbang in blib/script/bp_seqret.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_seqret.PLS.bak
Copying scripts/searchio/filter_search.PLS -> blib/script/filter_search.PLS
Changing sharpbang in blib/script/filter_search.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/filter_search.PLS.bak
Copying scripts/tree/nexus2nh.PLS -> blib/script/nexus2nh.PLS
Changing sharpbang in blib/script/nexus2nh.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/nexus2nh.PLS.bak
Copying scripts/Bio-DB-GFF/generate_histogram.PLS -> blib/script/generate_histogram.PLS
Changing sharpbang in blib/script/generate_histogram.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/generate_histogram.PLS.bak
Copying scripts/Bio-DB-GFF/load_gff.PLS -> blib/script/load_gff.PLS
Changing sharpbang in blib/script/load_gff.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/load_gff.PLS.bak
Copying scripts/seq/split_seq.PLS -> blib/script/split_seq.PLS
Changing sharpbang in blib/script/split_seq.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/split_seq.PLS.bak
Copying scripts/index/bp_fetch.PLS -> blib/script/bp_fetch.PLS
Changing sharpbang in blib/script/bp_fetch.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_fetch.PLS.bak
Copying scripts/utilities/mutate.PLS -> blib/script/mutate.PLS
Changing sharpbang in blib/script/mutate.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/mutate.PLS.bak
Copying scripts/Bio-DB-GFF/process_sgd.PLS -> blib/script/process_sgd.PLS
Changing sharpbang in blib/script/process_sgd.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/process_sgd.PLS.bak
Copying scripts/index/bp_index.PLS -> blib/script/bp_index.PLS
Changing sharpbang in blib/script/bp_index.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_index.PLS.bak
Copying scripts/utilities/dbsplit.PLS -> blib/script/dbsplit.PLS
Changing sharpbang in blib/script/dbsplit.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/dbsplit.PLS.bak
Copying scripts/seqstats/oligo_count.PLS -> blib/script/oligo_count.PLS
Changing sharpbang in blib/script/oligo_count.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/oligo_count.PLS.bak
Copying scripts/Bio-DB-GFF/process_gadfly.PLS -> blib/script/process_gadfly.PLS
Changing sharpbang in blib/script/process_gadfly.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/process_gadfly.PLS.bak
Copying scripts/searchio/hmmer_to_table.PLS -> blib/script/hmmer_to_table.PLS
Changing sharpbang in blib/script/hmmer_to_table.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/hmmer_to_table.PLS.bak
Copying scripts/DB/biofetch_genbank_proxy.PLS -> blib/script/biofetch_genbank_proxy.PLS
Changing sharpbang in blib/script/biofetch_genbank_proxy.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/biofetch_genbank_proxy.PLS.bak
Copying scripts/seq/extract_feature_seq.PLS -> blib/script/extract_feature_seq.PLS
Changing sharpbang in blib/script/extract_feature_seq.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/extract_feature_seq.PLS.bak
Copying scripts/Bio-DB-GFF/bulk_load_gff.PLS -> blib/script/bulk_load_gff.PLS
Changing sharpbang in blib/script/bulk_load_gff.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bulk_load_gff.PLS.bak
Copying scripts/utilities/search2gff.PLS -> blib/script/search2gff.PLS
Changing sharpbang in blib/script/search2gff.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/search2gff.PLS.bak
Copying scripts/seq/make_mrna_protein.PLS -> blib/script/make_mrna_protein.PLS
Changing sharpbang in blib/script/make_mrna_protein.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/make_mrna_protein.PLS.bak
Copying scripts/seq/unflatten_seq.PLS -> blib/script/unflatten_seq.PLS
Changing sharpbang in blib/script/unflatten_seq.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/unflatten_seq.PLS.bak
Copying scripts/utilities/search2tribe.PLS -> blib/script/search2tribe.PLS
Changing sharpbang in blib/script/search2tribe.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/search2tribe.PLS.bak
Copying scripts/DB/bioflat_index.PLS -> blib/script/bioflat_index.PLS
Changing sharpbang in blib/script/bioflat_index.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bioflat_index.PLS.bak
Copying scripts/utilities/pairwise_kaks.PLS -> blib/script/pairwise_kaks.PLS
Changing sharpbang in blib/script/pairwise_kaks.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/pairwise_kaks.PLS.bak
Copying scripts/Bio-DB-GFF/fast_load_gff.PLS -> blib/script/fast_load_gff.PLS
Changing sharpbang in blib/script/fast_load_gff.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/fast_load_gff.PLS.bak
Copying scripts/seqstats/chaos_plot.PLS -> blib/script/chaos_plot.PLS
Changing sharpbang in blib/script/chaos_plot.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/chaos_plot.PLS.bak
Copying scripts/utilities/bp_mrtrans.PLS -> blib/script/bp_mrtrans.PLS
Changing sharpbang in blib/script/bp_mrtrans.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_mrtrans.PLS.bak
Copying scripts/Bio-DB-EUtilities/einfo.PLS -> blib/script/einfo.PLS
Changing sharpbang in blib/script/einfo.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/einfo.PLS.bak
Copying scripts/utilities/bp_nrdb.PLS -> blib/script/bp_nrdb.PLS
Changing sharpbang in blib/script/bp_nrdb.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/bp_nrdb.PLS.bak
Copying scripts/taxa/classify_hits_kingdom.PLS -> blib/script/classify_hits_kingdom.PLS
Changing sharpbang in blib/script/classify_hits_kingdom.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/classify_hits_kingdom.PLS.bak
Copying scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.PLS -> blib/script/bp_seqfeature_gff3.PLS
Copying scripts/utilities/revtrans-motif.PLS -> blib/script/revtrans-motif.PLS
Changing sharpbang in blib/script/revtrans-motif.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/revtrans-motif.PLS.bak
Copying scripts/utilities/remote_blast.PLS -> blib/script/remote_blast.PLS
Changing sharpbang in blib/script/remote_blast.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/remote_blast.PLS.bak
Copying scripts/searchio/search2table.PLS -> blib/script/search2table.PLS
Changing sharpbang in blib/script/search2table.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/search2table.PLS.bak
Copying scripts/seq/translate_seq.PLS -> blib/script/translate_seq.PLS
Changing sharpbang in blib/script/translate_seq.PLS to /home/fly1600/ap1600/bin/perl-static
Deleting blib/script/translate_seq.PLS.bak
t/Align/AlignStats.t .........................
1..45
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::AlignIO;
ok 4 - The object isa Bio::Align::AlignI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - The object isa Bio::Align::AlignI
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - The object isa Bio::Align::AlignI
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - The object isa Bio::Align::AlignI
ok 38 - The object isa Bio::Matrix::PhylipDist
ok 39
ok 40
ok 41
ok 42 - The object isa Bio::PrimarySeqI
ok 43
ok 44 - Warn if seqs don't overlap
ok 45
ok
t/Align/AlignUtil.t ..........................
1..33
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqIO;
ok 4 - The object isa Bio::Align::AlignI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok
t/Align/Graphics.t ...........................
1..41
ok 1 - use Bio::Align::Graphics;
ok 2 - require Bio::Align::Graphics;
ok 3 - Bio::Align::Graphics->can(...)
ok 4 - input is defined
ok 5 - AlignIO object is defined
ok 6 - The object isa Bio::AlignIO
ok 7 - alignment is there and defined
ok 8 - all starts are present
ok 9 - all ends are present
ok 10 - all colors are present
ok 11 - first end is further than first start
ok 12 - second end is further than second start
ok 13 - third end is further than third start
ok 14 - domain labels are present
ok 15 - domain starts are present
ok 16 - domain ends are present
ok 17 - domain colors are present
ok 18 - label - first end is further than first start
ok 19 - label - second end is further than second start
ok 20 - label - third end is further than third start
ok 21 - first label start is within domain range
ok 22 - second label start is within domain range
ok 23 - third label start is within domain range
ok 24 - first label end is within domain range
ok 25 - second label end is within domain range
ok 26 - third label end is within domain range
ok 27 - individual labels work
ok 28 - The object isa Bio::Align::Graphics
ok 29 - new object is defined
ok 30 - pad_bottom is right
ok 31 - default pad_top is right
ok 32 - start point loaded
ok 33 - end point loaded
ok 34 - color of domain loaded
ok 35 - domain labels loaded
ok 36 - label starts loaded
ok 37 - label ends loaded
ok 38 - label colors loaded
ok 39 - labels loaded
ok 40 - output file is png
ok 41 - wrapping length is not zero
ok
t/Align/SimpleAlign.t ........................
1..199
ok 1 - use Bio::SimpleAlign;
ok 2 - use Bio::AlignIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Location::Simple;
ok 5 - use Bio::Location::Split;
ok 6 - The object isa Bio::AlignIO
ok 7 - pfam input test
ok 8 - match_line
ok 9 - The object isa Bio::Align::AlignI
ok 10 - num_sequences
ok 11 - num_sequences
ok 12 - select_noncont
ok 13 - select_noncont
ok 14 - num_sequences
ok 15 - select_noncont
ok 16 - select_noncont
ok 17 - each_seq
ok 18 - get_nse
ok 19 - id
ok 20 - num_gaps
ok 21 - each_alphabetically
ok 22 - column_from_residue_number
ok 23 - display_name get/set
ok 24 - display_name get
ok 25 - consensus_string
ok 26 - consensus_string
ok 27 - consensus_string
ok 28
ok 29 - each_seq_with_id
ok 30 - is_flush
ok 31 - id get/set
ok 32 - length
ok 33 - num_residues
ok 34 - num_sequences
ok 35 - overall_percentage_identity
ok 36 - overall_percentage_identity (align)
ok 37 - overall_percentage_identity (short)
ok 38 - overall_percentage_identity (long)
ok 39 - average_percentage_identity
ok 40
ok 41 - set_displayname_count
ok 42
ok 43 - set_displayname_flat
ok 44
ok 45 - set_displayname_normal
ok 46
ok 47
ok 48 - uppercase, map_chars
ok 49 - match_line
ok 50 - remove_seqs
ok 51 - remove_seqs
ok 52 - add_seq
ok 53 - add_seq
ok 54 - get_seq_by_pos
ok 55 - get_seq_by_pos
ok 56
ok 57
ok 58
ok 59 - purge
ok 60 - purge
ok 61 - IO::String consensus_iupac
ok 62 - IO::String write_aln normal
ok 63 - IO::String write_aln slice
ok 64 - IO::String write_aln slice
ok 65 - IO::String write_aln slice
ok 66 - IO::String write_aln slice
ok 67 - IO::String write_aln slice
ok 68
ok 69 - remove_columns by position
ok 70 - remove_columns by position (wrong order)
ok 71 - cigar_line
ok 72 - cigar_line
ok 73 - cigar_line
ok 74 - cigar_line
ok 75 - sort_alphabetically - before
ok 76
ok 77 - sort_alphabetically - after
ok 78 - remove_gaps
ok 79 - remove_gaps all_gaps_only
ok 80 - set_new_reference
ok 81 - set_new_reference
ok 82 - uniq_seq
ok 83 - bug 2099
ok 84 - bug 2099
ok 85 - bug 2793
ok 86 - bug 2793
ok 87 - bug 2793
ok 88 - bug 2793
ok 89 - Bad sequence, bad!
ok 90 - added 3 seqs
ok 91 - first 2 features added
ok 92 - 3rd feature added
not ok 93 # TODO This should pass but dies; see bug 2842
# Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 1.
# Overriding value [0] with value 1 for Bio::LocatableSeq::end().
# ?
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 94 - slice 1 len
ok 95 - correct masked seq
ok 96 - correct masked seq
ok 97 - correct masked seq
not ok 98 # TODO This should pass but dies; see bug 2842
# Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 3.
# Overriding value [2] with value 3 for Bio::LocatableSeq::end().
# ?
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 99 - slice 2 len
ok 100 - correct masked seq
ok 101 - correct masked seq
ok 102 - correct masked seq
not ok 103 # TODO This should pass but dies; see bug 2842
# Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 3.
# Overriding value [1] with value 3 for Bio::LocatableSeq::end().
# ??
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 104 - slice 3 len
ok 105 - correct masked seq
ok 106 - correct masked seq
ok 107 - correct masked seq
not ok 108 # TODO This should pass but dies; see bug 2842
# Failed (TODO) test at t/Align/SimpleAlign.t line 421.
# died: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: In sequence one residue count gives end value 6.
# Overriding value [4] with value 6 for Bio::LocatableSeq::end().
# ??
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::Root::RootI::warn Bio/Root/RootI.pm:180
# STACK: Bio::LocatableSeq::end Bio/LocatableSeq.pm:195
# STACK: Bio::SimpleAlign::slice Bio/SimpleAlign.pm:1146
# STACK: Test::Exception::lives_ok t/Align/SimpleAlign.t:421
# STACK: t/Align/SimpleAlign.t:421
# -----------------------------------------------------------
# )
ok 109 - slice 4 len
ok 110 - correct masked seq
ok 111 - correct masked seq
ok 112 - correct masked seq
ok 113 - initial display id ok
ok 114 - safe display id ok
ok 115 - restored display id ok
ok 116 - sort by list ok
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123 - BIC:GGATCCATT[C/C]CTACT
ok 124 - BIC:GGAT[C/-][C/-]ATT[C/C]CT[A/C]CT
ok 125 - BIC:G[G/C]ATCCATT[C/G]CTACT
ok 126 - BIC:GGATCCATT[C/G]CTACT
ok 127 - BIC:GGATCCATT[C/G]CTAC[T/A]
ok 128 - BIC:GGATCCATT[C/G]CTA[C/G][T/A]
ok 129 - BIC:GGATCCATT[C/G]CTACT
ok 130 - BIC:GGATCCATT{C.C}CTACT
ok 131 - BIC:GGAT{C.-}{C.-}ATT{C.C}CT{A.C}CT
ok 132 - BIC:G{G.C}ATCCATT{C.G}CTACT
ok 133 - BIC:GGATCCATT{C.G}CTACT
ok 134 - BIC:GGATCCATT{C.G}CTAC{T.A}
ok 135 - BIC:GGATCCATT{C.G}CTA{C.G}{T.A}
ok 136 - BIC:GGATCCATT{C.G}CTACT
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194 - The object isa Bio::SimpleAlign
ok 195 - consensus string looks ok
ok 196 - looks like correct unmasked alignment (from clustalw)
ok 197 - looks like correct masked alignment (from clustalw)
ok 198
ok 199 - align after looks ok
ok
t/Align/TreeBuild.t ..........................
1..13
ok 1 - use Bio::Align::DNAStatistics;
ok 2 - use Bio::Align::ProteinStatistics;
ok 3 - use Bio::Align::Utilities;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Tree::DistanceFactory;
ok 6 - use Bio::TreeIO;
ok 7 - SimpleAlign object parsed out isa Bio::SimpleAlign
ok 8 - Protein distance matrix retrieved isa Bio::Matrix::MatrixI
ok 9 - Tree object gotten back isa Bio::Tree::TreeI
ok 10 - NJ calculated Branch length
ok 11 - NJ calculated Branch length
ok 12 - Make sure two nodes are sister
ok 13 - 10 replicates formulated
ok
t/Align/Utilities.t ..........................
1..13
ok 1 - use Bio::Align::Utilities;
ok 2 - use Bio::SimpleAlign;
ok 3 - use Bio::PrimarySeq;
ok 4 - use Bio::LocatableSeq;
ok 5 - use Bio::AlignIO;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok
t/AlignIO/AlignIO.t ..........................
1..28
ok 1 - use Bio::AlignIO;
ok 2 - input filehandle method test : metafasta
ok 3 - input filehandle method test : po
ok 4 - input filehandle method test : nexus
ok 5 - input filehandle method test : clustalw
ok 6 - input filehandle method test : prodom
ok 7 - input filehandle method test : fasta
ok 8 - input filehandle method test : arp
ok 9 - input filehandle method test : xmfa
ok 10 - input filehandle method test : mase
ok 11 - input filehandle method test : psi
ok 12 - input filehandle method test : phylip
ok 13 - input filehandle method test : pfam
ok 14 - input filehandle method test : selex
ok 15 - input filehandle method test : stockholm
ok 16 - input filehandle method test : msf
ok 17 - filehandle output test : metafasta
ok 18 - filehandle output test : po
ok 19 - filehandle output test : nexus
ok 20 - filehandle output test : clustalw
ok 21 - filehandle output test : fasta
ok 22 - filehandle output test : xmfa
ok 23 - filehandle output test : psi
ok 24 - filehandle output test : phylip
ok 25 - filehandle output test : pfam
ok 26 - filehandle output test : selex
ok 27 - filehandle output test : stockholm
ok 28 - filehandle output test : msf
ok
t/AlignIO/arp.t ..............................
1..48
ok 1 - use Bio::AlignIO::arp;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4 - ARP get_nse()
ok 5
ok 6 - ARP num_sequences()
ok 7 - ARP id()
ok 8 - ARP description()
ok 9 - The object isa Bio::AnnotationCollectionI
ok 10 - The object isa Bio::AnnotationI
ok 11
ok 12
ok 13
ok 14
ok 15 - The object isa Bio::AlignIO
ok 16 - The object isa Bio::Align::AlignI
ok 17 - ARP get_nse()
ok 18 - ARP num_sequences()
ok 19 - ARP id()
ok 20 - ARP description()
ok 21 - The object isa Bio::AnnotationCollectionI
ok 22 - The object isa Bio::AnnotationI
ok 23
ok 24
ok 25
ok 26
ok 27 - The object isa Bio::Align::AlignI
ok 28 - ARP get_nse()
ok 29 - ARP num_sequences()
ok 30 - ARP id()
ok 31 - ARP description()
ok 32 - The object isa Bio::AnnotationCollectionI
ok 33 - The object isa Bio::AnnotationI
ok 34
ok 35
ok 36
ok 37
ok 38 - The object isa Bio::Align::AlignI
ok 39 - ARP get_nse()
ok 40 - ARP num_sequences()
ok 41 - ARP id()
ok 42 - ARP description()
ok 43 - The object isa Bio::AnnotationCollectionI
ok 44 - The object isa Bio::AnnotationI
ok 45
ok 46
ok 47
ok 48
ok
t/AlignIO/bl2seq.t ...........................
1..3
ok 1 - use Bio::AlignIO::bl2seq;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - BLAST bl2seq format test
ok
t/AlignIO/clustalw.t .........................
1..6
ok 1 - use Bio::AlignIO::clustalw;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - clustalw consensus_string test
ok 4 - clustalw (.aln) output test
ok 5 - The object isa Bio::Align::AlignI
ok 6 - clustalw (.aln) input test
ok
t/AlignIO/emboss.t ...........................
1..37
ok 1 - use Bio::AlignIO::emboss;
ok 2 - The object isa Bio::Align::AlignI
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10 - The object isa Bio::Align::AlignI
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Align::AlignI
ok 15
ok 16
ok 17
ok 18 - The object isa Bio::Align::AlignI
ok 19
ok 20
ok 21 - The object isa Bio::Align::AlignI
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - The object isa Bio::Align::AlignI
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/AlignIO/fasta.t ............................
1..10
ok 1 - use Bio::AlignIO::fasta;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - fasta input test
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for end
ok 7 - fasta input test for description
ok 8 - fasta output test
ok 9 - filehandle input test
ok 10 - filehandle output test
ok
t/AlignIO/largemultifasta.t ..................
1..7
ok 1 - use Bio::AlignIO::largemultifasta;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - fasta input test
ok 4 - fasta input test for description
ok 5 - fasta input test for id
ok 6 - fasta input test for description
ok 7 - fasta output test
ok
t/AlignIO/maf.t ..............................
1..11
ok 1 - use Bio::AlignIO::maf;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - maf input test
ok 4
ok 5 - The object isa Bio::Align::AlignI
ok 6 - maf input test
ok 7
ok 8 - maf input test
ok 9
ok 10 - maf input test
ok 11
ok
t/AlignIO/mase.t .............................
1..3
ok 1 - use Bio::AlignIO::mase;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - mase input test
ok
t/AlignIO/mega.t .............................
1..6
ok 1 - use Bio::AlignIO::mega;
ok 2 - The object isa Bio::Align::AlignI
ok 3
ok 4
ok 5
ok 6 - mega output test
ok
t/AlignIO/meme.t .............................
1..14
ok 1 - use Bio::AlignIO::meme;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6
ok 7
ok 8 - The object isa Bio::AlignIO
ok 9 - The object isa Bio::Align::AlignI
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/AlignIO/metafasta.t ........................
1..4
ok 1 - use Bio::AlignIO::metafasta;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - consensus_string on metafasta
ok 4 - symbol_chars() using metafasta
ok
t/AlignIO/msf.t ..............................
1..4
ok 1 - use Bio::AlignIO::msf;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - msf input test
ok 4 - msf output test
ok
# WARNING: NeXML parsing for NeXML v0.9 is currently very experimental support
t/AlignIO/nexml.t ............................
1..125
ok 1 - use Bio::AlignIO::nexml;
ok 2 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 3 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 4 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 5 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 6 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 7 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 8 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 9 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 10 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 11 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 12 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 13 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 14 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 15 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 16 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 17 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 18 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 19 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 20 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 21 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 22 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 23 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 24 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 25 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 26 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 27 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 28 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 29 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 30 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 31 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 32 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 33 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 34 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 35 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 36 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 37 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 38 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 39 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 40 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 41 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 42 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 43 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 44 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 45 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 46 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 47 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 48 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 49 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 50 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 51 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 52 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 53 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 54 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 55 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 56 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 57 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 58 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 59 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 60 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 61 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 62 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 63 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 64 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 65 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 66 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 67 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 68 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 69 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 70 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 71 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 72 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 73 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 74 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 75 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 76 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 77 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 78 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 79 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 80 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 81 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 82 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 83 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 84 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 85 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 86 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 87 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 88 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 89 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 90 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 91 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 92 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 93 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 94 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 95 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 96 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 97 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 98 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 99 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 100 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 101 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 102 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 103 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 104 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 105 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 106 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 107 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 108 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 109 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 110 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 111 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 112 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 113 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 114 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 115 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 116 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 117 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 118 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 119 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 120 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 121 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 122 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 123 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 124 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok 125 # skip NeXML parsing for NeXML v0.9 is currently very experimental support
ok
t/AlignIO/nexus.t ............................
1..43
ok 1 - use Bio::AlignIO::nexus;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - nexus output test
ok 6 - The object isa Bio::AlignIO
ok 7 - The object isa Bio::Align::AlignI
ok 8 - The object isa Bio::AlignIO
ok 9 - The object isa Bio::Align::AlignI
ok 10 - The object isa Bio::AlignIO
ok 11 - The object isa Bio::Align::AlignI
ok 12 - The object isa Bio::AlignIO
ok 13 - The object isa Bio::Align::AlignI
ok 14 - The object isa Bio::AlignIO
ok 15 - The object isa Bio::Align::AlignI
ok 16 - The object isa Bio::AlignIO
ok 17 - The object isa Bio::Align::AlignI
ok 18 - The object isa Bio::AlignIO
ok 19 - The object isa Bio::Align::AlignI
ok 20 - The object isa Bio::AlignIO
ok 21 - The object isa Bio::Align::AlignI
ok 22 - The object isa Bio::AlignIO
ok 23 - The object isa Bio::Align::AlignI
ok 24 - The object isa Bio::AlignIO
ok 25 - The object isa Bio::Align::AlignI
ok 26 - The object isa Bio::AlignIO
ok 27 - The object isa Bio::Align::AlignI
ok 28 - The object isa Bio::AlignIO
ok 29 - The object isa Bio::Align::AlignI
ok 30 - The object isa Bio::AlignIO
ok 31 - The object isa Bio::Align::AlignI
ok 32 - The object isa Bio::AlignIO
ok 33 - The object isa Bio::Align::AlignI
ok 34 - The object isa Bio::AlignIO
ok 35 - The object isa Bio::Align::AlignI
ok 36 - The object isa Bio::AlignIO
ok 37 - The object isa Bio::Align::AlignI
ok 38 - The object isa Bio::AlignIO
ok 39 - The object isa Bio::Align::AlignI
ok 40 - The object isa Bio::AlignIO
ok 41 - The object isa Bio::Align::AlignI
ok 42 - The object isa Bio::AlignIO
ok 43 - The object isa Bio::Align::AlignI
ok
t/AlignIO/pfam.t .............................
1..5
ok 1 - use Bio::AlignIO::pfam;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - pfam output test
ok
t/AlignIO/phylip.t ...........................
1..16
ok 1 - use Bio::AlignIO::phylip;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - phylip output test
ok 6
ok 7
ok 8
not ok 9 # TODO problems with default strand, length?
# Failed (TODO) test at t/AlignIO/phylip.t line 44.
# got: undef
# expected: '0'
not ok 10 # TODO problems with default strand, length?
# Failed (TODO) test at t/AlignIO/phylip.t line 45.
# got: '50'
# expected: '47'
ok 11 - The object isa Bio::Align::AlignI
ok 12
ok 13 - The object isa Bio::AlignIO
ok 14 - The object isa Bio::Align::AlignI
ok 15
ok 16
ok
t/AlignIO/po.t ...............................
1..11
ok 1 - use Bio::AlignIO::po;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5 - The object isa Bio::AlignIO
ok 6 - The object isa Bio::Align::AlignI
ok 7 - po output test
ok 8 - The object isa Bio::AlignIO
ok 9 - The object isa Bio::Align::AlignI
ok 10
ok 11
ok
t/AlignIO/prodom.t ...........................
1..3
ok 1 - use Bio::AlignIO::prodom;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - prodom input test
ok
t/AlignIO/psi.t ..............................
1..5
ok 1 - use Bio::AlignIO::psi;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok
t/AlignIO/selex.t ............................
1..4
ok 1 - use Bio::AlignIO::selex;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - selex format test
ok 4 - selex output test
ok
t/AlignIO/stockholm.t ........................
1..84
ok 1 - use Bio::AlignIO::stockholm;
ok 2 - The object isa Bio::AlignIO
ok 3 - The object isa Bio::Align::AlignI
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - The object isa Bio::Annotation::Comment
ok 10 - Stockholm annotation
ok 11 - Stockholm annotation
ok 12 - stockholm output test
ok 13 - The object isa Bio::Align::AlignI
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20 - Stockholm annotation isa Bio::Annotation::Reference
ok 21 - Stockholm annotation
ok 22 - Stockholm annotation
ok 23 - Stockholm annotation
ok 24 - Stockholm annotation
ok 25 - The object isa Bio::Seq::MetaI
ok 26 - Rfam meta data
ok 27 - Rfam meta data
ok 28
ok 29 - The object isa Bio::Align::AlignI
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35 - The object isa Bio::Seq::MetaI
ok 36 - Rfam meta data
ok 37 - Rfam meta data
ok 38 - The object isa Bio::AlignIO
ok 39
ok 40 - The object isa Bio::Align::AlignI
ok 41
ok 42
ok 43
ok 44
ok 45 - The object isa Bio::Annotation::SimpleValue
ok 46 - Pfam annotation
ok 47
ok 48 - The object isa Bio::Align::AlignI
ok 49
ok 50
ok 51
ok 52
ok 53 - The object isa Bio::Align::AlignI
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - The object isa Bio::Seq::MetaI
ok 60 - Pfam aln meta data
ok 61 - Pfam aln meta data
ok 62 - Pfam aln meta data
ok 63 - Pfam aln meta data
ok 64 - Pfam aln meta data
ok 65 - Pfam aln meta data
ok 66 - Pfam seq meta data
ok 67 - Pfam seq meta data
ok 68 - Pfam seq meta data
ok 69 - Pfam seq meta data
ok 70
ok 71 - The object isa Bio::SeqFeatureI
ok 72 - The object isa Bio::Seq::Meta
ok 73 - The object isa Bio::AnnotationI
ok 74 - The object isa Bio::Annotation::DBLink
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok
t/AlignIO/xmfa.t .............................
1..30
ok 1 - use Bio::AlignIO::xmfa;
ok 2 - The object isa Bio::Align::AlignI
ok 3 - xmfa input test
ok 4 - xmfa input test for start
ok 5 - xmfa input test for end
ok 6 - xmfa strand test
ok 7 - xmfa input test for id
ok 8 - xmfa input test for id
ok 9 - xmfa input test
ok 10 - xmfa input test for start
ok 11 - xmfa input test for end
ok 12 - xmfa strand test
ok 13 - xmfa input test for id
ok 14 - xmfa input test for id
ok 15 - xmfa input test
ok 16 - xmfa input test for start
ok 17 - xmfa input test for end
ok 18 - xmfa strand test
ok 19 - xmfa input test for id
ok 20 - xmfa input test for id
ok 21 - xmfa alignment score
ok 22 - The object isa Bio::Align::AlignI
ok 23 - xmfa input test
ok 24 - xmfa strand
ok 25 - xmfa input test for description
ok 26 - xmfa input test for id
ok 27 - xmfa input test for end
ok 28 - xmfa input test for end
ok 29 - xmfa alignment score
ok 30 - xmfa output test
ok
t/Alphabet.t .................................
1..100
ok 1 - use Bio::Symbol::Alphabet;
ok 2 - use Bio::Symbol::Symbol;
ok 3 - use Bio::Symbol::DNAAlphabet;
ok 4 - use Bio::Symbol::ProteinAlphabet;
ok 5 - The object isa Bio::Symbol::Alphabet
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - The object isa Bio::Symbol::AlphabetI
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - The object isa Bio::Symbol::AlphabetI
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok
t/Annotation/Annotation.t ....................
1..159
ok 1 - use Bio::Annotation::Collection;
ok 2 - use Bio::Annotation::DBLink;
ok 3 - use Bio::Annotation::Comment;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6 - use Bio::Annotation::Target;
ok 7 - use Bio::Annotation::AnnotationFactory;
ok 8 - use Bio::Annotation::StructuredValue;
ok 9 - use Bio::Annotation::TagTree;
ok 10 - use Bio::Annotation::Tree;
ok 11 - use Bio::Seq;
ok 12 - use Bio::SimpleAlign;
ok 13 - use Bio::Cluster::UniGene;
ok 14 - The object isa Bio::AnnotationI
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21 - The object isa Bio::AnnotationI
ok 22
ok 23
ok 24
ok 25 - The object isa Bio::AnnotationCollectionI
ok 26
ok 27
ok 28 - The object isa Bio::AnnotationI
ok 29
ok 30 - The object isa Bio::AnnotationI
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53 - The object isa Bio::AnnotationI
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68 - The object isa Bio::AnnotationCollectionI
ok 69
ok 70
ok 71
ok 72
ok 73 - The object isa Bio::Annotation::StructuredValue
ok 74
ok 75
ok 76
ok 77
ok 78 - use Bio::Annotation::OntologyTerm;
ok 79 - The object isa Bio::Ontology::Term
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85 - The object isa Bio::AnnotatableI
ok 86 - isa SeqFeatureI isa Bio::SeqFeatureI
ok 87 - isa AnnotatableI isa Bio::AnnotatableI
ok 88 - isa SeqFeatureI isa Bio::SeqFeatureI
ok 89 - isa AnnotatableI isa Bio::AnnotatableI
ok 90 - The object isa Bio::AnnotatableI
ok 91 - The object isa Bio::AnnotatableI
ok 92 - The object isa Bio::Factory::ObjectFactoryI
ok 93 - The object isa Bio::Annotation::SimpleValue
ok 94
ok 95 - The object isa Bio::Annotation::OntologyTerm
ok 96 - Bio::Annotation::Comment
ok 97 - The object isa Bio::Annotation::Comment
ok 98
ok 99 - Bio::Annotation::Comment
ok 100 - The object isa Bio::Annotation::Comment
ok 101 - Bio::Annotation::Comment
ok 102 - The object isa Bio::Annotation::Comment
ok 103
ok 104 - The object isa Bio::Annotation::Target
ok 105
ok 106
ok 107 - The object isa Bio::AnnotationI
ok 108 - tree_id()
ok 109 - tagname()
ok 110 - The object isa Bio::AnnotatableI
ok 111
ok 112 - add tree to AlignI
ok 113 - get seq from node id
ok 114
ok 115 - The object isa Bio::Annotation::Tree
ok 116 - The object isa Bio::AnnotationI
ok 117 - default itext
ok 118 - roundtrip
ok 119 - itext
ok 120 - spxr
ok 121 - indent
ok 122 - xml
ok 123 - The object isa Data::Stag::StagI
ok 124
ok 125 - child changes
ok 126 - The object isa Data::Stag::StagI
ok 127
ok 128 - child changes
ok 129 - The object isa Data::Stag::StagI
ok 130
ok 131 - child changes
ok 132 - child changes in parent node
ok 133 - no tags
ok 134 - before Stag node
ok 135 - after Stag node
ok 136 - both stag nodes
ok 137 - different instances
ok 138 - before TagTree
ok 139 - after TagTree
ok 140 - both stag nodes
ok 141 - different instances
ok 142 - before TagTree
ok 143 - after TagTree
ok 144 - stag nodes
ok 145 - same instance
ok 146 - before TagTree
ok 147 - after TagTree
ok 148 - stag nodes
ok 149 - different instance
ok 150 - The object isa Bio::AnnotationI
ok 151 - The object isa Data::Stag::StagI
ok 152 - child changes
ok 153 - The object isa Data::Stag::StagI
ok 154 - child changes
ok 155 - The object isa Data::Stag::StagI
ok 156 - child changes
ok 157
ok 158
ok 159 - The object isa Bio::Annotation::TagTree
ok
t/Annotation/AnnotationAdaptor.t .............
1..23
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::SeqFeature::AnnotationAdaptor;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
Bio::Assembly::IO: could not load tigr - for more details on supported formats please see the Assembly::IO docs
Exception
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::Assembly::IO::tigr. Can't load '/home/fly1600/ap1600/lib/auto/DB_File/DB_File.so' for module DB_File: libdb-4.3.so: cannot open shared object file: No such file or directory at /home/fly1600/ap1600/lib/XSLoader.pm line 68.
at /home/fly1600/ap1600/lib/DB_File.pm line 258.
Compilation failed in require at Bio/SeqFeature/Collection.pm line 146.
BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146.
Compilation failed in require at Bio/Assembly/Singlet.pm line 91.
BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91.
Compilation failed in require at Bio/Assembly/IO/tigr.pm line 237.
BEGIN failed--compilation aborted at Bio/Assembly/IO/tigr.pm line 237.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:296
STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:138
STACK: t/Assembly/ContigSpectrum.t:12
-----------------------------------------------------------
# Failed test 'The thing isa Bio::Assembly::IO'
# at t/Assembly/ContigSpectrum.t line 16.
# The thing isn't defined
Can't call method "next_assembly" on an undefined value at t/Assembly/ContigSpectrum.t line 17.
# Looks like you planned 236 tests but ran 3.
# Looks like you failed 1 test of 3 run.
# Looks like your test exited with 255 just after 3.
t/Assembly/ContigSpectrum.t ..................
1..236
ok 1 - use Bio::Assembly::IO;
ok 2 - use Bio::Assembly::Tools::ContigSpectrum;
not ok 3 - The thing isa Bio::Assembly::IO
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 234/236 subtests
Bareword found where operator expected at (eval 20) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 20) line 2.
Bareword found where operator expected at (eval 20) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 20) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 20) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 20) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 20) line 5, at end of line
(Missing semicolon on previous line?)
# Failed test 'use Bio::Assembly::Singlet;'
# at t/Assembly/IO/bowtie.t line 20.
# Tried to use 'Bio::Assembly::Singlet'.
# Error: Attempt to reload DB_File.pm aborted.
# Compilation failed in require at Bio/SeqFeature/Collection.pm line 146.
# BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146.
# Compilation failed in require at Bio/Assembly/Singlet.pm line 91.
# BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91.
# Compilation failed in require at (eval 87) line 2.
# BEGIN failed--compilation aborted at (eval 87) line 2.
Bio::Assembly::IO: could not load bowtie - for more details on supported formats please see the Assembly::IO docs
Exception
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::Assembly::IO::bowtie. Can't locate Bio/Tools/Run/Samtools.pm in @INC (@INC contains: . /home/fly1600/var/cpan/build/BioPerl-1.6.901-VRcq5e/blib/lib /home/fly1600/var/cpan/build/BioPerl-1.6.901-VRcq5e/blib/arch /home/fly1600/var/cpan/build/BioPerl-1.6.901-VRcq5e /home/fly1600/var/megalib /home/fly1600/ap1600/site/lib /home/fly1600/ap1600/lib) at Bio/Assembly/IO/bowtie.pm line 111.
BEGIN failed--compilation aborted at Bio/Assembly/IO/bowtie.pm line 111.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:296
STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:138
STACK: t/Assembly/IO/bowtie.t:30
-----------------------------------------------------------
# Failed test 'init bowtie IO object'
# at t/Assembly/IO/bowtie.t line 30.
# Failed test 'The thing isa Bio::Assembly::IO'
# at t/Assembly/IO/bowtie.t line 33.
# The thing isn't defined
Can't call method "sam" on an undefined value at t/Assembly/IO/bowtie.t line 34.
# Tests were run but no plan was declared and done_testing() was not seen.
t/Assembly/IO/bowtie.t .......................
ok 1 - use Bio::Seq;
ok 2 - use Bio::LocatableSeq;
ok 3 - use Bio::Seq::Quality;
ok 4 - use Bio::Assembly::IO;
not ok 5 - use Bio::Assembly::Singlet;
not ok 6 - init bowtie IO object
not ok 7 - The thing isa Bio::Assembly::IO
Dubious, test returned 2 (wstat 512, 0x200)
Failed 3/7 subtests
Bareword found where operator expected at (eval 20) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 20) line 2.
Bareword found where operator expected at (eval 20) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 20) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 20) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 20) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 20) line 5, at end of line
(Missing semicolon on previous line?)
# Failed test 'use Bio::Assembly::Singlet;'
# at t/Assembly/IO/sam.t line 21.
# Tried to use 'Bio::Assembly::Singlet'.
# Error: Attempt to reload DB_File.pm aborted.
# Compilation failed in require at Bio/SeqFeature/Collection.pm line 146.
# BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146.
# Compilation failed in require at Bio/Assembly/Singlet.pm line 91.
# BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91.
# Compilation failed in require at (eval 87) line 2.
# BEGIN failed--compilation aborted at (eval 87) line 2.
Bio::Assembly::IO: could not load sam - for more details on supported formats please see the Assembly::IO docs
Exception
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::Assembly::IO::sam. Attempt to reload Bio/Assembly/Singlet.pm aborted.
Compilation failed in require at Bio/Assembly/IO/sam.pm line 177.
BEGIN failed--compilation aborted at Bio/Assembly/IO/sam.pm line 177.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::Assembly::IO::_load_format_module Bio/Assembly/IO.pm:296
STACK: Bio::Assembly::IO::new Bio/Assembly/IO.pm:138
STACK: t/Assembly/IO/sam.t:29
-----------------------------------------------------------
# Failed test 'init sam IO object'
# at t/Assembly/IO/sam.t line 29.
# Failed test 'The thing isa Bio::Assembly::IO'
# at t/Assembly/IO/sam.t line 32.
# The thing isn't defined
Can't call method "sam" on an undefined value at t/Assembly/IO/sam.t line 33.
# Tests were run but no plan was declared and done_testing() was not seen.
t/Assembly/IO/sam.t ..........................
ok 1 - use Bio::Seq;
ok 2 - use Bio::LocatableSeq;
ok 3 - use Bio::Seq::Quality;
ok 4 - use Bio::Assembly::IO;
not ok 5 - use Bio::Assembly::Singlet;
not ok 6 - init sam IO object
not ok 7 - The thing isa Bio::Assembly::IO
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 3/7 subtests
Bareword found where operator expected at (eval 20) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 20) line 2.
Bareword found where operator expected at (eval 20) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 20) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 20) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 20) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 20) line 5, at end of line
(Missing semicolon on previous line?)
# Failed test 'use Bio::Assembly::Singlet;'
# at t/Assembly/core.t line 16.
# Tried to use 'Bio::Assembly::Singlet'.
# Error: Attempt to reload DB_File.pm aborted.
# Compilation failed in require at Bio/SeqFeature/Collection.pm line 146.
# BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146.
# Compilation failed in require at Bio/Assembly/Singlet.pm line 91.
# BEGIN failed--compilation aborted at Bio/Assembly/Singlet.pm line 91.
# Compilation failed in require at (eval 87) line 2.
# BEGIN failed--compilation aborted at (eval 87) line 2.
Can't locate object method "new" via package "Bio::Assembly::Singlet" at t/Assembly/core.t line 28.
# Tests were run but no plan was declared and done_testing() was not seen.
t/Assembly/core.t ............................
ok 1 - use Bio::Seq;
ok 2 - use Bio::LocatableSeq;
ok 3 - use Bio::Seq::Quality;
ok 4 - use Bio::Assembly::IO;
not ok 5 - use Bio::Assembly::Singlet;
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 1/5 subtests
t/Biblio/Biblio.t ............................
1..24
ok 1 - use Bio::Biblio;
ok 2 - use Bio::Biblio::IO;
ok 3
ok 4
ok 5 - citation 1
ok 6 - citation 2
ok 7 - citation 3
ok 8 - in callback
ok 9 - in callback
ok 10 - in callback
ok 11 - calling callback
ok 12 - citation 1
ok 13 - citation 2
ok 14 - citation 1
ok 15 - citation 2
ok 16
ok 17 - citation 1
ok 18 - citation 2
ok 19 - citation 3
ok 20 - citation 4
ok 21 - filehandle test
ok 22 - filehandle test
ok 23 - filehandle test
ok 24 - filehandle test
ok
t/Biblio/References.t ........................
1..537
ok 1 - use Bio::Biblio::Article;
ok 2 - use Bio::Biblio::Book;
ok 3 - use Bio::Biblio::BookArticle;
ok 4 - use Bio::Biblio::Journal;
ok 5 - use Bio::Biblio::JournalArticle;
ok 6 - use Bio::Biblio::MedlineArticle;
ok 7 - use Bio::Biblio::MedlineBook;
ok 8 - use Bio::Biblio::MedlineBookArticle;
ok 9 - use Bio::Biblio::MedlineJournal;
ok 10 - use Bio::Biblio::MedlineJournalArticle;
ok 11 - use Bio::Biblio::Organisation;
ok 12 - use Bio::Biblio::Patent;
ok 13 - use Bio::Biblio::Person;
ok 14 - use Bio::Biblio::Proceeding;
ok 15 - use Bio::Biblio::Provider;
ok 16 - use Bio::Biblio::Ref;
ok 17 - use Bio::Biblio::Service;
ok 18 - use Bio::Biblio::TechReport;
ok 19 - use Bio::Biblio::Thesis;
ok 20 - use Bio::Biblio::WebResource;
ok 21 - use Bio::Biblio::PubmedArticle;
ok 22 - use Bio::Biblio::PubmedBookArticle;
ok 23 - use Bio::Biblio::PubmedJournalArticle;
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47 - set 'abstract'
ok 48 - get 'abstract'
ok 49 - set 'abstract_language'
ok 50 - get 'abstract_language'
ok 51 - set 'abstract_type'
ok 52 - get 'abstract_type'
ok 53 - set 'author_list_complete'
ok 54 - get 'author_list_complete'
ok 55 - set 'cross_references_list_complete'
ok 56 - get 'cross_references_list_complete'
ok 57 - set 'date'
ok 58 - get 'date'
ok 59 - set 'date_completed'
ok 60 - get 'date_completed'
ok 61 - set 'date_created'
ok 62 - get 'date_created'
ok 63 - set 'date_revised'
ok 64 - get 'date_revised'
ok 65 - set 'format'
ok 66 - get 'format'
ok 67 - set 'identifier'
ok 68 - get 'identifier'
ok 69 - set 'language'
ok 70 - get 'language'
ok 71 - set 'last_modified_date'
ok 72 - get 'last_modified_date'
ok 73 - set 'repository_subset'
ok 74 - get 'repository_subset'
ok 75 - set 'rights'
ok 76 - get 'rights'
ok 77 - set 'spatial_location'
ok 78 - get 'spatial_location'
ok 79 - set 'subject_headings_source'
ok 80 - get 'subject_headings_source'
ok 81 - set 'temporal_period'
ok 82 - get 'temporal_period'
ok 83 - set 'title'
ok 84 - get 'title'
ok 85 - set 'toc'
ok 86 - get 'toc'
ok 87 - set 'toc_type'
ok 88 - get 'toc_type'
ok 89 - set 'type'
ok 90 - get 'type'
ok 91 - set 'first_page'
ok 92 - get 'first_page'
ok 93 - set 'last_page'
ok 94 - get 'last_page'
ok 95 - set 'issue'
ok 96 - get 'issue'
ok 97 - set 'issue_supplement'
ok 98 - get 'issue_supplement'
ok 99 - set 'volume'
ok 100 - get 'volume'
ok 101 - set 'affiliation'
ok 102 - get 'affiliation'
ok 103 - set 'citation_owner'
ok 104 - get 'citation_owner'
ok 105 - set 'date_of_electronic_publication'
ok 106 - get 'date_of_electronic_publication'
ok 107 - set 'gene_symbols'
ok 108 - get 'gene_symbols'
ok 109 - set 'grant_list_complete'
ok 110 - get 'grant_list_complete'
ok 111 - set 'medline_date'
ok 112 - get 'medline_date'
ok 113 - set 'medline_id'
ok 114 - get 'medline_id'
ok 115 - set 'medline_page'
ok 116 - get 'medline_page'
ok 117 - set 'number_of_references'
ok 118 - get 'number_of_references'
ok 119 - set 'other_languages'
ok 120 - get 'other_languages'
ok 121 - set 'pmid'
ok 122 - get 'pmid'
ok 123 - set 'season'
ok 124 - get 'season'
ok 125 - set 'status'
ok 126 - get 'status'
ok 127 - set 'vernacular_title'
ok 128 - get 'vernacular_title'
ok 129
ok 130 - abstract
ok 131 - abstract_language
ok 132 - abstract_type
ok 133 - author_list_complete
ok 134 - cross_references_list_complete
ok 135 - date
ok 136 - date_completed
ok 137 - date_created
ok 138 - date_revised
ok 139 - format
ok 140 - identifier
ok 141 - language
ok 142 - last_modified_date
ok 143 - repository_subset
ok 144 - rights
ok 145 - spatial_location
ok 146 - subject_headings_source
ok 147 - temporal_period
ok 148 - title
ok 149 - toc
ok 150 - toc_type
ok 151 - type
ok 152 - first_page
ok 153 - last_page
ok 154 - issue
ok 155 - issue_supplement
ok 156 - volume
ok 157 - affiliation
ok 158 - citation_owner
ok 159 - date_of_electronic_publication
ok 160 - gene_symbols
ok 161 - grant_list_complete
ok 162 - medline_date
ok 163 - medline_id
ok 164 - medline_page
ok 165 - number_of_references
ok 166 - other_languages
ok 167 - pmid
ok 168 - season
ok 169 - status
ok 170 - vernacular_title
ok 171 - get 'authors'
ok 172 - get 'cross_references'
ok 173 - get 'codes'
ok 174 - get 'contributors'
ok 175 - get 'keywords'
ok 176 - get 'publisher'
ok 177 - get 'subject_headings'
ok 178 - get 'journal'
ok 179 - get 'chemicals'
ok 180 - get 'comment_ins'
ok 181 - get 'comment_ons'
ok 182 - get 'erratum_fors'
ok 183 - get 'erratum_ins'
ok 184 - get 'general_notes'
ok 185 - get 'grants'
ok 186 - get 'mesh_headings'
ok 187 - get 'original_report_ins'
ok 188 - get 'other_abstracts'
ok 189 - get 'other_ids'
ok 190 - get 'republished_froms'
ok 191 - get 'republished_ins'
ok 192 - get 'retraction_ins'
ok 193 - get 'retraction_ofs'
ok 194 - get 'summary_for_patients_ins'
ok 195 - get 'update_ins'
ok 196 - get 'update_ofs'
ok 197 - get 'journal'
ok 198 - add_author 1
ok 199 - add_author 2
ok 200 - get authors
ok 201 - add_contributor 1
ok 202 - add_contributor 2
ok 203 - get contributors
ok 204 - add_cross_reference 1
ok 205 - add_cross_reference 2
ok 206 - get cross_references
ok 207 - get cross_references
ok 208 - set 'abstract'
ok 209 - get 'abstract'
ok 210 - set 'abstract_language'
ok 211 - get 'abstract_language'
ok 212 - set 'abstract_type'
ok 213 - get 'abstract_type'
ok 214 - set 'author_list_complete'
ok 215 - get 'author_list_complete'
ok 216 - set 'cross_references_list_complete'
ok 217 - get 'cross_references_list_complete'
ok 218 - set 'date'
ok 219 - get 'date'
ok 220 - set 'date_completed'
ok 221 - get 'date_completed'
ok 222 - set 'date_created'
ok 223 - get 'date_created'
ok 224 - set 'date_revised'
ok 225 - get 'date_revised'
ok 226 - set 'format'
ok 227 - get 'format'
ok 228 - set 'identifier'
ok 229 - get 'identifier'
ok 230 - set 'language'
ok 231 - get 'language'
ok 232 - set 'last_modified_date'
ok 233 - get 'last_modified_date'
ok 234 - set 'repository_subset'
ok 235 - get 'repository_subset'
ok 236 - set 'rights'
ok 237 - get 'rights'
ok 238 - set 'spatial_location'
ok 239 - get 'spatial_location'
ok 240 - set 'subject_headings_source'
ok 241 - get 'subject_headings_source'
ok 242 - set 'temporal_period'
ok 243 - get 'temporal_period'
ok 244 - set 'title'
ok 245 - get 'title'
ok 246 - set 'toc'
ok 247 - get 'toc'
ok 248 - set 'toc_type'
ok 249 - get 'toc_type'
ok 250 - set 'type'
ok 251 - get 'type'
ok 252 - set 'first_page'
ok 253 - get 'first_page'
ok 254 - set 'last_page'
ok 255 - get 'last_page'
ok 256 - set 'affiliation'
ok 257 - get 'affiliation'
ok 258 - set 'citation_owner'
ok 259 - get 'citation_owner'
ok 260 - set 'date_of_electronic_publication'
ok 261 - get 'date_of_electronic_publication'
ok 262 - set 'gene_symbols'
ok 263 - get 'gene_symbols'
ok 264 - set 'grant_list_complete'
ok 265 - get 'grant_list_complete'
ok 266 - set 'medline_date'
ok 267 - get 'medline_date'
ok 268 - set 'medline_id'
ok 269 - get 'medline_id'
ok 270 - set 'medline_page'
ok 271 - get 'medline_page'
ok 272 - set 'number_of_references'
ok 273 - get 'number_of_references'
ok 274 - set 'other_languages'
ok 275 - get 'other_languages'
ok 276 - set 'pmid'
ok 277 - get 'pmid'
ok 278 - set 'season'
ok 279 - get 'season'
ok 280 - set 'status'
ok 281 - get 'status'
ok 282 - set 'vernacular_title'
ok 283 - get 'vernacular_title'
ok 284
ok 285 - abstract
ok 286 - abstract_language
ok 287 - abstract_type
ok 288 - author_list_complete
ok 289 - cross_references_list_complete
ok 290 - date
ok 291 - date_completed
ok 292 - date_created
ok 293 - date_revised
ok 294 - format
ok 295 - identifier
ok 296 - language
ok 297 - last_modified_date
ok 298 - repository_subset
ok 299 - rights
ok 300 - spatial_location
ok 301 - subject_headings_source
ok 302 - temporal_period
ok 303 - title
ok 304 - toc
ok 305 - toc_type
ok 306 - type
ok 307 - first_page
ok 308 - last_page
ok 309 - affiliation
ok 310 - citation_owner
ok 311 - date_of_electronic_publication
ok 312 - gene_symbols
ok 313 - grant_list_complete
ok 314 - medline_date
ok 315 - medline_id
ok 316 - medline_page
ok 317 - number_of_references
ok 318 - other_languages
ok 319 - pmid
ok 320 - season
ok 321 - status
ok 322 - vernacular_title
ok 323 - get 'authors'
ok 324 - get 'cross_references'
ok 325 - get 'codes'
ok 326 - get 'contributors'
ok 327 - get 'keywords'
ok 328 - get 'publisher'
ok 329 - get 'subject_headings'
ok 330 - get 'book'
ok 331 - get 'chemicals'
ok 332 - get 'comment_ins'
ok 333 - get 'comment_ons'
ok 334 - get 'erratum_fors'
ok 335 - get 'erratum_ins'
ok 336 - get 'general_notes'
ok 337 - get 'grants'
ok 338 - get 'mesh_headings'
ok 339 - get 'original_report_ins'
ok 340 - get 'other_abstracts'
ok 341 - get 'other_ids'
ok 342 - get 'republished_froms'
ok 343 - get 'republished_ins'
ok 344 - get 'retraction_ins'
ok 345 - get 'retraction_ofs'
ok 346 - get 'summary_for_patients_ins'
ok 347 - get 'update_ins'
ok 348 - get 'update_ofs'
ok 349 - get 'book'
ok 350 - set 'abstract'
ok 351 - get 'abstract'
ok 352 - set 'abstract_language'
ok 353 - get 'abstract_language'
ok 354 - set 'abstract_type'
ok 355 - get 'abstract_type'
ok 356 - set 'author_list_complete'
ok 357 - get 'author_list_complete'
ok 358 - set 'cross_references_list_complete'
ok 359 - get 'cross_references_list_complete'
ok 360 - set 'date'
ok 361 - get 'date'
ok 362 - set 'date_completed'
ok 363 - get 'date_completed'
ok 364 - set 'date_created'
ok 365 - get 'date_created'
ok 366 - set 'date_revised'
ok 367 - get 'date_revised'
ok 368 - set 'format'
ok 369 - get 'format'
ok 370 - set 'identifier'
ok 371 - get 'identifier'
ok 372 - set 'language'
ok 373 - get 'language'
ok 374 - set 'last_modified_date'
ok 375 - get 'last_modified_date'
ok 376 - set 'repository_subset'
ok 377 - get 'repository_subset'
ok 378 - set 'rights'
ok 379 - get 'rights'
ok 380 - set 'spatial_location'
ok 381 - get 'spatial_location'
ok 382 - set 'subject_headings_source'
ok 383 - get 'subject_headings_source'
ok 384 - set 'temporal_period'
ok 385 - get 'temporal_period'
ok 386 - set 'title'
ok 387 - get 'title'
ok 388 - set 'toc'
ok 389 - get 'toc'
ok 390 - set 'toc_type'
ok 391 - get 'toc_type'
ok 392 - set 'type'
ok 393 - get 'type'
ok 394 - set 'edition'
ok 395 - get 'edition'
ok 396 - set 'isbn'
ok 397 - get 'isbn'
ok 398 - set 'series'
ok 399 - get 'series'
ok 400 - set 'volume'
ok 401 - get 'volume'
ok 402
ok 403 - abstract
ok 404 - abstract_language
ok 405 - abstract_type
ok 406 - author_list_complete
ok 407 - cross_references_list_complete
ok 408 - date
ok 409 - date_completed
ok 410 - date_created
ok 411 - date_revised
ok 412 - format
ok 413 - identifier
ok 414 - language
ok 415 - last_modified_date
ok 416 - repository_subset
ok 417 - rights
ok 418 - spatial_location
ok 419 - subject_headings_source
ok 420 - temporal_period
ok 421 - title
ok 422 - toc
ok 423 - toc_type
ok 424 - type
ok 425 - edition
ok 426 - isbn
ok 427 - series
ok 428 - volume
ok 429 - get 'authors'
ok 430 - get 'cross_references'
ok 431 - get 'codes'
ok 432 - get 'contributors'
ok 433 - get 'keywords'
ok 434 - get 'publisher'
ok 435 - get 'subject_headings'
ok 436 - get 'editor'
ok 437 - set 'abbreviation'
ok 438 - get 'abbreviation'
ok 439 - set 'issn'
ok 440 - get 'issn'
ok 441 - set 'name'
ok 442 - get 'name'
ok 443 - set 'coden'
ok 444 - get 'coden'
ok 445 - set 'country'
ok 446 - get 'country'
ok 447 - set 'medline_code'
ok 448 - get 'medline_code'
ok 449 - set 'medline_ta'
ok 450 - get 'medline_ta'
ok 451 - set 'nlm_unique_id'
ok 452 - get 'nlm_unique_id'
ok 453
ok 454 - abbreviation
ok 455 - issn
ok 456 - name
ok 457 - coden
ok 458 - country
ok 459 - medline_code
ok 460 - medline_ta
ok 461 - nlm_unique_id
ok 462 - set 'doc_number'
ok 463 - get 'doc_number'
ok 464 - set 'doc_office'
ok 465 - get 'doc_office'
ok 466 - set 'doc_type'
ok 467 - get 'doc_type'
ok 468
ok 469 - doc_number
ok 470 - doc_office
ok 471 - doc_type
ok 472 - get 'applicants'
ok 473 - set 'url'
ok 474 - get 'url'
ok 475 - set 'estimated_size'
ok 476 - get 'estimated_size'
ok 477 - set 'cost'
ok 478 - get 'cost'
ok 479
ok 480 - url
ok 481 - estimated_size
ok 482 - cost
ok 483 - set 'type'
ok 484 - get 'type'
ok 485 - set 'affiliation'
ok 486 - get 'affiliation'
ok 487 - set 'email'
ok 488 - get 'email'
ok 489 - set 'firstname'
ok 490 - get 'firstname'
ok 491 - set 'forename'
ok 492 - get 'forename'
ok 493 - set 'initials'
ok 494 - get 'initials'
ok 495 - set 'lastname'
ok 496 - get 'lastname'
ok 497 - set 'middlename'
ok 498 - get 'middlename'
ok 499 - set 'postal_address'
ok 500 - get 'postal_address'
ok 501 - set 'suffix'
ok 502 - get 'suffix'
ok 503
ok 504 - type
ok 505 - affiliation
ok 506 - email
ok 507 - firstname
ok 508 - forename
ok 509 - initials
ok 510 - lastname
ok 511 - middlename
ok 512 - postal_address
ok 513 - suffix
ok 514 - set 'type'
ok 515 - get 'type'
ok 516 - set 'name'
ok 517 - get 'name'
ok 518
ok 519 - type
ok 520 - name
ok 521 - set 'type'
ok 522 - get 'type'
ok 523 - set 'name'
ok 524 - get 'name'
ok 525
ok 526 - type
ok 527 - name
ok 528 - set 'pubmed_status'
ok 529 - get 'pubmed_status'
ok 530 - set 'pubmed_provider_id'
ok 531 - get 'pubmed_provider_id'
ok 532
ok 533 - pubmed_status
ok 534 - pubmed_provider_id
ok 535 - get 'pubmed_history_list'
ok 536 - get 'pubmed_article_id_list'
ok 537 - get 'pubmed_url_list'
ok
t/Biblio/biofetch.t .......................... skipped: Network tests have not been requested
t/Biblio/eutils.t ............................ skipped: Network tests have not been requested
t/ClusterIO/ClusterIO.t ......................
1..12
ok 1 - use Bio::ClusterIO;
ok 2 - use Bio::Cluster::ClusterFactory;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - The object isa Bio::Cluster::UniGeneI
ok 12 - The object isa Bio::Cluster::UniGeneI
ok
t/ClusterIO/SequenceFamily.t .................
1..19
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Cluster::SequenceFamily;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/ClusterIO/unigene.t ........................
1..73
ok 1 - use Bio::ClusterIO;
ok 2 - new Bio::ClusterIO object defined
ok 3
ok 4 - The object isa Bio::Cluster::UniGeneI
ok 5 - The object isa Bio::ClusterI
ok 6 - The object isa Bio::IdentifiableI
ok 7 - The object isa Bio::DescribableI
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48 - The object isa Bio::PrimarySeqI
ok 49
ok 50
ok 51 - annotation object defined
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66 - The object isa Bio::PrimarySeqI
ok 67
ok 68 - next cluster
ok 69
ok 70
ok 71
ok 72
ok 73
ok
t/Coordinate/CoordinateBoundaryTest.t ........
1..174
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3
ok 4 - The object isa Bio::Location::Simple
ok 5
ok 6 - The object isa Bio::Location::Simple
ok 7
ok 8 - The object isa Bio::Location::Simple
ok 9
ok 10 - The object isa Bio::Coordinate::Pair
ok 11
ok 12 - The object isa Bio::Coordinate::Pair
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32 - The object isa Bio::LocationI
ok 33
ok 34 - The object isa Bio::Coordinate::Result
ok 35
ok 36 - The object isa Bio::Coordinate::Result
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - The object isa Bio::LocationI
ok 51
ok 52 - The object isa Bio::Coordinate::Result
ok 53
ok 54 - The object isa Bio::Coordinate::Result
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68 - The object isa Bio::LocationI
ok 69
ok 70 - The object isa Bio::Coordinate::Result
ok 71
ok 72 - The object isa Bio::Coordinate::Result
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88 - The object isa Bio::LocationI
ok 89
ok 90 - The object isa Bio::Coordinate::Result
ok 91
ok 92 - The object isa Bio::Coordinate::Result
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108 - The object isa Bio::Location::Simple
ok 109
ok 110 - The object isa Bio::Location::Simple
ok 111
ok 112 - The object isa Bio::Location::Simple
ok 113
ok 114 - The object isa Bio::Coordinate::Pair
ok 115
ok 116 - The object isa Bio::Coordinate::Pair
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132 - The object isa Bio::Coordinate::Result
ok 133
ok 134 - The object isa Bio::Coordinate::Result
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142 - The object isa Bio::Coordinate::Result
ok 143
ok 144 - The object isa Bio::Coordinate::Result
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152 - The object isa Bio::Coordinate::Result
ok 153
ok 154 - The object isa Bio::Coordinate::Result
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164 - The object isa Bio::Coordinate::Result
ok 165
ok 166 - The object isa Bio::Coordinate::Result
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok
t/Coordinate/CoordinateGraph.t ...............
1..7
ok 1 - use Bio::Coordinate::Graph;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok
t/Coordinate/CoordinateMapper.t ..............
1..175
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3 - use Bio::Coordinate::Result::Match;
ok 4 - use Bio::Coordinate::Result::Gap;
ok 5 - use Bio::Coordinate::Chain;
ok 6 - use Bio::Coordinate::Collection;
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Coordinate::Result
ok 15 - The object isa Bio::Location::SplitLocationI
ok 16
ok 17
ok 18
ok 19 - The object isa Bio::LocationI
ok 20 - The object isa Bio::Coordinate::Result::Match
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - The object isa Bio::Coordinate::Result::Gap
ok 38 - The object isa Bio::LocationI
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106 - The object isa Bio::Coordinate::Result::Match
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138 - Match: |314696| Test: 314696|
ok 139
ok 140
ok 141
ok 142 - Match: |341| Test: 341|
ok 143
ok 144
ok 145
ok 146 - Match: |315843| Test: 315843|
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152 - Match: |627011| Test: 627011|
ok 153
ok 154
ok 155
ok 156 - Match: |chr1| Test: chr1|
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok
t/Coordinate/GeneCoordinateMapper.t ..........
1..116
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Coordinate::Pair;
ok 3 - use Bio::Coordinate::ExtrapolatingPair;
ok 4 - use Bio::Coordinate::GeneMapper;
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Location::Simple
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75 - The object isa Bio::Location::Simple
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok
t/Draw/Pictogram.t ...........................
1..6
ok 1 - use Bio::Draw::Pictogram;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::Matrix::PSM::IO;
ok 4 - The object isa Bio::Draw::Pictogram
ok 5
ok 6
ok
t/LiveSeq/Chain.t ............................
1..45
ok 1 - use Bio::LiveSeq::Chain;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok
t/LiveSeq/LiveSeq.t ..........................
1..48
ok 1 - use Bio::LiveSeq::IO::BioPerl;
ok 2
ok 3
ok 4 - Bio::LiveSeq::Gene
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok
t/LiveSeq/Mutation.t .........................
1..19
ok 1 - use Bio::LiveSeq::Mutation;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/LiveSeq/Mutator.t ..........................
1..24
ok 1 - use Bio::LiveSeq::Mutator;
ok 2 - use Bio::LiveSeq::IO::BioPerl;
ok 3 - use Bio::Variation::IO;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
You are loading a Bio::DB::GFF database with GFF3 formatted data.
While this will likely work fine, the Bio::DB::GFF schema does not
always faithfully capture the complexity represented in GFF3 files.
Unless you have a specific reason for using Bio::DB::GFF, we suggest
that you use a Bio::DB::SeqFeature::Store database and its corresponding
loader, bp_seqfeature_load.pl.
t/LocalDB/BioDBGFF.t .........................
1..275
ok 1 - use Bio::DB::GFF;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 102 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132 # skip delete_groups() not implemented by this adaptor
ok 133 # skip delete_groups() not implemented by this adaptor
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 239 # skip fetch_feature_by_gid() not implemented by this adaptor
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246 # skip preferred groups are not supported by gff3
ok 247 # skip preferred groups are not supported by gff3
ok 248 # skip preferred groups are not supported by gff3
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269 # skip delete_groups() not implemented by this adaptor
ok 270 # skip delete_groups() not implemented by this adaptor
ok 271
ok 272
ok 273
ok 274
ok 275
ok
t/LocalDB/DBFasta.t ..........................
1..17
ok 1
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8 - bug 3126
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17 - threw Regexp ((?^:FASTA header doesn't match))
ok
t/LocalDB/DBQual.t ...........................
1..38
ok 1 - use Bio::Root::IO;
ok 2 - use File::Copy;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13 - The object isa Bio::Seq::PrimaryQual
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - The object isa Bio::Seq::PrimaryQual
ok 26
ok 27
ok 28 - The object isa Bio::Seq::PrimaryQual
ok 29
ok 30
ok 31
ok 32 - The object isa Bio::Seq::PrimaryQual
ok 33
ok 34 - The object isa Bio::Seq::PrimaryQual
ok 35
ok 36
ok 37
ok 38
ok
Bareword found where operator expected at (eval 20) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 20) line 2.
Bareword found where operator expected at (eval 20) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 20) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 20) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 20) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 20) line 5, at end of line
(Missing semicolon on previous line?)
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Attempt to reload DB_File.pm aborted.
Compilation failed in require at Bio/DB/Flat/BDB.pm line 85.
BEGIN failed--compilation aborted at Bio/DB/Flat/BDB.pm line 85.
Compilation failed in require at (eval 38) line 2.
...propagated at /home/fly1600/var/megalib/base.pm line 84.
BEGIN failed--compilation aborted at Bio/DB/Flat/BDB/fasta.pm line 71.
Compilation failed in require at (eval 37) line 2.
BEGIN failed--compilation aborted at (eval 37) line 2.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::DB::Flat::new Bio/DB/Flat.pm:195
STACK: t/LocalDB/Flat.t:22
-----------------------------------------------------------
# Tests were run but no plan was declared and done_testing() was not seen.
t/LocalDB/Flat.t .............................
ok 1 - use Bio::DB::Flat;
Dubious, test returned 255 (wstat 65280, 0xff00)
All 1 subtests passed
t/LocalDB/Index/Blast.t ......................
1..26
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::Blast;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok
t/LocalDB/Index/BlastTable.t .................
1..27
ok 1 - use Cwd;
ok 2 - use Bio::SearchIO;
ok 3 - use Bio::Index::BlastTable;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
Bareword found where operator expected at (eval 20) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 20) line 2.
Bareword found where operator expected at (eval 20) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 20) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 20) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 20) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 20) line 5, at end of line
(Missing semicolon on previous line?)
# Failed test at t/LocalDB/Index/Index.t line 52.
# Failed test at t/LocalDB/Index/Index.t line 59.
--------------------- WARNING ---------------------
MSG: File /home/fly1600/var/cpan/build/BioPerl-1.6.901-VRcq5e/t/data/roa1.swiss already indexed. Skipping...
---------------------------------------------------
Can't call method "length" on an undefined value at t/LocalDB/Index/Index.t line 103.
# Tests were run but no plan was declared and done_testing() was not seen.
t/LocalDB/Index/Index.t ......................
ok 1 - use Bio::Index::Fasta;
ok 2 - use Bio::Index::Qual;
ok 3 - use Bio::Index::SwissPfam;
ok 4 - use Bio::Index::EMBL;
ok 5 - use Bio::Index::GenBank;
ok 6 - use Bio::Index::Swissprot;
ok 7 - use Bio::DB::InMemoryCache;
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - The object isa Bio::PrimarySeqI
not ok 17
not ok 18
ok 19
ok 20 - The object isa Bio::SeqI
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
Dubious, test returned 2 (wstat 512, 0x200)
Failed 2/34 subtests
Bareword found where operator expected at (eval 100) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 100) line 2.
Bareword found where operator expected at (eval 100) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 100) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 100) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 100) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 100) line 5, at end of line
(Missing semicolon on previous line?)
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Attempt to reload DB_File.pm aborted.
Compilation failed in require at Bio/DB/Flat/BDB.pm line 85.
BEGIN failed--compilation aborted at Bio/DB/Flat/BDB.pm line 85.
Compilation failed in require at (eval 102) line 2.
...propagated at /home/fly1600/var/megalib/base.pm line 84.
BEGIN failed--compilation aborted at Bio/DB/Flat/BDB/fasta.pm line 71.
Compilation failed in require at (eval 101) line 2.
BEGIN failed--compilation aborted at (eval 101) line 2.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::DB::Flat::new Bio/DB/Flat.pm:195
STACK: t/LocalDB/Registry.t:36
-----------------------------------------------------------
# Looks like you planned 14 tests but ran 3.
# Looks like your test exited with 255 just after 3.
t/LocalDB/Registry.t .........................
1..14
ok 1 - use Bio::DB::Registry;
ok 2 - use Bio::DB::Flat;
ok 3
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 11/14 subtests
# Failed test 'use Bio::DB::SeqFeature::Store::GFF3Loader;'
# in t/LocalDB/SeqFeature.t at line 16.
# Tried to use 'Bio::DB::SeqFeature::Store::GFF3Loader'.
# Error: Can't load '/home/fly1600/ap1600/lib/auto/DB_File/DB_File.so' for module DB_File: libdb-4.3.so: cannot open shared object file: No such file or directory at /home/fly1600/ap1600/lib/XSLoader.pm line 68.
# at /home/fly1600/ap1600/lib/DB_File.pm line 258.
# Compilation failed in require at Bio/DB/SeqFeature/Store/LoadHelper.pm line 38.
# BEGIN failed--compilation aborted at t/LocalDB/SeqFeature.t line 16.
# Compilation failed in require at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/GFF3Loader.pm line 72.
# Compilation failed in require at (eval 110) line 2.
# BEGIN failed--compilation aborted at (eval 110) line 2.
# Looks like you planned 116 tests but ran 1 extra.
# Looks like you failed 1 test of 117 run.
t/LocalDB/SeqFeature.t .......................
1..116
ok 1 - use Bio::SeqFeature::Generic;
ok 2 - use Bio::DB::SeqFeature::Store;
not ok 3 - use Bio::DB::SeqFeature::Store::GFF3Loader;
ok 4 - use Bio::Root::IO;
ok 5 - use Bio::DB::Fasta;
ok 6 - use File::Copy;
ok 7 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 8 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 9 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 10 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 11 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 12 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 13 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 14 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 15 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 16 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 17 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 18 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 19 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 20 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 21 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 22 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 23 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 24 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 25 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 26 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 27 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 28 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 29 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 30 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 31 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 32 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 33 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 34 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 35 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 36 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 37 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 38 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 39 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 40 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 41 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 42 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 43 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 44 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 45 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 46 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 47 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 48 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 49 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 50 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 51 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 52 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 53 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 54 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 55 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 56 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 57 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 58 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 59 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 60 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 61 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 62 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 63 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 64 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 65 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 66 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 67 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 68 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 69 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 70 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 71 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 72 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 73 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 74 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 75 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 76 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 77 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 78 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 79 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 80 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 81 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 82 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 83 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 84 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 85 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 86 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 87 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 88 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 89 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 90 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 91 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 92 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 93 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 94 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 95 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 96 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 97 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 98 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 99 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 100 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 101 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 102 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 103 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 104 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 105 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 106 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 107 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 108 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 109 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 110 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 111 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 112 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 113 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 114 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 115 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 116 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
ok 117 # skip DB load failed? Skipping all! Attempt to reload Bio/DB/SeqFeature/Store/GFF3Loader.pm aborted.
# Compilation failed in require at Bio/DB/SeqFeature/Store/memory.pm line 124.
# BEGIN failed--compilation aborted at Bio/DB/SeqFeature/Store/memory.pm line 124.
# Compilation failed in require at (eval 123) line 2.
# at t/LocalDB/SeqFeature.t line 32.
#
Dubious, test returned 1 (wstat 256, 0x100)
Failed 1/116 subtests
(less 111 skipped subtests: 4 okay)
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't load '/home/fly1600/ap1600/lib/auto/DB_File/DB_File.so' for module DB_File: libdb-4.3.so: cannot open shared object file: No such file or directory at /home/fly1600/ap1600/lib/XSLoader.pm line 68.
at /home/fly1600/ap1600/lib/DB_File.pm line 258.
Compilation failed in require at Bio/DB/Taxonomy/flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio/DB/Taxonomy/flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/LocalDB/transfac_pro.t:18
-----------------------------------------------------------
Bio::DB::Taxonomy: flatfile cannot be found
Exception
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't load '/home/fly1600/ap1600/lib/auto/DB_File/DB_File.so' for module DB_File: libdb-4.3.so: cannot open shared object file: No such file or directory at /home/fly1600/ap1600/lib/XSLoader.pm line 68.
at /home/fly1600/ap1600/lib/DB_File.pm line 258.
Compilation failed in require at Bio/DB/Taxonomy/flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio/DB/Taxonomy/flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/LocalDB/transfac_pro.t:18
-----------------------------------------------------------
For more information about the Bio::DB::Taxonomy system please see
the Bio::DB::Taxonomy docs. This includes ways of checking for
formats at compile time, not run time.
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Attempt to reload DB_File.pm aborted.
Compilation failed in require at Bio/DB/TFBS/transfac_pro.pm line 118.
BEGIN failed--compilation aborted at Bio/DB/TFBS/transfac_pro.pm line 118.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151
STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130
STACK: t/LocalDB/transfac_pro.t:25
-----------------------------------------------------------
Bio::DB::TFBS: transfac_pro cannot be found
Exception
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::TFBS::transfac_pro. Attempt to reload DB_File.pm aborted.
Compilation failed in require at Bio/DB/TFBS/transfac_pro.pm line 118.
BEGIN failed--compilation aborted at Bio/DB/TFBS/transfac_pro.pm line 118.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::TFBS::_load_tax_module Bio/DB/TFBS.pm:151
STACK: Bio::DB::TFBS::new Bio/DB/TFBS.pm:130
STACK: t/LocalDB/transfac_pro.t:25
-----------------------------------------------------------
For more information about the Bio::DB::TFBS system please see
the Bio::DB::TFBS docs. This includes ways of checking for
formats at compile time, not run time.
# Failed test at t/LocalDB/transfac_pro.t line 25.
Can't call method "get_reference_ids" on an undefined value at t/LocalDB/transfac_pro.t line 33.
# Looks like you planned 115 tests but ran 4.
# Looks like you failed 1 test of 4 run.
# Looks like your test exited with 255 just after 4.
t/LocalDB/transfac_pro.t .....................
1..115
ok 1 - use Bio::Matrix::PSM::IO;
ok 2 - use Bio::DB::TFBS;
ok 3 - use Bio::DB::Taxonomy;
not ok 4
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 112/115 subtests
t/Map/Cyto.t .................................
1..110
ok 1 - use Bio::Map::CytoMap;
ok 2 - use Bio::Map::CytoPosition;
ok 3 - use Bio::Map::CytoMarker;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::Map::CytoPosition
ok 15
ok 16
ok 17
ok 18 - The object isa Bio::Range
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok
t/Map/Linkage.t ..............................
1..18
ok 1 - use Bio::Map::LinkagePosition;
ok 2 - use Bio::Map::Microsatellite;
ok 3 - use Bio::Map::LinkageMap;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/Map/Map.t ..................................
1..267
ok 1 - use Bio::Map::SimpleMap;
ok 2 - use Bio::Map::Marker;
ok 3 - use Bio::Map::Position;
ok 4 - use Bio::Map::Relative;
ok 5 - use Bio::Map::Mappable;
ok 6
ok 7
ok 8
ok 9
ok 10 - Length is 0
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151 - use Bio::Map::Gene;
ok 152 - use Bio::Map::GeneMap;
ok 153 - use Bio::Map::TranscriptionFactor;
ok 154 - use Bio::Map::GeneRelative;
ok 155 - use Bio::Map::GenePosition;
ok 156 - use Bio::Map::Prediction;
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 250 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 251 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 252 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 253 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 254 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 255 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 256 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 257 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 258 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 259 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 260 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 261 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 262 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 263 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 264 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 265 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 266 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok 267 # skip The optional module Bio::Tools::Run::Ensembl (or dependencies thereof) was not installed
ok
t/Map/MapIO.t ................................
1..51
ok 1 - use Bio::MapIO;
ok 2
ok 3 - The object isa Bio::Map::MapI
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok
t/Map/MicrosatelliteMarker.t .................
1..8
ok 1 - use Bio::Map::SimpleMap;
ok 2 - use Bio::Map::Position;
ok 3 - use Bio::Map::Microsatellite;
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Map/Physical.t .............................
1..39
ok 1 - use Bio::Map::Physical;
ok 2 - use Bio::MapIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - code holds and returns a string, definition requires a boolean
ok 13 - code holds and returns a string, definition requires a boolean
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok
t/Matrix/IO/masta.t ..........................
1..16
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok
t/Matrix/IO/psm.t ............................
1..63
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok
t/Matrix/InstanceSite.t ......................
1..6
ok 1 - use Bio::Matrix::PSM::InstanceSite;
ok 2
ok 3
ok 4
ok 5
ok 6
ok
t/Matrix/Matrix.t ............................
1..77
ok 1 - use Bio::Matrix::Generic;
ok 2 - use Bio::Matrix::IO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30 - The object isa Bio::Matrix::Scoring
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - The object isa Bio::Matrix::Scoring
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok
t/Matrix/ProtMatrix.t ........................
1..14
ok 1 - use Bio::Matrix::PSM::ProtMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Matrix/ProtPsm.t ...........................
1..14
ok 1 - use Bio::Matrix::PSM::IO;
ok 2
ok 3
ok 4
ok 5 # skip TODO: Module incomplete
ok 6 # skip TODO: Module incomplete
ok 7 # skip TODO: Module incomplete
ok 8 # skip TODO: Module incomplete
ok 9 # skip TODO: Module incomplete
ok 10 # skip TODO: Module incomplete
ok 11 # skip TODO: Module incomplete
ok 12 # skip TODO: Module incomplete
ok 13 # skip TODO: Module incomplete
ok 14 # skip TODO: Module incomplete
ok
t/Matrix/SiteMatrix.t ........................
1..14
ok 1 - use Bio::Matrix::PSM::SiteMatrix;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok
t/Ontology/GOterm.t ..........................
1..62
ok 1 - use Bio::Ontology::GOterm;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - The object isa Bio::Ontology::GOterm
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok
t/Ontology/GraphAdaptor.t ....................
1..28
ok 1 - use Bio::Ontology::SimpleGOEngine::GraphAdaptor;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok
t/Ontology/IO/go.t ...........................
1..102
ok 1 - use Bio::OntologyIO;
ok 2
ok 3 - The object isa Bio::Ontology::OntologyI
ok 4
ok 5 - The object isa Bio::Ontology::OntologyEngineI
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/Ontology/IO/interpro.t .....................
1..69
ok 1 - use Bio::OntologyIO;
ok 2 - The object isa Bio::OntologyIO::InterProParser
ok 3
ok 4 - get_dbxrefs on leaf terms is non-empty
ok 5 - get_dbxrefs(member_list) on leaf terms is non-empty
ok 6 - get_dbxrefs(sec_list) on leaf terms is non-empty
ok 7 - get_dbxrefs(class_list) on leaf terms is non-empty
ok 8 - get_dbxrefs(pub_list) on leaf terms is non-empty
ok 9 - get_dbxrefs(example_list) on leaf terms is non-empty
ok 10 - get_dbxrefs(external_doc_list) on leaf terms is non-empty
ok 11 - get_members on leaf terms is non-empty
ok 12 - class_list on leaf terms is non-empty
ok 13 - get_examples on leaf terms is non-empty
ok 14 - get_external_documents on leaf terms is non-empty
ok 15 - get_references on leaf terms is non-empty
ok 16 - protein_count on leaf terms is non-empty
ok 17 - to_string looks reasonable
ok 18 - There are 8 root InterPro terms
ok 19 - The object isa Bio::Ontology::Ontology
ok 20 - term Integrins alpha chain in ontology InterPro
ok 21 - The object isa Bio::Ontology::Ontology
ok 22 - term post-translational modification in ontology InterPro
ok 23 - The object isa Bio::Ontology::Ontology
ok 24 - term Repeat in ontology InterPro
ok 25 - The object isa Bio::Ontology::Ontology
ok 26 - term Binding Site in ontology InterPro
ok 27 - The object isa Bio::Ontology::Ontology
ok 28 - term Cdc20/Fizzy in ontology InterPro
ok 29 - The object isa Bio::Ontology::Ontology
ok 30 - term Conserved Site in ontology InterPro
ok 31 - The object isa Bio::Ontology::Ontology
ok 32 - term Region in ontology InterPro
ok 33 - The object isa Bio::Ontology::Ontology
ok 34 - term Kringle in ontology InterPro
ok 35 - The object isa Bio::Ontology::Ontology
ok 36 - term Helix-turn-helix, AraC type in ontology InterPro
ok 37 - The object isa Bio::Ontology::Ontology
ok 38 - term Active Site in ontology InterPro
ok 39 - The object isa Bio::Ontology::Ontology
ok 40 - term Active Site in ontology InterPro
ok 41 - The object isa Bio::Ontology::Ontology
ok 42 - term Binding Site in ontology InterPro
ok 43 - The object isa Bio::Ontology::Ontology
ok 44 - term Conserved Site in ontology InterPro
ok 45 - The object isa Bio::Ontology::Ontology
ok 46 - term Domain in ontology InterPro
ok 47 - The object isa Bio::Ontology::Ontology
ok 48 - term Family in ontology InterPro
ok 49 - The object isa Bio::Ontology::Ontology
ok 50 - term Region in ontology InterPro
ok 51 - The object isa Bio::Ontology::Ontology
ok 52 - term Repeat in ontology InterPro
ok 53 - The object isa Bio::Ontology::Ontology
ok 54 - term post-translational modification in ontology InterPro
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 - Integrins alpha chain term has one parent
ok 62 - Integrins alpha chain term has one ancestor
ok 63 - Cdc20/Fizzy term has one parent
ok 64 - Cdc20/Fizzy term has one ancestor
ok 65 - Kringle term has one parent
ok 66 - Kringle term has one ancestor
ok 67 - Helix-turn-helix, AraC type term has one parent
ok 68 - Helix-turn-helix, AraC type term has one ancestor
ok 69 - secondary accession map has 2 keys
ok
t/Ontology/IO/obo.t ..........................
1..92
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - got a ontology IO handler isa Bio::OntologyIO
ok 47 - got ontology parser2 isa Bio::Ontology::Ontology
ok 48 - got OBO engine object isa Bio::Ontology::OBOEngine
ok 49 - got ontology parser2 isa Bio::Ontology::Ontology
ok 50 - got OBO engine object isa Bio::Ontology::OBOEngine
ok 51 - got ontology parser2 isa Bio::Ontology::Ontology
ok 52 - got OBO engine object isa Bio::Ontology::OBOEngine
ok 53 - Gene ontology
ok 54 - biological process
ok 55 - molecular function
ok 56 - Got root
ok 57 - Got root
ok 58 - Got regulates
# from gene_ontology
ok 59 - Got
# positively regulates from gene_ontology
ok 60 - Got
# regulates from biological_process
ok 61 - Got
# positively regulates from biological_process
ok 62 - Got predicates for gene_ontology
ok 63 - Got predicates for biological_process
ok 64 - Got regulates predicate
ok 65 - Got positively regulates predicate
ok 66 - Got relationships for biological_process
ok 67 - Got relationships for molecular_function
ok 68 - Got is a relationship from
# molecular_function
ok 69 - Got term object isa Bio::Ontology::Term
ok 70 - Got term id
ok 71 - Got term name
ok 72 - Got regulated object isa Bio::Ontology::Term
ok 73 - Got regulated term1 id
ok 74 - Got term1 object isa Bio::Ontology::Term
ok 75 - Got back the child
ok 76 - Got term object isa Bio::Ontology::Term
ok 77 - Got term id
ok 78 - Got term name
ok 79 - Got regulated object isa Bio::Ontology::Term
ok 80 - Got regulated term1 id
ok 81 - Got identical regulation
ok 82 - Got term1 object isa Bio::Ontology::Term
ok 83 - Got back the child
ok 84 - got a ontology IO handler isa Bio::OntologyIO
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok
t/Ontology/Ontology.t ........................
1..55
ok 1 - use Bio::OntologyIO;
ok 2 - use Bio::Ontology::RelationshipType;
ok 3 - The object isa Bio::Ontology::Ontology
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53 - Interpro XML file interpro.xml can be parsed
ok 54 - Interpro XML file interpro_sample.xml can be parsed
ok 55 - Interpro XML file interpro_relationship.xml can be parsed
ok
t/Ontology/OntologyEngine.t ..................
1..31
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::Relationship;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - use Bio::Ontology::SimpleOntologyEngine;
ok 5 - use Bio::Ontology::Ontology;
ok 6 - The object isa Bio::Ontology::OntologyEngineI
ok 7
ok 8 - adding a relationship with an undef object term fails
ok 9 - adding a relationship with an undef object term fails
ok 10 - adding a relationship with an undef subject term fails
ok 11 - adding a relationship with an undef subject term fails
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/Ontology/OntologyStore.t ................... skipped: Network tests have not been requested
t/Ontology/Relationship.t ....................
1..12
ok 1 - use Bio::Ontology::Relationship;
ok 2 - use Bio::Ontology::GOterm;
ok 3 - use Bio::Ontology::RelationshipType;
ok 4 - The object isa Bio::Ontology::RelationshipType
ok 5 - The object isa Bio::Ontology::GOterm
ok 6 - The object isa Bio::Ontology::GOterm
ok 7 - The object isa Bio::Ontology::Relationship
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/Ontology/RelationshipType.t ................
1..23
ok 1 - use Bio::Ontology::RelationshipType;
ok 2 - use Bio::Ontology::Ontology;
ok 3 - The object isa Bio::Ontology::RelationshipType
ok 4 - The object isa Bio::Ontology::TermI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok
t/Ontology/Term.t ............................
1..54
ok 1 - use Bio::Ontology::Term;
ok 2 - use Bio::Ontology::TermFactory;
ok 3 - use Bio::Annotation::DBLink;
ok 4 - The object isa Bio::Ontology::TermI
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44 - The object isa Bio::Ontology::TermI
ok 45
ok 46 - The object isa Bio::Ontology::TermI
ok 47 - The object isa Bio::Ontology::GOterm
ok 48
ok 49
ok 50 - The object isa Bio::Ontology::TermI
ok 51 - The object isa Bio::AnnotationI
ok 52
ok 53
ok 54
ok
t/Perl.t .....................................
1..31
ok 1 - use Bio::Perl;
ok 2
ok 3 - The object isa Bio::SeqI
ok 4
ok 5 - The object isa Bio::SeqI
ok 6
ok 7 - The object isa Bio::SeqI
ok 8 - The object isa Bio::SeqI
ok 9
ok 10
ok 11 - The object isa Bio::SeqI
ok 12
ok 13 - The object isa Bio::SeqI
ok 14
ok 15 - The object isa Bio::PrimarySeqI
ok 16
ok 17
ok 18
ok 19
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok
t/Phenotype/Correlate.t ......................
1..17
ok 1 - use Bio::Phenotype::Correlate;
ok 2 - use Bio::Species;
ok 3 - The object isa Bio::Phenotype::Correlate
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok
t/Phenotype/MeSH.t ...........................
1..24
ok 1 - use Bio::Phenotype::MeSH::Term;
ok 2 - use Bio::Phenotype::MeSH::Twig;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/Phenotype/Measure.t ........................
1..21
ok 1 - use Bio::Phenotype::Measure;
ok 2 - The object isa Bio::Phenotype::Measure
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok
t/Phenotype/MiniMIMentry.t ...................
1..15
ok 1 - use Bio::Phenotype::OMIM::MiniMIMentry;
ok 2 - The object isa Bio::Phenotype::OMIM::MiniMIMentry
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
t/Phenotype/OMIMentry.t ......................
1..153
ok 1 - use Bio::Phenotype::OMIM::OMIMentry;
ok 2 - use Bio::Phenotype::OMIM::MiniMIMentry;
ok 3 - use Bio::Species;
ok 4 - use Bio::Annotation::Reference;
ok 5 - use Bio::Map::CytoPosition;
ok 6 - use Bio::Phenotype::Correlate;
ok 7 - use Bio::Phenotype::Measure;
ok 8 - use Bio::Annotation::DBLink;
ok 9 - The object isa Bio::Phenotype::OMIM::OMIMentry
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79 - operator overloading in AnnotationI is deprecated
ok 80 - operator overloading in AnnotationI is deprecated
ok 81
ok 82
ok 83 - operator overloading in AnnotationI is deprecated
ok 84 - operator overloading in AnnotationI is deprecated
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136 - operator overloading in AnnotationI is deprecated
ok 137 - operator overloading in AnnotationI is deprecated
ok 138
ok 139
ok 140 - operator overloading in AnnotationI is deprecated
ok 141 - operator overloading in AnnotationI is deprecated
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok
t/Phenotype/OMIMentryAllelicVariant.t ........
1..27
ok 1 - use Bio::Phenotype::OMIM::OMIMentryAllelicVariant;
ok 2 - The object isa Bio::Phenotype::OMIM::OMIMentryAllelicVariant
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok
t/Phenotype/OMIMparser.t .....................
1..175
ok 1 - use Bio::Phenotype::OMIM::OMIMparser;
ok 2 - The object isa Bio::Phenotype::OMIM::OMIMparser
ok 3 - The object isa Bio::Phenotype::OMIM::OMIMentry
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - The object isa Bio::Phenotype::OMIM::MiniMIMentry
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - The object isa Bio::Phenotype::OMIM::OMIMentry
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105 - The object isa Bio::Phenotype::OMIM::MiniMIMentry
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175 - missing linebreak caught
ok
t/Phenotype/Phenotype.t ......................
1..116
ok 1 - use Bio::Phenotype::Phenotype;
ok 2 - use Bio::Species;
ok 3 - use Bio::Annotation::Reference;
ok 4 - use Bio::Map::CytoPosition;
ok 5 - use Bio::Phenotype::Correlate;
ok 6 - use Bio::Phenotype::Measure;
ok 7 - use Bio::Annotation::DBLink;
ok 8 - The object isa Bio::Phenotype::PhenotypeI
ok 9 - The object isa Bio::Phenotype::Phenotype
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - operator overloading in AnnotationI is deprecated
ok 43 - operator overloading in AnnotationI is deprecated
ok 44
ok 45
ok 46 - operator overloading in AnnotationI is deprecated
ok 47 - operator overloading in AnnotationI is deprecated
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - operator overloading in AnnotationI is deprecated
ok 100 - operator overloading in AnnotationI is deprecated
ok 101
ok 102
ok 103 - operator overloading in AnnotationI is deprecated
ok 104 - operator overloading in AnnotationI is deprecated
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok
# Failed test 'POD test for Bio/Tools/Geneid.pm'
# at /home/fly1600/var/megalib/Test/Pod.pm line 182.
# Bio/Tools/Geneid.pm (37): Non-ASCII character seen before =encoding in 'Guigó'. Assuming ISO8859-1
# Failed test 'POD test for Bio/Tools/GuessSeqFormat.pm'
# at /home/fly1600/var/megalib/Test/Pod.pm line 182.
# Bio/Tools/GuessSeqFormat.pm (233): Non-ASCII character seen before =encoding in 'Kähäri,'. Assuming ISO8859-1
# Failed test 'POD test for Bio/Tree/Statistics.pm'
# at /home/fly1600/var/megalib/Test/Pod.pm line 182.
Wide character in print at /home/fly1600/var/megalib/Test/Builder.pm line 1759.
# Bio/Tree/Statistics.pm (214): Non-ASCII character seen before =encoding in 'deï¬ning'. Assuming UTF-8
# Failed test 'POD test for examples/biblio/biblio-eutils-example.pl'
# at /home/fly1600/var/megalib/Test/Pod.pm line 182.
# examples/biblio/biblio-eutils-example.pl (108): Non-ASCII character seen before =encoding in 'Kubícková'. Assuming ISO8859-1
# Failed test 'POD test for Bio/Tools/Run/WrapperBase.pm'
# at /home/fly1600/var/megalib/Test/Pod.pm line 182.
# Bio/Tools/Run/WrapperBase.pm (181): Non-ASCII character seen before =encoding in 'NB:ÊThis'. Assuming ISO8859-1
# Looks like you failed 5 tests of 1011.
t/PodSyntax.t ................................
1..1011
ok 1 - POD test for Bio/AlignIO.pm
ok 2 - POD test for Bio/AnalysisI.pm
ok 3 - POD test for Bio/AnalysisParserI.pm
ok 4 - POD test for Bio/AnalysisResultI.pm
ok 5 - POD test for Bio/AnnotatableI.pm
ok 6 - POD test for Bio/AnnotationCollectionI.pm
ok 7 - POD test for Bio/AnnotationI.pm
ok 8 - POD test for Bio/Biblio.pm
ok 9 - POD test for Bio/ClusterI.pm
ok 10 - POD test for Bio/ClusterIO.pm
ok 11 - POD test for Bio/DasI.pm
ok 12 - POD test for Bio/DBLinkContainerI.pm
ok 13 - POD test for Bio/DescribableI.pm
ok 14 - POD test for Bio/FeatureHolderI.pm
ok 15 - POD test for Bio/FeatureIO.pm
ok 16 - POD test for Bio/HandlerBaseI.pm
ok 17 - POD test for Bio/IdCollectionI.pm
ok 18 - POD test for Bio/IdentifiableI.pm
ok 19 - POD test for Bio/LocatableSeq.pm
ok 20 - POD test for Bio/LocationI.pm
ok 21 - POD test for Bio/MapIO.pm
ok 22 - POD test for Bio/NexmlIO.pm
ok 23 - POD test for Bio/OntologyIO.pm
ok 24 - POD test for Bio/ParameterBaseI.pm
ok 25 - POD test for Bio/Perl.pm
ok 26 - POD test for Bio/PhyloNetwork.pm
ok 27 - POD test for Bio/PrimarySeq.pm
ok 28 - POD test for Bio/PrimarySeqI.pm
ok 29 - POD test for Bio/PullParserI.pm
ok 30 - POD test for Bio/Range.pm
ok 31 - POD test for Bio/RangeI.pm
ok 32 - POD test for Bio/SearchDist.pm
ok 33 - POD test for Bio/SearchIO.pm
ok 34 - POD test for Bio/Seq.pm
ok 35 - POD test for Bio/SeqAnalysisParserI.pm
ok 36 - POD test for Bio/SeqFeatureI.pm
ok 37 - POD test for Bio/SeqI.pm
ok 38 - POD test for Bio/SeqIO.pm
ok 39 - POD test for Bio/SeqUtils.pm
ok 40 - POD test for Bio/SimpleAlign.pm
ok 41 - POD test for Bio/SimpleAnalysisI.pm
ok 42 - POD test for Bio/Species.pm
ok 43 - POD test for Bio/Taxon.pm
ok 44 - POD test for Bio/Taxonomy.pm
ok 45 - POD test for Bio/TreeIO.pm
ok 46 - POD test for Bio/UpdateableSeqI.pm
ok 47 - POD test for Bio/WebAgent.pm
ok 48 - POD test for examples/bioperl.pl (no pod)
ok 49 - POD test for examples/generate_random_seq.pl (no pod)
ok 50 - POD test for examples/longorf.pl
ok 51 - POD test for examples/make_primers.pl (no pod)
ok 52 - POD test for examples/rev_and_trans.pl (no pod)
ok 53 - POD test for examples/revcom_dir.pl (no pod)
ok 54 - POD test for examples/subsequence.cgi (no pod)
ok 55 - POD test for maintenance/authors.pl
ok 56 - POD test for maintenance/check_NAME.pl
ok 57 - POD test for maintenance/check_URLs.pl
ok 58 - POD test for maintenance/cvs2cl_by_file.pl
ok 59 - POD test for maintenance/dependencies.pl
ok 60 - POD test for maintenance/deprecated.pl
ok 61 - POD test for maintenance/find_mod_deps.pl
ok 62 - POD test for maintenance/module_usage.pl (no pod)
ok 63 - POD test for maintenance/modules.pl
ok 64 - POD test for maintenance/ncbi_blast_switches.pl (no pod)
ok 65 - POD test for maintenance/pod.pl
ok 66 - POD test for maintenance/symlink_script.pl
ok 67 - POD test for maintenance/version.pl
ok 68 - POD test for Bio/Align/AlignI.pm
ok 69 - POD test for Bio/Align/DNAStatistics.pm
ok 70 - POD test for Bio/Align/Graphics.pm
ok 71 - POD test for Bio/Align/PairwiseStatistics.pm
ok 72 - POD test for Bio/Align/ProteinStatistics.pm
ok 73 - POD test for Bio/Align/StatisticsI.pm
ok 74 - POD test for Bio/Align/Utilities.pm
ok 75 - POD test for Bio/AlignIO/arp.pm
ok 76 - POD test for Bio/AlignIO/bl2seq.pm
ok 77 - POD test for Bio/AlignIO/clustalw.pm
ok 78 - POD test for Bio/AlignIO/emboss.pm
ok 79 - POD test for Bio/AlignIO/fasta.pm
ok 80 - POD test for Bio/AlignIO/largemultifasta.pm
ok 81 - POD test for Bio/AlignIO/maf.pm
ok 82 - POD test for Bio/AlignIO/mase.pm
ok 83 - POD test for Bio/AlignIO/mega.pm
ok 84 - POD test for Bio/AlignIO/meme.pm
ok 85 - POD test for Bio/AlignIO/metafasta.pm
ok 86 - POD test for Bio/AlignIO/msf.pm
ok 87 - POD test for Bio/AlignIO/nexml.pm
ok 88 - POD test for Bio/AlignIO/nexus.pm
ok 89 - POD test for Bio/AlignIO/pfam.pm
ok 90 - POD test for Bio/AlignIO/phylip.pm
ok 91 - POD test for Bio/AlignIO/po.pm
ok 92 - POD test for Bio/AlignIO/proda.pm
ok 93 - POD test for Bio/AlignIO/prodom.pm
ok 94 - POD test for Bio/AlignIO/psi.pm
ok 95 - POD test for Bio/AlignIO/selex.pm
ok 96 - POD test for Bio/AlignIO/stockholm.pm
ok 97 - POD test for Bio/AlignIO/xmfa.pm
ok 98 - POD test for Bio/Annotation/AnnotationFactory.pm
ok 99 - POD test for Bio/Annotation/Collection.pm
ok 100 - POD test for Bio/Annotation/Comment.pm
ok 101 - POD test for Bio/Annotation/DBLink.pm
ok 102 - POD test for Bio/Annotation/OntologyTerm.pm
ok 103 - POD test for Bio/Annotation/Reference.pm
ok 104 - POD test for Bio/Annotation/Relation.pm
ok 105 - POD test for Bio/Annotation/SimpleValue.pm
ok 106 - POD test for Bio/Annotation/StructuredValue.pm
ok 107 - POD test for Bio/Annotation/TagTree.pm
ok 108 - POD test for Bio/Annotation/Target.pm
ok 109 - POD test for Bio/Annotation/Tree.pm
ok 110 - POD test for Bio/Annotation/TypeManager.pm
ok 111 - POD test for Bio/Assembly/Contig.pm
ok 112 - POD test for Bio/Assembly/ContigAnalysis.pm
ok 113 - POD test for Bio/Assembly/IO.pm
ok 114 - POD test for Bio/Assembly/Scaffold.pm
ok 115 - POD test for Bio/Assembly/ScaffoldI.pm
ok 116 - POD test for Bio/Assembly/Singlet.pm
ok 117 - POD test for Bio/Biblio/Article.pm
ok 118 - POD test for Bio/Biblio/BiblioBase.pm
ok 119 - POD test for Bio/Biblio/Book.pm
ok 120 - POD test for Bio/Biblio/BookArticle.pm
ok 121 - POD test for Bio/Biblio/IO.pm
ok 122 - POD test for Bio/Biblio/Journal.pm
ok 123 - POD test for Bio/Biblio/JournalArticle.pm
ok 124 - POD test for Bio/Biblio/MedlineArticle.pm
ok 125 - POD test for Bio/Biblio/MedlineBook.pm
ok 126 - POD test for Bio/Biblio/MedlineBookArticle.pm
ok 127 - POD test for Bio/Biblio/MedlineJournal.pm
ok 128 - POD test for Bio/Biblio/MedlineJournalArticle.pm
ok 129 - POD test for Bio/Biblio/Organisation.pm
ok 130 - POD test for Bio/Biblio/Patent.pm
ok 131 - POD test for Bio/Biblio/Person.pm
ok 132 - POD test for Bio/Biblio/Proceeding.pm
ok 133 - POD test for Bio/Biblio/Provider.pm
ok 134 - POD test for Bio/Biblio/PubmedArticle.pm
ok 135 - POD test for Bio/Biblio/PubmedBookArticle.pm
ok 136 - POD test for Bio/Biblio/PubmedJournalArticle.pm
ok 137 - POD test for Bio/Biblio/Ref.pm
ok 138 - POD test for Bio/Biblio/Service.pm
ok 139 - POD test for Bio/Biblio/TechReport.pm
ok 140 - POD test for Bio/Biblio/Thesis.pm
ok 141 - POD test for Bio/Biblio/WebResource.pm
ok 142 - POD test for Bio/Cluster/ClusterFactory.pm
ok 143 - POD test for Bio/Cluster/FamilyI.pm
ok 144 - POD test for Bio/Cluster/SequenceFamily.pm
ok 145 - POD test for Bio/Cluster/UniGene.pm
ok 146 - POD test for Bio/Cluster/UniGeneI.pm
ok 147 - POD test for Bio/ClusterIO/dbsnp.pm
ok 148 - POD test for Bio/ClusterIO/unigene.pm
ok 149 - POD test for Bio/CodonUsage/IO.pm
ok 150 - POD test for Bio/CodonUsage/Table.pm
ok 151 - POD test for Bio/Coordinate/Chain.pm
ok 152 - POD test for Bio/Coordinate/Collection.pm
ok 153 - POD test for Bio/Coordinate/ExtrapolatingPair.pm
ok 154 - POD test for Bio/Coordinate/GeneMapper.pm
ok 155 - POD test for Bio/Coordinate/Graph.pm
ok 156 - POD test for Bio/Coordinate/MapperI.pm
ok 157 - POD test for Bio/Coordinate/Pair.pm
ok 158 - POD test for Bio/Coordinate/Result.pm
ok 159 - POD test for Bio/Coordinate/ResultI.pm
ok 160 - POD test for Bio/Coordinate/Utils.pm
ok 161 - POD test for Bio/Das/FeatureTypeI.pm
ok 162 - POD test for Bio/Das/SegmentI.pm
ok 163 - POD test for Bio/DB/Ace.pm
ok 164 - POD test for Bio/DB/BiblioI.pm
ok 165 - POD test for Bio/DB/BioFetch.pm
ok 166 - POD test for Bio/DB/CUTG.pm
ok 167 - POD test for Bio/DB/DBFetch.pm
ok 168 - POD test for Bio/DB/EMBL.pm
ok 169 - POD test for Bio/DB/EntrezGene.pm
ok 170 - POD test for Bio/DB/EUtilities.pm
ok 171 - POD test for Bio/DB/Expression.pm
ok 172 - POD test for Bio/DB/Failover.pm
ok 173 - POD test for Bio/DB/Fasta.pm
ok 174 - POD test for Bio/DB/FileCache.pm
ok 175 - POD test for Bio/DB/Flat.pm
ok 176 - POD test for Bio/DB/GenBank.pm
ok 177 - POD test for Bio/DB/GenericWebAgent.pm
ok 178 - POD test for Bio/DB/GenPept.pm
ok 179 - POD test for Bio/DB/GFF.pm
ok 180 - POD test for Bio/DB/HIV.pm
ok 181 - POD test for Bio/DB/InMemoryCache.pm
ok 182 - POD test for Bio/DB/LocationI.pm
ok 183 - POD test for Bio/DB/MeSH.pm
ok 184 - POD test for Bio/DB/NCBIHelper.pm
ok 185 - POD test for Bio/DB/Qual.pm
ok 186 - POD test for Bio/DB/QueryI.pm
ok 187 - POD test for Bio/DB/RandomAccessI.pm
ok 188 - POD test for Bio/DB/ReferenceI.pm
ok 189 - POD test for Bio/DB/RefSeq.pm
ok 190 - POD test for Bio/DB/Registry.pm
ok 191 - POD test for Bio/DB/SeqFeature.pm
ok 192 - POD test for Bio/DB/SeqHound.pm
ok 193 - POD test for Bio/DB/SeqI.pm
ok 194 - POD test for Bio/DB/SeqVersion.pm
ok 195 - POD test for Bio/DB/SwissProt.pm
ok 196 - POD test for Bio/DB/Taxonomy.pm
ok 197 - POD test for Bio/DB/TFBS.pm
ok 198 - POD test for Bio/DB/Universal.pm
ok 199 - POD test for Bio/DB/UpdateableSeqI.pm
ok 200 - POD test for Bio/DB/WebDBSeqI.pm
ok 201 - POD test for Bio/Draw/Pictogram.pm
ok 202 - POD test for Bio/Event/EventGeneratorI.pm
ok 203 - POD test for Bio/Event/EventHandlerI.pm
ok 204 - POD test for Bio/Factory/AnalysisI.pm
ok 205 - POD test for Bio/Factory/ApplicationFactoryI.pm
ok 206 - POD test for Bio/Factory/DriverFactory.pm
ok 207 - POD test for Bio/Factory/FTLocationFactory.pm
ok 208 - POD test for Bio/Factory/LocationFactoryI.pm
ok 209 - POD test for Bio/Factory/MapFactoryI.pm
ok 210 - POD test for Bio/Factory/ObjectBuilderI.pm
ok 211 - POD test for Bio/Factory/ObjectFactory.pm
ok 212 - POD test for Bio/Factory/ObjectFactoryI.pm
ok 213 - POD test for Bio/Factory/SeqAnalysisParserFactory.pm
ok 214 - POD test for Bio/Factory/SeqAnalysisParserFactoryI.pm
ok 215 - POD test for Bio/Factory/SequenceFactoryI.pm
ok 216 - POD test for Bio/Factory/SequenceProcessorI.pm
ok 217 - POD test for Bio/Factory/SequenceStreamI.pm
ok 218 - POD test for Bio/Factory/TreeFactoryI.pm
ok 219 - POD test for Bio/FeatureIO/bed.pm
ok 220 - POD test for Bio/FeatureIO/gff.pm
ok 221 - POD test for Bio/FeatureIO/gtf.pm
ok 222 - POD test for Bio/FeatureIO/interpro.pm
ok 223 - POD test for Bio/FeatureIO/ptt.pm
ok 224 - POD test for Bio/FeatureIO/vecscreen_simple.pm
ok 225 - POD test for Bio/Index/Abstract.pm
ok 226 - POD test for Bio/Index/AbstractSeq.pm
ok 227 - POD test for Bio/Index/Blast.pm
ok 228 - POD test for Bio/Index/BlastTable.pm
ok 229 - POD test for Bio/Index/EMBL.pm
ok 230 - POD test for Bio/Index/Fasta.pm
ok 231 - POD test for Bio/Index/Fastq.pm
ok 232 - POD test for Bio/Index/GenBank.pm
ok 233 - POD test for Bio/Index/Hmmer.pm
ok 234 - POD test for Bio/Index/Qual.pm
ok 235 - POD test for Bio/Index/Stockholm.pm
ok 236 - POD test for Bio/Index/SwissPfam.pm
ok 237 - POD test for Bio/Index/Swissprot.pm
ok 238 - POD test for Bio/LiveSeq/AARange.pm
ok 239 - POD test for Bio/LiveSeq/Chain.pm
ok 240 - POD test for Bio/LiveSeq/ChainI.pm
ok 241 - POD test for Bio/LiveSeq/DNA.pm
ok 242 - POD test for Bio/LiveSeq/Exon.pm
ok 243 - POD test for Bio/LiveSeq/Gene.pm
ok 244 - POD test for Bio/LiveSeq/Intron.pm
ok 245 - POD test for Bio/LiveSeq/Mutation.pm
ok 246 - POD test for Bio/LiveSeq/Mutator.pm
ok 247 - POD test for Bio/LiveSeq/Prim_Transcript.pm
ok 248 - POD test for Bio/LiveSeq/Range.pm
ok 249 - POD test for Bio/LiveSeq/Repeat_Region.pm
ok 250 - POD test for Bio/LiveSeq/Repeat_Unit.pm
ok 251 - POD test for Bio/LiveSeq/SeqI.pm
ok 252 - POD test for Bio/LiveSeq/Transcript.pm
ok 253 - POD test for Bio/LiveSeq/Translation.pm
ok 254 - POD test for Bio/Location/Atomic.pm
ok 255 - POD test for Bio/Location/AvWithinCoordPolicy.pm
ok 256 - POD test for Bio/Location/CoordinatePolicyI.pm
ok 257 - POD test for Bio/Location/Fuzzy.pm
ok 258 - POD test for Bio/Location/FuzzyLocationI.pm
ok 259 - POD test for Bio/Location/NarrowestCoordPolicy.pm
ok 260 - POD test for Bio/Location/Simple.pm
ok 261 - POD test for Bio/Location/Split.pm
ok 262 - POD test for Bio/Location/SplitLocationI.pm
ok 263 - POD test for Bio/Location/WidestCoordPolicy.pm
ok 264 - POD test for Bio/Map/Clone.pm
ok 265 - POD test for Bio/Map/Contig.pm
ok 266 - POD test for Bio/Map/CytoMap.pm
ok 267 - POD test for Bio/Map/CytoMarker.pm
ok 268 - POD test for Bio/Map/CytoPosition.pm
ok 269 - POD test for Bio/Map/EntityI.pm
ok 270 - POD test for Bio/Map/FPCMarker.pm
ok 271 - POD test for Bio/Map/Gene.pm
ok 272 - POD test for Bio/Map/GeneMap.pm
ok 273 - POD test for Bio/Map/GenePosition.pm
ok 274 - POD test for Bio/Map/GeneRelative.pm
ok 275 - POD test for Bio/Map/LinkageMap.pm
ok 276 - POD test for Bio/Map/LinkagePosition.pm
ok 277 - POD test for Bio/Map/MapI.pm
ok 278 - POD test for Bio/Map/Mappable.pm
ok 279 - POD test for Bio/Map/MappableI.pm
ok 280 - POD test for Bio/Map/Marker.pm
ok 281 - POD test for Bio/Map/MarkerI.pm
ok 282 - POD test for Bio/Map/Microsatellite.pm
ok 283 - POD test for Bio/Map/OrderedPosition.pm
ok 284 - POD test for Bio/Map/OrderedPositionWithDistance.pm
ok 285 - POD test for Bio/Map/Physical.pm
ok 286 - POD test for Bio/Map/Position.pm
ok 287 - POD test for Bio/Map/PositionHandler.pm
ok 288 - POD test for Bio/Map/PositionHandlerI.pm
ok 289 - POD test for Bio/Map/PositionI.pm
ok 290 - POD test for Bio/Map/PositionWithSequence.pm
ok 291 - POD test for Bio/Map/Prediction.pm
ok 292 - POD test for Bio/Map/Relative.pm
ok 293 - POD test for Bio/Map/RelativeI.pm
ok 294 - POD test for Bio/Map/SimpleMap.pm
ok 295 - POD test for Bio/Map/TranscriptionFactor.pm
ok 296 - POD test for Bio/MapIO/fpc.pm
ok 297 - POD test for Bio/MapIO/mapmaker.pm
ok 298 - POD test for Bio/Matrix/Generic.pm
ok 299 - POD test for Bio/Matrix/IO.pm
ok 300 - POD test for Bio/Matrix/MatrixI.pm
ok 301 - POD test for Bio/Matrix/Mlagan.pm
ok 302 - POD test for Bio/Matrix/PhylipDist.pm
ok 303 - POD test for Bio/Matrix/Scoring.pm
ok 304 - POD test for Bio/MolEvol/CodonModel.pm
ok 305 - POD test for Bio/Nexml/Factory.pm
ok 306 - POD test for Bio/Ontology/DocumentRegistry.pm
ok 307 - POD test for Bio/Ontology/GOterm.pm
ok 308 - POD test for Bio/Ontology/InterProTerm.pm
ok 309 - POD test for Bio/Ontology/OBOEngine.pm
ok 310 - POD test for Bio/Ontology/OBOterm.pm
ok 311 - POD test for Bio/Ontology/Ontology.pm
ok 312 - POD test for Bio/Ontology/OntologyEngineI.pm
ok 313 - POD test for Bio/Ontology/OntologyI.pm
ok 314 - POD test for Bio/Ontology/OntologyStore.pm
ok 315 - POD test for Bio/Ontology/Path.pm
ok 316 - POD test for Bio/Ontology/PathI.pm
ok 317 - POD test for Bio/Ontology/Relationship.pm
ok 318 - POD test for Bio/Ontology/RelationshipFactory.pm
ok 319 - POD test for Bio/Ontology/RelationshipI.pm
ok 320 - POD test for Bio/Ontology/RelationshipType.pm
ok 321 - POD test for Bio/Ontology/SimpleOntologyEngine.pm
ok 322 - POD test for Bio/Ontology/Term.pm
ok 323 - POD test for Bio/Ontology/TermFactory.pm
ok 324 - POD test for Bio/Ontology/TermI.pm
ok 325 - POD test for Bio/OntologyIO/dagflat.pm
ok 326 - POD test for Bio/OntologyIO/goflat.pm
ok 327 - POD test for Bio/OntologyIO/InterProParser.pm
ok 328 - POD test for Bio/OntologyIO/obo.pm
ok 329 - POD test for Bio/OntologyIO/simplehierarchy.pm
ok 330 - POD test for Bio/OntologyIO/soflat.pm
ok 331 - POD test for Bio/Phenotype/Correlate.pm
ok 332 - POD test for Bio/Phenotype/Measure.pm
ok 333 - POD test for Bio/Phenotype/Phenotype.pm
ok 334 - POD test for Bio/Phenotype/PhenotypeI.pm
ok 335 - POD test for Bio/PhyloNetwork/Factory.pm
ok 336 - POD test for Bio/PhyloNetwork/FactoryX.pm
ok 337 - POD test for Bio/PhyloNetwork/GraphViz.pm
ok 338 - POD test for Bio/PhyloNetwork/muVector.pm
ok 339 - POD test for Bio/PhyloNetwork/RandomFactory.pm
ok 340 - POD test for Bio/PhyloNetwork/TreeFactory.pm
ok 341 - POD test for Bio/PhyloNetwork/TreeFactoryMulti.pm
ok 342 - POD test for Bio/PhyloNetwork/TreeFactoryX.pm
ok 343 - POD test for Bio/PopGen/Genotype.pm
ok 344 - POD test for Bio/PopGen/GenotypeI.pm
ok 345 - POD test for Bio/PopGen/HtSNP.pm
ok 346 - POD test for Bio/PopGen/Individual.pm
ok 347 - POD test for Bio/PopGen/IndividualI.pm
ok 348 - POD test for Bio/PopGen/IO.pm
ok 349 - POD test for Bio/PopGen/Marker.pm
ok 350 - POD test for Bio/PopGen/MarkerI.pm
ok 351 - POD test for Bio/PopGen/PopStats.pm
ok 352 - POD test for Bio/PopGen/Population.pm
ok 353 - POD test for Bio/PopGen/PopulationI.pm
ok 354 - POD test for Bio/PopGen/Statistics.pm
ok 355 - POD test for Bio/PopGen/TagHaplotype.pm
ok 356 - POD test for Bio/PopGen/Utilities.pm
ok 357 - POD test for Bio/Restriction/Analysis.pm
ok 358 - POD test for Bio/Restriction/Enzyme.pm
ok 359 - POD test for Bio/Restriction/EnzymeCollection.pm
ok 360 - POD test for Bio/Restriction/EnzymeI.pm
ok 361 - POD test for Bio/Restriction/IO.pm
ok 362 - POD test for Bio/Root/Build.pm
ok 363 - POD test for Bio/Root/Exception.pm
ok 364 - POD test for Bio/Root/HTTPget.pm
ok 365 - POD test for Bio/Root/IO.pm
ok 366 - POD test for Bio/Root/Root.pm
ok 367 - POD test for Bio/Root/RootI.pm
ok 368 - POD test for Bio/Root/Storable.pm
ok 369 - POD test for Bio/Root/Test.pm
ok 370 - POD test for Bio/Root/Utilities.pm
ok 371 - POD test for Bio/Root/Version.pm
ok 372 - POD test for Bio/Search/BlastStatistics.pm
ok 373 - POD test for Bio/Search/BlastUtils.pm
ok 374 - POD test for Bio/Search/DatabaseI.pm
ok 375 - POD test for Bio/Search/GenericDatabase.pm
ok 376 - POD test for Bio/Search/GenericStatistics.pm
ok 377 - POD test for Bio/Search/Processor.pm
ok 378 - POD test for Bio/Search/SearchUtils.pm
ok 379 - POD test for Bio/Search/StatisticsI.pm
ok 380 - POD test for Bio/SearchIO/axt.pm
ok 381 - POD test for Bio/SearchIO/blast.pm
ok 382 - POD test for Bio/SearchIO/blast_pull.pm
ok 383 - POD test for Bio/SearchIO/blasttable.pm
ok 384 - POD test for Bio/SearchIO/blastxml.pm
ok 385 - POD test for Bio/SearchIO/cross_match.pm
ok 386 - POD test for Bio/SearchIO/erpin.pm
ok 387 - POD test for Bio/SearchIO/EventHandlerI.pm
ok 388 - POD test for Bio/SearchIO/exonerate.pm
ok 389 - POD test for Bio/SearchIO/fasta.pm
ok 390 - POD test for Bio/SearchIO/FastHitEventBuilder.pm
ok 391 - POD test for Bio/SearchIO/gmap_f9.pm
ok 392 - POD test for Bio/SearchIO/hmmer.pm
ok 393 - POD test for Bio/SearchIO/hmmer2.pm
ok 394 - POD test for Bio/SearchIO/hmmer3.pm
ok 395 - POD test for Bio/SearchIO/hmmer_pull.pm
ok 396 - POD test for Bio/SearchIO/infernal.pm
ok 397 - POD test for Bio/SearchIO/IteratedSearchResultEventBuilder.pm
ok 398 - POD test for Bio/SearchIO/megablast.pm
ok 399 - POD test for Bio/SearchIO/psl.pm
ok 400 - POD test for Bio/SearchIO/rnamotif.pm
ok 401 - POD test for Bio/SearchIO/SearchResultEventBuilder.pm
ok 402 - POD test for Bio/SearchIO/SearchWriterI.pm
ok 403 - POD test for Bio/SearchIO/sim4.pm
ok 404 - POD test for Bio/SearchIO/waba.pm
ok 405 - POD test for Bio/SearchIO/wise.pm
ok 406 - POD test for Bio/Seq/BaseSeqProcessor.pm
ok 407 - POD test for Bio/Seq/EncodedSeq.pm
ok 408 - POD test for Bio/Seq/LargeLocatableSeq.pm
ok 409 - POD test for Bio/Seq/LargePrimarySeq.pm
ok 410 - POD test for Bio/Seq/LargeSeq.pm
ok 411 - POD test for Bio/Seq/LargeSeqI.pm
ok 412 - POD test for Bio/Seq/Meta.pm
ok 413 - POD test for Bio/Seq/MetaI.pm
ok 414 - POD test for Bio/Seq/PrimaryQual.pm
ok 415 - POD test for Bio/Seq/PrimedSeq.pm
ok 416 - POD test for Bio/Seq/QualI.pm
ok 417 - POD test for Bio/Seq/Quality.pm
ok 418 - POD test for Bio/Seq/RichSeq.pm
ok 419 - POD test for Bio/Seq/RichSeqI.pm
ok 420 - POD test for Bio/Seq/SeqBuilder.pm
ok 421 - POD test for Bio/Seq/SeqFactory.pm
ok 422 - POD test for Bio/Seq/SeqFastaSpeedFactory.pm
ok 423 - POD test for Bio/Seq/SequenceTrace.pm
ok 424 - POD test for Bio/Seq/SeqWithQuality.pm
ok 425 - POD test for Bio/Seq/TraceI.pm
ok 426 - POD test for Bio/SeqEvolution/DNAPoint.pm
ok 427 - POD test for Bio/SeqEvolution/EvolutionI.pm
ok 428 - POD test for Bio/SeqEvolution/Factory.pm
ok 429 - POD test for Bio/SeqFeature/Annotated.pm
ok 430 - POD test for Bio/SeqFeature/AnnotationAdaptor.pm
ok 431 - POD test for Bio/SeqFeature/Collection.pm
ok 432 - POD test for Bio/SeqFeature/CollectionI.pm
ok 433 - POD test for Bio/SeqFeature/Computation.pm
ok 434 - POD test for Bio/SeqFeature/FeaturePair.pm
ok 435 - POD test for Bio/SeqFeature/Generic.pm
ok 436 - POD test for Bio/SeqFeature/Lite.pm
ok 437 - POD test for Bio/SeqFeature/PositionProxy.pm
ok 438 - POD test for Bio/SeqFeature/Primer.pm
ok 439 - POD test for Bio/SeqFeature/Similarity.pm
ok 440 - POD test for Bio/SeqFeature/SimilarityPair.pm
ok 441 - POD test for Bio/SeqFeature/TypedSeqFeatureI.pm
ok 442 - POD test for Bio/SeqIO/abi.pm
ok 443 - POD test for Bio/SeqIO/ace.pm
ok 444 - POD test for Bio/SeqIO/agave.pm
ok 445 - POD test for Bio/SeqIO/alf.pm
ok 446 - POD test for Bio/SeqIO/asciitree.pm
ok 447 - POD test for Bio/SeqIO/bsml.pm
ok 448 - POD test for Bio/SeqIO/bsml_sax.pm
ok 449 - POD test for Bio/SeqIO/chadoxml.pm
ok 450 - POD test for Bio/SeqIO/chaos.pm
ok 451 - POD test for Bio/SeqIO/chaosxml.pm
ok 452 - POD test for Bio/SeqIO/ctf.pm
ok 453 - POD test for Bio/SeqIO/embl.pm
ok 454 - POD test for Bio/SeqIO/embldriver.pm
ok 455 - POD test for Bio/SeqIO/entrezgene.pm
ok 456 - POD test for Bio/SeqIO/excel.pm
ok 457 - POD test for Bio/SeqIO/exp.pm
ok 458 - POD test for Bio/SeqIO/fasta.pm
ok 459 - POD test for Bio/SeqIO/fastq.pm
ok 460 - POD test for Bio/SeqIO/flybase_chadoxml.pm
ok 461 - POD test for Bio/SeqIO/FTHelper.pm
ok 462 - POD test for Bio/SeqIO/game.pm
ok 463 - POD test for Bio/SeqIO/gbdriver.pm
ok 464 - POD test for Bio/SeqIO/gbxml.pm
ok 465 - POD test for Bio/SeqIO/gcg.pm
ok 466 - POD test for Bio/SeqIO/genbank.pm
ok 467 - POD test for Bio/SeqIO/interpro.pm
ok 468 - POD test for Bio/SeqIO/kegg.pm
ok 469 - POD test for Bio/SeqIO/largefasta.pm
ok 470 - POD test for Bio/SeqIO/lasergene.pm
ok 471 - POD test for Bio/SeqIO/locuslink.pm
ok 472 - POD test for Bio/SeqIO/mbsout.pm
ok 473 - POD test for Bio/SeqIO/metafasta.pm
ok 474 - POD test for Bio/SeqIO/msout.pm
ok 475 - POD test for Bio/SeqIO/MultiFile.pm
ok 476 - POD test for Bio/SeqIO/nexml.pm
ok 477 - POD test for Bio/SeqIO/phd.pm
ok 478 - POD test for Bio/SeqIO/pir.pm
ok 479 - POD test for Bio/SeqIO/pln.pm
ok 480 - POD test for Bio/SeqIO/qual.pm
ok 481 - POD test for Bio/SeqIO/raw.pm
ok 482 - POD test for Bio/SeqIO/scf.pm
ok 483 - POD test for Bio/SeqIO/seqxml.pm
ok 484 - POD test for Bio/SeqIO/strider.pm
ok 485 - POD test for Bio/SeqIO/swiss.pm
ok 486 - POD test for Bio/SeqIO/swissdriver.pm
ok 487 - POD test for Bio/SeqIO/tab.pm
ok 488 - POD test for Bio/SeqIO/table.pm
ok 489 - POD test for Bio/SeqIO/tigr.pm
ok 490 - POD test for Bio/SeqIO/tigrxml.pm
ok 491 - POD test for Bio/SeqIO/tinyseq.pm
ok 492 - POD test for Bio/SeqIO/ztr.pm
ok 493 - POD test for Bio/Structure/Atom.pm
ok 494 - POD test for Bio/Structure/Chain.pm
ok 495 - POD test for Bio/Structure/Entry.pm
ok 496 - POD test for Bio/Structure/IO.pm
ok 497 - POD test for Bio/Structure/Model.pm
ok 498 - POD test for Bio/Structure/Residue.pm
ok 499 - POD test for Bio/Structure/StructureI.pm
ok 500 - POD test for Bio/Symbol/Alphabet.pm
ok 501 - POD test for Bio/Symbol/AlphabetI.pm
ok 502 - POD test for Bio/Symbol/DNAAlphabet.pm
ok 503 - POD test for Bio/Symbol/ProteinAlphabet.pm
ok 504 - POD test for Bio/Symbol/Symbol.pm
ok 505 - POD test for Bio/Symbol/SymbolI.pm
ok 506 - POD test for Bio/Taxonomy/FactoryI.pm
ok 507 - POD test for Bio/Taxonomy/Node.pm
ok 508 - POD test for Bio/Taxonomy/Taxon.pm
ok 509 - POD test for Bio/Taxonomy/Tree.pm
ok 510 - POD test for Bio/Tools/AlignFactory.pm
ok 511 - POD test for Bio/Tools/AnalysisResult.pm
ok 512 - POD test for Bio/Tools/Blat.pm
ok 513 - POD test for Bio/Tools/CodonTable.pm
ok 514 - POD test for Bio/Tools/Coil.pm
ok 515 - POD test for Bio/Tools/dpAlign.pm
ok 516 - POD test for Bio/Tools/ECnumber.pm
ok 517 - POD test for Bio/Tools/EPCR.pm
ok 518 - POD test for Bio/Tools/Eponine.pm
ok 519 - POD test for Bio/Tools/ERPIN.pm
ok 520 - POD test for Bio/Tools/Est2Genome.pm
ok 521 - POD test for Bio/Tools/ESTScan.pm
ok 522 - POD test for Bio/Tools/EUtilities.pm
ok 523 - POD test for Bio/Tools/Fgenesh.pm
ok 524 - POD test for Bio/Tools/FootPrinter.pm
ok 525 - POD test for Bio/Tools/Gel.pm
not ok 526 - POD test for Bio/Tools/Geneid.pm
ok 527 - POD test for Bio/Tools/Genemark.pm
ok 528 - POD test for Bio/Tools/Genewise.pm
ok 529 - POD test for Bio/Tools/Genomewise.pm
ok 530 - POD test for Bio/Tools/Genscan.pm
ok 531 - POD test for Bio/Tools/GFF.pm
ok 532 - POD test for Bio/Tools/Glimmer.pm
ok 533 - POD test for Bio/Tools/Grail.pm
not ok 534 - POD test for Bio/Tools/GuessSeqFormat.pm
ok 535 - POD test for Bio/Tools/Hmmpfam.pm
ok 536 - POD test for Bio/Tools/Infernal.pm
ok 537 - POD test for Bio/Tools/ipcress.pm
ok 538 - POD test for Bio/Tools/isPcr.pm
ok 539 - POD test for Bio/Tools/IUPAC.pm
ok 540 - POD test for Bio/Tools/Lucy.pm
ok 541 - POD test for Bio/Tools/Match.pm
ok 542 - POD test for Bio/Tools/MZEF.pm
ok 543 - POD test for Bio/Tools/OddCodes.pm
ok 544 - POD test for Bio/Tools/pICalculator.pm
ok 545 - POD test for Bio/Tools/Primer3.pm
ok 546 - POD test for Bio/Tools/Prints.pm
ok 547 - POD test for Bio/Tools/Profile.pm
ok 548 - POD test for Bio/Tools/Promoterwise.pm
ok 549 - POD test for Bio/Tools/PrositeScan.pm
ok 550 - POD test for Bio/Tools/Protparam.pm
ok 551 - POD test for Bio/Tools/Pseudowise.pm
ok 552 - POD test for Bio/Tools/pSW.pm
ok 553 - POD test for Bio/Tools/QRNA.pm
ok 554 - POD test for Bio/Tools/RandomDistFunctions.pm
ok 555 - POD test for Bio/Tools/RepeatMasker.pm
ok 556 - POD test for Bio/Tools/RNAMotif.pm
ok 557 - POD test for Bio/Tools/Seg.pm
ok 558 - POD test for Bio/Tools/SeqPattern.pm
ok 559 - POD test for Bio/Tools/SeqStats.pm
ok 560 - POD test for Bio/Tools/SeqWords.pm
ok 561 - POD test for Bio/Tools/Sigcleave.pm
ok 562 - POD test for Bio/Tools/Signalp.pm
ok 563 - POD test for Bio/Tools/SiRNA.pm
ok 564 - POD test for Bio/Tools/TandemRepeatsFinder.pm
ok 565 - POD test for Bio/Tools/TargetP.pm
ok 566 - POD test for Bio/Tools/Tmhmm.pm
ok 567 - POD test for Bio/Tools/tRNAscanSE.pm
ok 568 - POD test for Bio/Tree/AlleleNode.pm
ok 569 - POD test for Bio/Tree/AnnotatableNode.pm
ok 570 - POD test for Bio/Tree/Compatible.pm
ok 571 - POD test for Bio/Tree/DistanceFactory.pm
ok 572 - POD test for Bio/Tree/Node.pm
ok 573 - POD test for Bio/Tree/NodeI.pm
ok 574 - POD test for Bio/Tree/NodeNHX.pm
ok 575 - POD test for Bio/Tree/RandomFactory.pm
not ok 576 - POD test for Bio/Tree/Statistics.pm
ok 577 - POD test for Bio/Tree/Tree.pm
ok 578 - POD test for Bio/Tree/TreeFunctionsI.pm
ok 579 - POD test for Bio/Tree/TreeI.pm
ok 580 - POD test for Bio/TreeIO/cluster.pm
ok 581 - POD test for Bio/TreeIO/lintree.pm
ok 582 - POD test for Bio/TreeIO/newick.pm
ok 583 - POD test for Bio/TreeIO/NewickParser.pm
ok 584 - POD test for Bio/TreeIO/nexml.pm
ok 585 - POD test for Bio/TreeIO/nexus.pm
ok 586 - POD test for Bio/TreeIO/nhx.pm
ok 587 - POD test for Bio/TreeIO/pag.pm
ok 588 - POD test for Bio/TreeIO/phyloxml.pm
ok 589 - POD test for Bio/TreeIO/svggraph.pm
ok 590 - POD test for Bio/TreeIO/tabtree.pm
ok 591 - POD test for Bio/TreeIO/TreeEventBuilder.pm
ok 592 - POD test for Bio/Variation/AAChange.pm
ok 593 - POD test for Bio/Variation/AAReverseMutate.pm
ok 594 - POD test for Bio/Variation/Allele.pm
ok 595 - POD test for Bio/Variation/DNAMutation.pm
ok 596 - POD test for Bio/Variation/IO.pm
ok 597 - POD test for Bio/Variation/RNAChange.pm
ok 598 - POD test for Bio/Variation/SeqDiff.pm
ok 599 - POD test for Bio/Variation/SNP.pm
ok 600 - POD test for Bio/Variation/VariantI.pm
ok 601 - POD test for scripts/biblio/biblio.PLS
ok 602 - POD test for scripts/Bio-DB-EUtilities/einfo.PLS
ok 603 - POD test for scripts/Bio-DB-GFF/bulk_load_gff.PLS
ok 604 - POD test for scripts/Bio-DB-GFF/fast_load_gff.PLS
ok 605 - POD test for scripts/Bio-DB-GFF/genbank2gff.PLS
ok 606 - POD test for scripts/Bio-DB-GFF/genbank2gff3.PLS
ok 607 - POD test for scripts/Bio-DB-GFF/generate_histogram.PLS
ok 608 - POD test for scripts/Bio-DB-GFF/load_gff.PLS
ok 609 - POD test for scripts/Bio-DB-GFF/meta_gff.PLS
ok 610 - POD test for scripts/Bio-DB-GFF/process_gadfly.PLS
ok 611 - POD test for scripts/Bio-DB-GFF/process_sgd.PLS
ok 612 - POD test for scripts/Bio-DB-GFF/process_wormbase.PLS
ok 613 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_delete.PLS (no pod)
ok 614 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_gff3.PLS (no pod)
ok 615 - POD test for scripts/Bio-DB-SeqFeature-Store/bp_seqfeature_load.PLS
ok 616 - POD test for scripts/das/das_server.pl (no pod)
ok 617 - POD test for scripts/DB/biofetch_genbank_proxy.PLS
ok 618 - POD test for scripts/DB/bioflat_index.PLS
ok 619 - POD test for scripts/DB/biogetseq.PLS
ok 620 - POD test for scripts/DB/flanks.PLS
ok 621 - POD test for scripts/DB-HIV/hivq.PLS
ok 622 - POD test for scripts/index/bp_fetch.PLS
ok 623 - POD test for scripts/index/bp_index.PLS
ok 624 - POD test for scripts/index/bp_seqret.PLS
ok 625 - POD test for scripts/popgen/composite_LD.PLS
ok 626 - POD test for scripts/popgen/heterogeneity_test.PLS
ok 627 - POD test for scripts/searchio/fastam9_to_table.PLS
ok 628 - POD test for scripts/searchio/filter_search.PLS
ok 629 - POD test for scripts/searchio/hmmer_to_table.PLS
ok 630 - POD test for scripts/searchio/parse_hmmsearch.PLS
ok 631 - POD test for scripts/searchio/search2table.PLS
ok 632 - POD test for scripts/seq/extract_feature_seq.PLS
ok 633 - POD test for scripts/seq/make_mrna_protein.PLS
ok 634 - POD test for scripts/seq/seqconvert.PLS
ok 635 - POD test for scripts/seq/seqretsplit.PLS
ok 636 - POD test for scripts/seq/split_seq.PLS
ok 637 - POD test for scripts/seq/translate_seq.PLS
ok 638 - POD test for scripts/seq/unflatten_seq.PLS
ok 639 - POD test for scripts/seqstats/aacomp.PLS
ok 640 - POD test for scripts/seqstats/chaos_plot.PLS
ok 641 - POD test for scripts/seqstats/gccalc.PLS
ok 642 - POD test for scripts/seqstats/oligo_count.PLS
ok 643 - POD test for scripts/taxa/classify_hits_kingdom.PLS
ok 644 - POD test for scripts/taxa/local_taxonomydb_query.PLS
ok 645 - POD test for scripts/taxa/query_entrez_taxa.PLS
ok 646 - POD test for scripts/taxa/taxid4species.PLS
ok 647 - POD test for scripts/taxa/taxonomy2tree.PLS
ok 648 - POD test for scripts/tree/blast2tree.PLS
ok 649 - POD test for scripts/tree/nexus2nh.PLS
ok 650 - POD test for scripts/tree/tree2pag.PLS
ok 651 - POD test for scripts/utilities/bp_mrtrans.PLS
ok 652 - POD test for scripts/utilities/bp_netinstall.PLS
ok 653 - POD test for scripts/utilities/bp_nrdb.PLS
ok 654 - POD test for scripts/utilities/bp_sreformat.PLS
ok 655 - POD test for scripts/utilities/dbsplit.PLS
ok 656 - POD test for scripts/utilities/download_query_genbank.PLS
ok 657 - POD test for scripts/utilities/mask_by_search.PLS
ok 658 - POD test for scripts/utilities/mutate.PLS
ok 659 - POD test for scripts/utilities/pairwise_kaks.PLS
ok 660 - POD test for scripts/utilities/remote_blast.PLS
ok 661 - POD test for scripts/utilities/revtrans-motif.PLS
ok 662 - POD test for scripts/utilities/search2alnblocks.PLS
ok 663 - POD test for scripts/utilities/search2BSML.PLS
ok 664 - POD test for scripts/utilities/search2gff.PLS
ok 665 - POD test for scripts/utilities/search2tribe.PLS
ok 666 - POD test for scripts/utilities/seq_length.PLS
ok 667 - POD test for examples/align/align_on_codons.pl (no pod)
ok 668 - POD test for examples/align/aligntutorial.pl (no pod)
ok 669 - POD test for examples/align/clustalw.pl (no pod)
ok 670 - POD test for examples/align/simplealign.pl (no pod)
not ok 671 - POD test for examples/biblio/biblio-eutils-example.pl
ok 672 - POD test for examples/biblio/biblio-soap-example.pl
ok 673 - POD test for examples/biblio/biblio_soap.pl (no pod)
ok 674 - POD test for examples/Bio-DB-GFF/load_ucsc.pl (no pod)
ok 675 - POD test for examples/cluster/dbsnp.pl (no pod)
ok 676 - POD test for examples/contributed/nmrpdb_parse.pl (no pod)
ok 677 - POD test for examples/contributed/prosite2perl.pl (no pod)
ok 678 - POD test for examples/contributed/rebase2list.pl (no pod)
ok 679 - POD test for examples/db/dbfetch
ok 680 - POD test for examples/db/est_tissue_query.pl (no pod)
ok 681 - POD test for examples/db/gb2features.pl (no pod)
ok 682 - POD test for examples/db/get_seqs.pl (no pod)
ok 683 - POD test for examples/db/getGenBank.pl (no pod)
ok 684 - POD test for examples/db/rfetch.pl (no pod)
ok 685 - POD test for examples/db/use_registry.pl (no pod)
ok 686 - POD test for examples/liveseq/change_gene.pl (no pod)
ok 687 - POD test for examples/popgen/parse_calc_stats.pl (no pod)
ok 688 - POD test for examples/quality/svgtrace.pl (no pod)
ok 689 - POD test for examples/root/exceptions1.pl (no pod)
ok 690 - POD test for examples/root/exceptions2.pl (no pod)
ok 691 - POD test for examples/root/exceptions3.pl (no pod)
ok 692 - POD test for examples/root/exceptions4.pl (no pod)
ok 693 - POD test for examples/searchio/blast_example.pl (no pod)
ok 694 - POD test for examples/searchio/custom_writer.pl (no pod)
ok 695 - POD test for examples/searchio/hitwriter.pl (no pod)
ok 696 - POD test for examples/searchio/hspwriter.pl (no pod)
ok 697 - POD test for examples/searchio/htmlwriter.pl (no pod)
ok 698 - POD test for examples/searchio/psiblast_features.pl (no pod)
ok 699 - POD test for examples/searchio/psiblast_iterations.pl (no pod)
ok 700 - POD test for examples/searchio/rawwriter.pl (no pod)
ok 701 - POD test for examples/searchio/resultwriter.pl (no pod)
ok 702 - POD test for examples/searchio/waba2gff.pl (no pod)
ok 703 - POD test for examples/searchio/waba2gff3.pl
ok 704 - POD test for examples/sirna/rnai_finder.cgi
ok 705 - POD test for examples/structure/structure-io.pl (no pod)
ok 706 - POD test for examples/tk/gsequence.pl (no pod)
ok 707 - POD test for examples/tk/hitdisplay.pl (no pod)
ok 708 - POD test for examples/tools/extract_genes.pl
ok 709 - POD test for examples/tools/gb_to_gff.pl (no pod)
ok 710 - POD test for examples/tools/gff2ps.pl
ok 711 - POD test for examples/tools/parse_codeml.pl (no pod)
ok 712 - POD test for examples/tools/psw.pl (no pod)
ok 713 - POD test for examples/tools/reverse-translate.pl
ok 714 - POD test for examples/tools/run_genscan.pl (no pod)
ok 715 - POD test for examples/tools/run_primer3.pl
ok 716 - POD test for examples/tools/seq_pattern.pl (no pod)
ok 717 - POD test for examples/tools/standaloneblast.pl (no pod)
ok 718 - POD test for examples/tree/paup2phylip.pl (no pod)
ok 719 - POD test for Bio/AlignIO/Handler/GenericAlignHandler.pm
ok 720 - POD test for Bio/Assembly/IO/ace.pm
ok 721 - POD test for Bio/Assembly/IO/bowtie.pm
ok 722 - POD test for Bio/Assembly/IO/maq.pm
ok 723 - POD test for Bio/Assembly/IO/phrap.pm
ok 724 - POD test for Bio/Assembly/IO/sam.pm
ok 725 - POD test for Bio/Assembly/IO/tigr.pm
ok 726 - POD test for Bio/Assembly/Tools/ContigSpectrum.pm
ok 727 - POD test for Bio/Biblio/IO/medline2ref.pm
ok 728 - POD test for Bio/Biblio/IO/medlinexml.pm
ok 729 - POD test for Bio/Biblio/IO/pubmed2ref.pm
ok 730 - POD test for Bio/Biblio/IO/pubmedxml.pm
ok 731 - POD test for Bio/Coordinate/Result/Gap.pm
ok 732 - POD test for Bio/Coordinate/Result/Match.pm
ok 733 - POD test for Bio/DB/Biblio/biofetch.pm
ok 734 - POD test for Bio/DB/Biblio/eutils.pm
ok 735 - POD test for Bio/DB/Biblio/soap.pm
ok 736 - POD test for Bio/DB/Expression/geo.pm
ok 737 - POD test for Bio/DB/Flat/BDB.pm
ok 738 - POD test for Bio/DB/Flat/BinarySearch.pm
ok 739 - POD test for Bio/DB/GFF/Aggregator.pm
ok 740 - POD test for Bio/DB/GFF/Featname.pm
ok 741 - POD test for Bio/DB/GFF/Feature.pm
ok 742 - POD test for Bio/DB/GFF/Homol.pm
ok 743 - POD test for Bio/DB/GFF/RelSegment.pm
ok 744 - POD test for Bio/DB/GFF/Segment.pm
ok 745 - POD test for Bio/DB/GFF/Typename.pm
ok 746 - POD test for Bio/DB/HIV/HIVAnnotProcessor.pm
ok 747 - POD test for Bio/DB/HIV/HIVQueryHelper.pm
ok 748 - POD test for Bio/DB/Query/GenBank.pm
ok 749 - POD test for Bio/DB/Query/HIVQuery.pm
ok 750 - POD test for Bio/DB/Query/WebQuery.pm
ok 751 - POD test for Bio/DB/SeqFeature/NormalizedFeature.pm
ok 752 - POD test for Bio/DB/SeqFeature/NormalizedFeatureI.pm
ok 753 - POD test for Bio/DB/SeqFeature/NormalizedTableFeatureI.pm
ok 754 - POD test for Bio/DB/SeqFeature/Segment.pm
ok 755 - POD test for Bio/DB/SeqFeature/Store.pm
ok 756 - POD test for Bio/DB/SeqVersion/gi.pm
ok 757 - POD test for Bio/DB/Taxonomy/entrez.pm
ok 758 - POD test for Bio/DB/Taxonomy/flatfile.pm
ok 759 - POD test for Bio/DB/Taxonomy/list.pm
ok 760 - POD test for Bio/DB/TFBS/transfac_pro.pm
ok 761 - POD test for Bio/LiveSeq/IO/BioPerl.pm
ok 762 - POD test for Bio/LiveSeq/IO/Loader.pm
ok 763 - POD test for Bio/Matrix/IO/mlagan.pm
ok 764 - POD test for Bio/Matrix/IO/phylip.pm
ok 765 - POD test for Bio/Matrix/IO/scoring.pm
ok 766 - POD test for Bio/Matrix/PSM/InstanceSite.pm
ok 767 - POD test for Bio/Matrix/PSM/InstanceSiteI.pm
ok 768 - POD test for Bio/Matrix/PSM/IO.pm
ok 769 - POD test for Bio/Matrix/PSM/ProtMatrix.pm
ok 770 - POD test for Bio/Matrix/PSM/ProtPsm.pm
ok 771 - POD test for Bio/Matrix/PSM/Psm.pm
ok 772 - POD test for Bio/Matrix/PSM/PsmHeader.pm
ok 773 - POD test for Bio/Matrix/PSM/PsmHeaderI.pm
ok 774 - POD test for Bio/Matrix/PSM/PsmI.pm
ok 775 - POD test for Bio/Matrix/PSM/SiteMatrix.pm
ok 776 - POD test for Bio/Matrix/PSM/SiteMatrixI.pm
ok 777 - POD test for Bio/Ontology/SimpleGOEngine/GraphAdaptor.pm
ok 778 - POD test for Bio/Ontology/SimpleGOEngine/GraphAdaptor02.pm
ok 779 - POD test for Bio/OntologyIO/Handlers/BaseSAXHandler.pm
ok 780 - POD test for Bio/OntologyIO/Handlers/InterPro_BioSQL_Handler.pm
ok 781 - POD test for Bio/OntologyIO/Handlers/InterProHandler.pm
ok 782 - POD test for Bio/Phenotype/MeSH/Term.pm
ok 783 - POD test for Bio/Phenotype/MeSH/Twig.pm
ok 784 - POD test for Bio/Phenotype/OMIM/MiniMIMentry.pm
ok 785 - POD test for Bio/Phenotype/OMIM/OMIMentry.pm
ok 786 - POD test for Bio/Phenotype/OMIM/OMIMentryAllelicVariant.pm
ok 787 - POD test for Bio/Phenotype/OMIM/OMIMparser.pm
ok 788 - POD test for Bio/PopGen/IO/csv.pm
ok 789 - POD test for Bio/PopGen/IO/hapmap.pm
ok 790 - POD test for Bio/PopGen/IO/phase.pm
ok 791 - POD test for Bio/PopGen/IO/prettybase.pm
ok 792 - POD test for Bio/PopGen/Simulation/Coalescent.pm
ok 793 - POD test for Bio/PopGen/Simulation/GeneticDrift.pm
ok 794 - POD test for Bio/Restriction/Enzyme/MultiCut.pm
ok 795 - POD test for Bio/Restriction/Enzyme/MultiSite.pm
ok 796 - POD test for Bio/Restriction/IO/bairoch.pm
ok 797 - POD test for Bio/Restriction/IO/base.pm
ok 798 - POD test for Bio/Restriction/IO/itype2.pm
ok 799 - POD test for Bio/Restriction/IO/prototype.pm
ok 800 - POD test for Bio/Restriction/IO/withrefm.pm
ok 801 - POD test for Bio/Root/Test/Warn.pm
ok 802 - POD test for Bio/Search/Hit/BlastHit.pm
ok 803 - POD test for Bio/Search/Hit/BlastPullHit.pm
ok 804 - POD test for Bio/Search/Hit/Fasta.pm
ok 805 - POD test for Bio/Search/Hit/GenericHit.pm
ok 806 - POD test for Bio/Search/Hit/HitFactory.pm
ok 807 - POD test for Bio/Search/Hit/HitI.pm
ok 808 - POD test for Bio/Search/Hit/hmmer3Hit.pm
ok 809 - POD test for Bio/Search/Hit/HMMERHit.pm
ok 810 - POD test for Bio/Search/Hit/HmmpfamHit.pm
ok 811 - POD test for Bio/Search/Hit/ModelHit.pm
ok 812 - POD test for Bio/Search/Hit/PsiBlastHit.pm
ok 813 - POD test for Bio/Search/Hit/PullHitI.pm
ok 814 - POD test for Bio/Search/HSP/BlastHSP.pm
ok 815 - POD test for Bio/Search/HSP/BlastPullHSP.pm
ok 816 - POD test for Bio/Search/HSP/FastaHSP.pm
ok 817 - POD test for Bio/Search/HSP/GenericHSP.pm
ok 818 - POD test for Bio/Search/HSP/hmmer3HSP.pm
ok 819 - POD test for Bio/Search/HSP/HMMERHSP.pm
ok 820 - POD test for Bio/Search/HSP/HmmpfamHSP.pm
ok 821 - POD test for Bio/Search/HSP/HSPFactory.pm
ok 822 - POD test for Bio/Search/HSP/HSPI.pm
ok 823 - POD test for Bio/Search/HSP/ModelHSP.pm
ok 824 - POD test for Bio/Search/HSP/PsiBlastHSP.pm
ok 825 - POD test for Bio/Search/HSP/PSLHSP.pm
ok 826 - POD test for Bio/Search/HSP/PullHSPI.pm
ok 827 - POD test for Bio/Search/HSP/WABAHSP.pm
ok 828 - POD test for Bio/Search/Iteration/GenericIteration.pm
ok 829 - POD test for Bio/Search/Iteration/IterationI.pm
ok 830 - POD test for Bio/Search/Result/BlastPullResult.pm
ok 831 - POD test for Bio/Search/Result/BlastResult.pm
ok 832 - POD test for Bio/Search/Result/CrossMatchResult.pm
ok 833 - POD test for Bio/Search/Result/GenericResult.pm
ok 834 - POD test for Bio/Search/Result/hmmer3Result.pm
ok 835 - POD test for Bio/Search/Result/HMMERResult.pm
ok 836 - POD test for Bio/Search/Result/HmmpfamResult.pm
ok 837 - POD test for Bio/Search/Result/PullResultI.pm
ok 838 - POD test for Bio/Search/Result/ResultFactory.pm
ok 839 - POD test for Bio/Search/Result/ResultI.pm
ok 840 - POD test for Bio/Search/Result/WABAResult.pm
ok 841 - POD test for Bio/Search/Tiling/MapTileUtils.pm
ok 842 - POD test for Bio/Search/Tiling/MapTiling.pm
ok 843 - POD test for Bio/Search/Tiling/TilingI.pm
ok 844 - POD test for Bio/SearchIO/Writer/BSMLResultWriter.pm
ok 845 - POD test for Bio/SearchIO/Writer/GbrowseGFF.pm
ok 846 - POD test for Bio/SearchIO/Writer/HitTableWriter.pm
ok 847 - POD test for Bio/SearchIO/Writer/HSPTableWriter.pm
ok 848 - POD test for Bio/SearchIO/Writer/HTMLResultWriter.pm
ok 849 - POD test for Bio/SearchIO/Writer/ResultTableWriter.pm
ok 850 - POD test for Bio/SearchIO/Writer/TextResultWriter.pm
ok 851 - POD test for Bio/SearchIO/XML/BlastHandler.pm
ok 852 - POD test for Bio/SearchIO/XML/PsiBlastHandler.pm
ok 853 - POD test for Bio/Seq/Meta/Array.pm
ok 854 - POD test for Bio/SeqFeature/Gene/Exon.pm
ok 855 - POD test for Bio/SeqFeature/Gene/ExonI.pm
ok 856 - POD test for Bio/SeqFeature/Gene/GeneStructure.pm
ok 857 - POD test for Bio/SeqFeature/Gene/GeneStructureI.pm
ok 858 - POD test for Bio/SeqFeature/Gene/Intron.pm
ok 859 - POD test for Bio/SeqFeature/Gene/NC_Feature.pm
ok 860 - POD test for Bio/SeqFeature/Gene/Poly_A_site.pm
ok 861 - POD test for Bio/SeqFeature/Gene/Promoter.pm
ok 862 - POD test for Bio/SeqFeature/Gene/Transcript.pm
ok 863 - POD test for Bio/SeqFeature/Gene/TranscriptI.pm
ok 864 - POD test for Bio/SeqFeature/Gene/UTR.pm
ok 865 - POD test for Bio/SeqFeature/SiRNA/Oligo.pm
ok 866 - POD test for Bio/SeqFeature/SiRNA/Pair.pm
ok 867 - POD test for Bio/SeqFeature/Tools/FeatureNamer.pm
ok 868 - POD test for Bio/SeqFeature/Tools/IDHandler.pm
ok 869 - POD test for Bio/SeqFeature/Tools/TypeMapper.pm
ok 870 - POD test for Bio/SeqFeature/Tools/Unflattener.pm
ok 871 - POD test for Bio/SeqIO/game/featHandler.pm
ok 872 - POD test for Bio/SeqIO/game/gameHandler.pm
ok 873 - POD test for Bio/SeqIO/game/gameSubs.pm
ok 874 - POD test for Bio/SeqIO/game/gameWriter.pm
ok 875 - POD test for Bio/SeqIO/game/seqHandler.pm
ok 876 - POD test for Bio/SeqIO/Handler/GenericRichSeqHandler.pm
ok 877 - POD test for Bio/SeqIO/tinyseq/tinyseqHandler.pm
ok 878 - POD test for Bio/Structure/IO/pdb.pm
ok 879 - POD test for Bio/Tools/Alignment/Consed.pm
ok 880 - POD test for Bio/Tools/Alignment/Trim.pm
ok 881 - POD test for Bio/Tools/Analysis/SimpleAnalysisBase.pm
ok 882 - POD test for Bio/Tools/EMBOSS/Palindrome.pm
ok 883 - POD test for Bio/Tools/EUtilities/EUtilDataI.pm
ok 884 - POD test for Bio/Tools/EUtilities/EUtilParameters.pm
ok 885 - POD test for Bio/Tools/EUtilities/History.pm
ok 886 - POD test for Bio/Tools/EUtilities/HistoryI.pm
ok 887 - POD test for Bio/Tools/EUtilities/Info.pm
ok 888 - POD test for Bio/Tools/EUtilities/Link.pm
ok 889 - POD test for Bio/Tools/EUtilities/Query.pm
ok 890 - POD test for Bio/Tools/EUtilities/Summary.pm
ok 891 - POD test for Bio/Tools/HMMER/Domain.pm
ok 892 - POD test for Bio/Tools/HMMER/Results.pm
ok 893 - POD test for Bio/Tools/HMMER/Set.pm
ok 894 - POD test for Bio/Tools/Phylo/Gerp.pm
ok 895 - POD test for Bio/Tools/Phylo/Gumby.pm
ok 896 - POD test for Bio/Tools/Phylo/Molphy.pm
ok 897 - POD test for Bio/Tools/Phylo/PAML.pm
ok 898 - POD test for Bio/Tools/Prediction/Exon.pm
ok 899 - POD test for Bio/Tools/Prediction/Gene.pm
ok 900 - POD test for Bio/Tools/Primer/AssessorI.pm
ok 901 - POD test for Bio/Tools/Primer/Feature.pm
ok 902 - POD test for Bio/Tools/Primer/Pair.pm
ok 903 - POD test for Bio/Tools/Run/GenericParameters.pm
ok 904 - POD test for Bio/Tools/Run/hmmer3.pm (no pod)
ok 905 - POD test for Bio/Tools/Run/ParametersI.pm
ok 906 - POD test for Bio/Tools/Run/RemoteBlast.pm
ok 907 - POD test for Bio/Tools/Run/StandAloneBlast.pm
ok 908 - POD test for Bio/Tools/Run/StandAloneNCBIBlast.pm
ok 909 - POD test for Bio/Tools/Run/StandAloneWUBlast.pm
not ok 910 - POD test for Bio/Tools/Run/WrapperBase.pm
ok 911 - POD test for Bio/Tools/SeqPattern/Backtranslate.pm
ok 912 - POD test for Bio/Tools/Signalp/ExtendedSignalp.pm
ok 913 - POD test for Bio/Tools/Sim4/Exon.pm
ok 914 - POD test for Bio/Tools/Sim4/Results.pm
ok 915 - POD test for Bio/Tools/Spidey/Exon.pm
ok 916 - POD test for Bio/Tools/Spidey/Results.pm
ok 917 - POD test for Bio/Tree/Draw/Cladogram.pm
ok 918 - POD test for Bio/Variation/IO/flat.pm
ok 919 - POD test for Bio/Variation/IO/xml.pm
ok 920 - POD test for examples/root/lib/TestInterface.pm
ok 921 - POD test for examples/root/lib/TestObject.pm
ok 922 - POD test for Bio/DB/Flat/BDB/embl.pm
ok 923 - POD test for Bio/DB/Flat/BDB/fasta.pm
ok 924 - POD test for Bio/DB/Flat/BDB/genbank.pm
ok 925 - POD test for Bio/DB/Flat/BDB/swiss.pm
ok 926 - POD test for Bio/DB/GFF/Adaptor/ace.pm
ok 927 - POD test for Bio/DB/GFF/Adaptor/berkeleydb.pm
ok 928 - POD test for Bio/DB/GFF/Adaptor/biofetch.pm
ok 929 - POD test for Bio/DB/GFF/Adaptor/biofetch_oracle.pm
ok 930 - POD test for Bio/DB/GFF/Adaptor/dbi.pm
ok 931 - POD test for Bio/DB/GFF/Adaptor/memory.pm
ok 932 - POD test for Bio/DB/GFF/Aggregator/alignment.pm
ok 933 - POD test for Bio/DB/GFF/Aggregator/clone.pm
ok 934 - POD test for Bio/DB/GFF/Aggregator/coding.pm
ok 935 - POD test for Bio/DB/GFF/Aggregator/gene.pm
ok 936 - POD test for Bio/DB/GFF/Aggregator/match.pm
ok 937 - POD test for Bio/DB/GFF/Aggregator/none.pm
ok 938 - POD test for Bio/DB/GFF/Aggregator/orf.pm
ok 939 - POD test for Bio/DB/GFF/Aggregator/processed_transcript.pm
ok 940 - POD test for Bio/DB/GFF/Aggregator/so_transcript.pm
ok 941 - POD test for Bio/DB/GFF/Aggregator/transcript.pm
ok 942 - POD test for Bio/DB/GFF/Aggregator/ucsc_acembly.pm
ok 943 - POD test for Bio/DB/GFF/Aggregator/ucsc_ensgene.pm
ok 944 - POD test for Bio/DB/GFF/Aggregator/ucsc_genscan.pm
ok 945 - POD test for Bio/DB/GFF/Aggregator/ucsc_refgene.pm
ok 946 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22.pm
ok 947 - POD test for Bio/DB/GFF/Aggregator/ucsc_sanger22pseudo.pm
ok 948 - POD test for Bio/DB/GFF/Aggregator/ucsc_softberry.pm
ok 949 - POD test for Bio/DB/GFF/Aggregator/ucsc_twinscan.pm
ok 950 - POD test for Bio/DB/GFF/Aggregator/ucsc_unigene.pm
ok 951 - POD test for Bio/DB/GFF/Util/Binning.pm
ok 952 - POD test for Bio/DB/GFF/Util/Rearrange.pm
ok 953 - POD test for Bio/DB/SeqFeature/Store/bdb.pm
ok 954 - POD test for Bio/DB/SeqFeature/Store/berkeleydb.pm
ok 955 - POD test for Bio/DB/SeqFeature/Store/berkeleydb3.pm
ok 956 - POD test for Bio/DB/SeqFeature/Store/FeatureFileLoader.pm
ok 957 - POD test for Bio/DB/SeqFeature/Store/GFF2Loader.pm
ok 958 - POD test for Bio/DB/SeqFeature/Store/GFF3Loader.pm
ok 959 - POD test for Bio/DB/SeqFeature/Store/Loader.pm
ok 960 - POD test for Bio/DB/SeqFeature/Store/LoadHelper.pm
ok 961 - POD test for Bio/DB/SeqFeature/Store/memory.pm
ok 962 - POD test for Bio/Matrix/PSM/IO/mast.pm
ok 963 - POD test for Bio/Matrix/PSM/IO/masta.pm
ok 964 - POD test for Bio/Matrix/PSM/IO/meme.pm
ok 965 - POD test for Bio/Matrix/PSM/IO/psiblast.pm
ok 966 - POD test for Bio/Matrix/PSM/IO/transfac.pm
ok 967 - POD test for Bio/Structure/SecStr/DSSP/Res.pm
ok 968 - POD test for Bio/Structure/SecStr/STRIDE/Res.pm
ok 969 - POD test for Bio/Tools/Analysis/DNA/ESEfinder.pm
ok 970 - POD test for Bio/Tools/Analysis/Protein/Domcut.pm
ok 971 - POD test for Bio/Tools/Analysis/Protein/ELM.pm
ok 972 - POD test for Bio/Tools/Analysis/Protein/GOR4.pm
ok 973 - POD test for Bio/Tools/Analysis/Protein/HNN.pm
ok 974 - POD test for Bio/Tools/Analysis/Protein/Mitoprot.pm
ok 975 - POD test for Bio/Tools/Analysis/Protein/NetPhos.pm
ok 976 - POD test for Bio/Tools/Analysis/Protein/Scansite.pm
ok 977 - POD test for Bio/Tools/Analysis/Protein/Sopma.pm
ok 978 - POD test for Bio/Tools/EUtilities/Info/FieldInfo.pm
ok 979 - POD test for Bio/Tools/EUtilities/Info/LinkInfo.pm
ok 980 - POD test for Bio/Tools/EUtilities/Link/LinkSet.pm
ok 981 - POD test for Bio/Tools/EUtilities/Link/UrlLink.pm
ok 982 - POD test for Bio/Tools/EUtilities/Query/GlobalQuery.pm
ok 983 - POD test for Bio/Tools/EUtilities/Summary/DocSum.pm
ok 984 - POD test for Bio/Tools/EUtilities/Summary/Item.pm
ok 985 - POD test for Bio/Tools/EUtilities/Summary/ItemContainerI.pm
ok 986 - POD test for Bio/Tools/Phylo/Molphy/Result.pm
ok 987 - POD test for Bio/Tools/Phylo/PAML/Codeml.pm
ok 988 - POD test for Bio/Tools/Phylo/PAML/ModelResult.pm
ok 989 - POD test for Bio/Tools/Phylo/PAML/Result.pm
ok 990 - POD test for Bio/Tools/Phylo/Phylip/ProtDist.pm
ok 991 - POD test for Bio/Tools/Primer/Assessor/Base.pm
ok 992 - POD test for Bio/Tools/Run/WrapperBase/CommandExts.pm
ok 993 - POD test for Bio/Tools/SiRNA/Ruleset/saigo.pm
ok 994 - POD test for Bio/Tools/SiRNA/Ruleset/tuschl.pm
ok 995 - POD test for Bio/DB/GFF/Adaptor/berkeleydb/iterator.pm
ok 996 - POD test for Bio/DB/GFF/Adaptor/dbi/caching_handle.pm
ok 997 - POD test for Bio/DB/GFF/Adaptor/dbi/iterator.pm
ok 998 - POD test for Bio/DB/GFF/Adaptor/dbi/mysql.pm
ok 999 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlace.pm
ok 1000 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlcmap.pm
ok 1001 - POD test for Bio/DB/GFF/Adaptor/dbi/mysqlopt.pm
ok 1002 - POD test for Bio/DB/GFF/Adaptor/dbi/oracle.pm
ok 1003 - POD test for Bio/DB/GFF/Adaptor/dbi/oracleace.pm
ok 1004 - POD test for Bio/DB/GFF/Adaptor/dbi/pg.pm
ok 1005 - POD test for Bio/DB/GFF/Adaptor/dbi/pg_fts.pm
ok 1006 - POD test for Bio/DB/GFF/Adaptor/memory/feature_serializer.pm
ok 1007 - POD test for Bio/DB/GFF/Adaptor/memory/iterator.pm
ok 1008 - POD test for Bio/DB/SeqFeature/Store/DBI/Iterator.pm
ok 1009 - POD test for Bio/DB/SeqFeature/Store/DBI/mysql.pm
ok 1010 - POD test for Bio/DB/SeqFeature/Store/DBI/Pg.pm
ok 1011 - POD test for Bio/DB/SeqFeature/Store/DBI/SQLite.pm
Dubious, test returned 5 (wstat 1280, 0x500)
Failed 5/1011 subtests
t/PopGen/Coalescent.t ........................
1..13
ok 1 - use Bio::PopGen::Simulation::Coalescent;
ok 2 - use Bio::PopGen::Statistics;
ok 3 - use Bio::TreeIO;
ok 4
ok 5
ok 6 - pi
ok 7 - theta
ok 8 - tajimaD
ok 9 - all the mutations should be polymorphic (by definition)
ok 10 - fu and li D
ok 11 - fu and li D*
ok 12 - fu and li F
ok 13 - fu and li F
ok
t/PopGen/HtSNP.t .............................
1..8
ok 1 - use Bio::PopGen::HtSNP;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/PopGen/MK.t ................................
1..46
ok 1 - use Bio::AlignIO;
ok 2 - use Bio::PopGen::Statistics;
ok 3 - use Bio::PopGen::Utilities;
ok 4 - The object isa Bio::PopGen::Statistics
ok 5 - The object isa Bio::SimpleAlign
ok 6 - The object isa Bio::PopGen::Population
ok 7 - Marker Names
ok 8 - Number of Inds
ok 9 - number of ingroup sequences
ok 10 - number of outgroup1 sequences
ok 11 - number of outgroup2 sequences
ok 12 - NSpoly
ok 13 - NSfixed
ok 14 - Spoly
ok 15 - Sfixed
ok 16 - McDonald Kreitman
ok 17 - NSpoly
ok 18 - NSfixed
ok 19 - Spoly
ok 20 - Sfixed
ok 21 - McDonald Kreitman
ok 22 - NSpoly
ok 23 - NSfixed
ok 24 - Spoly
ok 25 - Sfixed
ok 26 - The object isa Bio::SimpleAlign
ok 27 - The object isa Bio::PopGen::Population
ok 28 - Marker Names
ok 29 - Number of Inds
ok 30 - number of ingroup sequences
ok 31 - number of outgroup1 sequences
ok 32 - number of outgroup2 sequences
ok 33 - NSpoly
ok 34 - NSfixed
ok 35 - Spoly
ok 36 - Sfixed
ok 37 - McDonald Kreitman
ok 38 - NSpoly
ok 39 - NSfixed
ok 40 - Spoly
ok 41 - Sfixed
ok 42 - McDonald Kreitman
ok 43 - NSpoly
ok 44 - NSfixed
ok 45 - Spoly
ok 46 - Sfixed
ok
t/PopGen/PopGen.t ............................
1..100
ok 1 - use Bio::PopGen::Individual;
ok 2 - use Bio::PopGen::Genotype;
ok 3 - use Bio::PopGen::Population;
ok 4 - use Bio::PopGen::IO;
ok 5 - use Bio::PopGen::PopStats;
ok 6 - use Bio::AlignIO;
ok 7 - use Bio::PopGen::Statistics;
ok 8 - use Bio::PopGen::Utilities;
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - mrsa,mssa aflp1
ok 38 - all pops, aflp1
ok 39 - mrsa,envpop aflp1,aflp2
ok 40
ok 41
ok 42
ok 43 - mssa,mrsa all_bands
ok 44 - env,mssa mkr1
ok 45 - env,mssa,mrsa all bands
ok 46 - env,mssa,mrsa mkr2
ok 47 - mrsa,nc all_bands
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - Pi on 3-allele data
ok 100 - Theta on 3-allele data
ok
t/PopGen/PopGenSims.t ........................
1..23
ok 1 - use Bio::PopGen::Simulation::GeneticDrift;
ok 2 - Allele freqs should sum to 1
ok 3 - Allele freqs should sum to 1
ok 4 - Allele freqs should sum to 1
ok 5 - Allele freqs should sum to 1
ok 6 - Allele freqs should sum to 1
ok 7 - Allele freqs should sum to 1
ok 8 - Allele freqs should sum to 1
ok 9 - Allele freqs should sum to 1
ok 10 - Allele freqs should sum to 1
ok 11 - Allele freqs should sum to 1
ok 12
ok 13 - All frequencies should be <= 1
ok 14 - Allele freqs should sum to 1
ok 15 - Allele freqs should sum to 1
ok 16 - Allele freqs should sum to 1
ok 17 - Allele freqs should sum to 1
ok 18 - Allele freqs should sum to 1
ok 19 - Allele freqs should sum to 1
ok 20 - Allele freqs should sum to 1
ok 21 - Allele freqs should sum to 1
ok 22 - Allele freqs should sum to 1
ok 23 - Allele freqs should sum to 1
ok
t/PopGen/TagHaplotype.t ......................
1..3
ok 1 - use Bio::PopGen::TagHaplotype;
ok 2
ok 3
ok
t/RemoteDB/BioFetch.t ........................ skipped: Network tests have not been requested
t/RemoteDB/CUTG.t ............................
1..37
ok 1 - use Bio::DB::CUTG;
ok 2 - use Bio::CodonUsage::Table;
ok 3 - use Bio::CodonUsage::IO;
ok 4 - use Bio::SeqIO;
ok 5 - use Bio::Tools::SeqStats;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok
t/RemoteDB/EMBL.t ............................ skipped: Network tests have not been requested
t/RemoteDB/EUtilities.t ...................... skipped: Valid email not provided; required for tests
t/RemoteDB/EntrezGene.t ...................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed
t/RemoteDB/GenBank.t ......................... skipped: Network tests have not been requested
t/RemoteDB/GenPept.t ......................... skipped: Network tests have not been requested
t/RemoteDB/HIV/HIV.t .........................
1..30
ok 1 - use Bio::DB::HIV;
ok 2 - use Bio::DB::WebDBSeqI;
ok 3 - use Bio::DB::HIV::HIVAnnotProcessor;
ok 4 - The object isa Bio::DB::HIV
ok 5 - The object isa Bio::Root::Root
ok 6 - Bio::DB::HIV->can(...)
ok 7 - Bio::DB::HIV->can(...)
ok 8 - Bio::DB::HIV->can(...)
ok 9 - lanl_base set in default object
ok 10 - map_db set in default object
ok 11 - make_search_if set in default object
ok 12 - search_ set in default object
ok 13 - url_base_address set in default object
ok 14 - default sequence request format (fasta)
ok 15 - sorry till implemented
ok 16 - sorry till implemented
ok 17 - HIVQuery type exception check
ok 18 # skip Network tests have not been requested
ok 19 # skip Network tests have not been requested
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok
t/RemoteDB/HIV/HIVAnnotProcessor.t ...........
1..11
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::DB::HIV::HIVAnnotProcessor;
ok 4 - The object isa Bio::DB::HIV::HIVAnnotProcessor
ok 5 - The object isa Bio::Root::Root
ok 6 - Bio::DB::HIV::HIVAnnotProcessor->can(...)
ok 7 - Bio::DB::HIV::HIVAnnotProcessor->can('hiv_query')
ok 8 - bad type set exception
ok 9 - attach stream
ok 10 - write exception
ok 11 - access stream
ok
t/RemoteDB/HIV/HIVQuery.t ....................
1..41
ok 1 - use Bio::DB::Query::HIVQuery;
ok 2 - use Bio::DB::HIV;
ok 3 - use Bio::Annotation::Collection;
ok 4 - use Bio::Annotation::Comment;
ok 5 - use Bio::Annotation::Reference;
ok 6 - use Bio::DB::HIV::HIVQueryHelper;
ok 7 - The object isa Bio::DB::Query::HIVQuery
ok 8 - The object isa Bio::Root::Root
ok 9 - Bio::DB::Query::HIVQuery->can(...)
ok 10 - Bio::DB::Query::HIVQuery->can(...)
ok 11 - Bio::DB::Query::HIVQuery->can(...)
ok 12 - _map_db_uri set in default object
ok 13 - _make_search_if_uri set in default object
ok 14 - _search_uri set in default object
ok 15 - _schema_file set in default object
ok 16 - _run_option set in default object
ok 17 - annotations container available
ok 18 - query syntax check 1
ok 19 - query syntax check 2
ok 20 - query syntax check 3
ok 21 - query parser check
ok 22 - multiquery parse check
ok 23 - use HTML::Parser;
ok 24 - help html to file
ok 25 - help html parsed
ok 26 - bad field exception check
ok 27 - bad match data exception check
ok 28 - empty field not ok exception check
ok 29 - uninitialized schema exception check
ok 30 - query not run (level 1) warning check
ok 31 - query not run (level 2) warning check
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok 38 # skip Network tests have not been requested
ok 39 # skip Network tests have not been requested
ok 40 # skip Network tests have not been requested
ok 41 # skip Network tests have not been requested
ok
t/RemoteDB/HIV/HIVQueryHelper.t ..............
1..40
ok 1 - use Bio::DB::HIV::HIVQueryHelper;
ok 2 - The object isa HIVSchema
ok 3 - The object isa QRY
ok 4 - The object isa R
ok 5 - The object isa Q
ok 6 - schema load
ok 7 - HIVSchema->can(...)
ok 8 - fields complete
ok 9 - tables complete
ok 10 - aliases complete
ok 11
ok 12 - test field syntax ok
ok 13 - test field syntax ok
ok 14 - test alias by field name
ok 15 - correct primary key for SequenceEntry
ok 16 - correct number of foreign keys for AUthor
ok 17 - correct foreign table for au_pub_id
ok 18 - correct annotation key hash
ok 19 - QRY->can(...)
ok 20 - R->can(...)
ok 21 - Q->can(...)
ok 22 - null QRY
ok 23 - null R (request object)
ok 24 - null Q (atomic query object)
ok 25 - R obj create and init (1)
ok 26 - R obj create and init (2)
ok 27 - R::In
ok 28 - !R::In
ok 29 - R::Eq
ok 30 - QRY obj create and init (1)
ok 31 - QRY obj create and init (2)
ok 32 - QRY obj create and init (3)
ok 33 - QRY overload |
ok 34 - QRY overload &
ok 35 - QRY nontrivial &
ok 36 - parse: ('odds bodkins', a)[X] m[Y] u[Z] OR 'b'[X] {A B [C] [D]}
ok 37 - make: 2 queries returned
ok 38 - {annotation fields} parsed correctly
ok 39 - parse: ('odds bodkins', a)[X] m[Y] u[Z] AND b[X] {A B [C] [D]}
ok 40 - above query is null
ok
t/RemoteDB/MeSH.t ............................ skipped: Network tests have not been requested
t/RemoteDB/Query/GenBank.t ................... skipped: Network tests have not been requested
t/RemoteDB/RefSeq.t ..........................
1..16
ok 1 - use Bio::DB::RefSeq;
ok 2 - use Bio::DB::GenBank;
ok 3 - use Bio::DB::EMBL;
ok 4
ok 5
ok 6
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok 15 # skip Network tests have not been requested
ok 16 # skip Network tests have not been requested
ok
t/RemoteDB/SeqHound.t ........................ skipped: Network tests have not been requested
t/RemoteDB/SeqRead_fail.t .................... skipped: Network tests have not been requested
t/RemoteDB/SeqVersion.t ......................
1..10
ok 1 - use Bio::DB::SeqVersion;
ok 2
ok 3 # skip Network tests have not been requested
ok 4 # skip Network tests have not been requested
ok 5 # skip Network tests have not been requested
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok
t/RemoteDB/SwissProt.t ....................... skipped: Network tests have not been requested
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't load '/home/fly1600/ap1600/lib/auto/DB_File/DB_File.so' for module DB_File: libdb-4.3.so: cannot open shared object file: No such file or directory at /home/fly1600/ap1600/lib/XSLoader.pm line 68.
at /home/fly1600/ap1600/lib/DB_File.pm line 258.
Compilation failed in require at Bio/DB/Taxonomy/flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio/DB/Taxonomy/flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/RemoteDB/Taxonomy.t:24
-----------------------------------------------------------
Bio::DB::Taxonomy: flatfile cannot be found
Exception
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Failed to load module Bio::DB::Taxonomy::flatfile. Can't load '/home/fly1600/ap1600/lib/auto/DB_File/DB_File.so' for module DB_File: libdb-4.3.so: cannot open shared object file: No such file or directory at /home/fly1600/ap1600/lib/XSLoader.pm line 68.
at /home/fly1600/ap1600/lib/DB_File.pm line 258.
Compilation failed in require at Bio/DB/Taxonomy/flatfile.pm line 89.
BEGIN failed--compilation aborted at Bio/DB/Taxonomy/flatfile.pm line 89.
Compilation failed in require at Bio/Root/Root.pm line 543.
STACK: Error::throw
STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
STACK: Bio::Root::Root::_load_module Bio/Root/Root.pm:545
STACK: Bio::DB::Taxonomy::_load_tax_module Bio/DB/Taxonomy.pm:263
STACK: Bio::DB::Taxonomy::new Bio/DB/Taxonomy.pm:114
STACK: t/RemoteDB/Taxonomy.t:24
-----------------------------------------------------------
For more information about the Bio::DB::Taxonomy system please see
the Bio::DB::Taxonomy docs. This includes ways of checking for
formats at compile time, not run time.
# Failed test at t/RemoteDB/Taxonomy.t line 24.
Can't call method "get_taxon" on an undefined value at t/RemoteDB/Taxonomy.t line 124.
# Looks like you planned 103 tests but ran 82.
# Looks like you failed 1 test of 82 run.
# Looks like your test exited with 255 just after 82.
t/RemoteDB/Taxonomy.t ........................
1..103
ok 1 - use Bio::DB::Taxonomy;
ok 2 - use Bio::Tree::Tree;
ok 3
not ok 4
ok 5 # skip Network tests have not been requested
ok 6 # skip Network tests have not been requested
ok 7 # skip Network tests have not been requested
ok 8 # skip Network tests have not been requested
ok 9 # skip Network tests have not been requested
ok 10 # skip Network tests have not been requested
ok 11 # skip Network tests have not been requested
ok 12 # skip Network tests have not been requested
ok 13 # skip Network tests have not been requested
ok 14 # skip Network tests have not been requested
ok 15 # skip Network tests have not been requested
ok 16 # skip Network tests have not been requested
ok 17 # skip Network tests have not been requested
ok 18 # skip Network tests have not been requested
ok 19 # skip Network tests have not been requested
ok 20 # skip Network tests have not been requested
ok 21 # skip Network tests have not been requested
ok 22 # skip Network tests have not been requested
ok 23 # skip Network tests have not been requested
ok 24 # skip Network tests have not been requested
ok 25 # skip Network tests have not been requested
ok 26 # skip Network tests have not been requested
ok 27 # skip Network tests have not been requested
ok 28 # skip Network tests have not been requested
ok 29 # skip Network tests have not been requested
ok 30 # skip Network tests have not been requested
ok 31 # skip Network tests have not been requested
ok 32 # skip Network tests have not been requested
ok 33 # skip Network tests have not been requested
ok 34 # skip Network tests have not been requested
ok 35 # skip Network tests have not been requested
ok 36 # skip Network tests have not been requested
ok 37 # skip Network tests have not been requested
ok 38 # skip Network tests have not been requested
ok 39 # skip Network tests have not been requested
ok 40 # skip Network tests have not been requested
ok 41 # skip Network tests have not been requested
ok 42 # skip Network tests have not been requested
ok 43 # skip Unable to connect to entrez database; no network or server busy?
ok 44 # skip Unable to connect to entrez database; no network or server busy?
ok 45 # skip Unable to connect to entrez database; no network or server busy?
ok 46 # skip Unable to connect to entrez database; no network or server busy?
ok 47 # skip Unable to connect to entrez database; no network or server busy?
ok 48 # skip Unable to connect to entrez database; no network or server busy?
ok 49 # skip Unable to connect to entrez database; no network or server busy?
ok 50 # skip Unable to connect to entrez database; no network or server busy?
ok 51 # skip Unable to connect to entrez database; no network or server busy?
ok 52 # skip Unable to connect to entrez database; no network or server busy?
ok 53 # skip Unable to connect to entrez database; no network or server busy?
ok 54 # skip Unable to connect to entrez database; no network or server busy?
ok 55 # skip Unable to connect to entrez database; no network or server busy?
ok 56 # skip Unable to connect to entrez database; no network or server busy?
ok 57 # skip Unable to connect to entrez database; no network or server busy?
ok 58 # skip Unable to connect to entrez database; no network or server busy?
ok 59 # skip Unable to connect to entrez database; no network or server busy?
ok 60 # skip Unable to connect to entrez database; no network or server busy?
ok 61 # skip Unable to connect to entrez database; no network or server busy?
ok 62 # skip Unable to connect to entrez database; no network or server busy?
ok 63 # skip Unable to connect to entrez database; no network or server busy?
ok 64 # skip Unable to connect to entrez database; no network or server busy?
ok 65 # skip Unable to connect to entrez database; no network or server busy?
ok 66 # skip Unable to connect to entrez database; no network or server busy?
ok 67 # skip Unable to connect to entrez database; no network or server busy?
ok 68 # skip Unable to connect to entrez database; no network or server busy?
ok 69 # skip Unable to connect to entrez database; no network or server busy?
ok 70 # skip Unable to connect to entrez database; no network or server busy?
ok 71 # skip Unable to connect to entrez database; no network or server busy?
ok 72 # skip Unable to connect to entrez database; no network or server busy?
ok 73 # skip Unable to connect to entrez database; no network or server busy?
ok 74 # skip Unable to connect to entrez database; no network or server busy?
ok 75 # skip Unable to connect to entrez database; no network or server busy?
ok 76 # skip Unable to connect to entrez database; no network or server busy?
ok 77 # skip Unable to connect to entrez database; no network or server busy?
ok 78 # skip Unable to connect to entrez database; no network or server busy?
ok 79 # skip Unable to connect to entrez database; no network or server busy?
ok 80 # skip Unable to connect to entrez database; no network or server busy?
ok 81
ok 82
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 22/103 subtests
(less 76 skipped subtests: 5 okay)
t/Restriction/Analysis-refac.t ...............
1..91
ok 1 - use Bio::Restriction::IO;
ok 2 - use Bio::Restriction::Analysis;
ok 3 - use Bio::Restriction::EnzymeCollection;
ok 4 - use Bio::Restriction::Enzyme;
ok 5 - read withrefm file
ok 6 - parse withrefm file
ok 7 - HindIII: nonambiguous intrasite cutter
ok 8 - AarI: nonambiguous extrasite cutter
ok 9 - AasI: ambiguous intrasite cutter
ok 10 - BceSI: ambiguous extrasite cutter
ok 11 - AjuI: cutter with central recog site
ok 12 - TaqII: multi-extrasite cutter
ok 13
ok 14 - HindIII plus
ok 15 - HindIII minus
ok 16 - AasI plus
ok 17 - AasI minus
ok 18 - AarI plus
ok 19 - AarI minus
ok 20 - BceSI plus
ok 21 - BceSI minus
ok 22 - AjuI plus
ok 23 - AjuI minus
ok 24 - TaqII plus
ok 25 - TaqII minus
ok 26 - build real B:R::Analysis object
ok 27 - 13 fragments
ok 28 - circularize
ok 29 - recut
ok 30 - circ: AasI
# site at origin
ok 31 - circ: still 13 fragments (cut site at origin)
ok 32 - use Bio::Restriction::IO;
ok 33 - use Bio::Restriction::Analysis;
ok 34 - read withrefm file
ok 35 - parse withrefm file
ok 36 - Collection initiated
ok 37 - AbeI: found ok into collection
ok 38 - AccBSI: found ok into collection
ok 39 - AciI: found ok into collection
ok 40 - Asp26HI: found ok into collection
ok 41 - BmgBI: found ok into collection
ok 42 - AbeI plus
ok 43 - AbeI minus
ok 44 - AbeI fragment
ok 45 - AbeI positions
ok 46 - AbeI Overhang
ok 47 - AbeI name
ok 48 - AbeI site
ok 49 - AbeI revcom_site
ok 50 - AbeI cut
ok 51 - AbeI complementary_cut
ok 52 - AccBSI plus
ok 53 - AccBSI minus
ok 54 - AccBSI fragment
ok 55 - AccBSI positions
ok 56 - AccBSI Overhang
ok 57 - AccBSI name
ok 58 - AccBSI site
ok 59 - AccBSI revcom_site
ok 60 - AccBSI cut
ok 61 - AccBSI complementary_cut
ok 62 - AciI plus
ok 63 - AciI minus
ok 64 - AciI fragment
ok 65 - AciI positions
ok 66 - AciI Overhang
ok 67 - AciI name
ok 68 - AciI site
ok 69 - AciI revcom_site
ok 70 - AciI cut
ok 71 - AciI complementary_cut
ok 72 - Asp26HI plus
ok 73 - Asp26HI minus
ok 74 - Asp26HI fragment
ok 75 - Asp26HI positions
ok 76 - Asp26HI Overhang
ok 77 - Asp26HI name
ok 78 - Asp26HI site
ok 79 - Asp26HI revcom_site
ok 80 - Asp26HI cut
ok 81 - Asp26HI complementary_cut
ok 82 - BmgBI plus
ok 83 - BmgBI minus
ok 84 - BmgBI fragment
ok 85 - BmgBI positions
ok 86 - BmgBI Overhang
ok 87 - BmgBI name
ok 88 - BmgBI site
ok 89 - BmgBI revcom_site
ok 90 - BmgBI cut
ok 91 - BmgBI complementary_cut
ok
t/Restriction/Analysis.t .....................
1..182
ok 1 - use Bio::Restriction::Enzyme;
ok 2 - use Bio::Restriction::Enzyme::MultiCut;
ok 3 - use Bio::Restriction::Enzyme::MultiSite;
ok 4 - use Bio::Restriction::EnzymeCollection;
ok 5 - use Bio::Restriction::Analysis;
ok 6 - use Bio::SeqIO;
ok 7
ok 8 - The object isa Bio::Restriction::EnzymeI
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - The object isa Bio::PrimarySeqI
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - bug 2179
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76 - The object isa Bio::Restriction::EnzymeI
ok 77 - The object isa Bio::Restriction::EnzymeI
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87 - The object isa Bio::Restriction::EnzymeI
ok 88 - The object isa Bio::Restriction::EnzymeI
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99 - The object isa Bio::Restriction::Enzyme
ok 100
ok 101
ok 102 - The object isa Bio::Restriction::Enzyme
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118 - number of unique cutters
ok 119 - number of RsaI fragments
ok 120 - number of maximum cutters
ok 121 - number of zero cutters
ok 122 - number of cutters
ok 123 - number of 3x cutters
ok 124 - 4 MseI fragments
ok 125 - 3 MseI cut sites
ok 126 - expected 2 PspEI fragments
ok 127
ok 128
ok 129 - expected 2 sizes for PspEI
ok 130
ok 131 - expected 2 sizes for PspEI
ok 132
ok 133 - not circular expected 1 fragments for MwoI as it doesnt cut
ok 134
ok 135
ok 136 - number of RsaI fragments
ok 137 - 3 circular MseI fragments
ok 138 - 3 circular MseI cut sites
ok 139 - number for AciI a non-palindromic enzyme
ok 140 - 1 fragment for MwoI as it cuts across the circ point
ok 141
ok 142
ok 143
ok 144
ok 145 - 7 fragments in the multiple digest
ok 146 - 7 positions in the multiple digest
ok 147 - 7 sizes in the multiple digest
ok 148
ok 149 - expected 9 cuts for HindI
ok 150 - expect 9 fragment maps for HindI
ok 151 - sequence for GT
ok 152 - start at 40
ok 153 - end at 41
ok 154 - sequence for GGATTAAAAAAAGAGT
ok 155 - start at 42
ok 156 - end at 57
ok 157 - sequence for GTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGT
ok 158 - start at 58
ok 159 - end at 92
ok 160 - sequence for GAGTAAATTAAAATTTTATTGACTTAGGTCA
ok 161 - start at 93
ok 162 - end at 123
ok 163 - sequence for CTAAATACTTTAACCAATATAGGCATAGCGCA
ok 164 - start at 124
ok 165 - end at 155
ok 166 - sequence for CAGACAGATAAAAATTACAGAGTACA
ok 167 - start at 156
ok 168 - end at 181
ok 169 - sequence for CAACATCCATGAAACGCATTAGCA
ok 170 - start at 182
ok 171 - end at 205
ok 172 - sequence for CCA
ok 173 - start at 206
ok 174 - end at 208
ok 175 - sequence for CCAGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGT
ok 176 - start at 209
ok 177 - end at 39
ok 178
ok 179 - bug 2139
ok 180 - number of HindIII fragments
ok 181 - number of EcoRI fragments
ok 182 - number of RsaI fragments
ok
t/Restriction/Gel.t ..........................
1..9
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Restriction::Analysis;
ok 3 - use Bio::Tools::Gel;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok
t/Restriction/IO.t ...........................
1..18
ok 1 - use Bio::Restriction::IO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
not ok 8 # TODO writing to a file doesn't seem to work? prints to STDOUT!
# Failed (TODO) test at t/Restriction/IO.t line 31.
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 # skip Network tests have not been requested
ok 17 # skip Network tests have not been requested
ok 18 # skip Network tests have not been requested
ok
t/Root/Exception.t ...........................
1..8
ok 1 - use TestObject;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Root/HTTPget.t ............................. skipped: Network tests have not been requested
t/Root/RootI.t ...............................
1..63
ok 1 - use Bio::Root::Root;
ok 2 - use Bio::Seq;
ok 3
ok 4 - The object isa Bio::Root::RootI
ok 5 - threw Regexp ((?^:Testing throw))
ok 6 - threw Regexp ((?^:EXCEPTION: Bio::Root::NotImplemented))
ok 7 - threw Regexp ((?^:EXCEPTION ))
ok 8 - threw Regexp ((?^:Testing throw))
ok 9
ok 10 - threw Regexp ((?^:Testing throw))
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16 - simple
ok 17 - simple
ok 18 - warns for versions below current version 1.006901
ok 19 - warns for versions below current version 1.006901
ok 20 - throws for versions above 1.006901
ok 21 - throws for versions above 1.006901
ok 22 - throws for versions equal to 1.006901
ok 23 - simple
ok 24 - simple
ok 25 - warns for versions below current version 1.006901
ok 26 - warns for versions below current version 1.006901
ok 27 - throws for versions above 1.006901
ok 28 - throws for versions above 1.006901
ok 29 - arg callable since method was created
ok 30 - mal-formed arg callable since method was created with good name
ok 31 - Bio::Foo2->can('t3')
ok 32 - Methods don't pollute original Bio::Root::Root namespace
ok 33 - Bio::Foo2->can('test_4')
ok 34 - Methods don't pollute original Bio::Root::Root namespace
ok 35 - Bio::Foo3->can('t5')
ok 36 - arg not in method list not created
ok 37 - Bio::Foo3->can('t5')
ok 38 - Methods don't pollute original Bio::Root::Root namespace
ok 39 - verbose was set correctly
ok 40 - synonym was set correctly
ok 41 - real method of synonym was set correctly
ok 42 - mal-formed arg correctly resolved to created method
ok 43 - synonym of set method was set correctly
ok 44 - Bio::Foo4->can('t7')
ok 45 - Methods don't pollute original Bio::Root::Root namespace
ok 46 - Bio::Foo4->can('test7')
ok 47 - Methods don't pollute original Bio::Root::Root namespace
ok 48 - Bio::Foo4->can('test_8')
ok 49 - Methods don't pollute original Bio::Root::Root namespace
ok 50 - Bio::Foo4->can('t8')
ok 51 - Methods don't pollute original Bio::Root::Root namespace
ok 52 - clone
ok 53 - clone
ok 54 - clone
ok 55 - clone changed, original didn't
ok 56 - parameters passed to clone() modify object
ok 57 - original is not modified
ok 58 - must use proper versioning scheme
ok 59 - warns for versions >= 1.006901
ok 60 - warns for versions >= 1.006901
ok 61 - throws for versions >= 1.006901
ok 62 - throws for versions >= 1.006901
ok 63 - No warnings/exceptions below 1.006901
ok
t/Root/RootIO.t ..............................
1..67
ok 1 - use Bio::Root::IO;
ok 2
ok 3 - throw()
ok 4 - throw() verbose(-1)
ok 5 - warn()
ok 6 - throw() verbose(1)
ok 7 - stack_trace()
ok 8 - set verbosity to 1
ok 9
ok 10
ok 11 - executable file
ok 12 - non-executable file
ok 13 - executable dir
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - filename, read
ok 20
ok 21
ok 22 - filename, write
ok 23
ok 24
ok 25
ok 26
ok 27 - handle, read
ok 28
ok 29
ok 30 - handle, write
ok 31
ok 32 - is a write handle
ok 33 - no warnings
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42 - _print
ok 43
ok 44 - _insert at middle of file
ok 45
ok 46
ok 47
ok 48
ok 49 - _insert in empty file
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61 # skip Network tests have not been requested
ok 62 # skip Network tests have not been requested
ok 63 - default -string method
ok 64
ok 65
ok 66
ok 67
ok
t/Root/Storable.t ............................
1..35
ok 1 - use Bio::Root::Storable;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok
t/Root/Tempfile.t ............................
1..18
ok 1 - use Bio::Root::IO;
ok 2
ok 3 - The object isa Bio::Root::IO
ok 4
ok 5
ok 6 - auto UNLINK => 1
ok 7
ok 8
ok 9 - tempfile deleted
ok 10
ok 11 - UNLINK => 0
ok 12
ok 13
ok 14
ok 15 - tempfile suffix
ok 16
ok 17 - tempfile() in scalar context
ok 18
ok
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gzip' found. Using /usr/bin/gzip.
---------------------------------------------------
--------------------- WARNING ---------------------
MSG: find_exe: Multiple paths to 'gunzip' found. Using /usr/bin/gunzip.
---------------------------------------------------
t/Root/Utilities.t ...........................
1..56
ok 1 - use Bio::Root::Utilities;
ok 2 - The object isa Bio::Root::Utilities
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37 - file_date()
ok 38 - unix (\n or 012 or ^J)
ok 39 - date format
ok 40 - date format
ok 41 - date format
ok 42 - date format
ok 43 - date format
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok
t/SearchDist.t ............................... skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed
t/SearchIO/CigarString.t .....................
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/SearchIO.t ........................
1..19
ok 1 - use Bio::SearchIO;
ok 2 - blastxml for f.blastxml
ok 3 - fasta for f.fy
ok 4 - exonerate for f.exonerate
ok 5 - blast for f.tblx
ok 6 - fasta for f.fx
ok 7 - fasta for f.osearch
ok 8 - blast for filename.bls
ok 9 - exonerate for f.exon
ok 10 - fasta for f.SSEARCH.m9
ok 11 - blast for filename.blast
ok 12 - fasta for f.m9
ok 13 - blast for f.blx
ok 14 - blastxml for f.xml
ok 15 - fasta for f.fasta
ok 16 - fasta for f.fa
ok 17 - blast for fast.bls
ok 18 - fasta for f.ssearch
ok 19 - fasta for f.psearch
ok
t/SearchIO/SimilarityPair.t ..................
1..12
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SeqIO;
ok 3
ok 4 - The object isa Bio::SeqI
ok 5
ok 6 - The object isa Bio::SearchIO
ok 7
ok 8 - The object isa Bio::Search::Hit::HitI
ok 9
ok 10 - The object isa Bio::SeqFeatureI
ok 11
ok 12
ok
t/SearchIO/Tiling.t ..........................
1..1141
ok 1 - use Bio::Search::Tiling::MapTiling;
ok 2 - use Bio::Search::Tiling::MapTileUtils;
ok 3 - use Bio::SearchIO;
ok 4 - use Bio::Search::Hit::BlastHit;
ok 5 - use File::Spec;
ok 6 - parse data file
ok 7 - got test hit
ok 8 - create tiling
ok 9 - The object isa Bio::Search::Tiling::TilingI
ok 10 - implements 'next_tiling'
ok 11 - implements 'rewind_tilings'
ok 12 - implements 'identities'
ok 13 - implements 'conserved'
ok 14 - implements 'length'
ok 15 - identities regression test
ok 16 - conserved regression test
ok 17 - tiling iterator regression test(1)
ok 18 - tiling iterator regression test(2)
ok 19 - tiling iterator regression test(3, rewind)
ok 20 - ecolitst.wublastp
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - dnaEbsub_ecoli.wublastx
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36 - tricky.wublast
ok 37 - tricky.wublast(1)
ok 38 - tricky.wublast(2)
ok 39 - tricky.wublast(3)
ok 40 - tricky.wublast(4)
ok 41 - ecolitst.bls
ok 42 - tile ecolitst.bls hit 1 \#hsps 1
ok 43 - q id: est (0.98293) = fast (0.98293)
ok 44 - q cn: est (0.98293) = fast (0.98293)
ok 45 - h id: est (0.98293) = fast (0.98293)
ok 46 - h cn: est (0.98293) = fast (0.98293)
ok 47 - tile ecolitst.bls hit 2 \#hsps 1
ok 48 - q id: est (0.30074) = fast (0.30074)
ok 49 - q cn: est (0.49876) = fast (0.49876)
ok 50 - h id: est (0.30759) = fast (0.30759)
ok 51 - h cn: est (0.51013) = fast (0.51013)
ok 52 - tile ecolitst.bls hit 3 \#hsps 1
ok 53 - q id: est (0.31004) = fast (0.31004)
ok 54 - q cn: est (0.49782) = fast (0.49782)
ok 55 - h id: est (0.32054) = fast (0.32054)
ok 56 - h cn: est (0.51467) = fast (0.51467)
ok 57 - tile ecolitst.bls hit 4 \#hsps 1
ok 58 - q id: est (0.30435) = fast (0.30435)
ok 59 - q cn: est (0.47826) = fast (0.47826)
ok 60 - h id: est (0.29787) = fast (0.29787)
ok 61 - h cn: est (0.46809) = fast (0.46809)
ok 62 - tricky.wublast
ok 63 - tile tricky.wublast hit 1 \#hsps 7
ok 64 - q id: exact (0.22153) ~ est (0.22153)
ok 65 - q id: exact (0.22153) <= max (0.22153)
ok 66 - q cn: exact (0.42760) ~ est (0.42760)
ok 67 - q cn: exact (0.42760) <= max (0.42760)
ok 68 - h id: exact (0.22704) ~ est (0.22704)
ok 69 - h id: exact (0.22704) <= max (0.22704)
ok 70 - h cn: exact (0.43335) ~ est (0.43335)
ok 71 - h cn: exact (0.43335) <= max (0.43335)
ok 72 - a_thaliana.blastn
ok 73 - tile a_thaliana.blastn hit 1 \#hsps 1
ok 74 - q id: est (0.96667) = fast (0.96667)
ok 75 - q cn: est (0.96667) = fast (0.96667)
ok 76 - h id: est (0.98305) = fast (0.98305)
ok 77 - h cn: est (0.98305) = fast (0.98305)
ok 78 - tile a_thaliana.blastn hit 2 \#hsps 1
ok 79 - q id: est (0.96667) = fast (0.96667)
ok 80 - q cn: est (0.96667) = fast (0.96667)
ok 81 - h id: est (0.98305) = fast (0.98305)
ok 82 - h cn: est (0.98305) = fast (0.98305)
ok 83 - tile a_thaliana.blastn hit 3 \#hsps 1
ok 84 - q id: est (1.00000) = fast (1.00000)
ok 85 - q cn: est (1.00000) = fast (1.00000)
ok 86 - h id: est (1.00000) = fast (1.00000)
ok 87 - h cn: est (1.00000) = fast (1.00000)
ok 88 - tile a_thaliana.blastn hit 4 \#hsps 1
ok 89 - q id: est (1.00000) = fast (1.00000)
ok 90 - q cn: est (1.00000) = fast (1.00000)
ok 91 - h id: est (1.00000) = fast (1.00000)
ok 92 - h cn: est (1.00000) = fast (1.00000)
ok 93 - tile a_thaliana.blastn hit 5 \#hsps 1
ok 94 - q id: est (0.92308) = fast (0.92308)
ok 95 - q cn: est (0.92308) = fast (0.92308)
ok 96 - h id: est (0.92308) = fast (0.92308)
ok 97 - h cn: est (0.92308) = fast (0.92308)
ok 98 - tile a_thaliana.blastn hit 6 \#hsps 1
ok 99 - q id: est (1.00000) = fast (1.00000)
ok 100 - q cn: est (1.00000) = fast (1.00000)
ok 101 - h id: est (1.00000) = fast (1.00000)
ok 102 - h cn: est (1.00000) = fast (1.00000)
ok 103 - tile a_thaliana.blastn hit 7 \#hsps 1
ok 104 - q id: est (1.00000) = fast (1.00000)
ok 105 - q cn: est (1.00000) = fast (1.00000)
ok 106 - h id: est (1.00000) = fast (1.00000)
ok 107 - h cn: est (1.00000) = fast (1.00000)
ok 108 - tile a_thaliana.blastn hit 8 \#hsps 1
ok 109 - q id: est (1.00000) = fast (1.00000)
ok 110 - q cn: est (1.00000) = fast (1.00000)
ok 111 - h id: est (1.00000) = fast (1.00000)
ok 112 - h cn: est (1.00000) = fast (1.00000)
ok 113 - tile a_thaliana.blastn hit 9 \#hsps 1
ok 114 - q id: est (1.00000) = fast (1.00000)
ok 115 - q cn: est (1.00000) = fast (1.00000)
ok 116 - h id: est (1.00000) = fast (1.00000)
ok 117 - h cn: est (1.00000) = fast (1.00000)
ok 118 - tile a_thaliana.blastn hit 10 \#hsps 1
ok 119 - q id: est (1.00000) = fast (1.00000)
ok 120 - q cn: est (1.00000) = fast (1.00000)
ok 121 - h id: est (1.00000) = fast (1.00000)
ok 122 - h cn: est (1.00000) = fast (1.00000)
ok 123 - tile a_thaliana.blastn hit 11 \#hsps 1
ok 124 - q id: est (1.00000) = fast (1.00000)
ok 125 - q cn: est (1.00000) = fast (1.00000)
ok 126 - h id: est (1.00000) = fast (1.00000)
ok 127 - h cn: est (1.00000) = fast (1.00000)
ok 128 - tile a_thaliana.blastn hit 12 \#hsps 1
ok 129 - q id: est (1.00000) = fast (1.00000)
ok 130 - q cn: est (1.00000) = fast (1.00000)
ok 131 - h id: est (1.00000) = fast (1.00000)
ok 132 - h cn: est (1.00000) = fast (1.00000)
ok 133 - tile a_thaliana.blastn hit 13 \#hsps 1
ok 134 - q id: est (1.00000) = fast (1.00000)
ok 135 - q cn: est (1.00000) = fast (1.00000)
ok 136 - h id: est (1.00000) = fast (1.00000)
ok 137 - h cn: est (1.00000) = fast (1.00000)
ok 138 - tile a_thaliana.blastn hit 14 \#hsps 1
ok 139 - q id: est (1.00000) = fast (1.00000)
ok 140 - q cn: est (1.00000) = fast (1.00000)
ok 141 - h id: est (1.00000) = fast (1.00000)
ok 142 - h cn: est (1.00000) = fast (1.00000)
ok 143 - tile a_thaliana.blastn hit 15 \#hsps 1
ok 144 - q id: est (1.00000) = fast (1.00000)
ok 145 - q cn: est (1.00000) = fast (1.00000)
ok 146 - h id: est (1.00000) = fast (1.00000)
ok 147 - h cn: est (1.00000) = fast (1.00000)
ok 148 - tile a_thaliana.blastn hit 16 \#hsps 1
ok 149 - q id: est (1.00000) = fast (1.00000)
ok 150 - q cn: est (1.00000) = fast (1.00000)
ok 151 - h id: est (1.00000) = fast (1.00000)
ok 152 - h cn: est (1.00000) = fast (1.00000)
ok 153 - tile a_thaliana.blastn hit 17 \#hsps 1
ok 154 - q id: est (1.00000) = fast (1.00000)
ok 155 - q cn: est (1.00000) = fast (1.00000)
ok 156 - h id: est (1.00000) = fast (1.00000)
ok 157 - h cn: est (1.00000) = fast (1.00000)
ok 158 - tile a_thaliana.blastn hit 18 \#hsps 1
ok 159 - q id: est (1.00000) = fast (1.00000)
ok 160 - q cn: est (1.00000) = fast (1.00000)
ok 161 - h id: est (1.00000) = fast (1.00000)
ok 162 - h cn: est (1.00000) = fast (1.00000)
ok 163 - tile a_thaliana.blastn hit 19 \#hsps 1
ok 164 - q id: est (1.00000) = fast (1.00000)
ok 165 - q cn: est (1.00000) = fast (1.00000)
ok 166 - h id: est (1.00000) = fast (1.00000)
ok 167 - h cn: est (1.00000) = fast (1.00000)
ok 168 - tile a_thaliana.blastn hit 20 \#hsps 1
ok 169 - q id: est (0.95238) = fast (0.95238)
ok 170 - q cn: est (0.95238) = fast (0.95238)
ok 171 - h id: est (0.95238) = fast (0.95238)
ok 172 - h cn: est (0.95238) = fast (0.95238)
ok 173 - tile a_thaliana.blastn hit 21 \#hsps 1
ok 174 - q id: est (1.00000) = fast (1.00000)
ok 175 - q cn: est (1.00000) = fast (1.00000)
ok 176 - h id: est (1.00000) = fast (1.00000)
ok 177 - h cn: est (1.00000) = fast (1.00000)
ok 178 - tile a_thaliana.blastn hit 22 \#hsps 1
ok 179 - q id: est (0.95238) = fast (0.95238)
ok 180 - q cn: est (0.95238) = fast (0.95238)
ok 181 - h id: est (0.95238) = fast (0.95238)
ok 182 - h cn: est (0.95238) = fast (0.95238)
ok 183 - tile a_thaliana.blastn hit 23 \#hsps 1
ok 184 - q id: est (1.00000) = fast (1.00000)
ok 185 - q cn: est (1.00000) = fast (1.00000)
ok 186 - h id: est (1.00000) = fast (1.00000)
ok 187 - h cn: est (1.00000) = fast (1.00000)
ok 188 - tile a_thaliana.blastn hit 24 \#hsps 1
ok 189 - q id: est (0.95238) = fast (0.95238)
ok 190 - q cn: est (0.95238) = fast (0.95238)
ok 191 - h id: est (0.95238) = fast (0.95238)
ok 192 - h cn: est (0.95238) = fast (0.95238)
ok 193 - tile a_thaliana.blastn hit 25 \#hsps 1
ok 194 - q id: est (1.00000) = fast (1.00000)
ok 195 - q cn: est (1.00000) = fast (1.00000)
ok 196 - h id: est (1.00000) = fast (1.00000)
ok 197 - h cn: est (1.00000) = fast (1.00000)
ok 198 - tile a_thaliana.blastn hit 26 \#hsps 1
ok 199 - q id: est (1.00000) = fast (1.00000)
ok 200 - q cn: est (1.00000) = fast (1.00000)
ok 201 - h id: est (1.00000) = fast (1.00000)
ok 202 - h cn: est (1.00000) = fast (1.00000)
ok 203 - tile a_thaliana.blastn hit 27 \#hsps 1
ok 204 - q id: est (1.00000) = fast (1.00000)
ok 205 - q cn: est (1.00000) = fast (1.00000)
ok 206 - h id: est (1.00000) = fast (1.00000)
ok 207 - h cn: est (1.00000) = fast (1.00000)
ok 208 - tile a_thaliana.blastn hit 28 \#hsps 1
ok 209 - q id: est (1.00000) = fast (1.00000)
ok 210 - q cn: est (1.00000) = fast (1.00000)
ok 211 - h id: est (1.00000) = fast (1.00000)
ok 212 - h cn: est (1.00000) = fast (1.00000)
ok 213 - tile a_thaliana.blastn hit 29 \#hsps 1
ok 214 - q id: est (1.00000) = fast (1.00000)
ok 215 - q cn: est (1.00000) = fast (1.00000)
ok 216 - h id: est (1.00000) = fast (1.00000)
ok 217 - h cn: est (1.00000) = fast (1.00000)
ok 218 - tile a_thaliana.blastn hit 30 \#hsps 1
ok 219 - q id: est (1.00000) = fast (1.00000)
ok 220 - q cn: est (1.00000) = fast (1.00000)
ok 221 - h id: est (1.00000) = fast (1.00000)
ok 222 - h cn: est (1.00000) = fast (1.00000)
ok 223 - tile a_thaliana.blastn hit 31 \#hsps 1
ok 224 - q id: est (1.00000) = fast (1.00000)
ok 225 - q cn: est (1.00000) = fast (1.00000)
ok 226 - h id: est (1.00000) = fast (1.00000)
ok 227 - h cn: est (1.00000) = fast (1.00000)
ok 228 - brassica_ATH.WUBLASTN
ok 229 - tile brassica_ATH.WUBLASTN hit 1 \#hsps 3
ok 230 - q id: exact (0.82465) ~ est (0.82343)
ok 231 - q id: exact (0.82465) <= max (0.83333)
ok 232 - q cn: exact (0.85590) ~ est (0.85312)
ok 233 - q cn: exact (0.85590) <= max (0.86458)
ok 234 - h id: exact (0.83920) ~ est (0.83920)
ok 235 - h id: exact (0.83920) <= max (0.83920)
ok 236 - h cn: exact (0.86935) ~ est (0.86935)
ok 237 - h cn: exact (0.86935) <= max (0.86935)
ok 238 - tile brassica_ATH.WUBLASTN hit 2 \#hsps 2
ok 239 - q id: exact (0.82486) ~ est (0.82486)
ok 240 - q id: exact (0.82486) <= max (0.82486)
ok 241 - q cn: exact (0.85122) ~ est (0.85122)
ok 242 - q cn: exact (0.85122) <= max (0.85122)
ok 243 - h id: exact (0.82955) ~ est (0.82955)
ok 244 - h id: exact (0.82955) <= max (0.82955)
ok 245 - h cn: exact (0.85606) ~ est (0.85606)
ok 246 - h cn: exact (0.85606) <= max (0.85606)
ok 247 - no_hsps.blastp
ok 248 - tile no_hsps.blastp hit 1 \#hsps 0
ok 249 - tile no_hsps.blastp hit 2 \#hsps 0
ok 250 - tile no_hsps.blastp hit 3 \#hsps 0
ok 251 - tile no_hsps.blastp hit 4 \#hsps 0
ok 252 - tile no_hsps.blastp hit 5 \#hsps 0
ok 253 - tile no_hsps.blastp hit 6 \#hsps 0
ok 254 - tile no_hsps.blastp hit 7 \#hsps 0
ok 255 - tile no_hsps.blastp hit 8 \#hsps 0
ok 256 - tile no_hsps.blastp hit 9 \#hsps 0
ok 257 - tile no_hsps.blastp hit 10 \#hsps 0
ok 258 - tile no_hsps.blastp hit 11 \#hsps 0
ok 259 - tile no_hsps.blastp hit 12 \#hsps 0
ok 260 - tile no_hsps.blastp hit 13 \#hsps 0
ok 261 - tile no_hsps.blastp hit 14 \#hsps 0
ok 262 - tile no_hsps.blastp hit 15 \#hsps 0
ok 263 - tile no_hsps.blastp hit 16 \#hsps 0
ok 264 - tile no_hsps.blastp hit 17 \#hsps 0
ok 265 - tile no_hsps.blastp hit 18 \#hsps 0
ok 266 - tile no_hsps.blastp hit 19 \#hsps 0
ok 267 - tile no_hsps.blastp hit 20 \#hsps 0
ok 268 - tile no_hsps.blastp hit 21 \#hsps 0
ok 269 - tile no_hsps.blastp hit 22 \#hsps 0
ok 270 - tile no_hsps.blastp hit 23 \#hsps 0
ok 271 - tile no_hsps.blastp hit 24 \#hsps 0
ok 272 - tile no_hsps.blastp hit 25 \#hsps 0
ok 273 - tile no_hsps.blastp hit 26 \#hsps 0
ok 274 - tile no_hsps.blastp hit 27 \#hsps 0
ok 275 - tile no_hsps.blastp hit 28 \#hsps 0
ok 276 - tile no_hsps.blastp hit 29 \#hsps 0
ok 277 - tile no_hsps.blastp hit 30 \#hsps 0
ok 278 - tile no_hsps.blastp hit 31 \#hsps 0
ok 279 - tile no_hsps.blastp hit 32 \#hsps 0
ok 280 - tile no_hsps.blastp hit 33 \#hsps 0
ok 281 - tile no_hsps.blastp hit 34 \#hsps 0
ok 282 - tile no_hsps.blastp hit 35 \#hsps 0
ok 283 - tile no_hsps.blastp hit 36 \#hsps 0
ok 284 - tile no_hsps.blastp hit 37 \#hsps 0
ok 285 - tile no_hsps.blastp hit 38 \#hsps 0
ok 286 - tile no_hsps.blastp hit 39 \#hsps 0
ok 287 - tile no_hsps.blastp hit 40 \#hsps 0
ok 288 - tile no_hsps.blastp hit 41 \#hsps 0
ok 289 - tile no_hsps.blastp hit 42 \#hsps 0
ok 290 - tile no_hsps.blastp hit 43 \#hsps 0
ok 291 - tile no_hsps.blastp hit 44 \#hsps 0
ok 292 - tile no_hsps.blastp hit 45 \#hsps 0
ok 293 - tile no_hsps.blastp hit 46 \#hsps 0
ok 294 - tile no_hsps.blastp hit 47 \#hsps 0
ok 295 - tile no_hsps.blastp hit 48 \#hsps 0
ok 296 - tile no_hsps.blastp hit 49 \#hsps 0
ok 297 - tile no_hsps.blastp hit 50 \#hsps 0
ok 298 - tile no_hsps.blastp hit 51 \#hsps 0
ok 299 - tile no_hsps.blastp hit 52 \#hsps 0
ok 300 - tile no_hsps.blastp hit 53 \#hsps 0
ok 301 - tile no_hsps.blastp hit 54 \#hsps 0
ok 302 - tile no_hsps.blastp hit 55 \#hsps 0
ok 303 - tile no_hsps.blastp hit 56 \#hsps 0
ok 304 - tile no_hsps.blastp hit 57 \#hsps 0
ok 305 - tile no_hsps.blastp hit 58 \#hsps 0
ok 306 - tile no_hsps.blastp hit 59 \#hsps 0
ok 307 - tile no_hsps.blastp hit 60 \#hsps 0
ok 308 - tile no_hsps.blastp hit 61 \#hsps 0
ok 309 - tile no_hsps.blastp hit 62 \#hsps 0
ok 310 - tile no_hsps.blastp hit 63 \#hsps 0
ok 311 - tile no_hsps.blastp hit 64 \#hsps 0
ok 312 - tile no_hsps.blastp hit 65 \#hsps 0
ok 313 - tile no_hsps.blastp hit 66 \#hsps 0
ok 314 - tile no_hsps.blastp hit 67 \#hsps 0
ok 315 - tile no_hsps.blastp hit 68 \#hsps 0
ok 316 - tile no_hsps.blastp hit 69 \#hsps 0
ok 317 - tile no_hsps.blastp hit 70 \#hsps 0
ok 318 - tile no_hsps.blastp hit 71 \#hsps 0
ok 319 - tile no_hsps.blastp hit 72 \#hsps 0
ok 320 - tile no_hsps.blastp hit 73 \#hsps 0
ok 321 - tile no_hsps.blastp hit 74 \#hsps 0
ok 322 - tile no_hsps.blastp hit 75 \#hsps 0
ok 323 - tile no_hsps.blastp hit 76 \#hsps 0
ok 324 - tile no_hsps.blastp hit 77 \#hsps 0
ok 325 - tile no_hsps.blastp hit 78 \#hsps 0
ok 326 - tile no_hsps.blastp hit 79 \#hsps 0
ok 327 - tile no_hsps.blastp hit 80 \#hsps 0
ok 328 - tile no_hsps.blastp hit 81 \#hsps 0
ok 329 - tile no_hsps.blastp hit 82 \#hsps 0
ok 330 - tile no_hsps.blastp hit 83 \#hsps 0
ok 331 - tile no_hsps.blastp hit 84 \#hsps 0
ok 332 - tile no_hsps.blastp hit 85 \#hsps 0
ok 333 - tile no_hsps.blastp hit 86 \#hsps 0
ok 334 - tile no_hsps.blastp hit 87 \#hsps 0
ok 335 - tile no_hsps.blastp hit 88 \#hsps 0
ok 336 - tile no_hsps.blastp hit 89 \#hsps 0
ok 337 - tile no_hsps.blastp hit 90 \#hsps 0
ok 338 - tile no_hsps.blastp hit 91 \#hsps 0
ok 339 - tile no_hsps.blastp hit 92 \#hsps 0
ok 340 - tile no_hsps.blastp hit 93 \#hsps 0
ok 341 - tile no_hsps.blastp hit 94 \#hsps 0
ok 342 - tile no_hsps.blastp hit 95 \#hsps 0
ok 343 - tile no_hsps.blastp hit 96 \#hsps 0
ok 344 - tile no_hsps.blastp hit 97 \#hsps 0
ok 345 - tile no_hsps.blastp hit 98 \#hsps 0
ok 346 - tile no_hsps.blastp hit 99 \#hsps 0
ok 347 - tile no_hsps.blastp hit 100 \#hsps 0
ok 348 - tile no_hsps.blastp hit 101 \#hsps 0
ok 349 - tile no_hsps.blastp hit 102 \#hsps 0
ok 350 - tile no_hsps.blastp hit 103 \#hsps 0
ok 351 - tile no_hsps.blastp hit 104 \#hsps 0
ok 352 - tile no_hsps.blastp hit 105 \#hsps 0
ok 353 - tile no_hsps.blastp hit 106 \#hsps 0
ok 354 - tile no_hsps.blastp hit 107 \#hsps 0
ok 355 - tile no_hsps.blastp hit 108 \#hsps 0
ok 356 - tile no_hsps.blastp hit 109 \#hsps 0
ok 357 - tile no_hsps.blastp hit 110 \#hsps 0
ok 358 - tile no_hsps.blastp hit 111 \#hsps 0
ok 359 - tile no_hsps.blastp hit 112 \#hsps 0
ok 360 - tile no_hsps.blastp hit 113 \#hsps 0
ok 361 - tile no_hsps.blastp hit 114 \#hsps 0
ok 362 - tile no_hsps.blastp hit 115 \#hsps 0
ok 363 - tile no_hsps.blastp hit 116 \#hsps 0
ok 364 - tile no_hsps.blastp hit 117 \#hsps 0
ok 365 - tile no_hsps.blastp hit 118 \#hsps 0
ok 366 - tile no_hsps.blastp hit 119 \#hsps 0
ok 367 - tile no_hsps.blastp hit 120 \#hsps 0
ok 368 - tile no_hsps.blastp hit 121 \#hsps 0
ok 369 - tile no_hsps.blastp hit 122 \#hsps 0
ok 370 - tile no_hsps.blastp hit 123 \#hsps 0
ok 371 - tile no_hsps.blastp hit 124 \#hsps 0
ok 372 - tile no_hsps.blastp hit 125 \#hsps 0
ok 373 - tile no_hsps.blastp hit 126 \#hsps 0
ok 374 - tile no_hsps.blastp hit 127 \#hsps 0
ok 375 - tile no_hsps.blastp hit 128 \#hsps 0
ok 376 - tile no_hsps.blastp hit 129 \#hsps 0
ok 377 - tile no_hsps.blastp hit 130 \#hsps 0
ok 378 - tile no_hsps.blastp hit 131 \#hsps 0
ok 379 - tile no_hsps.blastp hit 132 \#hsps 0
ok 380 - tile no_hsps.blastp hit 133 \#hsps 0
ok 381 - tile no_hsps.blastp hit 134 \#hsps 0
ok 382 - tile no_hsps.blastp hit 135 \#hsps 0
ok 383 - tile no_hsps.blastp hit 136 \#hsps 0
ok 384 - tile no_hsps.blastp hit 137 \#hsps 0
ok 385 - tile no_hsps.blastp hit 138 \#hsps 0
ok 386 - tile no_hsps.blastp hit 139 \#hsps 0
ok 387 - tile no_hsps.blastp hit 140 \#hsps 0
ok 388 - tile no_hsps.blastp hit 141 \#hsps 0
ok 389 - tile no_hsps.blastp hit 142 \#hsps 0
ok 390 - tile no_hsps.blastp hit 143 \#hsps 0
ok 391 - tile no_hsps.blastp hit 144 \#hsps 0
ok 392 - tile no_hsps.blastp hit 145 \#hsps 0
ok 393 - tile no_hsps.blastp hit 146 \#hsps 0
ok 394 - tile no_hsps.blastp hit 147 \#hsps 0
ok 395 - tile no_hsps.blastp hit 148 \#hsps 0
ok 396 - tile no_hsps.blastp hit 149 \#hsps 0
ok 397 - tile no_hsps.blastp hit 150 \#hsps 0
ok 398 - tile no_hsps.blastp hit 151 \#hsps 0
ok 399 - tile no_hsps.blastp hit 152 \#hsps 0
ok 400 - tile no_hsps.blastp hit 153 \#hsps 0
ok 401 - tile no_hsps.blastp hit 154 \#hsps 0
ok 402 - tile no_hsps.blastp hit 155 \#hsps 0
ok 403 - tile no_hsps.blastp hit 156 \#hsps 0
ok 404 - tile no_hsps.blastp hit 157 \#hsps 0
ok 405 - tile no_hsps.blastp hit 158 \#hsps 0
ok 406 - tile no_hsps.blastp hit 159 \#hsps 0
ok 407 - tile no_hsps.blastp hit 160 \#hsps 0
ok 408 - tile no_hsps.blastp hit 161 \#hsps 0
ok 409 - tile no_hsps.blastp hit 162 \#hsps 0
ok 410 - tile no_hsps.blastp hit 163 \#hsps 0
ok 411 - tile no_hsps.blastp hit 164 \#hsps 0
ok 412 - tile no_hsps.blastp hit 165 \#hsps 0
ok 413 - tile no_hsps.blastp hit 166 \#hsps 0
ok 414 - tile no_hsps.blastp hit 167 \#hsps 0
ok 415 - tile no_hsps.blastp hit 168 \#hsps 0
ok 416 - tile no_hsps.blastp hit 169 \#hsps 0
ok 417 - tile no_hsps.blastp hit 170 \#hsps 0
ok 418 - tile no_hsps.blastp hit 171 \#hsps 0
ok 419 - tile no_hsps.blastp hit 172 \#hsps 0
ok 420 - tile no_hsps.blastp hit 173 \#hsps 0
ok 421 - tile no_hsps.blastp hit 174 \#hsps 0
ok 422 - tile no_hsps.blastp hit 175 \#hsps 0
ok 423 - tile no_hsps.blastp hit 176 \#hsps 0
ok 424 - tile no_hsps.blastp hit 177 \#hsps 0
ok 425 - tile no_hsps.blastp hit 178 \#hsps 0
ok 426 - tile no_hsps.blastp hit 179 \#hsps 0
ok 427 - tile no_hsps.blastp hit 180 \#hsps 0
ok 428 - tile no_hsps.blastp hit 181 \#hsps 0
ok 429 - tile no_hsps.blastp hit 182 \#hsps 0
ok 430 - tile no_hsps.blastp hit 183 \#hsps 0
ok 431 - tile no_hsps.blastp hit 184 \#hsps 0
ok 432 - tile no_hsps.blastp hit 185 \#hsps 0
ok 433 - tile no_hsps.blastp hit 186 \#hsps 0
ok 434 - tile no_hsps.blastp hit 187 \#hsps 0
ok 435 - tile no_hsps.blastp hit 188 \#hsps 0
ok 436 - tile no_hsps.blastp hit 189 \#hsps 0
ok 437 - tile no_hsps.blastp hit 190 \#hsps 0
ok 438 - tile no_hsps.blastp hit 191 \#hsps 0
ok 439 - tile no_hsps.blastp hit 192 \#hsps 0
ok 440 - tile no_hsps.blastp hit 193 \#hsps 0
ok 441 - tile no_hsps.blastp hit 194 \#hsps 0
ok 442 - tile no_hsps.blastp hit 195 \#hsps 0
ok 443 - tile no_hsps.blastp hit 196 \#hsps 0
ok 444 - tile no_hsps.blastp hit 197 \#hsps 0
ok 445 - tile no_hsps.blastp hit 198 \#hsps 0
ok 446 - tile no_hsps.blastp hit 199 \#hsps 0
ok 447 - tile no_hsps.blastp hit 200 \#hsps 0
ok 448 - tile no_hsps.blastp hit 201 \#hsps 0
ok 449 - tile no_hsps.blastp hit 202 \#hsps 0
ok 450 - tile no_hsps.blastp hit 203 \#hsps 0
ok 451 - tile no_hsps.blastp hit 204 \#hsps 0
ok 452 - tile no_hsps.blastp hit 205 \#hsps 0
ok 453 - tile no_hsps.blastp hit 206 \#hsps 0
ok 454 - tile no_hsps.blastp hit 207 \#hsps 0
ok 455 - tile no_hsps.blastp hit 208 \#hsps 0
ok 456 - tile no_hsps.blastp hit 209 \#hsps 0
ok 457 - tile no_hsps.blastp hit 210 \#hsps 0
ok 458 - tile no_hsps.blastp hit 211 \#hsps 0
ok 459 - tile no_hsps.blastp hit 212 \#hsps 0
ok 460 - tile no_hsps.blastp hit 213 \#hsps 0
ok 461 - tile no_hsps.blastp hit 214 \#hsps 0
ok 462 - tile no_hsps.blastp hit 215 \#hsps 0
ok 463 - tile no_hsps.blastp hit 216 \#hsps 0
ok 464 - tile no_hsps.blastp hit 217 \#hsps 0
ok 465 - tile no_hsps.blastp hit 218 \#hsps 0
ok 466 - tile no_hsps.blastp hit 219 \#hsps 0
ok 467 - tile no_hsps.blastp hit 220 \#hsps 0
ok 468 - tile no_hsps.blastp hit 221 \#hsps 0
ok 469 - tile no_hsps.blastp hit 222 \#hsps 0
ok 470 - tile no_hsps.blastp hit 223 \#hsps 0
ok 471 - tile no_hsps.blastp hit 224 \#hsps 0
ok 472 - tile no_hsps.blastp hit 225 \#hsps 0
ok 473 - tile no_hsps.blastp hit 226 \#hsps 0
ok 474 - tile no_hsps.blastp hit 227 \#hsps 0
ok 475 - tile no_hsps.blastp hit 228 \#hsps 0
ok 476 - tile no_hsps.blastp hit 229 \#hsps 0
ok 477 - tile no_hsps.blastp hit 230 \#hsps 0
ok 478 - tile no_hsps.blastp hit 231 \#hsps 0
ok 479 - tile no_hsps.blastp hit 232 \#hsps 0
ok 480 - tile no_hsps.blastp hit 233 \#hsps 0
ok 481 - tile no_hsps.blastp hit 234 \#hsps 0
ok 482 - tile no_hsps.blastp hit 235 \#hsps 0
ok 483 - tile no_hsps.blastp hit 236 \#hsps 0
ok 484 - tile no_hsps.blastp hit 237 \#hsps 0
ok 485 - tile no_hsps.blastp hit 238 \#hsps 0
ok 486 - tile no_hsps.blastp hit 239 \#hsps 0
ok 487 - tile no_hsps.blastp hit 240 \#hsps 0
ok 488 - tile no_hsps.blastp hit 241 \#hsps 0
ok 489 - tile no_hsps.blastp hit 242 \#hsps 0
ok 490 - tile no_hsps.blastp hit 243 \#hsps 0
ok 491 - tile no_hsps.blastp hit 244 \#hsps 0
ok 492 - tile no_hsps.blastp hit 245 \#hsps 0
ok 493 - tile no_hsps.blastp hit 246 \#hsps 0
ok 494 - tile no_hsps.blastp hit 247 \#hsps 0
ok 495 - tile no_hsps.blastp hit 248 \#hsps 0
ok 496 - tile no_hsps.blastp hit 249 \#hsps 0
ok 497 - tile no_hsps.blastp hit 250 \#hsps 0
ok 498 - tile no_hsps.blastp hit 251 \#hsps 0
ok 499 - tile no_hsps.blastp hit 252 \#hsps 0
ok 500 - tile no_hsps.blastp hit 253 \#hsps 0
ok 501 - tile no_hsps.blastp hit 254 \#hsps 0
ok 502 - tile no_hsps.blastp hit 255 \#hsps 0
ok 503 - tile no_hsps.blastp hit 256 \#hsps 0
ok 504 - tile no_hsps.blastp hit 257 \#hsps 0
ok 505 - tile no_hsps.blastp hit 258 \#hsps 0
ok 506 - tile no_hsps.blastp hit 259 \#hsps 0
ok 507 - tile no_hsps.blastp hit 260 \#hsps 0
ok 508 - tile no_hsps.blastp hit 261 \#hsps 0
ok 509 - tile no_hsps.blastp hit 262 \#hsps 0
ok 510 - tile no_hsps.blastp hit 263 \#hsps 0
ok 511 - tile no_hsps.blastp hit 264 \#hsps 0
ok 512 - tile no_hsps.blastp hit 265 \#hsps 0
ok 513 - tile no_hsps.blastp hit 266 \#hsps 0
ok 514 - tile no_hsps.blastp hit 267 \#hsps 0
ok 515 - tile no_hsps.blastp hit 268 \#hsps 0
ok 516 - tile no_hsps.blastp hit 269 \#hsps 0
ok 517 - tile no_hsps.blastp hit 270 \#hsps 0
ok 518 - tile no_hsps.blastp hit 271 \#hsps 0
ok 519 - tile no_hsps.blastp hit 272 \#hsps 0
ok 520 - tile no_hsps.blastp hit 273 \#hsps 0
ok 521 - tile no_hsps.blastp hit 274 \#hsps 0
ok 522 - tile no_hsps.blastp hit 275 \#hsps 0
ok 523 - tile no_hsps.blastp hit 276 \#hsps 0
ok 524 - tile no_hsps.blastp hit 277 \#hsps 0
ok 525 - tile no_hsps.blastp hit 278 \#hsps 0
ok 526 - tile no_hsps.blastp hit 279 \#hsps 0
ok 527 - tile no_hsps.blastp hit 280 \#hsps 0
ok 528 - tile no_hsps.blastp hit 281 \#hsps 0
ok 529 - tile no_hsps.blastp hit 282 \#hsps 0
ok 530 - tile no_hsps.blastp hit 283 \#hsps 0
ok 531 - tile no_hsps.blastp hit 284 \#hsps 0
ok 532 - tile no_hsps.blastp hit 285 \#hsps 0
ok 533 - tile no_hsps.blastp hit 286 \#hsps 0
ok 534 - tile no_hsps.blastp hit 287 \#hsps 0
ok 535 - tile no_hsps.blastp hit 288 \#hsps 0
ok 536 - tile no_hsps.blastp hit 289 \#hsps 0
ok 537 - tile no_hsps.blastp hit 290 \#hsps 0
ok 538 - tile no_hsps.blastp hit 291 \#hsps 0
ok 539 - tile no_hsps.blastp hit 292 \#hsps 0
ok 540 - tile no_hsps.blastp hit 293 \#hsps 0
ok 541 - tile no_hsps.blastp hit 294 \#hsps 0
ok 542 - tile no_hsps.blastp hit 295 \#hsps 0
ok 543 - tile no_hsps.blastp hit 296 \#hsps 0
ok 544 - tile no_hsps.blastp hit 297 \#hsps 0
ok 545 - tile no_hsps.blastp hit 298 \#hsps 0
ok 546 - tile no_hsps.blastp hit 299 \#hsps 0
ok 547 - tile no_hsps.blastp hit 300 \#hsps 0
ok 548 - tile no_hsps.blastp hit 301 \#hsps 0
ok 549 - tile no_hsps.blastp hit 302 \#hsps 0
ok 550 - tile no_hsps.blastp hit 303 \#hsps 0
ok 551 - tile no_hsps.blastp hit 304 \#hsps 0
ok 552 - tile no_hsps.blastp hit 305 \#hsps 0
ok 553 - tile no_hsps.blastp hit 306 \#hsps 0
ok 554 - tile no_hsps.blastp hit 307 \#hsps 0
ok 555 - tile no_hsps.blastp hit 308 \#hsps 0
ok 556 - tile no_hsps.blastp hit 309 \#hsps 0
ok 557 - tile no_hsps.blastp hit 310 \#hsps 0
ok 558 - tile no_hsps.blastp hit 311 \#hsps 0
ok 559 - tile no_hsps.blastp hit 312 \#hsps 0
ok 560 - tile no_hsps.blastp hit 313 \#hsps 0
ok 561 - tile no_hsps.blastp hit 314 \#hsps 0
ok 562 - tile no_hsps.blastp hit 315 \#hsps 0
ok 563 - tile no_hsps.blastp hit 316 \#hsps 0
ok 564 - tile no_hsps.blastp hit 317 \#hsps 0
ok 565 - tile no_hsps.blastp hit 318 \#hsps 0
ok 566 - tile no_hsps.blastp hit 319 \#hsps 0
ok 567 - tile no_hsps.blastp hit 320 \#hsps 0
ok 568 - tile no_hsps.blastp hit 321 \#hsps 0
ok 569 - tile no_hsps.blastp hit 322 \#hsps 0
ok 570 - tile no_hsps.blastp hit 323 \#hsps 0
ok 571 - tile no_hsps.blastp hit 324 \#hsps 0
ok 572 - tile no_hsps.blastp hit 325 \#hsps 0
ok 573 - tile no_hsps.blastp hit 326 \#hsps 0
ok 574 - tile no_hsps.blastp hit 327 \#hsps 0
ok 575 - tile no_hsps.blastp hit 328 \#hsps 0
ok 576 - tile no_hsps.blastp hit 329 \#hsps 0
ok 577 - tile no_hsps.blastp hit 330 \#hsps 0
ok 578 - tile no_hsps.blastp hit 331 \#hsps 0
ok 579 - tile no_hsps.blastp hit 332 \#hsps 0
ok 580 - tile no_hsps.blastp hit 333 \#hsps 0
ok 581 - tile no_hsps.blastp hit 334 \#hsps 0
ok 582 - tile no_hsps.blastp hit 335 \#hsps 0
ok 583 - tile no_hsps.blastp hit 336 \#hsps 0
ok 584 - tile no_hsps.blastp hit 337 \#hsps 0
ok 585 - tile no_hsps.blastp hit 338 \#hsps 0
ok 586 - tile no_hsps.blastp hit 339 \#hsps 0
ok 587 - tile no_hsps.blastp hit 340 \#hsps 0
ok 588 - tile no_hsps.blastp hit 341 \#hsps 0
ok 589 - tile no_hsps.blastp hit 342 \#hsps 0
ok 590 - tile no_hsps.blastp hit 343 \#hsps 0
ok 591 - tile no_hsps.blastp hit 344 \#hsps 0
ok 592 - tile no_hsps.blastp hit 345 \#hsps 0
ok 593 - tile no_hsps.blastp hit 346 \#hsps 0
ok 594 - tile no_hsps.blastp hit 347 \#hsps 0
ok 595 - tile no_hsps.blastp hit 348 \#hsps 0
ok 596 - tile no_hsps.blastp hit 349 \#hsps 0
ok 597 - tile no_hsps.blastp hit 350 \#hsps 0
ok 598 - tile no_hsps.blastp hit 351 \#hsps 0
ok 599 - tile no_hsps.blastp hit 352 \#hsps 0
ok 600 - tile no_hsps.blastp hit 353 \#hsps 0
ok 601 - tile no_hsps.blastp hit 354 \#hsps 0
ok 602 - tile no_hsps.blastp hit 355 \#hsps 0
ok 603 - tile no_hsps.blastp hit 356 \#hsps 0
ok 604 - tile no_hsps.blastp hit 357 \#hsps 0
ok 605 - tile no_hsps.blastp hit 358 \#hsps 0
ok 606 - tile no_hsps.blastp hit 359 \#hsps 0
ok 607 - tile no_hsps.blastp hit 360 \#hsps 0
ok 608 - tile no_hsps.blastp hit 361 \#hsps 0
ok 609 - tile no_hsps.blastp hit 362 \#hsps 0
ok 610 - tile no_hsps.blastp hit 363 \#hsps 0
ok 611 - tile no_hsps.blastp hit 364 \#hsps 0
ok 612 - tile no_hsps.blastp hit 365 \#hsps 0
ok 613 - tile no_hsps.blastp hit 366 \#hsps 0
ok 614 - tile no_hsps.blastp hit 367 \#hsps 0
ok 615 - tile no_hsps.blastp hit 368 \#hsps 0
ok 616 - tile no_hsps.blastp hit 369 \#hsps 0
ok 617 - tile no_hsps.blastp hit 370 \#hsps 0
ok 618 - tile no_hsps.blastp hit 371 \#hsps 0
ok 619 - tile no_hsps.blastp hit 372 \#hsps 0
ok 620 - tile no_hsps.blastp hit 373 \#hsps 0
ok 621 - tile no_hsps.blastp hit 374 \#hsps 0
ok 622 - tile no_hsps.blastp hit 375 \#hsps 0
ok 623 - tile no_hsps.blastp hit 376 \#hsps 0
ok 624 - tile no_hsps.blastp hit 377 \#hsps 0
ok 625 - tile no_hsps.blastp hit 378 \#hsps 0
ok 626 - tile no_hsps.blastp hit 379 \#hsps 0
ok 627 - tile no_hsps.blastp hit 380 \#hsps 0
ok 628 - tile no_hsps.blastp hit 381 \#hsps 0
ok 629 - tile no_hsps.blastp hit 382 \#hsps 0
ok 630 - tile no_hsps.blastp hit 383 \#hsps 0
ok 631 - tile no_hsps.blastp hit 384 \#hsps 0
ok 632 - tile no_hsps.blastp hit 385 \#hsps 0
ok 633 - tile no_hsps.blastp hit 386 \#hsps 0
ok 634 - tile no_hsps.blastp hit 387 \#hsps 0
ok 635 - tile no_hsps.blastp hit 388 \#hsps 0
ok 636 - tile no_hsps.blastp hit 389 \#hsps 0
ok 637 - tile no_hsps.blastp hit 390 \#hsps 0
ok 638 - tile no_hsps.blastp hit 391 \#hsps 0
ok 639 - tile no_hsps.blastp hit 392 \#hsps 0
ok 640 - tile no_hsps.blastp hit 393 \#hsps 0
ok 641 - tile no_hsps.blastp hit 394 \#hsps 0
ok 642 - tile no_hsps.blastp hit 395 \#hsps 0
ok 643 - tile no_hsps.blastp hit 396 \#hsps 0
ok 644 - tile no_hsps.blastp hit 397 \#hsps 0
ok 645 - tile no_hsps.blastp hit 398 \#hsps 0
ok 646 - tile no_hsps.blastp hit 399 \#hsps 0
ok 647 - tile no_hsps.blastp hit 400 \#hsps 0
ok 648 - tile no_hsps.blastp hit 401 \#hsps 0
ok 649 - tile no_hsps.blastp hit 402 \#hsps 0
ok 650 - tile no_hsps.blastp hit 403 \#hsps 0
ok 651 - tile no_hsps.blastp hit 404 \#hsps 0
ok 652 - tile no_hsps.blastp hit 405 \#hsps 0
ok 653 - tile no_hsps.blastp hit 406 \#hsps 0
ok 654 - tile no_hsps.blastp hit 407 \#hsps 0
ok 655 - tile no_hsps.blastp hit 408 \#hsps 0
ok 656 - tile no_hsps.blastp hit 409 \#hsps 0
ok 657 - tile no_hsps.blastp hit 410 \#hsps 0
ok 658 - tile no_hsps.blastp hit 411 \#hsps 0
ok 659 - tile no_hsps.blastp hit 412 \#hsps 0
ok 660 - tile no_hsps.blastp hit 413 \#hsps 0
ok 661 - tile no_hsps.blastp hit 414 \#hsps 0
ok 662 - tile no_hsps.blastp hit 415 \#hsps 0
ok 663 - catalase-webblast.BLASTP
ok 664 - tile catalase-webblast.BLASTP hit 1 \#hsps 1
ok 665 - q id: est (1.00000) = fast (1.00000)
ok 666 - q cn: est (1.00000) = fast (1.00000)
ok 667 - h id: est (1.00000) = fast (1.00000)
ok 668 - h cn: est (1.00000) = fast (1.00000)
ok 669 - tile catalase-webblast.BLASTP hit 2 \#hsps 1
ok 670 - q id: est (0.80973) = fast (0.80973)
ok 671 - q cn: est (0.89006) = fast (0.89006)
ok 672 - h id: est (0.82543) = fast (0.82543)
ok 673 - h cn: est (0.90733) = fast (0.90733)
ok 674 - tile catalase-webblast.BLASTP hit 3 \#hsps 1
ok 675 - q id: est (0.71670) = fast (0.71670)
ok 676 - q cn: est (0.84144) = fast (0.84144)
ok 677 - h id: est (0.72747) = fast (0.72747)
ok 678 - h cn: est (0.85408) = fast (0.85408)
ok 679 - tile catalase-webblast.BLASTP hit 4 \#hsps 1
ok 680 - q id: est (0.58910) = fast (0.58910)
ok 681 - q cn: est (0.70860) = fast (0.70860)
ok 682 - h id: est (0.65654) = fast (0.65654)
ok 683 - h cn: est (0.78972) = fast (0.78972)
ok 684 - tile catalase-webblast.BLASTP hit 5 \#hsps 1
ok 685 - q id: est (0.49245) = fast (0.49245)
ok 686 - q cn: est (0.65257) = fast (0.65257)
ok 687 - h id: est (0.49544) = fast (0.49544)
ok 688 - h cn: est (0.65653) = fast (0.65653)
ok 689 - tile catalase-webblast.BLASTP hit 6 \#hsps 1
ok 690 - q id: est (0.44366) = fast (0.44366)
ok 691 - q cn: est (0.58920) = fast (0.58920)
ok 692 - h id: est (0.44787) = fast (0.44787)
ok 693 - h cn: est (0.59479) = fast (0.59479)
ok 694 - tile catalase-webblast.BLASTP hit 7 \#hsps 1
ok 695 - q id: est (0.42564) = fast (0.42564)
ok 696 - q cn: est (0.61282) = fast (0.61282)
ok 697 - h id: est (0.43229) = fast (0.43229)
ok 698 - h cn: est (0.62240) = fast (0.62240)
ok 699 - tile catalase-webblast.BLASTP hit 8 \#hsps 1
ok 700 - q id: est (0.48358) = fast (0.48358)
ok 701 - q cn: est (0.63881) = fast (0.63881)
ok 702 - h id: est (0.48943) = fast (0.48943)
ok 703 - h cn: est (0.64653) = fast (0.64653)
ok 704 - tile catalase-webblast.BLASTP hit 9 \#hsps 1
ok 705 - q id: est (0.42308) = fast (0.42308)
ok 706 - q cn: est (0.61282) = fast (0.61282)
ok 707 - h id: est (0.42969) = fast (0.42969)
ok 708 - h cn: est (0.62240) = fast (0.62240)
ok 709 - tile catalase-webblast.BLASTP hit 10 \#hsps 1
ok 710 - q id: est (0.39675) = fast (0.39675)
ok 711 - q cn: est (0.58933) = fast (0.58933)
ok 712 - h id: est (0.39767) = fast (0.39767)
ok 713 - h cn: est (0.59070) = fast (0.59070)
ok 714 - dcr1_sp.WUBLASTP
ok 715 - tile dcr1_sp.WUBLASTP hit 1 \#hsps 1
ok 716 - q id: est (1.00000) = fast (1.00000)
ok 717 - q cn: est (1.00000) = fast (1.00000)
ok 718 - h id: est (1.00000) = fast (1.00000)
ok 719 - h cn: est (1.00000) = fast (1.00000)
ok 720 - tile dcr1_sp.WUBLASTP hit 2 \#hsps 4
ok 721 - q id: exact (0.36876) ~ est (0.36973)
ok 722 - q id: exact (0.36876) <= max (0.37070)
ok 723 - q cn: exact (0.55022) ~ est (0.55041)
ok 724 - q cn: exact (0.55022) <= max (0.55105)
ok 725 - h id: exact (0.35111) ~ est (0.35111)
ok 726 - h id: exact (0.35111) <= max (0.35111)
ok 727 - h cn: exact (0.52305) ~ est (0.52305)
ok 728 - h cn: exact (0.52305) <= max (0.52305)
ok 729 - tile dcr1_sp.WUBLASTP hit 3 \#hsps 1
ok 730 - q id: est (0.38685) = fast (0.38685)
ok 731 - q cn: est (0.55397) = fast (0.55397)
ok 732 - h id: est (0.37613) = fast (0.37613)
ok 733 - h cn: est (0.53863) = fast (0.53863)
ok 734 - tile dcr1_sp.WUBLASTP hit 4 \#hsps 1
ok 735 - q id: est (0.38247) = fast (0.38247)
ok 736 - q cn: est (0.55068) = fast (0.55068)
ok 737 - h id: est (0.37306) = fast (0.37306)
ok 738 - h cn: est (0.53715) = fast (0.53715)
ok 739 - tile dcr1_sp.WUBLASTP hit 5 \#hsps 5
ok 740 - q id: exact (0.35010) ~ est (0.35010)
ok 741 - q id: exact (0.35010) <= max (0.35010)
ok 742 - q cn: exact (0.53183) ~ est (0.53183)
ok 743 - q cn: exact (0.53183) <= max (0.53183)
ok 744 - h id: exact (0.35082) ~ est (0.35082)
ok 745 - h id: exact (0.35082) <= max (0.35082)
ok 746 - h cn: exact (0.53292) ~ est (0.53292)
ok 747 - h cn: exact (0.53292) <= max (0.53292)
ok 748 - tile dcr1_sp.WUBLASTP hit 6 \#hsps 8
ok 749 - q id: exact (0.30547) ~ est (0.30659)
ok 750 - q id: exact (0.30547) <= max (0.30623)
ok 751 - q cn: exact (0.50076) ~ est (0.50205)
ok 752 - q cn: exact (0.50076) <= max (0.50076)
ok 753 - h id: exact (0.31390) ~ est (0.31179)
ok 754 - h id: exact (0.31390) <= max (0.31795)
ok 755 - h cn: exact (0.50531) ~ est (0.50557)
ok 756 - h cn: exact (0.50531) <= max (0.51091)
ok 757 - tile dcr1_sp.WUBLASTP hit 7 \#hsps 7
ok 758 - q id: exact (0.30136) ~ est (0.30184)
ok 759 - q id: exact (0.30136) <= max (0.30498)
ok 760 - q cn: exact (0.48688) ~ est (0.48742)
ok 761 - q cn: exact (0.48688) <= max (0.49140)
ok 762 - h id: exact (0.30944) ~ est (0.31034)
ok 763 - h id: exact (0.30944) <= max (0.30988)
ok 764 - h cn: exact (0.50178) ~ est (0.50277)
ok 765 - h cn: exact (0.50178) <= max (0.50223)
ok 766 - tile dcr1_sp.WUBLASTP hit 8 \#hsps 10
ok 767 - q id: exact (0.28918) ~ est (0.28961)
ok 768 - q id: exact (0.28918) <= max (0.28955)
ok 769 - q cn: exact (0.46418) ~ est (0.46247)
ok 770 - q cn: exact (0.46418) <= max (0.46866)
ok 771 - h id: exact (0.30166) ~ est (0.30299)
ok 772 - h id: exact (0.30166) <= max (0.30800)
ok 773 - h cn: exact (0.48179) ~ est (0.48439)
ok 774 - h cn: exact (0.48179) <= max (0.48535)
ok 775 - tile dcr1_sp.WUBLASTP hit 9 \#hsps 8
ok 776 - q id: exact (0.30289) ~ est (0.30238)
ok 777 - q id: exact (0.30289) <= max (0.30651)
ok 778 - q cn: exact (0.49955) ~ est (0.49787)
ok 779 - q cn: exact (0.49955) <= max (0.50362)
ok 780 - h id: exact (0.31395) ~ est (0.31347)
ok 781 - h id: exact (0.31395) <= max (0.31721)
ok 782 - h cn: exact (0.51535) ~ est (0.51578)
ok 783 - h cn: exact (0.51535) <= max (0.51814)
ok 784 - tile dcr1_sp.WUBLASTP hit 10 \#hsps 5
ok 785 - q id: exact (0.29334) ~ est (0.29534)
ok 786 - q id: exact (0.29334) <= max (0.29810)
ok 787 - q cn: exact (0.46617) ~ est (0.46719)
ok 788 - q cn: exact (0.46617) <= max (0.47040)
ok 789 - h id: exact (0.31176) ~ est (0.31176)
ok 790 - h id: exact (0.31176) <= max (0.31176)
ok 791 - h cn: exact (0.49299) ~ est (0.49299)
ok 792 - h cn: exact (0.49299) <= max (0.49299)
ok 793 - tile dcr1_sp.WUBLASTP hit 11 \#hsps 7
ok 794 - q id: exact (0.30456) ~ est (0.30514)
ok 795 - q id: exact (0.30456) <= max (0.30650)
ok 796 - q cn: exact (0.48739) ~ est (0.48879)
ok 797 - q cn: exact (0.48739) <= max (0.49370)
ok 798 - h id: exact (0.32062) ~ est (0.31987)
ok 799 - h id: exact (0.32062) <= max (0.32932)
ok 800 - h cn: exact (0.51071) ~ est (0.51306)
ok 801 - h cn: exact (0.51071) <= max (0.52410)
ok 802 - tile dcr1_sp.WUBLASTP hit 12 \#hsps 8
ok 803 - q id: exact (0.29615) ~ est (0.29879)
ok 804 - q id: exact (0.29615) <= max (0.30009)
ok 805 - q cn: exact (0.47419) ~ est (0.47394)
ok 806 - q cn: exact (0.47419) <= max (0.48119)
ok 807 - h id: exact (0.31611) ~ est (0.31482)
ok 808 - h id: exact (0.31611) <= max (0.32227)
ok 809 - h cn: exact (0.49779) ~ est (0.49788)
ok 810 - h cn: exact (0.49779) <= max (0.50616)
ok 811 - tile dcr1_sp.WUBLASTP hit 13 \#hsps 8
ok 812 - q id: exact (0.30390) ~ est (0.30440)
ok 813 - q id: exact (0.30390) <= max (0.30701)
ok 814 - q cn: exact (0.45874) ~ est (0.45993)
ok 815 - q cn: exact (0.45874) <= max (0.45963)
ok 816 - h id: exact (0.32282) ~ est (0.32324)
ok 817 - h id: exact (0.32282) <= max (0.32560)
ok 818 - h cn: exact (0.48052) ~ est (0.48136)
ok 819 - h cn: exact (0.48052) <= max (0.48330)
ok 820 - tile dcr1_sp.WUBLASTP hit 14 \#hsps 6
ok 821 - q id: exact (0.29769) ~ est (0.29851)
ok 822 - q id: exact (0.29769) <= max (0.29769)
ok 823 - q cn: exact (0.48480) ~ est (0.48628)
ok 824 - q cn: exact (0.48480) <= max (0.48637)
ok 825 - h id: exact (0.30704) ~ est (0.30810)
ok 826 - h id: exact (0.30704) <= max (0.30917)
ok 827 - h cn: exact (0.50107) ~ est (0.50292)
ok 828 - h cn: exact (0.50107) <= max (0.50320)
ok 829 - tile dcr1_sp.WUBLASTP hit 15 \#hsps 6
ok 830 - q id: exact (0.27854) ~ est (0.27854)
ok 831 - q id: exact (0.27854) <= max (0.27854)
ok 832 - q cn: exact (0.48174) ~ est (0.48174)
ok 833 - q cn: exact (0.48174) <= max (0.48174)
ok 834 - h id: exact (0.28514) ~ est (0.28623)
ok 835 - h id: exact (0.28514) <= max (0.28594)
ok 836 - h cn: exact (0.49197) ~ est (0.49154)
ok 837 - h cn: exact (0.49197) <= max (0.49237)
ok 838 - tile dcr1_sp.WUBLASTP hit 16 \#hsps 8
ok 839 - q id: exact (0.30362) ~ est (0.30824)
ok 840 - q id: exact (0.30362) <= max (0.30852)
ok 841 - q cn: exact (0.47111) ~ est (0.47587)
ok 842 - q cn: exact (0.47111) <= max (0.47405)
ok 843 - h id: exact (0.32347) ~ est (0.32392)
ok 844 - h id: exact (0.32347) <= max (0.32643)
ok 845 - h cn: exact (0.49310) ~ est (0.49360)
ok 846 - h cn: exact (0.49310) <= max (0.49606)
ok 847 - tile dcr1_sp.WUBLASTP hit 17 \#hsps 4
ok 848 - q id: exact (0.29174) ~ est (0.29174)
ok 849 - q id: exact (0.29174) <= max (0.29174)
ok 850 - q cn: exact (0.46230) ~ est (0.46230)
ok 851 - q cn: exact (0.46230) <= max (0.46230)
ok 852 - h id: exact (0.30204) ~ est (0.30204)
ok 853 - h id: exact (0.30204) <= max (0.30204)
ok 854 - h cn: exact (0.47862) ~ est (0.47862)
ok 855 - h cn: exact (0.47862) <= max (0.47862)
ok 856 - tile dcr1_sp.WUBLASTP hit 18 \#hsps 6
ok 857 - q id: exact (0.29064) ~ est (0.29089)
ok 858 - q id: exact (0.29064) <= max (0.29115)
ok 859 - q cn: exact (0.48765) ~ est (0.48670)
ok 860 - q cn: exact (0.48765) <= max (0.48868)
ok 861 - h id: exact (0.29848) ~ est (0.29887)
ok 862 - h id: exact (0.29848) <= max (0.29902)
ok 863 - h cn: exact (0.50108) ~ est (0.50116)
ok 864 - h cn: exact (0.50108) <= max (0.50163)
ok 865 - tile dcr1_sp.WUBLASTP hit 19 \#hsps 5
ok 866 - q id: exact (0.29510) ~ est (0.29505)
ok 867 - q id: exact (0.29510) <= max (0.29510)
ok 868 - q cn: exact (0.48982) ~ est (0.49039)
ok 869 - q cn: exact (0.48982) <= max (0.49029)
ok 870 - h id: exact (0.30019) ~ est (0.30019)
ok 871 - h id: exact (0.30019) <= max (0.30019)
ok 872 - h cn: exact (0.49906) ~ est (0.49906)
ok 873 - h cn: exact (0.49906) <= max (0.49906)
ok 874 - 503384.MEGABLAST.2
ok 875 - tile 503384.MEGABLAST.2 hit 1 \#hsps 5
ok 876 - q id: exact (0.91435) ~ est (0.91435)
ok 877 - q id: exact (0.91435) <= max (0.91435)
ok 878 - q cn: exact (0.91435) ~ est (0.91435)
ok 879 - q cn: exact (0.91435) <= max (0.91435)
ok 880 - h id: exact (0.91157) ~ est (0.91157)
ok 881 - h id: exact (0.91157) <= max (0.91157)
ok 882 - h cn: exact (0.91157) ~ est (0.91157)
ok 883 - h cn: exact (0.91157) <= max (0.91157)
ok 884 - tile 503384.MEGABLAST.2 hit 2 \#hsps 9
ok 885 - q id: exact (0.92895) ~ est (0.92895)
ok 886 - q id: exact (0.92895) <= max (0.92895)
ok 887 - q cn: exact (0.92895) ~ est (0.92895)
ok 888 - q cn: exact (0.92895) <= max (0.92895)
ok 889 - h id: exact (0.92854) ~ est (0.92854)
ok 890 - h id: exact (0.92854) <= max (0.92854)
ok 891 - h cn: exact (0.92854) ~ est (0.92854)
ok 892 - h cn: exact (0.92854) <= max (0.92854)
ok 893 - tile 503384.MEGABLAST.2 hit 3 \#hsps 3
ok 894 - q id: exact (0.93516) ~ est (0.93516)
ok 895 - q id: exact (0.93516) <= max (0.93516)
ok 896 - q cn: exact (0.93516) ~ est (0.93516)
ok 897 - q cn: exact (0.93516) <= max (0.93516)
ok 898 - h id: exact (0.93651) ~ est (0.93651)
ok 899 - h id: exact (0.93651) <= max (0.93651)
ok 900 - h cn: exact (0.93651) ~ est (0.93651)
ok 901 - h cn: exact (0.93651) <= max (0.93651)
ok 902 - tile 503384.MEGABLAST.2 hit 4 \#hsps 3
ok 903 - q id: exact (0.93064) ~ est (0.93064)
ok 904 - q id: exact (0.93064) <= max (0.93064)
ok 905 - q cn: exact (0.93064) ~ est (0.93064)
ok 906 - q cn: exact (0.93064) <= max (0.93064)
ok 907 - h id: exact (0.92885) ~ est (0.92885)
ok 908 - h id: exact (0.92885) <= max (0.92885)
ok 909 - h cn: exact (0.92885) ~ est (0.92885)
ok 910 - h cn: exact (0.92885) <= max (0.92885)
ok 911 - bl2seq.blastx.out
ok 912 - tile bl2seq.blastx.out hit 1 \#hsps 6
ok 913 - q id: est (0.71429) = fast (0.71429)
ok 914 - q cn: est (1.00000) = fast (1.00000)
ok 915 - q id: exact (0.70536) ~ est (0.70495)
ok 916 - q id: exact (0.70536) <= max (0.94286)
ok 917 - q cn: exact (0.78810) ~ est (0.78803)
ok 918 - q cn: exact (0.78810) <= max (0.96429)
ok 919 - q id: est (0.35714) = fast (0.35714)
ok 920 - q cn: est (0.57143) = fast (0.57143)
ok 921 - h id: exact (0.61923) ~ est (0.61955)
ok 922 - h id: exact (0.61923) <= max (0.64231)
ok 923 - h cn: exact (0.73077) ~ est (0.73077)
ok 924 - h cn: exact (0.73077) <= max (0.75000)
ok 925 - dnaEbsub_ecoli.wublastx
ok 926 - tile dnaEbsub_ecoli.wublastx hit 1 \#hsps 1
ok 927 - q id: est (0.36386) = fast (0.36386)
ok 928 - q cn: est (0.53735) = fast (0.53735)
ok 929 - h id: est (0.36562) = fast (0.36562)
ok 930 - h cn: est (0.53995) = fast (0.53995)
ok 931 - tblastn.out
ok 932 - tile tblastn.out hit 1 \#hsps 2
ok 933 - q id: exact (0.31250) ~ est (0.33325)
ok 934 - q id: exact (0.31250) <= max (0.33333)
ok 935 - q cn: exact (0.44792) ~ est (0.47055)
ok 936 - q cn: exact (0.44792) <= max (0.45833)
ok 937 - h id: exact (0.33333) ~ est (0.33333)
ok 938 - h id: exact (0.33333) <= max (0.33333)
ok 939 - h cn: exact (0.47059) ~ est (0.47059)
ok 940 - h cn: exact (0.47059) <= max (0.47059)
ok 941 - tile tblastn.out hit 2 \#hsps 2
ok 942 - q id: exact (0.68750) ~ est (0.68750)
ok 943 - q id: exact (0.68750) <= max (0.68750)
ok 944 - q cn: exact (0.81250) ~ est (0.81250)
ok 945 - q cn: exact (0.81250) <= max (0.81250)
ok 946 - h id: est (0.66667) = fast (0.66667)
ok 947 - h cn: est (0.77778) = fast (0.77778)
ok 948 - h id: est (0.71429) = fast (0.71429)
ok 949 - h cn: est (0.85714) = fast (0.85714)
ok 950 - dnaEbsub_ecoli.wutblastn
ok 951 - tile dnaEbsub_ecoli.wutblastn hit 1 \#hsps 1
ok 952 - q id: est (0.36386) = fast (0.36386)
ok 953 - q cn: est (0.53735) = fast (0.53735)
ok 954 - h id: est (0.36562) = fast (0.36562)
ok 955 - h cn: est (0.53995) = fast (0.53995)
ok 956 - HUMBETGLOA.tblastx
ok 957 - tile HUMBETGLOA.tblastx hit 1 \#hsps 1
ok 958 - q id: est (0.42308) = fast (0.42308)
ok 959 - q cn: est (0.61538) = fast (0.61538)
ok 960 - h id: est (0.42308) = fast (0.42308)
ok 961 - h cn: est (0.61538) = fast (0.61538)
ok 962 - tile HUMBETGLOA.tblastx hit 2 \#hsps 1
ok 963 - q id: est (0.47059) = fast (0.47059)
ok 964 - q cn: est (0.76471) = fast (0.76471)
ok 965 - h id: est (0.47059) = fast (0.47059)
ok 966 - h cn: est (0.76471) = fast (0.76471)
ok 967 - tile HUMBETGLOA.tblastx hit 3 \#hsps 1
ok 968 - q id: est (0.36000) = fast (0.36000)
ok 969 - q cn: est (0.56000) = fast (0.56000)
ok 970 - h id: est (0.36000) = fast (0.36000)
ok 971 - h cn: est (0.56000) = fast (0.56000)
ok 972 - tile HUMBETGLOA.tblastx hit 4 \#hsps 1
ok 973 - q id: est (0.29268) = fast (0.29268)
ok 974 - q cn: est (0.58537) = fast (0.58537)
ok 975 - h id: est (0.29268) = fast (0.29268)
ok 976 - h cn: est (0.58537) = fast (0.58537)
ok 977 - tile HUMBETGLOA.tblastx hit 5 \#hsps 1
ok 978 - q id: est (0.38889) = fast (0.38889)
ok 979 - q cn: est (0.55556) = fast (0.55556)
ok 980 - h id: est (0.38889) = fast (0.38889)
ok 981 - h cn: est (0.55556) = fast (0.55556)
ok 982 - tile HUMBETGLOA.tblastx hit 6 \#hsps 1
ok 983 - q id: est (0.43590) = fast (0.43590)
ok 984 - q cn: est (0.51282) = fast (0.51282)
ok 985 - h id: est (0.43590) = fast (0.43590)
ok 986 - h cn: est (0.51282) = fast (0.51282)
ok 987 - tile HUMBETGLOA.tblastx hit 7 \#hsps 1
ok 988 - q id: est (0.35714) = fast (0.35714)
ok 989 - q cn: est (0.42857) = fast (0.42857)
ok 990 - h id: est (0.35714) = fast (0.35714)
ok 991 - h cn: est (0.42857) = fast (0.42857)
ok 992 - tile HUMBETGLOA.tblastx hit 8 \#hsps 1
ok 993 - q id: est (0.33333) = fast (0.33333)
ok 994 - q cn: est (0.66667) = fast (0.66667)
ok 995 - h id: est (0.33333) = fast (0.33333)
ok 996 - h cn: est (0.66667) = fast (0.66667)
ok 997 - tile HUMBETGLOA.tblastx hit 9 \#hsps 2
ok 998 - q id: exact (0.40541) ~ est (0.40541)
ok 999 - q id: exact (0.40541) <= max (0.40541)
ok 1000 - q cn: exact (0.56757) ~ est (0.56757)
ok 1001 - q cn: exact (0.56757) <= max (0.56757)
ok 1002 - h id: est (0.36364) = fast (0.36364)
ok 1003 - h cn: est (0.63636) = fast (0.63636)
ok 1004 - h id: est (0.42308) = fast (0.42308)
ok 1005 - h cn: est (0.53846) = fast (0.53846)
ok 1006 - tile HUMBETGLOA.tblastx hit 10 \#hsps 1
ok 1007 - q id: est (0.29167) = fast (0.29167)
ok 1008 - q cn: est (0.39583) = fast (0.39583)
ok 1009 - h id: est (0.29167) = fast (0.29167)
ok 1010 - h cn: est (0.39583) = fast (0.39583)
ok 1011 - tile HUMBETGLOA.tblastx hit 11 \#hsps 1
ok 1012 - q id: est (0.60000) = fast (0.60000)
ok 1013 - q cn: est (0.65000) = fast (0.65000)
ok 1014 - h id: est (0.60000) = fast (0.60000)
ok 1015 - h cn: est (0.65000) = fast (0.65000)
ok 1016 - tile HUMBETGLOA.tblastx hit 12 \#hsps 1
ok 1017 - q id: est (0.50000) = fast (0.50000)
ok 1018 - q cn: est (0.68182) = fast (0.68182)
ok 1019 - h id: est (0.50000) = fast (0.50000)
ok 1020 - h cn: est (0.68182) = fast (0.68182)
ok 1021 - tile HUMBETGLOA.tblastx hit 13 \#hsps 1
ok 1022 - q id: est (0.29630) = fast (0.29630)
ok 1023 - q cn: est (0.48148) = fast (0.48148)
ok 1024 - h id: est (0.29630) = fast (0.29630)
ok 1025 - h cn: est (0.48148) = fast (0.48148)
ok 1026 - tile HUMBETGLOA.tblastx hit 14 \#hsps 1
ok 1027 - q id: est (0.47826) = fast (0.47826)
ok 1028 - q cn: est (0.52174) = fast (0.52174)
ok 1029 - h id: est (0.47826) = fast (0.47826)
ok 1030 - h cn: est (0.52174) = fast (0.52174)
ok 1031 - tile HUMBETGLOA.tblastx hit 15 \#hsps 1
ok 1032 - q id: est (0.47368) = fast (0.47368)
ok 1033 - q cn: est (0.63158) = fast (0.63158)
ok 1034 - h id: est (0.47368) = fast (0.47368)
ok 1035 - h cn: est (0.63158) = fast (0.63158)
ok 1036 - tile HUMBETGLOA.tblastx hit 16 \#hsps 1
ok 1037 - q id: est (0.44444) = fast (0.44444)
ok 1038 - q cn: est (0.55556) = fast (0.55556)
ok 1039 - h id: est (0.44444) = fast (0.44444)
ok 1040 - h cn: est (0.55556) = fast (0.55556)
ok 1041 - tile HUMBETGLOA.tblastx hit 17 \#hsps 1
ok 1042 - q id: est (0.47059) = fast (0.47059)
ok 1043 - q cn: est (0.70588) = fast (0.70588)
ok 1044 - h id: est (0.47059) = fast (0.47059)
ok 1045 - h cn: est (0.70588) = fast (0.70588)
ok 1046 - tile HUMBETGLOA.tblastx hit 18 \#hsps 1
ok 1047 - q id: est (0.38889) = fast (0.38889)
ok 1048 - q cn: est (0.66667) = fast (0.66667)
ok 1049 - h id: est (0.38889) = fast (0.38889)
ok 1050 - h cn: est (0.66667) = fast (0.66667)
ok 1051 - tile HUMBETGLOA.tblastx hit 19 \#hsps 1
ok 1052 - q id: est (0.27660) = fast (0.27660)
ok 1053 - q cn: est (0.48936) = fast (0.48936)
ok 1054 - h id: est (0.27660) = fast (0.27660)
ok 1055 - h cn: est (0.48936) = fast (0.48936)
ok 1056 - tile HUMBETGLOA.tblastx hit 20 \#hsps 1
ok 1057 - q id: est (0.40000) = fast (0.40000)
ok 1058 - q cn: est (0.60000) = fast (0.60000)
ok 1059 - h id: est (0.40000) = fast (0.40000)
ok 1060 - h cn: est (0.60000) = fast (0.60000)
ok 1061 - dnaEbsub_ecoli.wutblastx
ok 1062 - tile dnaEbsub_ecoli.wutblastx hit 1 \#hsps 12
ok 1063 - q id: exact (0.40224) ~ est (0.40912)
ok 1064 - q id: exact (0.40224) <= max (0.42628)
ok 1065 - q cn: exact (0.58494) ~ est (0.58968)
ok 1066 - q cn: exact (0.58494) <= max (0.62179)
ok 1067 - q id: est (0.25352) = fast (0.25352)
ok 1068 - q cn: est (0.47887) = fast (0.47887)
ok 1069 - q id: est (0.37500) = fast (0.37500)
ok 1070 - q cn: est (0.62500) = fast (0.62500)
ok 1071 - q id: exact (0.44118) ~ est (0.44118)
ok 1072 - q id: exact (0.44118) <= max (0.44118)
ok 1073 - q cn: exact (0.54412) ~ est (0.54412)
ok 1074 - q cn: exact (0.54412) <= max (0.54412)
ok 1075 - h id: est (0.25352) = fast (0.25352)
ok 1076 - h cn: est (0.47887) = fast (0.47887)
ok 1077 - h id: exact (0.39848) ~ est (0.40304)
ok 1078 - h id: exact (0.39848) <= max (0.40355)
ok 1079 - h cn: exact (0.58376) ~ est (0.58889)
ok 1080 - h cn: exact (0.58376) <= max (0.58883)
ok 1081 - h id: exact (0.44118) ~ est (0.44118)
ok 1082 - h id: exact (0.44118) <= max (0.44118)
ok 1083 - h cn: exact (0.54412) ~ est (0.54412)
ok 1084 - h cn: exact (0.54412) <= max (0.54412)
ok 1085 - tile dnaEbsub_ecoli.wutblastx hit 2 \#hsps 2
ok 1086 - q id: exact (0.41818) ~ est (0.41818)
ok 1087 - q id: exact (0.41818) <= max (0.41818)
ok 1088 - q cn: exact (0.52727) ~ est (0.52727)
ok 1089 - q cn: exact (0.52727) <= max (0.52727)
ok 1090 - h id: est (0.53333) = fast (0.53333)
ok 1091 - h cn: est (0.66667) = fast (0.66667)
ok 1092 - h id: est (0.37500) = fast (0.37500)
ok 1093 - h cn: est (0.47500) = fast (0.47500)
ok 1094 - bug2942: query m0: range correct
ok 1095 - bug2942: query m1: range correct
ok 1096 - bug2942: query m2: range correct
ok 1097 - bug2942: subject all : range correct
ok 1098 - get_tiled_alns
ok 1099 - got all alns
ok 1100
ok 1101 - aln and qfeat lengths correspond
ok 1102 - q length correct
ok 1103
ok 1104 - features on q and s correspond
ok 1105 - aln and hfeat lengths correspond
ok 1106 - s length correct
ok 1107
ok 1108 - aln and qfeat lengths correspond
ok 1109 - q length correct
ok 1110
ok 1111 - features on q and s correspond
ok 1112 - aln and hfeat lengths correspond
ok 1113 - s length correct
ok 1114
ok 1115 - aln and qfeat lengths correspond
ok 1116 - q length correct
ok 1117
ok 1118 - features on q and s correspond
ok 1119 - aln and hfeat lengths correspond
ok 1120 - s length correct
ok 1121
ok 1122 - aln and qfeat lengths correspond
ok 1123 - q length correct
ok 1124
ok 1125 - features on q and s correspond
ok 1126 - aln and hfeat lengths correspond
ok 1127 - s length correct
ok 1128
ok 1129 - aln and qfeat lengths correspond
ok 1130 - q length correct
ok 1131
ok 1132 - features on q and s correspond
ok 1133 - aln and hfeat lengths correspond
ok 1134 - s length correct
ok 1135
ok 1136 - aln and qfeat lengths correspond
ok 1137 - q length correct
ok 1138
ok 1139 - features on q and s correspond
ok 1140 - aln and hfeat lengths correspond
ok 1141 - s length correct
ok
t/SearchIO/Writer/GbrowseGFF.t ...............
1..4
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok
t/SearchIO/Writer/HSPTableWriter.t ...........
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HSPTableWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
t/SearchIO/Writer/HTMLWriter.t ...............
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HTMLResultWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
t/SearchIO/Writer/HitTableWriter.t ...........
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::HitTableWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
t/SearchIO/Writer/TextWriter.t ...............
1..8
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::SearchIO::Writer::TextResultWriter;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6
ok 7 - The object isa Bio::Align::AlignI
ok 8
ok
t/SearchIO/axt.t .............................
1..19
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok
t/SearchIO/blast.t ...........................
1..1348
ok 1 - use Bio::SearchIO;
ok 2
ok 3 - database_name()
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
not ok 411 # TODO frac_identical & frac_conserved are still too wrong
# Failed (TODO) test at t/SearchIO/blast.t line 584.
# '0.852'
# >
# '0.9'
not ok 412 # TODO frac_identical & frac_conserved are still too wrong
# Failed (TODO) test at t/SearchIO/blast.t line 585.
# '1.599'
# <=
# '1'
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517
ok 518
ok 519
ok 520
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561
ok 562
ok 563
ok 564
ok 565
ok 566
ok 567
ok 568
ok 569
ok 570
ok 571
ok 572
ok 573
ok 574
ok 575
ok 576
ok 577
ok 578
ok 579
ok 580
ok 581
ok 582
ok 583
ok 584
ok 585
ok 586
ok 587
ok 588
ok 589
ok 590
ok 591
ok 592
ok 593 - Multiblast query test
ok 594
ok 595 - Multiblast query test
ok 596
ok 597 - Multiblast query test
ok 598
ok 599 - Multiblast query test
ok 600
ok 601
ok 602
ok 603
ok 604
ok 605
ok 606
ok 607
ok 608
ok 609
ok 610
ok 611
ok 612
ok 613
ok 614
ok 615
ok 616
ok 617
ok 618
ok 619
ok 620
ok 621
ok 622
ok 623
ok 624
ok 625
ok 626
ok 627
ok 628
ok 629
ok 630
ok 631
ok 632
ok 633
ok 634
ok 635
ok 636
ok 637
ok 638
ok 639
ok 640
ok 641
ok 642
ok 643
ok 644
ok 645
ok 646
ok 647
ok 648
ok 649
ok 650
ok 651
ok 652
ok 653
ok 654
ok 655
ok 656
ok 657
ok 658
ok 659
ok 660
ok 661
ok 662
ok 663
ok 664
ok 665
ok 666
ok 667
ok 668
ok 669
ok 670
ok 671
ok 672
ok 673
ok 674
ok 675
ok 676
ok 677
ok 678
ok 679
ok 680
ok 681
ok 682
ok 683
ok 684
ok 685
ok 686
ok 687
ok 688
ok 689
ok 690
ok 691
ok 692
ok 693
ok 694
ok 695
ok 696
ok 697
ok 698
ok 699
ok 700
ok 701
ok 702
ok 703
ok 704
ok 705
ok 706
ok 707
ok 708
ok 709
ok 710
ok 711
ok 712
ok 713
ok 714
ok 715
ok 716
ok 717
ok 718
ok 719
ok 720
ok 721
ok 722
ok 723
ok 724
ok 725
ok 726
ok 727
ok 728
ok 729
ok 730
ok 731
ok 732
ok 733
ok 734
ok 735
ok 736
ok 737
ok 738
ok 739
ok 740
ok 741
ok 742
ok 743
ok 744
ok 745
ok 746
ok 747
ok 748
ok 749
ok 750
ok 751
ok 752
ok 753
ok 754
ok 755
ok 756
ok 757
ok 758
ok 759
ok 760
ok 761
ok 762
ok 763
ok 764
ok 765
ok 766
ok 767
ok 768
ok 769
ok 770
ok 771
ok 772
ok 773
ok 774
ok 775
ok 776
ok 777
ok 778
ok 779
ok 780
ok 781
ok 782
ok 783
ok 784
ok 785
ok 786
ok 787
ok 788
ok 789
ok 790
ok 791
ok 792
ok 793
ok 794
ok 795
ok 796
ok 797
ok 798
ok 799
ok 800
ok 801
ok 802
ok 803
ok 804
ok 805
ok 806
ok 807
ok 808
ok 809
ok 810
ok 811
ok 812
ok 813
ok 814
ok 815
ok 816
ok 817
ok 818
ok 819
ok 820
ok 821
ok 822
ok 823
ok 824
ok 825
ok 826
ok 827
ok 828
ok 829
ok 830
ok 831
ok 832
ok 833
ok 834
ok 835
ok 836
ok 837
ok 838
ok 839
ok 840
ok 841
ok 842
ok 843
ok 844
ok 845
ok 846
ok 847
ok 848
ok 849
ok 850
ok 851
ok 852
ok 853
ok 854
ok 855
ok 856
ok 857
ok 858
ok 859
ok 860
ok 861
ok 862
ok 863
ok 864
ok 865
ok 866
ok 867
ok 868
ok 869
ok 870
ok 871
ok 872
ok 873
ok 874
ok 875
ok 876
ok 877
ok 878
ok 879 - The object isa Bio::Search::Result::ResultI
ok 880
ok 881
ok 882
ok 883
ok 884
ok 885
ok 886
ok 887
ok 888
ok 889
ok 890
ok 891
ok 892
ok 893
ok 894
ok 895
ok 896
ok 897
ok 898
ok 899 - The object isa Bio::Search::Result::ResultI
ok 900
ok 901
ok 902
ok 903
ok 904
ok 905
ok 906
ok 907
ok 908
ok 909
ok 910
ok 911
ok 912
ok 913
ok 914
ok 915
ok 916
ok 917
ok 918
ok 919
ok 920
ok 921
ok 922
ok 923 - The object isa Bio::Search::Result::ResultI
ok 924
ok 925
ok 926
ok 927
ok 928
ok 929
ok 930
ok 931
ok 932
ok 933
ok 934
ok 935
ok 936
ok 937
ok 938
ok 939
ok 940
ok 941
ok 942
ok 943
ok 944
ok 945
ok 946
ok 947 - The object isa Bio::Search::Result::ResultI
ok 948
ok 949
ok 950
ok 951
ok 952
ok 953
ok 954
ok 955
ok 956
ok 957
ok 958
ok 959
ok 960
ok 961
ok 962
ok 963
ok 964
ok 965
ok 966
ok 967
ok 968
ok 969
ok 970
ok 971
ok 972 - The object isa Bio::Search::Result::ResultI
ok 973
ok 974
ok 975
ok 976
ok 977
ok 978
ok 979
ok 980
ok 981
ok 982
ok 983
ok 984
ok 985
ok 986
ok 987
ok 988
ok 989
ok 990
ok 991
ok 992
ok 993
ok 994
ok 995
ok 996
ok 997
ok 998
ok 999
ok 1000 - The object isa Bio::Search::Result::ResultI
ok 1001
ok 1002
ok 1003
ok 1004
ok 1005
ok 1006
ok 1007
ok 1008
ok 1009
ok 1010
ok 1011
ok 1012
ok 1013
ok 1014
ok 1015
ok 1016
ok 1017
ok 1018
ok 1019
ok 1020
ok 1021
ok 1022
ok 1023
ok 1024
ok 1025
ok 1026
ok 1027
ok 1028
ok 1029 - The object isa Bio::Search::Result::ResultI
ok 1030
ok 1031
ok 1032
ok 1033
ok 1034
ok 1035
ok 1036
ok 1037
ok 1038
ok 1039
ok 1040
ok 1041
ok 1042
ok 1043
ok 1044
ok 1045
ok 1046
ok 1047
ok 1048 - blastxml for f.blastxml
ok 1049 - fasta for f.fy
ok 1050 - exonerate for f.exonerate
ok 1051 - blast for f.tblx
ok 1052 - fasta for f.fx
ok 1053 - fasta for f.osearch
ok 1054 - blast for filename.bls
ok 1055 - exonerate for f.exon
ok 1056 - fasta for f.SSEARCH.m9
ok 1057 - blast for filename.blast
ok 1058 - fasta for f.m9
ok 1059 - blast for f.blx
ok 1060 - blastxml for f.xml
ok 1061 - fasta for f.fasta
ok 1062 - fasta for f.fa
ok 1063 - blast for fast.bls
ok 1064 - fasta for f.ssearch
ok 1065 - fasta for f.psearch
ok 1066
ok 1067
ok 1068
ok 1069
ok 1070
ok 1071
ok 1072
ok 1073
ok 1074
ok 1075
ok 1076
ok 1077
ok 1078
ok 1079
ok 1080
ok 1081 - full hit name
ok 1082 - hit accession
ok 1083
ok 1084
ok 1085 - query start
ok 1086 - query start
ok 1087
ok 1088
ok 1089
ok 1090
ok 1091
ok 1092
ok 1093
ok 1094
ok 1095
ok 1096
ok 1097
ok 1098
ok 1099
ok 1100
ok 1101
ok 1102
ok 1103
ok 1104
ok 1105
ok 1106
ok 1107
ok 1108
ok 1109
ok 1110
ok 1111
ok 1112
ok 1113
ok 1114
ok 1115
ok 1116
ok 1117
ok 1118
ok 1119
ok 1120
ok 1121
ok 1122
ok 1123
ok 1124
ok 1125
ok 1126
ok 1127
ok 1128
ok 1129
ok 1130
ok 1131
ok 1132
ok 1133
ok 1134
ok 1135
ok 1136
ok 1137
ok 1138
ok 1139
ok 1140
ok 1141
ok 1142
ok 1143
ok 1144
ok 1145
ok 1146
ok 1147
ok 1148
ok 1149
ok 1150
ok 1151
ok 1152
ok 1153
ok 1154
ok 1155
ok 1156
ok 1157
ok 1158
ok 1159
ok 1160
ok 1161
ok 1162
ok 1163
ok 1164
ok 1165
ok 1166
ok 1167
ok 1168
ok 1169
ok 1170
ok 1171
ok 1172
ok 1173
ok 1174
ok 1175
ok 1176
ok 1177
ok 1178
ok 1179
ok 1180
ok 1181
ok 1182
ok 1183
ok 1184
ok 1185
ok 1186
ok 1187
ok 1188
ok 1189
ok 1190
ok 1191
ok 1192
ok 1193
ok 1194
ok 1195
ok 1196
ok 1197
ok 1198
ok 1199
ok 1200
ok 1201
ok 1202
ok 1203
ok 1204
ok 1205
ok 1206
ok 1207
ok 1208
ok 1209
ok 1210
ok 1211
ok 1212
ok 1213
ok 1214
ok 1215
ok 1216
ok 1217
ok 1218
ok 1219
ok 1220
ok 1221
ok 1222
ok 1223
ok 1224
ok 1225
ok 1226
ok 1227
ok 1228
ok 1229
ok 1230
ok 1231
ok 1232
ok 1233
ok 1234
ok 1235
ok 1236
ok 1237
ok 1238
ok 1239
ok 1240
ok 1241
ok 1242
ok 1243
ok 1244
ok 1245
ok 1246
ok 1247
ok 1248
ok 1249
ok 1250
ok 1251
ok 1252
ok 1253
ok 1254
ok 1255
ok 1256
ok 1257
ok 1258
ok 1259
ok 1260
ok 1261
ok 1262
ok 1263
ok 1264
ok 1265
ok 1266
ok 1267
ok 1268
ok 1269
ok 1270
ok 1271
ok 1272
ok 1273
ok 1274
ok 1275
ok 1276
ok 1277
ok 1278
ok 1279
ok 1280
ok 1281
ok 1282
ok 1283
ok 1284
ok 1285
ok 1286
ok 1287
ok 1288
ok 1289
ok 1290
ok 1291
ok 1292
ok 1293
ok 1294
ok 1295
ok 1296
ok 1297
ok 1298
ok 1299
ok 1300
ok 1301
ok 1302
ok 1303
ok 1304
ok 1305
ok 1306
ok 1307
ok 1308
ok 1309
ok 1310
ok 1311
ok 1312
ok 1313
ok 1314
ok 1315
ok 1316
ok 1317
ok 1318
ok 1319
ok 1320
ok 1321
ok 1322
ok 1323
ok 1324
ok 1325
ok 1326
ok 1327
ok 1328
ok 1329
ok 1330
ok 1331
ok 1332
ok 1333
ok 1334
ok 1335
ok 1336
ok 1337
ok 1338
ok 1339
ok 1340
ok 1341
ok 1342
ok 1343
ok 1344
ok 1345
ok 1346
ok 1347
ok 1348
ok
t/SearchIO/blast_pull.t ......................
1..289
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59 - database_name()
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
not ok 191 # TODO frac_identical failing!
# Failed (TODO) test at t/SearchIO/blast_pull.t line 260.
# got: '0.946'
# expected: '0.943'
ok 192
ok 193
ok 194
ok 195
ok 196 - Multiblast query test
ok 197 - Multiblast query test
ok 198 - Multiblast query test
ok 199 - Multiblast query test
ok 200
ok 201
ok 202
ok 203 - full hit name
ok 204 - hit accession
ok 205
ok 206 - query start
ok 207 - query start
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok
t/SearchIO/blasttable.t ......................
1..165
ok 1 - use Bio::SearchIO;
ok 2 - use Bio::Search::SearchUtils;
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4
ok 5
ok 6 - hit1_bits
ok 7 - hit1_name
ok 8 - hsp1_bits
ok 9 - hsp1_gaps
ok 10 - hsp1_he
ok 11 - hsp1_hs
ok 12 - hsp1_hstr
ok 13 - hsp1_qe
ok 14 - hsp1_qs
ok 15 - hsp1_qstr
ok 16 - hsp2_bits
ok 17 - hsp2_gaps
ok 18 - hsp2_he
ok 19 - hsp2_hs
ok 20 - hsp2_hstr
ok 21 - hsp2_qe
ok 22 - hsp2_qs
ok 23 - hsp2_qstr
ok 24 - hsp3_bits
ok 25 - hsp3_gaps
ok 26 - hsp3_he
ok 27 - hsp3_hs
ok 28 - hsp3_hstr
ok 29 - hsp3_qe
ok 30 - hsp3_qs
ok 31 - hsp3_qstr
ok 32 - hsp4_bits
ok 33 - hsp4_gaps
ok 34 - hsp4_he
ok 35 - hsp4_hs
ok 36 - hsp4_hstr
ok 37 - hsp4_qe
ok 38 - hsp4_qs
ok 39 - hsp4_qstr
ok 40 - hsp5_bits
ok 41 - hsp5_gaps
ok 42 - hsp5_he
ok 43 - hsp5_hs
ok 44 - hsp5_hstr
ok 45 - hsp5_qe
ok 46 - hsp5_qs
ok 47 - hsp5_qstr
ok 48 - hsp6_bits
ok 49 - hsp6_gaps
ok 50 - hsp6_he
ok 51 - hsp6_hs
ok 52 - hsp6_hstr
ok 53 - hsp6_qe
ok 54 - hsp6_qs
ok 55 - hsp6_qstr
ok 56 - hsp7_bits
ok 57 - hsp7_gaps
ok 58 - hsp7_he
ok 59 - hsp7_hs
ok 60 - hsp7_hstr
ok 61 - hsp7_qe
ok 62 - hsp7_qs
ok 63 - hsp7_qstr
ok 64 - hsp8_bits
ok 65 - hsp8_gaps
ok 66 - hsp8_he
ok 67 - hsp8_hs
ok 68 - hsp8_hstr
ok 69 - hsp8_qe
ok 70 - hsp8_qs
ok 71 - hsp8_qstr
ok 72 - query_name
ok 73 - The object isa Bio::Search::Result::ResultI
ok 74
ok 75
ok 76 - hit1_bits
ok 77 - hit1_name
ok 78 - hsp1_bits
ok 79 - hsp1_gaps
ok 80 - hsp1_he
ok 81 - hsp1_hs
ok 82 - hsp1_hstr
ok 83 - hsp1_qe
ok 84 - hsp1_qs
ok 85 - hsp1_qstr
ok 86 - hsp2_bits
ok 87 - hsp2_gaps
ok 88 - hsp2_he
ok 89 - hsp2_hs
ok 90 - hsp2_hstr
ok 91 - hsp2_qe
ok 92 - hsp2_qs
ok 93 - hsp2_qstr
ok 94 - hsp3_bits
ok 95 - hsp3_gaps
ok 96 - hsp3_he
ok 97 - hsp3_hs
ok 98 - hsp3_hstr
ok 99 - hsp3_qe
ok 100 - hsp3_qs
ok 101 - hsp3_qstr
ok 102 - hsp4_bits
ok 103 - hsp4_gaps
ok 104 - hsp4_he
ok 105 - hsp4_hs
ok 106 - hsp4_hstr
ok 107 - hsp4_qe
ok 108 - hsp4_qs
ok 109 - hsp4_qstr
ok 110 - hsp5_bits
ok 111 - hsp5_gaps
ok 112 - hsp5_he
ok 113 - hsp5_hs
ok 114 - hsp5_hstr
ok 115 - hsp5_qe
ok 116 - hsp5_qs
ok 117 - hsp5_qstr
ok 118 - hsp6_bits
ok 119 - hsp6_gaps
ok 120 - hsp6_he
ok 121 - hsp6_hs
ok 122 - hsp6_hstr
ok 123 - hsp6_qe
ok 124 - hsp6_qs
ok 125 - hsp6_qstr
ok 126 - hsp7_bits
ok 127 - hsp7_gaps
ok 128 - hsp7_he
ok 129 - hsp7_hs
ok 130 - hsp7_hstr
ok 131 - hsp7_qe
ok 132 - hsp7_qs
ok 133 - hsp7_qstr
ok 134 - hsp8_bits
ok 135 - hsp8_gaps
ok 136 - hsp8_he
ok 137 - hsp8_hs
ok 138 - hsp8_hstr
ok 139 - hsp8_qe
ok 140 - hsp8_qs
ok 141 - hsp8_qstr
ok 142 - query_name
ok 143
ok 144
ok 145
ok 146
ok 147 - hit score
ok 148 - hit raw_score
ok 149 - The object isa Bio::SeqFeatureI
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158 - The object isa Bio::SeqFeatureI
ok 159
ok 160
ok 161
ok 162 - The object isa Bio::SeqFeatureI
ok 163
ok 164
ok 165
ok
t/SearchIO/blastxml.t ........................
1..391
ok 1 - use Bio::SearchIO;
ok 2
ok 3 - The object isa Bio::Search::Result::ResultI
ok 4 - database_name()
ok 5 - query_name()
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - database_name()
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60 - query name on HSP
ok 61 - query desc on HSP
ok 62 - hitname
ok 63 - hitdesc
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90 - The object isa Bio::Search::Hit::HitI
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168 - query name on HSP
ok 169 - query desc on HSP
ok 170 - hitname
ok 171 - hitdesc
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214 - query name on HSP
ok 215 - query desc on HSP
ok 216 - hitname
ok 217 - hitdesc
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309
ok 310
ok 311
ok 312
ok 313
ok 314
ok 315
ok 316
ok 317
ok 318
ok 319
ok 320
ok 321
ok 322
ok 323
ok 324
ok 325
ok 326
ok 327
ok 328
ok 329
ok 330
ok 331
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339
ok 340
ok 341
ok 342
ok 343
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353
ok 354
ok 355
ok 356
ok 357
ok 358
ok 359
ok 360
ok 361
ok 362
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369
ok 370
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382
ok 383
ok 384
ok 385
ok 386
ok 387
ok 388
ok 389
ok 390
ok 391
ok
t/SearchIO/cross_match.t .....................
1..15
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
defined(@array) is deprecated at Bio/Search/Hit/ModelHit.pm line 355.
(Maybe you should just omit the defined()?)
t/SearchIO/erpin.t ...........................
1..91
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::Search::Result::ResultI
ok 3 - Result ERPIN
ok 4 - Result ERPIN reference
ok 5 - Result ERPIN version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_name
ok 16 - The object isa Bio::Search::Hit::HitI
ok 17 - Hit accession
ok 18 - Hit GI
ok 19 - Hit algorithm
ok 20 - Hit bits
ok 21 - Hit description
ok 22 - Hit length
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit overlap
ok 28 - Hit query_length
ok 29 - Hit rank
ok 30 - Hit raw_score
ok 31 - Hit score
ok 32
ok 33 - The object isa Bio::Search::HSP::HSPI
ok 34 - HSP algorithm
ok 35
ok 36 - The object isa Bio::SeqFeature::Similarity
ok 37 - The object isa Bio::SeqFeature::Similarity
ok 38 - HSP frame
ok 39 - HSP gaps
ok 40 - HSP hit isa Bio::SeqFeature::Similarity
ok 41 - HSP hit_string
ok 42 - HSP homology_string
ok 43 - HSP hsp_group
ok 44 - HSP hsp_length
ok 45 - HSP length
ok 46 - HSP links
ok 47 - HSP query isa Bio::SeqFeature::Similarity
ok 48 - HSP query_string
ok 49 - HSP range
ok 50 - HSP rank
ok 51
ok 52 - HSP expect
ok 53 - The object isa Bio::LocatableSeq
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58
ok 59
ok 60 - HSP strand
ok 61
ok 62
ok 63 - ERPIN get_aln warning
ok 64 - The object isa Bio::Search::HSP::HSPI
ok 65 - HSP algorithm
ok 66
ok 67 - The object isa Bio::SeqFeature::Similarity
ok 68 - The object isa Bio::SeqFeature::Similarity
ok 69 - HSP frame
ok 70 - HSP gaps
ok 71 - HSP hit isa Bio::SeqFeature::Similarity
ok 72 - HSP hit_string
ok 73 - HSP homology_string
ok 74 - HSP query_string
ok 75 - HSP hsp_group
ok 76 - HSP hsp_length
ok 77 - HSP length
ok 78 - HSP links
ok 79 - The object isa Bio::SeqFeature::Similarity
ok 80 - HSP range
ok 81 - HSP rank
ok 82
ok 83 - HSP end
ok 84 - HSP expect
ok 85 - The object isa Bio::LocatableSeq
ok 86 - HSP seq_str
ok 87 - HSP start
ok 88 - HSP custom_score
ok 89
ok 90
ok 91 - HSP strand
ok
t/SearchIO/exonerate.t .......................
1..51
ok 1 - use Bio::SearchIO;
ok 2
ok 3 # skip no query length available in default output
ok 4
ok 5 # skip no hit length available in default output
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 # skip no query length available in default output
ok 26
ok 27 # skip no hit length available in default output
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46 - query_name
ok 47
ok 48 - query_name
ok 49
ok 50 - query_name
ok 51
ok
t/SearchIO/fasta.t ...........................
1..299
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267 - TFASTXY
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286 - num_identical()
ok 287 - num_conserved()
ok 288 - bug 2937 and FASTA version 3.5
ok 289 - algorithm version
ok 290 - query name
ok 291 - query description
ok 292 - query length
ok 293 - algorithm
ok 294 - num_identical()
ok 295 - num_conserved()
ok 296 - hsp->strand(hit)
ok 297 - hsp->hit->strand
ok 298 - hsp->strand(query)
ok 299 - hsp->query->strand
ok
t/SearchIO/gmap_f9.t .........................
1..54
ok 1 - use Bio::SearchIO;
ok 2 - Did we get a Result? isa Bio::Search::Result::GenericResult
ok 3 - Did we get the expected number of hits?
ok 4 - Did we get the expected algorithm?
ok 5 - Did we get the expected query_name?
ok 6 - Did we get a Hit? isa Bio::Search::Hit::GenericHit
ok 7 - The object isa Bio::Search::Hit::HitI
ok 8 - Check the name
ok 9 - Check the hit length
ok 10 - Check the number of hsps
ok 11 - Check the query length
ok 12 - The object isa Bio::Search::HSP::HSPI
ok 13 - Check the algorithm
ok 14 - Count gaps in the query
ok 15 - Count gaps in the hit
ok 16 - Length of the query
ok 17 - Length of the hit
ok 18 - Query sequence
ok 19 - Hit sequence
ok 20 - Check query start
ok 21 - Check query end
ok 22 - Check query end
ok 23 - Check the homology string
ok 24 - Check seq_inds
ok 25 - Check hit start
ok 26 - Check hit end
ok 27 - Check hit end
ok 28 - Did we get a Result? isa Bio::Search::Result::GenericResult
ok 29 - Did we get the expected number of hits?
ok 30 - Did we get the expected algorithm?
ok 31 - Did we get the expected query_name?
ok 32 - The object isa Bio::Search::Hit::HitI
ok 33 - Check the name
ok 34 - Check the hit length
ok 35 - Check the number of hsps
ok 36 - Check the query length
ok 37 - The object isa Bio::Search::HSP::HSPI
ok 38 - Check the algorithm
ok 39 - Count gaps in the query
ok 40 - Count gaps in the hit
ok 41 - Length of the query
ok 42 - Length of the hit
ok 43 - Query sequence
ok 44 - Hit sequence
ok 45 - Check query start
ok 46 - Check query end
ok 47 - Check query end
ok 48 - Check the homology string
ok 49 - Check seq_inds
ok 50 - Check hit start
ok 51 - Check hit end
ok 52 - Check hit end
ok 53 - Can we loop over multiple results properly (expecting 58)?
ok 54 - simple query_name now caught, bug 3021
ok
t/SearchIO/hmmer.t ...........................
1..295
ok 1 - use Bio::SearchIO;
ok 2 - Check for the correct result reference type
ok 3 - Check algorithm
ok 4 - Check algorithm version
ok 5 - Check hmm_name
ok 6 - Check sequence_file
ok 7 - Check query_name
ok 8 - Check query_description
ok 9 - Check num_hits
ok 10 - Check hit name
ok 11 - Check hit raw_score
ok 12 - Check hit significance
ok 13 - Check for the correct hit reference type
ok 14 - Check num_hsps
ok 15 - Check for hit hmmfrom value
ok 16 - Check for hit hmm to value
ok 17 - Check for query alifrom value
ok 18 - Check for query ali to value
ok 19 - Check for hsp score
ok 20 - Check for hsp c-Evalue
ok 21 - Check for query string
ok 22 - Check for number of gaps in query
ok 23 - Check for hit string
ok 24 - Check for homology string
ok 25 - Check if homology string and hit string have an equal lenght
ok 26 - Check if query string and homology string have an equal lenght
ok 27 - Check for hit hmmfrom value
ok 28 - Check for hit hmm to value
ok 29 - Check for query alifrom value
ok 30 - Check for query ali to value
ok 31 - Check for hsp score
ok 32 - Check for hsp c-Evalue
ok 33 - Check for query string
ok 34 - Check for number of gaps in query
ok 35 - Check for hit string
ok 36 - Check for homology string
ok 37 - Check if homology string and hit string have an equal lenght
ok 38 - Check if query string and homology string have an equal lenght
ok 39 - Check for the correct result reference type
ok 40 - Check algorithm
ok 41 - Check algorithm version
ok 42 - Check hmm_name
ok 43 - Check sequence_file
ok 44 - Check database_name
ok 45 - Check query_name
ok 46 - Check query_description
ok 47 - Check num_hits
ok 48 - Check hit name
ok 49 - Check for hit description
ok 50 - Check hit significance
ok 51 - Check hit raw_score
ok 52 - Check for hsp score
ok 53 - Check for hsp c-Evalue
ok 54 - Check for query alifrom value
ok 55 - Check for query ali to value
ok 56 - Check for hit hmmfrom value
ok 57 - Check for hit hmm to value
ok 58 - Check for query seq_id
ok 59 - Check for hit seq_id
ok 60 - Check for the correct result reference type
ok 61 - Check algorithm
ok 62 - Check algorithm version
ok 63 - Check hmm_name
ok 64 - Check sequence_file
ok 65 - Check query_name
ok 66 - Check query_description
ok 67 - Check num_hits
ok 68 - Check hit name
ok 69 - Check for hit description
ok 70 - Check hit significance
ok 71 - Check hit raw_score
ok 72 - Check for hsp score
ok 73 - Check for hsp evalue
ok 74 - Check for query alifrom value
ok 75 - Check for query ali to value
ok 76 - Check for hit hmmfrom value
ok 77 - Check for hit hmm to value
ok 78 - Check for query seq_id
ok 79 - Check for hit seq_id
ok 80 - Check for hiy string
ok 81 - Check for query string
ok 82 - Check for homology string
ok 83 - Check for nomatch indices in query
ok 84 - Check for nomatch indices in hit
ok 85 - Check for gap indices in query
ok 86 - Check for gap indices in hit
ok 87 - Check for the correct result reference type
ok 88 - Check algorithm
ok 89 - Check algorithm version
ok 90 - Check hmm_name
ok 91 - Check database_name
ok 92 - Check sequence_file
ok 93 - Check query_name
ok 94 - Check query_accession
ok 95 - Check query_description
ok 96 - Check num_hits
ok 97 - Check hit name
ok 98 - Check for hit description
ok 99 - Check hit significance
ok 100 - Check hit raw_score
ok 101 - Check for hsp score
ok 102 - Check for hsp evalue
ok 103 - Check for query alifrom value
ok 104 - Check for query ali to value
ok 105 - Check for hit hmmfrom value
ok 106 - Check for hit hmm to value
ok 107 - Check for query seq_id
ok 108 - Check for hit seq_id
ok 109 - Check for hiy string
ok 110 - Check for homology string
ok 111 - Check for query string
ok 112 - Check hit name
ok 113 - Check for hit description
ok 114 - Check hit significance
ok 115 - Check hit raw_score
ok 116 - Check for hsp seq_str
ok 117 - Check for the correct result reference type
ok 118 - Check algorithm
ok 119 - Check algorithm version
ok 120 - Check hmm_name
ok 121 - Check sequence_file
ok 122 - Check query_name
ok 123 - Check query_length
ok 124 - Check query_description
ok 125 - Check num_hits
ok 126 - Check for the correct hit reference type
ok 127 - Check hit name
ok 128 - Check for hit description
ok 129 - Check hit raw_score
ok 130 - Check hit significance
ok 131 - Check num_hsps
ok 132 - Check for correct hsp reference type
ok 133 - Check for hit hmmfrom value
ok 134 - Check for hit hmm to value
ok 135 - Check for query alifrom value
ok 136 - Check for query ali to value
ok 137 - Check for hsp score
ok 138 - Check for hsp c-Evalue
ok 139 - Check for query string
ok 140 - Check for hit string
ok 141 - Check for homology string
ok 142 - Check for the correct result reference type
ok 143 - Check algorithm
ok 144 - Check algorithm version
ok 145 - Check hmm_name
ok 146 - Check sequence_file
ok 147 - Check query_name
ok 148 - Check query_length
ok 149 - Check query_description
ok 150 - Check num_hits
ok 151 - Check for the correct result reference type
ok 152 - Check algorithm
ok 153 - Check algorithm version
ok 154 - Check hmm_name
ok 155 - Check sequence_file
ok 156 - Check query_name
ok 157 - Check query_length
ok 158 - Check query_description
ok 159 - Check num_hits
ok 160 - Check for the correct hit reference type
ok 161 - Check hit name
ok 162 - Check for hit description
ok 163 - Check hit raw_score
ok 164 - Check hit significance
ok 165 - Check num_hsps
ok 166 - Check for correct hsp reference type
ok 167 - Check for hit envfrom value
ok 168 - Check for hit env to value
ok 169 - Check for query hmmfrom value
ok 170 - Check for query hmm to value
ok 171 - Check for hsp score
ok 172 - Check for hsp c-Evalue
ok 173 - Check for correct hsp reference type
ok 174 - Check for hit envfrom value
ok 175 - Check for hit env to value
ok 176 - Check for query hmmfrom value
ok 177 - Check for query hmm to value
ok 178 - Check for hsp score
ok 179 - Check for hsp c-Evalue
ok 180 - Check for correct hsp reference type
ok 181 - Check for hit envfrom value
ok 182 - Check for hit env to value
ok 183 - Check for query hmmfrom value
ok 184 - Check for query hmm to value
ok 185 - Check for hsp score
ok 186 - Check for hsp c-Evalue
ok 187 - Check for correct hsp reference type
ok 188 - Check for hit envfrom value
ok 189 - Check for hit env to value
ok 190 - Check for query hmmfrom value
ok 191 - Check for query hmm to value
ok 192 - Check for hsp score
ok 193 - Check for hsp c-Evalue
ok 194 - Check for correct hsp reference type
ok 195 - Check for hit envfrom value
ok 196 - Check for hit env to value
ok 197 - Check for query hmmfrom value
ok 198 - Check for query hmm to value
ok 199 - Check for hsp score
ok 200 - Check for hsp c-Evalue
ok 201 - Check for correct hsp reference type
ok 202 - Check for hit envfrom value
ok 203 - Check for hit env to value
ok 204 - Check for query hmmfrom value
ok 205 - Check for query hmm to value
ok 206 - Check for hsp score
ok 207 - Check for hsp c-Evalue
ok 208 - Check for the correct hit reference type
ok 209 - Check hit name
ok 210 - Check for hit description
ok 211 - Check hit raw_score
ok 212 - Check hit significance
ok 213 - Check num_hsps
ok 214 - Check for correct hsp reference type
ok 215 - Check for hit envfrom value
ok 216 - Check for hit env to value
ok 217 - Check for query hmmfrom value
ok 218 - Check for query hmm to value
ok 219 - Check for hsp score
ok 220 - Check for hsp c-Evalue
ok 221 - Check for correct hsp reference type
ok 222 - Check for hit envfrom value
ok 223 - Check for hit env to value
ok 224 - Check for query hmmfrom value
ok 225 - Check for query hmm to value
ok 226 - Check for hsp score
ok 227 - Check for hsp c-Evalue
ok 228 - Check for correct hsp reference type
ok 229 - Check for hit envfrom value
ok 230 - Check for hit env to value
ok 231 - Check for query hmmfrom value
ok 232 - Check for query hmm to value
ok 233 - Check for hsp score
ok 234 - Check for hsp c-Evalue
ok 235 - Check for the correct result reference type
ok 236 - Check algorithm
ok 237 - Check algorithm version
ok 238 - Check hmm_name
ok 239 - Check sequence_file
ok 240 - Check query_name
ok 241 - Check query_length
ok 242 - Check query_description
ok 243 - Check num_hits
ok 244 - Check for the correct hit reference type
ok 245 - Check hit name
ok 246 - Check for hit description
ok 247 - Check hit raw_score
ok 248 - Check hit significance
ok 249 - Check num_hsps
ok 250 - Check for correct hsp reference type
ok 251 - Check hit sequence
ok 252 - Check query sequence
ok 253 - Check for correct hsp reference type
ok 254 - Check hit sequence
ok 255 - Check query sequence
ok 256 - Check for the correct hit reference type
ok 257 - Check hit name
ok 258 - Check for hit description
ok 259 - Check hit raw_score
ok 260 - Check hit significance
ok 261 - Check num_hsps
ok 262 - Check for correct hsp reference type
ok 263 - Check hit sequence
ok 264 - Check query sequence
ok 265 - Check for correct hsp reference type
ok 266 - Check hit sequence
ok 267 - Check query sequence
ok 268 - Check for the correct hit reference type
ok 269 - Check hit name
ok 270 - Check for hit description
ok 271 - Check hit raw_score
ok 272 - Check hit significance
ok 273 - Check num_hsps
ok 274 - Check for correct hsp reference type
ok 275 - Check hit sequence
ok 276 - Check query sequence
ok 277 - Check for correct hsp reference type
ok 278 - Check hit sequence
ok 279 - Check query sequence
ok 280 - Check if loading hmmpfam output via the hmm2 parser directly works
ok 281 - Check for the correct result reference type
ok 282 - Check if loading hmmsearch2 output via the hmm2 parser directly works
ok 283 - Check for the correct result reference type
ok 284 - Check if loading hmmscan output via the hmm3 parser directly works
ok 285 - Check for the correct result reference type
ok 286 - Check if loading hmmsearch3 output via the hmm3 parser directly works
ok 287 - Check for the correct result reference type
ok 288 - Check if selecting the correct hmmpfam parser using -version works
ok 289 - Check for the correct result reference type
ok 290 - Check if selecting the correct hmmsearch2 parser using -version works
ok 291 - Check for the correct result reference type
ok 292 - Check if selecting the correct hmmscan parser using -version works
ok 293 - Check for the correct result reference type
ok 294 - Check if selecting the correct hmmsearch3 parser using -version works
ok 295 - Check for the correct result reference type
ok
t/SearchIO/hmmer_pull.t ......................
1..290
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133
ok 134
ok 135
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144
ok 145
ok 146
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155
ok 156
ok 157
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166
ok 167
ok 168
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177
ok 178
ok 179
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188
ok 189
ok 190
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199
ok 200
ok 201
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210
ok 211
ok 212
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221
ok 222
ok 223
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232
ok 233
ok 234
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243
ok 244
ok 245
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273
ok 274
ok 275
ok 276
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok
defined(@array) is deprecated at Bio/Search/Hit/ModelHit.pm line 355.
(Maybe you should just omit the defined()?)
t/SearchIO/infernal.t ........................
1..412
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::Search::Result::ResultI
ok 3 - Result
ok 4 - Result reference
ok 5 - Result version
ok 6 - Result parameters
ok 7 - Result statistics
ok 8 - Result entries
ok 9 - Result letters
ok 10 - Result database_name
ok 11 - Result num_hits
ok 12 - Result program_reference
ok 13 - Result query_accession
ok 14 - Result query_description
ok 15 - Result query_length
ok 16 - Result query_name
ok 17 - The object isa Bio::Search::Hit::HitI
ok 18 - Hit GI
ok 19 - Hit accession
ok 20 - Hit algorithm
ok 21 - Hit bits
ok 22 - Hit description
ok 23 - Hit locus
ok 24 - Hit n
ok 25 - Hit name
ok 26 - Hit num_hsps
ok 27 - Hit length_aln() not implemented
ok 28 - Hit num_unaligned_hit() not implemented
ok 29 - Hit num_unaligned_query() not implemented
ok 30 - Hit num_unaligned_sbjct() not implemented
ok 31 - Hit start not implemented
ok 32 - Hit end not implemented
ok 33 - Hit strand not implemented
ok 34 - Hit logical_length not implemented
ok 35 - Hit frac_aligned_hit not implemented
ok 36 - Hit frac_aligned_query not implemented
ok 37 - Hit frac_conserved not implemented
ok 38 - Hit frac_identical not implemented
ok 39 - Hit matches not implemented
ok 40 - Hit gaps not implemented
ok 41 - Hit frame not implemented
ok 42 - Hit range not implemented
ok 43 - Hit seq_inds not implemented
ok 44 - Hit length
ok 45 - Hit overlap
ok 46 - Hit query_length
ok 47 - Hit rank
ok 48 - Hit raw_score
ok 49 - Hit score
ok 50 - Hit p
ok 51
ok 52 - The object isa Bio::Search::HSP::HSPI
ok 53 - HSP algorithm
ok 54
ok 55 - The object isa Bio::SeqFeature::Similarity
ok 56 - The object isa Bio::SeqFeature::Similarity
ok 57
ok 58
ok 59 - HSP frame
ok 60 - HSP gaps
ok 61 - Hit length
ok 62 - The object isa Bio::Align::AlignI
ok 63 - HSP hit isa Bio::SeqFeature::Similarity
ok 64 - HSP hit_string
ok 65 - HSP homology_string
ok 66 - HSP hsp_group
ok 67 - HSP hsp_length
ok 68 - HSP length
ok 69 - HSP links
ok 70 - HSP n
ok 71 - HSP pvalue
ok 72 - HSP query isa Bio::SeqFeature::Similarity
ok 73 - HSP query_string
ok 74 - HSP range
ok 75 - HSP rank
ok 76
ok 77 - HSP end
ok 78 - HSP expect
ok 79 - HSP seq_inds not implemented
ok 80 - HSP matches not implemented
ok 81 - HSP frac_conserved not implemented
ok 82 - HSP frac_identical not implemented
ok 83 - HSP num_conserved not implemented
ok 84 - HSP num_identical not implemented
ok 85 - HSP percent_identity not implemented
ok 86 - HSP cigar_string not implemented
ok 87 - HSP cigar_string not implemented
ok 88 - The object isa Bio::LocatableSeq
ok 89 - HSP seq_str
ok 90 - HSP start
ok 91 - HSP custom_score
ok 92 - HSP meta
ok 93 - HSP strand
ok 94 - The object isa Bio::Search::HSP::HSPI
ok 95 - HSP algorithm
ok 96
ok 97 - The object isa Bio::SeqFeature::Similarity
ok 98 - The object isa Bio::SeqFeature::Similarity
ok 99 - HSP frame
ok 100 - HSP gaps
ok 101 - The object isa Bio::Align::AlignI
ok 102 - HSP hit isa Bio::SeqFeature::Similarity
ok 103 - HSP hit_string
ok 104 - HSP homology_string
ok 105 - HSP hsp_group
ok 106 - HSP hsp_length
ok 107 - HSP length
ok 108 - HSP links
ok 109 - HSP n
ok 110 - HSP pvalue
ok 111 - HSP query isa Bio::SeqFeature::Similarity
ok 112 - HSP query_string
ok 113 - HSP range
ok 114 - HSP rank
ok 115
ok 116 - HSP end
ok 117 - HSP expect
ok 118 - The object isa Bio::LocatableSeq
ok 119 - HSP seq_str
ok 120 - HSP start
ok 121 - HSP custom_score
ok 122 - HSP meta
ok 123 - HSP strand
ok 124 - The object isa Bio::Search::Result::ResultI
ok 125 - Result CMSEARCH
ok 126 - Result CMSEARCH reference
ok 127 - Result CMSEARCH version
ok 128 - Result parameters
ok 129 - Result statistics
ok 130 - Result entries
ok 131 - Result letters
ok 132 - Result database_name
ok 133 - Result num_hits
ok 134 - Result program_reference
ok 135 - Result query_accession
ok 136 - Result query_description
ok 137 - Result query_length
ok 138 - Result query_name
ok 139 - The object isa Bio::Search::Hit::HitI
ok 140 - Hit GI
ok 141 - Hit accession
ok 142 - Hit algorithm
ok 143 - Hit bits
ok 144 - Hit description
ok 145 - Hit locus
ok 146 - Hit n
ok 147 - Hit name
ok 148 - Hit num_hsps
ok 149 - No p values
ok 150 - Hit length
ok 151 - Hit overlap
ok 152 - Hit query_length
ok 153 - Hit rank
ok 154 - Hit raw_score
ok 155 - Hit score
ok 156
ok 157 - The object isa Bio::Search::HSP::HSPI
ok 158 - HSP algorithm
ok 159
ok 160 - The object isa Bio::SeqFeature::Similarity
ok 161 - The object isa Bio::SeqFeature::Similarity
ok 162
ok 163
ok 164 - HSP frame
ok 165 - HSP gaps
ok 166 - Hit length
ok 167 - The object isa Bio::Align::AlignI
ok 168 - HSP hit isa Bio::SeqFeature::Similarity
ok 169 - HSP hit_string
ok 170 - HSP homology_string
ok 171 - HSP hsp_group
ok 172 - HSP hsp_length
ok 173 - HSP length
ok 174 - HSP links
ok 175 - HSP n
ok 176 - HSP pvalue
ok 177 - HSP query isa Bio::SeqFeature::Similarity
ok 178 - HSP query_string
ok 179 - HSP range
ok 180 - HSP rank
ok 181
ok 182 - HSP end
ok 183 - HSP expect
ok 184 - The object isa Bio::LocatableSeq
ok 185 - HSP seq_str
ok 186 - HSP start
ok 187 - HSP custom_score
ok 188 - HSP meta
ok 189 - HSP strand
ok 190 - The object isa Bio::Search::HSP::HSPI
ok 191 - HSP algorithm
ok 192
ok 193 - The object isa Bio::SeqFeature::Similarity
ok 194 - The object isa Bio::SeqFeature::Similarity
ok 195 - HSP frame
ok 196 - HSP gaps
ok 197 - The object isa Bio::Align::AlignI
ok 198 - HSP hit isa Bio::SeqFeature::Similarity
ok 199 - HSP hit_string
ok 200 - HSP homology_string
ok 201 - HSP hsp_group
ok 202 - HSP hsp_length
ok 203 - HSP length
ok 204 - HSP links
ok 205 - HSP n
ok 206 - HSP pvalue
ok 207 - HSP query isa Bio::SeqFeature::Similarity
ok 208 - HSP query_string
ok 209 - HSP range
ok 210 - HSP rank
ok 211
ok 212 - HSP end
ok 213 - HSP expect
ok 214 - The object isa Bio::LocatableSeq
ok 215 - HSP seq_str
ok 216 - HSP start
ok 217 - HSP custom_score
ok 218 - HSP meta
ok 219 - HSP strand
ok 220 - The object isa Bio::Search::Hit::HitI
ok 221 - Hit accession
ok 222 - Hit GI
ok 223 - Hit algorithm
ok 224 - Hit bits
ok 225 - Hit description
ok 226 - Hit length
ok 227 - Hit locus
ok 228 - Hit n
ok 229 - Hit name
ok 230 - Hit num_hsps
ok 231 - Hit overlap
ok 232 - Hit query_length
ok 233 - Hit rank
ok 234 - Hit raw_score
ok 235 - Hit score
ok 236
ok 237 - The object isa Bio::Search::HSP::HSPI
ok 238 - HSP algorithm
ok 239
ok 240 - The object isa Bio::SeqFeature::Similarity
ok 241 - The object isa Bio::SeqFeature::Similarity
ok 242 - HSP frame
ok 243 - HSP gaps
ok 244 - The object isa Bio::Align::AlignI
ok 245 - HSP hit isa Bio::SeqFeature::Similarity
ok 246 - HSP hit_string
ok 247 - HSP homology_string
ok 248 - HSP hsp_group
ok 249 - HSP hsp_length
ok 250 - HSP length
ok 251 - HSP links
ok 252 - HSP n
ok 253 - HSP query isa Bio::SeqFeature::Similarity
ok 254 - HSP query_string
ok 255 - HSP range
ok 256 - HSP rank
ok 257
ok 258 - HSP end
ok 259 - HSP expect
ok 260 - The object isa Bio::LocatableSeq
ok 261 - HSP seq_str
ok 262 - HSP start
ok 263 - HSP custom_score
ok 264 - HSP meta
ok 265 - HSP strand
ok 266 - HSP meta gap bug
ok 267 - HSP meta
ok 268 - HSP meta
ok 269
ok 270
ok 271 - The object isa Bio::Search::Result::ResultI
ok 272 - Result CMSEARCH
ok 273 - Result CMSEARCH reference
ok 274 - Result CMSEARCH version
ok 275 - Result parameters
ok 276 - Result statistics
ok 277 - Result entries
ok 278 - Result letters
ok 279 - Result database_name
ok 280 - Result num_hits
ok 281 - Result program_reference
ok 282 - Result query_accession
ok 283 - Result query_description
ok 284 - Result query_length
ok 285 - Result query_name
ok 286 - The object isa Bio::Search::Hit::HitI
ok 287 - Hit GI
ok 288 - Hit accession
ok 289 - Hit algorithm
ok 290 - Hit bits
ok 291 - Hit description
ok 292 - Hit locus
ok 293 - Hit n
ok 294 - Hit name
ok 295 - Hit num_hsps
ok 296 - No p values
ok 297 - Hit length
ok 298 - Hit overlap
ok 299 - Hit query_length
ok 300 - Hit rank
ok 301 - Hit raw_score
ok 302 - Hit score
ok 303
ok 304 - The object isa Bio::Search::HSP::HSPI
ok 305 - HSP algorithm
ok 306
ok 307 - The object isa Bio::SeqFeature::Similarity
ok 308 - The object isa Bio::SeqFeature::Similarity
ok 309
ok 310
ok 311 - HSP frame
ok 312 - HSP gaps
ok 313 - Hit length
ok 314 - The object isa Bio::Align::AlignI
ok 315 - HSP hit isa Bio::SeqFeature::Similarity
ok 316 - HSP hit_string
ok 317 - HSP homology_string
ok 318 - HSP hsp_group
ok 319 - HSP hsp_length
ok 320 - HSP length
ok 321 - HSP links
ok 322 - HSP n
ok 323 - HSP pvalue
ok 324 - HSP query isa Bio::SeqFeature::Similarity
ok 325 - HSP query_string
ok 326 - HSP range
ok 327 - HSP rank
ok 328
ok 329 - HSP end
ok 330 - HSP expect
ok 331 - The object isa Bio::LocatableSeq
ok 332 - HSP seq_str
ok 333 - HSP start
ok 334 - HSP custom_score
ok 335 - HSP meta
ok 336 - HSP strand
ok 337 - The object isa Bio::Search::HSP::HSPI
ok 338 - HSP algorithm
ok 339
ok 340 - The object isa Bio::SeqFeature::Similarity
ok 341 - The object isa Bio::SeqFeature::Similarity
ok 342 - HSP frame
ok 343 - HSP gaps
ok 344 - The object isa Bio::Align::AlignI
ok 345 - HSP hit isa Bio::SeqFeature::Similarity
ok 346 - HSP hit_string
ok 347 - HSP homology_string
ok 348 - HSP hsp_group
ok 349 - HSP hsp_length
ok 350 - HSP length
ok 351 - HSP links
ok 352 - HSP n
ok 353 - HSP pvalue
ok 354 - HSP query isa Bio::SeqFeature::Similarity
ok 355 - HSP query_string
ok 356 - HSP range
ok 357 - HSP rank
ok 358
ok 359 - HSP end
ok 360 - HSP expect
ok 361 - The object isa Bio::LocatableSeq
ok 362 - HSP seq_str
ok 363 - HSP start
ok 364 - HSP custom_score
ok 365 - HSP meta
ok 366 - HSP strand
ok 367 - The object isa Bio::Search::Hit::HitI
ok 368 - Hit accession
ok 369 - Hit GI
ok 370 - Hit algorithm
ok 371 - Hit bits
ok 372 - Hit description
ok 373 - Hit length
ok 374 - Hit locus
ok 375 - Hit n
ok 376 - Hit name
ok 377 - Hit num_hsps
ok 378 - Hit overlap
ok 379 - Hit query_length
ok 380 - Hit rank
ok 381 - Hit raw_score
ok 382 - Hit score
ok 383
ok 384 - The object isa Bio::Search::HSP::HSPI
ok 385 - HSP algorithm
ok 386
ok 387 - The object isa Bio::SeqFeature::Similarity
ok 388 - The object isa Bio::SeqFeature::Similarity
ok 389 - HSP frame
ok 390 - HSP gaps
ok 391 - The object isa Bio::Align::AlignI
ok 392 - HSP hit isa Bio::SeqFeature::Similarity
ok 393 - HSP hit_string
ok 394 - HSP homology_string
ok 395 - HSP hsp_group
ok 396 - HSP hsp_length
ok 397 - HSP length
ok 398 - HSP links
ok 399 - HSP n
ok 400 - HSP query isa Bio::SeqFeature::Similarity
ok 401 - HSP query_string
ok 402 - HSP range
ok 403 - HSP rank
ok 404
ok 405 - HSP end
ok 406 - HSP expect
ok 407 - The object isa Bio::LocatableSeq
ok 408 - HSP seq_str
ok 409 - HSP start
ok 410 - HSP custom_score
ok 411 - HSP meta
ok 412 - HSP strand
ok
t/SearchIO/megablast.t .......................
1..31
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok
t/SearchIO/psl.t .............................
1..53
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50 - next_hsp should be undef
ok 51 - next_hit should be undef
not ok 52 - next_result should be undef # TODO next_result should really return undef, not empty string
# Failed (TODO) test 'next_result should be undef'
# at t/SearchIO/psl.t line 97.
# got: ''
# expected: undef
ok 53
ok
defined(@array) is deprecated at Bio/Search/Hit/ModelHit.pm line 355.
(Maybe you should just omit the defined()?)
t/SearchIO/rnamotif.t ........................
1..60
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::Search::Result::ResultI
ok 3 - Result RNAMOTIF
ok 4 - Result RNAMOTIF reference
ok 5 - Result RNAMOTIF version
ok 6 - Result entries
ok 7 - Result letters
ok 8 - Result database_name
ok 9 - Result num_hits
ok 10 - Result program_reference
ok 11 - Result query_accession
ok 12 - Result query_description
ok 13 - Result query_length
ok 14 - Result query_name
ok 15 - The object isa Bio::Search::Hit::HitI
ok 16 - Hit accession
ok 17 - Hit GI
ok 18 - Hit algorithm
ok 19 - Hit description
ok 20 - Hit length
ok 21 - Hit locus
ok 22 - Hit n
ok 23 - Hit name
ok 24 - Hit num_hsps
ok 25 - Hit overlap
ok 26 - Hit rank
ok 27 - Hit raw_score
ok 28 - Hit score
ok 29
ok 30 - The object isa Bio::Search::HSP::HSPI
ok 31 - HSP algorithm
ok 32
ok 33 - The object isa Bio::SeqFeature::Similarity
ok 34 - The object isa Bio::SeqFeature::Similarity
ok 35 - HSP frame
ok 36 - HSP gaps
ok 37 - RNAMotif get_aln warning
ok 38 - HSP hit isa Bio::SeqFeature::Similarity
ok 39 - HSP hit_string
ok 40 - HSP homology_string
ok 41 - HSP hsp_group
ok 42 - HSP hsp_length
ok 43 - HSP length
ok 44 - HSP links
ok 45 - HSP n
ok 46 - HSP query isa Bio::SeqFeature::Similarity
ok 47 - HSP query_string
ok 48 - HSP range
ok 49 - HSP rank
ok 50
ok 51 - HSP end
ok 52 - HSP expect
ok 53 - The object isa Bio::LocatableSeq
ok 54 - HSP seq_str
ok 55 - HSP start
ok 56 - HSP custom_score
ok 57 - HSP meta
ok 58 - HSP strand
ok 59
ok 60
ok
t/SearchIO/sim4.t ............................
1..102
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok
t/SearchIO/waba.t ............................
1..64
ok 1 - use Bio::SearchIO;
ok 2 - The object isa Bio::SearchIO
ok 3 - query_name
ok 4 - query database
ok 5 - database name
ok 6 - name
ok 7 - hsps
ok 8 - total length
ok 9 - start
ok 10 - end
ok 11 - strand
ok 12 - start
ok 13 - end
ok 14 - strand
ok 15 - query string
ok 16 - hit_string
ok 17 - hmmstate string
ok 18
ok 19
ok 20
ok 21 - total length
ok 22 - start
ok 23 - end
ok 24 - strand
ok 25 - start
ok 26 - end
ok 27 - strand
ok 28 - query string
ok 29 - hit_string
ok 30 - hmmstate string
ok 31
ok 32
ok 33
ok 34 - total length
ok 35 - start
ok 36 - end
ok 37 - strand
ok 38 - start
ok 39 - end
ok 40 - strand
ok 41 - query string
ok 42 - hit_string
ok 43 - hmmstate string
ok 44
ok 45
ok 46
ok 47 - query_name
ok 48 - query database
ok 49 - database name
ok 50 - name
ok 51 - hsps
ok 52 - total length
ok 53 - start
ok 54 - end
ok 55 - strand
ok 56 - start
ok 57 - end
ok 58 - strand
ok 59 - query string
ok 60 - hit_string
ok 61 - hmmstate string
ok 62
ok 63
ok 64
ok
t/SearchIO/wise.t ............................
1..20
ok 1 - use Bio::SearchIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok
t/Seq/DBLink.t ...............................
1..131
ok 1 - use Bio::SeqIO;
ok 2 - "swissprot:K1C9_HUMAN"
ok 3 - no double colon
ok 4 - no trailing colon
ok 5 - no double space
ok 6 - dblink value is splittable
ok 7 - "GenBank:Z29074.1"
ok 8 - no double colon
ok 9 - no trailing colon
ok 10 - no double space
ok 11 - dblink value is splittable
ok 12 - "GenPept:CAA82315.1"
ok 13 - no double colon
ok 14 - no trailing colon
ok 15 - no double space
ok 16 - dblink value is splittable
ok 17 - "GenBank:S69510.1"
ok 18 - no double colon
ok 19 - no trailing colon
ok 20 - no double space
ok 21 - dblink value is splittable
ok 22 - "GenPept:AAC60619.1"
ok 23 - no double colon
ok 24 - no trailing colon
ok 25 - no double space
ok 26 - dblink value is splittable
ok 27 - "GenBank:X75015.1"
ok 28 - no double colon
ok 29 - no trailing colon
ok 30 - no double space
ok 31 - dblink value is splittable
ok 32 - "GenPept:CAA52924.1"
ok 33 - no double colon
ok 34 - no trailing colon
ok 35 - no double space
ok 36 - dblink value is splittable
ok 37 - "GenBank:AB001594.1"
ok 38 - no double colon
ok 39 - no trailing colon
ok 40 - no double space
ok 41 - dblink value is splittable
ok 42 - "GenPept:BAA19418.1"
ok 43 - no double colon
ok 44 - no trailing colon
ok 45 - no double space
ok 46 - dblink value is splittable
ok 47 - "GenBank:I37984"
ok 48 - no double colon
ok 49 - no trailing colon
ok 50 - no double space
ok 51 - dblink value is splittable
ok 52 - "HSSP:P08670"
ok 53 - no double colon
ok 54 - no trailing colon
ok 55 - no double space
ok 56 - dblink value is splittable
ok 57 - "IntAct:P35527"
ok 58 - no double colon
ok 59 - no trailing colon
ok 60 - no double space
ok 61 - dblink value is splittable
ok 62 - "Ensembl:ENSG00000171403"
ok 63 - no double colon
ok 64 - no trailing colon
ok 65 - no double space
ok 66 - dblink value is splittable
ok 67 - "KEGG:hsa:3857"
ok 68 - no double colon
ok 69 - no trailing colon
ok 70 - no double space
ok 71 - dblink value is splittable
ok 72 - "HGNC:6447"
ok 73 - no double colon
ok 74 - no trailing colon
ok 75 - no double space
ok 76 - dblink value is splittable
ok 77 - "MIM:144200"
ok 78 - no double colon
ok 79 - no trailing colon
ok 80 - no double space
ok 81 - dblink value is splittable
ok 82 - "MIM:607606"
ok 83 - no double colon
ok 84 - no trailing colon
ok 85 - no double space
ok 86 - dblink value is splittable
ok 87 - "ArrayExpress:P35527"
ok 88 - no double colon
ok 89 - no trailing colon
ok 90 - no double space
ok 91 - dblink value is splittable
ok 92 - "GO:0005200"
ok 93 - no double colon
ok 94 - no trailing colon
ok 95 - no double space
ok 96 - dblink value is splittable
ok 97 - "GO:0008544"
ok 98 - no double colon
ok 99 - no trailing colon
ok 100 - no double space
ok 101 - dblink value is splittable
ok 102 - "InterPro:IPR011000"
ok 103 - no double colon
ok 104 - no trailing colon
ok 105 - no double space
ok 106 - dblink value is splittable
ok 107 - "InterPro:IPR001664"
ok 108 - no double colon
ok 109 - no trailing colon
ok 110 - no double space
ok 111 - dblink value is splittable
ok 112 - "InterPro:IPR002957"
ok 113 - no double colon
ok 114 - no trailing colon
ok 115 - no double space
ok 116 - dblink value is splittable
ok 117 - "Pfam:PF00038"
ok 118 - no double colon
ok 119 - no trailing colon
ok 120 - no double space
ok 121 - dblink value is splittable
ok 122 - "PRINTS:PR01248"
ok 123 - no double colon
ok 124 - no trailing colon
ok 125 - no double space
ok 126 - dblink value is splittable
ok 127 - "PROSITE:PS00226"
ok 128 - no double colon
ok 129 - no trailing colon
ok 130 - no double space
ok 131 - dblink value is splittable
ok
t/Seq/EncodedSeq.t ...........................
1..37
ok 1 - use Bio::Seq::EncodedSeq;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - The object isa Bio::Location::Simple
ok 12
ok 13
ok 14 - The object isa Bio::Location::Simple
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok
t/Seq/LargeLocatableSeq.t ....................
1..8
ok 1 - use Bio::Seq::LargeLocatableSeq;
ok 2
ok 3 - The object isa Bio::Seq::LargeSeqI
ok 4
ok 5
ok 6
ok 7
ok 8
ok
t/Seq/LargePSeq.t ............................
1..30
ok 1 - use Bio::Seq::LargePrimarySeq;
ok 2 - use Bio::Seq::LargeSeq;
ok 3 - use Bio::Location::Simple;
ok 4 - use Bio::Location::Fuzzy;
ok 5 - use Bio::Location::Split;
ok 6 - use Bio::SeqIO;
ok 7
ok 8
ok 9 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 10 - Subseq is GGGGT
ok 11
ok 12
ok 13
ok 14 - trunc seq was GGGGTGAA
ok 15
ok 16
ok 17
ok 18 - Sequence is ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT
ok 19
ok 20 - output via Bio::SeqIO::fasta
ok 21 - Subseq is GGGGT
ok 22 - trunc seq was GGGGTGAA
ok 23
ok 24
ok 25
ok 26 - Sequence is ATGGGGTGGGGT
ok 27 - Subseq is GGGGT
ok 28 - trunc seq was GGGGT
ok 29
ok 30
ok
t/Seq/LocatableSeq.t .........................
1..118
ok 1 - use Bio::LocatableSeq;
ok 2 - use Bio::AlignIO;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - The object isa Bio::Location::Simple
ok 13
ok 14
ok 15 - The object isa Bio::Location::Simple
ok 16
ok 17
ok 18
ok 19
not ok 20 # TODO Need to fix columns before start of seq w/ start > 1
# Failed (TODO) test at t/Seq/LocatableSeq.t line 45.
# got: 'Bio::Location::Simple=HASH(0x819f848)'
# expected: undef
ok 21
ok 22 - The object isa Bio::AlignIO
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49 - The object isa Bio::Location::Simple
ok 50
ok 51
ok 52 - The object isa Bio::Location::Simple
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105 - * is counted in length
ok 106 - * is counted in length, but end is wrong
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
not ok 117 # TODO Bio::LocatableSeq global variables have scoping issues
# Failed (TODO) test at t/Seq/LocatableSeq.t line 301.
# got: '\-\.=~'
# expected: '-\?'
not ok 118 # TODO Bio::LocatableSeq global variables have scoping issues
# Failed (TODO) test at t/Seq/LocatableSeq.t line 303.
# got: '19'
# expected: anything else
ok
t/Seq/MetaSeq.t ..............................
1..128
ok 1 - use Bio::Seq::Meta;
ok 2 - use Bio::Seq::Meta::Array;
ok 3 - use Bio::SeqIO;
ok 4 - use Bio::AlignIO;
ok 5 - use Bio::Seq::Quality;
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - aa-bb bb
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok 102
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122
ok 123
ok 124
ok 125
ok 126
ok 127
ok 128
ok
t/Seq/PrimaryQual.t ..........................
1..35
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::Quality;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok
t/Seq/PrimarySeq.t ...........................
1..87
ok 1 - use Bio::PrimarySeq;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::Location::Split;
ok 5
ok 6 - The object isa Bio::PrimarySeqI
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14 - The object isa Bio::IdentifiableI
ok 15 - The object isa Bio::DescribableI
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29 - The object isa Bio::PrimarySeqI
ok 30
ok 31 - The object isa Bio::PrimarySeqI
ok 32
ok 33 - The object isa Bio::PrimarySeqI
ok 34
ok 35 - The object isa Bio::PrimarySeqI
ok 36
ok 37
ok 38 - alphabet copied through revcom
not ok 39 - namespace copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms
# Failed (TODO) test 'namespace copied through revcom'
# at t/Seq/PrimarySeq.t line 110.
# got: ''
# expected: 't'
not ok 40 - namespace_string copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms
# Failed (TODO) test 'namespace_string copied through revcom'
# at t/Seq/PrimarySeq.t line 111.
# got: ':X677667'
# expected: 't:X677667.47'
not ok 41 - is_circular copied through revcom # TODO all attributes of primaryseqs are not currently copied through revcoms
# Failed (TODO) test 'is_circular copied through revcom'
# at t/Seq/PrimarySeq.t line 113.
# got: undef
# expected: '0'
ok 42 - Translation: LVAST
ok 43 - Translation: MVAST
ok 44 - Translation: MVAST
ok 45 - Translation: MVAST*
ok 46 - Translation: M*
ok 47 - Translation: M
ok 48
ok 49 - Translation: MWP
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60 - Alphabet
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77 - Bug 2438
ok 78
ok 79 - Bug \#2864
ok 80 - Terminator + inside sequence
ok 81
ok 82 - _find_orfs 1
ok 83 - orfs are sorted by descending length
ok 84 - got correct -orf => "longest" seq
ok 85 - _find_orfs 1
ok 86 - orfs are sorted by descending length
ok 87 - got correct -orf => "longest" seq
ok
t/Seq/PrimedSeq.t ............................
1..10
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::Seq::PrimedSeq;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok
t/Seq/Quality.t ..............................
1..85
ok 1 - use Bio::Seq::Quality;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bug 2845
ok 73
ok 74 - Bug 2845
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok
t/Seq/Seq.t ..................................
1..72
ok 1 - use Bio::Seq;
ok 2 - use Bio::Seq::RichSeq;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::Species;
ok 5 - use Bio::Annotation::SimpleValue;
ok 6
ok 7
ok 8
ok 9
ok 10 - truncated sequence length
ok 11 - truncated sequence string
ok 12
ok 13
ok 14 - alphabet
ok 15 - id
ok 16 - accession number
ok 17 - subseq
ok 18 - The object isa Bio::IdentifiableI
ok 19 - The object isa Bio::DescribableI
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33 - translated sequence
ok 34 - translated sequence with explicit unambiguous codons
ok 35 - translated sequence with unknown unambiguous codons
ok 36 - translated sequence with unknown unambiguous codons, completed
ok 37 - translated sequence with unambiguous codons
ok 38 - translated sequence with unambiguous codons
ok 39 - translated sequence with unknown unambiguous codons, completed
ok 40 - translated sequence with unambiguous codons
ok 41 - translated sequence with unknown unambiguous codons, completed
ok 42 - translated sequence with stop
ok 43 - translated sequence
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64 - Bug \#2864
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok
t/Seq/WithQuality.t ..........................
1..22
ok 1 - use Bio::Seq::SeqWithQuality;
ok 2 - use Bio::PrimarySeq;
ok 3 - use Bio::Seq::PrimaryQual;
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - The object isa Bio::Seq::PrimaryQual
ok 20 - The object isa Bio::PrimarySeq
ok 21
ok 22
ok
t/SeqEvolution.t .............................
1..39
ok 1 - use Bio::SeqEvolution::Factory;
ok 2 - use Bio::PrimarySeq;
ok 3
ok 4 - The object isa Bio::SeqEvolution::DNAPoint
ok 5
ok 6 - The object isa Bio::SeqEvolution::DNAPoint
ok 7
ok 8 - The object isa Bio::SeqEvolution::DNAPoint
ok 9
ok 10
ok 11 - get rate()
ok 12 - get and set rate()
ok 13 - identity()
ok 14 - identity()
ok 15 - pam()
ok 16 - pam()
ok 17 - mutation_count()
ok 18 - mutation_count()
ok 19 - seq_type()
ok 20 - seq_type()
ok 21 - next_seq()
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27 - each_mutation()
ok 28
ok 29
ok 30 - get_alignment_identity()
ok 31
ok 32
ok 33 - get_mutation_counter()
ok 34 - get_sequence_counter()
ok 35 - reset_sequence_counter()
ok 36 - get_sequence_counter() == 0
ok 37
ok 38
ok 39 - The object isa Bio::SimpleAlign
ok
t/SeqFeature/Clone.t .........................
1..17
ok 1 - clone()
ok 2 - start() clone set
ok 3 - start() clone get
ok 4 - start() original unchanged
ok 5 - clone() with arguments
ok 6 - start() orig get
ok 7 - end() orig get
ok 8 - start() clone get
ok 9 - end() clone get
ok 10 - start() clone set
ok 11 - start() clone get
ok 12 - start() original unchanged
ok 13 - location() Bio::Location::Split
ok 14 - clone()
ok 15 - start() clone set
ok 16 - start() clone get
ok 17 - start() original unchanged
ok
defined(@array) is deprecated at Bio/FeatureIO/gff.pm line 843.
(Maybe you should just omit the defined()?)
t/SeqFeature/FeatureIO.t .....................
1..47
ok 1 - use Bio::FeatureIO;
ok 2
ok 3
not ok 4 # TODO How did this ever work?!?
# Failed (TODO) test at t/SeqFeature/FeatureIO.t line 43.
# got: 'TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC'
# expected: 'Test1'
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
not ok 13 # TODO How did this ever work?!?
# Failed (TODO) test at t/SeqFeature/FeatureIO.t line 103.
# got: 'GATTACAGATTACA'
# expected: 'Test1'
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
not ok 24 # TODO How did this ever work?!?
# Failed (TODO) test at t/SeqFeature/FeatureIO.t line 173.
# got: 'GATTACAGATTACA'
# expected: 'Test1'
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - vecscreen_simple gets the correct features
ok 46
ok 47
ok
t/SeqFeature/Location.t ......................
1..103
ok 1 - use Bio::Location::Simple;
ok 2 - use Bio::Location::Split;
ok 3 - use Bio::Location::Fuzzy;
ok 4 - use Bio::SeqFeature::Generic;
ok 5 - use Bio::SeqFeature::SimilarityPair;
ok 6 - use Bio::SeqFeature::FeaturePair;
ok 7 - The object isa Bio::LocationI
ok 8 - The object isa Bio::RangeI
ok 9 - Bio::Location::Simple tests
ok 10
ok 11
ok 12
ok 13
ok 14 - Bio::SeqFeature::Generic isa Bio::SeqFeatureI
ok 15 - The object isa Bio::RangeI
ok 16
ok 17
ok 18 - Bio::SeqFeature::FeaturePair tests
ok 19
ok 20
ok 21
ok 22 - Bio::SeqFeature::Generic tests
ok 23
ok 24 - Bio::Location::Fuzzy tests
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38 - Bio::Location::Split tests
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55 - Bugfix 1074
ok 56
ok 57
ok 58
ok 59 - Positive length
ok 60
ok 61 - seq_id() on Bio::Location::Split
ok 62
ok 63
ok 64 - The object isa Bio::LocationI
ok 65 - The object isa Bio::RangeI
ok 66 - Bio::Location::Simple EXACT
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72 - Bio::Location::Simple IN-BETWEEN
ok 73
ok 74
ok 75
ok 76
ok 77 - Testing error handling
ok 78
ok 79
ok 80
ok 81 - use Bio::Location::WidestCoordPolicy;
ok 82 - use Bio::Location::NarrowestCoordPolicy;
ok 83 - use Bio::Location::AvWithinCoordPolicy;
ok 84 - Default coodinate policy
ok 85
ok 86
ok 87
ok 88 - The object isa Bio::Location::WidestCoordPolicy
ok 89 - Narrowest coodinate policy
ok 90
ok 91
ok 92
ok 93 - The object isa Bio::Location::NarrowestCoordPolicy
ok 94 - Average coodinate policy
ok 95
ok 96
ok 97
ok 98 - The object isa Bio::Location::AvWithinCoordPolicy
ok 99 - Widest coodinate policy
ok 100
ok 101
ok 102
ok 103 - The object isa Bio::Location::WidestCoordPolicy
ok
t/SeqFeature/LocationFactory.t ...............
1..272
ok 1 - use Bio::Factory::FTLocationFactory;
ok 2 - The object isa Bio::Factory::LocationFactoryI
ok 3 - Bio::Location::Simple
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12 - Location String: J00194:100..202
ok 13
ok 14 - Bio::Location::Fuzzy
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23 - Location String: 1..?
ok 24
ok 25 - Bio::Location::Fuzzy
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34 - Location String: (122.133)..(204.221)
ok 35
ok 36 - Bio::Location::Fuzzy
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - Location String: (102.110)
ok 46
ok 47 - Bio::Location::Simple
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56 - Location String: 340..565
ok 57
ok 58 - Bio::Location::Split
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - Location String: join(12..78,134..202)
ok 68
ok 69 - Bio::Location::Fuzzy
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78 - Location String: ?..?
ok 79
ok 80 - Bio::Location::Fuzzy
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89 - Location String: <345..500
ok 90
ok 91 - Bio::Location::Fuzzy
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100 - Location String: ?22..?64
ok 101
ok 102 - Bio::Location::Simple
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111 - Location String: J00194:100..202
ok 112
ok 113 - Bio::Location::Simple
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120
ok 121
ok 122 - Location String: 467
ok 123
ok 124 - Bio::Location::Fuzzy
ok 125
ok 126
ok 127
ok 128
ok 129
ok 130
ok 131
ok 132
ok 133 - Location String: (23.45)..600
ok 134
ok 135 - Bio::Location::Simple
ok 136
ok 137
ok 138
ok 139
ok 140
ok 141
ok 142
ok 143
ok 144 - Location String: 123^124
ok 145
ok 146 - Bio::Location::Fuzzy
ok 147
ok 148
ok 149
ok 150
ok 151
ok 152
ok 153
ok 154
ok 155 - Location String: <1..?
ok 156
ok 157 - Bio::Location::Fuzzy
ok 158
ok 159
ok 160
ok 161
ok 162
ok 163
ok 164
ok 165
ok 166 - Location String: 145^177
ok 167
ok 168 - Bio::Location::Fuzzy
ok 169
ok 170
ok 171
ok 172
ok 173
ok 174
ok 175
ok 176
ok 177 - Location String: 22..?64
ok 178
ok 179 - Bio::Location::Fuzzy
ok 180
ok 181
ok 182
ok 183
ok 184
ok 185
ok 186
ok 187
ok 188 - Location String: complement(34..(122.126))
ok 189
ok 190 - Bio::Location::Split
ok 191
ok 192
ok 193
ok 194
ok 195
ok 196
ok 197
ok 198
ok 199 - Location String: complement(join(4918..5163,2691..4571))
ok 200
ok 201 - Bio::Location::Split
ok 202
ok 203
ok 204
ok 205
ok 206
ok 207
ok 208
ok 209
ok 210 - Location String: join(AY016290.1:108..185,AY016291.1:1546..1599)
ok 211
ok 212 - Bio::Location::Fuzzy
ok 213
ok 214
ok 215
ok 216
ok 217
ok 218
ok 219
ok 220
ok 221 - Location String: ?..>393
ok 222
ok 223 - Bio::Location::Fuzzy
ok 224
ok 225
ok 226
ok 227
ok 228
ok 229
ok 230
ok 231
ok 232 - Location String: ?2465..2774
ok 233
ok 234 - Bio::Location::Fuzzy
ok 235
ok 236
ok 237
ok 238
ok 239
ok 240
ok 241
ok 242
ok 243 - Location String: (122.133)..(204.221)
ok 244
ok 245 - Bio::Location::Fuzzy
ok 246
ok 247
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254 - Location String: ?..536
ok 255
ok 256 - Bio::Location::Fuzzy
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265 - Location String: <1..888
ok 266
ok 267 - join(11025..11049,join(complement(239890..240081),complement(241499..241580),complement(251354..251412),complement(315036..315294)))
ok 268 - join(11025..11049,complement(join(315036..315294,251354..251412,241499..241580,239890..240081)))
ok 269 - join(20464..20694,21548..22763,complement(join(314652..314672,232596..232990,231520..231669)))
ok 270 - join(20464..20694,21548..22763,join(complement(231520..231669),complement(232596..232990),complement(314652..314672)))
ok 271 - join(1000..2000,join(3000..4000,join(5000..6000,7000..8000)),9000..10000)
ok 272 - order(S67862.1:72..75,join(S67863.1:1..788,1..19))
ok
t/SeqFeature/Primer.t ........................
1..18
ok 1 - use Bio::SeqFeature::Primer;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok
t/SeqFeature/Range.t .........................
1..49
ok 1 - use Bio::Range;
ok 2 - BioRange object isa Bio::Range
ok 3
ok 4 - BioRange object isa Bio::Range
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15 - BioRange object isa Bio::Range
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - BioRange object isa Bio::Range
ok 26 - BioRange object isa Bio::Range
ok 27 - BioRange object isa Bio::Range
ok 28 - 1 & -1
ok 29 - 1 & 1 true
ok 30 - 1 & 0 true
ok 31 - 1 & -1 false
ok 32 - 1 & 1 true
ok 33 - 1 & 0 false
ok 34 - 1 & -1 false
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45 - Bio::Range object isa Bio::Range
ok 46
ok 47
ok 48
ok 49
ok
t/SeqFeature/RangeI.t ........................
1..45
ok 1 - use Bio::SeqFeature::Generic;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39 - subtract() of split features
ok 40 - 0 start
ok 41 - 0 end
ok 42 - 1 start
ok 43 - 1 end
ok 44 - 2 start
ok 45 - 2 end
ok
t/SeqFeature/SeqAnalysisParser.t .............
1..14
ok 1 - use Bio::Factory::SeqAnalysisParserFactory;
ok 2 - use Bio::SeqIO;
ok 3 - The object isa Bio::SeqIO
ok 4 - The object isa Bio::PrimarySeqI
ok 5 - The object isa Bio::SeqAnalysisParserI
ok 6
ok 7
ok 8
ok 9 - The object isa Bio::PrimarySeqI
ok 10 - The object isa Bio::SeqAnalysisParserI
ok 11
ok 12
ok 13 - The object isa Bio::SeqAnalysisParserI
ok 14
ok
t/SeqFeature/SeqFeatAnnotated.t .............. skipped: Network tests have not been requested
Bareword found where operator expected at (eval 20) line 2, near "'The optional module DB_File generated the following error:
Can't"
(Might be a runaway multi-line '' string starting on line 1)
(Missing operator before t?)
Having no space between pattern and following word is deprecated at (eval 20) line 2.
Bareword found where operator expected at (eval 20) line 3, near "68.
at"
(Missing operator before at?)
Bareword found where operator expected at (eval 20) line 4, near "258.
Compilation"
(Missing operator before Compilation?)
Bareword found where operator expected at (eval 20) line 4, near ") line"
(Missing operator before line?)
Number found where operator expected at (eval 20) line 4, near "line 1."
(Do you need to predeclare line?)
String found where operator expected at (eval 20) line 5, at end of line
(Missing semicolon on previous line?)
# Failed test 'use Bio::SeqFeature::Collection;'
# at t/SeqFeature/SeqFeatCollection.t line 13.
# Tried to use 'Bio::SeqFeature::Collection'.
# Error: Attempt to reload DB_File.pm aborted.
# Compilation failed in require at Bio/SeqFeature/Collection.pm line 146.
# BEGIN failed--compilation aborted at Bio/SeqFeature/Collection.pm line 146.
# Compilation failed in require at (eval 21) line 2.
# BEGIN failed--compilation aborted at (eval 21) line 2.
Can't locate object method "new" via package "Bio::SeqFeature::Collection" at t/SeqFeature/SeqFeatCollection.t line 30, line 132.
# Tests were run but no plan was declared and done_testing() was not seen.
t/SeqFeature/SeqFeatCollection.t .............
not ok 1 - use Bio::SeqFeature::Collection;
ok 2 - use Bio::Location::Simple;
ok 3 - use Bio::Tools::GFF;
ok 4 - use Bio::SeqIO;
ok 5
Dubious, test returned 255 (wstat 65280, 0xff00)
Failed 1/5 subtests
t/SeqFeature/SeqFeature.t ....................
1..249
ok 1 - use Bio::Seq;
ok 2 - use Bio::SeqIO;
ok 3 - use Bio::SeqFeature::Generic;
ok 4 - use Bio::SeqFeature::FeaturePair;
ok 5 - use Bio::SeqFeature::Computation;
ok 6 - use Bio::SeqFeature::Gene::Transcript;
ok 7 - use Bio::SeqFeature::Gene::UTR;
ok 8 - use Bio::SeqFeature::Gene::Exon;
ok 9 - use Bio::SeqFeature::Gene::Poly_A_site;
ok 10 - use Bio::SeqFeature::Gene::GeneStructure;
ok 11 - use Bio::Location::Fuzzy;
ok 12 - start of feature location
ok 13 - end of feature location
ok 14 - primary tag
ok 15 - source tag
ok 16 - undef phase by default
ok 17 - phase accessor returns
ok 18 - phase is persistent
ok 19
ok 20 - set phase from constructor
ok 21
ok 22 - feature1 of pair stored
ok 23 - feature2 of pair stored
ok 24 - feature start
ok 25 - feature end
ok 26 - primary tag
ok 27 - source tag
ok 28 - hstart
ok 29 - hend
ok 30 - hprimary tag
ok 31 - hsource tag
ok 32 - inverted end
ok 33
ok 34 - seq string
ok 35 - sf1 end
ok 36 - sf1 start
ok 37
ok 38 - sf2
ok 39
ok 40 - computation id
ok 41 - score value
ok 42
ok 43
ok 44 - sft[0] is exon
ok 45
ok 46 - computation id
ok 47
ok 48 - score value
ok 49 - sfeat start for EXPAND-ED feature (bug \#947)
ok 50 - sfeat end for EXPAND-ED feature (bug \#947)
ok 51
ok 52 - can create feature starting and ending at 0
ok 53
ok 54 - can create feature starting and ending at 0
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74 - mRNA spliced length
ok 75 - has 2 UTRs
ok 76
ok 77
ok 78
ok 79
ok 80 - The object isa Bio::SeqIO
ok 81 - The object isa Bio::Seq
ok 82 # skip Network tests have not been requested
ok 83 # skip Network tests have not been requested
ok 84 # skip Network tests have not been requested
ok 85 # skip Network tests have not been requested
ok 86 # skip Network tests have not been requested
ok 87 - The object isa Bio::SeqIO
ok 88 - The object isa Bio::Seq
ok 89 # skip Network tests have not been requested
ok 90 # skip Network tests have not been requested
ok 91 - The object isa Bio::SeqIO
ok 92 - spliced seq translation matches expected
ok 93 - spliced seq translation matches expected
ok 94 - spliced seq translation matches expected
ok 95 - spliced seq translation matches expected
ok 96 - spliced seq translation matches expected
ok 97 - spliced seq translation matches expected
ok 98 - spliced seq translation matches expected
ok 99 - spliced seq translation matches expected
ok 100 - spliced seq translation matches expected
ok 101 - spliced seq translation matches expected
ok 102 - spliced seq translation matches expected
ok 103 - spliced seq translation matches expected
ok 104 - spliced seq translation matches expected
ok 105 - spliced seq translation matches expected
ok 106 - spliced seq translation matches expected
ok 107 - spliced seq translation matches expected
ok 108 - spliced seq translation matches expected
ok 109 - spliced seq translation matches expected
ok 110 - spliced seq translation matches expected
ok 111 - spliced seq translation matches expected
ok 112 - spliced seq translation matches expected
ok 113 - spliced seq translation matches expected
ok 114 - spliced seq translation matches expected
ok 115 - spliced seq translation matches expected
ok 116 - spliced seq translation matches expected
ok 117 - spliced seq translation matches expected
ok 118 - spliced seq translation matches expected
ok 119 - spliced seq translation matches expected
ok 120 - spliced seq translation matches expected
ok 121 - spliced seq translation matches expected
ok 122 - spliced seq translation matches expected
ok 123 - spliced seq translation matches expected
ok 124 - spliced seq translation matches expected
ok 125 - spliced seq translation matches expected
ok 126 - spliced seq translation matches expected
ok 127 - spliced seq translation matches expected
ok 128 - spliced seq translation matches expected
ok 129 - spliced seq translation matches expected
ok 130 - spliced seq translation matches expected
ok 131 - spliced seq translation matches expected
ok 132 - spliced seq translation matches expected
ok 133 - spliced seq translation matches expected
ok 134 - spliced seq translation matches expected
ok 135 - spliced seq translation matches expected
ok 136 - spliced seq translation matches expected
ok 137 - spliced seq translation matches expected
ok 138 - spliced seq translation matches expected
ok 139 - spliced seq translation matches expected
ok 140 - spliced seq translation matches expected
ok 141 - spliced seq translation matches expected
ok 142 - spliced seq translation matches expected
ok 143 - spliced seq translation matches expected
ok 144 - spliced seq translation matches expected
ok 145 - spliced seq translation matches expected
ok 146 - spliced seq translation matches expected
ok 147 - spliced seq translation matches expected
ok 148 - spliced seq translation matches expected
ok 149 - spliced seq translation matches expected
ok 150 - spliced seq translation matches expected
ok 151 - spliced seq translation matches expected
ok 152 - spliced seq translation matches expected
ok 153 - spliced seq translation matches expected
ok 154 - spliced seq translation matches expected
ok 155 - spliced seq translation matches expected
ok 156 - spliced seq translation matches expected
ok 157 - spliced seq translation matches expected
ok 158 - spliced seq translation matches expected
ok 159 - spliced seq translation matches expected
ok 160 - spliced seq translation matches expected
ok 161 - spliced seq translation matches expected
ok 162 - spliced seq translation matches expected
ok 163 - spliced seq translation matches expected
ok 164 - spliced seq translation matches expected
ok 165 - spliced seq translation matches expected
ok 166 - spliced seq translation matches expected
ok 167 - spliced seq translation matches expected
ok 168 - spliced seq translation matches expected
ok 169 - spliced seq translation matches expected
ok 170 - spliced seq translation matches expected
ok 171 - spliced seq translation matches expected
ok 172 - spliced seq translation matches expected
ok 173 - spliced seq translation matches expected
ok 174 - spliced seq translation matches expected
ok 175 - spliced seq translation matches expected
ok 176 - spliced seq translation matches expected
ok 177 - spliced seq translation matches expected
ok 178 - spliced seq translation matches expected
ok 179 - spliced seq translation matches expected
ok 180 - spliced seq translation matches expected
ok 181 - spliced seq translation matches expected
ok 182 - spliced seq translation matches expected
ok 183 - spliced seq translation matches expected
ok 184 - spliced seq translation matches expected
ok 185 - spliced seq translation matches expected
ok 186 - spliced seq translation matches expected
ok 187 - spliced seq translation matches expected
ok 188 - spliced seq translation matches expected
ok 189 - spliced seq translation matches expected
ok 190 - spliced seq translation matches expected
ok 191 - spliced seq translation matches expected
ok 192 - spliced seq translation matches expected
ok 193 - spliced seq translation matches expected
ok 194 - spliced seq translation matches expected
ok 195 - spliced seq translation matches expected
ok 196 - spliced seq translation matches expected
ok 197 - spliced seq translation matches expected
ok 198 - spliced seq translation matches expected
ok 199 - spliced seq translation matches expected
ok 200 - spliced seq translation matches expected
ok 201 - spliced seq translation matches expected
ok 202 - spliced seq translation matches expected
ok 203 - spliced seq translation matches expected
ok 204 - spliced seq translation matches expected
ok 205 - spliced seq translation matches expected
ok 206 - spliced seq translation matches expected
ok 207 - spliced seq translation matches expected
ok 208 - spliced seq translation matches expected
ok 209
ok 210 - phase check
ok 211
ok 212 - phase check
ok 213
ok 214 - phase check
ok 215
ok 216 - phase check
ok 217
ok 218 - phase check
ok 219 - tags found
ok 220 - get_tagset_values tag values found
ok 221 - get_tagset_values tag values for multiple tags found
ok 222 - get_tag_values tag values found
ok 223 - get_tag_values lives with tag
ok 224 - get_tagset_values no tag values found
ok 225 - get_tagset_values lives with no tag
ok 226 - get_tag_values throws with no tag
ok 227 - Phi-X174 genome is circular
ok 228 - only 3 split locations
ok 229 - The object isa Bio::Location::SplitLocationI
ok 230 - feature string
ok 231 - first ten nucleotides
ok 232 - strand
not ok 233 - start # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'start'
# at t/SeqFeature/SeqFeature.t line 421.
# got: '1'
# expected: '3981'
not ok 234 - end # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'end'
# at t/SeqFeature/SeqFeature.t line 422.
# got: '5386'
# expected: '136'
not ok 235 - expected length # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'expected length'
# at t/SeqFeature/SeqFeature.t line 423.
# got: '5386'
# expected: '1542'
ok 236 - The object isa Bio::Location::SplitLocationI
ok 237 - feature string
ok 238 - first ten nucleotides
ok 239 - strand
not ok 240 - start # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'start'
# at t/SeqFeature/SeqFeature.t line 421.
# got: '1'
# expected: '4497'
not ok 241 - end # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'end'
# at t/SeqFeature/SeqFeature.t line 422.
# got: '5386'
# expected: '136'
not ok 242 - expected length # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'expected length'
# at t/SeqFeature/SeqFeature.t line 423.
# got: '5386'
# expected: '1026'
ok 243 - The object isa Bio::Location::SplitLocationI
ok 244 - feature string
ok 245 - first ten nucleotides
ok 246 - strand
not ok 247 - start # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'start'
# at t/SeqFeature/SeqFeature.t line 421.
# got: '1'
# expected: '5075'
not ok 248 - end # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'end'
# at t/SeqFeature/SeqFeature.t line 422.
# got: '5386'
# expected: '136'
not ok 249 - expected length # TODO Need to define how to deal with start, end length for circular sequences
# Failed (TODO) test 'expected length'
# at t/SeqFeature/SeqFeature.t line 423.
# got: '5386'
# expected: '363'
ok
t/SeqFeature/SeqFeaturePrimer.t ..............
1..8
ok 1 - use Bio::SeqFeature::Primer;
ok 2 - The object isa Bio::SeqFeature::Primer
ok 3 - The object isa Bio::SeqFeature::Primer
ok 4 - The object isa Bio::Seq
ok 5
ok 6
ok 7
ok 8
ok
t/SeqFeature/Unflattener.t ...................
1..10
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Tools::Unflattener;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok
t/SeqFeature/Unflattener2.t ..................
1..12
ok 1 - use Bio::SeqIO;
ok 2 - use Bio::SeqFeature::Tools::Unflattener;
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok
t/SeqIO/Handler.t ............................
1..561
ok 1 - use Bio::SeqIO;
ok 2 - AI129902
ok 3
ok 4
ok 5
ok 6 - NT_021877
ok 7
ok 8
ok 9
ok 10
ok 11 - BAB68554
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21 - operator overloading in AnnotationI is deprecated
ok 22 - NC_006346
ok 23
ok 24
ok 25 - U71225
ok 26
ok 27 - AB077698
ok 28
ok 29 - DQ018368
ok 30 - D10483
ok 31
ok 32
ok 33
ok 34 - bug 1487
ok 35
ok 36 - bug 1647
ok 37
ok 38
ok 39 - bug 1673
ok 40
ok 41
ok 42
ok 43 - AF165282
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52 - species parsing incorrect for genbank
ok 53 - genus duplicated in genbank parsing
ok 54
ok 55
ok 56 - species parsing incorrect for genbank
ok 57 - genus duplicated in genbank parsing
ok 58
ok 59
ok 60 - species parsing incorrect for genbank
ok 61 - genus duplicated in genbank parsing
ok 62
ok 63 - streaming
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69 - Total number of sequences in test file
ok 70
ok 71 - Fuzzy in
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83 - Fuzzy out
ok 84 - BK000016
ok 85
ok 86 - BK000016
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101 - BK000016
ok 102 - roundtrip
ok 103
ok 104
ok 105
ok 106
ok 107
ok 108
ok 109
ok 110
ok 111
ok 112
ok 113
ok 114
ok 115
ok 116
ok 117
ok 118
ok 119
ok 120 - revcomp split location
ok 121 - Bug 1925
ok 122
ok 123
ok 124 - wgs
ok 125
ok 126 - wgs_scafld
ok 127
ok 128 - wgs_scafld
ok 129
ok 130
ok 131 - BC000007
ok 132 - BK000016-tpa.gbk
ok 133 - ay116458.gb
ok 134 - ay149291.gb
ok 135 - NC_006346.gb
ok 136 - ay007676.gb
ok 137 - dq519393.gb
ok 138
ok 139 - swissprot:K1C9_HUMAN
ok 140
ok 141 - swissprot
ok 142
ok 143 - GenBank:Z29074.1
ok 144
ok 145 - GenBank
ok 146
ok 147 - GenPept:CAA82315.1
ok 148
ok 149 - GenPept
ok 150
ok 151 - GenBank:S69510.1
ok 152
ok 153 - GenBank
ok 154
ok 155 - GenPept:AAC60619.1
ok 156
ok 157 - GenPept
ok 158
ok 159 - GenBank:X75015.1
ok 160
ok 161 - GenBank
ok 162
ok 163 - GenPept:CAA52924.1
ok 164
ok 165 - GenPept
ok 166
ok 167 - GenBank:AB001594.1
ok 168
ok 169 - GenBank
ok 170
ok 171 - GenPept:BAA19418.1
ok 172
ok 173 - GenPept
ok 174
ok 175 - GenBank:I37984
ok 176
ok 177 - GenBank
ok 178
ok 179 - HSSP:P08670
ok 180
ok 181 - HSSP
ok 182
ok 183 - IntAct:P35527
ok 184
ok 185 - IntAct
ok 186
ok 187 - Ensembl:ENSG00000171403
ok 188
ok 189 - Ensembl
ok 190
ok 191 - KEGG:hsa:3857
ok 192
ok 193 - KEGG
ok 194
ok 195 - HGNC:6447
ok 196
ok 197 - HGNC
ok 198
ok 199 - MIM:144200
ok 200
ok 201 - MIM
ok 202
ok 203 - MIM:607606
ok 204
ok 205 - MIM
ok 206
ok 207 - ArrayExpress:P35527
ok 208
ok 209 - ArrayExpress
ok 210
ok 211 - GO:0005200
ok 212
ok 213 - GO
ok 214
ok 215 - GO:0008544
ok 216
ok 217 - GO
ok 218
ok 219 - InterPro:IPR011000
ok 220
ok 221 - InterPro
ok 222
ok 223 - InterPro:IPR001664
ok 224
ok 225 - InterPro
ok 226
ok 227 - InterPro:IPR002957
ok 228
ok 229 - InterPro
ok 230
ok 231 - Pfam:PF00038
ok 232
ok 233 - Pfam
ok 234
ok 235 - PRINTS:PR01248
ok 236
ok 237 - PRINTS
ok 238
ok 239 - PROSITE:PS00226
ok 240
ok 241 - PROSITE
ok 242
ok 243 - Bug 2195
ok 244 - Bug 2195
ok 245 - The object isa Bio::Annotation::SimpleValue
ok 246
ok 247 - The object isa Bio::Annotation::SimpleValue
ok 248
ok 249
ok 250
ok 251
ok 252
ok 253
ok 254
ok 255
ok 256
ok 257
ok 258
ok 259
ok 260
ok 261
ok 262
ok 263
ok 264
ok 265
ok 266
ok 267
ok 268
ok 269
ok 270
ok 271
ok 272
ok 273 - success reading Embl with ^ location and badly split double quotes
ok 274
ok 275
ok 276 - success writing Embl format with ^ < and > locations
ok 277
ok 278
ok 279
ok 280
ok 281
ok 282
ok 283
ok 284
ok 285
ok 286
ok 287
ok 288
ok 289
ok 290
ok 291
ok 292
ok 293
ok 294
ok 295
ok 296
ok 297
ok 298
ok 299
ok 300
ok 301
ok 302
ok 303
ok 304
ok 305
ok 306
ok 307
ok 308
ok 309 - genus duplication test
ok 310
ok 311
ok 312 - The object isa Bio::SeqIO
ok 313 - The object isa Bio::Species
ok 314
ok 315
ok 316 - operator overloading in AnnotationI is deprecated
ok 317
ok 318 - dates
ok 319 - dates
ok 320 - dates
ok 321
ok 322 - The object isa Bio::Seq::RichSeqI
ok 323
ok 324
ok 325
ok 326 - operator overloading in AnnotationI is deprecated
ok 327
ok 328
ok 329
ok 330
ok 331 - id is ROA1_HUMAN
ok 332
ok 333
ok 334
ok 335
ok 336
ok 337
ok 338
ok 339 - operator overloading in AnnotationI is deprecated
ok 340
ok 341
ok 342
ok 343 - The object isa Bio::Seq::RichSeqI
ok 344
ok 345
ok 346
ok 347
ok 348
ok 349
ok 350
ok 351
ok 352
ok 353 - operator overloading in AnnotationI is deprecated
ok 354
ok 355
ok 356
ok 357 - GC1QBP
ok 358 - HABP1
ok 359 - SF2P32
ok 360 - C1QBP
ok 361
ok 362 - The object isa Bio::Seq::RichSeqI
ok 363
ok 364
ok 365
ok 366
ok 367
ok 368
ok 369 - F54H12.1
ok 370 - The object isa Bio::Seq::RichSeqI
ok 371
ok 372
ok 373
ok 374
ok 375
ok 376
ok 377
ok 378
ok 379
ok 380
ok 381
ok 382 - The object isa Bio::Seq::RichSeqI
ok 383
ok 384
ok 385
ok 386
ok 387 - The object isa Bio::Seq::RichSeqI
ok 388
ok 389
ok 390
ok 391
ok 392
ok 393
ok 394
ok 395
ok 396
ok 397
ok 398
ok 399
ok 400
ok 401 - The object isa Bio::Seq::RichSeqI
ok 402
ok 403
ok 404
ok 405
ok 406
ok 407
ok 408
ok 409
ok 410
ok 411
ok 412
ok 413
ok 414
ok 415
ok 416
ok 417
ok 418
ok 419
ok 420
ok 421
ok 422
ok 423
ok 424
ok 425
ok 426
ok 427
ok 428
ok 429
ok 430
ok 431
ok 432
ok 433
ok 434
ok 435
ok 436
ok 437
ok 438
ok 439
ok 440
ok 441
ok 442
ok 443
ok 444
ok 445
ok 446
ok 447
ok 448
ok 449
ok 450
ok 451
ok 452
ok 453
ok 454
ok 455
ok 456
ok 457
ok 458
ok 459
ok 460
ok 461
ok 462
ok 463
ok 464
ok 465
ok 466
ok 467
ok 468
ok 469
ok 470
ok 471
ok 472
ok 473
ok 474
ok 475
ok 476
ok 477
ok 478
ok 479
ok 480
ok 481
ok 482
ok 483
ok 484
ok 485 - The object isa Bio::Species
ok 486
ok 487
ok 488
ok 489
ok 490
ok 491
ok 492
ok 493
ok 494
ok 495
ok 496
ok 497
ok 498
ok 499
ok 500
ok 501
ok 502
ok 503
ok 504
ok 505
ok 506
ok 507
ok 508
ok 509
ok 510
ok 511
ok 512
ok 513
ok 514
ok 515
ok 516
ok 517 - The object isa Bio::Species
ok 518
ok 519
ok 520 - operator overloading in AnnotationI is deprecated
ok 521
ok 522
ok 523
ok 524
ok 525
ok 526
ok 527
ok 528
ok 529
ok 530
ok 531
ok 532
ok 533
ok 534
ok 535
ok 536
ok 537
ok 538
ok 539
ok 540
ok 541
ok 542
ok 543
ok 544
ok 545
ok 546
ok 547
ok 548
ok 549
ok 550
ok 551 - P39765
ok 552
ok 553
ok 554
ok 555
ok 556
ok 557
ok 558
ok 559
ok 560
ok 561 - operator overloading in AnnotationI is deprecated
ok
t/SeqIO/MultiFile.t ..........................
1..3
ok 1 - use Bio::SeqIO::MultiFile;
ok 2
ok 3
ok
t/SeqIO/Multiple_fasta.t .....................
1..9
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9 - all sequences in the file
ok
t/SeqIO/SeqBuilder.t .........................
1..101
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - The object isa Bio::Factory::ObjectBuilderI
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54
ok 55
ok 56
ok 57
ok 58
ok 59
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67
ok 68
ok 69
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85
ok 86
ok 87
ok 88
ok 89
ok 90
ok 91
ok 92
ok 93
ok 94
ok 95
ok 96
ok 97
ok 98
ok 99
ok 100
ok 101
ok
t/SeqIO/SeqIO.t ..............................
1..45
ok 1 - use Bio::SeqIO;
ok 2
ok 3 - ID for format gcg
ok 4
ok 5
ok 6
ok 7
ok 8 - ID for format fasta
ok 9
ok 10
ok 11
ok 12 - accession.version
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19 - ID for format pir
ok 20
ok 21
ok 22
ok 23
ok 24
ok 25 - ID for format tab
ok 26
ok 27
ok 28
ok 29
ok 30
ok 31 - ID for format ace
ok 32
ok 33
ok 34
ok 35
ok 36 - use Algorithm::Diff;
ok 37 - use IO::ScalarArray;
ok 38 - use IO::String;
ok 39
ok 40
ok 41
not ok 42 - Must pass a file or file handle # TODO file/fh-based tests should be in Bio::Root::IO, see issue #3204
# Failed (TODO) test 'Must pass a file or file handle'
# at t/SeqIO/SeqIO.t line 120.
# expecting: Regexp ((?^:No file, fh, or string argument provided))
# found: Bio::Root::Exception (
# ------------- EXCEPTION: Bio::Root::Exception -------------
# MSG: Could not guess format from file/fh
# STACK: Error::throw
# STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472
# STACK: Bio::SeqIO::new Bio/SeqIO.pm:389
# STACK: Test::Exception::throws_ok t/SeqIO/SeqIO.t:119
# STACK: t/SeqIO/SeqIO.t:120
# -----------------------------------------------------------
# )
ok 43 - Must pass a file or file handle
ok 44 - Must pass a file or file handle
ok 45 - Must pass a real file
ok
t/SeqIO/Splicedseq.t .........................
1..14
ok 1 - use Bio::SeqIO;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11 - get_SeqFeatures()
ok 12 - protein sequence
ok 13 - nucleotide sequence - correct CDS range
ok 14 - nucleotide length
ok
t/SeqIO/abi.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
t/SeqIO/ace.t ................................
1..7
ok 1 - use Bio::SeqIO;
ok 2 - number of sequence objects
ok 3 - unescaping of characters, Name; 4% strewn with \ various / escaped characters
ok 4 - alphabets detected
ok 5 - alphabets detected
ok 6 - writing sequence
ok 7 - test output
ok
t/SeqIO/agave.t ..............................
1..8
ok 1 - use Bio::SeqIO::agave;
not ok 2 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for agave format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for agave format -- no sample file to test against
ok
t/SeqIO/alf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
t/SeqIO/asciitree.t ..........................
1..2
ok 1 - use Bio::SeqIO;
not ok 2 # TODO Output doesn't exists on linux
# Failed (TODO) test at t/SeqIO/asciitree.t line 39.
ok
t/SeqIO/bsml.t ...............................
1..16
ok 1 - use XML::DOM;
ok 2 - use Bio::SeqIO::bsml;
ok 3 - The object isa Bio::Seq::RichSeqI
ok 4 - got correct number of refs
ok 5 - display_id
ok 6 - molecule
ok 7 - is_circular
ok 8 - dates
ok 9 - accession_number
ok 10 - seq_version
ok 11 - got correct number of SeqFeatures
ok 12 - feature start
ok 13 - feature end
ok 14 - get_tag_values db_xref
ok 15 - get_Annotations reference
ok 16 - get_Annotations dblink
ok
t/SeqIO/bsml_sax.t ...........................
1..15
ok 1 - use Bio::SeqIO;
ok 2 - The object isa Bio::Seq::RichSeqI
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok
defined(@array) is deprecated at Bio/SeqIO/chadoxml.pm line 1673.
(Maybe you should just omit the defined()?)
defined(@array) is deprecated at Bio/SeqIO/chadoxml.pm line 1698.
(Maybe you should just omit the defined()?)
t/SeqIO/chadoxml.t ...........................
1..8
ok 1 - use Bio::SeqIO::chadoxml;
not ok 2 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for chadoxml format -- no sample file to test against
ok
t/SeqIO/chaos.t ..............................
1..8
ok 1 - use Bio::SeqIO::chaos;
not ok 2 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for chaos format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for chaos format -- no sample file to test against
ok
t/SeqIO/chaosxml.t ...........................
1..2
ok 1 - use Bio::SeqIO;
ok 2
ok
t/SeqIO/ctf.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
t/SeqIO/embl.t ...............................
1..95
ok 1 - use Bio::SeqIO::embl;
ok 2
ok 3
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24 - success reading Embl with ^ location and badly split double quotes
ok 25
ok 26 - success writing Embl format with ^ < and > locations
ok 27
ok 28
ok 29
ok 30
ok 31
ok 32
ok 33
ok 34
ok 35
ok 36
ok 37
ok 38
ok 39
ok 40
ok 41
ok 42
ok 43
ok 44
ok 45
ok 46
ok 47
ok 48
ok 49
ok 50
ok 51
ok 52
ok 53
ok 54 - genus duplication test
ok 55
ok 56
ok 57
ok 58
ok 59 - CDS - accession on PA line
ok 60
ok 61
ok 62
ok 63
ok 64
ok 65
ok 66
ok 67 - CDS - OX tagname
ok 68 - CDS - OX database
ok 69 - CDS - OX primary_id
ok 70
ok 71
ok 72
ok 73
ok 74
ok 75
ok 76
ok 77
ok 78
ok 79
ok 80
ok 81
ok 82
ok 83
ok 84
ok 85 - Check if product was parsed correctly
ok 86 - Parse long qualifier
ok 87
ok 88 - TaxID set correctly
ok 89 - The read sequence has a species object
ok 90 - NCBI TaxID has roundtripped
ok 91 - Name has roundtripped
ok 92 - TaxID set correctly
ok 93 - The read sequence has a species object
ok 94 - The taxid of the source feature overrides that of the OX line
ok 95 - Name has roundtripped
ok
t/SeqIO/entrezgene.t ......................... skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed
t/SeqIO/excel.t ..............................
1..4
ok 1 - use Bio::SeqIO::excel;
ok 2 - The object isa Bio::SeqIO
ok 3 - Bio::SeqIO::excel->can('next_seq')
ok 4 - Bio::SeqIO::excel->can('write_seq')
ok
t/SeqIO/exp.t ................................ skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed
t/SeqIO/fasta.t ..............................
1..22
ok 1 - use Bio::SeqIO::fasta;
ok 2 - The object isa Bio::SeqIO
ok 3 - Bio::SeqIO::fasta->can('next_seq')
ok 4 - Bio::SeqIO::fasta->can('write_seq')
ok 5 - The object isa Bio::Seq
ok 6 - sequence
ok 7 - length
ok 8 - primary_id
ok 9 - description
ok 10 - The object isa Bio::Seq
ok 11 - sequence
ok 12 - length
ok 13 - primary_id
ok 14 - description
ok 15 - use Algorithm::Diff;
ok 16 - use IO::ScalarArray;
ok 17 - use IO::String;
ok 18 - fasta format can round-trip
ok 19 - dies with roa1.genbank
ok 20 - dies with test.gcg
ok 21 - dies with test.ace
ok 22 - dies with test.raw
ok
t/SeqIO/fastq.t ..............................
1..139
ok 1 - use Bio::SeqIO::fastq;
ok 2 - use Bio::Seq::Quality;
ok 3 - bug2335 parses
ok 4 - correct num. seqs in bug2335
ok 5 - sample sequence obtained
ok 6 - The object isa Bio::Seq::Quality
ok 7 - seq() matches bug2335
ok 8 - desc() matches bug2335
ok 9 - display_id() matches bug2335
ok 10 - qual() matches bug2335
ok 11
ok 12 - evil_wrapping parses
ok 13 - correct num. seqs in evil_wrapping
ok 14 - sample sequence obtained
ok 15 - The object isa Bio::Seq::Quality
ok 16 - seq() matches evil_wrapping
ok 17 - desc() matches evil_wrapping
ok 18 - display_id() matches evil_wrapping
ok 19 - qual() matches evil_wrapping
ok 20
ok 21 - example parses
ok 22 - correct num. seqs in example
ok 23 - sample sequence obtained
ok 24 - The object isa Bio::Seq::Quality
ok 25 - seq() matches example
ok 26 - desc() matches example
ok 27 - display_id() matches example
ok 28 - qual() matches example
ok 29
ok 30 - illumina_faked parses
ok 31 - correct num. seqs in illumina_faked
ok 32 - sample sequence obtained
ok 33 - The object isa Bio::Seq::Quality
ok 34 - seq() matches illumina_faked
ok 35 - desc() matches illumina_faked
ok 36 - display_id() matches illumina_faked
ok 37 - qual() matches illumina_faked
ok 38
ok 39 - sanger_93 parses
ok 40 - correct num. seqs in sanger_93
ok 41 - sample sequence obtained
ok 42 - The object isa Bio::Seq::Quality
ok 43 - seq() matches sanger_93
ok 44 - desc() matches sanger_93
ok 45 - display_id() matches sanger_93
ok 46 - qual() matches sanger_93
ok 47
ok 48 - sanger_faked parses
ok 49 - correct num. seqs in sanger_faked
ok 50 - sample sequence obtained
ok 51 - The object isa Bio::Seq::Quality
ok 52 - seq() matches sanger_faked
ok 53 - desc() matches sanger_faked
ok 54 - display_id() matches sanger_faked
ok 55 - qual() matches sanger_faked
ok 56
ok 57 - solexa_example parses
ok 58 - correct num. seqs in solexa_example
ok 59 - sample sequence obtained
ok 60 - The object isa Bio::Seq::Quality
ok 61 - seq() matches solexa_example
ok 62 - desc() matches solexa_example
ok 63 - display_id() matches solexa_example
ok 64 - qual() matches solexa_example
ok 65
ok 66 - solexa_faked parses
ok 67 - correct num. seqs in solexa_faked
ok 68 - sample sequence obtained
ok 69 - The object isa Bio::Seq::Quality
ok 70 - seq() matches solexa_faked
ok 71 - desc() matches solexa_faked
ok 72 - display_id() matches solexa_faked
ok 73 - qual() matches solexa_faked
ok 74
ok 75 - test1_sanger parses
ok 76 - correct num. seqs in test1_sanger
ok 77 - sample sequence obtained
ok 78 - The object isa Bio::Seq::Quality
ok 79 - seq() matches test1_sanger
ok 80 - desc() matches test1_sanger
ok 81 - display_id() matches test1_sanger
ok 82 - qual() matches test1_sanger
ok 83
ok 84 - test2_solexa parses
ok 85 - correct num. seqs in test2_solexa
ok 86 - sample sequence obtained
ok 87 - The object isa Bio::Seq::Quality
ok 88 - seq() matches test2_solexa
ok 89 - desc() matches test2_solexa
ok 90 - display_id() matches test2_solexa
ok 91 - qual() matches test2_solexa
ok 92
ok 93 - test3_illumina parses
ok 94 - correct num. seqs in test3_illumina
ok 95 - sample sequence obtained
ok 96 - The object isa Bio::Seq::Quality
ok 97 - seq() matches test3_illumina
ok 98 - desc() matches test3_illumina
ok 99 - display_id() matches test3_illumina
ok 100 - qual() matches test3_illumina
ok 101
ok 102 - tricky parses
ok 103 - correct num. seqs in tricky
ok 104 - sample sequence obtained
ok 105 - The object isa Bio::Seq::Quality
ok 106 - seq() matches tricky
ok 107 - desc() matches tricky
ok 108 - display_id() matches tricky
ok 109 - qual() matches tricky
ok 110
ok 111 - Conversion from illumina to sanger
ok 112 - Conversion from illumina to illumina
ok 113 - Conversion from illumina to solexa
ok 114 - Conversion from sanger to sanger
ok 115 - Conversion from sanger to illumina
ok 116 - Conversion from sanger to solexa
ok 117 - Conversion from solexa to sanger
ok 118 - Conversion from solexa to illumina
ok 119 - Conversion from solexa to solexa
ok 120 - Exception caught for error_diff_ids
ok 121 - Exception caught for error_long_qual
ok 122 - Exception caught for error_no_qual
ok 123 - Exception caught for error_qual_del
ok 124 - Exception caught for error_qual_escape
ok 125 - Exception caught for error_qual_null
ok 126 - Exception caught for error_qual_space
ok 127 - Exception caught for error_qual_tab
ok 128 - Exception caught for error_qual_unit_sep
ok 129 - Exception caught for error_qual_vtab
ok 130 - Exception caught for error_short_qual
ok 131 - Exception caught for error_spaces
ok 132 - Exception caught for error_tabs
ok 133 - Exception caught for error_trunc_at_plus
ok 134 - Exception caught for error_trunc_at_qual
ok 135 - Exception caught for error_trunc_at_seq
ok 136 - Exception caught for error_trunc_in_plus
ok 137 - Exception caught for error_trunc_in_qual
ok 138 - Exception caught for error_trunc_in_seq
ok 139 - Exception caught for error_trunc_in_title
ok
defined(@array) is deprecated at Bio/SeqIO/chadoxml.pm line 1673.
(Maybe you should just omit the defined()?)
defined(@array) is deprecated at Bio/SeqIO/chadoxml.pm line 1698.
(Maybe you should just omit the defined()?)
t/SeqIO/flybase_chadoxml.t ...................
1..8
ok 1 - use Bio::SeqIO::flybase_chadoxml;
not ok 2 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
not ok 3 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
not ok 4 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
not ok 5 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
not ok 6 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
not ok 7 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
not ok 8 # TODO & SKIP No tests for flybase_chadoxml format -- no sample file to test against
ok
t/SeqIO/game.t ...............................
1..24
ok 1 - use Bio::SeqIO::game;
ok 2 - The object isa Bio::SeqIO
ok 3 - The object isa Bio::Seq::RichSeq
ok 4
ok 5
ok 6
ok 7
ok 8
ok 9
ok 10
ok 11
ok 12
ok 13
ok 14
ok 15
ok 16
ok 17
ok 18
ok 19
ok 20
ok 21
ok 22
ok 23
ok 24
ok
t/SeqIO/gbxml.t ..............................
1..14
ok 1 - use Bio::SeqIO::gbxml;
ok 2 - The object isa Bio::SeqIO
ok 3 - molecule
ok 4 - alphabet
ok 5 - primary_id
ok 6 - display_id
ok 7 - version
ok 8 - is_circular
ok 9 - description
ok 10 - sequence
ok 11 - classification
ok 12 - feat - clone_lib
ok 13 - feat - db_xref
ok 14 - feat - lab_host
ok
Timeout (max run time is 300s)
/home/fly1600/ap1600/bin/perl-static killed by signal 15.